Embodiment
The present invention has carried out a large amount of previous works aspect Interferon, rabbit research.Interferon, rabbit to present discovery carries out information biology homology analysis and function prediction, avtive spot according to the interferon gene sequence of reporting in the pertinent literature, the difference that has compared several interferon medicines, design a kind of human interferon-alpha-2 b aminoacid sequence that can have high specific acitivity, and oppositely released a kind of recombinant human interferon alpha 2 b dna fragmentation (the described nucleotide sequence of sequence table SEQ ID NO.1).And according to inclined to one side preferendum of colibacillary codon and expression characterization, carry out the orthomutation transformation, obtain three kinds of recombinant human interferon alpha 2 b DNA fragments (sequence table SEQ ID NO.2, SEQ ID NO.4, the described nucleotide sequence of SEQ ID NO.6), respectively with three kinds of recombinantinterferon 2b sequence dna fragments with after carrier is connected, import host cell and express, obtain recombinant human interferon alpha 2 b dna fragmentation encoded protein matter (sequence table SEQ ID NO.3, SEQ ID NO.5, the described aminoacid sequence of SEQ ID NO.7).Its antiviral activity of recombinant human interferon alpha 2 b dna fragmentation encoded protein matter of the present invention is tens times of the natural Interferon, rabbit of people.Its anti-tumor activity is compared with the natural Interferon, rabbit of people, has higher antiproliferative activity.
At first by human interferon IFN α 2b gene being carried out the analysis of 26S Proteasome Structure and Function relation, selectivity is with human interferon receptors bind zone and result's after the radical amino acid replacement of avtive spot becomes other amino-acid residue analysis, selected 52,53,55,103,107,113,121,125,132,10 residues of 161 amino acids carry out directional transformation, use round pcr, constantly optimize PCR reaction system and reaction conditions, at first designed and synthesized rh-mIFN-1 (the described nucleotide sequence of sequence table SEQ IDNO.1), again according to gene fragment 52,53,55 and 103, the 107 amino acids nearer characteristics of being separated by, adopt the method for large primer PCR that it is carried out the mutagenesis of multidigit point, be docile and obedient preface and obtained rh-mIFN-2 and rh-mIFN-3 encoding gene, when obtaining rh-mIFN-2, utilize downstream primer that 161 are suddenlyd change, adopting overlapping extension rite-directed mutagenesis method at last is template with rh-mIFN-6, respectively to 113,121,125,132 amino acids residues carry out site-directed mutagenesis, have obtained rh-mIFN-4, rh-mIFN-5, rh-mIFN-6, rh-mIFN-7.By being checked order, rh-mIFN-7 determines finally to have obtained a kind of recombinant human interferon alpha 2 b dna fragmentation (the described nucleotide sequence of sequence table SEQ ID NO.6).
Then respectively with sequence table SEQ ID NO.2, SEQ ID NO.4, the described nucleotide sequence of SEQ ID NO.6 is connected on efficient expression vector pBPE172 or the pET 43.1a, recombinant vectors pBPE172-rh-mIFN or pET43.1a-rh-mIFN are carried out abduction delivering at expression bacterium E.coli.BL21, when selecting expression strain, we need select to express the more bacterial strain E.coli BL21 of its rare codon of corresponding identification tRNA, the expression-form that has compared recombinant vectors pBPE172-rh-mIFN or pET 43.1a-rh-mIFN at last, because the former has the EcolC1958-Tag fusion rotein, the latter has the Nus-tag fusion rotein, makes recombinant human interferon alpha 2 b dna fragmentation encoded protein matter (the described aminoacid sequence of sequence table SEQ ID NO.3 of the present invention, described aminoacid sequence of sequence table SEQ ID NO.5 and the described aminoacid sequence of sequence table SEQ ID NO.7) exist with the soluble proteins form.
And by to the selection of induction time, inducing temperature and inductor concentration, initial optimization the expression condition of engineering bacteria, at 30 ℃, IPTG concentration is 1mM, induces the expressing quantity height that obtains behind the 5h, the engineering bacteria good stability.
