WO2011043584A9 - 형질전환 식물 유래의 고병원성 조류독감 바이러스 단백질 백신 및 그 제조방법 - Google Patents
형질전환 식물 유래의 고병원성 조류독감 바이러스 단백질 백신 및 그 제조방법 Download PDFInfo
- Publication number
- WO2011043584A9 WO2011043584A9 PCT/KR2010/006821 KR2010006821W WO2011043584A9 WO 2011043584 A9 WO2011043584 A9 WO 2011043584A9 KR 2010006821 W KR2010006821 W KR 2010006821W WO 2011043584 A9 WO2011043584 A9 WO 2011043584A9
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- virus
- protein
- hemagglutinin
- present
- plant
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/145—Orthomyxoviridae, e.g. influenza virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8257—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
- C12N15/8258—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon for the production of oral vaccines (antigens) or immunoglobulins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/16011—Orthomyxoviridae
- C12N2760/16111—Influenzavirus A, i.e. influenza A virus
- C12N2760/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Definitions
- the present invention provides a method for producing a transgenic plant capable of producing hemagglutinin, which is a surface protein of avian influenza virus with high efficiency, and a method for producing an antigenic avian influenza virus that can induce an immune effect against avian influenza virus from the transgenic plant.
- a method for producing magglutinin protein and a bird flu virus vaccine composition comprising the hemagglutinin protein produced by the method.
- Avian influenza virus belongs to the orthomyxovirus, an RNA virus that is very pathogenic from very fast transmission and no clinical symptoms to almost 100% mortality when infected. It is known to be various.
- the avian influenza virus belongs to type A, and according to the hemagglutin (HA) and neuraminidase (NA) genes in the outer membrane of the virus, HA is divided into 16 types and NA is classified into 9 types. There are various serotypes, such as loss, and when the HA and NA are combined with each other, there may be 144 types of influenza A virus.
- H5 and H7 are known to be pathogenic to birds, and H1, H2 and H3 are known to cause influenza in humans.
- avian influenza virus is not known to infect animals other than birds and pigs, but in 1997 Hong Kong was infected with avian influenza and it was known that H5N1 caused it. It was confirmed.
- the reason for the human infection is that when avian influenza virus and human influenza are infected in the human body at the same time, they cause genetic mutations and become highly pathogenic viruses.
- a total of 19 H5N1 type of highly pathogenic avian influenza were generated from December 2003 to March 21, 2004, affecting not only domestic poultry industry but also related secondary industries due to contraction of consumption concerned about human infection.
- the government's quarantine protection for the eradication of highly pathogenic avian influenza has been severely damaged and ended by direct expenses of about 150 billion won.
- recent cases of human infection caused by H5N1 type in Thailand and Vietnam have caused global concern.
- serotypes are so diverse, and each serotype is weak or non-cross-immune, making it difficult to prevent infection of other serotype viruses, and mutations occur well. Do not. Only the most effective prevention methods currently in use include disinfectant washing, parenteral deadly poisoned vaccines or recombinant chickenpox virus vaccines, but they are also used only after the virus has been identified after the outbreak of bird flu. There is a limit to the reduction or prevention.
- vaccine production for H5N1 is difficult to produce for a variety of reasons, there is a problem that takes a long time to commercialize.
- a virus vaccine is usually used as a vaccine for amplifying a virus by inoculating a virus with an egg, and thus the production is low, and thus the production equipment is not only able to cope with the rapid demand such as pendemic. Due to the problem that it takes a lot of money and time, it is impossible to produce highly pathogenic H5N1 vaccine using eggs. Therefore, if a vaccine using a protein antigen rather than a virus is used, it is necessary to develop a vaccine using a protein antigen as it is expected to prevent economic losses of bird farmers and effectively protect birds and breeders from deadly viruses.
- plants since plants have a synthetic pathway of eukaryotic proteins that require post-translational modification, which is essential for mammals, they have the advantage of producing proteins that are similar to mammalian expression proteins. Attention has been paid to producing useful bioactive substances.
- the inventors of the present invention while researching to develop a protein vaccine against avian influenza, in particular, a highly pathogenic virus H5N1 using the characteristics of the plant, recombinant plant trait comprising the hemagglutinin (HA) gene of the H5N1 virus It is economical, safer and easier to administer than before by transforming a plant using a vector for transformation and confirming that hemagglutinin (HA), an antigenic protein of H5N1 virus, can be mass produced from the transformed plant.
- the present invention was completed by developing a plant-derived bird flu vaccine that can be used as an edible vaccine.
- HA hemagglutinin
- Another object of the present invention is to provide a transformed plant that produces hemagglutinin (HA), which is an antigenic protein of H5N1 virus prepared by the above method.
- HA hemagglutinin
- Another object of the present invention is to provide a method for producing hemagglutinin (HA), which is an antigenic protein of H5N1 virus, from a transformed plant according to the present invention.
- HA hemagglutinin
- Another object of the present invention is to provide a vaccine protein against H5N1 virus produced by the method of the present invention.
- Another object of the present invention is a transgenic plant, a composition for H5N1 virus vaccine comprising a hemagglutinin (HA) protein of H5N1 virus produced from the transgenic plant, or a protein extract of the transgenic plant.
- HA hemagglutinin
- Another object of the present invention (a) collecting blood from the sample; (b) separating serum from the collected blood; And (c) reacting the separated serum by adding an antibody against hemagglutinin (HA) and an antibody against a cellulose-binding domain (CBD). It is to provide a method for diagnosing whether is formed by the infection of H5N1 virus or by vaccination.
- HA hemagglutinin
- CBD cellulose-binding domain
- the present invention (i) a DNA sequence consisting of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to 12; (ii) a chaperone binding protein (BiP) gene sequence represented by SEQ ID NO: 13; (iii) the hemagglutinin (HA) gene sequence of the H5N1 virus represented by SEQ ID NO: 14; (iv) the gene sequence encoding the cellulose-binding domain (CBD) represented by SEQ ID NO: 15 and (v) the nucleotide sequence encoding the HDEL (His-Asp-Glu-Leu) peptide works with the promoter
- a method for producing a transformed plant that produces hemagglutinin (HA), an antigenic protein of the H5N1 virus comprising the step of introducing a plant transformation vector capable of being linked to the plant.
- the method for introducing the plant transformation vector into the plant is Agrobacterium (Agrobacterium sp.)-Mediated method, particle gun bombardment, silicon carbide whisker method (Silicon carbide whiskers), sonication (sonication), electroporation (electroporation) and PEG precipitation (Polyethylen glycol) can be used any one selected from the group.
- the plant is Arabidopsis, soybean, tobacco, eggplant, pepper, potato, tomato, cabbage, radish, cabbage, lettuce, peach, pear, strawberry, watermelon, melon, cucumber, carrot and celery Dicotyledonous plants selected from the group consisting of; Or a monocotyledonous plant selected from the group consisting of rice, barley, wheat, rye, corn, sugar cane, oats and onions.
- the present invention also provides a transformed plant that produces hemagglutinin (HA), which is an antigenic protein of H5N1 virus prepared by the method of the present invention.
- HA hemagglutinin
- the present invention is the step of culturing the transformed plant according to the present invention isolating and purifying the protein expressed from the hemagglutinin (HA) gene of H5N1 virus represented by SEQ ID NO: 14 introduced into the plant
- HA hemagglutinin
- SEQ ID NO: 14 introduced into the plant
- HA hemagglutinin
- HA hemagglutinin
- CBD cellulose-binding domain
- the present invention also provides a vaccine protein against H5N1 virus produced by the method of the present invention.
- the protein may be a hemagglutinin (HA) protein of the H5N1 virus fused with a cellulose-binding domain (CBD).
- HA hemagglutinin
- CBD cellulose-binding domain
- the present invention also provides a composition for H5N1 virus vaccine comprising the transformed plant according to the present invention, the hemagglutinin (HA) protein of the H5N1 virus produced from the transformed plant, or the protein extract of the transformed plant. to provide.
