CN103757049B - Control structure body and the method thereof of insect - Google Patents

Abstract

The present invention relates to a kind of structure body controlling insect and method thereof, described structure body includes Cry2Aa albumen and Cry1A albumen. The present invention controls the structure body of insect and method thereof and controls insect by producing Cry2Aa and Cry1Ab/Ac albumen in plant; Compared with the cultural control method that prior art uses, chemical prevention and control method and biological control method; the present invention not only virulence is strong, effect is thorough; and plant is carried out the time of infertility, whole plant protect against the infringement controlling insect; and pollution-free, noresidue; effect stability, simple, convenient, economical.

Description

Control structure body and the method thereof of insect

Technical field

The present invention relates to a kind of structure body controlling insect and method thereof, particularly relate to a kind of body that builds being used in plant to express Cry2Aa albumen and Cry1Ab/Ac albumen and cause harm the method for plant controlling insect.

Background technology

Semen Maydis and Oryza sativa L. are the cereal crops that China is important, every year because the grain loss that insect pest of the plant causes is huge, have influence on the survival state of local population what is more. In order to prevent and treat insect pest of the plant, people generally use phosphoramidite chemical insecticide and Biocidal preparation, but the two all has limitation in actual applications: chemical insecticide can bring the problem of environmental pollution, and causes the appearance of resistant insect; And Biocidal preparation is easily degraded in the environment, on producing, need repetitive administration, considerably increase production cost.

In order to solve chemical insecticide and Biocidal preparation limitation in actual applications, scientists finds to proceed in plant by the anti insect gene of encoding insecticidal proteins through research, can obtain some insect-resistant transgenic plants to prevent and treat insect pest of the plant. Cry2Aa albumen and Cry1Ab/Ac albumen are Bt toxin, are insoluble sexual partner's spore crystalline proteins, and this albuminoid is uptaked into middle intestinal by insecticide, and toxalbumin parent toxin is dissolved under the alkaline pH environment of insect midgut. Parent toxin, by basic protein enzymic digestion, is transformed into active fragment by albumen N-and C-end; On active fragment and insect midgut epithelial cell membrane upper surface, receptor combines, and inserts goldbeater's skin, causes that perforation focus occurs in cell membrane, destroys the osmotic pressure change inside and outside cell membrane and pH balance etc., upsets the digestion process of insecticide, ultimately result in it dead.

Current Cry2Aa albumen and Cry1Ab/Ac albumen major part are applied in plant with monogenic form, especially Cry2Aa albumen, when it exists with single-gene form the resistance of striped rice borer and pink rice borer is not high, it is likely to result in the generation to the independent resistance of the two gene of striped rice borer and pink rice borer, hinders the popularization of transgenic resistance material.

Summary of the invention

It is an object of the invention to provide a kind of structure body controlling insect and method thereof, provide first and control insect and cause harm the method for plant by producing to express the body that builds of Cry2Aa albumen and Cry1Ab/Ac albumen, and effectively overcome the technological deficiencies such as prior art cultural control, chemical prevention and Biological control.

For achieving the above object, the invention provides a kind of structure body, including Cry2Aa albumen and Cry1A albumen.

Further, described structure body includes the first expression cassette and the second expression cassette, and described first expression cassette includes Cry2Aa albumen, and described second expression cassette includes Cry1A albumen.

Further, described first expression cassette also includes the regulating and controlling sequence being effectively connected with Cry2Aa albumen, and described second expression cassette also includes the regulating and controlling sequence being effectively connected with Cry1A albumen.

On the basis of technique scheme, the aminoacid sequence of described Cry2Aa albumen has the aminoacid sequence shown in SEQIDNO:1. The nucleotide sequence of described Cry2Aa albumen has the nucleotide sequence shown in SEQIDNO:3.

Further, described Cry1A albumen is Cry1Ab/Ac albumen. The aminoacid sequence of described Cry1Ab/Ac albumen has the aminoacid sequence shown in SEQIDNO:2. The nucleotide sequence of described Cry1Ab/Ac albumen has the nucleotide sequence shown in SEQIDNO:4.

For achieving the above object, present invention also offers a kind of recombinant vector comprising described structure body.

For achieving the above object, present invention also offers a kind of method producing insect-killing protein, including:

Obtain the cell that the transformed host comprising described structure body is biological;

The cell that described transformed host is biological is cultivated when allowing to produce insect-killing protein;

Reclaim described insect-killing protein.

Further, described transformed host biology includes plant cell, zooblast, antibacterial, yeast, baculovirus, nematicide or algae.

Preferably, described plant is corn and soybean, Cotton Gossypii, Oryza sativa L. or Semen Tritici aestivi.

For achieving the above object, present invention also offers a kind of method for increasing insecticide target scope, including: the insect-killing protein encoded by described structure body is expressed in plant together with the third parasite killing nucleotide of at least one insect-killing protein being different from described structure body coding.

Further, the third parasite killing nucleotide described can encode Cry class insect-killing protein, Vip class insect-killing protein, protease inhibitor, agglutinin, ��-amylase or peroxidase.

Selectively, the third parasite killing nucleotide described is suppress the dsRNA of important gene in target insect pests.

In the present invention, the expression in a kind of transgenic plant of the described structure body can along with the expression of one or more Cry class insect-killing proteins and/or Vip class insect-killing protein. This kind of Pesticidal toxins co expression in same strain transgenic plant that exceedes can make plant comprise by genetic engineering and express required gene to realize. It addition, a kind of plant (the 1st parent) can express the protein of described structure body coding by genetic engineering procedure, the second plant (the 2nd parent) can pass through genetic engineering procedure and express Cry class insect-killing protein and/or Vip class insect-killing protein. The progeny plants expressing all genes introducing the 1st parent and the 2nd parent is obtained by the 1st parent and the 2nd parents.

RNA interference (RNAinterference, RNAi) refers to phenomenon that be highly conserved during evolution, that brought out, the efficient selective degradation of homologous mRNA by double-stranded RNA (double-strandedRNA, dsRNA).Therefore can use RNAi technology specific depletion or close the expression of specific gene.

For achieving the above object, present invention also offers a kind of method producing zoophobous, including: described structure body or described recombinant vector are imported plant.

For achieving the above object; present invention also offers a kind of method for protecting the plants from the damage caused by insect pest; including: described structure body or described recombinant vector are imported plant, makes the plant after importing produce enough to protected from the insect-killing protein of insect pest amount.

Described structure body or described recombinant vector are imported plant, it is by Exogenous DNA transfered plant cell in the present invention, conventional transformation methods includes but not limited to, Agrobacterium-medialed transformation, trace are launched bombardment, DNA is directly taken in the DNA importing of protoplast, electroporation or silicon whisker mediation.

For achieving the above object, present invention also offers a kind of method controlling insect pest, including: make the insect inhibitory protein that insect pest encodes with the described structure body of amount of suppression contact.

Further, described Cry2Aa albumen and described Cry1Ab/Ac albumen are present in the plant cell producing it, and described insect pest is by described plant cell and described Cry2Aa albumen and the described Cry1Ab/Ac protein contact of ingesting.

Further, described Cry2Aa albumen and described Cry1Ab/Ac albumen are present in the transgenic plant producing it, described insect pest is by tissue and described Cry2Aa albumen and the described Cry1Ab/Ac protein contact of described transgenic plant of ingesting, after contact, the growth of described insect pest is suppressed and/or causes death, the control of plant of insect pest being caused harm with realization.

On the basis of technique scheme, described transgenic plant may be at any period of duration.

The tissue of described transgenic plant can be blade, stem stalk, tassel, female fringe, flower pesticide or filigree.

The control of described plant that insect pest is caused harm does not change because planting the change in place.

The described control that insect pest is caused harm plant does not change because of the change of implantation time.

Described plant can come from Semen Maydis, Oryza sativa L., Sorghum vulgare Pers., wheat, foxtail millet, Cotton Gossypii, phragmites communis, Caulis Sacchari sinensis, Caulis Zizaniae caduciflorae, Semen Viciae fabae or Brassica campestris L.

Step before described contact procedure is the plantation plant containing the polynucleotide encoding described Cry2Aa albumen and described Cry1Ab/Ac albumen.

On the basis of technique scheme, described insect pest is lepidopteran insect pests. Preferably, described lepidopteran insect pests is pink rice borer and/or striped rice borer.

For achieving the above object, present invention also offers the purposes of the insect inhibitory protein Quality Control insect pest of a kind of described structure body coding.

The genome of heretofore described plant, plant tissue or plant cell, refers to any hereditary material in plant, plant tissue or plant cell, and includes nucleus and plastid and mitochondrial genome.

Heretofore described polynucleotide and/or nucleotide form completely " gene ", coded protein or polypeptide in required host cell. Those skilled in the art are it is readily appreciated that under the regulating and controlling sequence that can the polynucleotide of the present invention and/or nucleotide be placed in purpose host controls.