The present invention is further illustrated below in conjunction with specific embodiment.
Embodiment 1
A kind of recombinant human interferon alpha 2 b dna fragmentation, it is the described nucleotide sequence of sequence table SEQ ID NO.1.
The design of gene fragment with synthesize:
(1) the people source interferon alpha 2 b original series by National Center for Biotechnology Information (NCBI) database retrieval, and according to the interferon alpha 2 b aminoacid sequence of known listing, after summing up and analyze a large amount of documents about the interferon activity site, directed design a kind of recombinant human interferon alpha 2 b dna fragmentation (the described nucleotide sequence of sequence table SEQ ID NO.1);
(2) recombinant human interferon alpha 2 b dna fragmentation (the described nucleotide sequence of sequence table SEQ ID NO.1) is synthetic.
Contain 166 amino acid in the recombinant human interferon alpha 2 b, the length of its gene order is at 498bp.
Primer design is with synthetic:
(A1~A8), length is 60~80bp, and the overlapping region of adjacent primer is 12bp, and the Tm value is 50~60 ℃ of scopes according to the synthetic 8 pairs of primers of the described nucleotide sequence design of implementation sequence table SEQ ID NO.1.Design upstream primer ES and downstream primer HX, upstream primer ES introduces restriction enzyme site EcoRI, and downstream primer HX introduces restriction enzyme site HindIII;
Each primer sequence is as follows:
ES (straight line is a restriction enzyme site): CGC
GAATTCATGTGCGATCTGCCG (SEQ ID NO.8)
HX (straight line is a restriction enzyme site): GTC
AAGCTTTTCTTTGCTACGCAGTCTTTC (SEQ ID NO.9)
A1:
ATGTGCGATCTGCCGCAGACCCATAGCCTGGGCAGCCGTCGTACCCTGATGCTGC
TGGCCCAG(SEQ?ID?NO.10)
A2:
CTTCCTGCGGAAAGCCAAAATCATGACGATCTTTCAGGCAGCTAAACAGGCTAA
TACGACGCATCTGGGCCAGCAG(SEQ?ID?NO.11)
A3:
TTCCGCAGGAAGAATTTGGCAACCAGTTTCAGAAAGCGGAAACCATTCCGGTGC
TGCATGAAATGATTCAGCAGAT(SEQ?ID?NO.12)
A4:
GAATTTATCCAGCAGGGTTTCATCCCACGCCGCGCTGCTATCTTTGGTGCTAAAC
AGGTTGAAGATCTGCTGAATC(SEQ?ID?NO.13)
A5:
CTGGATAAATTCTATACCGAACTGTATCAGCAGCTGAACGATCTGGAAGCGTGC
GTGATTCAGGGCGTGGGCGTGA(SEQ?ID?NO.14)
A6:
GTGATGCGCTGAAAATATTTACGCACGGCCAGAATGCTATCTTCTTTCATCAGCG
GGGTTTCGGTCACGCCCACGC(SEQ?ID?NO.15)
A7:
TCAGCGCATCACCCTGTATCTGAAAGAAAAAAAATATAGCCCGTGCGCGTGGGA
AGTGGTGCGTGCGGAAATTATG(SEQ?ID?NO.16)
A8:
TTCTTTGCTACGCAGGCTTTCCTGCAGGTTGGTGCTCAGGCTAAAGCTACGCATA
ATTTCCGC(SEQ?ID?NO.17)
The pcr amplification of human interferon-alpha-2 b gene fragment:
The PCR reaction system:
10 * pfu Buffer (containing Mg2+15mM), 5 μ L
DNTP (each 2.5mM) 5 μ L
Upstream primer ES (20ng/ μ L) 2 μ L
Downstream primer HX (20ng/ μ L) 2 μ L
Each 0.2 μ L of primer A1~A8 (20ng/ μ L)
Ultrapure water 33.9 μ L
Pfu enzyme (5U/ μ L) 0.5 μ L
Reaction conditions: 95 ℃, 5min; 95 ℃, 1min, 55 ℃, 1min, 72 ℃, 1min, 35 circulations; 72 ℃, extend 10min, 4 ℃ of preservations.Electrophoresis checking PCR result's (see Fig. 1, swimming lane 1 is about 500bp) adopts PCR product purification test kit purified product, numbering rh-mIFN-1 (the described nucleotide sequence of sequence table SEQ ID NO.1), 4 ℃ of preservations.
