WO2024128804A1 - Sars-cov-2 바이러스 백신 - Google Patents

Sars-cov-2 바이러스 백신 Download PDF

Info

Publication number
WO2024128804A1
WO2024128804A1 PCT/KR2023/020554 KR2023020554W WO2024128804A1 WO 2024128804 A1 WO2024128804 A1 WO 2024128804A1 KR 2023020554 W KR2023020554 W KR 2023020554W WO 2024128804 A1 WO2024128804 A1 WO 2024128804A1
Authority
WO
WIPO (PCT)
Prior art keywords
virus
cov
sars
eid
beta
Prior art date
Application number
PCT/KR2023/020554
Other languages
English (en)
French (fr)
Inventor
김덕환
정제현
Original Assignee
주식회사 카브
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 카브 filed Critical 주식회사 카브
Publication of WO2024128804A1 publication Critical patent/WO2024128804A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/155—Paramyxoviridae, e.g. parainfluenza virus
    • A61K39/17—Newcastle disease virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/215—Coronaviridae, e.g. avian infectious bronchitis virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/18011—Paramyxoviridae
    • C12N2760/18111—Avulavirus, e.g. Newcastle disease virus
    • C12N2760/18121—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/18011—Paramyxoviridae
    • C12N2760/18111—Avulavirus, e.g. Newcastle disease virus
    • C12N2760/18122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/18011—Paramyxoviridae
    • C12N2760/18111—Avulavirus, e.g. Newcastle disease virus
    • C12N2760/18134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/18011—Paramyxoviridae
    • C12N2760/18111—Avulavirus, e.g. Newcastle disease virus
    • C12N2760/18141—Use of virus, viral particle or viral elements as a vector
    • C12N2760/18143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • the present invention relates to a virus inserting the spike gene of SARS-CoV-2 beta variant into the pK148/08 vector made from K148/08, a Newcastle Disease Virus, and a vaccine containing the same.
  • SARS-CoV-2 belongs to the beta coronavirus genus and is a single positive-strand RNA virus with a gene size of 29.8 to 30 kb.
  • the spike is the most important. It has the role of recognizing cellular receptors, binding to the cell membrane, and invading the inside of the cell.
  • the RBD (Receptor binding domain) of the spike protein plays a role in recognizing receptors on target cells and is one of the main targets of SARS-CoV-2 neutralizing antibodies.
  • the present inventors made extensive research efforts to develop a vaccine against the SARS-CoV-2 virus.
  • the spike protein of the SARS-CoV-2 beta mutant virus is inserted and expressed in the gene of K148/08, a strain of the low-pathogenic Newcastle disease virus, based on reverse genetics technology, a vaccine is effective against both Newcastle disease and the SARS-CoV-2 virus.
  • the present invention was completed.
  • the object of the present invention is the nucleocapsid protein (NP), phosphoprotein (P), matrix (M), fusion protein (F), and hemagglutinin protein of Newcastle disease virus K148/08 deposited with accession number KCTC 11570BP.
  • a spike of the SARS-CoV-2 beta variant virus comprising a nucleotide sequence encoding the proteins of laminidase (HN) and polymerase (L), and between the nucleotide sequences encoding the P protein and the M protein. (Spike) To provide a recombinant vector containing a nucleotide sequence encoding a protein.
  • Another object of the present invention is to provide a recombinant Newcastle disease virus prepared from the above vector.
  • Another object of the present invention is to provide a preventive vaccine composition against SARS-CoV-2 virus, Newcastle disease virus, or a combination thereof, comprising the recombinant Newcastle disease virus or an antigen purified therefrom.
  • the present invention provides inventions 1 to 16 below.
  • NP Nucleocapsid protein
  • P phosphoprotein
  • M matrix
  • F fusion protein
  • HN hemagglutinin neuraminidase
  • a recombinant vector comprising a nucleotide sequence encoding the spike protein of the SARS-CoV-2 beta variant virus between the nucleotide sequences encoding the P protein and the M protein.
  • the nucleotide sequence encoding the spike protein of the SARS-CoV-2 beta variant virus includes a Kozak sequence upstream of the gene encoding the spike protein. Phosphorus, recombinant vector.
  • nucleotide sequence encoding the spike protein of the SARS-CoV-2 beta variant virus has a Kozak sequence and NCR (non) upstream of the gene encoding the spike protein.
  • Newcastle disease virus 8. The recombinant Newcastle disease virus according to 7, wherein the Newcastle disease virus expresses the SARS-CoV-2 virus spike protein on its surface.
  • the SARS-CoV-2 virus is a SARS-CoV-2 beta mutant virus, a SARS-CoV-2 delta mutant virus, or a combination thereof, a SARS-CoV-2 virus, Newcastle disease virus, or a prophylactic vaccine composition for a combination thereof.
  • the vaccine composition contains a recombinant virus of 10 5 EID 50 to 10 8 EID 50 .
  • the vaccine composition has 10 5.0 EID 50 to 10 8.0 EID 50 , 10 5.2 EID 50 to 10 8 EID 50 , 10 5.4 EID 50 to 10 8 EID 50 , 10 5.6 EID 50 to 10 8 EID 50 , 10 5.8 EID.
  • Newcastle disease virus of 7 or an antigen purified therefrom in the manufacture of a vaccine composition against the SARS-CoV-2 virus, Newcastle disease virus, or a combination thereof.
  • the nucleocapsid protein includes a nucleotide sequence encoding the proteins of magglutinin neuraminidase (HN) and polymerase (L), and a SARS-CoV-2 beta variant between the nucleotide sequences encoding the P protein and the M protein.
  • HN magglutinin neuraminidase
  • L polymerase
  • SARS-CoV-2 beta variant between the nucleotide sequences encoding the P protein and the M protein.
  • the present inventors made extensive research efforts to develop a vaccine against the SARS-CoV-2 virus.
  • the spike protein of the SARS-CoV-2 beta mutant virus is inserted and expressed in the gene of K148/08, a strain of the low-pathogenic Newcastle disease virus, based on reverse genetics technology, a vaccine is effective against both Newcastle disease and the SARS-CoV-2 virus. It was found that it can be produced.
  • the recombinant vector contains the nucleocapsid protein (NP), phosphoprotein (P), matrix (M), fusion protein (F), and hemagglutinin in the 5' to 3' direction. It sequentially contains nucleotide sequences encoding the proteins of neuraminidase (HN) and polymerase (L).
  • NP nucleocapsid protein
  • P phosphoprotein
  • M matrix
  • F fusion protein
  • HN neuraminidase
  • L polymerase
  • the nucleocapsid protein (NP), phosphoprotein (P), matrix (M), fusion protein (F), and hemagglutinin neuraminidase are the nucleotide sequences shown in SEQ ID NOs: 47 to 52, respectively.
  • SARS-CoV-2 refers to the coronavirus that causes the COVID-19 infectious disease.
  • SARS-CoV-2 is a coronavirus with four major structural proteins, specifically the Spike (S) protein, Envelope (E) protein, Membrane (M) protein, and Nucleocapsid (N) protein. It's a virus.
  • the N protein is a protein that surrounds the RNA genome, while the three structural proteins other than the N protein are components of the viral envelope.
  • the spike (S) protein of the SARS-CoV-2 virus contains the S1 subunit, which mediates attachment, and the S2 subunit, which mediates fusion of the virus cell membrane with the host cell.
  • the S1 subunit contains a receptor binding domain (RBD), which protects the subject from severe COVID-19 through strong binding to angiotensin-converting enzyme (ACE2), a receptor on human host cells. (COVID-19) is known to cause infectious diseases.
  • RBD receptor binding domain
  • ACE2 angiotensin-converting enzyme
  • COVID-19 is known to cause infectious diseases.
  • the S1 subunit and S2 subunit constitute the extracellular domain of the S protein.
  • the vector may be an attenuated strain (lentogenic) vector, more specifically, a linear plasmid vector, and most specifically, Newcastle disease derived from NDV K148/08 deposited under the accession number KCTC 11570BP. It may be a viral vector.
  • NDV Newcastlele Disease Virus
  • the term “Newcastle Disease Virus (NDV)” used in the present invention refers to a negative sense single-stranded RNA virus, belonging to the Paramyxoviridae family, the order Mononegavirales, and the abulavirus. It is an infectious virus belonging to the genus Avulavirus. NDV genomic RNA has an extragenic leader sequence of about 30 bases and a tail sequence of about 50 bases. The two sequences at both ends are known to regulate the transcription and replication of the viral gene and the encapsidation process of the newly synthesized RNA genome into the viral particle.
  • the NDV gene composition consists of six genes including NP, P, M, F, HN, and L between the terminal leader and tail genes, and each gene contains nucleoprotein (NP), phosphoprotein (P), and matrix protein ( M), fusion protein (F), hemagglutinin-neuramidase protein (HN), and large protein (L).
  • NP nucleoprotein
  • P phosphoprotein
  • M matrix protein
  • F hemagglutinin-neuramidase protein
  • L large protein
  • the Newcastle disease virus has an IGS [Gene end (GE), Intergenic sequence (IG), Gene start (GS)] sequence between each gene, and at the beginning of host cell infection, each gene undergoes a transcription process to enter the endoplasmic reticulum of the host cell. (endoplasmic reticulum, ER) to synthesize proteins. Afterwards, when the amount of M protein synthesis rises above a certain level, the (+)sense RNA genome is synthesized and the (-)sense RNA genome is synthesized using this as a template. Completed virus particles are expelled out of the cell.
  • IGS Gene end (GE), Intergenic sequence (IG), Gene start (GS)
  • the ability of the Newcastle disease virus to introduce a foreign gene is up to about 6 kb, and the introduction of a foreign gene has mainly been carried out between the P and M genes and between the HN and L genes.
  • introduction of foreign genes is possible between all six genes, but it is known that each location has an effect on mRNA expression, protein expression, and in severe cases, virus proliferation.
  • quantitative comparative tests have not been conducted for each location. It is a state.
  • the (-)sense RNA genome synthesizes the mRNA of each protein at the beginning of infection by the NP, L, and P proteins possessed by NDV, and the synthesized mRNA moves to the endoplasmic reticulum of the host cell to synthesize the protein of each gene. .
  • the (+)sense RNA genome is synthesized through the interaction of NP, L, P, and M proteins, and many copies of the (-)sense RNA genome are synthesized using this as a template and released outside the host cell.
  • the SARS-CoV-2 beta variant virus is the SARS-CoV-2 beta B.1.351 mutant strain.
  • SARS-CoV-2 is an RNA virus, and these viruses mutate frequently because they are prone to errors during the replication process. These mutations may affect the transmissibility of the virus, its pathogenicity, or the immune response to the vaccine.
  • the SARS-CoV-2 beta variant (B.1.351) was first discovered in South Africa in 2020. This variant has multiple genetic mutations, some of which are located in the virus' S protein. Because the S protein plays an important role in the virus' binding to and invasion of host cells, mutations at this location can affect the virus's transmissibility and pathogenicity. Beta mutations specifically include mutations such as E484K, N501Y, and K417N.
  • the recombinant vector contains the base sequence of SEQ ID NO: 42.
  • the recombinant vector consists of the base sequence of SEQ ID NO: 53.
  • the nucleotide sequence encoding the spike protein of the SARS-CoV-2 beta variant virus has a Kozak sequence upstream of the gene encoding the spike protein. It includes.
  • the nucleotide sequence encoding the spike protein of the SARS-CoV-2 beta variant virus includes a Kozak sequence and a Kozak sequence upstream of the gene encoding the spike protein. It includes NCR (non-coding region).
  • the nucleotide sequence encoding the spike protein of the SARS-CoV-2 beta variant virus may additionally include a non-coding region.
  • Non-coding regions contain regulatory elements that regulate gene expression. For example, a promoter determines the point where RNA polymerase binds and starts transcription, and an enhancer plays a role in increasing gene expression. Additionally, non-coding regions can increase the stability of mRNA. For example, the 5' cap and 3' poly-A tail prevent mRNA degradation and increase translation efficiency. Some non-coding regions contain splicing sites. It plays an important role in the post-transcriptional processing of genes. That is, when constructing a recombinant vector, including not only the coding region of the gene to be introduced but also an appropriate non-coding region can have a significant impact on the expression efficiency and stability of the recombinant vector.
  • the present invention provides a recombinant Newcastle disease virus prepared from the vector of any one of claims 1 to 5.
  • the recombinant virus may be obtained from allantoic fluid after inoculating the supernatant of animal cells transformed with the recombinant vector into embryonated eggs.
  • the Newcastle disease virus expresses the SARS-CoV-2 virus spike protein on its surface.
  • the present invention provides a preventive vaccine composition against SARS-CoV-2 virus, Newcastle disease virus, or a combination thereof, comprising the recombinant Newcastle disease virus or an antigen purified therefrom.
  • a certain amount of antigen must be inoculated in order for a vaccinated individual to exhibit an immune response capable of preventing infection, so it is very important to manufacture a vaccine containing more than a standard amount of virus.
  • the term “vaccine composition” refers to a composition that positively affects the immune response of a subject.
  • the vaccine composition provides the subject with an enhanced systemic or local immune response triggered by a cellular immune response, such as a Cytotoxic T Lymphocyte (CTL) response, or a humoral immune response, such as an antibody. .
  • CTL Cytotoxic T Lymphocyte
  • prophylaxis refers to the prevention or protective treatment of a disease or disease state.
  • the vaccine composition may be used in mixture with a pharmaceutically acceptable carrier or diluent depending on selection. That is, in one embodiment of the present invention, the vaccine composition of the present invention may additionally include a pharmaceutically acceptable carrier.
  • the “pharmaceutically effective amount” means an amount sufficient to prevent, alleviate, or achieve therapeutic efficacy against diseases or pathological symptoms caused by viruses.
  • Pharmaceutically acceptable carriers that can be included in the composition of the present invention are those commonly used in preparation, such as lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, and silicic acid. Including, but not limited to, calcium, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. That is not the case.
  • composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc.
  • lubricants wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc.
  • suitable pharmaceutically acceptable carriers and agents are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).
  • the vaccine composition of the present invention may include other components, such as stabilizers, excipients, other pharmaceutically acceptable compounds, or any other antigen or portion thereof.
  • Vaccines may be in the form of freeze-dried preparations or suspensions, both of which are common in the field of vaccine production.
  • the vaccine composition of the present invention can be administered in a pharmaceutically effective amount to a subject in need.
  • the appropriate dosage of the vaccine composition of the present invention varies depending on factors such as formulation method, administration method, subject's age, body weight, sex, pathological condition, diet, administration time, administration route, excretion rate, and reaction sensitivity. can be decided. Meanwhile, the dosage of the vaccine composition of the present invention is preferably 0.001-100 mg/kg (body weight) per day.
  • the vaccine compositions of the invention can be administered in the conventional manner via oral, rectal, topical, intravenous, intraperitoneal, intramuscular, intraarterial, transdermal, intranasal, inhalation, intraocular or intradermal routes.
  • the vaccine composition of the present invention can be administered parenterally.
  • Parenteral administration of the present invention refers to administration methods including intravenous, intramuscular, intranasal, intraperitoneal, intrasternal, transdermal and intraarterial injection and infusion.
  • the dosage form of the vaccine composition of the present invention may be for inoculation for intraperitoneal, intramuscular, nasal or subcutaneous administration.
  • the parenteral administration should be prepared in a unit dosage form by mixing non-toxic to the recipient and compatible with other preparation components at a pharmaceutically acceptable concentration and dosage under desirable purity.
  • the vaccine is administered to mammals.
  • the mammals include, but are not limited to, cows, horses, pigs, sheep, goats, or humans.
  • the vaccine is targeted at birds.
  • the birds may be poultry and wild birds, including chickens, ducks, quails, turkeys, and geese, but are not limited thereto.
  • the chickens include young chickens, broilers and layer hens.
  • the SARS-CoV-2 virus is a SARS-CoV-2 beta mutant virus, a SARS-CoV-2 delta mutant virus, or a combination thereof.
  • the vaccine is a live vaccine or an inactivated vaccine in which the virus is attenuated.
  • the virus inactivation prevents replication of the virus used in vaccine production after the proliferation step, and generally, this can be done by chemical or physical means known in the art.
  • the inactivation method known in the art can be achieved by treating the virus with formalin, ultraviolet rays, heat, BEI (Binary Ethyleneimine), beta-propiolactone, etc.
  • the vaccine composition additionally includes an immune enhancing substance or adjuvant.
  • the adjuvant is generally any substance that increases the humoral or cellular immune response to an antigen (e.g., alum, Freund's complete adjuvant, Freund's incomplete adjuvant, LPS, poly IC, poly AU, etc.).