- HA hemagglutinin
- Antibodies formed in the sample may be determined by the administration of the vaccine composition according to claim 9, and when only antibodies against hemagglutinin (HA) are detected, they may be determined by the infection of the H5N1 virus. have.
- a recombinant vector for plant transformation which can efficiently express the hemagglutinin protein of the H5N1 avian influenza virus according to the present invention and transfer and retain the protein expressed in the plant to the endoplasmic reticulum for glycosylation essential for antigen action.
- the method of producing the hemagglutinin protein of the antigenic H5N1 avian influenza virus from the transformed plant has the effect of mass production of antigenic protein at low cost, and the recombinant vector used in the present invention is a cellulose-binding domain. It has an effect that can be quickly and easily separated from the protein expressed in the plant.
- the transgenic plant according to the present invention can be ingested in the form of a feed additive, it can be used as an edible vaccine. Furthermore, the antigenic hemagglutinin produced in the present invention is immunized when administered to an animal model. As a result of inducing the reaction, there is an effect that can be used as a protein vaccine against H5N1 avian influenza virus as well as an agent for diagnosing infection of avian influenza virus.
- Figure 1a is a schematic diagram showing the connection form of the 35Sp-UTR35: Bip: H5N1 (HA): CBD: HDEL: NOS portion in the transformation vector of the plant prepared in the present invention
- Figure 1b is an embodiment of the present invention The cleavage map of the produced plant transformation vector is shown.
- Figure 3 is a photograph showing the Arabidopsis that can produce the HA protein of H5N1 produced using the plant transformation vector according to the present invention.
- Figure 4 is a photograph observing the intracellular location of the H5N1 HA antigen protein expressed in the Arabidopsis transformed in accordance with the present invention using the cell immunostaining method.
- HA antigen protein of H5N1 is extracted after extracting the protein from the Arabidopsis transformed according to the present invention; Western blots were performed on untreated controls.
- Figure 6a shows the separation and purification of H5N1 HA antigen protein using cellulose from the Arabidopsis transformed according to the present invention, followed by SDS-PAGE electrophoresis and confirmed the isolated and purified protein using coomassie staining method will be.
- Figure 6b is the amount of H5N1 HA antigen protein expressed in the total water soluble protein extracted from the Arabidopsis edodes transformed according to the present invention Western blot using a CBD antibody and a signal using a multigauge program It is shown that the intensity of the was measured.
- Figure 7 shows the injection of H5N1 HA antigen protein isolated from the Arabidopsis transformed in accordance with the present invention to the mouse and using the respective serum of the specific antibodies against the avian influenza antigen, ie IgG, IgG2a and IgG1 antibodies The degree of formation was examined by ELISA method, and the control group was used as the serum of mice injected with TIV vaccine instead of H5N1 HA antigen protein.
- FIG. 8 is a graph measuring the weight change of each mouse after injecting a TIV vaccine into mice with the H5N1 HA antigen protein and a control group produced according to the present invention and then inducing infection with the H5N2 virus.
- Figure 9 is a graph showing the survival rate of each mouse after induction of infection with H5N2 virus after injecting mice with a TIV vaccine with the HA antigen protein and control of H5N1 produced according to the present invention.
- Figure 10 shows the immunization of mice with the H5N1 HA antigen protein produced according to the present invention and confirmed by Western blot of antibodies to CBD as well as antibodies to HA of H5N1 using the serum of the mouse.
- Figure 11 shows the injection of H5N1 HA antigen protein isolated from the Arabidopsis transformed in accordance with the present invention in chickens and after serum separation, the formation of anti-total IgG (chicken) antibody that is a specific antibody to avian influenza antigen It was investigated by ELISA method, and as a control, the antigen antibody reaction was performed using the serum of chickens injected with PBS buffer instead of H5N1 HA antigen protein.
- the present invention relates to the development of a vaccine for the prevention of the highly pathogenic avian influenza H5N1 virus, characterized in that the production of transformed plants to produce hemagglutinin (HA), the antigenic protein of the H5N1 virus. More specifically, the present invention (i) a DNA sequence consisting of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to 12; (ii) a chaperone binding protein (BiP) gene sequence represented by SEQ ID NO: 13; (iii) the hemagglutinin (HA) gene sequence of the H5N1 virus represented by SEQ ID NO: 14; (iv) the gene sequence encoding the cellulose-binding domain (CBD) represented by SEQ ID NO: 15 and (v) the nucleotide sequence encoding the HDEL (His-Asp-Glu-Leu) peptide works with the promoter Provided is a method for producing a transformed plant that produces hemagglutinin (HA
- the present inventors can introduce and express a gene coating the protein into the plant in a way to maximize the production of a useful protein in the plant, that is, the hemagglutinin (HA) protein of the H5N1 virus, a protein usable as a vaccine.
- a recombinant vector for plant transformation was prepared.
- the recombinant vector includes a base sequence of a 5 'untranslated region (5' UTR: 5 'untranslated region) that can regulate the expression control of the protein in the translation step, and generally 5' ratio of mRNA
- the translational region (5 'untranslated region, UTR) has been known to play an important role in post-transcriptional regulation of gene expression, regulation of mRNA transport out of the nucleus, efficiency of protein translation and regulation of mRNA stability.
- the 5 'untranslated region may be a DNA fragment having a translation enhancement efficiency of the protein isolated from Arabidopsis, preferably SEQ ID NOs 1 to 12 described in the following table It may be any one of the base sequence selected from the base sequence consisting of.
- the glycosylation is known to play a very important role in the stable structure of the viral protein, antibody induction and induction of immune response (Goffard, A. , et al., J. Virol. 79, 8400-8409, 2005; Hebert, DN, et al., J. Cell Biol. 139, 613-623, 1997), comparing glycated and unglycosylated proteins. It has also been reported that glycosylation of viral proteins aids in antibody formation (Ewasyshyn, M., et al., J. Gen. Virol. 74, 2781-2785, 1993).
- the endoplasmic reticulum contains a large amount of mannose, and glycosylation is actively occurring. Therefore, when the hemagglutinin (HA) protein of the H5N1 virus is transferred to the endoplasmic reticulum, the glycated form of the HA protein is maintained. There is an advantage that can be obtained in bulk.
- HA hemagglutinin
- the base sequence encoding the Bip (chaperone binding protein) protein can be used to move the hemagglutinin (HA) protein of the H5N1 virus to the endoplasmic reticulum in the plant, and preferably includes an intron instead of the cDNA of Bip.
- the nucleotide sequence represented by SEQ ID NO: 13, which is the genomic DNA of Bip, can be used.
- the BiP is a luminal binding protein, identified as an immunoglobulin heavy chain binding protein and a glucose regulated protein, and is a type of HSP70 chaperone family located in the endoplasmic reticulum. And temporarily bind to the newly synthesized protein in the endoplasmic reticulum.
- the N-terminus of the BiP protein contains a signal sequence that determines targeting to the endoplasmic reticulum, which serves to target the target proteins to the endoplasmic reticulum.
- the recombinant vector for plant transformation may include a nucleotide sequence coating an ER retention signal peptide such as HDEL, which in the case of the HDEL signal peptide by retaining the target protein in the endoplasmic reticulum This results in increased folding and assembly by consequently minimizing protein degradation (Nuttall, J. et al., 2002).
- the yield of the target protein is known to increase by about 10 to 100 times (Hellwig, S. et al., 2004).
- the recombinant vector for plant transformation according to the present invention may include a gene for coating hemagglutinin (HA) present on the surface of the H5N1 virus.
- Influenza viruses generally have hemagglutinin (HA) and neuraminidase (NA) antigens on their surface.
- HA and NA are relatively large glycoproteins.
- HA is a protein that functions to recognize and penetrate cells to be invaded by the virus.
- NA is a protein that acts to escape the host cell after the virus has proliferated in the host cell. Proteins, which have been identified as proteins that cause immune responses in the host.
- HA proteins are known to be antigens that have the ability to aggregate red blood cells in algae and are responsible for most of the antibody responses induced in the body.