Well-known to those skilled in the art, DNA typically exists with double chain form. In this arrangement, chain and another chain complementation, vice versa. Owing to DNA replicates other complementary strand creating DNA in plant.So, the present invention includes the use to the polynucleotide of example in sequence table and complementary strand thereof. " coding strand " that this area often uses refers to the chain being combined with antisense strand. For marking protein in vivo, DNA chain is transcribed into the complementary strand of a mRNA by typical case, and it translates protein as template. " antisense " chain that mRNA is actually from DNA is transcribed. " having justice " or " coding " chain has a series of codon (codon is three nucleotide, once reads three and can produce specific amino acids), it can be read as open reading frame (ORF) and form destination protein matter or peptide. Present invention additionally comprises the DNA with example and have RNA and the PNA(peptide nucleic acid(PNA) of suitable function).

Nucleic acid molecule of the present invention or its fragment under strict conditions with Cry2Aa gene of the present invention and/or Cry1Ab/Ac gene recombination. The nucleic acid hybridization of any routine or amplification method may be used to identify the existence of Cry2Aa gene of the present invention and/or Cry1Ab/Ac gene. Nucleic acid molecules or its fragment can carry out specific hybrid with other nucleic acid molecules in any case. In the present invention, if two nucleic acid molecules can form antiparallel double-strandednucleic acid structure, it is possible to say that the two nucleic acid molecules can carry out specific hybrid to each other. If two nucleic acid molecules demonstrate complementary completely, then claiming one of them nucleic acid molecules is another nucleic acid molecules " complement ". In the present invention, when the corresponding nucleotide complementary of each nucleotide and another nucleic acid molecules of a nucleic acid molecules, then the two nucleic acid molecules is claimed to demonstrate " complete complementary ". If two nucleic acid molecules can with enough stability phase mutual crosses so that they be annealed and be bonded to each other under at least conventional " low strict " condition, then claiming the two nucleic acid molecules is " minimum level is complementary ". Similarly, if two nucleic acid molecules with enough stability phase mutual crosses so that they are annealed under conventional " highly strict " condition and are bonded to each other, then can claim the two nucleic acid molecules to have " complementarity ". Deviate from complete complementary and can allow, as long as this deviation not exclusively stops two molecules to form duplex structure. In order to enable a nucleic acid molecules as primer or probe, it is only necessary to ensure that it has sufficient complementarity in sequence, so that stable duplex structure can be formed under the specific solvent adopted and salinity.

In the present invention, the sequence of basic homology is one section of nucleic acid molecules, and this nucleic acid molecules can with the complementary strand generation specific hybrid of another section of nucleic acid molecules matched under high stringency. Promote the stringent condition being suitable for of DNA hybridization, for instance, it is approximately under 45 DEG C of conditions and processes by 6.0 �� sodium chloride/sodium citrate (SSC), then wash with 2.0 �� SSC under 50 DEG C of conditions, those skilled in the art are known by these conditions. Such as, the salinity in washing step can be selected from the about 2.0 �� SSC of Low stringency conditions, 50 DEG C to the about 0.2 �� SSC of high stringency, 50 DEG C. Additionally, the temperature conditions in washing step from the room temperature of Low stringency conditions about 22 DEG C, can be increased to about 65 DEG C of high stringency. Temperature conditions and salinity can all change, it is also possible to one of them remains unchanged and another variable changes. Preferably, stringent condition of the present invention can be in 6 �� SSC, 0.5%SDS solution, with SEQIDNO:3 and/or SEQIDNO:4, specific hybrid occurs, then respectively wash film 1 time with 2 �� SSC, 0.1%SDS and 1 �� SSC, 0.1%SDS at 65 DEG C.

Therefore, there is anti-insect activity and be included in the invention with the sequence of SEQIDNO:3 and/or SEQIDNO:4 of the present invention hybridization under strict conditions. These sequences and sequence of the present invention be 40%-50% homology at least about, about 60%, 65% or 70% homology, even at least about sequence homology of 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or bigger.

Heretofore described gene and protein not only include specific exemplary sequence, also include the part saving the insecticidal activity feature of the protein of described particular example and/fragment (including compared with full length protein and/or terminal deletion), variant, mutant, substituent (having the amino acid whose protein of replacement), chimera and fusion protein. Described " variant " or " variation " refer to that the same albumen of coding or coding have the nucleotide sequence of the equivalent protein of insecticidal activity. Described " equivalent protein " refers to that the albumen with claim has the bioactive albumen of identical or essentially identical anti-lepidopteran insect pests.

Original DNA that " fragment " or " truncate " of heretofore described DNA molecular or protein sequence refers to or a part for protein sequence (nucleotide or aminoacid) or its artificial reconstructed form (being such as suitable for the sequence of expression of plants), can there is change in the length of foregoing sequences, but length is enough to ensure that (coding) protein is insect toxins.

Use standard technique can build gene variant with easy by modifying gene. Such as, it is well known that the technology manufacturing point mutation. Again such as U.S. Patent number 5605793 describe after random fracture use DNA reassembly produce other molecular diversity method. Commercialization Cobra venom endonuclease can be used to manufacture the fragment of full-length gene, and exonuclease can be used according to standardization program. It is, for example possible to use enzyme such as Bal31 or direct mutagenesis excise nucleotide from the end system of these genes. Multiple restricted enzyme can also be used to obtain the gene of encoding active fragment. Protease can be used to directly obtain the active fragment of these toxin.

The present invention can derive equivalent protein from B.t. separator and/or DNA library and/or encode the gene of these equivalent protein. Multiple method is had to obtain the insecticidal proteins of the present invention. It is, for example possible to use the antibody of disclosure and claimed insecticidal proteins is identified and isolated from other albumen from protein mixture. Especially, antibody is probably what the most constant by albumen and the most different from other B.t. albumen protein part caused. May then pass through immunoprecipitation, enzyme-linked immunosorbent assay (ELISA) or western immunoblot method uses these antibody exclusively to identify the equivalent protein of activity characteristic. This area standardization program can be used to be easy to prepare the antibody of the fragment of albumen or equivalent protein or this albuminoid disclosed in the present invention. Then the gene encoding these albumen can be obtained from microorganism.

Due to the Feng Yuxing of genetic codon, multiple different DNA sequence can encode identical aminoacid sequence. Produce the alternative DNA sequence of the identical or essentially identical albumen of these codings just in the technical merit of those skilled in the art. These different DNA sequence are included within the scope of the invention. Described " substantially the same " sequence refers to aminoacid replacement, disappearance, interpolation or insertion but does not substantially affect the sequence of insecticidal activity, also includes the fragment retaining insecticidal activity.

In the present invention, the replacement of aminoacid sequence, disappearance or interpolation are the ordinary skill in the art, it is preferable that this seed amino acid is changed to: little characteristic changing, and namely folding the and/or active conserved amino acid of not appreciable impact albumen replaces; Little disappearance, normally about 1-30 amino acid whose disappearance; Little amino or c-terminus extend, for instance aminoterminal extends a methionine residues; Little connection peptides, for instance about 20-25 residue is long.

The conservative example replaced is the replacement occurred in following aminoacid group: basic amino acid (such as arginine, lysine and histidine), acidic amino acid (such as glutamic acid and aspartic acid), polar amino acid (such as glutamine, agedoite), hydrophobic amino acid (such as leucine, isoleucine and valine), ArAA (such as phenylalanine, tryptophan and tyrosine), and little molecule aminoacid (such as glycine, alanine, serine, threonine and methionine). Those aminoacid replacement generally not changing given activity are well-known in this area, and by, such as, N.Neurath and R.L.Hill was described in new york academic publishing house (AcademicPress) " Protein " that publish in 1979. Modal exchange has Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and they contrary exchanges.

For a person skilled in the art it should be evident that this replacement can occur outside the region that molecular function is played an important role, and still produce active polypeptide. For by the polypeptide of the present invention, its activity required and therefore select the amino acid residue not being replaced, it is possible to according to methods known in the art, as direct mutagenesis or alanine scanning mutagenesis carry out identifying (as referring to, Cunningham and Wells, 1989, Science244:1081-1085). Latter technique is that each positively charged residue place introduces sudden change in the molecule, detects the anti-insect activity of gained mutating molecule, so that it is determined that the amino acid residue wanted that this molecular activity is overstated. Substrate-enzyme interacting site can also be measured by the analysis of its three dimensional structure, this three dimensional structure can by the technical measurements such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling (referring to, such as deVos etc., 1992, Science255:306-312; Smith etc., 1992, J.Mol.Biol224:899-904; Wlodaver etc., 1992, FEBSLetters309:59-64).