Embodiment 2
A kind of recombinant human interferon alpha 2 b dna fragmentation, it is the described nucleotide sequence of sequence table SEQ ID NO.2.
Step is:
Utilize big primer amplification method that the 52nd, 53,55 amino acids are carried out rite-directed mutagenesis, design downstream primer HX2 161 amino acids of suddenling change simultaneously, thereby obtain recombinant interferon sequence rh-mIFN-2 (the described nucleotide sequence of sequence table SEQ ID NO.2);
Mutant primer design: (wavy line is the mutational site)
Mut2(5’---3’):TTC?ATG?CAG?CAC
AAT
CGC?TTT?CTG(SEQ?IDNO.18)
The design downstream primer:
HX2 (straight line is a restriction enzyme site): GTC
AAG CTTTTC TTT GCT ACG CAG
TTC (SEQID NO.19)
Detailed process is:
First round reaction system (cumulative volume is 100 μ L): with upstream primer ES (SEQ ID NO.8) and mutant primer Mut2 (SEQ ID NO.18) is primer, is template with rh-mIFN-1 (SEQ ID NO.1) sequence.
The PCR reaction conditions: 94 ℃, 4min, 1 circulation; 94 ℃, 40s, 60 ℃, 30s, 72 ℃, 30s, totally 24 circulations; 72 ℃, 5min, 1 circulation;
After first round PCR reaction finishes, in the above-mentioned reactant of 100 μ L, add:
DNTP (each 2.5mM) 6 μ L
Downstream primer HX2 (20ng/ μ L) 2 μ L
Pfu enzyme (5U/ μ L) 1 μ L
The PCR reaction conditions: 94 ℃, 40s, 68 ℃, 25s, 72 ℃, 1min, totally 10 circulations; 94 ℃, 40s, 55 ℃, 25s, 72 ℃, 1min, totally 12 circulations; 72 ℃, extend 1min, PCR reacts end, the electrophoresis checking (see Fig. 2, swimming lane 1 is among the figure. first round PCR product; Swimming lane 2 is. second takes turns the PCR product), adopt PCR product purification test kit purified product, numbering rh-mIFN-2 (the described nucleotide sequence of sequence table SEQ ID NO.2), 4 ℃ of preservations.
Embodiment 3
A kind of recombinant human interferon alpha 2 b dna fragmentation, it is the described nucleotide sequence of sequence table SEQ ID NO.4.
Step is:
After obtaining the rh-mIFN-2 target fragment, be template with this sequence again, adopt big primer method, 103,107 amino acids are carried out rite-directed mutagenesis, thereby obtain target sequence rh-mIFN-3 (the described nucleotide sequence of sequence table SEQ ID NO.4);
Mutant primer is as follows:
Mut3(5’---3’):CAG?CGG?GGT?TTC
CAC?GCC?CAC
CTGAAT?CAC?GCA(SEQ?ID?NO.20);
Carry out PCR, obtain product, (see Fig. 3, swimming lane 1 is a first round PCR product among the figure in the electrophoresis checking; Swimming lane 2 is second to take turns the PCR product) adopt PCR product purification test kit purified product, obtain numbering rh-mIFN-3 (the described nucleotide sequence of sequence table SEQ ID NO.4), 4 ℃ of preservations.
Embodiment 4
A kind of recombinant human interferon alpha 2 b dna fragmentation, it is the described nucleotide sequence of sequence table SEQ ID NO.6.