- the nucleotide sequence of coating the hemagglutinin (HA) protein of the H5N1 virus on a plant transformation recombinant vector, preferably the H5N1 virus represented by SEQ ID NO: 14 May comprise the hemagglutinin (HA) gene sequence.
- the gene sequence represented by SEQ ID NO: 14 is a gene coating an amino acid including a portion excluding 23 amino acids of the hemagglutinin protein of the H5N1 type / Hong Kong / 213/03 virus.
- the recombinant vector for plant transformation comprises a DNA sequence, a Bip gene sequence, an HA gene sequence of H5N1, a base sequence encoding CBD, and a gene sequence coating HDEL peptide, which can enhance the translation efficiency of the protein.
- the sequences can be operably linked to the promoter sequentially.
- the term "expression vector” refers to a plasmid, virus or other medium known in the art in which the DNA sequence, gene sequence or nucleotide sequence according to the present invention can be inserted or introduced.
- the DNA sequence, gene sequence or nucleotide sequence according to the present invention may be operably linked to an expression control sequence, wherein the operably linked gene sequence and expression control sequence include a selection marker and a replication origin. It can be included in one expression vector.
- “Operably linked” can be genes and expression control sequences linked in such a way as to enable gene expression when the appropriate molecule is bound to the expression control sequences.
- an "expression control sequence” refers to a DNA sequence that controls the expression of a polynucleotide sequence operably linked in a particular host cell.
- Such regulatory sequences include promoters for carrying out transcription, any operator sequence for regulating transcription, sequences encoding suitable mRNA ribosomal binding sites, and sequences that control termination of transcription and translation.
- the promoter is not particularly limited as long as it can express an insertion gene in a plant.
- the promoter include, but are not limited to, 35S RNA and 19S RNA promoters of CaMV; Full length transcriptional promoters derived from Peak Water Mosaic Virus (FMV) and Coat protein promoters of TMV.
- Further suitable vectors for introducing the DNA sequence, gene sequence or nucleotide sequence according to the invention into plant cells include Ti plasmids and plant viral vectors.
- suitable vectors include, but are not limited to, binary vectors such as pCHF3, pPZP, pGA and pCAMBIA series. In the present invention, any vector may be used as long as it is a vector capable of introducing the sequences according to the present invention into plant cells.
- a vector capable of moving and expressing and maintaining a target gene developed by the present inventors to a vesicle in a plant that is, a vector disclosed in Korean Patent Application No. 2009-0081403
- a vector disclosed in Korean Patent Application No. 2009-0081403 By introducing the hemagglutinin gene sequence of the H5N1 virus represented by SEQ ID NO: 14 into the target gene portion of the vector, and cutting the region including the 35S promoter and the NOS terminator portion, restriction of PstI and EcoRI An enzyme was used to connect the pBI121 vector, a plant transformation vector, to produce an antigenic hemagglutinin expression vector of the recombinant H5N1 virus.
- the present invention can provide a method for producing a transgenic plant that produces hemagglutinin (HA), which is an antigenic protein of H5N1 virus, comprising introducing the plant transformation vector described above into a plant. .
- HA hemagglutinin
- the method of introducing the recombinant vector of the present invention into the plant is not limited thereto, but the Agrobacterium sp.-mediated method, particle gun bombardment, silicon carbide whisker method (Silicon carbide) whiskers), sonication, electroporation and precipitation by polyethylene glycol (PEG) may be used.
- the Agrobacterium sp.-mediated method particle gun bombardment, silicon carbide whisker method (Silicon carbide) whiskers), sonication, electroporation and precipitation by polyethylene glycol (PEG)
- PEG polyethylene glycol
- the present invention therefore provides a transformed plant that produces hemagglutinin (HA), which is an antigenic protein of the H5N1 virus prepared by the method according to the present invention.
- HA hemagglutinin
- hemagglutinin which is an antigenic protein of H5N1 virus in plants transformed with the recombinant vector of the present invention, is highly efficiently translated and accumulated in the endoplasmic reticulum, resulting in H5N1 hemagglutinin.
- Plants that can be produced with high efficiency can be obtained through the planetary propagation method or the asexual propagation method which is a conventional method in the art. More specifically, the plant of the present invention may be obtained through oily breeding, which is a process of producing seeds from the pollination process of flowers and breeding from the seeds.
- asexual propagation method which is a process of induction, rooting and soil purification of callus according to a conventional method. That is, the fragments of the plant transformed with the recombinant vector according to the present invention are inoculated into a suitable medium known in the art, and then cultured under appropriate conditions to induce the formation of callus, and when the shoots are formed, transfer to a hormone-free medium to culture. do. After about 2 weeks, the shoots are transferred to rooting medium to induce roots.
- the plant according to the invention can be obtained by root derivation, which is then transplanted into soil and purified. Plants transformed in the present invention may include whole plants as well as tissues, cells or seeds obtainable therefrom.
- the plant may be a dicotyledonous plant or a monocotyledonous plant, and the dicotyledonous plant is not limited thereto, but the Arabidopsis, soybean, tobacco, eggplant, pepper, potato, tomato, Chinese cabbage, radish, cabbage, lettuce, Peach, pear, strawberry, watermelon, melon, cucumber, carrot, and celery, and the monocotyledonous plants may include, but are not limited to, rice, barley, wheat, rye, corn, sugar cane, oats, and onions.
- the inventors of the present invention to investigate whether the hemagglutinin protein of H5N1 is located in the endoplasmic reticulum in the transformed plants by the recombinant vector using an immunoassay method of the present invention, It was confirmed that the hemagglutinin protein of H5N1 exists in the endoplasmic reticulum in the plant (see FIG. 4).
- the extract is a sugar residue degrading enzyme
- the hemagglutinin protein of H5N1 expressed was glycosylated through the modification process after detoxification in plants (see FIG. 5).
- the present invention can provide a method for producing hemagglutinin (HA), which is an antigenic protein of H5N1 virus, from a plant transformed with the recombinant vector according to the present invention, the method culturing the transformed plant. And separating and purifying the protein expressed from the hemagglutinin (HA) gene, which is an antigenic protein of H5N1 virus represented by SEQ ID NO: 14 introduced into the plant.
- HA hemagglutinin
- the method for producing hemagglutinin (HA), an antigenic protein of H5N1 virus, from the transformed plant is introduced into the plant recombinant vector according to the invention or transformed cells with the recombinant expression vector After incubation for a suitable time so that the hemagglutinin (HA) is expressed, it can be obtained from the transformed plants or cells.
- any method for expressing the protein may be used as long as it is known in the art.
- the recovery of the protein expressed in the transformed plant or cells can be carried out through a variety of separation and purification methods known in the art, and the cell lysate is usually removed to remove cell debris.
- hemagglutinin (HA) of the present invention may be applied alone or in combination with ion exchange chromatography, gel-penetration chromatography, HPLC, reverse phase-HPLC, affinity column chromatography, and ultrafiltration.
- Proteins can be purified (Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1982); Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press (1989); Deutscher, M., Guide to Protein Purification Methods Enzymology, vol. 182. Academic Press. Inc., San Diego, CA (1990).
- Hemagglutinin (HA) an antigenic protein of the H5N1 virus expressed in the plant, is cellulose-linked by further operably linking the nucleotide sequence encoding CBD), preferably the nucleotide sequence represented by SEQ ID NO: 15. It may be in a fused form with a domain, and thus can be easily separated and purified through chromatography using a cellulose carrier as a column.
- the present invention can provide a hemagglutinin protein of recombinant H5N1 virus having antigenicity produced by the method
- the protein produced by the method may be a vaccine protein against H5N1 virus
- the protein is H5N1 virus
- the hemagglutinin and the cellulose-binding domain (CBD) may be a fusion protein in a fused form.
- the inventors investigated whether the hemagglutinin fusion protein of H5N1 virus produced from plants by the method of the present invention can actually act as an antigen and be used as a H5N1 virus vaccine as described above.