In the present invention, Cry1A albumen includes but not limited to Cry1Ab, Cry1Ac, Cry1Ab/Ac or Cry1Ah albumen, or has at least 70% homology with the aminoacid sequence of above-mentioned albumen and pink rice borer has parasite killing fragment or the functional area of insecticidal activity.

Therefore, the aminoacid sequence with the aminoacid sequence shown in sequence 1 and/or sequence 2 with certain homology is also included within the present invention. These sequences and sequence similarities/homogeny of the present invention are typically larger than 60%, it is preferred that more than 75%, be more preferably greater than 80%, even more preferably from more than 90%, and can more than 95%. Can also according to the preferred polynucleotide of homogeny particularly and/or the similarity scope definition present invention and protein. Homogeny and/or the similarity of 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% is such as had with the sequence of example of the present invention.

Heretofore described regulating and controlling sequence includes but not limited to promoter, transit peptides, terminator, enhancer, targeting sequencing, intron and other be operably connected to described Cry2Aa albumen and the adjustment sequence of described Cry1A albumen.

Described promoter is effable promoter in plant, and described " in plant effable promoter " refers to and guarantee that connected coded sequence carries out the promoter expressed in plant cell. In plant, effable promoter can be constitutive promoter. Instruct the example of the promoter of constitutive expression in plant to include but not limited to, derive from the promoter etc. of the 35S promoter of cauliflower mosaic virus, Semen Maydis Ubi promoter, Oryza sativa L. GOS2 gene. Alternatively, in plant, effable promoter can be tissue-specific promoter, namely this promoter as instructs the expression of coded sequence to be higher than its hetero-organization (can pass through conventional RNA test be measured) of plant in some tissues of plant in chlorenchyma, such as PEP carboxylase promoter. Alternatively, in plant, effable promoter can be wound-induced promoter. Wound-induced promoter or instruct the promoter of expression pattern of wound-induced to refer to when plant is stood machinery or gnawed, by insecticide, the wound caused, is significantly increased under the expression compared with normal growth conditions of the coded sequence under promoter regulation. The example of wound-induced promoter includes but not limited to, the protease suppressor gene (pin I and pin II) of Rhizoma Solani tuber osi and Fructus Lycopersici esculenti and the promoter of zein enzyme level gene (MPI).

Described transit peptides (also known as secretory signal sequence or targeting sequencing) is to instruct transgene product to arrive specific organelle or cellular compartment, for receptor protein, described transit peptides can be allos, such as, utilize encoding chloroplast transit peptide sequence targeting chloroplast, or utilize ' KDEL ' to retain sequence targeting endoplasmic reticulum, or utilize the CTPP targeting vacuole of barley plants agglutinin gene.

Described targeting sequencing including but not limited to, picornavirus targeting sequencing, such as EMCV targeting sequencing (encephalomyocarditis virus 5 ' noncoding region); Potyvirus leaders, such as MDMV(Maize Dwarf Mosaic Virus) targeting sequencing; Human immunoglobulin matter heavy-chain binding protein matter (BiP); The coat protein mRNA of alfalfa mosaic virus does not translate targeting sequencing (AMVRNA4); Tobacco mosaic virus (TMV) (TMV) targeting sequencing.

Described enhancer including but not limited to, cauliflower mosaic virus (CaMV) enhancer, figwort mosaic virus (FMV) enhancer, Dianthus carryophyllus air slaking circovirus virus (CERV) enhancer, cassava vein mosaic virus (CsVMV) enhancer, Mirabilis jalapa mosaic virus (MMV) enhancer, Castrum nocturum L tomato yellow leaf curl China virus (CmYLCV) enhancer, Cotton leaf curl Multan virus (CLCuMV), commelina yellow mottle virus (CoYMV) and Semen arachidis hypogaeae chlorisis streak mosaic virus (PCLSV) enhancer.

For monocotyledon apply for, described intron including but not limited to, Semen Maydis hsp70 intron, maize ubiquitin intron, Adh introne 1, crose synthase intron or Oryza sativa L. Act1 intron. For dicotyledon apply for, described intron including but not limited to, CAT-1 intron, pKANNIBAL intron, PIV2 intron and " super ubiquitin " intron.

Described terminator can be the applicable polyadenylation signal sequence worked in plant, include but not limited to, the polyadenylation signal sequence, the polyadenylation signal sequence deriving from protease-inhibitor �� (pin II) gene that derive from Agrobacterium (Agrobacteriumtumefaciens) rouge alkali synthetase (NOS) gene, derive from the polyadenylation signal sequence of Semen Pisi sativi ssRUBISCOE9 gene and derive from the polyadenylation signal sequence of alpha-tubulin (��-tubulin) gene.

Heretofore described " effectively connecting " represents the connection of nucleotide sequence, and described connection makes a sequence can provide the function that linked sequence is needed. " effectively connecting " described in the present invention can for be connected promoter with sequence interested so that transcribing of this sequence interested is subject to the control of this promoter and regulation and control. when sequential coding albumen interested and when going for the expression of this albumen " effectively connecting " represent: promoter is connected with described sequence, and connected mode makes the transcript efficient translation obtained. if the connection of promoter and coded sequence is the expression that transcript merges and want the albumen that realization encodes, manufacture such connection so that in the transcript obtained, the first translation initiation codon is the start codon of coded sequence. alternatively, if the connection of promoter and coded sequence is the expression that the albumen that realization encodes is merged and wants in translation, manufacture such connection, the first translation initiation codon contained in 5 ' non-translated sequences and promoter are connected, and connected mode makes the translation product obtained and the relation of the translation opening code-reading frame encoding the albumen wanted is consistent with reading frame. the nucleotide sequence that can " effectively connect " includes but not limited to: provide sequence (the i.e. gene expression element of gene expression function, such as promoter, 5 ' untranslated regions, intron, protein encoding regions, 3 ' untranslated regions, poly-putative adenylylation site and/or transcription terminator), sequence (the i.e. T-DNA border sequence of DNA transfer and/or integration function is provided, site-specific recombinase recognition site, intergrase recognition site), sequence (the i.e. antibiotic resistance markers of selectivity function is provided, biosynthesis gene), offer can be scored the sequence of label function, sequence (the i.e. polylinker sequence of external or internal assistance series of operations, locus specificity recombination sequence) and provide copy function sequence (the i.e. origin of replication of antibacterial, autonomous replication sequence, centromeric sequence).

It is poisonous that heretofore described " parasite killing " refers to crop pests. More specifically, targeted insect is pink rice borer and/or striped rice borer insect.

In the present invention, pink rice borer insect is had toxicity by Cry2A albumen. Plant in the present invention, particularly Oryza sativa L. and Semen Maydis, containing foreign DNA in its genome, described foreign DNA comprises the nucleotide sequence of coding Cry2Aa albumen and Cry1A albumen, insect pest is by feeding plant tissue and this protein contact, and after contact, the growth of pink rice borer insect is suppressed and/or causes death. Suppression refers to lethal or sub-lethal. Meanwhile, plant should be morphologically normal, and can cultivate the consumption for product and/or generation under conventional approaches. Additionally, this plant can substantially eliminate the needs insecticide of the pink rice borer insect for Cry2A albumen institute targeting (described chemistry or the biological insecticides are) to chemistry or biological insecticides.

In vegetable material, the expression of insecticidal crystal protein (ICP) can be detected by multiple method described in this area, such as by application special primer, the mRNA of the coded insect-killing protein of generation in tissue is carried out quantitatively, or the amount of the insect-killing protein of direct specific detection generation.

The insecticidal effect of ICP in different test determination plants can be applied. In the present invention, targeted insect is mainly pink rice borer and/or striped rice borer.

In the present invention, described Cry2Aa albumen can have the aminoacid sequence shown in SEQ ID NO:1;Described Cry1Ab/Ac albumen can have the aminoacid sequence shown in SEQ ID NO:2. Except comprising the coding region of Cry2Aa albumen and Cry1A albumen, it is possible to comprise other elements, for instance the coding region of encoding transit peptides or the protein of encoding selection markers.

In addition, comprise code book invention Cry2Aa albumen to express together with the protein of at least one encoding herbicide resistance gene in plant with the structure body of Cry1A albumen, described herbicide resistance gene includes but not limited to, phosphine oxamate resistant gene is (such as bar gene, pat gene), phenmedipham resistant gene (such as pmph gene), Glyphosate resistance gene (such as EPSPS gene), Brominal (bromoxynil) resistant gene, sulfonylurea resistance gene, resistant gene to herbicide Dalapon, resistant gene to the resistant gene of cyanamide or glutamine synthetase inhibitor (such as PPT), thus obtaining, both there is high insecticidal activity, there is again the transgenic plant of Herbicid resistant.

