WO2024005563A1 - 편도유래줄기세포를 유효성분으로 포함하는 감염성 폐 질환의 예방 또는 치료용 조성물 - Google Patents

편도유래줄기세포를 유효성분으로 포함하는 감염성 폐 질환의 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2024005563A1
WO2024005563A1 PCT/KR2023/009103 KR2023009103W WO2024005563A1 WO 2024005563 A1 WO2024005563 A1 WO 2024005563A1 KR 2023009103 W KR2023009103 W KR 2023009103W WO 2024005563 A1 WO2024005563 A1 WO 2024005563A1
Authority
WO
WIPO (PCT)
Prior art keywords
tonsil
cov
sars
composition
present
Prior art date
Application number
PCT/KR2023/009103
Other languages
English (en)
French (fr)
Inventor
박대휘
김정미
박현경
이삭
Original Assignee
주식회사 지씨셀
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 지씨셀 filed Critical 주식회사 지씨셀
Publication of WO2024005563A1 publication Critical patent/WO2024005563A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses

Definitions

  • the present invention relates to a method for preventing, treating or improving various lung injuries, including acute respiratory distress syndrome (ARDS) caused by infectious lung diseases, specifically coronavirus infection, using tonsil-derived stem cells.
  • ARDS acute respiratory distress syndrome
  • SARS-CoV a positive sense single-stranded RNA (+ssRNA) virus that causes severe acute respiratory syndrome
  • pandemic would stabilize as vaccine supply was activated by various development entities, but the infection rate is still higher than the vaccination rate worldwide, and the occurrence of new variants after vaccination, cases of non-production of antibodies, and side effects The efficacy of the vaccine, including cases of death, has not been fully verified.
  • ARDS acute respiratory distress syndrome
  • SARS-CoV-2 infection a representative lung disease that can be caused by SARS-CoV-2 infection and is a life-threatening condition that requires emergency treatment. It is a serious lung disease.
  • ARDS also appears when lung damage occurs due to severe trauma or burns, but one-third of all patients develop it due to bacterial or viral blood infection. If the cause is a bacterial or viral infection, the infected body fluid flows from the small blood vessels of the lungs into the alveoli, causing a sharp decrease in oxygen delivery and not only preventing normal breathing due to insufficient expansion of the lungs, but also causing multiple organ failure in other organs such as the kidneys and liver. It can be.
  • the present inventors have made extensive research efforts to develop an efficient cell therapy composition that can reversibly restore damage and loss of function in lung tissue caused by various causes, including pathogenic bacterial or viral infections.
  • Tonsil-derived Mesenchymal Stem Cell TMSC
  • isolated and cultured from human tonsil tissue, or its extract or culture by-product is used as a pharmacological ingredient
  • viral infection occurs, specifically SARS-CoV-2 infection.
  • the present invention was completed by discovering that not only was damage to lung tissue, bleeding, epithelial cell shedding, and excessive inflammatory response caused by the disease significantly improved, but also the survival rate of infected individuals was significantly improved.
  • an object of the present invention is to provide a composition for preventing or treating infectious lung diseases.
  • Another object of the present invention is to provide a composition for preventing or treating acute respiratory distress syndrome (ARDS).
  • ARDS acute respiratory distress syndrome
  • Another object of the present invention is to provide a composition for preventing or treating coronavirus infectious diseases.
  • the present invention provides a composition for preventing or treating infectious lung disease comprising tonsil-derived mesenchymal stem cells, extracts thereof, or secretions thereof as an active ingredient.
  • TMSC tonsil-derived mesenchymal stem cells
  • the term “cell therapy product” refers to cells manufactured to have or enhance pharmacological activity against a specific disease through isolation, culture, in vitro proliferation, and/or genetic or chemical modification from an individual for the purpose of preventing or treating the disease. This refers to autologous, allogeneic, or xenogeneic cells in which the cells themselves or their culture by-products are injected into the human body.
  • stem cell refers to an undifferentiated cell in the stage before differentiation into each cell constituting a tissue, which has the ability to differentiate into a specific cell under a specific differentiation stimulus (environment).
  • Cells are collectively referred to as Stem cells, unlike differentiated cells whose cell division has stopped, can produce cells identical to themselves through cell division (self-renewal), and when a differentiation stimulus is applied, they can differentiate into various cells depending on the nature of the stimulus. , It is characterized by the plasticity of differentiation.
  • the stem cells used in the present invention are tonsil-derived mesenchymal stem cells (TMSC).
  • TMSC tonsil-derived mesenchymal stem cells
  • meenchymal stem cells refers to stem cells with multipotency capable of differentiating into adipocytes, osteocytes, cartilage cells, muscle cells, nerve cells, and cardiomyocytes.
  • Mesenchymal stem cells can be identified through their spindle shape and the level of expression of basic cell surface markers CD73(+), CD105(+), CD34(-), and CD45(-), and have multipotency. It also has the function of regulating immune responses.
  • tonsil refers to lymphoid tissue located around the throat (pharynx) leading to the nasal cavity, which primarily blocks bacteria or viruses coming from outside and induces an immune response. It includes the coronal tonsil, palatine tonsil, and lingual tonsil.
  • TMSC tons-derived mesenchymal stem cells
  • cell extract refers to an extract obtained using an extraction solvent appropriately selected based on the physical properties of the target substance to be selectively separated from cells.
  • cell secretion refers to active ingredients that enable the pharmacological effects of the tonsil-derived mesenchymal stem cells of the present invention, such as growth factors, enzymes, and extracellular vesicles, that living cells release into the body or culture environment during the growth process. It is meant to encompass all secretions including.
  • extracellular vesicle refers to a vesicle with a lipid double membrane structure with a diameter in the range of 30-1,000 nm that is secreted into the extracellular environment through the fusion of the multivesicular body and the plasma membrane in various cells, of which In particular, microscopic vesicles with nano-level particle size are called exosomes.
  • prevention refers to suppressing the occurrence of a disease or disease in a subject who has not been diagnosed as having the disease or disease but is likely to develop the disease or disease.
  • treatment refers to (a) inhibiting the development of a disease, condition or symptom; (b) alleviation of a disease, condition or symptom; or (c) means eliminating a disease, condition or symptom.
  • lung tissue damaged by pathogenic virus infection, especially coronavirus infection is recovered, lesion area is reduced, weight loss of the infected subject is suppressed, and ultimately the survival rate is significantly improved, causing symptoms caused by coronavirus infection. It plays a role in suppressing, eliminating or alleviating.
  • composition of the present invention may itself be a composition for the treatment of infectious lung diseases, or may be administered together with other pharmacological ingredients and applied as a treatment adjuvant for the disease.
  • treatment or “therapeutic agent” includes the meaning of “therapeutic aid” or “therapeutic aid.”
  • administer refers to directly administering a therapeutically effective amount of the composition of the present invention to a subject so that the same amount is formed in the subject's body, and is the same as “transplantation” or “injection.” It has meaning.
  • the term “therapeutically effective amount” refers to the therapeutic or preventive effect of the pharmacological ingredients in the composition (i.e., tonsil-derived mesenchymal stem cells, extracts thereof, or secretions thereof) in the individual to whom the pharmaceutical composition of the present invention is to be administered. It refers to the content of the composition contained in a sufficient amount to provide, and includes a “prophylactically effective amount.”
  • the term “subject” includes, without limitation, humans, mice, rats, guinea pigs, dogs, cats, horses, cattle, pigs, monkeys, chimpanzees, baboons, or rhesus monkeys. Specifically, the subject of the present invention is a human.
  • infectious Lung Diseases encompasses a series of lung diseases in which lung tissue damage and function decline due to infection by pathogenic bacteria or viruses. It is used with the same meaning as “Respiratory Diseases” or “Pneumonia.”
  • the lung disease is selected from the group consisting of acute lung injury, chronic obstructive pulmonary disease (COPD), and acute respiratory distress syndrome (ARDS). Specifically, it is acute respiratory distress syndrome.
  • COPD chronic obstructive pulmonary disease
  • ARDS acute respiratory distress syndrome
  • ARDS acute respiratory distress syndrome
  • the infectious lung disease is a lung disease caused by a viral infection.
  • the virus is a coronavirus, more specifically a betacoronavirus, even more specifically Severe acute respiratory syndrome coronavirus (SARS-CoV) or SARS-CoV2, and most specifically is SARS-CoV-2.
  • SARS-CoV Severe acute respiratory syndrome coronavirus
  • SARS-CoV-2 Severe acute respiratory syndrome coronavirus
  • the present invention provides a composition for preventing or treating acute respiratory distress syndrome (ARDS), comprising tonsil-derived mesenchymal stem cells, extracts thereof, or secretions thereof as an active ingredient.
  • ARDS acute respiratory distress syndrome
  • tonsil-derived mesenchymal stem cells and their extracts and secretions used in the present invention and the acute respiratory distress syndrome to be prevented or treated through them have already been described in detail, their description is omitted to avoid excessive duplication.
  • the present invention provides a composition for preventing or treating coronavirus infectious diseases, comprising tonsil-derived mesenchymal stem cells, extracts thereof, or secretions thereof as an active ingredient.
  • tonsil-derived mesenchymal stem cells of the present invention their extracts, secretions, and coronaviruses to be treated have already been described in detail, their description is omitted to avoid excessive duplication.
  • the composition of the present invention not only restores lung tissue damage caused by the coronavirus, but also suppresses weight loss and significantly improves the survival rate of individuals infected with the coronavirus, thereby reducing symptoms caused by coronavirus infection. It has been experimentally confirmed that it plays a significant role in the reversible recovery and survival of infected individuals beyond alleviation of infection. Accordingly, the composition of the present invention can be used as a composition for preventing or treating not only infectious lung disease caused by coronavirus infection, but also coronavirus infection itself.
  • the pharmaceutical composition of the present invention when prepared as a pharmaceutical composition, includes a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are those commonly used in preparation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, Includes, but is limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. It doesn't work.
  • the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc.
  • lubricants wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc.
  • suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).
  • composition of the present invention can be administered parenterally, specifically intravenously or intraperitoneally.
  • the appropriate dosage of the pharmaceutical composition of the present invention is prescribed in various ways depending on factors such as formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity. It can be.
  • the preferred dosage of the pharmaceutical composition of the present invention is within the range of 0.001-100 mg/kg for adults.
