CN103734169A - Pest control method - Google Patents

Abstract

The invention relates to a method for controlling the pest Conogethes punctiferalis. The method includes contacting the pest Conogethes punctiferalis with Cry1A.105 protein. According to the invention, the pest Conogethes punctiferalis is controlled through the Cry1A.105 protein that is generated in plants and can kill Conogethes punctiferalis. Compared with agricultural control methods, chemical control methods and biological control methods employed in the prior art, the method provided by the invention can achieve whole-plant protection on plants during a whole growth period so as to prevent and treat the attack of the pest Conogethes punctiferalis. Being free of pollution and residual, the method has stable and thorough effects, and is simple, convenient, and economical.

Description

The method of Control pests

Technical field

The present invention relates to a kind of method of Control pests, particularly relate to a kind of method that the Cry1A.105 albumen of expressing in plant is controlled dichocrocis punctiferalis harm plant that is used in.

Background technology

Dichocrocis punctiferalis (Conogethes punctiferalis) belongs to Lepidoptera Pyralidae, for polyphagous pest-insect, except harm corn, Chinese sorghum etc. make beyond the region of objective existence, also endanger the fruit trees such as peach, persimmon, Chinese chestnut, be distributed widely in China domestic, North gets Heilungkiang, the Inner Mongol, reach Taiwan, Hainan, Guangdong, Guangxi, south, Yunnan edge in the south, border, Dong Jie former Soviet Union east, border, Korea north, west, behind Shanxi, Xi Xiezhi Ningxia, Shaanxi, Gansu, folds into Sichuan, Yunnan, Tibet.During harm corn, the female fringe of main moth food, also can eat into stem, and the strain rate of being injured reaches 30%-80%; During harm Chinese sorghum, newly hatched larvae is eaten in the tender seed of Chinese sorghum children, with ight soil or swill, mouth is sealed, moth evil, eats empty one and turns again one until before three ages, weaving silk after three ages knots puts together the middle tunnel that leaves of small ear within it, inside walk and gnaw seed, serious has eaten sorghum grain moth.Can eat into stalk in addition, the similar corn borer of Harm.

Corn and Chinese sorghum are the important cereal crops of China, and the grain loss causing because of dichocrocis punctiferalis is every year huge, have influence on what is more the survival state of local population.In order to prevent and treat dichocrocis punctiferalis, the main method of preventing and treating that people adopt conventionally has: cultural control, chemical control and biological control.

Cultural control is that regulation and control crop, insect, environmental factor, one of creation are conducive to plant growth and are unfavorable for the farmland ecological environment that dichocrocis punctiferalis occurs the multifactorial comprehensive coordination management of whole agro-ecosystem.As utilized, process dichocrocis punctiferalis overwintering host, pick up and ruin shedding and extract wormed fruit, reform cropping system, plant anti-dichocrocis punctiferalis kind and plantation lures the measures such as collection field to reduce the harm of dichocrocis punctiferalis.Because of cultural control, must obey the requirement of crop allocation and volume increase, application has certain limitation, can not, as emergency measure, when dichocrocis punctiferalis is broken out, just seem helpless.

Chemical control is pesticide control, to utilize chemical insecticide to carry out kill pests, it is the important component part of the dichocrocis punctiferalis comprehensive regulation, it has fast, the feature of convenient, easy and high economic benefit, particularly in the situation of the large generation of dichocrocis punctiferalis, the emergency measure that is absolutely necessary, it can be by its elimination before dichocrocis punctiferalis works the mischief.Chemical prevention and control method mainly contains chemistry trapping, medicine liquid spray etc. at present.But chemical control also has its limitation, as tending to cause crops generation poisoning, insect, improper use develops immunity to drugs, and killed natural enemies, contaminated environment, make field ecosystem suffer to destroy and residue of pesticide to adverse consequencess such as the safety of people, animal constitute a threat to.

Biological control is to utilize some beneficial organism or biological metabolic product to carry out Control pests population quantity, to reach the object that reduces or eliminate destructive insects.Be characterized in that environmental pollution is few to people, animal safety, to some insect, can reach the object of long-term control; But effect is often unstable, no matter and dichocrocis punctiferalis generation weight all need same investment to carry out.

In order to solve cultural control, chemical control and biological control limitation in actual applications, scientists is found the anti insect gene of encoding insecticidal proteins to proceed in plant through research, can obtain some insect-resistant transgenic plants with control insect pest of the plant.Cry1A.105 insecticidal proteins is a kind of in numerous insecticidal proteins, is the companion's spore crystalline protein being produced by bacillus thuringiensis storehouse Stuckey subspecies (Bacillus thuringiensis subsp.kurstaki, B.t.k.).

Cry1A.105 albumen is taken in and is entered middle intestines by insect, and toxalbumin parent toxin is dissolved under the alkaline pH environment of insect midgut.Albumen N-and C-end, by basic protein enzymic digestion, are transformed into active fragment by parent toxin; Receptors bind on active fragment and insect midgut epithelial cell membrane upper surface, insertion goldbeater's skin, causes cell membrane to occur perforation focus, destroys the inside and outside osmotic pressure variation of cell membrane and pH balance etc., upsets the digestion process of insect, finally causes its death.

Proved that the plant that turns Cry1A.105 gene can resist the infringement of Lepidoptera (Lepidoptera) insects such as corn borer, cotton bollworm, black cutworm, yet, there is no so far about express the transfer-gen plant of Cry1A.105 albumen by generation and control the report of dichocrocis punctiferalis to plant hazard.

Summary of the invention

A kind of method that the object of this invention is to provide Control pests, provide first the transfer-gen plant of expressing Cry1A.105 albumen by generation to control the method for dichocrocis punctiferalis to plant hazard, and effectively overcome the technological deficiencies such as prior art cultural control and chemical control.

For achieving the above object, the invention provides a kind of method of controlling dichocrocis punctiferalis insect, comprise dichocrocis punctiferalis insect is contacted with Cry1A.105 albumen.

Further, described Cry1A.105 albumen is present in the plant cell that produces described Cry1A.105 albumen, and described dichocrocis punctiferalis insect contacts with described Cry1A.105 albumen by the described plant cell of ingesting.

Further, described Cry1A.105 albumen is present in the genetically modified plants that produce described Cry1A.105 albumen, described dichocrocis punctiferalis insect contacts with described Cry1A.105 albumen by the tissue of the described genetically modified plants that ingest, after contact, described dichocrocis punctiferalis insect growth is suppressed and finally causes death, to realize the control to dichocrocis punctiferalis harm plant.

Described genetically modified plants can be in any breeding time.

The tissue of described genetically modified plants can be root, blade, stem stalk, tassel, female fringe, flower pesticide or filigree.

The described control that dichocrocis punctiferalis is endangered to plant is not because the change in plantation place changes.

The described control that dichocrocis punctiferalis is endangered to plant is not because the change of implantation time changes.

Described plant can be from corn, Chinese sorghum, grain, sunflower, castor-oil plant, ginger, cotton, peach, persimmon, walnut, Chinese chestnut, fig or pine tree.

Step before described contact procedure is for planting the plant of the polynucleotides that contain the described Cry1A.105 albumen of encoding.

Preferably, the amino acid sequence of described Cry1A.105 albumen has the amino acid sequence shown in SEQ ID NO:1.The nucleotide sequence of described Cry1A.105 albumen has the nucleotide sequence shown in SEQ ID NO:2.

On the basis of technique scheme, described plant can also produce at least one the second nucleotide that is different from described Cry1A.105 albumen.

Further, can encode Cry class insect-killing protein, Vip class insect-killing protein, protease inhibitors, agglutinin, α-amylase or peroxidase of described the second nucleotide.

Preferably, can encode Cry2Ab albumen or Vip3A albumen of described the second nucleotide.

Further, described the second nucleotide comprises the nucleotide sequence shown in SEQ ID NO:3 or SEQ ID NO:4.

Selectively, described the second nucleotide is for suppressing the dsRNA of important gene in targeted insect insect.

For achieving the above object, the present invention also provides a kind of Cry1A.105 protein to control the purposes of dichocrocis punctiferalis insect.