Step is:
(1) adopt overlapping extension PCR rite-directed mutagenesis method that the 132nd amino acids is carried out rite-directed mutagenesis, thereby obtain recombinant interferon sequence rh-mIFN-4, two mutant primers are as follows:
Mut132F:GCT?ATA?TTT?TTT?TTC
CAG?ATA?CAG(SEQ?ID?NO.21)
Mut132R:ACC?CTG?TAT?CTG
GAA?AAA?AAA?TAT(SEQ?ID?NO.22)
Overlapping extension need be carried out three PCR reactions of two-wheeled, and concrete steps are as follows:
Big fragment PCR reaction system:
10 * pfu Buffer (contains Mg
2+15mM) 10 μ L
DNTP (each 2.5mM) 8 μ L
Upstream primer ES (20ng/ μ L) 2 μ L
Mutant primer Mut132F (20ng/ μ L) 2 μ L
Template DNA rh-mIFN-3 (15ng/ μ L) 2 μ L
Ultrapure water 75 μ L
Pfu enzyme (5U/ μ L) 1 μ L
Big fragment PCR reaction conditions: 95 ℃, 5min; 95 ℃, 1min, 60 ℃, 1min, 72 ℃, 1min, 20 circulations; 72 ℃, extend 5min, 4 ℃ of preservations.Electrophoresis checking PCR result adopts PCR product purification test kit purified product, numbering CYL-B1,4 ℃ of preservations;
The PCR reaction system of small segment:
10 * pfu Buffer (contains Mg
2+15mM) 10 μ L
DNTP (each 2.5mM) 8 μ L
Downstream primer HX2 (20ng/ μ L) 2 μ L
Mutant primer Mut132R (20ng/ μ L) 2 μ L
Template DNA rh-mIFN-3 (15ng/ μ L) 2 μ L
Ultrapure water 75 μ L
Pfu enzyme (5U/ μ L) 1 μ L
The PCR reaction conditions: 95 ℃, 5min; 95 ℃, 1min, 55 ℃, 25s, 72 ℃, 30s, 20 circulations; 72 ℃, extend 5min, 4 ℃ of preservations.Electrophoresis checking PCR result adopts PCR product purification test kit purified product, numbering CYL-S1,4 ℃ of preservations;
Preparation reaction system (cumulative volume is 100 μ L): the gene correct with extension increasing sequence is template, gets the Eppendorf tube of 1 cleaning, adds successively:
10 * pfu Buffer (contains Mg
2+15mM) 10 μ L
DNTP (each 2.5mM) 8 μ L
Upstream primer ES (20ng/ μ L) 2 μ L
Downstream primer HX2 (20ng/ μ L) 2 μ L
CYL-B1 1μL
CYL-S1 1μL
Ultrapure water 75 μ L
Pfu enzyme (5U/ μ L) 1 μ L
The PCR reaction conditions: 95 ℃, 5min; 95 ℃, 1min, 55 ℃, 1min, 72 ℃, 1min, 35 circulations; 72 ℃, 10min, 4 ℃ of preservations.The electrophoresis checking is adopted PCR product purification test kit purified product, numbering rh-mIFN-4,4 ℃ of preservations;
(2) 113 of rh-mIFN-5 carry out rite-directed mutagenesis
With rh-mIFN-4 is template, and two mutant primer designs are as follows:
Mut113F:AAT?GCT?ATC?TTC
CAT?CAG?CGG(SEQ?ID?NO.23)
Mut113R:ACC?CCG?CTG?ATG
GAA?GATAGC(SEQ?ID?NO.24)
PCR process such as step (1) obtain rh-mIFN-5;
(3) 121 of rh-mIFN-6 carry out rite-directed mutagenesis
With rh-mIFN-5 is template, and the mutant primer design is as follows:
Mut121F:CTG?AAA?ATA?TTT
CAC?GGC?CAG?AAT(SEQ?ID?NO.25)
Mut121R:ATT?CTG?GCC?GTG
AAA?TAT?TTT?CAG(SEQ?ID?NO.26)
PCR process such as step (1) obtain rh-mIFN-6;
(4) 125 of rh-mIFN-7 carry out rite-directed mutagenesis
With rh-mIFN-6 is template, and the mutant primer design is as follows:
Mut125F:CAG?GGT?GAT?GCG
AAA?ATA?TTT?TTT?CAC(SEQ?ID?NO.27)
Mut125R:AAA?AAA?TAT?TTT
CGC?ATC?ACC?CTG(SEQ?ID?NO.28)
PCR process such as step (1) have obtained a kind of recombinant human interferon alpha 2 b dna fragmentation rh-mIFN-7, are the described nucleotide sequences of sequence table SEQ ID NO.6.(see Fig. 4, swimming lane 1 is a small segment among the figure; Swimming lane 2 is big fragment; Swimming lane 3 is overlapping extension products rh-mIFN-7).