  • the immunostimulant of the present invention includes alum, Complete Freund's Adjuvant, Incomplete Freund's Adjuvant, LPS, poly IC, poly AU, Lipofectin, and lipotaxi. , CaPO4, DEAE dextran, polybrene, saponin, minerals such as aluminum hydroxide, gel, lysolecithin, pluronic polyols, polyanion.
  • polyanions peptides
  • surface active substances such as oil or hydrocarbon emulsions, and dinitrophenol.
  • the vaccine composition is administered intramuscularly or intranasally.
  • the present inventors confirmed that the vaccine composition of the present invention provides immunity against the SARS-CoV-2 virus to a subject when administered intramuscularly and nasally.
  • the formulation of the vaccine of the present invention can be applied in any formulation, and the manufactured formulation can be used for oral use, injection, application, or spraying.
  • the formulation may be selected in an appropriate form depending on the administration method.
  • the vaccine composition may be formulated in the form of an injection, or for intranasal administration, in the form of a liniment or spray.
  • Intranasal administration can be non-invasive and can be accomplished via nebulizer or dropper.
  • the vaccine composition includes a recombinant virus of 10 5 EID 50 to 10 8 EID 50 .
  • the vaccine composition has 10 5.0 EID 50 to 10 8.0 EID 50 , 10 5.2 EID 50 to 10 8 EID 50 , 10 5.4 EID 50 to 10 8 EID 50 , 10 5.6 EID 50 to 10 8 EID 50 , 10 5.8 EID.
  • the present invention relates to the nucleocapsid protein (NP), phosphoprotein (P), matrix (M), fusion protein (F), and hemagglutinin neuramini of Newcastle disease virus K148/08 deposited with accession number KCTC 11570BP.
  • a spike of the SARS-CoV-2 beta variant virus comprising a nucleotide sequence encoding the proteins of nidase (HN) and polymerase (L), and between the nucleotide sequences encoding the P protein and the M protein (
  • a recombinant vector containing a nucleotide sequence encoding a spike protein is provided.
  • the present invention provides a recombinant Newcastle disease virus prepared from the above vector.
  • Another object of the present invention is to provide a preventive vaccine composition for SARS-CoV-2 virus, Newcastle disease virus, or a combination thereof, comprising the recombinant Newcastle disease virus or an antigen purified therefrom.
  • Figure 1 shows a schematic diagram of the structure of rK148/beta-S.
  • Figure 2 shows a photograph of a PCR band in which the NCR (non-coding region), Kozak sequence, and spike gene are inserted between the P and M genes of K148/beta-S.
  • Figure 3 shows Western blotting results for the spike protein and HN protein of K148 and rK148/beta-S viruses.
  • Figure 4 shows the results of comparing the growth curves of K148 and rK148/beta-S viruses.
  • Figure 5 shows the results of HI analysis for NDV after low concentration K148/beta-S intramuscular vaccination.
  • Figure 6 shows the results of SARS-CoV-2 ELISA for SARS-CoV-2 after low concentration K148/beta-S intramuscular vaccination.
  • Figure 7 shows the survival rate and body weight change in response to SARS-CoV-2 challenge after low concentration K148/beta-S muscle vaccination.
  • Figure 8 shows the results of HI analysis for NDV after high concentration K148/beta-S intramuscular vaccination.
  • Figure 9 shows the results of SARS-CoV-2 ELISA for SARS-CoV-2 after high concentration K148/beta-S intramuscular vaccination.
  • Figure 10 shows ELISpot results for SARS-CoV-2 after high concentration K148/beta-S muscle vaccination.
  • Figure 11 shows the survival rate and body weight change in response to SARS-CoV-2 beta variant challenge after high concentration K148/beta-S muscle vaccination.
  • Figure 12 shows the results of lung viral load analysis for SARS-CoV-2 beta variant challenge after high-concentration K148/beta-S muscle vaccination.
  • Figure 13 shows the survival rate and body weight change in response to SARS-CoV-2 delta variant challenge after high-concentration K148/beta-S intramuscular vaccination.
  • Figure 14 shows the results of lung viral load analysis for SARS-CoV-2 delta variant challenge after high-concentration K148/beta-S muscle vaccination.
  • Figure 15 shows the results of HI analysis for NDV after low concentration K148/beta-S nasal vaccination.
  • Figure 16 shows the results of SARS-CoV-2 ELISA for SARS-CoV-2 after low concentration K148/beta-S nasal vaccination.
  • Figure 17 shows the survival rate and body weight change in response to SARS-CoV-2 beta variant challenge after low concentration K148/beta-S nasal vaccination.
  • Figure 18 shows the results of HI assay for NDV after high concentration K148/beta-S nasal vaccination.
  • Figure 19 shows the results of SARS-CoV-2 ELISA for SARS-CoV-2 after high-concentration K148/beta-S nasal vaccination.
  • Figure 20 shows ELISpot results for SARS-CoV-2 after high-concentration K148/beta-S nasal vaccination.
  • Figure 21 shows the survival rate and body weight change in response to SARS-CoV-2 beta variant challenge after high-concentration K148/beta-S nasal vaccination.
  • Figure 22 shows the results of lung viral load analysis for SARS-CoV-2 beta variant challenge after high-concentration K148/beta-S nasal vaccination.
  • Figure 23 shows the results of analyzing the amount of SARS-CoV-2 specific IgA in the lungs in response to SARS-CoV-2 beta variant challenge after high-concentration K148/beta-S nasal vaccination.
  • Figure 24 shows the survival rate and body weight change in response to SARS-CoV-2 delta variant challenge after high-concentration K148/beta-S nasal vaccination.
  • Figure 25 shows the results of lung viral load analysis for SARS-CoV-2 delta variant challenge after high-concentration K148/beta-S nasal vaccination.
  • Chicken embryo fibroblast (CEF), Vero cell-E6 line, and Hep-2 cell line were cultured in DMEM (Dulbecco's Modified Eagle Medium, CCL-81; ATCC) supplemented with 8% fetal bovine serum and antibiotics.
  • DMEM Dulbecco's Modified Eagle Medium, CCL-81; ATCC
  • K148 Newcastle disease virus (KCTC 11570BP) into a plasmid.
  • the cDNA of the K148 NDV virus is divided into six segments with approximately 300 bp of nucleotide overlap between adjacent segments. All six fragments were amplified through PCR using 6 sets of primers for each gene and cloned into RBC TA cloning vector (RBC Bioscience, Taipei, Taiwan) (Table 1). Each fragment was sequentially inserted into the pBluescript vector using the In-Fusion PCR cloning kit (Clontech, Mountain View, CA).
  • pfuUltraTM II fusion HS DNA polymerase (Stratagene, La Jolla, CA) was used for amplification of each fragment and vector linearization. Vector plasmids were linearized prior to insertion of each fragment. To create a supporting plasmid, the Nucleoprotein (NP), Polymerase (P), and Large polymerase (L) genes were cloned into an expression plasmid. Primers used for vector linearization and insertion of each fragment are listed in Table 2.
  • the full-length genome cDNA clone (pK148) of the K148 virus was transformed into HIT-DH5 ⁇ competent cells, and after culturing at 37°C for 18 hours, the plasmid was isolated using the PureLinkTMHiPure plasmid midiprep kit (Thermo Fisher Scientific, California, USA). and purified.
  • Modified Vaccinia Ankara T7 recombinant virus (MVA-T7) for T7 transcriptase supply was provided by Bernard Moss (National Institutes of Health; NIH). MVA-T7 virus was cultured in CEF cells for future use.
  • SARS-CoV-2 beta variant (B.1.351 resource number 43382) and delta variant (B.1.167.2 resource number 43390) were distributed by the Korea Centers for Disease Control and Prevention.
  • SARS-CoV-2 beta variant and delta variant were cultured using vero cell-E6.
  • Viral RNA was extracted from cell cultures harvested from the SARS-CoV-2 beta variant using the RNeasy kit (Qiagen, Valencia, CA). cDNA was synthesized using the SuperScript IV first-Strand system (Thermo Fisher scientific, California).
  • pK148 was linearized so that the untranslated region (UTR) and the spike gene cDNA fragment of the SARS-CoV-2 beta variant could be inserted between the P and M genes of the K148/08 full-length gene cDNA clone.
  • the spike gene and NCR (non-coding region) of the SARS-CoV-2 beta variant were amplified by PCR and cloned into RBC TA cloning Vector (RBC Bioscience, Taipei, Taiwan).
  • RBC Bioscience RBC Bioscience, Taipei, Taiwan
  • a Kozak sequence CACC was inserted upstream of the ATG of the spike gene using the Muta-directTM site-directed Mutagenesis kit (iNtRON Biotechnology, Korea).
  • the cDNA of the NCR and modified spike genes were inserted between the P and M genes of pK148 using the In-Fusion® PCR cloning kit (Clontech, Mountain View, CA), and ultimately pK148/beta-S clone was created. was produced ( Figure 1). Primers for linearizing pK148 and primers for infusion of the Spike gene with the linearized pK148 are described in Table 3. The pK148/beta-S clone was amplified in HIT-DH5 ⁇ competent cells for 18 hours at 37°C and purified using the PureLink TM HiPure plasmid midiprep kit.
  • a plasmid encoding full-genome cDNA (pK148/beta-S) and three supporting plasmids (N, P and L) were transfected into Hep-2 cells.
  • pK148/beta-S 8.8ug, pSupport_NP 1ug, pSupport_P 0.1ug, and pSupport_L 0.1ug were mixed and transfected into Hep-2 cells using Lipofectamine 3000 ((Thermo Fisher Scientific, California, USA). Incubator at 37°C.
  • the cells were washed once with PBS, the medium was replaced with Opti-MEM media, and the cells were then cultured at 37°C and 5% CO2 for 72 hours by freezing and thawing once.
  • the harvested virus was inoculated into 10-day-old SPF fertilized eggs and cultured at 37°C for 3 days.
  • the inoculated eggs were refrigerated at 4°C for 1 hour and the rescued virus was detected.
  • HA-positive samples were filtered through a 0.45 ⁇ m syringe filter (Ministart RC 15, Sartorius Stedim Biotech, Germany) and then sub-inoculated into 10-day-old SPF fertilized eggs. After passage, the allantoic fluid of the hatched eggs was harvested and divided and stored at -80°C for further experiments.
  • the primary antibody was SARS/SARS-CoV-2 Spike protein S2 monoclonal antibody (1A9), and the secondary antibody was HRP-conjugated anti-mouse IgG.
  • anti-NDV HN mouse IgG antibody was used as the primary antibody
  • HRP conjugated mouse IgG antibody was used as the secondary antibody.
  • decimal-diluted K148 and rK148/beta-S virus (10EID50) were inoculated into 10-day-old SPF fertilized eggs. Allantoic fluid from inoculated eggs was collected at 12, 24, 36, 48, 60, 72, 84, and 96 h, and RNA from the virus culture was extracted at each time period to quantify the amount of virus through qPCR. CT value was converted to EID 50 /mL through the standard curve.
  • Serum was isolated through blood collection at 4, 6, and 8 weeks after the first vaccination. At 4 weeks after the second vaccination, all animals except 5 in the high dose group for ELISpot analysis were tested for SRAS-CoV-2 beta variant (B.1.351) and SARS-CoV-2 delta variant (B.1.167.2). 100 lethal dose (LD50) was administered. In the high-dose group, three animals were autopsied on the 3rd and 6th days after challenge, and clinical signs, body weight, and mortality were recorded daily. Vaccination was conducted in a BSL-2 facility, and challenge study was conducted in Konkuk University's ABSL-3 facility.
  • the second vaccination was performed 4 weeks after the first vaccination. Clinical signs of vaccinated mice were evaluated every week. Serum was isolated through blood collection at 4, 6, and 8 weeks after the first vaccination. At 4 weeks after the second vaccination, all animals except 5 in the high dose group for ELISpot analysis were tested for SRAS-CoV-2 beta variant (B.1.351) and SARS-CoV-2 delta variant (B.1.167.2). 100 lethal dose (LD50) was administered. In the high-dose group, three animals were autopsied on the 3rd and 6th days after challenge, and clinical signs, body weight, and mortality were recorded daily. Vaccination experiments were conducted in a BSL-2 facility, and challenge studies were conducted in an ABSL-3 facility at Konkuk University.
  • mice were removed 4 weeks after the second vaccination.
  • the extracted spleen was separated into single cells using a 70um cell strainer. Red blood cells were removed from the isolated cells using RBC lysis buffer (Sigma Aldrich, USA). The concentration of cells was confirmed and the cells were dispensed at 5
  • Peptivator SARS-CoV-2 prot_S1 (Miltenyi Biotec, Germany) was diluted 1/100 and 50ul was added to each well. Reaction was performed in a cell incubator at 5% CO 2 and 37°C for 24 hours. Color was developed using the reagents and methods provided by the IFN-r ELISpot kit. The number of spots in the colored wells was confirmed using AID ispot (AID GmbH, Germany).
  • SARS-CoV-2 specific IgA was measured using a mouse anti-2019 nCOV(S)IgA ELISA kit (FineTest, China). The mouse emulsion was diluted 1/50 according to the standard protocol of the mouse anti-2019 nCOV(S)IgA ELISA kit.
  • Newcastle virus expressing the spike protein (S protein) of the SARS-CoV-2 beta variant virus was successfully produced.
  • Example 4 Confirmation of immune response upon intramuscular administration of low-concentration rK148/beta-S vaccine using K18-hACE2 transgenic mice, survival rate after challenge, and degree of virus shedding
  • the degree of immune response was analyzed by administering Newcastle virus or SARS-CoV-2 virus after intramuscular administration of low concentration rK148/beta-S vaccine.
  • low-concentration rK148/beta-S vaccine was administered intramuscularly and then challenged with SARS-CoV-2 beta variant virus to determine survival rate and weight change.
  • Example 5 Confirmation of immune response upon intramuscular administration of high-concentration rK148/beta-S vaccine using K18-hACE2 transgenic mice, survival rate after challenge, and degree of virus shedding
  • the degree of immune response was analyzed by administering Newcastle virus or SARS-CoV-2 virus after intramuscular administration of high-concentration rK148/beta-S vaccine.
  • the immune response to SARS-CoV-2 was confirmed through ELISA.
  • Antibodies to SARS-CoV-2 were confirmed in group 1, and at 4 weeks after the second vaccination, group 1 was confirmed to have a PI value of 60.1 ( ⁇ 10.7).
  • the degree of response to cellular immunity was measured using IFN-r ELISpot.
  • the ELISpot for the S protein of SARS-CoV-2 was found to be 212.4 ( ⁇ 48.1) only in group 1.
  • the survival rate and degree of body weight change were confirmed by intramuscular administration of high-concentration rK148/beta-S vaccine and then challenge with SARS-CoV-2 beta variant virus.
  • the viral load for SARS-CoV-2 beta variant in the lungs on the 3rd day after challenge was 10 2.3 TCID 50 /mL in group 1 and 10 5.7 TCID 50 in group 2. /mL) and group 3 (10 5.5 TCID 50 /mL).
  • the viral load for SARS-CoV-2 beta variant in the lungs on the 6th day after challenge was 10 2.0 TCID 50 /mL in group 1 and 10 3.5 TCID in group 3. 50 /mL).
  • high-concentration rK148/beta-S vaccine was administered intramuscularly and then challenged with the SARS-CoV-2 delta variant virus in the lungs.
  • the viral load for SARS-CoV-2 delta variant in the lungs on the 3rd day after challenge was 10 2.6 TCID 50 /mL in group 4 and 10 4.6 TCID 50 in group 5. /mL).
  • the viral load for SARS-CoV-2 delta variant in the lungs on the 6th day after challenge was 10 2.0 TCID 50 /mL in group 4 and 10 3.1 TCID in group 5. 50 /mL).
  • Example 6 Confirmation of immune response upon intranasal administration of low-concentration rK148/beta-S vaccine using K18-hACE2 transgenic mice, survival rate after challenge, and degree of virus shedding
  • the degree of immune response was analyzed by administering Newcastle virus or SARS-CoV-2 virus after intranasal administration of low concentration rK148/beta-S vaccine.
  • low-concentration rK148/beta-S vaccine was administered intranasally and then challenged with SARS-CoV-2 beta variant virus to determine survival rate and weight change.
  • Example 7 Confirmation of immune response upon intranasal administration of high-concentration rK148/beta-S vaccine using K18-hACE2 transgenic mice , survival rate after challenge, and degree of virus shedding
  • the degree of immune response was analyzed by intranasal administration of high-concentration rK148/beta-S vaccine followed by administration of Newcastle virus or SARS-CoV-2 virus.
  • the hemagglutination inhibition ability to the Newcastle disease virus was confirmed in the remaining groups except the PBS group, and at 4 weeks after the second vaccination.
  • Group 1 was confirmed to be 5.3 ( ⁇ 1.2 Log 2 ) and Group 2 was confirmed to be 5.1 ( ⁇ 1.1 Log 2 ).
  • the immune response to SARS-CoV-2 was confirmed through ELISA.
  • Antibodies to SARS-CoV-2 were confirmed in group 1, and at 4 weeks after the second vaccination, group 1 was confirmed to have a PI value of 55.2 ( ⁇ 11.1).
  • the degree of response to cellular immunity was measured using IFN-r ELISpot.
  • the ELISpot for the S protein of SARS-CoV-2 was found to be 318.6 ( ⁇ 64.0) only in group 1.
  • intranasal administration of high-concentration rK148/beta-S vaccine was followed by challenge with SARS-CoV-2 beta variant virus to determine the rate of viral discharge from the lungs and SARS-CoV-2.
  • SARS-CoV-2 beta variant virus was used to determine the rate of viral discharge from the lungs and SARS-CoV-2.
  • the viral load for SARS-CoV-2 beta variant in the lungs on the 3rd day after challenge was 10 2.2 TCID 50 /mL in group 1 and 10 4.7 TCID 50 /mL in group 2.
  • group 3 (10 4.5 TCID 50 /mL).
  • the viral load for SARS-CoV-2 beta variant in the lungs was not detected in group 1, group 2 (10 2.6 TCID 50 /mL), and group 3 (10 2.6 TCID 50 /mL ). /mL) showed a significantly lower value.
  • the SARS-CoV-2 specific IgA present in the lungs was 65.6 ( ⁇ 9.1 ng/mL) in group 1 on the 3rd day after challenge and 176.4 ( ⁇ 29.8 ng/mL) in group 1 on the 6th day. ), and groups 2 and 3 were hardly detected.
  • high-concentration rK148/beta-S vaccine was administered intranasally and then challenged with the SARS-CoV-2 delta variant virus in the lungs.
  • the viral load for SARS-CoV-2 delta variant in the lungs on the 3rd day after challenge was 10 2.1 TCID 50 /mL in group 4 and 10 4.7 TCID 50 /mL in group 5.
  • the viral load for SARS-CoV-2 delta variant in the lungs on day 6 after challenge was 10 2.0 TCID 50 /mL in group 4, which was significantly lower than that in group 5 (10 2.8 TCID 50 /mL). showed it