In the present invention, the expression of Cry1A.105 albumen in a kind of genetically modified plants can be accompanied by the expression of one or more Cry class insect-killing proteins and/or Vip class insect-killing protein.Thisly surpass a kind of Pesticidal toxins co expression in same strain genetically modified plants and can plant be comprised and express required gene and realize by genetic engineering.In addition, a Plants (the 1st parent) can be expressed Cry1A.105 protein by genetic engineering procedure, and the second plant (the 2nd parent) can be expressed Cry class insect-killing protein and/or Vip class insect-killing protein by genetic engineering procedure.By the 1st parent and the 2nd parent, hybridize and obtain the progeny plants of expressing all genes of introducing the 1st parent and the 2nd parent.

RNA disturbs (RNA interference, RNAi) to refer to the phenomenon of the efficient specificity degraded of high conservative, that brought out by double-stranded RNA (double-stranded RNA, dsRNA), homologous mRNA during evolution.Therefore can use in the present invention RNAi technology specific depletion or close the expression of specific gene in targeted insect insect.

Dichocrocis punctiferalis (Conogethes punctiferalis) belongs to Lepidoptera Pyralidae together with corn borer (Ostrinia nubilalis), for polyphagous pest-insect, however, dichocrocis punctiferalis and corn borer be biologically clearly, distinct two species, at least there is the following main distinction:

1, feeding habits are different.Dichocrocis punctiferalis not only takes food the gramineous crops such as corn, and also the fruit trees such as peach, pomegranate, Chinese chestnut, persimmon are eaten in happiness simultaneously; And corn borer is obviously had a liking for gramineous crop, the most often endanger Chinese sorghum, corn etc.

2, distributed areas are different.It is whole that dichocrocis punctiferalis spreads all over China, on Japan, the Korea peninsula, Britain, Australia and other places, also has distribution.Corn borer comprises Asiatic corn borer and European corn borer, and wherein Asiatic corn borer is distributed in Eastern China and southwestern Major Maize, Chinese sorghum producing region; European corn borer is mainly distributed in Chinese Xinjiang and Europe, North America, West Africa and area, Asia Minor.From distributed areas, the distributed areas of dichocrocis punctiferalis all want wide compared with European corn borer and Asiatic corn borer.

3, Damage habits is different.When dichocrocis punctiferalis is caused harm Chinese sorghum, newly hatched larvae is eaten in the tender seed of Chinese sorghum children, with ight soil or swill, mouth is sealed, and moth evil, eats empty one and turn again one until before three ages within it; After three ages, weaving silk knots puts together in the middle of small ear and leaves tunnel, inside walks and gnaws seed, and serious has eaten sorghum grain moth; Can eat into stalk in addition; While causing harm corn, the female fringe of main moth food, eats into and produces stickiness ight soil after young tender seed and block channel, turns grain and cause harm in channel; Also can eat into stem, blade, seed simultaneously; Dichocrocis punctiferalis is caused harm and often produces stickiness ight soil, has increased the probability that mould occurs, and has especially increased the probability of happening of aspergillus flavus, has affected feed processing.And after corn borer larvae hatches, first flock together, then in the tender part of plant children, creep, start harm; Newly hatched larvae, can weave silk sagging, borrows wind-force to waft and moves adjacent strain, forms and turns strain harm; Larva mostly was for five ages, and the activity on young tender lobus cardiacus, tassel, bract and filigree that mainly concentrated on before three ages takes food, and killed lobus cardiacus presents many horizontally-arranged apertures after launching; After four ages, major part pierces stem stalk; Corn borer milpa each position on the ground of can causing harm, blade is stung after food by larva, can reduce its photosynthetic efficiency; Tassel is eaten into, normal frangibility, impact pollination; Bract, filigree are eaten into food, can cause and lack grain and blighted grain; Stem stalk, fringe handle, cob are eaten into after food, form tunnel, destroy the conveying of moisture, nutrient in plant, and the stem stalk rate of falling folding is increased, and grain yield declines.The spring of various places, summer, autumn sowing corn have damage to different degrees, especially the heaviest with Summer Maize.

4, morphological feature is different.

1) avette state is different: the long 0.6-0.7mm of dichocrocis punctiferalis ovum, and ovum face is coarse, and gather tiny circular punctum or netted decorative pattern, be orange red before hatching, the loose rough surface that originates in of simple grain; And egg stage of Ostrinia furnacalis becomes flat elliptic, near hatching leading section, there is pore, tens of grains are fish scale-shaped irregular alignment.

2) Larva Morpho. Logy is different: dichocrocis punctiferalis larva body colour is changeable, and light gray is to kermesinus, and the outside of belly mostly is light green, head crineous, body back of the body kermesinus, outside of belly light green, pronotary and podical plate dark brown, each body segment workprint is obvious, and ash is brown to pitchy, and on l-8 uromere, each tool is 8, line up two row, 6, prostatitis is larger, and 2 of rank rears are less, and after 3 ages, 2 crineous sexual glands appear in male larva the 5th uromere back side; And corn borer larvae back yellow-white is to light chocolate, head and pronotary dark brown, lineback is obvious, and there is the sub-lineback of fuzzyyer crineous both sides, and belly 1-8 saves has verruca two row, 4, prostatitis, 2 of rank rears.

3) pupa form is different: the dichocrocis punctiferalis pupa initial stage is pistac, after deepen brown, head, the belly 1-8 joint back side tiny projection of gathering, 5-7 joint belly leading edge has 1 flash line consisting of little cdontoid process, abdomen end has 6 of elongated curling hook thorns; And corn borer pupa yellowish-brown, the densely covered horizontal wrinkle of the abdomen back of the body, there is 5-8 root hook thorn at abdomen end.

4) adult form is different: dichocrocis punctiferalis adult is yellow to orange-yellow, on chest, belly and wing, there are a lot of black splotches, both sides, shirtfront by 1 stain of each tool on hair, male moth belly the 9th joint end is black, very obvious, more blunt, there is black scopular, female moth abdomen end is conical, and minor details only end, the back side have few black scale; And corn borer adult fore wing yellowish-brown has two brown wave-like cross striations, between two lines, there are two yellowish-brown short grains, hind wing taupe, female moth wing look male moth is light, and fore wing presents yellow, and inside and outside horizontal line and speckle are obvious not as good as male moth.

5, habit of growth is different with pests occurrence rule.Dichocrocis punctiferalis is in raw 1-2 of Liaoning year generation, in 3 generations of Hebei, Shandong, Shaanxi, in 4 generations of Henan, Yangtze river basin 4-5 generation, all with mature larva, in the stubbles such as corn, sunflower, castor-oil plant, cocoons and survives the winter; In Henan 1 generation larva in late May-late June, first on peach, endanger, 2-3 can endanger on peach and Chinese sorghum for larva, in the 4th generation, endangered on summer sowing Chinese sorghum and sunflower, with 4 generation larva survive the winter, next year, Overwintering Larvae was pupated at the beginning of 4 months, late April enters the Sheng phase of pupating, and by the end of April-late May sprouts wings, and winter generation adult produces ovum on peach; 1 generation of mid-June-late June larvae pupation, 1 generation adult in late June, start to occur, early July enters the emergence Sheng phase, 2 ovum Sheng phases in generation and then occurred, the Chinese sorghum of at this moment sowing in spring heading flowering, be 2 larva harm Sheng phases in generation mid-July; The 2 generations emergence Sheng phase on August, the middle ten days, at this moment Chinese sorghum is closely ripe the spring, the late sowing spring Chinese sorghum and the early sowing summer Chinese sorghum flowering of just earing, adult concentrates on these Chinese sorghums and lays eggs, the 3rd generation ovum at the beginning of 8 months by the end of July, hatch, in 8 months, the last ten-days period enter 3 generation larva endanger the Sheng phases; 3 generations adult appearance by the end of August, September, early and middle ten days entered the Sheng phase, and at this moment Chinese sorghum and peach fruit is gathered, adult ovum produce the summer in evening Chinese sorghum and late-maturing sunflower on, mid-September-early October enter 4 generation larva cause harm the phase, in 10 months, the last ten-days period mercury dropped with 4 generation larva survive the winter.18 days ovum phases in generation in Henan, 2 4.5 days generations, 3 4.2 days generations, overwinter generation 6 days; 1 generation larva go through 19.8 days phases, 2 13.7 days generations, 3 13.2 days generations, overwinter generation 208 days, larvae underwent 5 instars; 1 8.8 days pupa time of generation, 2 8.3 days generations, 3 8.7 days generations, overwinter generation 19.4 days; Generation Life of Adult 7.3 days, 2 7.2 days generations, 3 7.6 days generations, overwinter generation 10.7 days.After adult eclosion, hide and just lay eggs through supplementing the nutrients at sorghum field daytime, ovum is produced on the Chinese sorghum of earing flowering, ovum per unit area yield, every femalely lay eggs 169, the one fringe 3-5 grain of laying eggs, in Yibin, Sichuan, from autumn corn, take out hero and to the wax ripeness stage, ovum is produced at tassel, female fringe, leaf sheath commissure or auricle positive and negative, hundred strain ovum amounts are up to 1729; After larva person is ripe, in fringe or in axil, leaf sheath, dead leaf place and Chinese sorghum, corn, sunflower stalk, survive the winter; Rain for many years part generation is heavy, be subject in recent years the impact of Global Greenhouse Effect, North China and the Northeast's summer rainwater amount are large, make dichocrocis punctiferalis progressively become the Major Maize insect of North China, but because its feeding habits are assorted, be everlasting and shift and cause harm between different hosts, and favorite eats into fruit ear with brill and stem stalk is caused harm, and generally sprays insecticide and is difficult to control.And the generation of corn borer has significant difference with latitude: in China, 1 generation to the north of 45 ° of north latitude, 45 °-40 ° 2 generations, 40 °-30 ° 3 generations, 30 °-25 ° 4 generations, 25 °-20 ° 5-6 generations.Height above sea level is higher, and generation is fewer; 2-4 generation occurs in Sichuan Province for 1 year, and temperature is high, height above sea level is low, and generation is more, conventionally with mature larva, in corn stem, cob or in the stalk of Chinese sorghum, sunflower, survives the winter, and the next year 4-5 month pupates, and pupa was through emergence in about 10 days.Adult nocturnalism, the power of circling in the air is strong, has phototaxis, 5～10 days life-spans, like laying eggs in liftoff more than 50 centimetres, the more luxuriant Zhong Mai both sides, the maize leaves back side of growth, the female moth 350-700 grain of can laying eggs, ovum phase 3-5 days; Corn borer is adapted at growing under high temperature, super-humid conditions, and winter temperature is higher, and natural enemy parasitic amount is few, is conducive to the breeding of corn borer, endangers heavier; Ovum phase arid, maize leaf is curling, and pieces of an egg easily come off and death from leaf back, endanger lighter.