The invention provides a kind of structure body controlling insect and method thereof, have the advantage that

1, virulence is strong, effect is thorough. Owing to structure body of the present invention comprises Cry2Aa albumen and the Cry1A albumen of two kinds of different insecticidal mechanisms, make the insecticidal toxicity comprising the transgenic plant of structure body of the present invention strong, especially pink rice borer and striped rice borer, the prevention effect of newly hatched larvae is almost absolutely, survival larva also substantially stasi extremely individually, after 3 days, larva is substantially still in just incubating state, and stasi, and transgenic plant is generally limited only by slight damage.

2, endogenous cause of ill preventing and treating. Prior art controls causing harm of insect pest mainly by external action and exopathogenic factor, such as cultural control, chemical prevention and Biological control; And the present invention is by producing in plant to kill the Cry2Aa albumen of pink rice borer and striped rice borer and Cry1A albumen controls insect, namely prevented and treated by endogenous cause of ill.

3, pollution-free, noresidue. Although the chemical prevention and control method that prior art uses serves certain effect to controlling causing harm of insect, but also people, animal and farmland ecosystem are brought pollution simultaneously, destroys and residual; The present invention is used to control structure body and the method thereof of insect, it is possible to eliminate above-mentioned adverse consequences.

4, preventing and treating in the time of infertility. The method controlling insect that prior art uses is all interim; and plant is carried out the protection in the time of infertility by the present invention; transgenic plant (Cry2Aa albumen and Cry1A albumen) from germinate, growth, until bloom, result, can avoid suffering the infringement of insect.

5, whole plant preventing and treating. The method controlling insect that prior art uses is locality mostly, such as foliage-spray; And whole plant is protected by the present invention, pest infestation all can be resisted such as the blade of transgenic plant (Cry2Aa albumen and Cry1A albumen), stem stalk, tassel, female fringe, flower pesticide, filigree etc.

6, effect stability. The biological insecticides that prior art uses need directly to spray application to crop surface, thus result in activated crystalline protein (including Cry2Aa albumen and Cry1A albumen) and are degraded in the environment; The present invention makes described Cry2Aa albumen and Cry1A albumen express in plant, efficiently avoid biological insecticides in the unstable defect of nature, and the prevention effect of transgenic plant of the present invention (Cry2Aa albumen and Cry1A albumen) in different location, different time, different genetic background be also all stable and consistent.

7, simple, convenient, economical. The biological insecticides that prior art uses easily are degraded in the environment, it is therefore desirable to duplication of production and repeated application, and bring difficulty for the practical application in agricultural production, substantially increase cost; The present invention only need to plant the transgenic plant that can express Cry2Aa albumen and Cry1A albumen, without adopting other measure, thus saving a large amount of human and material resources and financial resources.

Below by drawings and Examples, technical scheme is described in further detail.

Accompanying drawing explanation

Fig. 1 is the recombinant cloning vector DBN01-T structure flow chart building body and method thereof that the present invention controls insect;

Fig. 2 is the recombinant expression carrier DBN100074 structure flow chart building body and method thereof that the present invention controls insect;

Fig. 3 is the insect resistant effect figure that the present invention controls the transgenic corn plant inoculation pink rice borer building body and method thereof of insect;

Fig. 4 is the insect resistant effect figure that the present invention controls the transgenic rice plant inoculation pink rice borer building body and method thereof of insect;

Fig. 5 is the insect resistant effect figure that the present invention controls the transgenic rice plant inoculation striped rice borer building body and method thereof of insect.

Detailed description of the invention

Further illustrate the present invention below by specific embodiment and control the technical scheme building body and method thereof of insect.

The acquisition of first embodiment, Cry2Aa gene and Cry1Ab/Ac gene and synthesis

1, Cry2Aa and Cry1Ab/Ac nucleotide sequence is obtained

The aminoacid sequence (633 aminoacid) of Cry2Aa insect-killing protein, as shown in SEQ ID NO:1; Encode the Cry2Aa nucleotide sequence (1902 nucleotide) of the aminoacid sequence (633 aminoacid) corresponding to described Cry2Aa insect-killing protein, as shown in SEQ ID NO:3.

The aminoacid sequence (609 aminoacid) of Cry1Ab/Ac insect-killing protein, as shown in SEQ ID NO:2; Encode the Cry1Ab/Ac nucleotide sequence (1830 nucleotide) of the aminoacid sequence (609 aminoacid) corresponding to described Cry1Ab/Ac insect-killing protein, as shown in SEQ ID NO:4.

2, above-mentioned nucleotide sequence is synthesized

Described Cry2Aa nucleotide sequence (shown in SEQ ID NO:3) and as described in Cry1Ab/Ac nucleotide sequence (as shown in SEQ ID NO:4) synthesized by Nanjing Genscript Biotechnology Co., Ltd.; 5 ' ends of the described Cry2Aa nucleotide sequence (SEQIDNO:3) of synthesis are also associated with NcoI restriction enzyme site, and 3 ' ends of described Cry2Aa nucleotide sequence (SEQIDNO:3) are also associated with BamHI restriction enzyme site; 5 ' ends of the described Cry1Ab/Ac nucleotide sequence (SEQIDNO:4) of synthesis are also associated with NcoI restriction enzyme site, and 3 ' ends of described Cry1Ab/Ac nucleotide sequence (SEQIDNO:4) are also associated with KpnI restriction enzyme site.

Second embodiment, the structure of recombinant expression carrier and recombinant expression carrier convert Agrobacterium

1, the recombinant cloning vector containing Cry2Aa gene and Cry1Ab/Ac gene is built

The Cry2Aa nucleotide sequence of synthesis is connected into cloning vehicle pGEM-T(Promega, Madison, USA, CAT:A3600) on, operating procedure is undertaken by Promega Products pGEM-T carrier description, obtaining recombinant cloning vector DBN01-T, it builds flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 1; F1 represents the origin of replication of phage f1;LacZ is LacZ start codon; SP6 is SP6RNA polymerase promoter; T7 is t7 rna polymerase promoter; Cry2Aa is Cry2Aa nucleotide sequence (SEQIDNO:3); MCS is multiple clone site).

Then recombinant cloning vector DBN01-T heat shock method is converted escherichia coli T1 competent cell (Transgen, Beijing, China, CAT:CD501), its hot shock condition is: 50 �� l escherichia coli T1 competent cells, 10 �� l plasmid DNA (recombinant cloning vector DBN01-T), 42 DEG C of water-baths 30 seconds; 37 DEG C of shaken cultivation 1 hour (under 100rpm rotating speed shaking table shake), scribble IPTG(isopropylthio-��-D-galactoside on surface) and the bromo-4-of X-gal(5-chloro-3-indole-��-D-galactoside) LB flat board (the tryptone 10g/L of ampicillin (100 mg/litre), yeast extract 5g/L, NaCl10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) upper growth is overnight. Picking white colony, LB fluid medium (tryptone 10g/L, yeast extract 5g/L, NaCl10g/L, ampicillin 100mg/L, with NaOH adjust pH to 7.5) under 37 DEG C of conditions of temperature overnight incubation. Its plasmid of alkalinity extraction: by bacterium solution centrifugal 1min under 12000rpm rotating speed, remove supernatant, precipitate the thalline solution I (25mMTris-HCl, 10mMEDTA(ethylenediaminetetraacetic acid) of 100 �� l ice pre-coolings, 50mM glucose, pH8.0) suspend; Add the 200 �� l solution II (0.2MNaOH, 1%SDS(sodium lauryl sulphate) newly prepared), pipe is overturned 4 times, mixing, put 3-5min on ice; Add 150 solution III (3M potassium acetate, 5M acetic acid) ice-cold for �� l, fully mix immediately, place 5-10min on ice; Centrifugal 5min in temperature 4 DEG C, rotating speed 12000rpm when, adds 2 times of volume dehydrated alcohol in supernatant, and after mixing, room temperature places 5min; In temperature 4 DEG C, rotating speed 12000rpm when, centrifugal 5min, abandons supernatant, precipitation concentration (V/V) be 70% washing with alcohol after dry; Add 30 �� l containing RNase(20 �� g/ml) TE(10mMTris-HCl, 1mMEDTA, PH8.0) dissolution precipitation; Water-bath 30min at temperature 37 DEG C, digests RNA; Save backup in temperature-20 DEG C.

The plasmid extracted is after XhoI and BamHI enzyme action is identified, positive colony is carried out sequence verification, result shows that the described Cry2Aa nucleotides sequence inserted in recombinant cloning vector DBN01-T is classified as the nucleotide sequence shown in SEQ ID NO:3, and namely Cry2Aa nucleotide sequence is correctly inserted into.

Method according to above-mentioned structure recombinant cloning vector DBN01-T, the described Cry1Ab/Ac nucleotide sequence of synthesis is connected on cloning vehicle pGEM-T, obtaining recombinant cloning vector DBN02-T, wherein, Cry1Ab/Ac is Cry1Ab/Ac nucleotide sequence (SEQIDNO:4). Cry1Ab/Ac nucleotide sequence described in enzyme action and sequence verification recombinant cloning vector DBN02-T is correctly inserted into.