Embodiment 5
The plasmid that contains the recombinant human interferon alpha 2 b dna fragmentation of sequence table SEQ ID NO.2
(pBPE172-rh-mIFN-2) structure:
According to intestinal bacteria EcolC1958 gene order, design two primers, introduce restriction enzyme site XbaI and EcoRI respectively, with the e. coli dna is template, carries out pcr amplification, obtains amplified production EcolC1958, with XbaI and EcoRI double digestion plasmid pET28a and amplified production EcolC1958, purifying enzyme is cut product, connects carrier construction pBPE172;
With recombinant interferon rh-mIFN-2 gene fragment EcoRI and the HindIII double digestion that PCR obtained, reaction system is EcoRI and each 1 μ l of HindIII, DNA product 10 μ l, 10 * M Buffer, 2 μ l, sterilized water is supplied 20 μ l, 37 ℃ of reaction 3h, reaction product EZ-10 Spin Column DNA Gel Extraction Kit Cat purifying (purification step is complied with the step operation according to the test kit explanation).Equally, with EcoRI and HindIII double digestion pBPE172 plasmid, purifying enzyme is cut product.
PBPE172 endonuclease bamhi and recombinant interferon rh-mIFN-2 gene fragment are carried out agarose electrophoresis, after the estimation concentration, mix by 3: 1 volumetric molar concentrations, add equal-volume DNA Ligation Kit Ver 2.0 ligase enzymes, 16 ℃ connect 1h.
To connect product Transformed E .coli DH5 α competent cell, mixing gently, ice bath 30min, 42 ℃ of water-bath thermal shock 90s, place in the trash ice rapidly and leave standstill 2min, add 400 μ l LB liquid nutrient mediums (not containing Amp) then, 37 ℃ of shaking tables leave standstill 50min, and centrifugal 1 minute of 5000rpm/min abandons supernatant, add fresh LB liquid nutrient medium 200 μ l, be uniformly coated on the LB solid medium that contains kantlex, 37 ℃ of overnight incubation were chosen single bacterium colony in second day, extract plasmid with alkaline process and carry out the double digestion checking, after order-checking correctly is expression plasmid pBPE172-rh-mIFN-2.
Embodiment 6
The plasmid that contains the recombinant human interferon alpha 2 b dna fragmentation of sequence table SEQ ID NO.4
(pBPE172-rh-mIFN-3) structure.Step is with embodiment 5.
Embodiment 7
The structure of plasmid (pBPE172-rh-mIFN-7) that contains the recombinant human interferon alpha 2 b dna fragmentation of sequence table SEQ ID NO.6.Step is with embodiment 5.See Fig. 5.
Embodiment 8
Expression vector also can select the pBPE172 in the pET 43.1a alternate embodiment 5, constructs expression vector pET43.1a-rh-mIFN-2.
Embodiment 9
Expression vector also can select the pBPE172 in the pET 43.1a alternate embodiment 6, constructs expression vector pET43.1a-rh-mIFN-3.
Embodiment 10
Expression vector also can select the pBPE172 in the pET 43.1a alternate embodiment 7, constructs expression vector pET43.1a-rh-mIFN-7.