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Virology (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Public Health (AREA)
  • Microbiology (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Pulmonology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Communicable Diseases (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Oncology (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 뉴캐슬병 바이러스(Newcastle Disease Virus)인 K148/08로 만들어진 pK148/08 벡터 내에 SARS-CoV-2 beta variant의 스파이크 유전자를 삽입한 바이러스 및 이를 포함하는 백신에 관한 것이다. 본 발명의 백신 조성물을 이용하는 경우, 대상의 SARS-CoV-2 바이러스 바이러스 및 뉴캐슬 바이러스에 대한 면역 기능을 활성화할 수 있다.

Description

SARS-COV-2 바이러스 백신
본 특허출원은 2022년 12월 14일에 대한민국 특허청에 제출된 대한민국 특허출원 제10-2022-0175236호에 대하여 우선권을 주장하며, 상기 특허출원의 개시사항은 본 명세서에 참조로서 삽입된다.
본 발명은 뉴캐슬병 바이러스(Newcastle Disease Virus)인 K148/08로 만들어진 pK148/08 벡터 내에 SARS-CoV-2 beta variant의 스파이크 유전자를 삽입한 바이러스 및 이를 포함하는 백신에 관한 것이다.
2019년 중국 우한에서 발생한 SARS-CoV-2로 인해 Covid-19가 발생하였고, 전세계로 확산되어 WHO 2020년 3월에 팬데믹으로 분류하였다. SARS-CoV-2는 베타 코로나바이러스 속에 속하며 단일양성가닥 RNA 바이러스로 유전자의 크기는 29.8~30kb이다. SARS-CoV-2를 구성하고 있는 단백질 중에 스파이크(spike)가 가장 중요한데, SARS-CoV-2가 세포의 수용체를 인지하고 세포막과 결합하고 세포 내부로 함입하는 역할을 가진다. 특히 스파이크(spike) 단백질의 RBD (Receptor binding domain)이 타겟 세포의 수용체를 인지하는 역할을 수행하며, SARS-CoV-2 중화항체의 주요 타겟 중 한개이다. 2019년 SASR-CoV-2가 발생한 이래로 alpha, beta, gamma, delta, omicron 변이(variant)가 중대변이로 WHO에서 지정되었다. SARS-CoV-2 팬데믹을 극복하기 위해 다국적회사들이 다양한 플랫폼을 이용하여 백신 후보를 제작하고 있다.
다만, SARS-CoV-2 바이러스의 지속적인 변이의 발생으로 백신 개발에 어려움이 있으며, 다양한 변이 SARS-CoV-2 바이러스에 대한 면역력을 제공하는 백신 개발이 필요한 실정이다.
본 발명자들은 SARS-CoV-2 바이러스에 대한 백신을 개발하고자 예의 연구 노력하였다. 그 결과 저병원성 뉴캐슬병 바이러스의 strain인 K148/08의 유전자에 역유전학 기술을 바탕으로 SARS-CoV-2 베타 변이 바이러스의 스파이크 단백질을 삽입 및 발현시키는 경우, 뉴캐슬병과 SARS-CoV-2 바이러스 모두에 효과적인 백신을 제작할 수 있음을 규명함으로써, 본 발명을 완성하게 되었다.
따라서, 본 발명의 목적은 수탁번호 KCTC 11570BP로 기탁된 뉴캐슬병 바이러스 K148/08의 뉴클레오캡시드 단백질(NP), 인단백질(P), 매트릭스(M), 융합 단백질(F), 헤마글루티닌 뉴라미니다제(HN) 및 폴리머라제(L)의 단백질을 인코딩하는 뉴클레오타이드 서열을 포함하고, 상기 P 단백질과 M 단백질을 인코딩하는 뉴클레오타이드 서열 사이에 SARS-CoV-2 베타 변이(beta variant) 바이러스의 스파이크(spike) 단백질을 인코딩하는 뉴클레오타이드 서열을 포함하는, 재조합 벡터를 제공하는 것이다.
본 발명의 다른 목적은 상기 벡터로부터 제조된 재조합 뉴캐슬병 바이러스를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 재조합 뉴캐슬병 바이러스 또는 이로부터 정제된 항원을 포함하는 SARS-CoV-2 바이러스, 뉴캐슬병 바이러스, 또는 이들의 조합에 대한 예방용 백신 조성물을 제공하는 것이다.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
본 발명은 하기 1 내지 16의 발명을 제공한다.
1. 수탁번호 KCTC 11570BP로 기탁된 뉴캐슬병 바이러스 K148/08의 뉴클레오캡시드 단백질(NP), 인단백질(P), 매트릭스(M), 융합 단백질(F), 헤마글루티닌 뉴라미니다제(HN) 및 폴리머라제(L)의 단백질을 인코딩하는 뉴클레오타이드 서열을 포함하고,
상기 P 단백질과 M 단백질을 인코딩하는 뉴클레오타이드 서열 사이에 SARS-CoV-2 베타 변이(beta variant) 바이러스의 스파이크(spike) 단백질을 인코딩하는 뉴클레오타이드 서열을 포함하는, 재조합 벡터.
2. 1에 있어서, 상기 SARS-CoV-2 베타 변이(beta variant) 바이러스는 SARS-CoV-2 베타 B.1.351 변이주인 것인, 재조합 벡터.
3.1에 있어서, 상기 재조합 벡터는 서열번호 42의 염기서열을 포함하는 것인, 재조합 벡터.
4. 1에 있어서, 상기 재조합 벡터는 서열번호 50의 염기서열로 이루어진 것인, 재조합 벡터.
5. 1에 있어서, 상기 SARS-CoV-2 베타 변이(beta variant) 바이러스의 스파이크(spike) 단백질을 인코딩하는 뉴클레오타이드 서열은 스파이크 단백질을 인코딩하는 유전자의 상류에 코작 서열(Kozak sequence)를 포함하는 것인, 재조합 벡터.
6. 1에 있어서, 상기 SARS-CoV-2 베타 변이(beta variant) 바이러스의 스파이크(spike) 단백질을 인코딩하는 뉴클레오타이드 서열은 스파이크 단백질을 인코딩하는 유전자의 상류에 코작 서열(Kozak sequence) 및 NCR(non-coding region)을 포함하는 것인, 재조합 벡터.
7. 1 내지 6 중 어느 한 항의 벡터로부터 제조된 재조합 뉴캐슬병 바이러스.
8. 7에 있어서, 상기 뉴캐슬병 바이러스는 표면에 SARS-CoV-2 바이러스 스파이크(spike) 단백질을 발현하는 것인, 재조합 뉴캐슬병 바이러스.
9. 7의 재조합 뉴캐슬병 바이러스 또는 이로부터 정제된 항원을 포함하는 SARS-CoV-2 바이러스, 뉴캐슬병 바이러스, 또는 이들의 조합에 대한 예방용 백신 조성물.
10. 9에 있어서, 상기 SARS-CoV-2 바이러스는 SARS-CoV-2 베타 변이 바이러스, SARS-CoV-2 델타 변이 바이러스, 또는 이들의 조합인 것인, SARS-CoV-2 바이러스, 뉴캐슬병 바이러스, 또는 이들의 조합에 대한 예방용 백신 조성물.
11. 9에 있어서, 상기 백신은 바이러스가 약독화된 생독 백신 또는 불활화 백신인 것인, SARS-CoV-2 바이러스, 뉴캐슬병 바이러스, 또는 이들의 조합에 대한 예방용 백신 조성물.
12. 9에 있어서, 상기 백신 조성물은 면역증강물질 또는 어쥬번트를 추가적으로 포함하는 것인, SARS-CoV-2 바이러스, 뉴캐슬병 바이러스, 또는 이들의 조합에 대한 예방용 백신 조성물.
13. 9에 있어서, 상기 백신 조성물은 근육 또는 비강 내 투여되는 것인, SARS-CoV-2 바이러스, 뉴캐슬병 바이러스, 또는 이들의 조합에 대한 예방용 백신 조성물.
14. 9에 있어서, 상기 백신 조성물은 105 EID50 내지 108 EID50의 재조합 바이러스를 포함하는 것이다. 예를 들어 상기 백신 조성물은 105.0 EID50 내지 108.0 EID50, 105.2 EID50 내지 108 EID50, 105.4 EID50 내지 108 EID50, 105.6 EID50 내지 108 EID50, 105.8 EID50 내지 108 EID50, 106.0 EID50 내지 108 EID50, 106.2 EID50 내지 108 EID50, 106.4 EID50 내지 108 EID50, 106.6 EID50 내지 108 EID50, 106.8 EID50 내지 108 EID50, 107.0 EID50 내지 108 EID50, 107.2 EID50 내지 108 EID50, 107.4 EID50 내지 108 EID50, 107.6 EID50 내지 107.8 EID50, 105 EID50 내지 107.8 EID50, 105 EID50 내지 107.6 EID50, 105 EID50 내지 107.4 EID50, 105 EID50 내지 107.2 EID50, 105 EID50 내지 107.0 EID50, 105 EID50 내지 106.8 EID50, 105 EID50 내지 106.6 EID50, 105 EID50 내지 106.4 EID50, 105 EID50 내지 106.2 EID50, 105 EID50 내지 106 EID50, 105 EID50 내지 105.8 EID50, 105 EID50 내지 105.6 EID50, 105 EID50 내지 105.4 EID50, 105 EID50 내지 105.2 EID50, 105.2 EID50 내지 107.8 EID50, 105.4 EID50 내지 107.6 EID50, 105.6 EID50 내지 107.4 EID50, 105.8 EID50 내지 107.2 EID50, 또는 106.0 EID50 내지 107.0 EID50의 재조합 바이러스를 포함하는 것이다.
15. 1 내지 6의 재조합 벡터; 7 또는 8의 재조합 뉴캐슬병 바이러스 또는 이로부터 정제된 항원을 포함하는 SARS-CoV-2 바이러스; 또는 9 내지 14의 백신 조성물을 대상에 투여하는 단계를 포함하는 SARS-CoV-2 바이러스, 뉴캐슬병 바이러스, 또는 이들의 조합에 대한 예방 방법.
16. 15에 있어서, 상기 1 내지 6의 재조합 벡터; 7 또는 8의 재조합 뉴캐슬병 바이러스 또는 이로부터 정제된 항원을 포함하는 SARS-CoV-2 바이러스; 또는 9 내지 14의 백신 조성물을 대상에 투여하는 단계는 1회 혹은 2회 이상 수행되는 것인, SARS-CoV-2 바이러스, 뉴캐슬병 바이러스, 또는 이들의 조합에 대한 예방 방법.
17. 15에 있어서, 상기 1 내지 6의 재조합 벡터; 7 또는 8의 재조합 뉴캐슬병 바이러스 또는 이로부터 정제된 항원을 포함하는 SARS-CoV-2 바이러스; 또는 9 내지 14의 백신 조성물은 근육 또는 비강 내 투여되는 것인 SARS-CoV-2 바이러스, 뉴캐슬병 바이러스, 또는 이들의 조합에 대한 예방 방법.
18. 15에 있어서, 상기 7 또는 8의 재조합 뉴캐슬병 바이러스 또는 9 내지 14의 백신 조성물은 105 EID50 내지 108 EID50의 재조합 바이러스를 포함하는 것이다. 예를 들어 105.0 EID50 내지 108.0 EID50, 105.2 EID50 내지 108 EID50, 105.4 EID50 내지 108 EID50, 105.6 EID50 내지 108 EID50, 105.8 EID50 내지 108 EID50, 106.0 EID50 내지 108 EID50, 106.2 EID50 내지 108 EID50, 106.4 EID50 내지 108 EID50, 106.6 EID50 내지 108 EID50, 106.8 EID50 내지 108 EID50, 107.0 EID50 내지 108 EID50, 107.2 EID50 내지 108 EID50, 107.4 EID50 내지 108 EID50, 107.6 EID50 내지 107.8 EID50, 105 EID50 내지 107.8 EID50, 105 EID50 내지 107.6 EID50, 105 EID50 내지 107.4 EID50, 105 EID50 내지 107.2 EID50, 105 EID50 내지 107.0 EID50, 105 EID50 내지 106.8 EID50, 105 EID50 내지 106.6 EID50, 105 EID50 내지 106.4 EID50, 105 EID50 내지 106.2 EID50, 105 EID50 내지 106 EID50, 105 EID50 내지 105.8 EID50, 105 EID50 내지 105.6 EID50, 105 EID50 내지 105.4 EID50, 105 EID50 내지 105.2 EID50, 105.2 EID50 내지 107.8 EID50, 105.4 EID50 내지 107.6 EID50, 105.6 EID50 내지 107.4 EID50, 105.8 EID50 내지 107.2 EID50, 또는 106.0 EID50 내지 107.0 EID50의 재조합 바이러스를 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.
19. 7의 재조합 뉴캐슬병 바이러스 또는 이로부터 정제된 항원의 SARS-CoV-2 바이러스, 뉴캐슬병 바이러스, 또는 이들의 조합에 대한 백신 조성물 제조상의 용도.
본 발명의 일 양태에 따르면, 본 발명은 수탁번호 KCTC 11570BP로 기탁된 뉴캐슬병 바이러스 K148/08의 뉴클레오캡시드 단백질(NP), 인단백질(P), 매트릭스(M), 융합 단백질(F), 헤마글루티닌 뉴라미니다제(HN) 및 폴리머라제(L)의 단백질을 인코딩하는 뉴클레오타이드 서열을 포함하고, 상기 P 단백질과 M 단백질을 인코딩하는 뉴클레오타이드 서열 사이에 SARS-CoV-2 베타 변이(beta variant) 바이러스의 스파이크(spike) 단백질을 인코딩하는 뉴클레오타이드 서열을 포함하는, 재조합 벡터를 제공한다.
본 발명자들은 SARS-CoV-2 바이러스에 대한 백신을 개발하고자 예의 연구 노력하였다. 그 결과 저병원성 뉴캐슬병 바이러스의 strain인 K148/08의 유전자에 역유전학 기술을 바탕으로 SARS-CoV-2 베타 변이 바이러스의 스파이크 단백질을 삽입 및 발현시키는 경우, 뉴캐슬병과 SARS-CoV-2 바이러스 모두에 효과적인 백신을 제작할 수 있음을 규명하였다.
본 발명의 일 구현예에 있어서, 상기 재조합 벡터는 5'에서 3' 방향으로 상기 뉴클레오캡시드 단백질(NP), 인단백질(P), 매트릭스(M), 융합 단백질(F), 헤마글루티닌 뉴라미니다제(HN) 및 폴리머라제(L)의 단백질을 인코딩하는 뉴클레오타이드 서열을 순차적으로 포함한다.
본 발명의 일 구현예에 있어서, 상기 뉴캐슬병 바이러스 K148/08의 뉴클레오캡시드 단백질(NP), 인단백질(P), 매트릭스(M), 융합 단백질(F), 헤마글루티닌 뉴라미니다제(HN) 및 폴리머라제(L)의 단백질을 인코딩하는 뉴클레오타이드 서열은 각각 서열번호 47 내지 52에 표시된 뉴클레오타이드 서열인 것이다.
본 명세서에서, 용어 "SARS-CoV-2"는 COVID-19 감염병을 유발하는 코로나 바이러스를 의미한다.
SARS-CoV-2는 4가지 주요 구조 단백질, 구체적으로 스파이크(Spike; S) 단백질, 외피(Envelope; E) 단백질, 막(Membrane; M) 단백질 및 뉴클레오캡시드(Nucleocapsid; N) 단백질을 가지는 코로나 바이러스이다. N 단백질은 RNA 지놈을 둘러싸고 있는 단백질인 반면, N 단백질 이외의 3가지 구조 단백질은 바이러스 외피를 구성하는 성분이다.
SARS-CoV-2바이러스의 스파이크(spike, S) 단백질은 부착을 매개하는 S1 서브유닛과, 바이러스 세포막과 숙주 세포의 융합을 매개하는 S2 서브유닛을 포함한다. 특히, S1 서브유닛은 수용체 결합 도메인(receptor binding domain; RBD)을 포함하고, 이는 인간 숙주 세포의 수용체인 안지오텐신 전환 효소 2(angiotensin-converting enzyme; ACE2)와의 강력한 결합력을 통해 대상에게 심각한 코로나-19(COVID-19) 감염병을 유발하는 것으로 알려져 있다. S1 서브유닛과 S2 서브유닛은 S 단백질의 세포 외 도메인(extracellular domain)을 구성한다.
본 발명에 있어서, 상기 벡터는 약독화 균주(lentogenic) 벡터일 수 있으며, 보다 구체적으로는 선형의 플라스미드 백터일 수 있으며, 가장 구체적으로는 기탁번호 KCTC 11570BP로 기탁된 NDV K148/08로부터 유래한 뉴캐슬병 바이러스 벡터일 수 있다.
본 발명에서 사용되는 용어 “뉴캐슬병 바이러스 (Newcastle Disease Virus, NDV)”는 음성(negative sense) 단일가닥 RNA 바이러스로 파라믹소 비리다에(Paramyxoviridae) 과, 모노네가바이랄러스(Mononegavirales) 목, 아불라바이러스(Avulavirus) 속에 속하는 전염성 바이러스이다. NDV 게놈 RNA는 30 base 정도의 extragenic leader 서열을 가지고 있으며 50 base 정도의 tail 서열을 가지고 있다. 양쪽 말단의 두 서열은 바이러스의 유전자의 전사 (transcription)와 복제 (replication) 그리고 새롭게 합성된 RNA 게놈을 바이러스 파티클 안에 봉입 (encapsidation) 과정을 조절하는 것으로 알려져 있다. NDV 유전자 구성은 양쪽 말단 리더와 꼬리 유전자 사이에 NP, P, M, F, HN 및 L을 포함하는 6개의 유전자로 구성되어 있으며 각각의 유전자는 nucleoprotein (NP), phosphoprotein (P), matrix protein (M), fusion protein (F), hemagglutinin-neuraminidase protein (HN), large protein (L)을 암호화하고 있다.
상기 뉴캐슬병 바이러스는 각각의 유전자 사이에 IGS[Gene end (GE), Intergenic sequence (IG), Gene start(GS)] 서열이 존재하고 있으며 숙주세포 감염 초기 각각의 유전자는 전사과정을 거쳐 숙주세포의 소포체(endoplasmic reticulum, ER)으로 이동 단백질을 합성하게 된다. 이후 M protein 합성량이 일정 수준 이상으로 올라가게 되면 (+)sense RNA 게놈을 합성하고 이를 주형으로 하여 (-)sense RNA 게놈을 합성하게 된다. 완성된 바이러스 파티클은 세포 밖으로 배출되게 된다.