  • the pharmaceutical composition of the present invention is prepared in unit dosage form by formulating it using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily performed by a person skilled in the art. Alternatively, it can be manufactured by placing it in a multi-capacity container. At this time, the formulation may be in the form of a solution, suspension, syrup or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, powder, granule, tablet or capsule, and may additionally contain a dispersant or stabilizer.
  • the present invention provides a method for preventing or treating infectious lung disease comprising administering to a subject a composition containing tonsil-derived mesenchymal stem cells, extracts thereof, or secretions thereof as an active ingredient. do.
  • the present invention provides a treatment for acute respiratory distress syndrome (acute respiratory distress syndrome), comprising the step of administering to a subject a composition containing tonsil-derived mesenchymal stem cells, extracts thereof, or secretions thereof as an active ingredient.
  • a treatment for acute respiratory distress syndrome comprising the step of administering to a subject a composition containing tonsil-derived mesenchymal stem cells, extracts thereof, or secretions thereof as an active ingredient.
  • ARDS a method of preventing or treating ARDS.
  • the present invention provides a method for preventing or treating a coronavirus infectious disease comprising administering to a subject a composition containing tonsil-derived mesenchymal stem cells, extracts thereof, or secretions thereof as an active ingredient. to provide.
  • tonsil-derived mesenchymal stem cells used in the present invention their extracts and secretions, and infectious lung diseases, acute respiratory distress syndrome, and coronavirus infectious diseases that can be treated or prevented through them have already been described in detail, to avoid excessive duplication, Omit the description.
  • the present invention provides a composition for preventing or treating infectious lung diseases, including acute respiratory distress syndrome.
  • Tonsillar-derived mesenchymal stem cells used as a pharmacological ingredient in the present invention can be obtained from tonsil tissue discarded after surgery, enabling easy and continuous supply.
  • the present invention not only efficiently and reversibly repairs the damage and functional decline of lung tissue caused by infectious lung disease, specifically SARS-CoV-2 infection, but also significantly improves the survival rate of infected individuals, It can be useful in treating not only lung damage but also viral infectious diseases themselves.
  • Figure 1 is a schematic diagram showing the in vivo efficacy evaluation test procedure for tonsil stem cells of the present invention.
  • FIG. 2 shows the results of measuring the survival rate of tonsil stem cells (CT303) of the present invention in the preparation and storage stages before use.
  • Figure 3 is a diagram showing the results of comparing changes in survival rate of hACE2-Tg mice by CT303 administration.
  • Figure 4 is a diagram showing the results of measuring the change in body weight of hACE2-Tg mice due to CT303 administration.
  • Figure 5 shows a negative control group administered an excipient (Figure 5a), a positive control group infected with SARS-CoV-2 and then administered an excipient (Figure 5b), and an experimental group administered CT303 after infection with SARS-CoV-2 ( Figure 5c). ) This is the result of observing lung lesions in hACE2-Tg mice.
  • Figure 6 is a diagram showing the results of analyzing the expression of the human-derived Alu gene in lung tissue after CT303 administration.
  • Figure 7 is a diagram showing the results of analysis of changes in RNA expression of the N gene of SARS-CoV-2 in mouse lung tissue by CT303 administration.
  • Figure 8 is a diagram showing the results of analysis of changes in inflammatory cytokine expression in mouse blood following CT303 administration.
  • Figure 9 is a diagram showing the results of analyzing changes in inflammatory cytokine expression in mouse lung tissue following CT303 administration.
  • Figure 10 is a diagram showing the results of H&E staining of lung tissues of hACE2-Tg mice in the negative control group, positive control group, and CT303 administration group.
  • Figure 11 is a diagram showing the results of evaluating the degree of lung tissue lesions following CT303 administration during SARS-CoV-2 infection using histopathology score generation values.
  • Figure 12 is a diagram showing the results of analyzing the distribution of SARS-CoV-2 in the lung tissue of hACE2-Tg mice in the negative control group, positive control group, and CT303 administration group through IHC staining.
  • Figure 13 shows the results of measuring changes in SARS-CoV-2 distribution in lung tissue following CT303 administration.
  • Tonsillar tissue obtained through tonsillectomy was donated from a healthy donor under the age of 10 who met the donor compatibility test criteria, and the cells were isolated and cultured to establish a tonsil-derived mesenchymal stem cell line.
  • Allogeneic tonsil-derived mesenchymal stem cells (CT303), which can rapidly regulate immunity and promote tissue regeneration, were produced by proliferating and culturing tonsil-derived mesenchymal stem cells for which characterization had been completed and treating them with factors that mimic the inflammatory environment in the body.
  • test material tonsil stem cells (CT303) of the present invention
  • CT303 tonsil stem cells
  • the test substances were stained with trypan blue (after thawing during the manufacturing process, mixing with CS10, and mixing with PBS) and analyzed for viability using a cell counter (Luna-II, logos biosystems). Each mouse was sacrificed 6 days after SARS-CoV-2 infection.
  • the lung tissue was transferred to a homogenization tube containing TRIZOL, tissue homogenization was performed, total RNA was isolated, and cDNA was synthesized using All-in-One cDNA Master Mix (Cellsafe, Korea, Cat no. CDS-200). Changes in viral RNA (N gene of SARS-CoV-2) were analyzed using synthesized cDNA (qRT-PCR; Nucleocapsid forward primer: TAATCAGACAAGGAACTGATTA, reverse primer: CGAAGTGTGACTTCCATG).
  • body weight changes of hACE2-Tg mice were measured daily.
  • mortality rate of each group of hACE2-Tg mice was measured for 6 days after infection, and the lung tissue of each hACE2-Tg mouse group was observed 6 days after infection.
  • the mouse was sacrificed and the degree of damage to the extracted lung tissue was observed with the naked eye, pathological changes were evaluated through H&E staining, and the histopathological score was measured.
  • IL-6, IL-8, TNF- ⁇ , and IL-1 ⁇ inflammatory cytokines
  • IL-6, IL-8, TNF- ⁇ , and IL-1 ⁇ inflammatory cytokines
  • total RNA was extracted from lung tissue and previously reported IL-8 primer sequence ( Molecules. 2020. 25(4):920) and TNF- ⁇ , IL-1 ⁇ , and IL-6 primer sequences ( Int J Mol Sci qRT-PCR was performed using . 2014. 15(12), 22728-42).
  • Tonsil stem cells (CT303) stored in an LN2 tank were thawed at 37°C and cell viability was analyzed at each preparation stage (immediately after thawing, after excipient mixing, and after mixing with PBS) ( Figure 1).
  • the survival rate of CT303 cells was measured by staining CT303 cells with trypan blue and counting them after storing them at room temperature for about 2 hours.
  • the 1st IV and 2nd IV at each stage immediately after thawing the stock vial (cells + excipients), after mixing additional excipients (+CS10), and after mixing excipients with PBS (+CS10+PBS).
  • the survival rate of CT303 manufactured for administration was confirmed to be over 90%, and the cell survival rate did not decrease even after being left at room temperature for 2 hours.
  • Virus-induced mortality was observed for the two control groups (excipient-only administration group and SARS-CoV-2 + excipient mixed administration group) and the CT303-administration experimental group until 6 days after SARS-CoV-2 infection (before autopsy).
  • the two control groups excipient-only administration group and SARS-CoV-2 + excipient mixed administration group
  • the CT303-administration experimental group until 6 days after SARS-CoV-2 infection (before autopsy).
  • nine 7-week-old male hACE2-Tg mice were prepared for each experimental group, and each mouse was administered 5 After administering 5 x 10 5 cells/200ul via route, the mortality rate of each hACE2-Tg mouse was analyzed.
  • the positive control group SARS-CoV-2 + excipient mixed administration
  • the present inventors administered CT303 twice to hACE2-Tg mice by IV route and attempted to confirm the effect of suppressing weight loss compared to the control group. Specifically, 10 7-week-old male hACE2-Tg mice in each experimental group were infected with SARS-CoV-2 at 5 dpi) As a result of administering CT303 by IV route, the body weight of the mice in the negative control group (administration of excipients only) tended to increase over time, whereas in the case of the positive control group (administration of mixed SARS-CoV-2 + excipients), the body weight of the mice showed a tendency to increase over time.
  • mice in the negative control group, positive control group, and CT303 administration group 6 days after SARS-CoV-2 infection were sacrificed 6 days after SARS-CoV-2 infection, and lung tissue from each group of mice was extracted to check morphological and clinical symptoms.
  • both the right lung and left lung were confirmed to be normal.
  • Figure 5a in mice infected with SARS-CoV-2, serious hemorrhage was confirmed in all lobes of the right lung in lung 1, and hemorrhage was confirmed in the left lung in lungs 2 and 3, 4, 5, In lung 6, severe hemorrhage was observed in the right upper lobe ( Figure 5b).
  • GC Cell Co., Ltd. produced primers based on the Human Alu Sequence used in non-clinical distribution tests (human Alu forward - TTAGCCGGACGTAGTGGC, reverse - GCAATCTCGGCTCACTGCAA), mouse GAPDH forward - TGTGAACCACGAGAAATATGA, reverse - TTGTCATGGATGACCTTGGC) and performed qPCR.
  • IL-8, IL-6, TNF- ⁇ , and IL-1 ⁇ inflammatory cytokines
  • Serum was separated using a serum separation tube, diluted with PBS at a ratio of 1:2, and then ELISA was performed.
  • IL-6 expression increased in the blood of the experimental group administered CT303 compared to the SARS-CoV-2 infection positive control group (red), but IL-8, TNF- ⁇ , and IL-1 ⁇ were increased. No changes in expression could be confirmed. Accordingly, when measuring ELISA with a blood sample, the cytokine expression measurement value was found to be low overall, and it was determined that cytokines were present in the blood below an appropriate level.
  • mice lung tissue was transferred to a homogenization tube containing TRIZOL, the tissue was pulverized, total RNA was isolated, RNA quantification and purity were confirmed with nano-drop, and cDNA was synthesized using 200 ng of RNA as a template (Superscript III First -strand synthesis kit, Invitrogen) and then qPCR was performed using an inflammatory cytokine-specific primer set. As shown in Figure 9, IL-8 decreased, but there was no difference in TNF- ⁇ , IL-6, and IL-1 ⁇ .
  • hACE2-Tg mouse lung tissue was isolated 6 days after SARS-CoV-2 infection, and tissue sections were slided.
  • the SARS-CoV-2 uninfected negative control group (NC, treated only with CS10) has widely distributed alveoli, normal parenchyma, and bronchiole and blood vessel surroundings.
  • a histopathological score was derived based on the degree and severity of lesions in blood vessels, parenchyma, and bronchiole in lung tissue caused by SARS-CoV-2 infection.
  • the histopathology score was determined based on Table 1 below, and the parameters for each experimental group were given a score from 0 to 3.
  • the positive area (%) value was calculated based on the distribution of infectious SARS-CoV-2 in lung tissue, and as a result of quantification using TS Auto 5.1 (Olympus, Tokyo, Japan) software, SARS-CoV- compared to the negative control group. 2 While the positive area of infectious SARS-CoV-2 significantly increased in the infected group, it was confirmed that the positive area decreased slightly to a slight level in the experimental group administered CT303.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Virology (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Cell Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Developmental Biology & Embryology (AREA)
  • Biotechnology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Pulmonology (AREA)
  • Zoology (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