See Fig. 6, among the figure, swimming lane 6 is pET 43.1a-rh-mIFN-2, and swimming lane 8 is pET 43.1a-rh-mIFN-3, and swimming lane 22 is pET 43.1a-rh-mIFN-7.
Embodiment 11
The preparation of recombinant human interferon alpha 2 b dna fragmentation encoded protein matter (sequence table SEQ ID NO.3, SEQ ID NO.5, the described aminoacid sequence of SEQ ID NO.7).
The separation and purification of a, recombinant human interferon alpha 2 b:
(1) abduction delivering:
PBPE172-rh-mIFN-2, pBPE172-rh-mIFN-3 and the pBPE172-rh-mIFN-7 plasmid of correctly reorganization are transformed expression strain E.coli.BL21 competent cell respectively, mixing gently, ice bath 30min, 42 ℃ of water-bath thermal shock 90s, place in the trash ice rapidly and leave standstill 2min, add 1ml LB liquid nutrient medium (not containing microbiotic) then, 37 ℃ leave standstill 45min, centrifugal 1 minute of 5000rpm/min, abandon supernatant, add fresh LB liquid nutrient medium 200 μ l, be uniformly coated on and contain on the biorefractive LB solid medium, 37 ℃ of overnight incubation are as kind of a daughter bacteria.
(2) thalline results
To plant daughter bacteria and insert in the 5ml LB liquid nutrient medium (containing paraxin and penbritin) 37 ℃ of recoveries of spending the night.Then the bacterium liquid of recovering was inoculated in the 50ml LB liquid nutrient medium by 1: 100 and (contains paraxin and penbritin), 37 ℃ of cultivation OD
600Be 0.5-0.6, add 1mM IPTG inducing culture, 30 ℃ of abduction delivering 5h.With refrigerated centrifuge 8000rpm, 4 ℃ of following centrifugal 10min, collect thalline.
(3) carrying out ultrasonic bacteria breaking
PBS (pH8.0) with 1/10 volume suspends with the thalline collected, puts on ice, uses ultrasonic degradation, and the employing power level is 6~7, and super 10s stops 10s, totally 30 times.When lysate viscosity diminishes, when clarifying substantially, illustrate that thalline is broken substantially.After the basic fragmentation, with broken liquid at 12000rpm, 4 ℃ of centrifugal 10min, cleer and peaceful precipitation collections in, precipitation usefulness equal-volume PBS suspension, freezing preservation, SDS-PAGE electrophoretic analysis.
(4) SDS-PAGE electrophoretic analysis
Carry out electrophoresis according to following steps:
Sample preparation
Get the each several part sample of an amount of volume, comprise before inducing and cleer and peaceful precipitation is gone up in the thalline after inducing, ultrasonic back, add 5 * SDS electrophoretic buffer of 1/5 volume.100 ℃ of heating in water bath 10min make the abundant sex change of albumen.
The gel preparation
The preparation of 12% separation gel: 4ml A liquid, 3.5ml B liquid, 2.5ml ultrapure water, 50 μ L10% Ammonium Persulfate 98.5s, 5 μ LTEMED.
4 * concentrate glue to prepare: 0.67ml A liquid, 1ml C liquid, 2.3ml ultrapure water, 30 μ L10% ammonium persulphates, 5 μ L TEMED.
After adding TEMED, mixing immediately, encapsulating.
Last sample
After the PAGE gelling is solid, add electrophoretic buffer, last sample in the electrophoresis chamber.
Electrophoresis
Earlier use low voltage during electrophoresis, first 150V, treat that sample enters separation gel after, voltage is brought up to 180V, until tetrabromophenol sulfonphthalein till the bottom of glue.
Dyeing
After electrophoresis finishes, peel separation glue, bubble is gone in the coomassie brilliant blue staining liquid immediately, slowly shake 30min on the shaking table, change destainer flushing twice then, about at every turn 45min, the scanning of dyeing back, confirm to have target stripe, do with reference to the expression amount of estimation specificity product (sequence table SEQ ID NO.3, SEQ ID NO.5, the described aminoacid sequence of SEQ ID NO.7) and the ratio in bacterial protein thereof with standard Marker.