상기 뉴캐슬병 바이러스의 외부 유전자 도입 능력은 최대 6 kb 정도인 것으로 알려져 있으며 외래 유전자 도입은 주로 P과 M 유전자 사이 그리고 HN과 L 유전자 사이에 이루어져 왔다. 다만 6개의 유전자 사이에 외래 유전자 도입이 모두 가능한 것으로 알려져 있으나 각각의 위치에 따라 mRNA 발현, 단백질 발현 그리고 심한 경우 바이러스 증식에도 영향이 있는 것으로 알려져 있으나 각각의 위치에 따라 정량적인 비교 시험은 이루어지지 않은 상태이다. 각각의 유전자 사이에는 GE-IG-GS 유전자가 있으며 특히 IG 유전자의 경우 NP-P, P-M, M-F 사이에는 1개 또는 2개의 뉴클레오티드를 가지고 있으며 F-HN 사이는 35개, HN-L 사이는 47개의 뉴클레오티드로 구성되어 있다. 바이러스 감염 후 (-)sense RNA 게놈은 NDV 가 가지고 있는 NP, L 그리고 P 단백질에 의해 감염 초기 각 단백질의 mRNA를 합성하여 합성된 mRNA 가 숙주 세포의 소포체로 이동하여 각 유전자의 단백질을 합성하게 된다. 이후 NP, L, P 그리고 M 단백질의 상호작용에 의해 (+)sense RNA 게놈을 합성하고 이를 주형으로 많은 copy의 (-)sense RNA 게놈을 합성하고 숙주세포 밖으로 방출되게 된다. 최초 감염시 자가 단백질 생산을 위한 mRNA의 합성량은 N말단 에서부터 즉 NP mRNA 가 가장 많이 합성되고 이후 N말단으로부터 멀어질수록 mRNA 합성은 줄어드는 것으로 알려져 있다.
본 발명의 일 구현예에 있어서, 상기 SARS-CoV-2 베타 변이(beta variant) 바이러스는 SARS-CoV-2 베타 B.1.351 변이주인 것이다.
SARS-CoV-2는 RNA 바이러스로, 이들 바이러스는 복제 과정에서 오류가 발생하기 쉽기 때문에 변이를 자주 일으킨다. 상기 변이가 바이러스의 전파력, 병원성, 또는 백신에 대한 면역 반응에 영향을 줄 수 있다. SARS-CoV-2 베타 변이 (B.1.351)는 처음으로 2020년 남아프리카에서 발견되었다. 이 변이는 여러 개의 유전자 변이를 가지고 있으며, 그 중 일부는 바이러스의 S 단백질에 위치해 있다. S 단백질은 바이러스가 호스트 세포에 결합하고 침입하는 데 중요한 역할을 하므로, 이 위치의 변이는 바이러스의 전파력과 병원성에 영향을 줄 수 있다. 베타 변이는 특히 E484K, N501Y, K417N 등의 변이를 포함하고 있다.
본 발명의 일 구현예에 있어서, 상기 재조합 벡터는 서열번호 42의 염기서열을 포함하는 것이다.
본 발명의 일 구현예에 있어서, 상기 재조합 벡터는 서열번호 53의 염기서열로 이루어진 것이다.
본 발명의 일 구현예에 있어서, 상기 SARS-CoV-2 베타 변이(beta variant) 바이러스의 스파이크(spike) 단백질을 인코딩하는 뉴클레오타이드 서열은 스파이크 단백질을 인코딩하는 유전자의 상류에 코작 서열(Kozak sequence)를 포함하는 것이다.
본 발명의 일 구체예에 있어서, 상기 SARS-CoV-2 베타 변이(beta variant) 바이러스의 스파이크(spike) 단백질을 인코딩하는 뉴클레오타이드 서열은 스파이크 단백질을 인코딩하는 유전자의 상류에 코작 서열(Kozak sequence) 및 NCR(non-coding region)을 포함하는 것이다.
본 발명의 일 구현예에 있어서, 상기 SARS-CoV-2 베타 변이(beta variant) 바이러스의 스파이크(spike) 단백질을 인코딩하는 뉴클레오타이드 서열은 논코딩 영역을 추가적으로 포함할 수 있다. 논코딩 영역은 유전자의 발현을 조절하는 조절 요소를 포함하고 있다. 예를 들어, 프로모터(promoter)는 RNA 폴리머라제가 결합하여 전사를 시작하는 지점을 결정하고, 인핸서(enhancer)는 유전자 발현을 증가시키는 역할을 수행한다. 또한 논코딩 영역은 mRNA의 안정성을 증가시킬 수 있다. 예를 들어, 5' cap과 3' poly-A 꼬리는 mRNA 분해를 방지하고, 번역 효율을 높이는 역할을 수행한다. 일부 논코딩 영역은 스플라이싱 사이트를 포함하고 있다. 이는 유전자의 전사 후 가공 과정에서 중요한 역할을 수행한다. 즉, 재조합 벡터를 제작하는데 있어서, 도입하려는 유전자의 코딩 영역뿐 아니라, 적절한 논코딩 영역을 포함시키는 것이 재조합 벡터의 발현 효율 및 안정성에 큰 영향을 끼칠 수 있다.
본 발명의 일 양태에 있어서, 본 발명은 제1항 내지 제5항 중 어느 한 항의 벡터로부터 제조된 재조합 뉴캐슬병 바이러스를 제공한다.
상기 재조합 바이러스는 상기 재조합 벡터로 형질전환 된 동물 세포의 상층액을 발육란(embryonated egg)에 접종한 후 요막액(allantoic fluid)으로 부터 수득되는 것일 수 있다.
본 발명의 일 구현예에 있어서, 상기 뉴캐슬병 바이러스는 표면에 SARS-CoV-2 바이러스 스파이크(spike) 단백질을 발현하는 것이다.
본 발명의 일 양태에 있어서, 본 발명은 상기 재조합 뉴캐슬병 바이러스 또는 이로부터 정제된 항원을 포함하는 SARS-CoV-2 바이러스, 뉴캐슬병 바이러스, 또는 이들의 조합에 대한 예방용 백신 조성물을 제공한다.
일반적으로 백신된 개체에서 감염을 예방할 수 있는 면역 반응을 나타내기 위해서는 일정 정도 이상의 항원량이 접종되어야 하므로, 기준 함량 이상의 바이러스가 포함된 백신의 제조가 매우 중요하다.
대부분의 인플루엔자 바이러스를 이용한 백신의 제조에 있어, 종란을 이용한 증식 과정에서 낮은 역가를 나타내므로 낮은 역가의 바이러스액을 농축시키는 추가적인 공정을 필요로 하고, 이는 백신의 단가를 높아지게 하여 경제성의 문제로 이어진다. 그러나, 높은 역가를 갖는 고증식성의 인플루엔자 바이러스주의 수득이 가능한 경우, 별도로 역가를 높이기 위한 바이러스 농축 과정이 불필요하므로, 높은 백신 효능과 더불어 경제적 이점을 갖는 백신의 제조를 가능케 한다.
본 명세서에서 용어 "백신 조성물"은 대상(subject)의 면역 반응에 긍정적으로 영향을 주는 조성물을 의미한다. 상기 백신 조성물은 대상(subject)에게 세포성 면역 반응, 예를 들어 CTL(Cytotoxic T Lymphocyte) 반응, 또는 체액성 면역 반응, 예를 들어, 항체에 의해 유발되는 향상된 전신적 또는 국소적 면역 반응을 제공한다.
본 명세서에서 용어 "예방"은 질환 또는 질환 상태의 방지 또는 보호적인 치료를 의미한다.
또한, 상기 백신 조성물은 선택에 따라 약제학적으로 허용되는 담체 또는 희석제와 혼합하여 사용될 수 있다. 즉, 본 발명의 일 구현예에 있어서, 본 발명의 백신 조성물은 약제학적으로 허용되는 담체를 추가적으로 포함할 수 있다.
상기 "약제학적 유효량"은 바이러스에 의해 유발되는 질병 또는 병리학적 증상에 대한 예방, 경감 또는 치료적 효능을 달성하는 데 충분한 양을 의미한다. 본 발명의 조성물에 포함될 수 있는 약제학적으로 허용되는 담체는 제제시에통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로오스, 폴리비닐피롤리돈, 셀룰로오스, 물, 시럽, 메틸 셀룰로오스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 제한되는 것은 아니다. 본 발명의 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences(19th ed., 1995)에 상세히 기재되어 있다.
또한, 본 발명인 백신 조성물은 기타 구성성분, 예컨대, 안정화제, 부형제, 기타 약학적 허용 화합물 또는 임의의 기타 항원 또는 그의 일부를 포함할 수 있다. 백신은 냉동 건조된 제제 또는 현탁액의 형태로서 존재할 수 있으며, 이들은 모두 백신 생성 분야에 일반적인 것들이다.
본 발명의 백신 조성물은 이를 필요로 하는 대상(subject)에게 약제학적 유효량으로 투여될 수 있다.
본 발명의 백신 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 대상(subject)의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 결정될 수 있다. 한편, 본 발명의 백신 조성물의 투여량은 바람직하게는 1일 당 0.001-100 mg/kg(체중)이다.
본 발명의 백신 조성물은 경구, 직장, 국소, 정맥내, 복강내, 근육내, 동맥내, 경피, 비측내, 흡입, 안구내 또는 피내 경로를 통해 통상적인 방식으로 투여할 수 있다.
구체적으로, 본 발명의 백신 조성물은 비경구 투여될 수 있다. 본 발명의 비경구 투여는 정맥내, 근육내, 비강내, 복강내, 흉골내, 경피 및 동맥내 주사 및 주입을 포함하는 투여방식을 의미한다.
보다 구체적으로, 본 발명의 백신 조성물의 투여 형태는 복강내, 근육내, 비강 또는 피하 투여용 접종 용도일 수 있다. 상기 비경구 투여는 바람직한 순도 하에 약제학적으로 허용가능한 농도와 투여량에서 수용체에게 비독성이고 다른 제제 성분과 화합할 수 있는 것을 혼합하여 단위 투여량의 제형으로 조제하여야 한다.
본 발명의 일 구현예에 있어서, 상기 백신은 포유동물을 투여 대상(subject)으로 하는 것이다. 상기 포유 동물은 소, 말, 돼지, 양, 염소 또는 사람을 포함하나 이에 한정되지는 않는다. 또는 상기 백신은 조류를 투어 대상으로 하는 것이다. 상기 조류은 닭, 오리, 메추라기, 칠면조, 거위를 포함하는 가금류 및 야생 조류 등일 수 있으나, 이에 제한되는 것은 아니다. 상기 닭은 어린 닭, 육계 및 산란계를 포함한다.
본 발명의 일 구현예에 있어서, 상기 SARS-CoV-2 바이러스는 SARS-CoV-2 베타 변이 바이러스, SARS-CoV-2 델타 변이 바이러스, 또는 이들의 조합인 것이다.
본 발명의 일 구현예에 있어서, 상기 백신은 바이러스가 약독화된 생독 백신 또는 불활화 백신인 것이다.
상기 바이러스 불활화는 증식 단계 이후의 백신 제조에 사용되는 바이러스의 복제를 방지하는 것으로, 일반적으로, 이는 당업계에 공지된 화학적 또는 물리적 수단에 의해 행할 수 있다. 예를 들어, 상기 당업계에 공지된 불활화 방법은, 바이러스에 포르말린, 자외선, 열, BEI(Binary Ethyleneimine), 베타-프로피오락톤(Beta-Propiolactone) 등의 처리로 달성될 수 있다.
본 발명의 일 구현예에 있어서, 상기 백신 조성물은 면역증강물질 또는 어쥬번트를 추가적으로 포함하는 것이다.
보다 구체적으로, 상기 면역증강제(어쥬번트)는 일반적으로 항원에 대한 체액 또는 세포 면역 반응을 증가시키는 임의의 물질(예컨대, alum, 프로인트 완전 어쥬번트, 프로인트 불완전 어쥬번트, LPS, poly IC, poly AU 등)을 의미한다. 본 발명의 면역증강제에는 alum, 완전 프로인트 어쥬번트(Complete Freund's Adjuvant), 불완전 프로인트 어쥬번트(Incomplete Freund's Adjuvant), LPS, poly IC, poly AU, 리포펙틴(Lipofectin), 피로탁시(lipotaxi), CaPO4, DEAE 덱스트란, 폴리브렌(Polybrene), 사포닌, 알루미늄 하이드록시드(aluminum hydroxide)와 같은 무기질, 젤(gel), 리소레시틴(lysolecithin), 플루로릭 폴리올스(pluronic polyols), 플리음이온(polyanions), 펩티드(peptides), 오일 또는 탄화수소 에멀젼과 같은 표면활성물질, 디니트로페놀(dinitrophenol)이 포함되나, 이에 제한되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 백신 조성물은 근육 또는 비강 내 투여되는 것이다.
본 발명의 일 실시예에 있어서, 본 발명자들은 본 발명 백신 조성물이 근육 투여 및 비강 투여되는 경우 대상에 SARS-CoV-2 바이러스에 대한 면역력을 제공하는 것을 확인하였다.
본 발명의 백신의 제형은 어떠한 제형으로도 적용가능하며, 제조한 제형은 경구용, 주사용, 도포용, 분무용으로 사용할 수 있다. 상기 제형은 투여 방법에 따라 적합한 형태로 선택될 수 있다. 예를 들어, 근육 내 투여의 경우 백신 조성물은 주사제의 형태로, 비강 내 투여의 경우 도포제 또는 분무제의 형태로 제작될 수 있다. 비강 내 투여는 비침습적 투여일 수 있으며 분무기 또는 드롭퍼를 통해 수행될 수 있다.
본 발명의 일 구현예에 있어서, 상기 백신 조성물은 105 EID50 내지 108 EID50의 재조합 바이러스를 포함하는 것이다. 예를 들어 상기 백신 조성물은 105.0 EID50 내지 108.0 EID50, 105.2 EID50 내지 108 EID50, 105.4 EID50 내지 108 EID50, 105.6 EID50 내지 108 EID50, 105.8 EID50 내지 108 EID50, 106.0 EID50 내지 108 EID50, 106.2 EID50 내지 108 EID50, 106.4 EID50 내지 108 EID50, 106.6 EID50 내지 108 EID50, 106.8 EID50 내지 108 EID50, 107.0 EID50 내지 108 EID50, 107.2 EID50 내지 108 EID50, 107.4 EID50 내지 108 EID50, 107.6 EID50 내지 107.8 EID50, 105 EID50 내지 107.8 EID50, 105 EID50 내지 107.6 EID50, 105 EID50 내지 107.4 EID50, 105 EID50 내지 107.2 EID50, 105 EID50 내지 107.0 EID50, 105 EID50 내지 106.8 EID50, 105 EID50 내지 106.6 EID50, 105 EID50 내지 106.4 EID50, 105 EID50 내지 106.2 EID50, 105 EID50 내지 106 EID50, 105 EID50 내지 105.8 EID50, 105 EID50 내지 105.6 EID50, 105 EID50 내지 105.4 EID50, 105 EID50 내지 105.2 EID50, 105.2 EID50 내지 107.8 EID50, 105.4 EID50 내지 107.6 EID50, 105.6 EID50 내지 107.4 EID50, 105.8 EID50 내지 107.2 EID50, 또는 106.0 EID50 내지 107.0 EID50의 재조합 바이러스를 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 특징 및 이점을 요약하면 다음과 같다:
(a) 본 발명은 수탁번호 KCTC 11570BP로 기탁된 뉴캐슬병 바이러스 K148/08의 뉴클레오캡시드 단백질(NP), 인단백질(P), 매트릭스(M), 융합 단백질(F), 헤마글루티닌 뉴라미니다제(HN) 및 폴리머라제(L)의 단백질을 인코딩하는 뉴클레오타이드 서열을 포함하고, 상기 P 단백질과 M 단백질을 인코딩하는 뉴클레오타이드 서열 사이에 SARS-CoV-2 베타 변이(beta variant) 바이러스의 스파이크(spike) 단백질을 인코딩하는 뉴클레오타이드 서열을 포함하는, 재조합 벡터를 제공한다.
(b) 본 발명은 상기 벡터로부터 제조된 재조합 뉴캐슬병 바이러스를 제공한다.
(c) 본 발명의 또 다른 목적은 상기 재조합 뉴캐슬병 바이러스 또는 이로부터 정제된 항원을 포함하는 SARS-CoV-2 바이러스, 뉴캐슬병 바이러스, 또는 이들의 조합에 대한 예방용 백신 조성물을 제공한다.
(d) 본 발명의 백신 조성물을 이용하는 경우, 대상의 SARS-CoV-2 바이러스 바이러스 및 뉴캐슬 바이러스에 대한 면역 기능을 활성화할 수 있다.
도 1은 rK148/beta-S의 구조의 모식도를 나타낸다.
도 2는 K148/beta-S의 P와 M 유전자 사이에 NCR(non-coding region), 코작 서열 및 스파이크 유전자가 삽입된 PCR 밴드 사진을 나타낸다.
도 3은 K148과 rK148/beta-S 바이러스의 스파이크 단백질 및 HN 단백질에 대한 웨스턴 블롯팅 결과를 나타낸다.
도 4는 K148 및 rK148/beta-S 바이러스의 생장곡선 비교 결과를 나타낸다.
도 5는 저농도의 K148/beta-S 근육백신접종 후 NDV에 대한 HI 분석 결과를 나타낸다.
도 6은 저농도의 K148/beta-S 근육백신접종 후 SARS-CoV-2에 대한 SARS-CoV-2 ELISA 결과를 나타낸다.
도 7은 저농도의 K148/beta-S 근육백신접종 후 SARS-CoV-2 공격접종에 대한 생존율 및 체중변화를 나타낸다.
도 8은 고농도의 K148/beta-S 근육백신접종 후 NDV에 대한 HI 분석 결과를 나타낸다.
도 9는 고농도의 K148/beta-S 근육백신접종 후 SARS-CoV-2에 대한 SARS-CoV-2 ELISA 결과를 나타낸다.
도 10은 고농도의 K148/beta-S 근육백신접종 후 SARS-CoV-2에 대한 ELISpot 결과를 나타낸다.
도 11은 고농도의 K148/beta-S 근육백신접종 후 SARS-CoV-2 beta variant 공격접종에 대한 생존율 및 체중변화를 나타낸다.
도 12는 고농도의 K148/beta-S 근육백신접종 후 SARS-CoV-2 beta variant 공격접종에 대한 폐 바이러스 농도(lung viral load) 분석 결과를 나타낸다.
도 13은 고농도의 K148/beta-S 근육백신접종 후 SARS-CoV-2 delta variant 공격접종에 대한 생존율 및 체중변화를 나타낸다.
도 14는 고농도의 K148/beta-S 근육백신접종 후 SARS-CoV-2 delta variant 공격접종에 대한 폐 바이러스 농도(lung viral load) 분석 결과를 나타낸다.
도 15는 저농도의 K148/beta-S 비강백신접종 후 NDV에 대한 HI 분석 결과를 나타낸다.
도 16은 저농도의 K148/beta-S 비강백신접종 후 SARS-CoV-2에 대한 SARS-CoV-2 ELISA 결과를 나타낸다.
도 17은 저농도의 K148/beta-S 비강백신접종 후 SARS-CoV-2 beta variant 공격접종에 대한 생존율 및 체중변화를 나타낸다.
도 18은 고농도의 K148/beta-S 비강백신접종 후 NDV에 대한 HI assay 결과를 나타낸다.
도 19는 고농도의 K148/beta-S 비강백신접종 후 SARS-CoV-2에 대한 SARS-CoV-2 ELISA 결과를 나타낸다.
도 20은 고농도의 K148/beta-S 비강백신접종 후 SARS-CoV-2에 대한 ELISpot 결과를 나타낸다.