2, the recombinant expression carrier containing Cry2Aa gene and Cry1Ab/Ac gene is built

Enzyme action recombinant cloning vector DBN01-T and expression vector DBNBC-01(carrier framework is distinguished: pCAMBIA2301(CAMBIA mechanism can provide with restricted enzyme NcoI and BamHI)), the Cry2Aa nucleotide sequence fragment cut is inserted between NcoI and the BamHI site of expression vector DBNBC-01, it is well-known to those skilled in the art for utilizing conventional enzymatic cleavage methods carrier construction, being built into recombinant expression carrier DBN100074, it builds flow process (Kan: kanamycin gene as shown in Figure 2;RB: right margin; Ubi: Semen Maydis Ubiquitin(ubiquitin) gene promoter (SEQIDNO:5); Cry2Aa:Cry2Aa nucleotide sequence (SEQIDNO:3); Nos: the terminator (SEQIDNO:6) of rouge alkali synthetase gene; PMI: Phophomannose isomerase gene (SEQIDNO:7); LB: left margin).

Recombinant expression carrier DBN100074 heat shock method is converted escherichia coli T1 competent cell, and its hot shock condition is: 50 �� l escherichia coli T1 competent cells, 10 �� l plasmid DNA (recombinant expression carrier DBN100074), 42 DEG C of water-baths 30 seconds; 37 DEG C of shaken cultivation 1 hour (under 100rpm rotating speed shaking table shake); Then at LB solid plate (the tryptone 10g/L containing 50mg/L kanamycin (Kanamycin), yeast extract 5g/L, NaCl10g/L, agar 15g/L, adjust pH to 7.5 with NaOH) upper cultivation 12 hours under 37 DEG C of conditions of temperature, picking white colony, at LB fluid medium (tryptone 10g/L, yeast extract 5g/L, NaCl10g/L, kanamycin 50mg/L, with NaOH adjust pH to 7.5) under 37 DEG C of conditions of temperature overnight incubation. Its plasmid of alkalinity extraction. The plasmid extracted is identified with after restricted enzyme XhoI and BamHI enzyme action, and positive colony is carried out order-checking qualification, result shows that recombinant expression carrier DBN100074 nucleotides sequence between NcoI and BamHI site is classified as nucleotide sequence shown in SEQ ID NO:3, i.e. Cry2Aa nucleotide sequence.

According to the method for above-mentioned structure recombinant expression carrier DBN100074, NcoI and the KpnI enzyme action recombinant cloning vector DBN02-T described Cry1Ab/Ac nucleotide sequence cut is inserted expression vector DBNBC-01, obtains recombinant expression carrier DBN100056. Enzyme action and sequence verification recombinant expression carrier DBN100056 contain nucleotide sequence shown in SEQ ID NO:4, i.e. Cry2Aa nucleotide sequence, and described Cry2Aa nucleotide sequence can connect described Ubi promoter and Nos terminator.

Method according to above-mentioned structure recombinant expression carrier DBN100074, NcoI and BamHI, NcoI and KpnI enzyme action recombinant cloning vector DBN01-T and the DBN02-T respectively described Cry2Aa nucleotide sequence cut and Cry1Ab/Ac nucleotide sequence are inserted expression vector DBNBC-01, obtains recombinant expression carrier DBN100058. Enzyme action and sequence verification recombinant expression carrier DBN100058 contain nucleotide sequence shown in SEQ ID NO:3 and SEQIDNO:4, i.e. Cry2Aa nucleotide sequence and Cry1Ab/Ac nucleotide sequence, described Cry2Aa nucleotide sequence and Cry1Ab/Ac nucleotide sequence can connect described Ubi promoter and Nos terminator.

3, recombinant expression carrier converts Agrobacterium

Oneself is constructed correct recombinant expression carrier DBN100074, DBN100056 and DBN100058 liquid nitrogen method and is transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT:18313-015) in, its conversion condition is: 100 �� L Agrobacterium LBA4404s, 3 �� L plasmid DNA (recombinant expression carrier), it is placed in liquid nitrogen 10 minutes, 37 DEG C of tepidarium 10 minutes, Agrobacterium LBA4404 after converting is inoculated in LB test tube in temperature 28 DEG C, cultivate 2 hours when rotating speed is 200rpm, be applied to the rifampicin containing 50mg/L (Rifampicin) and 100mg/L kanamycin (Kanamycin) LB flat board on until growing positive monoclonal, picking Colony Culture also extracts its plasmid, with restriction enzyme A hdI and XhoI to recombinant expression carrier DBN100074, digestion verification is carried out after DBN100056 and DBN100058 enzyme action, result shows recombinant expression carrier DBN100074, DBN100056 and DBN100058 structure is completely correct.

3rd embodiment, the acquisition proceeding to the milpa of Cry2Aa and Cry1Ab/Ac gene and checking

1, the milpa proceeding to Cry2Aa and Cry1Ab/Ac gene is obtained

The Agrobacterium infestation method conventionally adopted, the corn variety of aseptic culture is combined 31(Z31) rataria and the second embodiment in Agrobacterium described in 3 co-culture, with by the second embodiment 2 recombinant expression carrier DBN100074 built, T-DNA(in DBN100056 and DBN100058 includes the promoter sequence of Semen Maydis Ubiquitin gene, Cry2Aa nucleotide sequence, Cry1Ab/Ac nucleotide sequence, PMI gene and Nos terminator sequence) it is transferred in maize chromosome group, obtain the milpa proceeding to Cry2Aa nucleotide sequence, proceed to the milpa of Cry1Ab/Ac nucleotide sequence and proceed to the milpa of Cry2Aa-Cry1Ab/Ac nucleotide sequence, simultaneously using wild-type corn plant as comparison.

For agriculture bacillus mediated corn transformation, briefly, immature rataria is separated from Semen Maydis, rataria is contacted with agrobacterium suspension, wherein Cry2Aa nucleotide sequence and/or Cry1Ab/Ac nucleotide sequence can be transferred at least one cell (step 1: infect step) of one of rataria by Agrobacterium, in this step, rataria preferably immerses agrobacterium suspension (OD₆₆₀=0.4-0.6, infect culture medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 68.5g/L, glucose 36g/L, acetosyringone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH5.3)) in start inoculation. Rataria and Agrobacterium co-culture one period (3 days) (step 2: co-culture step). Preferably, rataria after infecting step solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 20g/L, glucose 10g/L, acetosyringone (AS) 100mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation. After co-culturing the stage at this, it is possible to have selective " recovery " step. In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) at least exist in a kind of oneself know suppress Agrobacterium growth antibiotic (cephamycin), without the selective agent (step 3: recovering step) of vegetable transformant. Preferably, rataria does not have on the solid medium of selective agent cultivate there being antibiotic, to eliminate Agrobacterium and to provide convalescent period for infected cell. Then, the transformed calli (step 4: select step) that the rataria of inoculation is cultivated in the culture medium containing selective agent (mannose) and growth selection. Preferably, rataria have the screening solid medium of selective agent (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 5g/L, mannose 12.5g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation, causes the cell selective growth converted. Then, callus regeneration becomes plant (step 5: regeneration step), it is preferable that in the culture medium containing selective agent, the callus of growth is above cultivated with aftergrowth at solid medium (MS division culture medium and MS root media).

The resistant calli that screening obtains transfers to described MS division culture medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, mannose 5g/L, agar 8g/L, pH5.8), on, differentiation at 25 DEG C, is cultivated.Differentiation seedling out transfers to described MS root media (MS salt 2.15g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH5.8) on, it is cultured to about 10cm at 25 DEG C high, moves to hot-house culture to solid. In greenhouse, every day cultivates 16 hours at 28 DEG C, cultivates 8 hours at 20 DEG C.

2, the milpa of Cry2Aa and Cry1Ab/Ac gene is proceeded to TaqMan checking

The blade of the milpa take the milpa proceeding to Cry2Aa nucleotide sequence respectively, proceeding to Cry1Ab/Ac nucleotide sequence and the milpa proceeding to Cry2Aa-Cry1Ab/Ac nucleotide sequence is about 100mg as sample, extract its genomic DNA with the DNeasyPlantMaxiKit of Qiagen, detected the copy number of Cry2Aa gene and Cry1Ac/Ab gene by Taqman fluorescence probe quantitative PCR method. Simultaneously using wild-type corn plant as comparison, carry out detection according to the method described above and analyze. Experiment sets 3 repetitions, averages.