본 발명은 급성호흡곤란증후군을 비롯한 감염성 폐질환의 예방 또는 치료용 조성물에 관한 것으로, 본 발명에서 약리성분으로 이용되는 편도유래 중간엽 줄기세포는 외과 수술 후 버려지는 편도 조직으로부터 수득될 수 있어 용이하고 지속적인 수급이 가능하다. 본 발명은 감염성 폐질환, 구체적으로는 SARS-CoV-2 감염으로 인한 폐 조직의 손상 및 기능 저하를 효율적, 가역적으로 복구할 뿐 아니라 피감염 개체의 생존률을 유의하게 개선시킴으로서, 바이러스로 인한 폐 손상 뿐 아니라 바이러스 감염 질환 자체를 치료하는 데에 유용하게 이용될 수 있다.

Description

편도유래줄기세포를 유효성분으로 포함하는 감염성 폐 질환의 예방 또는 치료용 조성물
본 발명은 편도유래 줄기세포를 이용하여 감염성 폐 질환, 구체적으로는 코로나바이러스 감염으로 유발된 급성호흡곤란증후군(acute respiratory distress syndrome, ARDS)을 비롯한 다양한 폐 손상을 예방, 치료 또는 개선하는 방법에 관한 것이다.
중증의 급성 호흡기 증후군을 야기하는 양성 단일가닥(positive sense single-stranded) RNA(+ssRNA) 바이러스인 코로나바이러스(SARS-CoV)는 거의 20년 전에 처음 보고되었으며, 베타 코로나바이러스(CoV)는 2002-2003년의 SARS-CoV, 2012년의 MERS-CoV 및 2019년 말에 시작된 SARS-CoV-2를 포함하여 지난 20년 간 세 번이나 동물성 전염병 또는 인간에서의 범유행을 야기한 바 있다. 그러나, 최근의 SARS-CoV-2는 전염성이 높고 중증의 호흡기 질환과 높은 치사율을 보이면서 지난 100년간 발발한 전염병 중 최악의 대유행을 유발한 바 있다.
최근, 다양한 개발 주체들에 의해 백신 공급이 활성화되면서 범유행이 안정화될 것으로 기대되었으나, 전 세계적으로 여전히 백신 접종률보다 감염률이 더 높은 상황이고, 백신 접종 후 새로운 변이체 발생, 항체 미생성 사례 및 부작용으로 인한 사망 사례 등 백신 효능에 대한 검증이 완벽히 이루어지지 않고 있다.
많은 연구팀들은 RNA 바이러스를 타겟으로 한 종래 또는 개발 중인 치료제 후보물질을 신속히 SARS-CoV-2에 적용해보고 효과적인 후보물질을 선별하고 있으며, 실제로 유사 RNA 바이러스의 경우 약제나 치료제 간의 교차 효과가 증명된 사례가 있어 가장 현실적인 대체 방안으로 떠오르고 있다.
한편, 성인 호흡곤란 증후군 또는 급성 호흡부전 증후군이라고도 불리는 급성호흡곤란증후군(acute respiratory distress syndrome, ARDS)은 SARS-CoV-2 감염에 의해 유발될 수 있는 대표적인 폐 질환으로 응급 처치가 필요한, 생명을 위협하는 심각한 폐 질환이다. ARDS는 심한 외상이나 화상에 의한 폐손상 시에도 나타나지만, 전체 환자의 1/3이 세균성 또는 바이러스성 혈액 감염을 원인으로 발병한다. 세균 또는 바이러스 감염을 원인으로 하는 경우, 감염된 체액이 폐의 작은 혈관에서 폐포로 흘러 들어가 산소 전달량이 급감하고 폐가 충분히 펴지지 않아 정상적인 호흡이 진행되지 않을 뿐 아니라 신장이나 간 등 다른 장기의 다발성 부전이 동반될 수 있다.
본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 발명자들은 병원성 세균 또는 바이러스 감염을 비롯한 다양한 원인에 의한 폐 조직의 손상 및 기능 소실을 가역적으로 회복시킬 수 있는 효율적인 세포 치료제 조성물을 개발하기 위하여 예의 연구 노력하였다. 그 결과, 인간 편도 조직에서 분리 배양된 편도유래 중간엽 줄기세포(Tonsil-derived Mesenchymal Stem Cell, TMSC) 또는 이의 추출물이나 배양 부산물을 약리성분으로 사용할 경우 바이러스 감염, 구체적으로는 SARS-CoV-2 감염으로 인한 폐 조직의 손상, 출혈, 상피세포 탈락 및 과도한 염증 반응 등이 현저히 개선될 뿐 아니라 피감염 개체의 생존률이 유의하게 개선됨을 발견함으로써, 본 발명을 완성하게 되었다.
따라서 본 발명의 목적은 감염성 폐질환의 예방 또는 치료용 조성물을 제공하는 데 있다.
본 발명의 다른 목적은 급성호흡곤란증후군(acute respiratory distress syndrome, ARDS)의 예방 또는 치료용 조성물을 제공하는 데 있다.
본 발명의 또 다른 목적은 코로나바이러스 감염 질환의 예방 또는 치료용 조성물을 제공하는 데 있다.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
본 발명의 일 양태에 따르면, 본 발명은 편도유래 중간엽 줄기세포, 이의 추출물 또는 이의 분비물을 유효성분으로 포함하는 감염성 폐질환의 예방 또는 치료용 조성물을 제공한다.
본 발명자들은 병원성 세균 또는 바이러스 감염을 비롯한 다양한 원인에 의한 폐 조직의 손상 및 기능 소실을 가역적으로 회복시킬 수 있는 효율적인 세포 치료제 조성물을 개발하기 위하여 예의 연구 노력하였다. 그 결과, 인간 편도 조직에서 분리 배양된 편도유래 중간엽 줄기세포(TMSC) 또는 이의 추출물이나 배양 부산물을 약리성분으로 사용할 경우 바이러스 감염, 구체적으로는 SARS-CoV-2 감염으로 인한 폐 조직의 손상, 출혈, 상피세포 탈락 및 과도한 염증 반응 등이 현저히 개선될 뿐 아니라 피감염 개체의 생존률이 유의하게 개선됨을 발견하였다.
본 발명에 있어서, 용어“세포치료제”는 개체로부터 분리, 배양, 체외증식 및/또는 유전적, 화학적 변형을 통해 특정 질환에 대한 약리활성을 가지거나 증진되도록 제조된 세포로서 질환의 예방 또는 치료 목적으로 세포 자체 또는 이의 배양 부산물이 인체에 주입되는 자가, 동종, 또는 이종세포를 의미한다.
본 명세서에서, 용어“줄기세포(stem cell)”는 조직을 구성하는 각 세포로 분화(differentiation)되기 전 단계의 미분화 세포로서, 특정 분화 자극(환경) 하에서 특정 세포로 분화할 수 있는 능력을 가지는 세포들을 총칭한다. 줄기세포는 세포분열이 정지된 분화된 세포와는 달리 세포분열에 의해 자신과 동일한 세포를 생산(self-renewal)할 수 있고, 분화 자극이 가해지면 자극의 성격에 따라 다양한 세포로 분화될 수 있는, 분화의 유연성(plasticity)을 가지고 있는 것이 특징이다.
본 발명의 구체적인 구현예에 따르면, 본 발명에서 이용되는 줄기세포는 편도유래 중간엽 줄기세포(Tonsil-derived mesenchymal stem cell, TMSC)이다.