- the hemagglutinin antigen protein of the H5N1 virus isolated and purified by the method of the present invention described above was intramuscularly injected into the mouse using a mouse model, and then blood was collected. Serum was isolated and then antigen-specific antibody response was examined using ELISA method.
- a trivalent influenza vaccine (H1N1 + H3N2 + B type HA protein) vaccine was used as a control instead of hemagglutinin antigen protein. .
- the TIV vaccine used as a control group did not induce an H5N1 specific antibody response, but in the mouse group to which the hemagglutinin antigen protein of H5N1 produced in the present invention was administered, it retained immunogenicity and thus an antigen specific antibody response. It was confirmed that the induced (see Figure 8).
- H5N2 is known to have a relatively low risk of H5N1 in mice inoculated with the hemagglutinin protein of the H5N1 virus of the present invention and a TIV vaccine (used as a control), which were born from plants. After infection with the virus, the weight change and survival rate of the mice were investigated. In the group receiving H5N1 hemagglutinin protein, the weight of the mouse was decreased, but after 15 days, 90% of the initial weight was lost.
- the hemagglutinin protein of the H5N1 virus produced from the transgenic plant according to the present invention was able to induce antibody formation against the H5N1 virus as well as have a protective effect against avian influenza virus.
- the inventors of the present invention can induce an antigen-specific antibody response by retaining immunogenicity of the hemagglutinin protein of H5N1 virus produced from plants by the method of the present invention in mice. Therefore, the hemagglutinin protein of the H5N1 virus produced in the present invention can be used as a vaccine applicable to mammals including mice and humans.
- the inventors of the present invention to investigate whether the hemagglutinin protein of the H5N1 virus produced from plants by the method of the present invention can be used as a vaccine applicable to birds and poultry as well as mammals in one embodiment of the present invention
- the chicken was administered the hemagglutinin protein of the H5N1 virus produced from the plant by the method of the present invention, and serum was isolated from the chicken, and then the antigen-specific antibody response was examined using the ELISA method.
- PBS buffer was used instead of hemagglutinin antigen protein as a control.
- chickens administered with PBS buffer did not induce an H5N1-specific antibody response, but chickens administered with the H5N1 hemagglutinin antigen protein produced in the present invention retained immunogenicity regardless of the sex of male or female. It was shown to induce specific antibody responses (see FIG. 11).
- the hemagglutinin protein of the H5N1 virus produced from the transgenic plant according to the present invention can be used for the production of vaccines applicable to birds and poultry including chickens as well as mammals.
- the present invention provides a composition for H5N1 virus vaccine comprising a transgenic plant according to the method of the present invention described above, a hemagglutinin protein of H5N1 virus produced from the transgenic plant or a protein extract of the transgenic plant. can do.
- the vaccine composition according to the present invention can be administered to a subject in need thereof via a variety of routes including oral, transdermal, subcutaneous, intravenous or intramuscular, the dosage of the composition being the route of administration, body weight and age of the subject. It can be adjusted appropriately according to various factors such as.
- the composition according to the present invention may be administered in parallel with a known compound having the effect of preventing or treating an infection of H5N1 virus, and may further include a pharmacologically acceptable carrier, diluent or excipient.
- the vaccine composition of the present invention may include 100 to 1,000 mg / l of hemagglutinin protein of the H5N1 virus as an active ingredient, and may be administered to 50 to 500 mg as a dose, but is not limited thereto.
- Examples of the carriers, excipients and diluents that may be further included in the vaccine composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium Phosphate, calcium silicate, cellulose, methyl cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
- fillers, anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers and preservatives may be further included.
- compositions of the present invention may be formulated using methods known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to a subject in need thereof.
- the formulation may be in the form of powders, granules, tablets, emulsions, syrups, aerosols, soft or hard gelatin capsules, sterile injectable solutions, sterile powders, but is not limited thereto.
- the subject to which the vaccine composition of the present invention can be administered may include all subjects capable of being infected by H5N1 virus, such as mammals, birds, livestock, and poultry, including humans.
- the transformed plant of the present invention can be used by itself or as a vaccine for oral administration because it can be administered by grinding the plant and adding it to animal feed or drinking water.
- the present invention relates to an H5N1 virus comprising the transformed plant according to the present invention, a hemagglutinin (HA) protein of H5N1 virus produced from the transformed plant, or a protein extract of the transformed plant.
- Vaccine compositions for oral administration can be provided, and when transformed plants are used as vaccine compositions for oral administration, the possibility of contamination with animal viruses is low, and the hemagglutinin (HA) protein of the produced H5N1 virus is applied to the plants. It can be stored and transported for a long time as well as greatly reducing the cost of vaccination.
- the present invention can isolate and purify the hemagglutinin (HA) antigen protein of the highly pathogenic avian influenza H5N1 virus from the transformed plant according to the present invention can provide a reagent for diagnosing infection of the H5N1 virus, Furthermore, a method for diagnosing infection by H5N1 virus may be provided by reacting the isolated and purified H5N1 virus hemagglutinin (HA) antigen protein with a serum of an avian or mammal.
- HA hemagglutinin
- hemagglutinin (HA) antigen protein of the H5N1 virus isolated and purified from the transformed plant according to the present invention is characterized in that it is a fusion protein in a fused form with a cellulose-binding domain (CBD). There is this.
- the inventors of the present invention when the mouse was administered the hemagglutinin (HA) antigen protein of the H5N1 virus produced by the present invention, as a result of investigating whether the antibody to the CBD protein fused with the hemagglutinin protein is produced, It was confirmed that the antibody against the fused CBD protein was also generated upon administration of the HA antigen protein (see FIG. 10).
- HA hemagglutinin
- the present invention provides a method for detecting hemagglutinin formed in the subject by detecting antibodies against hemagglutinin (HA) of the H5N1 virus and antibodies against the CBD protein in serum obtained from the subject ( It can be diagnosed whether the antibody against HA) is produced by infection of the H5N1 virus or by a vaccine comprising hemagglutinin (HA) of the H5N1 virus according to the present invention.
- the diagnostic method is a subject that is susceptible to infection by a sample, preferably avian influenza virus, for example blood from all animals except birds or humans, and then blood commonly used in the art.
- Serum was isolated using a method of separating serum from the antibody, followed by immunoreaction by adding an antibody against hemagglutinin (HA) and an antibody against cellulose-binding domain (CBD).
- Antibodies against hemagglutinin (HA) and hemagglutinin (HA) antibodies formed in the sample through antibody detection against cellulose-binding domains (CBD) were generated by infection with H5N1 virus. Whether or is produced by a vaccine comprising hemagglutinin (HA) of the H5N1 virus according to the invention.
- Diagnosis according to the immune response is performed when the antibody against hemagglutinin (HA) and the antibody against cellulose-binding domain (CBD) are detected together in the serum obtained from the sample.
- Antibodies can be determined to have been produced by administration of the vaccine according to the invention, and can be determined to have been produced by infection of the H5N1 virus when only antibodies to hemagglutinin (HA) were detected.
- the diagnostic method according to the present invention has the effect of confirming that the antibody against the H5N1 virus is effectively produced by the vaccine after administering the vaccine or vaccine composition of the present invention to a subject,
- the diagnosis of H5N1 virus is diagnosed by the above-mentioned diagnosis method, it is possible to promptly prevent or treat the poultry, thereby reducing the economic loss. It has the effect of preventing or treating an infection. Therefore, the antigenic H5N1 hemagglutinin protein fused with CBD produced in the present invention has an effect that can be used as a marker vaccine.
- the inventors of the present invention disclose the patent application No. 2009-0081403 developed by the present inventors to prepare a plant transformation vector containing a hemagglutinin (HA) gene that acts as an antigen on the surface of HPAI (H5N1) virus.
- a recombinant vector comprising a DNA fragment for enhancing translation efficiency, which enhances the translation efficiency of the described protein of interest, was used.