The concrete grammar of detection Cry2Aa gene and Cry1Ac/Ab gene copy number is as follows:

Step 11, take the milpa proceeding to Cry2Aa nucleotide sequence respectively, the milpa proceeding to Cry1Ab/Ac nucleotide sequence, the milpa proceeding to Cry2Aa-Cry1Ab/Ac nucleotide sequence and wild-type corn plant each 100mg of blade, being ground into homogenate with liquid nitrogen in mortar respectively, each sample takes 3 repetitions;

Step 12, use Qiagen DNeasyPlantMiniKit extract above-mentioned sample genomic DNA, concrete grammar is with reference to its product description;

Step 13, with NanoDrop2000(ThermoScientific) measure the genomic DNA concentration of above-mentioned sample;

Step 14, adjust the genomic DNA concentration of above-mentioned sample to same concentration value, described concentration value range for 80-100ng/ �� l;

Step 15, employing Taqman fluorescence probe quantitative PCR method identify the copy number of sample, using the sample through identifying known copy number as standard substance, using the sample of wild-type corn plant as comparison, and the repetition of 3, each sample, take its meansigma methods; Fluorescence quantification PCR primer and probe sequence be respectively:

Following primer and probe are used for detecting Cry2Aa nucleotide sequence:

Primer 1(CF1): TCGGCACAGTCTCCAGCTTC is such as shown in SEQ ID NO:8;

Primer 2 (CR1): CCACAGCTCACTGAGAATCCG is such as shown in SEQ ID NO:9;

Probe 1(CP1): CCTGAAGAAGGTCGGCTCGCTGATC is such as shown in SEQ ID NO:10;

Following primer and probe are used for detecting Cry1Ab/Ac nucleotide sequence:

Primer 3(CF2): TGCGTATTCAATTCAACGACATG is such as shown in SEQ ID NO:11;

Primer 4(CR2): CTTGGTAGTTCTGGACTGCGAAC is such as shown in SEQ ID NO:12;

Probe 2(CP2): CAGCGCCTTGACCACAGCTATCCC is such as shown in SEQ ID NO:13;

PCR reaction system is:

Described 50 �� primer/probe mixture comprises each 45 �� l of every kind of primer, the probe 50 �� l of 100 ��Ms of concentration and the 860 �� l1 �� TE buffer of 1mM concentration, and at 4 DEG C, is housed in amber tube.

PCR reaction condition is:

Utilize SDS2.3 software (AppliedBiosystems) analytical data.

Test result indicate that, all oneself is incorporated in the chromosome set of the milpa detected for Cry2Aa nucleotide sequence, Cry1Ab/Ac nucleotide sequence and Cry2Aa-Cry1Ab/Ac nucleotide sequence, and proceeds to the milpa of Cry2Aa nucleotide sequence, proceed to the milpa of Cry1Ab/Ac nucleotide sequence and proceed to the milpa of Cry2Aa-Cry1Ab/Ac nucleotide sequence and all obtain the transgenic corn plant containing single copy Cry2Aa gene and/or Cry1Ab/Ac gene.

4th embodiment, transgenic corn plant insect resistant effect detection

The milpa of Cry2Aa nucleotide sequence will be proceeded to, proceed to the milpa of Cry1Ab/Ac nucleotide sequence, proceed to the milpa of Cry2Aa-Cry1Ab/Ac nucleotide sequence, wild-type corn plant and be accredited as not genetically modified milpa through Taqman pink rice borer is carried out insect resistant effect detection.

Take the milpa proceeding to Cry2Aa nucleotide sequence respectively, proceed to the milpa of Cry1Ab/Ac nucleotide sequence, proceed to the milpa of Cry2Aa-Cry1Ab/Ac nucleotide sequence, wild-type corn plant and be accredited as the fresh blade (lobus cardiacus) of not genetically modified milpa (V3-V4 phase) through Taqman, totally and with gauze, the water on blade is blotted with aseptic water washing, then maize leaf is removed vein, it is cut into the strip of about 1cm �� 4cm simultaneously, take 1 cut after strip blade put on the filter paper bottom round plastic culture dish, described filter paper distilled water moistening, each culture dish is put the pink rice borer (newly hatched larvae) of 10 artificial breedings, after worm examination culture dish is added a cover, at temperature 26-28 DEG C, relative humidity 70%-80%, after placing 3 days when photoperiod (light dark) 16:8, according to pink rice borer larvae development progress, mortality rate and three indexs of blade injury rate, obtain resistance total score: total score=100 �� mortality rate+[100 �� mortality rate+90 �� (just incubate borer population/connect worm sum)+60 �� (just incubate-negative control borer population/connect worm sum)+10 �� (negative control borer population/connect worm sum)]+100 �� (1-blade injury rate). proceed to totally 3 strains (S1, S2 and S3) of Cry2Aa nucleotide sequence, proceed to totally 3 strains (S4, S5 and S6) of Cry1Ab/Ac nucleotide sequence, proceed to totally 3 strains (S7, S8 and S9) of Cry2Aa-Cry1Ab/Ac nucleotide sequence, it is accredited as not genetically modified (NGM1) totally 1 strain, (CK1) of wild type totally 1 strain through Taqman, 3 strains are selected to test from each strain, multiple 6 times of every plant weight. shown in result such as table 1 and Fig. 3.

The pest-resistant experimental result of table 1, transgenic corn plant inoculation pink rice borer

The result of table 1 shows: the milpa proceeding to Cry2Aa nucleotide sequence and the milpa that proceeds to Cry1Ab/Ac nucleotide sequence raw survey total score all about 200 points or more than, proceed to milpa raw of Cry2Aa-Cry1Ab/Ac nucleotide sequence survey total score can up to about 280 points, and be accredited as the raw total score of surveying of not genetically modified milpa and wild-type corn plant through Taqman and be typically in about 50 points or following. the result of Fig. 3 shows: compared with wild-type corn plant, the milpa proceeding to Cry2Aa nucleotide sequence and the milpa proceeding to Cry1Ab/Ac nucleotide sequence all can cause the death of pink rice borer larva, its blade still can be subject to the damage of about 25%, and the prevention effect just incubating pink rice borer larva is almost absolutely by the milpa proceeding to Cry2Aa-Cry1Ab/Ac nucleotide sequence, survival larva also substantially stasi extremely individually, after 3 days, larva is substantially still in just incubating state, and the milpa proceeding to Cry2Aa-Cry1Ab/Ac nucleotide sequence is generally limited only by slight damage, blade is only the damage of minute quantity Pinhole-shaped, its blade injury rate is about 3% or below.

Thus proving that proceeding to the milpa of Cry2Aa-Cry1Ab/Ac nucleotide sequence demonstrates the activity of high resistance pink rice borer, this activity is enough to the growth to pink rice borer and produces ill effect so that it is controlled.

5th embodiment, the acquisition proceeding to the rice plant of Cry2Aa and Cry1Ab/Ac gene and checking

1, the rice plant proceeding to Cry2Aa and Cry1Ab/Ac gene is obtained

The Agrobacterium infestation method conventionally adopted, Agrobacterium described in 3 in the japonica rice variety of the aseptic culture fine callus of Japan and the second embodiment is co-cultured, with by the second embodiment 2 recombinant expression carrier DBN100074 built, T-DNA(in DBN100056 and DBN100058 includes the promoter sequence of Semen Maydis Ubiquitin gene, Cry2Aa nucleotide sequence, Cry1Ab/Ac nucleotide sequence, PMI gene and Nos terminator sequence) it is transferred in rice chromosome group, obtain the rice plant proceeding to Cry2Aa nucleotide sequence, proceed to the rice plant of Cry1Ab/Ac nucleotide sequence and proceed to the rice plant of Cry2Aa-Cry1Ab/Ac nucleotide sequence,Simultaneously using wild rice plant as comparison.

For agriculture bacillus mediated rice conversion, briefly, rice paddy seed is seeded in inducing culture (N6 salt, N6 vitamin, casein 300mg/L, sucrose 30g/L, 2, 4-dichlorphenoxyacetic acid (2, 4-D) 2mg/L, plant gel 3g/L, pH5.8) on, callus (step 1: wound healing induction step) is induced from Mature Embryos of Rice, afterwards, preferred callus, callus is contacted with agrobacterium suspension, wherein Cry2Aa nucleotide sequence and/or Cry1Ab/Ac nucleotide sequence can be transferred at least one cell (step 2: infect step) on callus by Agrobacterium. in this step, callus preferably immerses agrobacterium suspension (OD660=0.3, infect culture medium (N6 salt, N6 vitamin, casein 300mg/L, sucrose 30g/L, glucose 10g/L, acetosyringone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, pH5.4)) in start infect. callus and Agrobacterium co-culture one period (3 days) (step 3: co-culture step). preferably, callus after infecting step solid medium (N6 salt, N6 vitamin, casein 300mg/L, sucrose 30g/L, glucose 10g/L, acetosyringone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8) upper cultivate. after co-culturing the stage at this, there is " recovery " step. in " recovery " step, recovery media (N6 salt, N6 vitamin, casein 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8) at least exist in a kind of oneself know suppress Agrobacterium growth antibiotic (cephamycin), without the selective agent (step 4: recovering step) of vegetable transformant. preferably, callus does not have on the solid medium of selective agent cultivate there being antibiotic, to eliminate Agrobacterium and to provide convalescent period for infected cell. then, the transformed calli (step 5: select step) that the callus of inoculation is cultivated in the culture medium containing selective agent (mannose) and growth selection. preferably, callus have the screening solid medium of selective agent (N6 salt, N6 vitamin, casein 300mg/L, sucrose 10g/L, mannose 10g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8) upper cultivation, causes the cell selective growth converted. then, callus regeneration becomes plant (step 6: regeneration step), it is preferable that in the culture medium containing selective agent, the callus of growth is above cultivated with aftergrowth at solid medium (N6 division culture medium and MS root media).