본 명세서에서 용어“중간엽 줄기세포”는 지방세포, 골세포, 연골세포, 근육세포, 신경세포, 심근세포로의 분화가 가능한 다분화능(multipotency)을 가진 줄기세포를 의미한다. 중간엽 줄기세포는 방추형 (Spindle shape)의 형태와 기본적인 세포표면 표식자 CD73(+), CD105(+), CD34(-), CD45(-)의 발현 정도를 통하여 식별될 수 있으며, 다분화능과 함께 면역 반응을 조절하는 기능도 가진다.
본 명세서에서 용어“편도(Tonsil)”는 목(인두) 주변에서 비강으로 이어지는 곳에 위치하여 외부에서 유입되는 세균이나 바이러스를 일차적으로 차단하면서 면역반응을 유도하는 림프조직을 의미하며, 인두편도, 귀인두관편도, 구개편도, 혀편도 등을 포함한다.
본 명세서에서 용어“편도유래 중간엽 줄기세포(Tonsil-derived Mesenchymal stem cell, TMSC)"는 편도에서 유래한 중간엽 줄기세포(mesenchymal stem cells; MSCs)를 의미한다.
본 명세서에서 용어“세포 추출물”은 세포로부터 선택적으로 분리하고자 하는 목적 물질의 물성에 기반하여 적절하게 선정된 추출 용매를 사용하여 수득된 추출물(extract)를 의미한다.
본 명세서에서 용어“세포 분비물”은 살아있는 세포가 성장 과정에서 생체 내 또는 배양환경으로 배출하는 성장인자, 효소, 세포밖 소포체 등 본 발명의 편도유래 중간엽 줄기세포의 약리효과가 발휘되도록 하는 유효 성분을 포함하는 일체의 분비물을 포괄하는 의미이다.
본 명세서에서 용어 "세포밖 소포체(extracellular vesicle)"는 다양한 세포에서 다낭체와 원형질막의 융합을 통해 세포 밖 환경으로 분비되는 30-1,000 nm 범위 직경의 지질 이중막 구조의 소낭을 의미하며, 이 중 특히 나노수준의 입경을 가지는 미세 소포체를 엑소좀(exosome)이라 한다.
본 명세서에서 용어“예방”은 질환 또는 질병을 보유하고 있다고 진단된 적은 없으나, 이러한 질환 또는 질병에 걸릴 가능성이 있는 대상체에서 질환 또는 질병의 발생을 억제하는 것을 의미한다.
본 명세서에서 용어“치료”는 (a) 질환, 질병 또는 증상의 발전의 억제; (b) 질환, 질병 또는 증상의 경감; 또는 (c) 질환, 질병 또는 증상을 제거하는 것을 의미한다. 본 발명의 조성물을 대상체에 투여하면 병원성 바이러스, 특히 코로나바이러스 감염에 의해 손상된 폐 조직이 회복되고 병변부가 감소하며 피감염 개체의 체중 감소가 억제되면서 궁극적으로 생존률이 현저히 개선되어 코로나바이러스 감염에 의한 증상을 억제, 제거 또는 경감시키는 역할을 한다. 따라서, 본 발명의 조성물은 그 자체로 감염성 폐질환의 치료 조성물이 될 수도 있고, 혹은 다른 약리성분과 함께 투여되어 상기 질환에 대한 치료 보조제로 적용될 수도 있다. 이에, 본 명세서에서 용어“치료”또는“치료제”는“치료 보조”또는“치료 보조제”의 의미를 포함한다.
본 명세서에서 용어“투여”또는“투여하다”는 본 발명의 조성물의 치료적 유효량을 대상체에 직접적으로 투여함으로써 대상체의 체내에서 동일한 양이 형성되도록 하는 것을 말하며,“이식”또는“주입”과 동일한 의미를 가진다.
본 발명에서 용어“치료적 유효량”은 본 발명의 약제학적 조성물을 투여하고자 하는 개체에게 조성물 내의 약리성분(즉, 편도유래 중간엽 줄기세포, 이의 추출물 또는 이의 분비물)이 치료적 또는 예방적 효과를 제공하기에 충분한 정도로 함유된 조성물의 함량을 의미하며, 이에“예방적 유효량”을 포함하는 의미이다.
본 명세서에서 용어“대상체”는 제한없이 인간, 마우스, 래트, 기니아 피그, 개, 고양이, 말, 소, 돼지, 원숭이, 침팬지, 비비 또는 붉은털 원숭이를 포함한다. 구체적으로는, 본 발명의 대상체는 인간이다.
본 명세서에서 용어“감염성 폐질환(Infectious Lung Diseases)”은 병원성 세균 또는 바이러스에 의한 감염으로 인해 폐 조직의 손상 및 기능 저하가 발생하는 일련의 폐 질환을 포괄하는 의미로서,“감염성 호흡기 질환(Infectious Respiratory Diseases)”또는“폐렴(Pneumonia)”과 동일한 의미로 사용된다.
본 발명의 구체적인 구현예에 따르면, 상기 폐질환은 급성 폐손상, 만성폐쇄성폐질환(Chronic Obstructive Pulmonary Disease, COPD) 및 급성호흡곤란증후군(acute respiratory distress syndrome, ARDS)으로 구성된 군으로부터 선택되며, 보다 구체적으로는 급성호흡곤란증후군이다.
본 명세서에서 용어“급성호흡곤란증후군(acute respiratory distress syndrome, ARDS)”은 감염이나 외상으로 인한 폐 조직 손상 및 기능 부전으로 인해 혈중 산소량이 저하되어 고농도의 산소 공급하여도 호전되지 않는 호흡곤란을 일으키는 중증 폐 질환을 의미한다.
본 발명의 구체적인 구현예에 따르면, 상기 감염성 폐질환은 바이러스 감염에 의한 폐질환이다. 보다 구체적으로는, 상기 바이러스는 코로나바이러스이며, 보다 더 구체적으로는 베타-코로나바이러스(betacoronavirus)이고, 보다 더 구체적으로는 SARS-CoV(Severe acute respiratory syndrome coronavirus) 또는 SARS-CoV2이며, 가장 구체적으로는 SARS-CoV-2이다.
본 발명의 다른 양태에 따르면, 본 발명은 편도유래 중간엽 줄기세포, 이의 추출물 또는 이의 분비물을 유효성분으로 포함하는 급성호흡곤란증후군(acute respiratory distress syndrome, ARDS)의 예방 또는 치료용 조성물을 제공한다.
본 발명에서 이용되는 편도유래 중간엽 줄기세포 및 이의 추출물, 분비물과 이를 통해 예방 또는 치료하고자 하는 급성호흡곤란증후군에 대해서는 이미 상술하였으므로, 과도한 중복을 피하기 위해 그 기재를 생략한다.
본 발명의 또 다른 양태에 따르면, 본 발명은 편도유래 중간엽 줄기세포, 이의 추출물 또는 이의 분비물을 유효성분으로 포함하는 코로나바이러스 감염 질환의 예방 또는 치료용 조성물을 제공한다.
본 발명의 편도유래 중간엽 줄기세포, 이의 추출물, 분비물 및 치료 대상 코로나바이러스에 대해서는 이미 상술하였으므로, 과도한 중복을 피하기 위해 그 기재를 생략한다.
후술하는 실시예에서 보는 바와 같이, 본 발명의 조성물은 코로나바이러스에 의한 폐 조직 손상을 회복시킬 뿐 아니라 코로나바이러스에 감염된 개체의 체중 감소를 억제하고 생존률을 유의하게 향상시킴으로써, 코로나바이러스 감염으로 인한 증상의 경감을 넘어 감염된 개체의 가역적 회복과 생존 자체에 현저한 기능을 함이 실험적으로 규명되었다. 이에, 본 발명의 조성물은 코로나바이러스 감염으로 인한 감염성 폐질환 뿐 아니라, 코로나바이러스 감염증 자체에 대한 예방 또는 치료 조성물로 이용될 수 있다.
본 발명의 조성물이 약제학적 조성물로 제조되는 경우, 본 발명의 약제학적 조성물은 약제학적으로 허용되는 담체를 포함한다.