- the recombinant vector for plant transformation used in the invention is a color flower mosaic virus 35S promoter, a DNA fragment that enhances the translation efficiency of a protein, that is, a 5 'UTR (5' untranslated region) sequence, Base sequence consisting of SEQ ID NO: 6 from the base sequences of SEQ ID NOs: 1 to 12, a BiP (chaperone binding protein) sequence represented by SEQ ID NO: 13 capable of targeting a target protein as an endoplasmic reticulum (ER) in plant cells, to SEQ ID NO: 14 Hemagglutinin gene sequence of the indicated H5N1 virus (sequence excluding the last 23 amino acids of the hemagglutinin protein of HPAI (H5N1) type A / Hong Kong / 213/03 virus), cellulose represented by SEQ ID NO: 15 Base sequence encoding the cellulose-binding domain (CBD), HDEL (His-Asp-Glu-Leu) sequence and 35S terminator (NOS), a signal sequence for
- FIG. 1A shows a sequential linkage of 35Sp-UTR35: Bip: H5N1 (HA): CBD: HDEL: NOS in a plant transformation vector prepared according to the present invention.
- the cleavage map of the produced vector is shown in FIG. 1B.
- the Arabidopsis expressing HA of H5N1 virus was prepared using the recombinant vector for plant transformation prepared in Example 1 using an Agro bacterium-mediated transformation method known in the art.
- the transformed Arabidopsis selection was used pBI121 as a base vector for the plant transformation recombinant vector prepared in Example 1, this vector has a selection marker for kanamycin in the plant, so using the kanamycin resistance test Arabidopsis plants transformed with the recombinant vector prepared by the method of the present invention were selected.
- the baby pole plants selected by the kanamycin resistance test to find a line expressing the HA protein well through Western blot to secure the first generation of transformation, and then in the second generation of transformation using a marker marker dies: surviving individuals 1 line was selected as a clean copy line, and these lines were then designated as the third generation of transformation, and then Western blot was used to identify all the proteins expressed in the surviving individuals in the third generation of transformation. This was selected as a homo (homo) to maintain the line to secure the transformed Arabidopsis plant line.
- FIG. 1 shows the Western blot for confirming the expression of the HA protein.
- FIG 2 shows the result of expressing the hemagglutinin (HA) antigen protein of the H5N1 virus.
- Figure 3 shows the transformed Arabidopsis in accordance with the present invention.
- BiP a signal sequence that carries the hemagglutinin (HA) protein of HPAI (H5N1) type A / Hong Kong / 213/03 to the endoplasmic reticulum (ER). . Therefore, in order to confirm whether the HA protein expressed in the transformed plant prepared in Example 2 is located in the endoplasmic reticulum (ER), an immunostaining method was performed as follows.
- the protoplasts were separated from the leaves of Arabidopsis transformed with pBI121-35Sp-UTR35: BiP: H5N1 (HA): CBD: HDEL: NOS, and then W6 buffer (154mM NaCl, 125mM CaCl2, 2.5mM Maltose, 5mM KCl). , 10 mM HEPES, pH7.2), and then placed on a poly-L-lysine-coated slide, 300 ⁇ l of the transformed protoplast dissolved in the W6 buffer, and then 3% paraformaldehyde.
- TWS buffer (10 mM Tris-HCl pH7.4, 0.9% NaCl, 0.25% gelatin, 0.02% SDS, 0.1% TritonX-100)
- TSW buffer (10 mM Tris-HCl pH7.4, 0.9% NaCl, 0.25% gelatin, 0.02% SDS, 0.1% TritonX-100)
- rabbit-FITC green fluorescence
- secondary antibody Secondary antibody
- the green fluorescence pattern is confirmed as a typical network structure (vesicles) (network structure) of the HA protein expressed in the transgenic plant prepared according to the present invention to accurately move to the endoplasmic reticulum (ER) I could confirm it.
- the surface protein of the virus is glycosylated and whether such glycosylation is characterized by inducing an antibody response to help the formation of antibodies.
- the present inventors can transfer the target protein to the vesicle in which glycosylation occurs actively to induce more glycosylation effect of hemagglutinin, the antigenic protein of H5N1, and also keep the protein expressed in the vesicles longer.
- Arabidopsis was transformed using a vector transformed with a recombinant vector.
- an endoglycosidase H enzyme method was used, and the endoglycosidase H enzyme was used. Is an enzyme that selectively cleaves sugar residues linked to asaparagine in proteins, and is used in the art as a method for confirming glycosylation of proteins.
- the treated sample compared to the sample not treated with the endoglycosidase H enzyme was confirmed that the protein size was further reduced as the endoglycosidase H enzyme cleaved oligosaccharides (oligosaccharides) Can be. Therefore, the results showed that the HPAI (H5N1) type A / Hong Kong / 213/03 HA protein expressed in the plant transformed by the method of the present invention was normally glycosylated in the plant. It was found to be suitable for inducing antibody response.
- HPAI (H5N1) type A / Hong Kong / 213/03 HA protein which is the antigen of H5N1 virus, which causes avian influenza from the transformed plant according to the present invention prepared in Example 2, was isolated from the plant by the following method. Isolate and purify. That is, the transformed Arabidopsis was planted about 70-80 grains in a 150mm MAXi plate, and then cultured in a culture room equipped with environmental conditions of 16 hours / 8 hours (light / dark) at a temperature of 23 ° C. for 3 weeks. The plates were then allowed to contain medium containing 2% sucrose, B5 mixture, 0.5% MES pH5.75 and 8% agar.
- the extraction buffer (10mM Hepes, 10mM NaCl, 3mM MgCl2, 5mM EGTA, 5mM EDTA, 5mM DTT, 0.2% triton X-100) was added to 10000rpm 10 After centrifugation for minutes, only the supernatant was taken, and the supernatant was loaded into a column about 3 cm prepared with cellulose (Sigma type 20).
- wash buffer 1 (10mM Hepes, 10mM NaCl, 3mM MgCl 2, 5mM EGTA, 5mM EDTA, 5mM DTT, 0.2% triton X-100)
- wash buffer 2 10 mM Hepes, 10 mM NaCl, 3 mM MgCl 2, 5 mM EGTA, 5 mM EDTA, 5 mM DTT).
- BiP H5N1 (HA): CBD: HDEL fusion protein that is bound to cellulose, the purified above The fusion protein was again electrophoresed with SDS-PAGE and stained with coomassie to confirm the amount of purified protein.
- HA protein of H5N1 virus isolated and purified by the above method 100 ng of the HA protein of H5N1 virus isolated and purified by the above method was extracted from the transformed Arabidopsis 50 After SDS-PAGE electrophoresis with ⁇ g, Western blot was performed using CBD antibody, and then quantitatively analyzed by comparing the intensity of signals using a multigauge program.
- the plant transformed with the plant transformation vector according to the present invention can express and produce HA protein of H5N1 virus at a very high efficiency.
- hemagglutinin (HA) protein on the surface of the virus of HPAI (H5N1) type A / Hong Kong / 213/03 to function as an immune antigen.
- HPAI HPAI
- the specific mechanism of glycosylation differs slightly in plants and animals, and the formation of antibodies using mouse models to determine whether hemagglutinin produced and glycated in plants is immunogenic, like glycated proteins produced in animal cells. The reaction was investigated.
- the mouse was used as a Balb / c mouse that is widely used in influenza virus test, the vaccine for antibody formation was used hemagglutinin protein obtained from plants transformed by the method of the present invention, the control group TIV (trivalent influenza vaccine, H1N1 + H3N2 + B type HA protein), a vaccine not related to avian influenza, was diluted in PBS buffer to 10 ⁇ g / ml (H5N1 HA) and 30 ⁇ g / ml (TIV HA) concentrations, respectively. Thereafter, 50 ⁇ l of each of the mice was injected into each leg, and 100 ⁇ l of total protein was injected twice in total over 0 and 3 weeks.
- TIV trivalent influenza vaccine, H1N1 + H3N2 + B type HA protein
- the TIV vaccine was mixed with three types of hemagglutinin protein, and therefore, three times the amount of H5N1 hemagglutinin protein was administered.