(5) supernatant is crossed column purification:
Resin is added in the chromatography column binding buffer liquid (20mmol/L sodium phosphate; 500mmol/L sodium-chlor; PH7.8) drain into the top, make resin precipitated to the bottom.With the cell pyrolysis liquid supernatant upper prop that obtains, adjust flow velocity and be 10 column volumes per hour, about 3~4 seconds one.Binding buffer liquid with 6 times of column volumes is washed post.With lavation buffer solution (20mmol/L sodium phosphate; 500mmol/L sodium-chlor; PH6.0) wash post, the light absorption value under effluent liquid 280nm is approximately the damping fluid of 20 times of column volumes less than 0.01.Imidazoles elution buffer (20mmol/L sodium phosphate with the 100mmol/L of 6 column volumes; 500mmol/L sodium-chlor; The 100mmol/L imidazoles; PH7.8), the albumen of elution of bound.Substep is collected albumen, and every part of 1ml detects the light absorption value under the 280nm.
The fermentation optimization of b, recombinant human interferon alpha 2 b:
(1) optimization of inducing temperature
Shake at 3 250ml and (to contain 50ml LB liquid nutrient medium) in the bottle bacterium is expressed in inoculation respectively, 37 ℃ are cultured to OD
600Be about 0.6, the IPTG that adds final concentration 1mM induces, and induces at 25 ℃, 30 ℃, 37 ℃ respectively, continues to cultivate 5 hours, takes out and shakes bottle, at 8000rpm, 4 ℃ of centrifugal 10min, collects thalline, sampling analysis with refrigerated centrifuge.
(2) optimization of induction time
Bacterium is expressed in inoculation as stated above, and 37 ℃ of shake-flask culture are to OD
600When being 0.6 left and right sides, add the IPTG of 1mM, under 30 ℃, induce, at 1h, 2h, 3h, 4h and 5h sampling electrophoresis, analyze of the influence of different induction times respectively expressing quantity.
(3) inductor concentration determines
Bacterium is expressed in inoculation as stated above, and 37 ℃ of shake-flask culture are to OD
600When being 0.6 left and right sides, add the IPTG of 0.1mM, 0.5mM, 1mM, induce under 30 ℃, the sampling electrophoresis is analyzed the influence of different inductor concentration to expressing quantity.
Conclusion:
Be optimized from inducing temperature, induction time and inductor concentration, determine that tentatively the fermentation expression condition is 30 ℃, IPTG concentration is 1mM, induces 5h.
(also can substitute the alternative pBPE172-rh-mIFN-7 of pBPE172-rh-mIFN-2, pET 43.1a-rh-mIFN-3 alternative pBPE172-rh-mIFN-3, pET 43.1a-rh-mIFN-7 and carry out abduction delivering) with pET 43.1a-rh-mIFN-2
Embodiment 12
The active mensuration of recombinant human interferon alpha 2 b of the present invention's preparation
(1) antiviral activity detects:
Carry out antiviral activity with WISH cell/VSV system and detect, calculate its antiviral activity by standard method.
The result is:
The natural Interferon, rabbit of people is 1.0 * 10
8IU/mg.The activity of three kinds of recombinant human interferon alpha 2 bs (sequence table SEQ ID NO.3, SEQ ID NO.5, the described aminoacid sequence of SEQ ID NO.7) that the present invention is prepared is respectively 8.0 * 10
8IU/mg, 3.0 * 10
9IU/mg, 5 * 10
9IU/mg, its antiviral activity are respectively 8 times, 30 times and 50 times of the natural Interferon, rabbit of people.
(2) anti-tumor activity detects:
With the A549 cell as target cell, detect the anti-tumor activity of the prepared three kinds of recombinant human interferon alpha 2 bs (sequence table SEQ ID NO.3, SEQ ID NO.5, the described aminoacid sequence of SEQ ID NO.7) of the present invention with mtt assay, with the A549 cell as target cell, in contrast with the natural Interferon, rabbit of people.