본 발명의 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다.
본 발명의 약제학적 조성물은 비경구 투여될 수 있으며, 구체적으로는 정맥 또는 복강 투여될 수 있다.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다. 본 발명의 약제학적 조성물의 바람직한 투여량은 성인 기준으로 0.001-100 ㎎/kg 범위 내이다.
본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액, 시럽제 또는 유화액 형태이거나 엑스제, 산제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
본 발명의 또 다른 양태에 따르면, 본 발명은 편도유래 중간엽 줄기세포, 이의 추출물 또는 이의 분비물을 유효성분으로 포함하는 조성물을 대상체에 투여하는 단계를 포함하는 감염성 폐질환의 예방 또는 치료 방법을 제공한다.
본 발명의 또 다른 양태에 따르면, 본 발명은 편도유래 중간엽 줄기세포, 이의 추출물 또는 이의 분비물을 유효성분으로 포함하는 조성물을 대상체에 투여하는 단계를 포함하는 급성호흡곤란증후군(acute respiratory distress syndrome, ARDS)의 예방 또는 치료 방법을 제공한다.
본 발명의 또 다른 양태에 따르면, 본 발명은 편도유래 중간엽 줄기세포, 이의 추출물 또는 이의 분비물을 유효성분으로 포함하는 조성물을 대상체에 투여하는 단계를 포함하는 코로나바이러스 감염 질환의 예방 또는 치료 방법을 제공한다.
본 발명에서 이용되는 편도유래 중간엽 줄기세포, 이의 추출물, 분비물 및 이를 통해 치료 또는 예방될 수 있는 감염성 폐질환, 급성호흡곤란증후군 및 코로나바이러스 감염 질환에 대해서는 이미 상술하였으므로, 과도한 중복을 피하기 위해 그 기재를 생략한다.
본 발명의 특징 및 이점을 요약하면 다음과 같다:
(a) 본 발명은 급성호흡곤란증후군을 비롯한 감염성 폐질환의 예방 또는 치료용 조성물을 제공한다.
(b) 본 발명에서 약리성분으로 이용되는 편도유래 중간엽 줄기세포는 외과 수술 후 버려지는 편도 조직으로부터 수득될 수 있어 용이하고 지속적인 수급이 가능하다.
(c) 본 발명은 감염성 폐질환, 구체적으로는 SARS-CoV-2 감염으로 인한 폐 조직의 손상 및 기능 저하를 효율적, 가역적으로 복구할 뿐 아니라 피감염 개체의 생존률을 유의하게 개선시킴으로서, 바이러스로 인한 폐 손상 뿐 아니라 바이러스 감염 질환 자체를 치료하는 데에 유용하게 이용될 수 있다.
도 1은 본 발명의 편도줄기세포에 대한 인 비보 효능 평가 시험절차를 보여주는 모식도이다.
도 2는 사용 전 조제 및 보관 단계에서의 본 발명의 편도줄기세포(CT303)에 대한 생존율 측정 결과를 나타낸다.
도 3은 CT303 투여에 의한 hACE2-Tg 마우스의 생존률 변화를 비교한 결과를 보여주는 그림이다.
도 4는 CT303 투여에 의한 hACE2-Tg 마우스의 체중 변화를 측정한 결과를 나타낸 그림이다.
도 5는 부형제 투여 음성대조군(도 5a), SARS-CoV-2에 감염시킨 뒤 부형제를 투여한 양성대조군(도 5b) 및 SARS-CoV-2에 감염시킨 뒤 CT303 투여를 투여한 실험군(도 5c) hACE2-Tg 마우스의 폐 병변을 관찰한 결과이다.
도 6은 CT303 투여 후 폐 조직 내 인간 유래 Alu 유전자의 발현을 분석한 결과를 보여주는 그림이다.
도 7은 CT303 투여에 의해 마우스 폐 조직 내 SARS-CoV-2의 N 유전자의 RNA 발현 변화를 분석한 결과를 보여주는 그림이다.
도 8은 CT303 투여에 따른 마우스 혈액 내 염증성 사이토카인 발현 변화를 분석한 결과를 보여주는 그림이다.
도 9는 CT303 투여에 따른 마우스 폐 조직 내 염증성 사이토카인 발현 변화를 분석한 결과를 보여주는 그림이다.
도 10은 음성대조군, 양성대조군 및 CT303 투여군 hACE2-Tg 마우스의 폐 조직에 대한 H&E 염색 결과를 보여주는 그림이다.
도 11은 SARS-CoV-2 감염시 CT303 투여에 따른 폐 조직 병변 정도를 조직병리학 점수발생 값으로 평가한 결과를 보여주는 그림이다.
도 12는 음성대조군, 양성대조군 및 CT303 투여군 hACE2-Tg 마우스의 폐 조직 내 SARS-CoV-2 분포를 IHC 염색을 통해 분석한 결과를 보여주는 그림이다.
도 13은 CT303 투여에 따른 폐 조직 내 SARS-CoV-2 분포 변화를 측정한 결과이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
실험방법
편도줄기세포의 제작 및 시료 준비
공여자 적합성 검사 기준에 합당한 10세 미만의 건강한 공여자로부터 편도 절제술로 인하여 수득된 편도 조직을 기증받아 세포를 분리, 배양하여 편도유래 중간엽줄기세포주를 확립하였다. 특성분석이 완료된 편도유래 중간엽줄기세포를 증식배양하고 체내 염증 환경을 모사하는 인자를 처리하여 신속한 면역 조절 및 조직 재생 촉진을 할 수 있는 동종 편도유래 중간엽줄기세포(CT303)를 제조하였다.
전술한 방법으로 제조된 동종 편도유래 중간엽줄기세포에 의한 hACE2-Tg 마우스 내 SARS-CoV-2 감염 유도 폐질환 발생 차단 효능을 평가하고자 하였다. hACE2-Tg 마우스 1마리당 주사 용적(injection volume)을 200 μl (5 x 105 cells)로 하여 계산하였으며, 동물실험 직전, 줄기세포 stock vial(1 x 107 cells/ml)을 37℃에서 해동하여 부형제(CS10)와 1 : 1로 혼합(세포 저장액 1ml + CS10 1ml)하여 뭉치는 세포가 없도록 충분히 풀어주었다. 전체 부피의 50% (2 ml)에 해당하는 PBS을 넣고 잘 혼합될 정도로 볼텍싱하였다.
SARS-CoV-2 감염
본 발명의 모든 동물실험은 동물실험윤리위원회 승인(JBNU 2022-1) 하에 수행되었다. 7주령 수컷 hACE2-Tg 마우스를 실험군 당 10마리씩 준비하고, 실험 수행 전 SARS-CoV-2(Delta, NCCP43390)를 1 x 107 TCID50/mlDelta, NCCP43390)를 5 x 104 TCID50/20 μl로 준비하였다. 이후 hACE2-Tg 마우스 비강을 통해 5 x 104 TCID50/20 μl의 SARS-CoV-2를 감염시켰다.
시험 물질의 투여
200 μl (5.0 x 105 cells/head)의 편도줄기세포를 hACE2-Tg 마우스에 바이러스 감염 1일과 3일 후, 총 2회 정맥 투여하였다(도 1). 시험물질인 본 발명의 편도줄기세포(CT303)는 매회 투여 전 조제하였다. 시험물질은 제조 과정에서 해동 후, CS10 혼합 후, 그리고 PBS 혼합 후) 트리판 블루로 염색하여 세포 계수기(Luna-II, logos biosystems)를 이용하여 생존율을 분석하였다. 각 마우스는 SARS-CoV-2 감염 후 6일 째에 희생시켰다.