Comprehensively above-mentioned, can determine that dichocrocis punctiferalis and corn borer are two kinds of insects, and affiliation is far away, cannot mating produce offspring.

The genome of the plant described in the present invention, plant tissue or plant cell, refers to any genetic material in plant, plant tissue or plant cell, and comprises cell nucleus and plastid and mitochondrial genomes.

Polynucleotides described in the present invention and/or nucleotide form complete " gene ", coded protein or polypeptide in required host cell.Those skilled in the art are easy to recognize, polynucleotides of the present invention and/or nucleotide can be placed under object host's regulating and controlling sequence control.

Well-known to those skilled in the art, DNA typically exists with double chain form.In this arrangement, a chain and another chain complementation, vice versa.Because DNA copies other complementary strand that has produced DNA in plant.Like this, the present invention includes the use to the polynucleotides of example in sequence table and complementary strand thereof.Normal " coding strand " using in this area refers to the chain of being combined with antisense strand.For marking protein in vivo, typical case is transcribed into a chain of DNA the complementary strand of a mRNA, and it translates protein as template.MRNA is actually from " antisense " chain of DNA and transcribes." have justice " or " coding " chain has a series of codons (codon is three nucleotide, once reads three and can produce specific amino acids), it can be used as open reading frame (ORF) and reads and form destination protein matter or peptide.The present invention also comprises that the DNA with example has RNA and the PNA(peptide nucleic acid of suitable function).

Amplifying nucleic acid molecule of the present invention or its fragment under stringent condition with Cry1A.105 gene recombination of the present invention.The nucleic acid hybridization of any routine or amplification method may be used to identify the existence of Cry1A.105 gene of the present invention.Nucleic acid molecules or its fragment can be carried out specific hybrid with other nucleic acid molecules under a stable condition.In the present invention, if two nucleic acid molecules can form antiparallel double-strandednucleic acid structure, just can say that these two nucleic acid molecules can carry out specific hybrid to each other.If two nucleic acid molecules demonstrate complementarity completely, claim that one of them nucleic acid molecules is another nucleic acid molecules " complement ".In the present invention, when each nucleotide of a nucleic acid molecules and the corresponding nucleotide complementation of another nucleic acid molecules, claim these two nucleic acid molecules to demonstrate " complete complementary ".If thereby two nucleic acid molecules can make with enough stability phase mutual crosses them anneal and be bonded to each other under at least conventional " low strict " condition, claim these two nucleic acid molecules for " minimum level is complementary ".Similarly, if thereby two nucleic acid molecules can make with enough stability phase mutual crosses them under " highly strict " condition of routine, anneal and be bonded to each other, and claim these two nucleic acid molecules to there is " complementarity ".From complete complementary, depart from and can allow, as long as this, depart from two molecules of incomplete prevention and form duplex structure.In order to make a nucleic acid molecules as primer or probe, only need to guarantee that it has sufficient complementarity in sequence, so that can form stable duplex structure under adopted specific solvent and salinity.

In the present invention, the sequence of basic homology is one section of nucleic acid molecules, this nucleic acid molecules under height stringent condition can with the complementary strand generation specific hybrid of another section of nucleic acid molecules matching.Promote the applicable stringent condition of DNA hybridization, for example, process greatly under 45 ℃ of conditions by 6.0 * sodium chloride/sodium citrate (SSC), then under 50 ℃ of conditions, with 2.0 * SSC, wash, these conditions are known to those skilled in the art.For example, the salinity in washing step can be selected from the approximately 2.0 * SSC, 50 ℃ of low stringent condition to the approximately 0.2 * SSC of height stringent condition, 50 ℃.In addition, the temperature condition in washing step can, from approximately 22 ℃ of the room temperatures of low stringent condition, be elevated to approximately 65 ℃ of height stringent condition.Temperature condition and salinity can all change, and also can one of them remain unchanged and another variable changes.Preferably, stringent condition of the present invention can be in 6 * SSC, 0.5%SDS solution, at 65 ℃, with SEQ ID NO:2, specific hybrid occurs, and then uses 2 * SSC, 0.1%SDS and 1 * SSC, 0.1%SDS respectively to wash film 1 time.

Therefore, there is anti-insect activity and comprise in the present invention with the sequence of SEQ ID NO:2 hybridization of the present invention under stringent condition.These sequences and sequence of the present invention be 40%-50% homology at least approximately, about 60%, 65% or 70% homology, even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or larger sequence homology.

Gene described in the present invention and protein not only comprise specific exemplary sequence, also comprise the part and/fragment (comprise with full length protein and comparing and/or terminal deletion), variant, mutant, substituent (having the amino acid whose protein of substituting), chimera and fusion of the insecticidal activity feature of the protein of having preserved described particular example.Described " variant " or " variation " refer to that the same albumen of coding or coding have the nucleotide sequence of the albumen of equal value of insecticidal activity.Described " albumen of equal value " refers to the bioactive albumen with the albumen of claim with identical or essentially identical anti-dichocrocis punctiferalis insect.

" fragment " of the DNA molecular described in the present invention or protein sequence or " brachymemma " refer to a part or its artificial reconstructed form (sequence that is for example applicable to expression of plants) of the original DNA that relates to or protein sequence (nucleotide or amino acid), can there is variation in the length of aforementioned sequence, but length sufficient to guarantee (coding) protein is insect toxins.

Use standard technique can modifier gene and the easy gene variant that builds.For example, the technology of well known manufacturing place sudden change.For example U.S. Patent number 5605793 has been described the method for using DNA to reassembly other molecular diversity of generation after random fracture again.Can use commercialization endonuclease to manufacture the fragment of full-length gene, and can use exonuclease according to standardization program.For example, can use enzyme such as Bal31 or direct mutagenesis from the end system of these genes excise nucleotide.Can also use multiple restriction enzyme to obtain the gene of coding active fragment.Can use protease directly to obtain the active fragment of these toxin.

The present invention can derive from B.t. separator and/or DNA library the gene of albumen of equal value and/or these albumen of equal value of encoding.There is several different methods to obtain insecticidal proteins of the present invention.For example, can use the antibody of the open and claimed insecticidal proteins of the present invention to identify and separated other albumen from protein mixture.Especially, antibody may be that the most constant by albumen and the most different from other B.t. albumen protein parts causes.Then can by immunoprecipitation, enzyme linked immunosorbent assay (ELISA) (ELISA) or western trace method use these antibody single-minded identify the albumen of equal value of feature activity.Can use this area standardization program to be easy to the antibody of the fragment of disclosed albumen in preparation the present invention or albumen of equal value or this plastein.Then can from microorganism, obtain the gene of these albumen of coding.