The resistant calli that screening obtains transfers to described N6 division culture medium (N6 salt, N6 vitamin, casein 300mg/L, sucrose 20g/L, 6-benzyl aminoadenine 2mg/L, naa 1mg/L, plant gel 3g/L, pH5.8), on, differentiation at 25 DEG C, is cultivated. Differentiation seedling out is transferred on described MS root media (MS salt, MS vitamin, casein 300mg/L, sucrose 15g/L, plant gel 3g/L, pH5.8), is cultured to about 10cm high at 25 DEG C, moves to hot-house culture to solid. In greenhouse, every day cultivates at 30 DEG C.

2, the rice plant of Cry2Aa and Cry1Ab/Ac gene is proceeded to TaqMan checking

The blade of the rice plant take the rice plant proceeding to Cry2Aa nucleotide sequence respectively, proceeding to Cry1Ab/Ac nucleotide sequence and the rice plant proceeding to Cry2Aa-Cry1Ab/Ac nucleotide sequence is about 100mg as sample, extract its genomic DNA with the DNeasyPlantMaxiKit of Qiagen, detected the copy number of Cry2Aa gene and Cry1Ab/Ac gene by Taqman fluorescence probe quantitative PCR method.Simultaneously using wild rice plant as comparison, carry out detection analysis according to the method for in above-mentioned 3rd embodiment 2 milpas proceeding to Cry2Aa and Cry1Ab/Ac gene with TaqMan checking. Experiment sets 3 repetitions, averages.

Test result indicate that, all oneself is incorporated in the chromosome set of the rice plant detected for Cry2Aa nucleotide sequence, Cry1Ab/Ac nucleotide sequence and Cry2Aa-Cry1Ab/Ac nucleotide sequence, and proceeds to the rice plant of Cry2Aa nucleotide sequence, proceed to the rice plant of Cry1Ab/Ac nucleotide sequence and proceed to the rice plant of Cry2Aa-Cry1Ab/Ac nucleotide sequence and all obtain the transgenic rice plant containing single copy Cry2Aa gene and/or Cry1Ab/Ac gene.

Sixth embodiment, transgenic rice plant insect resistant effect detection

The rice plant of Cry2Aa nucleotide sequence will be proceeded to, proceed to the rice plant of Cry1Ab/Ac nucleotide sequence, proceed to the rice plant of Cry2Aa-Cry1Ab/Ac nucleotide sequence, wild rice plant and be accredited as not genetically modified rice plant through Taqman pink rice borer and striped rice borer are carried out insect resistant effect detection.

(1) pink rice borer: take the rice plant proceeding to Cry2Aa nucleotide sequence respectively, proceed to the rice plant of Cry1Ab/Ac nucleotide sequence, proceed to the rice plant of Cry2Aa-Cry1Ab/Ac nucleotide sequence, wild rice plant and be accredited as the fresh blade of not genetically modified rice plant (tillering stage) through Taqman, totally and with gauze, the water on blade is blotted with aseptic water washing, then rice leaf is removed vein, it is cut into the strip of about 1cm �� 4cm simultaneously, take 1 cut after strip blade put on the filter paper bottom round plastic culture dish, described filter paper distilled water moistening, each culture dish is put the pink rice borer (newly hatched larvae) of 10 artificial breedings, after worm examination culture dish is added a cover, at temperature 26-28 DEG C, relative humidity 70%-80%, after placing 3 days when photoperiod (light dark) 16:8, according to pink rice borer larvae development progress, mortality rate and three indexs of blade injury rate, obtain resistance total score: total score=100 �� mortality rate+[100 �� mortality rate+90 �� (just incubate borer population/connect worm sum)+60 �� (just incubate-negative control borer population/connect worm sum)+10 �� (negative control borer population/connect worm sum)]+100 �� (1-blade injury rate). proceed to totally 3 strains (S10, S11 and S12) of Cry2Aa nucleotide sequence, proceed to totally 3 strains (S13, S14 and S15) of Cry1Ab/Ac nucleotide sequence, proceed to totally 3 strains (S16, S17 and S18) of Cry2Aa-Cry1Ab/Ac nucleotide sequence, it is accredited as not genetically modified (NGM2) totally 1 strain, (CK2) of wild type totally 1 strain through Taqman, 3 strains are selected to test from each strain, multiple 6 times of every plant weight. shown in result such as table 2 and Fig. 4.

The pest-resistant experimental result of table 2, transgenic rice plant inoculation pink rice borer

The result of table 2 shows: the raw total score of surveying of the rice plant proceeding to Cry2Aa nucleotide sequence and the rice plant that proceeds to Cry1Ab/Ac nucleotide sequence all at about 220 points, proceed to rice plant raw of Cry2Aa-Cry1Ab/Ac nucleotide sequence survey total score can up to more than 280 points, and be accredited as the raw total score of surveying of not genetically modified rice plant and wild rice plant through Taqman and be typically in about 55 points. the result of Fig. 4 shows: compared with wild rice plant, the rice plant proceeding to Cry2Aa nucleotide sequence and the rice plant proceeding to Cry1Ab/Ac nucleotide sequence all can cause the death of pink rice borer larva, its blade still can be subject to about 25% damage, and the prevention effect just incubating pink rice borer larva is almost absolutely by the rice plant proceeding to Cry2Aa-Cry1Ab/Ac nucleotide sequence, survival larva also substantially stasi extremely individually, after 3 days, larva is substantially still in just incubating state, and the rice plant proceeding to Cry2Aa-Cry1Ab/Ac nucleotide sequence is generally limited only by slight damage, blade is only the damage of minute quantity Pinhole-shaped, its blade injury rate is all below 5%.

Thus proving that proceeding to the rice plant of Cry2Aa-Cry1Ab/Ac nucleotide sequence demonstrates the activity of high resistance pink rice borer, this activity is enough to the growth to pink rice borer and produces ill effect so that it is controlled.

(2) striped rice borer: take the rice plant proceeding to Cry2Aa nucleotide sequence respectively, proceed to the rice plant of Cry1Ab/Ac nucleotide sequence, proceed to the rice plant of Cry2Aa-Cry1Ab/Ac nucleotide sequence, wild rice plant and be accredited as the fresh blade of not genetically modified rice plant (tillering stage) through Taqman, totally and with gauze, the water on blade is blotted with aseptic water washing, then rice leaf is removed vein, it is cut into the strip of about 1cm �� 4cm simultaneously, take 1 cut after strip blade put on the filter paper bottom round plastic culture dish, described filter paper distilled water moistening, each culture dish is put the striped rice borer (newly hatched larvae) of 10 artificial breedings, after worm examination culture dish is added a cover, at temperature 26-28 DEG C, relative humidity 70%-80%, after placing 3 days when photoperiod (light dark) 16:8, according to Chilo spp larvae development progress, mortality rate and three indexs of blade injury rate, obtain resistance total score: total score=100 �� mortality rate+[100 �� mortality rate+90 �� (just incubate borer population/connect worm sum)+60 �� (just incubate-negative control borer population/connect worm sum)+10 �� (negative control borer population/connect worm sum)]+100 �� (1-blade injury rate). proceed to totally 3 strains (S10, S11 and S12) of Cry2Aa nucleotide sequence, proceed to totally 3 strains (S13, S14 and S15) of Cry1Ab/Ac nucleotide sequence, proceed to totally 3 strains (S16, S17 and S18) of Cry2Aa-Cry1Ab/Ac nucleotide sequence, it is accredited as not genetically modified (NGM2) totally 1 strain, (CK2) of wild type totally 1 strain through Taqman, 3 strains are selected to test from each strain, multiple 6 times of every plant weight. shown in result such as table 3 and Fig. 5.