바이러스 유전자의 발현 분석
폐 조직을 TRIZOL이 담긴 균질화 튜브로 옮기고 조직 균질화를 진행한 후 총 RNA를 분리하고 All-in-One cDNA Master Mix (Cellsafe, Korea, Cat no. CDS-200)을 이용하여 cDNA를 합성하였다. 합성된 cDNA를 사용하여( qRT-PCR을 통해 바이러스 RNA(SARS-CoV-2의 N 유전자) 변화를 분석하였다. Nucleocapsid 정방향 프라이머: TAATCAGACAAGGAACTGATTA, 역방향 프라이머: CGAAGGTGTGACTTCCATG).
hACE2-Tg 마우스의 임상 증상 변화 분석
양성대조군 및 음성대조군과 CT303 투여군에서, hACE2-Tg 마우스의 체중 변화를 매일 측정하였다. 아울러, 감염 후 6일 동안 hACE2-Tg 마우스의 그룹별 사망률을 측정하고, 감염 6일 후 각 hACE2-Tg 마우스 그룹의 폐 조직을 관찰하였다. 이를 위해 마우스를 희생시킨 뒤 적출된 폐 조직의 손상 정도를 육안으로 관찰하고, H&E 염색을 통한 병리학적 변화를 평가하였으며 조직병리학 점수(Histopathological score)를 측정하였다.
아울러, 면역조직화학 염색을 통한 조직 내 바이러스 존재 유무 및 위치를 분석하고, 폐 조직과 혈액 내 염증성 사이토카인(IL-6, IL-8, TNF-α 및 IL-1β)의 발현을 분석하였다. 구체적으로, 폐 조직으로부터 총 RNA를 추출하여 종래 보고된 IL-8 프라이머 서열(Molecules. 2020. 25(4):920) 및 TNF-α, IL-1β, IL-6 프라이머 서열(Int J Mol Sci. 2014. 15(12), 22728-42)을 이용하여 qRT-PCR을 수행하였다. hACE2-Tg 마우스의 부검 시 심장으로부터 혈액을 확보하고 혈청을 분리하여 ELISA 킷(Nori®Mouse IL-8, GR117025-2; Arigo biolaboratories Mouse proinflammatory cytokine multiplex ELISA kit, ARG82842)을 통해 염증성 사이토카인 발현 변화를 분석하였다.
통계적 분석
hACE2-Tg 체중 변화 측정, 생 바이러스 역가 & 바이러스 RNA 값에 대한 모든 데이터는 특별한 언급이 없는 한 평균 ± 표준편차로 표시하였고, 통계 분석은 독립 t-검정 및 일원배치분산분석(Graph-Pad Prism version 7.0, p <0.05인 경우 통계적 유의성이 있는 것으로 간주)을 수행하여 분석하였다.
실험결과
CT303의 세포 생존율 측정
LN2 탱크에 보관된 편도줄기세포(CT303)를 37℃에서 해동 후 각 조제 단계 (해동 직후, 부형제 혼합 후 및 PBS 혼합 후)에서 세포 생존율을 분석하였다(도 1). hACE2-Tg 마우스에 투여 전 CT303과 상온에서 약 2시간 보관 후 세포를 트리판 블루로 염색하고 계수함으로써 CT303 세포의 생존율 측정하였다. 그 결과, 도 2에서 보는 바와 같이 Stock vial 해동 직후(세포+부형제), 추가 부형제 혼합 후 (+CS10), 그리고 부형제와 PBS 혼합 (+CS10+PBS) 후의 각 단계에서 1차 IV 및 2차 IV 투여를 위해 제작된 CT303의 생존율은 모두 약 90% 이상임을 확인하였으며, 상온에서 2시간 방치된 이후에도 세포 생존율은 감소하지 않았다.
CT303 투여에 따른 hACE2-Tg 마우스의 생존률 변화
SARS-CoV-2 감염 후 6일(부검 이전)까지 두 대조군(부형제 단독투여군, SARS-CoV-2 + 부형제 혼합투여군)과 CT303 투여 실험군에 대하여 바이러스에 의한 사망률을 관찰하였다. 구체적으로, 각 실험군 당 7주령 수컷 hACE2-Tg 9 마리를 준비하고, 각 마우스에 SARS-CoV-2를 5 x 104 TCID50/20μl 비강 투여한 뒤, 감염 후 1일과 3일째에 CT303을 IV 경로로 5 x 105 cells/200ul을 투여한 뒤 각 hACE2-Tg 마우스의 사망률을 분석하였다. 그 결과, 양성대조군 (SARS-CoV-2 + 부형제 혼합투여)의 경우 5일 23.3%(2마리 사망), 6일 56.6%(3마리 사망, 총 5마리/9마리)의 사망률을 나타낸 반면, CT303을 투여한 실험군의 경우, 5일 0%, 6일 23.3% (2마리 사망)의 사망률이 관찰되었다(도 3). 이를 통해 본 발명의 편도줄기세포가 SARS-CoV-2 감염에 의한 hACE2-Tg 마우스의 사망률을 유의하게 감소시킴을 알 수 있었다.
CT303 투여에 따른 hACE2-Tg 마우스의 체중 변화
체중 감소는 SARS-CoV-2 감염에 의한 대표적인 임상 증상 중 하나이므로, 본 발명자들은 CT303을 hACE2-Tg 마우스에 IV 경로로 2회 투여한 후 대조군 대비 체중 감소 억제 효과를 확인하고자 하였다. 구체적으로, 각 실험군 당 7주령 수컷 hACE2-Tg 10마리에 SARS-CoV-2를 5 x 104 TCID50/20μl로 비강을 통해 감염시키고, 감염 1일 후(1 dpi) 및 3일 후(3 dpi) IV 경로로 CT303을 투여한 결과, 음성대조군 (부형제만 투여) 마우스의 체중은 시간에 따라 증가하는 경향을 보인 반면, 양성대조군(SARS-CoV-2 + 부형제 혼합투여)의 경우 SARS-CoV-2 감염 후 매일 체중이 감소하는 것을 확인하였으며, CT303 투여 실험군 마우스는 SARS-CoV-2를 감염시키지 않은 음성대조군 대비 체중이 감소하였지만, 양성대조군에 비해 체중 감소가 유의하게 억제되는 것을 확인하였다(도 4).
CT303 투여 후 hACE2-Tg 마우스 폐 조직 형태 관찰
음성대조군, 양성대조군 및 CT303 투여군 마우스에서 SARS-CoV-2 감염 6일 후 폐 조직을 분리한 뒤 형태학적인 변화를 관찰하였다. 구체적으로, SARS-CoV-2 감염 6일재 마우스를 희생시키고 각 그룹 마우스의 폐 조직을 적출하여 형태학적 임상 증상을 확인한 결과, 음성대조군(부형제만 투여)에서는 우측 폐와 좌측 폐 모두 정상으로 확인된 반면(도 5a) SARS-CoV-2에 감염된 마우스의 경우 1번 폐는 우측 폐의 모든 엽에서 심각한 출혈이 확인되었고, 2번과 3번 폐는 좌측 폐에서 출혈이 확인되었으며, 4, 5, 6번 폐는 우상엽에서 심각한 출혈이 관찰되었다(도 5b). CT303을 투여한 마우스 폐의 경우, 1번 폐의 우상엽에서 다소간의 출혈이 확인되고 5번 폐의 좌상엽에 부분적으로 미약한 출혈이 확인되었지만, 나머지 폐는 모두 정상으로 확인되었다(도 5c).
hACE2-Tg 마우스 폐 조직 내 CT303 유전자 발현 변화