Due to the Feng Yuxing of genetic codon, the multiple different DNA sequence dna identical amino acid sequence of can encoding.Produce the alternative DNA sequence dna of these encode identical or essentially identical albumen just in those skilled in the art's technical merit.These different DNA sequence dnas comprise within the scope of the invention.Described " substantially the same " sequence refers to 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor, disappearance, interpolation or insertion but does not affect in fact the sequence of insecticidal activity, also comprises the fragment that retains insecticidal activity.

In the present invention, the replacement of amino acid sequence, disappearance or interpolation are the ordinary skill in the art, and preferably this seed amino acid is changed to: little characteristic changing, and the folding and/or active conserved amino acid that does not significantly affect albumen replaces; Little disappearance, common about 1-30 amino acid whose disappearance; Little amino or c-terminus extend, and for example aminoterminal extends a methionine residues; Little connection peptide, for example an about 20-25 residue is long.

The conservative example replacing is the replacement occurring in following amino acid group: basic amino acid (as arginine, lysine and histidine), acidic amino acid (as glutamic acid and aspartic acid), polar amino acid (as glutamine, asparagine), hydrophobic amino acid (as leucine, isoleucine and valine), ArAA (as phenyl alanine, tryptophan and tyrosine), and little molecule amino acid (as glycine, alanine, serine, threonine and methionine).Conventionally those 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factors that do not change given activity are well-known in this area, and by, for example, N.Neurath and R.L.Hill are described in the < < Protein > > of new york academic publishing house (Academic Press) in 1979 publication.Modal exchange has Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and their contrary exchanges.

For a person skilled in the art apparently, this replacement can occur outside the region that molecular function is played an important role, and still produces active peptides.For by polypeptide of the present invention, it is active essential and therefore select not substituted amino acid residue, can be according to methods known in the art, as direct mutagenesis or alanine scanning mutagenesis identify (as referring to, Cunningham and Wells, 1989, Science244:1081-1085).A rear technology is that each positively charged residue place introduces sudden change in molecule, detects the anti-insect activity of gained mutating molecule, thereby determines the amino acid residue that this molecular activity is overstated and wanted.Substrate-enzyme interacting site also can be measured by the analysis of its three-dimensional structure, this three-dimensional structure can be measured by the technology such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling (referring to, as de Vos etc., 1992, Science255:306-312; Smith etc., 1992, J.Mol.Biol224:899-904; Wlodaver etc., 1992, FEBS Letters309:59-64).

In the present invention, Cry1A.105 albumen includes but not limited to Cry1A.105 albumen, or has at least 70% autoploidy with the amino acid sequence of above-mentioned albumen and dichocrocis punctiferalis is had to desinsection fragment or the functional area of insecticidal activity.

Therefore the amino acid sequence that, has certain autoploidy with the amino acid sequence shown in sequence 1 is also included within the present invention.These sequences and sequence similarity/homogeny of the present invention are typically greater than 60%, are preferably greater than 75%, are preferredly greater than 80%, are even preferredly greater than 90%, and can be greater than 95%.Also can be according to more specific homogeny and/or similarity scope definition preferred polynucleotides of the present invention and protein.For example there are 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homogeny and/or similarity with the sequence of example of the present invention.

Regulating and controlling sequence described in the present invention includes but not limited to promotor, transit peptides, terminator, enhancer, and targeting sequencing, intron and other are operably connected to the adjusting sequence of described Cry1A.105 albumen.

Described promotor is effable promotor in plant, and described " effable promotor in plant " refers to the promotor of guaranteeing that connected coded sequence is expressed in plant cell.In plant, effable promotor can be constitutive promoter.Instruct the example of the promotor of constitutive expression in plant to include but not limited to, derive from 35S promoter, the ubi promoter of maize of cauliflower mosaic virus, the promotor of paddy rice GOS2 gene etc.Alternatively, in plant, effable promotor can be tissue-specific promotor, this promotor is in some tissues of plant as instructed the expression of coded sequence higher than its hetero-organization of plant (can be tested and be measured by conventional RNA), as PEP carboxylase promotor in chlorenchyma.Alternatively, in plant, effable promotor can be wound-induced promotor.Wound-induced promotor or instruct the promotor of the expression pattern of wound-induced to refer to when plant is stood machinery or gnaws by insect the wound causing, is significantly increased under the expression compared with normal growth conditions of the coded sequence under promoter regulation.The example of wound-induced promotor includes but not limited to, the promotor of the protease suppressor of potato and tomato (pin I and pin II) and zein enzyme suppressor (MPI).

Described transit peptides (claiming again secretory signal sequence or targeting sequencing) is to instruct transgene product to arrive specific organelle or cellular compartment, concerning receptor protein, described transit peptides can be allos, for example, utilize coding chloroplast transit peptide sequence target chloroplast, or utilize ' KDEL ' reservation queue target endoplasmic reticulum, or utilize the CTPP target vacuole of barley plants agglutinin gene.

Described targeting sequencing including but not limited to, picornavirus targeting sequencing, as EMCV targeting sequencing (encephalomyocarditis virus 5 ' noncoding region); Potyvirus group targeting sequencing, as the MDMV(corn mosaic virus that stunts) targeting sequencing; Human immunoglobulin matter heavy chain conjugated protein (BiP); The coat protein mRNA of alfalfa mosaic virus does not translate targeting sequencing (AMV RNA4); Tobacco mosaic virus (TMV) targeting sequencing.

Described enhancer including but not limited to, cauliflower mosaic virus (CaMV) enhancer, figwort mosaic virus (FMV) enhancer, carnation weathering circovirus virus (CERV) enhancer, cassava vein mosaic virus (CsVMV) enhancer, Mirabilis jalapa mosaic virus (MMV) enhancer, dama de noche tomato yellow leaf curl China virus (CmYLCV) enhancer, Cotton leaf curl Multan virus (CLCuMV), commelina yellow mottle virus (CoYMV) and peanut chlorisis streak mosaic virus (PCLSV) enhancer.

For monocotyledon application, described intron including but not limited to, corn hsp70 intron, corn ubiquitin intron, Adh introne 1, sucrose synthase intron or paddy rice Act1 intron.For dicotyledon application, described intron including but not limited to, CAT-1 intron, pKANNIBAL intron, PIV2 intron and " super ubiquitin " intron.

Described terminator can be the applicable polyadenylation signal sequence working in plant, include but not limited to, derive from Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene polyadenylation signal sequence, derive from protease inhibitors II (pin II) gene polyadenylation signal sequence, derive from the polyadenylation signal sequence of pea ssRUBISCO E9 gene and derive from the polyadenylation signal sequence of alpha-tubulin (α-tubulin) gene.

Described in the present invention, " effectively connect " connection that represents nucleotide sequence, described connection makes a sequence that the function needing concerning the sequence that is connected can be provided.In the present invention, " effectively connect " and can, for promotor is connected with interested sequence, makes transcribing of this interested sequence be subject to this promotor and control and regulate and control.When interested sequential coding albumen and while going for the expression of this albumen " effectively connecting " represent: promotor is connected with described sequence, and connected mode is efficiently translated the transcript obtaining.If when promotor is the expression of transcript fusion and the albumen of wanting realization coding with being connected of coded sequence, manufacture such connection, in the transcript that makes to obtain, the first translation initiation codon is the initiation codon of coded sequence.Alternatively, when if promotor is the expression of translation fusion and the albumen of wanting realization coding with being connected of coded sequence, manufacture such connection, the first translation initiation codon and the promotor that in 5 ' non-translated sequence, contain are connected, and connected mode make the relation of the translation opening code-reading frame of the albumen that the translation product that obtains and coding want meet reading frame.The nucleotide sequence that can " effectively connect " includes but not limited to: it (is gene expression element that the sequence of gene expression function is provided, promotor for example, 5 ' untranslated region, intron, encoding histone region, 3 ' untranslated region, poly-putative adenylylation site and/or transcription terminator), it (is T-DNA border sequence that the sequence of DNA transfer and/or integration function is provided, site-specific recombinase recognition site, integrase recognition site), it (is antibiotic resistance markers that the sequence of selectivity function is provided, biosynthesis gene), the sequence of the label function of can scoring is provided, sequence external or the interior assistance of body series of operations (is polylinker sequence, locus specificity recombination sequence) and the sequence of copy function is provided (is the origin of replication of bacterium, autonomously replicating sequence, centromeric sequence).