도 21은 고농도의 K148/beta-S 비강백신접종 후 SARS-CoV-2 beta variant 공격접종에 대한 생존율 및 체중 변화를 나타낸다.
도 22는 고농도의 K148/beta-S 비강백신접종 후 SARS-CoV-2 beta variant 공격접종에 대한 폐 바이러스 농도(lung viral load) 분석 결과를 나타낸다.
도 23은 고농도의 K148/beta-S 비강백신접종 후 SARS-CoV-2 beta variant 공격접종에 대해 폐에서 SARSR-CoV-2 특이적 IgA의 양을 분석한 결과를 나타낸다.
도 24는 고농도의 K148/beta-S 비강백신접종 후 SARS-CoV-2 delta variant 공격접종에 대한 생존율 및 체중 변화를 나타낸다.
도 25는 고농도의 K148/beta-S 비강백신접종 후 SARS-CoV-2 delta variant 공격접종에 대한 폐 바이러스 농도(lung viral load) 분석 결과를 나타낸다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
실시예 1: 재료 및 방법
1-1. 사용된 세포와 바이러스
8%의 Fetal bovine serum과 항생제로 보충된 DMEM(Dulbecco's Modified Eagle Medium, CCL-81; ATCC)에서 CEF(Chicken embryo fibroblast), Vero cell-E6 line 및 Hep-2 세포주를 배양하였다.
K148 뉴캐슬병바이러스 (KCTC 11570BP)를 플라스미드(plasmid)로 만들기 위해 다음과 같은 과정을 수행하였다. K148 NDV 바이러스의 cDNA는 인접한 조각들 간에 약 300 bp의 뉴클레오티드가 중첩되어 있는 6개의 절편으로 나뉘어있다. 6개 절편 모두 유전자별 프라이머 6세트를 사용하여 PCR을 통해 증폭하고, RBC TA cloning vector(RBC Bioscience, Taipei, Taiwan)로 cloning 하였다(표 1). 각 절편은 In-Fusion PCR 복제 키트 (Clontech, Mountain View, CA)를 사용하여 pBluescript 벡터에 순차적으로 삽입되었다. pfuUltraTM II fusion HS DNA polymerase(Stratagene, La Jolla, CA)는 각 절편의 증폭 및 벡터 선형화에 사용되었다. 벡터 플라스미드는 각각의 절편의 삽입 이전에 선형화되었다. Supporting Plasmid를 제작하기 위해 Nucleoprotein(NP), Polymerase(P) 및 Large polymerase(L) 유전자는 발현 플라스미드에 클로닝(cloning) 되었다. 벡터 선형화 및 각 절편의 삽입에 사용되는 프라이머는 표 2에 기재하였다. K148 바이러스의 전장 지놈 cDNA 클론(pK148)은 HIT-DH5αcompetent cell에 형질전환되었고, 37 ℃에서 18시간 동안의 배양 이후 PureLink™HiPure plasmid midiprep kit(Thermo Fisher Scientific, California, USA)을 사용하여 플라스미드를 분리 및 정제하였다.
K148/08 cDNA의 여섯개 절편과 NP, P, L 유전자 증폭에 사용된 프라이머
서열번호 서열 프라이머명
1 5'-ACCAAACAGAGAATCTGTAAGG-3' F1_F
2 5'-TCAGTACCCCCAGTCGG-3' F1_R
3 5'-GTGACCAGATGAGCTTTGC-3' F2_F
4 5'-TTAGCCATTCAGTGCAAGG-3' F2_R
5 5'-GTGCATTGATCATGTCACG-3' F3_F
6 5'-GTCAGTTTGACATTGACCTTG-3' F3_R
7 5'-GATAGAAGAACTTGACACCTC-3' F4_F
8 5'-GAGCCATGCAAACTTGGCTG-3' F4_R
9 5'-ATGGCGRGCTCCGGTCC-3' F5_F
10 5'-AACAGCATTGCATGCATGC-3' F5_R
11 5'-GACTAACCTTCAATACTCAAG-3' F6_F
12 5'-ACCAAACAAAGATTTGGTGAATG-3' F6_R
13 5'-ATGTCTTCTGTATTCGATGAG-3' NP_F
14 5'-TCAGTACCCCCAGTCGG-3' NP_R
15 5'-ATGGCCACCTTYACAGATG-3' P_F
16 5'-TTAGCCATTCAGTGCAAGG-3' P_R
17 5'-ATGGCGRGCTCCGGTCC-3' L_F
18 5'-TTAAGAGTCACAGTTACTRTAATATC-3' L_R
K148 cDNA의 여섯개 절편과 NP, P, L 유전자 증폭에 사용된 프라이머
서열번호 서열 프라이머명
19 5'-ACCAAACAGAGAATCTGTAAGGTACG-3' F1-F
20 5'-gatttggtgaatgacCTCTCATCAAATCCAAAAATTG-3' F1-up-trailer
21 5'-TGGATTTGATGAGAGCGGTGGCAAATAGC-3' F2-F
22 5'-gatttggtgaatgacTTAGCCATTCAGTGCAAGGC-3' F2-up-trailer
23 5'-TGTCACGCCCTATGCATCCGAGCTCC-3' F3-F
24 5'-gatttggtgaatgacGAGATATCGAGATTGCCTGTC-3' F3-up-trailer
25 5'-CAATCTCGATATCTCGACTGAGCTTGG-3' F4-F
26 5'-gatttggtgaatgacAGCCGATTCAAGTATTTTCTTCC-3' F4-up-trailer
27 5'-ATACTTGAATCGGCTTCTCCTGACAC-3' F5-F
28 5'-gatttggtgaatgacCTTCCTCCTACCTACGGAGCTTG-3' F5-up-trailer
29 5'-GTAGGTAGGAGGAAGCAGATTCAGG-3' F6-F
30 5'-gatttggtgaatgacAGAACTACACTCAAGAACAATTAC-3' F6-up-trailer
31 5'-GATTCTCTGTTTGGTccctatagtgagtcgtattagc-3' F1-up
32 5'-CTCTCATCAAATCCAaaaattgggtctc-3' F2-up
33 5'-GCATAGGGCGTGACAtgatcaatgcac-3' F3-up
34 5'-GAGATATCGAGATTGcctgtcacgattac-3' F4-up
35 5'-AGCCGATTCAAGTATtttcttccattgtcg-3' F5-up
36 5'-CTTCCTCCTACCTACggagcttgcttc-3' F6-up
37 5'-gtcattcaccaaatctttgtttg-3' Trailer-down
* 소문자는 Plasmid 부분에 해당되는 프라이머의 서열임.
T7 전사효소 공급을 위한 수정된 Vaccinia Ankara T7 재조합 바이러스(MVA-T7)는Bernard Moss (미국국립보건소; NIH)가 제공해 주었다. MVA-T7 바이러스는 향후 사용을 위해 CEF 세포에서 배양되었다. 질병관리 본부에서 SARS-CoV-2 beta variant (B.1.351 자원번호 43382) 및 delta variant (B.1.167.2 자원번호 43390)을 분양 받았다. SARS-CoV-2 beta variant 및 delta variant는 vero cell-E6를 이용해 배양되었다.
1-2. RNA 준비
SARS-CoV-2 beta variant를 RNeasy 키트(Qiagen, Valencia, CA)를 사용하여 수확된 세포 배양액에서 바이러스 RNA를 추출하였다. cDNA는 SuperScript IV first-Strand system (Thermo Fisher scientific, California)을 사용하여 합성되었다.
1-3. SARS-CoV-2 beta variant의 S 유전자를 포함하는 pK148/beta-S clone 구축
K148/08 전장 유전자 cDNA clone의 P 유전자와 M 유전자 사이에 untranslated region(UTR)와 SARS-CoV-2 beta variant의 스파이크(spike) 유전자 cDNA 조각을 삽입할 수 있도록 pK148을 선형화하였다. SARS-CoV-2 beta variant의 spike 유전자와 NCR(non-coding region)은 PCR에 의해 증폭되어 RBC TA cloning Vector(RBC Bioscience, Taipei, Taiwan)로 복제되었다. 스파이크(spike) 유전자의 발현을 향상시키기 위해 Muta-directTM site-directed Mutagenesis kit (iNtRON Biotechnology, Korea)를 이용하여 스파이크(spike) 유전자의 ATG 상류에 Kozak sequence(CACC)를 삽입하였다. NCR과 변형된 스파이크(spike) 유전자의 cDNA는 In-Fusion® PCR 복제 키트(Clontech, Mountain View, CA)를 사용하여 통하여 pK148의 P와 M 유전자 사이에 삽입되었고 최종적으로 pK148/beta-S clone이 제작되었다(도 1). pK148을 선형화하기 위한 프라이머와 Spike 유전자를 선형화 된 pK148와 Infusion 하기 위한 프라이머는 표 3에 기술하였다. pK148/beta-S 클론은 37℃에서 18시간 동안 HIT-DH5αcompetent 셀에서 증폭되어 PureLinkTMHiPure plasmid midiprep kit를 사용하여 정제되었다.
pK148/beta-S 클론 제작에 사용된 프라이머
서열번호 서열 프라이머명
38 5'- TTAGCCATTCAGTGCAAGGCGC - 3' P-M Insertion-up
39 5'- TCACCACTGCAGCTCGCAGC - 3' P-M Insertion-down
40 5'- gcactgaatggctaaTCACCACTGCAGCTCGCAGCC - 3' Infusion UTR-S_F
41 5'- gagctgcagtggtgaTTATGTGTAATGTAATTTGACTCC - 3' Infusion UTR-S_R
1-4. 바이러스 획득(rescue) 및 증식
풀-지놈(full-genome) cDNA (pK148/beta-S)를 인코딩한 플라스미드와 세가지 서포팅 플라스미드 서포팅(supporting) 플라스미드(N, P and L)를 Hep-2 세포로 형질주입(transfection) 하였다. T7 전사효소(transcriptase)를 공급하기 위해 6-웰 플레이트에 배양된 Hep-2 세포에 MVA-T7 바이러스를 감염시켰다. pK148/beta-S 8.8ug, pSupport_NP 1ug, pSupport_P 0.1ug, pSupport_L 0.1ug을 혼합하였고 리포펙타민 3000((Thermo Fisher Scientific, California, USA)을 사용하여 Hep-2 세포로 형질주입하였다. 37℃ 인큐베이터에서 1시간 배양 후 PBS로 1회 세척하였고 Opti-MEM media로 배지를 교체한 후 37℃, 5% CO2 조건에서 72시간 배양하였다. 이후 세포를 1회 냉동 및 해동하는 과정을 통해 rK148/beta-S 바이러스를 수확하였다. 수확한 바이러스는 10일령 SPF 유정란에 접종되어 37℃에서 3일 동안 배양되었다. 배양 3일 후 접종된 종란을 4℃에서 1시간 동안 냉장하였고 획득(rescue)된 바이러스를 검출하기 위해 요막강 액(Allantoic Fluid)를 Hemagglutination Assay(HA)에 사용하였다. HA 양성 시료는 0.45 μm 주사기필터 (Ministart RC 15, Sartorius Stedim Biotech, Germany)를 통해 필터링한 후 10일령 SPF 유정란에 계대 접종하였다. 계대 후 종란의 요막강 액(Allantoic fluid)를 수확 및 소분하였고, 추가 실험을 위해 -80℃에서 저장되었다.
1-5. 바이러스 정제 및 웨스턴 블롯팅(western blotting)
rK148/beta-S 바이러스 외피에 SARS-CoV-2의 스파이크(spike)가 발현되었는지 확인하기 위해 10일령 SPF 종란에 감염 시켜 3일뒤에 수확하였다. 수확한 용액은 원심분리를 (3000rpm, 10min, 4℃) 통해 상층액만 회수하였다. 회수된 상층액은 0.2% 포르말린 용액과 혼합하여 불활화 하였다. 불활화된 바이러스는 초원심분리를 (18000rpm, 1hr 30min, 4℃) 통해 바이러스를 펠렛(pellet)화 하였다. 펠렛은 수크로오즈(20%-50%)를 이용한 밀도구배원심분리 (25000rpm, 1hr 30min, 4℃) 통해 정제하였다. 정제된 바이러스는 SDS PAGE 이후 트랜스퍼(tansfer)를 통해 멤브레인(membranse)으로 옴겨졌다. 1차 항체는 SARS/SARS-CoV-2 Spike protein S2 monoclonal antibody(1A9)를 사용하였고, 2차 항체는 HRP-conjugated anti-mouse IgG를 사용하였다. NDV의 HN 단백질을 확인하기 위해 1차항체는 anti NDV HN mouse IgG antibody를 사용하였으며, 2차 항체로 HRP conjugated mouse IgG antibody를 사용하였다.
1-6. 바이러스 생장 곡선 분석
획득(rescue)된 rK148/beta-S 바이러스의 안정성 및 증폭 특성을 확인하여 10진 희석된 K148과 rK148/beta-S 바이러스(10EID50)를 10일령 SPF 유정란에 접종하였다. 접종된 종란의 요막강 액을 12, 24, 36, 48, 60, 72, 84, 96h 시간 째에 회수하였고 각 시간 대별 바이러스 배양액의 RNA를 추출하여 qPCR을 통하여 바이러스의 양을 정량하였다. 표준 곡선를 통하여 CT value를 EID50/mL으로 변환하였다.
1-7. 동물 실험 (근육)
Jackson Lab for Genomic Medicine(USA)사에서 판매되는 7주령 K18-hACE2 형질전환 마우스를 93마리를 구매하였다. 7주령 K18-hACE2 형질전환 마우스는 표4 및 표 5에 설명된 대로 총 7그룹으로 나누어 사육하였다. 백신 접종 그룹은 근육으로 106EID50 용량 또는 107EID50 용량의 rK148/beta-S를 사용하여 백신 접종하였다(각각 107EID50/ml, 108EID50/ml 농도의 백신을 100 ㎕ 접종). Mock 백신 접종 그룹은 PBS로 백신 접종하였다. 2차 백신접종은 1차 백신 접종 후 4주에 수행되었다. 백신 접종된 마우스의 임상징후는 1주마다 평가하였다. 1차 백신 접종 후 4, 6 및 8주에 채혈을 통하여 혈청을 분리하였다. 2차 백신접종 후 4주에 고농도 그룹에서 ELISpot 분석을 위한 5마리를 제외하고 모든 개체에게 SRAS-CoV-2 beta variant(B.1.351) 및 SARS-CoV-2 delta variant(B.1.167.2) 100 lethal dose(LD50)을 공격접종 하였다. 고농도 그룹은 공격접종 후 3일차와 6일차에 3마리씩 부검을 진행하였으며 임상 징후, 체중 및 사망률은 매일 기록하였다. 백신접종은 BSL-2 시설에서, 공격접종 연구는 건국대학교 ABSL-3 시설에서 수행하였다.
저농도 근육 백신 그룹 표
Group Vaccine
(live) 		Dose Challenge virus
(SARS-CoV-2) 		Number
1 rK148/beta-S 106EID50 Beta variant 7
2 PBS - Beta variant 7
고농도 근육 백신 그룹 표
Group Vaccine
(live) 		Dose Challenge virus
(SARS-CoV-2) 		Number
1 rK148/beta-S 107EID50 Beta variant 18
2 K148/08(NDV) 107EID50 Beta variant 10
3 PBS - Beta variant 18
4 rK148/beta-S 107EID50 Delta variant 13
5 PBS - Delta variant 13
1-8. 동물 실험 (비강)
Jackson Lab for Genomic Medicine(USA)사에서 판매되는 7주령 K18-hACE2 형질전환 마우스를 101마리를 구매하였다. 7주령 K18-hACE2 형질전환 마우스는 표 6 및 표 7에 설명된 대로 총 7그룹으로 나누어 사육하였다. 백신 접종 그룹은 비강으로 106EID50 용량 또는 107EID50 용량의 rK148/beta-S를 사용하여 백신 접종하였다(각각 107EID50/ml, 108EID50/ml 농도의 백신을 100 ㎕ 접종). 비강에 대한 백신 투여는 파이펫을 통해 100 ㎕를 코로 흘려보내는 방법으로 수행되었다. Mock 백신 접종 그룹은 PBS로 백신 접종하였다. 2차 백신접종은 1차 백신 접종 후 4주에 수행되었다. 백신 접종된 마우스의 임상징후는 1주마다 평가하였다. 1차 백신 접종 후 4, 6 및 8주에 채혈을 통하여 혈청을 분리하였다. 2차 백신접종 후 4주에 고농도 그룹에서 ELISpot 분석을 위한 5마리를 제외하고 모든 개체에게 SRAS-CoV-2 beta variant(B.1.351) 및 SARS-CoV-2 delta variant(B.1.167.2) 100 lethal dose(LD50)을 공격접종 하였다. 고농도 그룹은 공격접종 후 3일차와 6일차에 3마리씩 부검을 진행하였으며 임상 징후, 체중 및 사망률은 매일 기록하였다. 백신접종 실험은 BSL-2 시설에서, 공격접종 연구는 건국대학교 ABSL-3 시설에서 수행하였다.
저농도 비강 백신 그룹 표
Group Vaccine
(live) 		Dose Challenge virus
(SARS-CoV-2) 		Number
1 PBS - Beta variant 7
2 rK148/beta-S 106EID50 Beta variant 7
고농도 비강 백신 그룹 표
Group Vaccine
(live) 		Dose Challenge virus
(SARS-CoV-2) 		Number
1 PBS - Beta variant 18
2 K148/08(NDV) 107EID50 Beta variant 18
3 rK148/beta-S 107EID50 Beta variant 18
4 PBS - Delta variant 13
5 rK148/beta-S 107EID50 Delta variant 13
1-9. 혈청학적 분석