The pest-resistant experimental result of table 3, transgenic rice plant inoculation striped rice borer

The result of table 3 shows: proceed to the raw total score of surveying of rice plant of Cry2Aa nucleotide sequence at about 220 points, and the rice plant proceeding to Cry1Ab/Ac nucleotide sequence and the rice plant that proceeds to Cry2Aa-Cry1Ab/Ac nucleotide sequence raw surveys total score all can up to more than 290 points, and be accredited as the raw total score of surveying of not genetically modified rice plant and wild rice plant through Taqman and be typically in about 50 points or following. the result of Fig. 5 shows: compared with wild rice plant, the rice plant proceeding to Cry2Aa nucleotide sequence can cause the death of Chilo spp larvae, its blade still can be subject to the damage of about 20%, and the prevention effect just incubating Chilo spp larvae is almost absolutely with the rice plant proceeding to Cry2Aa-Cry1Ab/Ac nucleotide sequence by the rice plant proceeding to Cry1Ab/Ac nucleotide sequence, survival larva also substantially stasi extremely individually, after 3 days, larva is substantially still in just incubating state, and the rice plant proceeding to Cry1Ab/Ac nucleotide sequence is generally limited only by slight damage with the rice plant proceeding to Cry2Aa-Cry1Ab/Ac nucleotide sequence, blade is only the damage of minute quantity Pinhole-shaped, its blade injury rate is all below 2%.

Thus proving that proceeding to the rice plant of Cry2Aa-Cry1Ab/Ac nucleotide sequence demonstrates the activity of high resistance striped rice borer, this activity is enough to the growth to striped rice borer and produces ill effect so that it is controlled.

In sum, the present invention controls the structure body of insect and method thereof and controls insect by producing Cry2Aa and Cry1Ab/Ac albumen in plant;Compared with the cultural control method that prior art uses, chemical prevention and control method and biological control method; the present invention not only virulence is strong, effect is thorough; and plant is carried out the time of infertility, whole plant protect against the infringement controlling insect; and pollution-free, noresidue; effect stability, simple, convenient, economical.

It should be noted last that, above example is only in order to illustrate technical scheme and unrestricted, although the present invention being described in detail with reference to preferred embodiment, it will be understood by those within the art that, technical scheme can be modified or equivalent replacement, without deviating from the spirit and scope of technical solution of the present invention.

Claims (35)

1. one kind builds body, it is characterised in that including the nucleotide sequence of coding Cry2Aa albumen and Cry1Ab/Ac albumen, the aminoacid sequence of described Cry1Ab/Ac albumen is the aminoacid sequence shown in SEQIDNO:2.

2. build body according to claim 1, it is characterized in that, described structure body includes the first expression cassette and the second expression cassette, and described first expression cassette includes the nucleotide sequence of coding Cry2Aa albumen, and described second expression cassette includes the nucleotide sequence of coding Cry1Ab/Ac albumen.

3. build body according to claim 2, it is characterized in that, described first expression cassette also includes the regulating and controlling sequence being effectively connected with the nucleotide sequence of coding Cry2Aa albumen, and described second expression cassette also includes the regulating and controlling sequence being effectively connected with the nucleotide sequence of coding Cry1Ab/Ac albumen.

4. according to any one of claim 1-3, build body, it is characterised in that the aminoacid sequence of described Cry2Aa albumen is the aminoacid sequence shown in SEQIDNO:1.

5. build body according to claim 4, it is characterised in that the nucleotides sequence of described Cry2Aa albumen is classified as the nucleotide sequence shown in SEQIDNO:3.

6. build body according to claim 5, it is characterised in that the nucleotides sequence of described Cry1Ab/Ac albumen is classified as the nucleotide sequence shown in SEQIDNO:4.

7. build body according to claim 4, it is characterised in that the nucleotides sequence of described Cry1Ab/Ac albumen is classified as the nucleotide sequence shown in SEQIDNO:4.

8. according to any one of claim 1-3, build body, it is characterised in that the nucleotides sequence of described Cry1Ab/Ac albumen is classified as the nucleotide sequence shown in SEQIDNO:4.

9. one kind comprises the recombinant vector building body described in any one of claim 1-3.

10. the method producing insect-killing protein, it is characterised in that including:

Obtain and comprise the cell that the transformed host building body described in any one of claim 1-3 is biological;

The cell that described transformed host is biological is cultivated when allowing to produce insect-killing protein;

Reclaim described insect-killing protein.

11. the method producing insect-killing protein according to claim 10, it is characterised in that described transformed host biology includes plant cell, zooblast, antibacterial, yeast, baculovirus, nematicide or algae.

12. the method producing insect-killing protein according to claim 11, it is characterised in that described plant is corn and soybean, Cotton Gossypii, Oryza sativa L. or Semen Tritici aestivi.

13. the method for increasing insecticide target scope, it is characterized in that, including: the insect-killing protein building body coding described in any one of claim 1-3 is expressed in plant together with at least one the third parasite killing nucleotide being different from and building the insect-killing protein that body encodes described in any one of claim 1-3.

14. the method being used for increasing insecticide target scope according to claim 13, it is characterized in that, the third parasite killing nucleotide coding Cry class insect-killing protein described, Vip class insect-killing protein, protease inhibitor, agglutinin, ��-amylase or peroxidase.

15. the method being used for increasing insecticide target scope according to claim 13, it is characterised in that the third parasite killing nucleotide described is suppress the dsRNA of important gene in target insect pests.

16. the method producing zoophobous, it is characterised in that including: import plant by building recombinant vector described in body or claim 9 described in any one of claim 1-3.

17. the method for protecting the plants from the damage caused by lepidopteran insect pests; it is characterized in that; including: import plant by building recombinant vector described in body or claim 9 described in any one of claim 1-3, make the plant after importing produce enough to protected from the insect-killing protein of lepidopteran insect pests infringement amount.

18. the method controlling insect pest, it is characterised in that including: making insect pest contact with the insect inhibitory protein matter building body coding described in any one of claim 1-3 of amount of suppression, described insect pest is lepidopteran insect pests.

19. the method for control insect pest according to claim 18, it is characterized in that, described Cry2Aa albumen and described Cry1Ab/Ac albumen are present in the plant cell producing it, and described insect pest is by described plant cell and described Cry2Aa albumen and the described Cry1Ab/Ac protein contact of ingesting.

20. the method for control insect pest according to claim 19, it is characterized in that, described Cry2Aa albumen and described Cry1Ab/Ac albumen are present in the transgenic plant producing it, described insect pest is by tissue and described Cry2Aa albumen and the described Cry1Ab/Ac protein contact of described transgenic plant of ingesting, after contact, the growth of described insect pest is suppressed and/or causes death, the control of plant of insect pest being caused harm with realization.

21. the method for control insect pest according to claim 20, it is characterised in that described transgenic plant may be at any period of duration.

22. the method for control insect pest according to claim 20, it is characterised in that described transgenic plant be organized as blade, stem stalk, tassel, female fringe, flower pesticide or filigree.

23. the method for control insect pest according to claim 20, it is characterised in that the control of described plant that insect pest is caused harm does not change because planting the change in place.

24. the method for control insect pest according to claim 20, it is characterised in that the described control that insect pest is caused harm plant does not change because of the change of implantation time.

25. the method controlling insect pest according to any one of claim 19-24, it is characterised in that described plant is from Semen Maydis, Oryza sativa L., Sorghum vulgare Pers., wheat, foxtail millet, Cotton Gossypii, phragmites communis, Caulis Sacchari sinensis, Caulis Zizaniae caduciflorae, Semen Viciae fabae or Brassica campestris L.

26. the method for control insect pest according to claim 25, it is characterised in that the step before described contact procedure is the plantation plant containing the polynucleotide encoding described Cry2Aa albumen and described Cry1Ab/Ac albumen.

27. the method controlling insect pest according to any one of claim 19-24, it is characterised in that the step before described contact procedure is the plantation plant containing the polynucleotide encoding described Cry2Aa albumen and described Cry1Ab/Ac albumen.

28. the method controlling insect pest according to claim 27, it is characterised in that described lepidopteran insect pests is pink rice borer and/or striped rice borer.

29. the method controlling insect pest according to claim 26, it is characterised in that described lepidopteran insect pests is pink rice borer and/or striped rice borer.

30. the method controlling insect pest according to claim 25, it is characterised in that described lepidopteran insect pests is pink rice borer and/or striped rice borer.

31. the method controlling insect pest according to any one of claim 19-24, it is characterised in that described lepidopteran insect pests is pink rice borer and/or striped rice borer.

32. the method controlling insect pest according to claim 18, it is characterised in that described lepidopteran insect pests is pink rice borer and/or striped rice borer.

33. build the purposes of the insect inhibitory protein Quality Control lepidopteran insect pests of body coding described in a claim 1-3 or any one of 5-7.

34. build the purposes of the insect inhibitory protein Quality Control lepidopteran insect pests of body coding described in a claim 4.

35. build the purposes of the insect inhibitory protein Quality Control lepidopteran insect pests of body coding described in a claim 8.