It is poisonous that " desinsection " described in the present invention refers to crop pests.More specifically, targeted insect is dichocrocis punctiferalis insect.

In the present invention, Cry1A.105 albumen has toxicity to dichocrocis punctiferalis insect.Plant in the present invention, particularly corn contains foreign DNA in its genome, the nucleotide sequence that described foreign DNA comprises coding Cry1A.105 albumen, dichocrocis punctiferalis insect is organized with this albumen and is contacted by feeding plant, and after contact, dichocrocis punctiferalis insect growth is suppressed and finally causes death.Suppress to refer to lethal or sub-lethal.Meanwhile, plant should be normal in form, and can under conventional method, cultivate consumption and/or the generation for product.In addition, this plant can be eliminated substantially to the needs of chemistry or biological insecticides (described chemistry or biological insecticides are the insecticide of the dichocrocis punctiferalis insect for Cry1A.105 albumen institute target).

The expression of insecticidal crystal protein in vegetable material (ICP) can detect by described several different methods in this area, for example by application special primer to organizing the mRNA of the coded insect-killing protein of interior generation to carry out quantitatively, or the direct amount of the insect-killing protein of specific detection generation.

Can apply the insecticidal effect of ICP in different test determination plants.In the present invention, targeted insect is mainly dichocrocis punctiferalis.

In the present invention, described Cry1A.105 albumen can have the amino acid sequence shown in SEQ ID NO:1 in sequence table.Except the code area that comprises Cry1A.105 albumen, also can comprise other elements, the code area of for example encode the second desinsection nucleotide, the protein of codes selection mark or the protein of conferring herbicide resistance.

In addition, the expression cassette of the nucleotide sequence that comprises code book invention Cry1A.105 albumen can also be expressed with together with the protein of at least one herbicide resistance gene of encoding in plant, described herbicide resistance gene includes but not limited to, phosphine oxamate resistant gene is (as bar gene, pat gene), phenmedipham resistant gene (as pmph gene), glyphosate resistance gene (as EPSPS gene), Brominal (bromoxynil) resistant gene, sulfonylureas resistant gene, resistant gene to weed killer herbicide dalapon, resistant gene to the resistant gene of cyanamide or glutamine synthetase inhibitor (as PPT), thereby obtain, both there is high insecticidal activity, the genetically modified plants again with Herbicid resistant.

In the present invention, foreign DNA is imported to plant, as by the gene of the described Cry1A.105 albumen of coding or expression cassette or recombinant vector importing plant cell, conventional method for transformation includes but not limited to, agriculture bacillus mediated conversion, micro-transmitting bombardment, the direct DNA importing of DNA being taken in to protoplast, electroporation or silicon whisker mediation.

A kind of method that the invention provides Control pests, has the following advantages:

1, internal cause control.Prior art is to be mainly the harm that external cause is controlled dichocrocis punctiferalis insect by external action, as cultural control, chemical control and biological control; And the present invention to be the Cry1A.105 albumen can kill dichocrocis punctiferalis by producing in plant corpus control dichocrocis punctiferalis insect, by internal cause, prevent and treat.

2, pollution-free, noresidue.Although the chemical prevention and control method that prior art is used has played certain effect to controlling the harm of dichocrocis punctiferalis insect, also people, animal and field ecosystem has been brought to pollution, destruction and residual simultaneously; Use the present invention to control the method for dichocrocis punctiferalis insect, can eliminate above-mentioned adverse consequences.

3, control in the time of infertility.The method of the control dichocrocis punctiferalis insect that prior art is used is all interim; and the present invention carries out the protection in the time of infertility to plant; genetically modified plants (Cry1A.105 albumen) from germinateing, growth, until bloom, result, can avoid suffering the infringement of dichocrocis punctiferalis.

4, whole plant control.The method of the control dichocrocis punctiferalis insect that prior art is used is locality mostly, as foliage-spray; And the present invention protects whole plant, as the root of genetically modified plants (Cry1A.105 albumen), blade, stem stalk, tassel, female fringe, flower pesticide, filigree etc. all can be resisted dichocrocis punctiferalis infringement.

5, effect stability.The biological insecticides that prior art is used need to directly spray application to crop surface, therefore cause activated crystalline protein (comprising Cry1A.105 albumen) to be degraded in environment; The present invention expresses described Cry1A.105 albumen in plant corpus, effectively avoided biological insecticides in the unsettled defect of natural world, and the control efficiency of genetically modified plants of the present invention (Cry1A.105 albumen) in different location, different time, different genetic background be all also stable and consistent.

6, simple, convenient, economical.The biological insecticides that prior art is used are easily degraded in environment, therefore need duplication of production and repeated application, and for the practical application in agricultural production brings difficulty, have increased widely cost; The present invention only need plant the genetically modified plants that can express Cry1A.105 albumen, and does not need to adopt other measure, thereby has saved a large amount of human and material resources and financial resources.

7, effect is thorough.The method of the control dichocrocis punctiferalis insect that prior art is used, its effect is halfway, only plays and alleviates effect; And genetically modified plants of the present invention (Cry1A.105 albumen) can be caused the mortality of just incubating dichocrocis punctiferalis larva, and fraction survival larvae development progress is caused to great inhibition, it is all obvious depauperation, and stasi, be difficult to again corn be worked the mischief, and genetically modified plants are only subject to slight damage substantially.

Below by drawings and Examples, technical scheme of the present invention is described in further detail.

Accompanying drawing explanation

Fig. 1 is that the recombinant cloning vector DBN01-T that contains Cry1A.105 nucleotide sequence of the method for Control pests of the present invention builds flow chart;

Fig. 2 is that the recombinant expression carrier DBN100032 that contains Cry1A.105 nucleotide sequence of the method for Control pests of the present invention builds flow chart;

Fig. 3 is the blade injury figure that the transgenic corn plant of the method for Control pests of the present invention is inoculated dichocrocis punctiferalis.Embodiment

Below by specific embodiment, further illustrate the technical scheme of the method for Control pests of the present invention.

The acquisition of the first embodiment, Cry1A.105 gene and synthetic

1, obtain Cry1A.105 nucleotide sequence

The amino acid sequence of Cry1A.105 insect-killing protein (1177 amino acid), as shown in SEQ ID NO:1 in sequence table; Coding is corresponding to the Cry1A.105 nucleotide sequence (3534 nucleotide) of the amino acid sequence (1177 amino acid) of described Cry1A.105 insect-killing protein, as shown in SEQ ID NO:2 in sequence table.

2, obtain Cry2Ab and Vip3A nucleotide sequence

The Cry2Ab nucleotide sequence (1905 nucleotide) of the amino acid sequence (634 amino acid) of coding Cry2Ab insect-killing protein, as shown in SEQ ID NO:3 in sequence table; The Vip3A nucleotide sequence (2370 nucleotide) of the amino acid sequence (789 amino acid) of coding Vip3A insect-killing protein, as shown in SEQ ID NO:4 in sequence table.

3, synthetic above-mentioned nucleotide sequence

Described Cry1A.105 nucleotide sequence (as shown in SEQ ID NO:2 in sequence table), as described in Cry2Ab nucleotide sequence (as shown in SEQ ID NO:3 in sequence table) and as described in Vip3A nucleotide sequence (as shown in SEQ ID NO:4 in sequence table) by Nanjing Genscript Biotechnology Co., Ltd., synthesized; 5 ' end of synthetic described Cry1A.105 nucleotide sequence (SEQ ID NO:2) is also connected with NcoI restriction enzyme site, and 3 ' end of described Cry1A.105 nucleotide sequence (SEQ ID NO:2) is also connected with HindIII restriction enzyme site; 5 ' end of synthetic described Cry2Ab nucleotide sequence (SEQ ID NO:3) is also connected with NcoI restriction enzyme site, and 3 ' end of described Cry2Ab nucleotide sequence (SEQ ID NO:3) is also connected with SpeI restriction enzyme site; 5 ' end of synthetic described Vip3A nucleotide sequence (SEQ ID NO:4) is also connected with ScaI restriction enzyme site, and 3 ' end of described Vip3A nucleotide sequence (SEQ ID NO:4) is also connected with SpeI restriction enzyme site.