- Antibody formation analysis after the vaccine administration was performed by collecting blood from the sublingual vein using a heparinized tube two weeks after the last administration, and centrifugation at 13,000 rpm for 10 minutes to analyze the serum located in the upper layer. Serum was used to examine antigen specific antibody responses by ELISA assay.
- ELISA assay target antigen was used hemagglutinin protein produced by the method of the present invention, diluted in PBS buffer at a concentration of 1.5 ⁇ g / ml, and then 50 ⁇ l per well in a 96-well absorption plate After that, it was allowed to stand overnight at 4 ° C. After washing twice with 200 ⁇ l of PBST solution (PBS buffer containing 0.05% Tween-20), 200 ⁇ l of binding buffer (PBST solution containing 5% skim milk) was dispensed into each well and blocked for 1 hour. (blocking) After washing twice with 200 ⁇ l of PBST solution, 50 ⁇ l of the serum diluted 1:50 in binding buffer was added to each well, and reacted at 37 ° C.
- H5N1 was found to retain the immunogenicity in Balb / c mice to induce antigen-specific antibody response.
- this antigen-specific antibody response was found to increase greatly through boost immunization.
- the hemagglutinin protein of H5N1 obtained by the method of the present invention through the above results has a different form of glycation from hemagglutinin protein obtained from animal cells, but hemagglutinin obtained from animal cells through a mouse model. It could be confirmed that it has immunogenicity.
- Example 6 As shown in Example 6 that the H5N1 hemagglutinin protein produced according to the present invention can induce antibodies in vivo, it can be seen that there is a protective effect against H5N1 avian influenza virus. Furthermore, the present inventors measured the protective effect using H5N2 avian influenza virus to investigate whether H5N1 hemagglutinin protein actually protects against other kinds of avian influenza virus. In other words, mice immunized with H5N1 hemagglutinin protein produced according to the present invention and a TIV vaccine induce 5LD50 (LD50: 50% mortality at the time of infection) which is sufficient to induce 100% mortality in non-immunized mice. Concentration) H5N2 virus was infected and the weight change and survival rate of the mice after infection were measured.
- 5LD50 50% mortality at the time of infection
- H5N1 hemagglutininin even if the same subtype (subtype), even if the different strains of the virus, considering that the immunity can be difficult, different subtype virus after administration of H5N1 hemagglutinin according to the present invention
- the fact that the H5N2 avian influenza virus effectively induces protective immunity shows that the H5N1 hemagglutinin according to the present invention has excellent protective effects against H5N1 as well as H5N2, and furthermore, it is used for H5N1 and H5N2. It was confirmed that the development of a new enough vaccine to replace the existing vaccine was possible.
- the present inventors have discovered a novel protein vaccine against the H5N1 virus through the above results, and in view of the reports that the protein vaccine is infected with the H5N1 virus as well as humans recently, including birds and humans. All animals were found to be available as a vaccine against the H5N1 virus.
- the present inventors focused on the fact that the vector for plant transformation used in the present invention used the CBD gene for the purpose of effectively separating and purifying proteins from plants in addition to the H5N1 hemagglutinin gene.
- the hemagglutinin protein of H5N1 expressed by the method was fused with the CBD protein, it was examined whether the antibody against the CBD protein was also formed.
- the serum of the mice immunized with the vaccine of the present invention that is, a protein in the form of a fusion of the hemagglutinin protein of H5N1 and CBD was used as a vaccine protein (H5N1 (HA):
- H5N1 (HA) a vaccine protein
- GFP CBD, TPA: CBD
- hemagglutinin-linked CBD also induced antibody responses in mice.
- the vaccine used in the present invention is sufficient to protect the mice from the virus At the same time, the antibody against CBD was also produced.
- the present inventors have found that the antibody against hemagglutinin and the antibody against CBD are detected by the vaccination effect in the serum test for diagnosing avian influenza.
- the antibody against hemagglutinin is detected without detecting the CBD antibody, it can be seen that the antibody is caused by viral infection.
- the detection method using the CBD antibody according to the present invention can distinguish whether the antibody is an antibody caused by an infection or an antibody produced by vaccination through analysis of an antibody detected in a specimen.
- the antigenic protein produced from the transformed plant provided by H.N. a protein fused with the hemagglutinin protein of H5N1 and CBD, could be used as a marker vaccine, thereby eliminating unnecessary poultry killing. It could be expected to prevent economic losses and enable rapid treatment of people's early infections.
- H5N1 hemagglutinin protein produced according to the present invention through the fact that the H5N1 hemagglutinin protein produced according to the present invention can induce an antibody response through the experiment of the above embodiment, that is, a mouse experiment is a human It can be seen that it can be used to develop vaccines for mammals. Furthermore, the present inventors conducted the following experiment to determine whether the H5N1 hemagglutinin protein produced according to the present invention can be used for the development of a vaccine for poultry. It was investigated through. In other words, chickens were used as poultry, and white leghorn varieties were used for the chicken breeds.
- hemagglutinin protein obtained from the plants by the method according to the present invention was 5 ⁇ g, 25 ⁇ g, and 50 ⁇ g, respectively, for 6 weeks at 2 week intervals. Three times each was administered. At this time, the control group was used to administer PBS buffer three times at intervals of two weeks instead of hemagglutinin protein.
- blood was collected using a heparin-treated tube, and then centrifuged at 13,000 rpm for 10 minutes to separate serum as a supernatant. Antigen-antibody reactions were performed using the isolated serum using an ELISA assay widely used in the art.
- hemagglutinin protein produced by the method of the present invention was used as the ELISA assay target antigen, diluted in PBS buffer at a concentration of 1.5 ⁇ g / ml, and then 50 per well in a 96-well absorption plate. The aliquots were aliquoted and allowed to stand overnight at 4 ° C. The next day, after washing twice with 200 ⁇ l of PBST solution (PBS buffer containing 0.05% Tween-20), 200 ⁇ l of binding buffer (PBST solution containing 5% skim milk) was dispensed into each well and blocked for 1 hour. blocking).
- PBST solution PBS buffer containing 0.05% Tween-20
- the present inventors found that the hemagglutinin protein of H5N1 obtained by the method of the present invention has a different form of glycosylation from the hemagglutinin protein obtained from animal cells as a protein obtained from plants.
- Experimental results using a chicken model was confirmed that the hemagglutinin protein of the H5N1 of the present invention obtained from plants have the same immunogenicity as hemagglutinin obtained from animal cells, furthermore, the H5N1 of the present invention It was found that hemagglutinin protein can be used to make vaccines for poultry including chickens as well as mammals including humans.
- cacgcccagg acatcctgga gaagacccac aacggcaagc tgtgcgacct ggacggcgtg 120
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Virology (AREA)
- General Health & Medical Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Animal Behavior & Ethology (AREA)
- Organic Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Pulmonology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Biochemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
5' UTR 번호 | 염기서열 | 서열번호 |
UTR 1 | AGAGAAGACGAAACACAAAAG | 1 |
UTR 2 | GAGAGAAGAAAGAAGAAGACG | 2 |
UTR 6 | AAAACTTTGGATCAATCAACA | 3 |
UTR 7 | CTCTAATCACCAGGAGTAAAA | 4 |
UTR 24 | AGAAAAGCTTTGAGCAGAAAC | 5 |
UTR 35 | AACACTAAAAGTAGAAGAAAA | 6 |
U1 AAA | AGAGAAGACGAAACACAAAAA | 7 |
U1 CCC | AGAGAAGACGAAACACAACCC | 8 |
U1 GGG | AGAGAAGACGAAACACAAGGG | 9 |
U1(-4,5G) | AGAGAAGACGAAACACGGAAG | 10 |
U1(-4,5C) | AGAGAAGACGAAACACCCAAG | 11 |
U AAG | AAGAAGAAGAAGAAGAAGAAG | 12 |
Claims (11)
- (i) 서열번호 1 내지 12로 이루어진 군 중에서 선택되는 어느 하나의 염기서열로 이루어진 DNA 서열; (ii) 서열번호 13으로 표시되는 BiP(chaperone binding protein) 유전자 서열; (iii) 서열번호 14로 표시되는 H5N1 바이러스의 헤마글루티닌(HA) 유전자 서열; (iv) 서열번호 15로 표시되는 셀룰로오스-결합 도메인(cellulose-binding domain:CBD)을 코딩하는 유전자 서열 및 (v) HDEL(His-Asp-Glu-Leu) 펩타이드를 코딩하는 염기서열이 프로모터와 작동가능하게 연결된 식물형질전환용 벡터를 식물체에 도입하는 단계를 포함하는, H5N1 바이러스의 항원성 단백질인 헤마글루티닌(HA)을 생산하는 형질전환된 식물체의 제조방법.