백신 접종 이후 바이러스에 대한 항체의 정도를 확인하기 위해 1차 백신 접종 후 4, 6 및 8주차에 마우스의 혈액을 채취하여 혈청을 분리하였다. 분리된 혈청은 56℃에 30분 비동화를 실시하였다. RDE(receptor destroying enzyme)와 1:3 비율로 혼합하여 보체계를 비활성화 하였다. 비동화된 혈청을 PBS에서 2진 희석하고 4 HAU의 NDV 항원을 상온에서 40분 동안 보관하였다. 그후 1% 칠면조 혈구와 혼합후 OIE의 표준 프로토콜에 따라 NDV의 K148/08주에 대한 혈구 응집 억제능을 확인하였다. SARS-CoV-2의 항체 정도를 확인하기 위하여, SARS-CoV-2 Surrogate ELISA(Bionote, Korea)를 이용하여 확인하였다. 마우스 혈청을 1/10희석하여 SARS-CoV-2 Surrogate ELISA의 표준 프로토콜을 따라 SARS-CoV-2의 항체 정도를 확인하였으며, PI value 30이하는 음성으로 기록하였다.
1-10. SARS-CoV-2 S 항원에 대한 IFN-r ELISpot
백신 접종 이후 바이러스에 대한 T cell면역을 확인하기 위해 2차 백신 접종 후 4주차에 마우스의 비장을 적출하였다. 적출된 비장은 70um cell strainer를 이용하여 싱글 셀(single cell)로 분리하였다. 분리된 셀은 RBC 용해 버퍼(Sigma Aldrich, USA)를 이용하여 적혈구를 제거하였다. 셀의 농도를 확인하고 IFN-r ELISpot kit(3321-APW-10, Mabtech, Sweden)에 5X105cell/웰이 되도록 분주하였다. SARS-CoV-2에 대한 IFN-r에 반응여부를 확인하기 위해 Peptivator SARS-CoV-2 prot_S1(Miltenyi Biotec, Germany)를 1/100으로 희석하여 각 웰 마다 50ul씩 넣어주었다. 5% CO2, 37℃ 세포배양기에서 24시간 반응하였다. IFN-r ELISpot kit에서 제공하는 시약들과 방법을 통하여 발색하였다. 발색된 웰은 AID ispot(AID GmbH, Germany)를 통하여 스팟(spot)수를 확인하였다.
1-11. 조직에서 바이러스 역가 및 SARS-CoV-2 특이적 IgA 확인
공격접종 이후 각각의 마우스에 대해서 부검을 실시하여 폐를 분리하였다. 분리된 폐는 10%(w/v)PBS로 유제를 진행하였다. 유제액은 Vero E6 셀을 이용하여 TCDI50/mL을 측정하였다.
SARS-CoV-2 특이적 IgA는 마우스 항-2019 nCOV(S)IgA ELISA kit(FineTest, china)를 이용하여 측정하였다. 마우스 항-2019 nCOV(S)IgA ELISA kit의 표준 프로코톨을 따라 마우스 유제액을 1/50 희석하여 진행하였다.
실시예 2: rK148/beta-S 바이러스의 제작 및 단백질 발현 확인
SARS-CoV-2 beta variant 바이러스의 스파이크 단백질(S 단백질)을 발현하는 뉴캐슬 바이러스가 성공적으로 제작되었는지 여부를 확인하였다.
결과는 도 2 및 도 3에 나타내었다.
도 2에 나타낸 바와 같이, K148 전장 유전자를 인코딩 하고 있는 플라스미드에 SARS-CoV-2의 S 유전자가 성공적으로 삽입된 것을 확인할 수 있었다. 형질주입 이후 rK148/beta-S가 성공적으로 획득된 것을 혈구 응집능으로 확인하였다. 10일령 SPF에 추가 계대를 3회 진행하여 rK148/beta-S의 유전자를 확인하였고 스파이크(spike) 유전자 서열 내에 변이가 없는 것을 확인하였다.
도 3에 나타낸 바와 같이, 웨스턴블롯 결과 (lane 1: rK148/beta-S, lane 2: K148/08) 약 190 kDa에 스파이크(spike) 단백질, 70 kDa에 S2 단백질이 확인되어 재조합 바이러스 외피에 SARS-CoV-2의 스파이크(spike) 단백질이 발현된 것을 확인할 수 있었다.
실시예 3: rK148/beta-S 바이러스 생장 곡선 분석
제작한 재조합 바이러스의 생장 능력을 확인하고자 하였다.
결과는 도 4에 나타내었다.
도 4에 나타낸 바와 같이, rK148/beta-S와 K148 바이러스의 생장 곡선을 분석한 결과 두 바이러스 최고 역가 확인 시 K148 109.5EID50/ml, rK148/beta-S는 109.5EID50/ml으로 유의적인 차이는 확인되지 않았다.
실시예 4: K18-hACE2 형질전환 마우스를 이용한 저농도 rK148/beta-S 백신의 근육 내 투여시 면역반응과 공격접종 후 생존율 및 바이러스 배출 정도 확인
제작한 재조합 바이러스의 면역 반응 유도 효과를 분석하기 위해, 저농도 rK148/beta-S 백신의 근육 내 투여 후 뉴캐슬 바이러스 또는 SARS-CoV-2 바이러스를 투여하여 면역 반응 정도를 분석하였다.
결과는 도 5 및 도 6에 나타내었다.
도 5에 나타낸 바와 같이, 뉴캣슬병 바이러스에 대한 면역반응을 혈구응집억제능(HI) 분석으로 확인한 결과, 그룹 1에서 뉴캣슬병 바이러스에 대한 혈구응집억제능이 확인되었으며, 2차 백신후 4주차에 4.71 (±2.8 Log2)로 확인되었다.
도 6에 나타낸 바와 같이, SARS-CoV-2에 대한 면역반응을 ELISA를 통해 확인한 결과, 그룹 1에서 SARS-CoV-2에 대한 항체가 확인되었으며, 2차 백신 후 4주차에 48.9 (±14.9 PI value)로 확인되었다.
제작한 재조합 바이러스의 면역 반응 유도 효과 분석을 위해, 저농도 rK148/beta-S 백신의 근육 내 투여 후 SARS-CoV-2 beta variant 바이러스를 공격접종하여 생존율 및 체중 변화 정도를 확인하였다.
결과는 도 7에 나타내었다.
도 7의 A에 나타낸 바와 같이, SARS-CoV-2 beta variant를 공격접종 하고 9일차까지 그룹 2는 모두 폐사 하였으며, 그룹 1은 14일차까지 2마리 폐사 하여 72%의 생존율을 보여주었다. 도 7의 B에 나타낸 바와 같이, 그룹 2는 공격접종 4일차부터 급격하게 체중이 감소하였으나, 그룹 1은 폐사한 개체를 제외하고 체중이 감소하지 않았다.
실시예 5: K18-hACE2 형질전환 마우스를 이용한 고농도 rK148/beta-S 백신의 근육 내 투여시 면역반응과 공격접종 후 생존율 및 바이러스 배출 정도 확인
제작한 재조합 바이러스의 면역 반응 유도 효과를 분석하기 위해, 고농도 rK148/beta-S 백신의 근육 내 투여 후 뉴캐슬 바이러스 또는 SARS-CoV-2 바이러스를 투여하여 면역 반응 정도를 분석하였다.
결과는 도 8 및 도 9에 나타내었다.
도 8에 나타낸 바와 같이, 뉴캣슬병 바이러스에 대한 면역반응을 혈구응집억제능(HI) 분석으로 확인한 결과, PBS 그룹을 제외한 나머지 그룹에서 뉴캣슬병 바이러스에 대한 혈구응집억제능이 확인되었으며, 2차 백신후 4주차에 그룹 1는 5.0 (± 0.8 Log2), 그룹 2은 4.9(± 0.7 Log2)로 확인되었다.
도 9에 나타낸 바와 같이, SARS-CoV-2에 대한 면역반응은 ELISA를 통해 확인하였다. 그룹 1에서 SARS-CoV-2에 대한 항체가 확인되었으며, 2차 백신 후 4주차에 그룹 1은 60.1 (±10.7 PI value)로 확인되었다.
제작한 재조합 바이러스의 면역 반응 유도 효과를 분석하기 위해 세포성 면역에 대한 반응 정도를 IFN-r ELISpot을 이용하여 측정하였다.
결과는 도 10에 나타내었다.
도 10에 나타낸 바와 같이, SARS-CoV-2의 S 단백질에 대한 ELISpot은 그룹 1에서만 212.4(±48.1)로 확인되었다.
제작한 재조합 바이러스의 면역 반응 유도 효과 분석을 위해, 고농도 rK148/beta-S 백신의 근육 내 투여 후 SARS-CoV-2 beta variant 바이러스를 공격접종하여 생존율 및 체중 변화 정도를 확인하였다.
결과는 도 11에 나타내었다.
도 11의 A에 나타낸 바와 같이, SARS-CoV-2 beta variant 공격접종 결과 9일차까지 그룹 2 및 그룹 3은 모두 폐사하였으며, 그룹 1은 100% 생존하였다. 도 11의 B에 나타낸 바와 같이, 공격접종 후 체중의 변화도 그룹 2, 3은 4일차부터 감소하기 시작하였으나, 그룹 1은 체중변화가 일어나지 않았다.
제작한 재조합 바이러스의 면역 반응 유도 효과 분석을 위해, 고농도 rK148/beta-S 백신의 근육 내 투여 후 SARS-CoV-2 beta variant 바이러스를 공격접종하여 공격접종하여 폐에서 바이러스 배출량을 분석하고자 하였다. 공격접종 3일 및 6일차에 각각 3마리씩 부검하여 폐의 바이러스 농도(lung viral load)를 측정하였다.
결과는 도 12에 나타내었다.
도 12의 A에 나타낸 바와 같이, 공격접종 후 3일차에 폐에서 SARS-CoV-2 beta variant에 대한 바이러스 농도(viral load)는 그룹 1은 102.3TCID50/mL로 그룹 2(105.7TCID50/mL) 와 그룹 3(105.5TCID50/mL)보다 현저히 낮은 값을 보여주었다. 또한 도 12의 B에 나타낸 바와 같이, 공격접종 후 6일차에 폐에서 SARS-CoV-2 beta variant에 대한 바이러스 농도(viral load)는 그룹 1은 102.0TCID50/mL로 그룹 3(103.5TCID50/mL) 보다 현저히 낮은 값을 보여주었다.
제작한 재조합 바이러스가 다양한 변이 SARS-CoV-2 바이러스에 대한 면역 반응을 유도하는지 분석하기 위해, 고농도 rK148/beta-S 백신의 근육 내 투여 후 SARS-CoV-2 delta variant 바이러스를 공격접종하여 생존율 및 체중 변화 정도를 확인하였다.
결과는 도 13에 나타내었다.
도 13의 A에 나타낸 바와 같이, SARS-CoV-2 delta variant 공격접종 결과 7일차까지 그룹 5는 모두 폐사하였으며, 그룹 4는 100% 생존하였다. 도 13의 B에 나타낸 바와 같이, 공격접종 후 체중의 변화도 그룹 5는 4일차부터 감소하기 시작하였으나, 그룹 4은 체중변화가 일어나지 않았다.
제작한 재조합 바이러스가 다양한 변이 SARS-CoV-2 바이러스에 대한 면역 반응을 유도하는지 분석하기 위해, 고농도 rK148/beta-S 백신의 근육 내 투여 후 SARS-CoV-2 delta variant 바이러스를 공격접종하여 폐에서 바이러스 배출량을 분석하고자 하였다. 공격접종 3일 및 6일차에 각각 3마리씩 부검하여 폐의 바이러스 농도(lung viral load)를 측정하였다.
결과는 도 14에 나타내었다.
도 14의 A에 나타낸 바와 같이, 공격접종 후 3일차에 폐에서 SARS-CoV-2 delta variant에 대한 바이러스농도(viral load)는 그룹 4는 102.6TCID50/mL로 그룹 5(104.6TCID50/mL)보다 현저히 낮은 값을 보여주었다. 또한 도 14의 B에 나타낸 바와 같이, 공격접종 후 6일차에 폐에서 SARS-CoV-2 delta variant에 대한 바이러스 농도(viral load)는 그룹 4는 102.0TCID50/mL로 그룹 5(103.1TCID50/mL) 보다 현저히 낮은 값을 보여주었다.
상기 결과로부터 본원의 재조합 바이러스 백신은 SARS-CoV-2 beta variant 뿐만 아니라, delta variant 등 다양한 변이 SARS-CoV-2 바이러스에 대한 면역력을 향상시키는 것으로 판단된다.
실시예 6: K18-hACE2 형질전환 마우스를 이용한 저농도 rK148/beta-S 백신의 비강 내 투여시 면역반응과 공격접종 후 생존율 및 바이러스 배출 정도 확인
제작한 재조합 바이러스의 면역 반응 유도 효과를 분석하기 위해, 저농도 rK148/beta-S 백신의 비강 내 투여 후 뉴캐슬 바이러스 또는 SARS-CoV-2 바이러스를 투여하여 면역 반응 정도를 분석하였다.
결과는 도 15 및 도 16에 나타내었다.
도 15에 나타낸 바와 같이, 뉴캣슬병 바이러스에 대한 면역반응을 혈구응집억제능(HI) assay으로 확인한 결과, 그룹1에서 뉴캣슬병 바이러스에 대한 혈구응집억제능이 확인되었으며, 2차 백신후 4주차에 3.5 (±0.7 Log2)로 확인되었다.
도 16에 나타낸 바와 같이, SARS-CoV-2에 대한 면역반응을 ELISA를 통해 확인한 결과, 그룹 1에서 SARS-CoV-2에 대한 항체가 확인되었으며, 2차 백신 후 4주차에 51.3 (±11.3 PI value)로 확인되었다.
제작한 재조합 바이러스의 면역 반응 유도 효과 분석을 위해, 저농도 rK148/beta-S 백신의 비강 내 투여 후 SARS-CoV-2 beta variant 바이러스를 공격접종하여 생존율 및 체중 변화 정도를 확인하였다.
결과는 도 17에 나타내었다.
도 17의 A에 나타낸 바와 같이, SARS-CoV-2 beta variant를 공격접종 하고 8일차까지 그룹 2는 모두 폐사 하였으며, 그룹 1은 14일차까지 1마리 폐사 하여 86%의 생존율을 보여주었다. 도 17의 B에 나타낸 바와 같이, 그룹2는 공격접종 4일차부터 급격하게 체중이 감소하였으나, 그룹 1은 폐사한 개체를 제외하고 체중이 감소하지 않았다.
실시예 7: K18-hACE2 형질전환 마우스를 이용한 고농도 rK148/beta-S 백신의 비강 내 투여시 면역반응과 공격접종 후 생존율 및 바이러스 배출 정도 확인
제작한 재조합 바이러스의 면역 반응 유도 효과를 분석하기 위해, 고농도 rK148/beta-S 백신의 비강 내 투여 후 뉴캐슬 바이러스 또는 SARS-CoV-2 바이러스를 투여하여 면역 반응 정도를 분석하였다.
결과는 도 18 및 도 19에 나타내었다.
도 18에 나타낸 바와 같이, 뉴캣슬병 바이러스에 대한 면역반응을 혈구응집억제능(HI) assay으로 확인한 결과, PBS 그룹을 제외한 나머지 그룹에서 뉴캣슬병 바이러스에 대한 혈구응집억제능이 확인되었으며, 2차 백신후 4주차에 그룹1은 5.3 (±1.2 Log2), 그룹 2는 5.1(±1.1 Log2)로 확인되었다.
도 19에 나타낸 바와 같이, SARS-CoV-2에 대한 면역반응은 ELISA를 통해 확인하였다. 그룹 1에서 SARS-CoV-2에 대한 항체가 확인되었으며, 2차 백신 후 4주차에 그룹1은 55.2 (±11.1 PI value)로 확인되었다.
제작한 재조합 바이러스의 면역 반응 유도 효과를 분석하기 위해 세포성 면역에 대한 반응 정도를 IFN-r ELISpot을 이용하여 측정하였다.
결과는 도 20에 나타내었다.
도 20에 나타낸 바와 같이, SARS-CoV-2의 S 단백질에 대한 ELISpot은 그룹1에서만 318.6 (±64.0)로 확인되었다.
제작한 재조합 바이러스의 면역 반응 유도 효과 분석을 위해, 고농도 rK148/beta-S 백신의 비강 내 투여 후 SARS-CoV-2 beta variant 바이러스를 공격접종하여 생존율 및 체중 변화 정도를 확인하였다.
결과는 도 21에 나타내었다.
도 21의 A에 나타낸 바와 같이, SARS-CoV-2 beta variant 공격접종 결과 9일차까지 그룹 2 및 그룹 3은 모두 폐사하였으며, 그룹 1은 100% 생존하였다. 도 21의 B에 나타낸 바와 같이, 공격접종 후 체중의 변화도 그룹 2, 3은 4일차부터 감소하기 시작하였으나, 그룹 1은 체중변화가 일어나지 않았다.
제작한 재조합 바이러스의 면역 반응 유도 효과 분석을 위해, 고농도 rK148/beta-S 백신의 비강 내 투여 후 SARS-CoV-2 beta variant 바이러스를 공격접종하여 공격접종하여 폐에서 바이러스 배출량 및 SARS-CoV-2 특이적 항체 생성량을 분석하고자 하였다. 공격접종 3일 및 6일차에 각각 3마리씩 부검하여 폐의 바이러스 농도(lung viral load)와 SARS-CoV-2 특이적 IgA의 양을 측정하였다.
결과는 도 22 및 도 23에 나타내었다.
도 22에 나타낸 바와 같이, 공격접종 후 3일차에 폐에서 SARS-CoV-2 beta variant에 대한 바이러스 농도(viral load)는 그룹 1은 102.2TCID50/mL로 그룹 2(104.7TCID50/mL) 와 그룹 3(104.5TCID50/mL)보다 현저히 낮은 값을 보여주었다. 또한 공격접종 후 6일차에 폐에서 SARS-CoV-2 beta variant에 대한 바이러스 농도(viral load)는 그룹 1은 검출되지 않았으며 그룹 2(102.6TCID50/mL), 그룹 3(102.6TCID50/mL) 보다 현저히 낮은 값을 보여주었다.
도 23에 나타낸 바와 같이, 폐에 존재하는 SARS-CoV-2 특이적 IgA는 공격접종 3일차에 그룹 1에서 65.6 (±9.1 ng/mL), 6일차에 그룹 1에서 176.4 (±29.8 ng/mL)로 검출되었으며, 그룹2, 3은 거의 검출되지 않았다.
제작한 재조합 바이러스가 다양한 변이 SARS-CoV-2 바이러스에 대한 면역 반응을 유도하는지 분석하기 위해, 고농도 rK148/beta-S 백신의 비강 내 처리 후 SARS-CoV-2 delta variant 바이러스를 공격접종하여 생존율 및 체중 변화 정도를 확인하였다.
결과는 도 24에 나타내었다.
도 24의 A에 나타낸 바와 같이, SARS-CoV-2 delta variant 공격접종 결과 7일차까지 그룹 5는 모두 폐사하였으며, 그룹 4는 100% 생존하였다. 도 24의 B에 나타낸 바와 같이, 공격접종 후 체중의 변화도 그룹 5는 4일차부터 감소하기 시작하였으나, 그룹 4은 체중변화가 일어나지 않았다.
제작한 재조합 바이러스가 다양한 변이 SARS-CoV-2 바이러스에 대한 면역 반응을 유도하는지 분석하기 위해, 고농도 rK148/beta-S 백신의 비강 내 투여 후 SARS-CoV-2 delta variant 바이러스를 공격접종하여 폐에서 바이러스 배출량을 분석하고자 하였다. 공격접종 3일 및 6일차에 각각 3마리씩 부검하여 폐의 바이러스 농도(lung viral load)를 측정하였다.
결과는 도 25에 나타내었다.
도 25에 나타낸 바와 같이, 공격접종 후 3일차에 폐에서 SARS-CoV-2 delta variant에 대한 바이러스 농도(viral load)는 그룹 4은 102.1TCID50/mL로 그룹 5(104.7TCID50/mL)보다 현저히 낮은 값을 보여주었다. 또한 공격접종 후 6일차에 폐에서 SARS-CoV-2 delta variant에 대한 바이러스 농도(viral load)는 그룹 4은 102.0TCID50/mL로 그룹 5(102.8TCID50/mL) 보다 현저히 낮은 값을 보여주었다.
상기 결과로부터 본원의 재조합 바이러스 백신은 SARS-CoV-2 beta variant 뿐만 아니라, delta variant 등 다양한 변이 SARS-CoV-2 바이러스에 대한 면역력을 향상시키는 것으로 판단된다.