The structure of the second embodiment, recombinant expression carrier and recombinant expression carrier transform Agrobacterium

1, build the recombinant cloning vector that contains Cry1A.105 gene

Synthetic Cry1A.105 nucleotide sequence is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) on, operating procedure is undertaken by the product pGEM-T of Promega company carrier specification, obtain recombinant cloning vector DBN01-T, it builds flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 1; F1 represents the origin of replication of phage f1; LacZ is LacZ initiation codon; SP6 is SP6RNA polymerase promoter; T7 is t7 rna polymerase promotor; Cry1A.105 is Cry1A.105 nucleotide sequence (SEQ ID NO:2); MCS is multiple clone site).

Then recombinant cloning vector DBN01-T is transformed to Escherichia coli T1 competent cell (Transgen by heat shock method, Beijing, China, CAT:CD501), its hot shock condition is: 50 μ l Escherichia coli T1 competent cells, 10 μ l plasmid DNA (recombinant cloning vector DBN01-T), 42 ℃ of water-baths 30 seconds; 37 ℃ of shaken cultivation 1 hour (under 100rpm rotating speed, shaking table shakes), on surface, scribble IPTG(isopropylthio-β-D-galactoside) and the chloro-3-indoles-β-D-of the bromo-4-of X-gal(5-galactoside) dull and stereotyped (the tryptone 10g/L of LB of ampicillin (100 mg/litre), yeast extract 5g/L, NaCl10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) upper grow overnight.Picking white colony, in LB liquid nutrient medium (NaCl10g/L, ampicillin 100mg/L, adjusts pH to 7.5 with NaOH for tryptone 10g/L, yeast extract 5g/L) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid: by bacterium liquid centrifugal 1min under 12000rpm rotating speed, remove supernatant, and the solution I (25mM Tris-HCl, 10mM EDTA(ethylenediamine tetra-acetic acid) of 100 μ l ice precoolings for precipitation thalline, 50mM glucose, pH8.0) suspends; The solution II (0.2M NaOH, 1%SDS(lauryl sodium sulfate) that adds the new preparation of 150 μ l), pipe is put upside down 4 times, mixed, put 3-5min on ice; Add the solution III that 150 μ l are ice-cold (4M potassium acetate, 2M acetic acid), fully mix immediately, place 5-10min on ice; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition adds 2 times of volume absolute ethyl alcohols in supernatant, mixes rear room temperature and places 5min; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition, abandons supernatant, after the ethanol washing that precipitation is 70% by concentration (V/V), dries; Add 30 μ l containing RNase(20 μ g/ml) TE(10mM Tris-HCl, 1mM EDTA, PH8.0) dissolution precipitation; Water-bath 30min at 37 ℃ of temperature, digestion RNA; In temperature-20, ℃ save backup.

The plasmid extracting is cut after evaluation through EcoRV and XohI enzyme, positive colony is carried out to sequence verification, result shows that the described Cry1A.105 nucleotides sequence inserting in recombinant cloning vector DBN01-T classifies the nucleotide sequence shown in SEQ ID NO:2 in sequence table as, and Cry1A.105 nucleotide sequence correctly inserts.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, synthetic described Cry2Ab nucleotide sequence is connected into cloning vector pGEM-T upper, obtain recombinant cloning vector DBN02-T, wherein, Cry2Ab is Cry2Ab nucleotide sequence (SEQ ID NO:3).Enzyme is cut with Cry2Ab nucleotide sequence described in sequence verification recombinant cloning vector DBN02-T and is correctly inserted.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, synthetic described Vip3A nucleotide sequence is connected into cloning vector pGEM-T upper, obtain recombinant cloning vector DBN03-T, wherein, Vip3A is Vip3A nucleotide sequence (SEQ ID NO:4).Enzyme is cut with Vip3A nucleotide sequence described in sequence verification recombinant cloning vector DBN03-T and is correctly inserted.

2, build the recombinant expression carrier that contains Cry1A.105 gene

With restriction enzyme NcoI and HindIII respectively enzyme cut recombinant cloning vector DBN01-T and expression vector DBNBC-01(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)), the Cry1A.105 nucleotide sequence fragment cutting is inserted between the NcoI and HindIII site of expression vector DBNBC-01, it is well-known to those skilled in the art utilizing conventional enzyme blanking method carrier construction, be built into recombinant expression carrier DBN100032, it builds flow process (Kan: kanamycin gene as shown in Figure 2; RB: right margin; Ubi: corn Ubiquitin(ubiquitin) gene promoter (SEQ ID NO:5); Cry1A.105:Cry1A.105 nucleotide sequence (SEQ ID NO:2); Nos: the terminator of rouge alkali synthetase gene (SEQID NO:6); PMI: Phophomannose isomerase gene (SEQ ID NO:7); LB: left margin).

Recombinant expression carrier DBN100032 is transformed to Escherichia coli T1 competent cell by heat shock method, and its hot shock condition is: 50 μ l Escherichia coli T1 competent cells, 10 μ l plasmid DNA (recombinant expression carrier DBN100032), 42 ℃ of water-baths 30 seconds; 37 ℃ of shaken cultivation 1 hour (under 100rpm rotating speed, shaking table shakes); Then at LB solid plate (the tryptone 10g/L containing 50mg/L kanamycin (Kanamycin), yeast extract 5g/L, NaCl10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) above under 37 ℃ of conditions of temperature, cultivate 12 hours, picking white colony, at LB liquid nutrient medium (tryptone 10g/L, yeast extract 5g/L, NaCl10g/L, kanamycin 50mg/L, adjusts pH to 7.5 with NaOH) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid.The plasmid of extraction is cut to rear evaluation with restriction enzyme NcoI and HindIII enzyme, and by the positive colony evaluation of checking order, result show the nucleotides sequence of recombinant expression carrier DBN100032 between NcoI and HindIII site classify sequence table as in nucleotide sequence, i.e. Cry1A.105 nucleotide sequence shown in SEQ ID NO:2.

According to the method for above-mentioned structure recombinant expression carrier DBN100032, by NcoI and HindIII, NcoI and SpeI respectively enzyme cut described Cry1A.105 nucleotide sequence and the Cry2Ab nucleotide sequence that recombinant cloning vector DBN01-T and DBN02-T cut and insert expression vector DBNBC-01, obtain recombinant expression carrier DBN100076.Enzyme cut with sequence verification recombinant expression carrier DBN100076 in nucleotide sequence containing nucleotide sequence shown in SEQ ID NO:2 in promising sequence table and SEQ ID NO:3, be Cry1A.105 nucleotide sequence and Cry2Ab nucleotide sequence, described Cry1A.105 nucleotide sequence can be connected described Ubi promotor and Nos terminator with described Cry2Ab nucleotide sequence.

According to the method for above-mentioned structure recombinant expression carrier DBN100032, by NcoI and HindIII, ScaI and SpeI respectively enzyme cut described Cry1A.105 nucleotide sequence and the Vip3A nucleotide sequence that recombinant cloning vector DBN01-T and DBN03-T cut and insert expression vector DBNBC-01, obtain recombinant expression carrier DBN100029.Enzyme cut with sequence verification recombinant expression carrier DBN100029 in nucleotide sequence containing nucleotide sequence shown in SEQ ID NO:2 in promising sequence table and SEQ ID NO:4, be Cry1A.105 nucleotide sequence and Vip3A nucleotide sequence, described Cry1A.105 nucleotide sequence can be connected described Ubi promotor and Nos terminator with described Vip3A nucleotide sequence.

3, recombinant expression carrier transforms Agrobacterium

Oneself is transformed into Agrobacterium LBA4404 (Invitrgen through building correct recombinant expression carrier DBN100032, DBN100076 and DBN100029 by liquid nitrogen method, Chicago, USA, CAT:18313-015) in, its conversion condition is: 100 μ L Agrobacterium LBA4404s, 3 μ L plasmid DNA (recombinant expression carrier), be placed in liquid nitrogen 10 minutes, 37 ℃ of tepidarium 10 minutes, Agrobacterium LBA4404 after transforming is inoculated in LB test tube in 28 ℃ of temperature, rotating speed is under 200rpm condition, to cultivate 2 hours, be applied on the LB flat board that contains the rifampin (Rifampicin) of 50mg/L and the kanamycin (Kanamycin) of 100mg/L until grow positive monoclonal, its plasmid is cultivated and extracted to picking monoclonal, with restriction enzyme A hdI and XhoI to recombinant expression carrier DBN100032, DBN100076 and DBN100029 enzyme carry out enzyme after cutting and cut checking, result shows recombinant expression carrier DBN100032, DBN100076 and DBN100029 structure are entirely true.