SARS-CoV-2 감염 6일 후 희생시킨 hACE2-Tg 마우스에서 적출한 폐 조직에서의 CT303 발현 정도를 분석하고자 분리된 폐 조직에서 총 RNA를 분리하고, RNA 정량 및 순도 확인 후 cDNA 합성(Superscript Ⅲ First-strand synthesis kit, Invitrogen)을 진행하였다. (주)지씨셀에서 비임상 분포시험에 사용된 Human Alu Sequence를 바탕으로 프라이머를 제작(인간 Alu 정방향-TTAGCCGGACGTAGTGGC, 역방향-GCAATCTCGGCTCACTGCAA), 마우스 GAPDH 정방향-TGTGAACCACGAGAAATATGA, 역방향-TTGTCATGGATGACCTTGGC)하여 qPCR을 수행하였다. 그 결과, hACE2-Tg 마우스 폐 조직 내 음성대조군과 양성대조군 대비 CT303 투여군에서 Alu 유전자 발현율에 큰 차이가 없음을 확인하였다(도 6). 도 6에서 보는 바와 같이 CT303 세포 투여 마우스 폐에서 Alu 유전자가 오히려 소폭 감소하는 것으로 보이나 유의미한 수치를 보이지 않았다.
CT303 투여 hACE2-Tg 마우스 폐 조직 내 바이러스 RNA 유전자 발현 분석
음성대조군, 양성대조군 및 CT303 투여군 마우스의 폐 조직에서 바이러스 RNA 유전자의 발현율을 분석하고자, SARS-CoV-2 N(Nucleoprotein) 유전자를 타겟팅하는 프라이머 세트를 이용하여 PCR을 수행하였다(3회 반복). 그 결과, 도 7에서 보는 바와 같이 SARS-CoV-2 감염 양성대조군(붉은색) 대비 CT303을 투여한 실험군(파란색)에서 바이러스 RNA 유전자 감소는 확인되지 않았다. CT303을 투여한 실험군에서 바이러스 RNA 유전자 발현율이 소폭 증가하는 것처럼 보이나, 이는 유의미한 차이가 아닌 것으로 나타났다.
CT303 투여 hACE2-Tg 마우스의 폐 및 혈액 내 염증성 사이토카인 분석
SARS-CoV-2 감염 6일 후 hACE2-Tg 마우스의 혈액과 폐 조직에서 염증성 사이토카인(IL-8, IL-6, TNF-α 및 IL-1β)의 발현을 분석하고자 심장 채혈로 수득한 혈액에서 혈청 분리 튜브를 이용하여 혈청을 분리하고 PBS로 1:2의 배율로 희석한 뒤 ELISA를 수행하였다. 그 결과, 도 8에서 보는 바와 같이 SARS-CoV-2 감염 양성대조군(붉은색) 대비 CT303을 투여한 실험군의 혈액에서 IL-6 발현이 증가하였으나, IL-8, TNF-α 및 IL-1β의 발현 변화는 확인할 수 없었다. 이에, 혈액 샘플로 ELISA 측정 시 사이토카인 발현 측정값이 전반적으로 낮은 것으로 나타나 혈액 내 적정 수준 이하의 사이토카인이 존재하는 것으로 판단되었다.
아울러, 마우스 폐 조직을 TRIZOL이 담긴 균질화 튜브에 옮긴 후 조직을 분쇄하고 총 RNA를 분리한 후, nano-drop으로 RNA 정량 및 순도를 확인한 뒤 200 ng의 RNA를 주형으로 cDNA를 합성(Superscript III First-strand synthesis kit, Invitrogen)한 다음 염증성 사이토카인 특이적 프라이머 세트로 qPCR을 수행하였다. 도 9에서 보는 바와 같이, IL-8은 감소하였으나 TNF-α, IL-6 및 IL-1β는 차이가 없는 것으로 확인되었다.
CT303 투여 hACE2-Tg 마우스의 폐 조직 내 병변 발생 및 변화 관찰
H&E 염색
CT303을 투여한 hACE2-Tg 마우스 폐 조직에서 SARS-CoV-2 감염에 의한 병변 발생 정도의 변화를 분석하고자 SARS-CoV-2 감염 6일 후 hACE2-Tg 마우스 폐 조직을 분리하고, 조직 절편을 슬라이드에 고정한 후 H&E 염색을 수행한 결과, 도 10에서 보는 바와 같이 SARS-CoV-2 미감염 음성대조군(NC, CS10만 처리)은 폐포가 넓게 분포되어 있으며 실질이 정상이고 세기관지(bronchiole)와 혈관 주변 염증세포의 침윤이 확인되지 않았으며 세기관지의 상피세포(bronchiole epithelium)가 균질하게 위치하는 것이 확인된 반면, SARS-CoV-2 감염 양성대조군(SARS-CoV-2(delta) + CS10)의 경우 실질이 두터워지고 폐포가 좁아진 것을 확인할 수 있으며, 세기관지의 상피세포가 일부 탈락되고, 혈관 주위의 염증세포 침윤에 따른 간질성폐렴 증상이 관찰되었다. 한편, SARS-CoV-2 감염 후 CT303을 투여한 실험군에서는 음성대조군과 유사한 수준으로 폐포가 분포하고 있으며, 양성대조군 대비 SARS-CoV-2에 의한 실질의 경화(consolidation)가 현저히 낮아졌다. 혈관 주변의 염증세포 침윤은 미약하게 확인이 되지만, 세기관지의 상피세포가 정상 수준으로 유지하는 것으로 확인되어 결과적으로 CT303 투여를 통해 SARS-CoV-2에 의해 유도되는 간질성 폐렴 증상이 정상 폐와 유사한 수준으로 회복됨을 확인하였다.
조직병리학 점수
SARS-CoV-2 감염에 의한 폐 조직 내 혈관, 실질(parenchyma) 및 세기관지(bronchiole)에서 병변 발생 정도 및 중증도를 토대로 조직병리학 점수(histopathological score)를 도출하였다. 조직병리학 점수는 아래 표 1을 기준으로 결정하였으며, 각 실험군 별 파라미터는 0부터 3까지 점수를 부여하였다.
Figure PCTKR2023009103-appb-img-000001
음성대조군 대비 양성대조군(Delta) 마우스의 폐에서 조직 병변 심각성, 조직병리학 점수 값이 크게 증가한 반면, CT303을 투여한 실험군은 SARS-CoV-2에 감염되었음에도 음성대조군과 유사한 수준의 점수값을 보였다(도 11).
면역조직화학분석
미감염 음성대조군, 양성대조군(SARS-CoV-2(Delta) + CS10) 및 CT303을 투여한 실험군(SARS-CoV-2(Delta) + CT303) 마우스 폐 조직에 대한 IHC 분석을 수행한 결과, 감염 6일 후 SARS-CoV-2의 분포는 음성대조군 대비 모든 그룹에서 실질과 세기관지의 상피세포에서 양성 분포를 나타내며 양성대조군 CT303 투여 실험군에서 바이러스 분포 차이는 나타나지 않았다(도 12). 폐 조직 내 감염성 SARS-CoV-2 분포를 토대로 양성 면적(positive area, %) 값을 산출하였고, TS Auto 5.1 (Olympus, Tokyo, Japan) 소프트웨어를 이용하여 수치화한 결과, 음성대조군 대비 SARS-CoV-2 감염된 군에서 감염성 SARS-CoV-2의 양성 면적이 현저하게 증가한 반면, CT303을 투여한 실험군에서는 미약한 수준으로 양성 면적이 다소 감소함이 확인되었다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.