Claims (13)

  1. 수탁번호 KCTC 11570BP로 기탁된 뉴캐슬병 바이러스 K148/08의 뉴클레오캡시드 단백질(NP), 인단백질(P), 매트릭스(M), 융합 단백질(F), 헤마글루티닌 뉴라미니다제(HN) 및 폴리머라제(L)의 단백질을 인코딩하는 뉴클레오타이드 서열을 포함하고,
    상기 P 단백질과 M 단백질을 인코딩하는 뉴클레오타이드 서열 사이에 SARS-CoV-2 베타 변이(beta variant) 바이러스의 스파이크(spike) 단백질을 인코딩하는 뉴클레오타이드 서열을 포함하는, 재조합 벡터.
  2. 제1항에 있어서, 상기 SARS-CoV-2 베타 변이(beta variant) 바이러스는 SARS-CoV-2 베타 B.1.351 변이주인 것인, 재조합 벡터.
  3. 제1항에 있어서, 상기 재조합 벡터는 서열번호 42의 염기서열을 포함하는 것인, 재조합 벡터.
  4. 제1항에 있어서, 상기 재조합 벡터는 서열번호 53의 염기서열로 이루어진 것인, 재조합 벡터.
  5. 제1항에 있어서, 상기 SARS-CoV-2 베타 변이(beta variant) 바이러스의 스파이크(spike) 단백질을 인코딩하는 뉴클레오타이드 서열은 스파이크 단백질을 인코딩하는 유전자의 상류에 코작 서열(Kozak sequence)을 포함하는 것인, 재조합 벡터.
  6. 제1항 내지 제5항 중 어느 한 항의 벡터로부터 제조된 재조합 뉴캐슬병 바이러스.
  7. 제6항에 있어서, 상기 뉴캐슬병 바이러스는 표면에 SARS-CoV-2 바이러스 스파이크(spike) 단백질을 발현하는 것인, 재조합 뉴캐슬병 바이러스.
  8. 제6항의 재조합 뉴캐슬병 바이러스 또는 이로부터 정제된 항원을 포함하는 SARS-CoV-2 바이러스, 뉴캐슬병 바이러스, 또는 이들의 조합에 대한 예방용 백신 조성물.
  9. 제8항에 있어서, 상기 SARS-CoV-2 바이러스는 SARS-CoV-2 베타 변이 바이러스, SARS-CoV-2 델타 변이 바이러스, 또는 이들의 조합인 것인, SARS-CoV-2 바이러스, 뉴캐슬병 바이러스, 또는 이들의 조합에 대한 예방용 백신 조성물.
  10. 제8항에 있어서, 상기 백신은 바이러스가 약독화된 생독 백신 또는 불활화 백신인 것인, SARS-CoV-2 바이러스, 뉴캐슬병 바이러스, 또는 이들의 조합에 대한 예방용 백신 조성물.
  11. 제8항에 있어서, 상기 백신 조성물은 면역증강물질 또는 어쥬번트를 추가적으로 포함하는 것인, SARS-CoV-2 바이러스, 뉴캐슬병 바이러스, 또는 이들의 조합에 대한 예방용 백신 조성물.
  12. 제8항에 있어서, 상기 백신 조성물은 근육 또는 비강 내 투여되는 것인, SARS-CoV-2 바이러스, 뉴캐슬병 바이러스, 또는 이들의 조합에 대한 예방용 백신 조성물.
  13. 제8항에 있어서, 상기 백신 조성물은 105 EID50 내지 108 EID50의 재조합 바이러스를 포함하는 것인, SARS-CoV-2 바이러스, 뉴캐슬병 바이러스, 또는 이들의 조합에 대한 예방용 백신 조성물.
PCT/KR2023/020554 2022-12-14 2023-12-13 Sars-cov-2 바이러스 백신 WO2024128804A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20220175236 2022-12-14
KR10-2022-0175236 2022-12-14