The 3rd embodiment, proceed to acquisition and the checking of the milpa of Cry1A.105 gene

1, obtain the milpa that proceeds to Cry1A.105 gene

The Agrobacterium infestation method adopting according to routine, the corn variety of aseptic culture is combined to 31(Z31) rataria and the second embodiment in Agrobacterium described in 3 cultivate altogether, with by the 2 recombinant expression carrier DBN100032 that build in the second embodiment, T-DNA(in DBN100076 and DBN100029 comprises the promoter sequence of corn Ubiquitin gene, Cry1A.105 nucleotide sequence, Cry2Ab nucleotide sequence, Vip3A nucleotide sequence, PMI gene and Nos terminator sequence) be transferred in maize chromosome group, obtained the milpa that proceeds to Cry1A.105 nucleotide sequence, proceed to the milpa and the milpa that proceeds to Cry1A.105-Vip3A nucleotide sequence of Cry1A.105-Cry2Ab nucleotide sequence, in contrast with wild type milpa simultaneously.

For agriculture bacillus mediated corn, transform, briefly, separated immature rataria from corn, with agrobacterium suspension, contact rataria, wherein Agrobacterium can be passed to Cry1A.105 nucleotide sequence, Cry2Ab nucleotide sequence and/or Vip3A nucleotide sequence at least one cell (step 1: infect step) of one of rataria, in this step, rataria preferably immerses agrobacterium suspension (OD ₆₆₀=0.4-0.6, infect medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 68.5g/L, glucose 36g/L, acetosyringone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH5.3)) in, to start, inoculate.Rataria and Agrobacterium are cultivated one period (3 days) (step 2: be total to incubation step) altogether.Preferably, rataria after infecting step at solid culture medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 20g/L, glucose 10g/L, acetosyringone (AS) 100mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) is upper to be cultivated.After this common cultivation stage, can there is optionally " recovery " step.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) in, at least exist a kind of oneself know the antibiotic (cephalosporin) that suppresses Agrobacterium growth, the selective agent (step 3: recovering step) of not adding vegetable transformant.Preferably, rataria is cultivated on the solid culture medium of selective agent having antibiotic but do not have, and take and eliminates Agrobacterium and provide convalescence as infected cell.Then, the rataria of inoculation is containing the transformed calli (step 4: select step) of cultivating and selecting growing on the medium of selective agent (mannose).Preferably, rataria is having the screening solid culture medium of selective agent (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 5g/L, mannose 12.5g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation, causes the cell selective growth transforming.Then, callus regeneration becomes plant (step 5: regeneration step), preferably, above cultivate with aftergrowth at solid culture medium (MS differential medium and MS root media) at the callus containing growing on the medium of selective agent.

The resistant calli that screening obtains is transferred to described MS differential medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, mannose 5g/L, agar 8g/L, pH5.8) upper, cultivate differentiation at 25 ℃.Differentiation seedling is out transferred to described MS root media (MS salt 2.15g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH5.8) on, at 25 ℃, be cultured to about 10cm high, move to hot-house culture to solid.In greenhouse, cultivate 16 hours every day at 28 ℃, then at 20 ℃, cultivate 8 hours.

2, with TaqMan checking, proceed to the milpa of Cry1A.105 gene

Get respectively and proceed to the milpa of Cry1A.105 nucleotide sequence, the about 100mg of blade of milpa that proceeds to the milpa of Cry1A.105-Cry2Ab nucleotide sequence and proceed to Cry1A.105-Vip3A nucleotide sequence as sample, with the DNeasy Plant Maxi Kit of Qiagen, extract its genomic DNA, by Taqman fluorescence probe quantitative PCR method, detect the copy number of Cry1A.105 gene, Cry2Ab gene and Vip3A gene.In contrast with wild type milpa, detect according to the method described above analysis simultaneously.3 repetitions are established in experiment, average.

The concrete grammar that detects Cry1A.105 gene copy number is as follows:

Step 11, get each 100mg of blade that proceeds to the milpa of Cry1A.105 nucleotide sequence, the milpa that proceeds to Cry1A.105-Cry2Ab nucleotide sequence, the milpa that proceeds to Cry1A.105-Vip3A nucleotide sequence and wild type milpa respectively, in mortar, with liquid nitrogen, be ground into homogenate respectively, each sample is got 3 repetitions;

The DNeasy Plant Mini Kit of step 12, use Qiagen extracts the genomic DNA of above-mentioned sample, and concrete grammar is with reference to its product description;

Step 13, use NanoDrop2000(Thermo Scientific) measure the genomic DNA concentration of above-mentioned sample;

Step 14, adjust above-mentioned sample genomic DNA concentration to same concentration value, the scope of described concentration value is 80-100ng/ μ l;

Step 15, adopt Taqman fluorescence probe quantitative PCR method to identify the copy number of sample, using through the sample of identifying known copy number as standard items, with the sample of wild type milpa in contrast, 3 repetitions of each sample, get its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:

Following primer and probe are used for detecting Cry1A.105 nucleotide sequence:

Primer 1(CF1): GCGCATCCAGTTCAACGAC is as shown in SEQ ID NO:8 in sequence table;

Primer 2 (CR1): GTTCTGGACGGCGAAGAGTG is as shown in SEQ ID NO:9 in sequence table;

Probe 1(CP1): TGAACAGCGCCCTGACCACCG is as shown in SEQ ID NO:10 in sequence table;

Following primer and probe are used for detecting Cry2Ab nucleotide sequence:

Primer 3(CF2): CTGATACCCTTGCTCGCGTC is as shown in SEQ ID NO:11 in sequence table;

Primer 4(CR2): CACTTGGCGGTTGAACTCCTC is as shown in SEQ ID NO:12 in sequence table;

Probe 2(CP2): CGCTGAGCTGACGGGTCTGCAAG is as shown in SEQ ID NO:13 in sequence table;

Following primer and probe are used for detecting Vip3A nucleotide sequence:

Primer 5(VF1): ATTCTCGAAATCTCCCCTAGCG is as shown in SEQ ID NO:14 in sequence table;

Primer 6(VR1): GCTGCCAGTGGATGTCCAG is as shown in SEQ ID NO:15 in sequence table;

Probe 3(VP1): CTCCTGAGCCCCGAGCTGATTAACACC is as shown in SEQ ID NO:16 in sequence table;

PCR reaction system is:

Each 45 μ l of every kind of primer that described 50 * primer/probe mixture comprises 1mM concentration, the probe 50 μ l of 100 μ M concentration and 860 μ l1 * TE buffer solution, and at 4 ℃, be housed in amber test tube.

PCR reaction condition is:

Utilize SDS2.3 software (Applied Biosystems) to analyze data.

Experimental result shows, all oneself is incorporated in the chromosome set of detected milpa for Cry1A.105 nucleotide sequence, Cry1A.105-Cry2Ab nucleotide sequence and Cry1A.105-Vip3A nucleotide sequence, and proceed to the milpa of Cry1A.105 nucleotide sequence, the milpa that proceeds to the milpa of Cry1A.105-Cry2Ab nucleotide sequence and proceed to Cry1A.105-Vip3A nucleotide sequence has all obtained the transgenic corn plant that contains single copy Cry1A.105 gene.

The pest-resistant effect detection of the 4th embodiment, transgenic corn plant

By proceeding to the milpa of Cry1A.105 nucleotide sequence, the milpa that proceeds to Cry1A.105-Cry2Ab nucleotide sequence, the milpa that proceeds to Cry1A.105-Vip3A nucleotide sequence, wild type milpa and being accredited as not genetically modified milpa through Taqman, dichocrocis punctiferalis is carried out to pest-resistant effect detection.