- 제1항에 있어서,상기 식물형질전환용 벡터를 식물체로 도입하는 방법은 아그로박테리움(Agrobacterium sp.)-매개에 의한 방법, 입자 총 충격법(particle gun bombardment), 실리콘 탄화물 위스커법(Silicon carbide whiskers), 초음파 처리법(sonication), 전기천공법(electroporation) 및 PEG 침전법(Polyethylen glycol)으로 이루어진 군 중에서 선택된 어느 하나를 사용하는 것임을 특징으로 하는 H5N1 바이러스의 항원성 단백질인 헤마글루티닌(HA)을 생산하는 형질전환된 식물체의 제조방법.
- 제1항에 있어서,상기 식물은 애기장대, 대두, 담배, 가지, 고추, 감자, 토마토, 배추, 무, 양배추, 상추, 복숭아, 배, 딸기, 수박, 참외, 오이, 당근 및 샐러리로 이루어진 군 중에서 선택되는 쌍자엽 식물; 또는 벼, 보리, 밀, 호밀, 옥수수, 사탕수수, 귀리 및 양파로 이루어진 군 중에서 선택되는 단자엽 식물인 것을 특징으로 하는 H5N1 바이러스의 항원성 단백질인 헤마글루티닌(HA)을 생산하는 형질전환된 식물체의 제조방법.
- 제1항 내지 제3항 중 어느 한 항의 방법으로 제조된 H5N1 바이러스의 항원성 단백질인 헤마글루티닌(HA)을 생산하는 형질전환된 식물체.
- 제4항에 따른 형질전환된 식물체를 배양하여 상기 식물체에 도입된 서열번호 14로 표시되는 H5N1 바이러스의 헤마글루티닌(HA) 유전자로부터 발현된 단백질을 분리 및 정제하는 단계를 포함하는 형질전환된 식물체로부터 H5N1 바이러스의 항원성 단백질인 헤마글루티닌(HA)을 생산하는 방법.
- 제5항에 있어서,상기 형질전환된 식물체로부터 분리 및 정제된 H5N1 바이러스의 항원성 단백질인 헤마글루티닌(HA)은 셀룰로오스-결합 도메인(cellulose-binding domain:CBD)과 융합된 형태인 것을 특징으로 하는 형질전환된 식물체로부터 H5N1 바이러스의 항원성 단백질인 헤마글루티닌(HA)을 생산하는 방법.
- 제5항 또는 제6항의 방법으로 생산되는 것을 특징으로 하는 H5N1 바이러스에 대한 백신 단백질.
- 제7항에 있어서,상기 단백질은 셀룰로오스-결합 도메인(cellulose-binding domain:CBD)과 융합된 H5N1 바이러스의 헤마글루티닌(HA) 단백질인 것을 특징으로 하는 백신 단백질.
- 제5항 또는 제6항에 따른 형질전환된 식물체, 상기 형질전횐된 식물체로부터 생산된 H5N1 바이러스의 헤마글루티닌(HA) 단백질, 또는 상기 형질전환된 식물체의 단백질 추출물을 포함하는 H5N1 바이러스 백신용 조성물.
- (a) 검체로부터 혈액을 채취하는 단계;(b) 상기 채취한 혈액으로부터 혈청을 분리하는 단계; 및(c) 상기 분리된 혈청에 헤마글루티닌(HA)에 대한 항체 및 셀룰로오스-결합 도메인(cellulose-binding domain:CBD)에 대한 항체를 첨가하여 반응시키는 단계를 포함하는, 검체에서 생성된 항체가 H5N1 바이러스의 감염에 의해 형성된 것인지 또는 백신투여에 의해 형성된 것인지를 진단하는 방법.
- 제10항에 있어서,상기 (c) 단계의 반응에서 헤마글루티닌(HA)에 대한 항체 및 셀룰로오스-결합 도메인(cellulose-binding domain:CBD)에 대한 항체가 함께 검출될 경우에는 상기 검체에서 형성된 항체는 제9항에 따른 백신용 조성물의 투여에 의해 생성된 것으로 판단하고, 헤마글루티닌(HA)에 대한 항체만이 검출될 경우에는 H5N1 바이러스의 감염에 의해 생성된 것으로 판단하는 것을 특징으로 하는, 검체에서 생성된 항체가 H5N1 바이러스의 감염에 의해 형성된 것인지 또는 백신투여에 의해 형성된 것인지를 진단하는 방법.
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US13/500,762 US20120219580A1 (en) | 2009-10-06 | 2010-10-06 | Highly pathogenic avian influenza virus protein vaccine derived from transgenic plant, and preparing method thereof |
IN3330DEN2012 IN2012DN03330A (ko) | 2009-10-06 | 2010-10-06 | |
CN2010800563463A CN102770016A (zh) | 2009-10-06 | 2010-10-06 | 来源于转基因植物的高致病性禽流感病毒蛋白疫苗及其制备方法 |
EP10822229.0A EP2486791A4 (en) | 2009-10-06 | 2010-10-06 | PROTEIN VACCINE AGAINST HIGHLY PATHOGENIC AVIAN INFLUENZA VIRUS FROM TRANSGENIC PLANTS AND PREPARATION METHOD THEREOF |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR20090094627 | 2009-10-06 | ||
KR10-2009-0094627 | 2009-10-06 | ||
KR1020100096488A KR101262300B1 (ko) | 2009-10-06 | 2010-10-04 | 형질전환 식물 유래의 고병원성 조류독감 바이러스 단백질 백신 및 그 제조방법 |
KR10-2010-0096488 | 2010-10-04 |
Publications (3)
Publication Number | Publication Date |
---|---|
WO2011043584A2 WO2011043584A2 (ko) | 2011-04-14 |
WO2011043584A9 true WO2011043584A9 (ko) | 2011-09-01 |
WO2011043584A3 WO2011043584A3 (ko) | 2011-10-20 |
Family
ID=44045255
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2010/006821 WO2011043584A2 (ko) | 2009-10-06 | 2010-10-06 | 형질전환 식물 유래의 고병원성 조류독감 바이러스 단백질 백신 및 그 제조방법 |
Country Status (6)
Country | Link |
---|---|
US (1) | US20120219580A1 (ko) |
EP (1) | EP2486791A4 (ko) |
KR (1) | KR101262300B1 (ko) |
CN (1) | CN102770016A (ko) |
IN (1) | IN2012DN03330A (ko) |
WO (1) | WO2011043584A2 (ko) |
Families Citing this family (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101535704B1 (ko) * | 2012-12-28 | 2015-07-27 | 한국생명공학연구원 | 항원성 단백질 고정화를 통한 돈단독 백신 제조방법 |
US9624272B2 (en) | 2013-03-14 | 2017-04-18 | University Of Washington Through Its Center For Commercialization | Polypeptides for treating and/or limiting influenza infection |
KR101602562B1 (ko) * | 2014-06-10 | 2016-03-10 | 포항공과대학교 산학협력단 | 인플루엔자 a 바이러스 h5n1의 헤마글루티닌을 발현하는 식물체 및 사포닌을 포함하는 경구용 인플루엔자 a 바이러스 h5n1 백신 조성물 |
CN109563518A (zh) * | 2016-05-12 | 2019-04-02 | 巴伊沃爱普有限公司 | 来自植物的用于经典猪瘟的疫苗组合物及其制造方法 |
CN109563138B (zh) | 2016-06-03 | 2022-09-23 | 圣诺菲·帕斯图尔公司 | 经改造的流感血凝素多肽的修饰 |
CN107058377A (zh) * | 2017-06-16 | 2017-08-18 | 深圳惠升生物科技有限公司 | 植物作为宿主在表达中东呼吸综合征的疫苗中的应用 |
KR102128453B1 (ko) * | 2018-03-23 | 2020-07-01 | 주식회사 젠바디 | 황열 바이러스 유래 ns1 단백질, 이에 특이적으로 결합하는 단일클론항체 및 이의 용도 |
KR102138272B1 (ko) * | 2018-09-19 | 2020-07-28 | 주식회사 바이오앱 | BiP 단편을 포함하는 재조합 벡터 및 상기 벡터를 이용한 재조합 단백질의 제조 방법 |