The result is: with the natural Interferon, rabbit of people and its antiproliferative activity of α 2b measurement of identical activity (antiviral), three kinds of prepared recombinant human interferon alpha 2 bs of the present invention are compared with the natural Interferon, rabbit of people, all have higher antiproliferative activity.
<120〉recombinant human interferon alpha 2 b dna fragmentation and encoded protein matter
Gln?Met?Arg?Arg?Ile?Ser?Leu?Phe?Ser?Cys?Leu?Lys?Asp?Arg?His?Asp?Phe?Gly?Phe?Pro 40
Gln?Glu?Glu?Phe?Gly?Asn?Gln?Phe?Gln?Lys?Ala?Gln?Ala?Ile?Ser?Val?Leu?His?Glu?Met 60
Ile?Gln?Gln?Ile?Phe?Asn?Leu?Phe?Ser?Thr?Lys?Asp?Ser?Ser?Ala?Ala?Trp?Asp?Glu?Thr 80
Ile?Gln?Gly?Val?Gly?Val?Thr?Glu?Thr?Pro?Leu?Met?Lys?Glu?Asp?Ser?Ile?Leu?Ala?Val 120
Arg?Lys?Tyr?Phe?Gln?Arg?Ile?Thr?Leu?Tyr?Leu?Lys?Glu?Lys?Lys?Tyr?Ser?Pro?Cys?Ala 140
Trp?Glu?Val?Val?Arg?Ala?Glu?Ile?Met?Arg?Ser?Phe?Ser?Leu?Ser?Thr?Asn?Leu?Gln?Glu 160
Gln?Met?Arg?Arg?Ile?Ser?Leu?Phe?Ser?Cys?Leu?Lys?Asp?Arg?His?Asp?Phe?Gly?Phe?Pro 40
Gln?Glu?Glu?Phe?Gly?Asn?Gln?Phe?Gln?Lys?Ala?Gln?Ala?Ile?Ser?Val?Leu?His?Glu?Met 60
Ile?Gln?Gln?Ile?Phe?Asn?Leu?Phe?Ser?Thr?Lys?Asp?Ser?Ser?Ala?Ala?Trp?Asp?Glu?Thr 80
Ile?Gln?Glu?Val?Gly?Val?Glu?Glu?Thr?Pro?Leu?Met?Lys?Glu?Asp?Ser?Ile?Leu?Ala?Val 120
Arg?Lys?Tyr?Phe?Gln?Arg?Ile?Thr?Leu?Tyr?Leu?Lys?Glu?Lys?Lys?Tyr?Ser?Pro?Cys?Ala 140
Trp?Glu?Val?Val?Arg?Ala?Glu?Ile?Met?Arg?Ser?Phe?Ser?Leu?Ser?Thr?Asn?Leu?Gln?Glu 160
Gln?Met?Arg?Arg?Ile?Ser?Leu?Phe?Ser?Cys?Leu?Lys?Asp?Arg?His?Asp?Phe?Gly?Phe?Pro 40
Gln?Glu?Glu?Phe?Gly?Asn?Gln?Phe?Gln?Lys?Ala?Gln?Ala?Ile?Ser?Val?Leu?His?Glu?Met 60
Ile?Gln?Gln?Ile?Phe?Asn?Leu?Phe?Ser?Thr?Lys?Asp?Ser?Ser?Ala?Ala?Trp?Asp?Glu?Thr 80
Ile?Gln?Glu?Val?Gly?Val?Glu?Glu?Thr?Pro?Leu?Met?Asn?Glu?Asp?Ser?Ile?Leu?Ala?Val 120
Lys?Lys?Tyr?Phe?Arg?Arg?Ile?Thr?Leu?Tyr?Leu?Thr?Glu?Lys?Lys?Tyr?Ser?Pro?Cys?Ala 140
Trp?Glu?Val?Val?Arg?Ala?Glu?Ile?Met?Arg?Ser?Phe?Ser?Leu?Ser?Thr?Asn?Leu?Gln?Glu 160