Get respectively the milpa that proceeds to Cry1A.105 nucleotide sequence, proceed to the milpa of Cry1A.105-Cry2Ab nucleotide sequence, proceed to the milpa of Cry1A.105-Vip3A nucleotide sequence, wild type milpa and be accredited as the not genetically modified milpa fresh blade of (V3-V4 phase) through Taqman, clean and with gauze, the water on blade is blotted with aseptic water washing, then maize leaf is removed to vein, be cut into the strip of about 1cm * 4cm simultaneously, getting 1 strip blade after cutting puts on the filter paper of round plastic culture dish bottom, described filter paper is wetting with distilled water, in each culture dish, put the dichocrocis punctiferalis (newly hatched larvae) of 10 artificial feedings, after worm examination culture dish is added a cover, at temperature 25-28 ℃, relative moisture 70%-80%, under the condition of photoperiod (light/dark) 16:8, place after 3 days, according to dichocrocis punctiferalis larvae development progress, three indexs of lethality and blade injury rate, obtain resistance total points: total points=100 * lethality+[100 * lethality+90 * (just incubate borer population/connect worm sum)+60 * (just incubate-negative control borer population/connect worm sum)+10 * (negative control borer population/connect worm sum)]+100 * (1-blade injury rate).Proceed to totally 3 strains (S1, S2 and S3) of Cry1A.105 nucleotide sequence, proceed to totally 3 strains (S4, S5 and S6) of Cry1A.105-Cry2Ab nucleotide sequence, proceed to totally 3 strains (S7, S8 and S9) of Cry1A.105-Vip3A nucleotide sequence, through Taqman, be accredited as not genetically modified (NGM) totally 1 strain, (CK) of wild type be totally 1 strain; From each strain, select 3 strains to test, every strain repeats 6 times.Result is as shown in table 1 and Fig. 3.

The pest-resistant experimental result of table 1, transgenic corn plant inoculation dichocrocis punctiferalis

The result of table 1 shows: proceed to the milpa of Cry1A.105 nucleotide sequence, the raw total points of surveying of milpa that proceeds to the milpa of Cry1A.105-Cry2Ab nucleotide sequence and proceed to Cry1A.105-Vip3A nucleotide sequence all more than 280 minutes, part can reach full marks 300 minutes; And the raw total points of surveying that is accredited as not genetically modified milpa and wild type milpa through Taqman is generally about 30 minutes.

The result of Fig. 3 shows: compare with wild type milpa, proceed to the milpa of Cry1A.105 nucleotide sequence, the milpa that proceeds to the milpa of Cry1A.105-Cry2Ab nucleotide sequence and proceed to Cry1A.105-Vip3A nucleotide sequence can be caused the mortality of dichocrocis punctiferalis newly hatched larvae, and fraction survival larvae development progress is caused to great inhibition, after 3 days, larva substantially still incubates state in just, and proceed to the milpa of Cry1A.105 nucleotide sequence, the milpa that proceeds to Cry1A.105-Cry2Ab nucleotide sequence is only subject to utmost point slight damage substantially with the milpa that proceeds to Cry1A.105-Vip3A nucleotide sequence, it on blade, is only the damage of minute quantity Pinhole-shaped, its blade injury rate is all below 1%.

Proof proceeds to the activity that the milpa of Cry1A.105 nucleotide sequence, the milpa that proceeds to the milpa of Cry1A.105-Cry2Ab nucleotide sequence and proceed to Cry1A.105-Vip3A nucleotide sequence all demonstrate high resistance dichocrocis punctiferalis thus, thereby this activity is enough to that the growth of dichocrocis punctiferalis is produced to ill effect, it is controlled.

Above-mentioned experimental result also shows to proceed to the milpa of Cry1A.105 nucleotide sequence, the milpa that proceeds to the milpa of Cry1A.105-Cry2Ab nucleotide sequence and proceed to Cry1A.105-Vip3A nucleotide sequence is obviously because plant itself can produce Cry1A.105 albumen to the control of dichocrocis punctiferalis, so, well known to those skilled in the art, identical toxic action according to Cry1A.105 albumen to dichocrocis punctiferalis, can produce the harm that the transfer-gen plant that similarly can express Cry1A.105 albumen can be used in control dichocrocis punctiferalis.In the present invention, Cry1A.105 albumen includes but not limited to the Cry1A.105 albumen of given amino acid sequence in embodiment, transfer-gen plant can also produce the second insect-killing protein that at least one is different from Cry1A.105 albumen simultaneously, as Vip plastein, Cry plastein.

In sum, the Cry1A.105 albumen that the method for Control pests of the present invention can be killed dichocrocis punctiferalis by generation in plant corpus is controlled dichocrocis punctiferalis insect; Compare with cultural control method, chemical prevention and control method and biological control method that prior art is used; the present invention carries out the protection of the time of infertility, whole plant with the infringement of control dichocrocis punctiferalis insect to plant; and pollution-free, noresidue, effect stability, thorough, simple, convenient, economical.

It should be noted last that, above embodiment is only unrestricted in order to technical scheme of the present invention to be described, although the present invention is had been described in detail with reference to preferred embodiment, those of ordinary skill in the art is to be understood that, can modify or be equal to replacement technical scheme of the present invention, and not depart from the spirit and scope of technical solution of the present invention.

Claims (17)

1. a method of controlling dichocrocis punctiferalis insect, is characterized in that, comprises dichocrocis punctiferalis insect is contacted with Cry1A.105 albumen.

2. the method for control according to claim 1 dichocrocis punctiferalis insect, it is characterized in that, described Cry1A.105 albumen is present in the plant cell that produces described Cry1A.105 albumen, and described dichocrocis punctiferalis insect contacts with described Cry1A.105 albumen by the described plant cell of ingesting.

3. the method for control according to claim 2 dichocrocis punctiferalis insect, it is characterized in that, described Cry1A.105 albumen is present in the genetically modified plants that produce described Cry1A.105 albumen, described dichocrocis punctiferalis insect contacts with described Cry1A.105 albumen by the tissue of the described genetically modified plants that ingest, after contact, described dichocrocis punctiferalis insect growth is suppressed and finally causes death, to realize the control to dichocrocis punctiferalis harm plant.

4. the method for control dichocrocis punctiferalis insect according to claim 3, is characterized in that, described genetically modified plants can be in any breeding time.

5. the method for control dichocrocis punctiferalis insect according to claim 3, is characterized in that, the tissue of described genetically modified plants can be root, blade, stem stalk, tassel, female fringe, flower pesticide or filigree.

6. the method for control dichocrocis punctiferalis insect according to claim 3, is characterized in that, the described control that dichocrocis punctiferalis is endangered to plant is not because the change in plantation place changes.

7. the method for control dichocrocis punctiferalis insect according to claim 3, is characterized in that, the described control that dichocrocis punctiferalis is endangered to plant is not because the change of implantation time changes.

8. according to the method for the control dichocrocis punctiferalis insect described in claim 2 to 7 any one, it is characterized in that, described plant can be from corn, Chinese sorghum, grain, sunflower, castor-oil plant, ginger, cotton, peach, persimmon, walnut, Chinese chestnut, fig or pine tree.

9. according to the method for the control dichocrocis punctiferalis insect described in claim 2 to 8 any one, it is characterized in that, the step before described contact procedure is for planting the plant of the polynucleotides that contain the described Cry1A.105 albumen of encoding.

10. according to the method for the control dichocrocis punctiferalis insect described in claim 2 to 9 any one, it is characterized in that, the amino acid sequence of described Cry1A.105 albumen has the amino acid sequence shown in SEQ ID NO:1.

The method of 11. control dichocrocis punctiferalis insects according to claim 10, is characterized in that, the nucleotide sequence of described Cry1A.105 albumen has the nucleotide sequence shown in SEQ ID NO:2.

12. according to the method for the control dichocrocis punctiferalis insect described in claim 2 to 11 any one, it is characterized in that, described plant can also produce at least one the second nucleotide that is different from described Cry1A.105 albumen.

The methods of 13. control according to claim 12 dichocrocis punctiferalis insects, is characterized in that, described the second nucleotide can encode Cry class insect-killing protein, Vip class insect-killing protein, protease inhibitors, agglutinin, α-amylase or peroxidase.

The methods of 14. control according to claim 13 dichocrocis punctiferalis insects, is characterized in that, described the second nucleotide can encode Cry2Ab albumen or Vip3A albumen.

The method of 15. control dichocrocis punctiferalis insects according to claim 14, is characterized in that, described the second nucleotide comprises the nucleotide sequence shown in SEQ ID NO:3 or SEQ ID NO:4.

The method of 16. control dichocrocis punctiferalis insects according to claim 12, is characterized in that, described the second nucleotide is for suppressing the dsRNA of important gene in targeted insect insect.

17. 1 kinds of Cry1A.105 protein are controlled the purposes of dichocrocis punctiferalis insect.

Images