GB2578163A (en) * | 2018-10-19 | 2020-04-22 | Univ Pretoria | Plant produced avian influenza antigens and their uses in diagnostic assays and devices |
KR102317403B1 (ko) * | 2019-01-28 | 2021-10-29 | 주식회사 바이오앱 | 당화된 Ag85A 단백질을 포함하는 결핵 예방용 백신 조성물 및 이의 제조방법 |
KR102209198B1 (ko) * | 2019-04-02 | 2021-02-02 | 주식회사 바이오앱 | 식물에서의 발현이 최적화된 재조합 이리신 유전자 및 이를 이용한 재조합 이리신 단백질의 생산 방법 |
Family Cites Families (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20040242518A1 (en) * | 2002-09-28 | 2004-12-02 | Massachusetts Institute Of Technology | Influenza therapeutic |
KR100769584B1 (ko) | 2004-07-30 | 2007-10-23 | 학교법인 포항공과대학교 | 셀룰로오스의 자가가수분해를 위한 셀룰라아제 발현형질전환 식물체 및 이를 이용한 수용성 당의 생산방법 |
CU23576A1 (es) * | 2006-02-28 | 2010-09-30 | Ct Ingenieria Genetica Biotech | Antígenos vacunales quiméricos contra el virus de la influenza aviar |
DK2023952T3 (en) * | 2006-05-18 | 2015-10-19 | Epimmune Inc | Induction of immune responses to influenza virus using polypeptide and nucleic acid compositions |
CN1884517B (zh) * | 2006-06-08 | 2010-06-30 | 武汉禾元生物科技有限公司 | 利用谷物非储藏蛋白为融合载体在胚乳表达多肽的方法及应用 |
JP5385146B2 (ja) | 2006-10-20 | 2014-01-08 | スリーエム イノベイティブ プロパティズ カンパニー | 易洗浄基材のための方法及びそれによる物品 |
CN101284130B (zh) * | 2007-04-09 | 2011-12-14 | 生宝生物科技股份有限公司 | 利用逆向基因工程技术开发蛋白质疫苗与禽流感疫苗的方法 |
KR101161622B1 (ko) * | 2009-08-31 | 2012-07-04 | 헬릭스 주식회사 | 번역 효율 증진용 dna 단편 및 이를 포함하는 재조합 벡터 |
-
2010
- 2010-10-04 KR KR1020100096488A patent/KR101262300B1/ko active IP Right Grant
- 2010-10-06 IN IN3330DEN2012 patent/IN2012DN03330A/en unknown
- 2010-10-06 CN CN2010800563463A patent/CN102770016A/zh active Pending
- 2010-10-06 EP EP10822229.0A patent/EP2486791A4/en not_active Withdrawn
- 2010-10-06 WO PCT/KR2010/006821 patent/WO2011043584A2/ko active Application Filing
- 2010-10-06 US US13/500,762 patent/US20120219580A1/en not_active Abandoned
Also Published As
Publication number | Publication date |
---|---|
WO2011043584A3 (ko) | 2011-10-20 |
EP2486791A2 (en) | 2012-08-15 |
CN102770016A (zh) | 2012-11-07 |
KR101262300B1 (ko) | 2013-05-20 |
US20120219580A1 (en) | 2012-08-30 |
WO2011043584A2 (ko) | 2011-04-14 |
KR20110037880A (ko) | 2011-04-13 |
EP2486791A4 (en) | 2013-06-12 |
IN2012DN03330A (ko) | 2015-10-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2011043584A9 (ko) | 형질전환 식물 유래의 고병원성 조류독감 바이러스 단백질 백신 및 그 제조방법 | |
WO2017116205A1 (ko) | 글루카곤, glp-1 및 gip 수용체 모두에 활성을 갖는 삼중 활성체의 지속형 결합체 | |
WO2014158001A1 (ko) | 2 이상의 인플루엔자 a 바이러스 중화 결합 분자를 포함하는 조성물 | |
WO2020218829A1 (ko) | 플라젤린 융합 단백질 및 이의 용도 | |
WO2018074884A1 (ko) | 재조합 단백질 및 그의 용도 | |
WO2011025242A2 (ko) | 번역 효율 증진용 dna 단편 및 이를 포함하는 재조합 벡터 | |
WO2018165913A1 (zh) | 靶向nkg2dl的特异性嵌合抗原受体及其car-t细胞以及它们的应用 | |
WO2011142514A1 (ko) | Pias3을 유효성분으로 포함하는 암 또는 면역질환의 예방 또는 치료용 조성물 | |
WO2017003267A1 (ko) | 항바이러스 활성 효능을 가지는 펩티드 및 이를 포함하는 조성물 | |
US20230346912A1 (en) | Restrictive epitope peptide of major histocompatibility complex b2 of h9n2 subtype avian influenza virus and application thereof | |
WO2019182417A1 (ko) | 황열 바이러스 유래 ns1 단백질, 이에 특이적으로 결합하는 단일클론항체 및 이의 용도 | |
WO2022139493A1 (ko) | TGF-β 신호전달을 억제할 수 있는 신규한 펩타이드 및 이의 용도 | |
WO2022065913A1 (ko) | 요산산화효소-알부민 접합체, 그 제조방법 및 용도 | |
CN100580092C (zh) | 用于禽流感病毒检测和分型的基因芯片 | |
WO2023027402A1 (ko) | 아프리카 돼지열병 바이러스 유래 항원 단백질을 포함하는 아프리카 돼지열병의 예방용 백신 | |
WO2014142515A1 (ko) | 재조합 효모 전세포를 이용한 돼지 써코바이러스(pcv2) 서브유닛 백신과 그의 제조 방법 | |
WO2016195394A1 (ko) | 효모 세포벽 만노단백질 유래의 당사슬을 이용한 만노스-6-인산 당사슬이 부가된 당단백질의 제조방법 | |
WO2022119380A1 (ko) | 신규한 ace2 변이체 및 그의 이용 | |
WO2021221338A1 (ko) | 일회용 배양 공정 시스템을 이용한 인플루엔자 바이러스 생산 방법 및 인플루엔자 바이러스 항원 정제 조건 신속 확인 시험 | |
WO2022015115A1 (ko) | 3중 작용성 지속형 결합체 또는 3중 작용제를 포함하는 조합물의 치료학적 용도 | |
WO2020263063A1 (ko) | 글루카곤, glp-1 및 gip 수용체 모두에 활성을 갖는 삼중 활성체 또는 이의 결합체의 간 질환에 대한 치료적 용도 | |
WO2020162696A1 (ko) | 암 치료를 위한 t 세포의 활성화 방법 | |
WO2023101381A1 (ko) | 구제역 바이러스 유사 입자를 생산하기 위한 백신 플랫폼 | |
WO2015088256A1 (ko) | 광견병 바이러스를 중화시킬 수 있는 결합 분자 | |
WO2022050521A1 (ko) | Ace2 결합력이 감소된 코로나바이러스 유래 수용체 결합 도메인 변이체 및 이를 포함하는 백신 조성물 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 201080056346.3 Country of ref document: CN |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10822229 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 3330/DELNP/2012 Country of ref document: IN |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2010822229 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 13500762 Country of ref document: US |