Publications (1)

Publication Number Publication Date
WO2024128804A1 true WO2024128804A1 (ko) 2024-06-20

Family

ID=91485345

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/020554 WO2024128804A1 (ko) 2022-12-14 2023-12-13 Sars-cov-2 바이러스 백신

Country Status (2)

Country Link
KR (1) KR20240097997A (ko)
WO (1) WO2024128804A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101099629B1 (ko) * 2009-10-27 2011-12-29 건국대학교 산학협력단 신규한 뉴캣슬병 바이러스 ｋ148/08주, 및 그 바이러스를 함유하는 뉴캣슬병 백신
KR102348854B1 (ko) * 2019-10-17 2022-01-12 주식회사 카브 락토바실러스 플란타룸 및 뉴캣슬병 바이러스를 포함하는 백신 조성물

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102399308B1 (ko) 2020-11-10 2022-05-20 주식회사 비엘 코로나바이러스의 스파이크 단백질 및 뉴클레오캡시드 단백질을 동시발현하는 복제불능 아데노바이러스를 이용한 코로나바이러스 백신

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101099629B1 (ko) * 2009-10-27 2011-12-29 건국대학교 산학협력단 신규한 뉴캣슬병 바이러스 ｋ148/08주, 및 그 바이러스를 함유하는 뉴캣슬병 백신
KR102348854B1 (ko) * 2019-10-17 2022-01-12 주식회사 카브 락토바실러스 플란타룸 및 뉴캣슬병 바이러스를 포함하는 백신 조성물

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
KIM DEOK-HWAN, LEE JIHO, YOUK SUNGSU, JEONG JEI-HYUN, LEE DA-YE, JU HYO-SEON, YOUN HA-NA, KIM JIN-CHEOL, PARK SOO-BIN, PARK JI-EUN: "Intramuscular administration of recombinant Newcastle disease virus expressing SARS-CoV-2 spike protein protects hACE-2 TG mice against SARS-CoV-2 infection", VACCINE, ELSEVIER, AMSTERDAM, NL, vol. 41, no. 33, 1 July 2023 (2023-07-01), AMSTERDAM, NL , pages 4787 - 4797, XP093181554, ISSN: 0264-410X, DOI: 10.1016/j.vaccine.2023.05.071 *
SUN WEINA, LIU YONGHONG, AMANAT FATIMA, GONZÁLEZ-DOMÍNGUEZ IRENE, MCCROSKERY STEPHEN, SLAMANIG STEFAN, COUGHLAN LYNDA, ROSADO VICT: "A Newcastle disease virus expressing a stabilized spike protein of SARS-CoV-2 induces protective immune responses", NATURE COMMUNICATIONS, NATURE PUBLISHING GROUP, UK, vol. 12, no. 1, 27 October 2021 (2021-10-27), UK, pages 6197, XP093181550, ISSN: 2041-1723, DOI: 10.1038/s41467-021-26499-y *
SUN WEINA, SUN WEINA, LEIST SARAH, MCCROSKERY STEPHEN, LIU YONGHONG, SLAMANIG STEFAN, OLIVA JUSTINE, AMANAT FATIMA, SCHÄFER ALEXAN: "Newcastle disease virus (NDV) expressing the spike protein of SARS-CoV-2 as a live virus vaccine candidate", EBIOMEDICINE, ELSEVIER BV, NL, vol. 62, 1 December 2020 (2020-12-01), NL , pages 103132, XP055872539, ISSN: 2352-3964, DOI: 10.1016/j.ebiom.2020.103132 *
TCHEOU JOHNSTONE, RASKIN ARIEL, SINGH GAGANDEEP, KAWABATA HISAAKI, BIELAK DOMINIKA, SUN WEINA, GONZÁLEZ-DOMÍNGUEZ IRENE, SATHER D : "Safety and Immunogenicity Analysis of a Newcastle Disease Virus (NDV-HXP-S) Expressing the Spike Protein of SARS-CoV-2 in Sprague Dawley Rats", FRONTIERS IN IMMUNOLOGY, FRONTIERS MEDIA, LAUSANNE, CH, vol. 12, 18 November 2021 (2021-11-18), Lausanne, CH , XP093181548, ISSN: 1664-3224, DOI: 10.3389/fimmu.2021.791764 *

Also Published As

Publication number Publication date
KR20240097997A (ko) 2024-06-27

Similar Documents

Publication Publication Date Title
WO2021221486A1 (en) Vaccine composition for preventing or treating infection of sars-cov-2
WO2020005028A1 (ko) 중증 열성 혈소판 감소 증후군(sfts) 바이러스 감염 질환 예방 또는 치료용 백신 조성물
WO2011043584A9 (ko) 형질전환 식물 유래의 고병원성 조류독감 바이러스 단백질 백신 및 그 제조방법
WO2020091529A1 (ko) 재조합 호흡기 세포융합 바이러스 f 단백질 및 이를 포함하는 백신 조성물
WO2020246750A2 (ko) 안정화된 핵산 면역증강제를 함유하는 약학 조성물
WO2022045827A1 (ko) 신규한 코로나바이러스 재조합 스파이크 단백질, 이를 코딩하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 벡터 및 상기 벡터를 포함하는 코로나바이러스감염증 예방 또는 치료용 백신
WO2024128804A1 (ko) Sars-cov-2 바이러스 백신
WO2020076141A1 (ko) 재조합 rsv 생백신주 및 이의 제조 방법
WO2016200113A2 (ko) 녹차 추출물에 의해 불화된 바이러스를 포함하는 백신 및 그의 제조방법
WO2021091279A1 (ko) Ｈ５ｎ８ 재조합 인플루엔자 바이러스, 이의 제조용 조성물, 및 이를 포함하는 백신 조성물
WO2019212312A1 (ko) 키메라 지카바이러스 백신
WO2023101381A1 (ko) 구제역 바이러스 유사 입자를 생산하기 위한 백신 플랫폼
WO2020138761A1 (ko) 돼지 생식기 및 호흡기 증후군 바이러스의 키메라 바이러스 및 이를 이용한 백신
WO2023048532A1 (ko) 레오바이러스 기반 신규한 백신플랫폼 및 이의 용도
KR102091281B1 (ko) 재조합 인플루엔자 a 바이러스 h5n6주 및 이를 포함하는 고병원성 인플루엔자 a 바이러스 백신 조성물
WO2021215857A1 (ko) 삼량체를 형성하는 코로나-19 바이러스 (covid-19, coronavirus disease 2019)의 재조합 스파이크 단백질 및 식물에서의 상기 재조합 스파이크 단백질의 대량 생산 방법과 이를 기반으로하는 백신조성물 제조 방법
WO2016056681A1 (ko) 인플루엔자 바이러스 항원의 세포표면 발현벡터 및 이에 의해 형질전환된 미생물
WO2022119380A1 (ko) 신규한 ace2 변이체 및 그의 이용
WO2022163902A1 (ko) 인체 감염 사스코로나 바이러스 예방 및 감염 증상 완화용 백신 조성물
WO2019066437A1 (ko) 가용성 변형 호흡기 융합세포 바이러스 (rsv) ｆ 단백질 항원
WO2022169344A1 (ko) 내열성이 개선된 뉴캐슬병 바이러스 및 이를 포함하는 뉴캐슬병 바이러스 백신
WO2022203404A1 (ko) 뉴캐슬병 바이러스 벡터를 이용한 고역가 조류메타뉴모바이러스 백신
WO2016099226A1 (ko) 신규한 돼지 유행성설사 바이러스 및 그의 이용
WO2023055154A1 (ko) 재조합된 약독화 rsv 생백신 및 이를 제조하는 방법
WO2022092921A1 (ko) 사스-코로나바이러스-2 항원을 포함하는 바이럴 벡터 및 이의 이용

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23904004

Country of ref document: EP

Kind code of ref document: A1