Claims (9)

  1. 편도유래 중간엽 줄기세포, 이의 추출물 또는 이의 분비물을 유효성분으로 포함하는 감염성 폐질환의 예방 또는 치료용 조성물.
  2. 제 1 항에 있어서, 상기 폐질환은 급성 폐손상, 만성폐쇄성폐질환(Chronic Obstructive Pulmonary Disease, COPD) 및 급성호흡곤란증후군(acute respiratory distress syndrome, ARDS)으로 구성된 군으로부터 선택되는 것을 특징으로 하는 조성물.
  3. 제 1 항에 있어서, 상기 감염성 폐질환은 바이러스 감염에 의한 폐질환인 것을 특징으로 하는 조성물.
  4. 제 3 항에 있어서, 상기 바이러스는 코로나바이러스인 것을 특징으로 하는 조성물.
  5. 제 4 항에 있어서, 상기 코로나바이러스는 SARS-CoV-2(Severe acute respiratory syndrome coronavirus 2)인 것을 특징으로 하는 조성물.
  6. 제 1 항에 있어서, 상기 조성물은 정맥 또는 복강 내 투여되는 것을 특징으로 하는 조성물.
  7. 편도유래 중간엽 줄기세포, 이의 추출물 또는 이의 분비물을 유효성분으로 포함하는 급성호흡곤란증후군(acute respiratory distress syndrome, ARDS)의 예방 또는 치료용 조성물.
  8. 편도유래 중간엽 줄기세포, 이의 추출물 또는 이의 분비물을 유효성분으로 포함하는 코로나바이러스 감염 질환의 예방 또는 치료용 조성물.
  9. 제 8 항에 있어서, 상기 코로나바이러스는 SARS-CoV-2(Severe acute respiratory syndrome coronavirus 2)인 것을 특징으로 하는 조성물.
PCT/KR2023/009103 2022-06-30 2023-06-29 편도유래줄기세포를 유효성분으로 포함하는 감염성 폐 질환의 예방 또는 치료용 조성물 WO2024005563A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2022-0080314 2022-06-30
KR1020220080314A KR20240003167A (ko) 2022-06-30 2022-06-30 편도유래줄기세포를 유효성분으로 포함하는 감염성 폐 질환의 예방 또는 치료용 조성물

Publications (1)

Publication Number Publication Date
WO2024005563A1 true WO2024005563A1 (ko) 2024-01-04

Family

ID=89381153

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/009103 WO2024005563A1 (ko) 2022-06-30 2023-06-29 편도유래줄기세포를 유효성분으로 포함하는 감염성 폐 질환의 예방 또는 치료용 조성물

Country Status (2)

Country Link
KR (1) KR20240003167A (ko)
WO (1) WO2024005563A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160109358A (ko) * 2015-03-11 2016-09-21 이화여자대학교 산학협력단 면역 질환 예방 또는 치료용 조성물
KR101791347B1 (ko) * 2016-06-29 2017-10-27 단국대학교 천안캠퍼스 산학협력단 편도유래 중간엽 줄기세포 스페로이드를 포함하는 알레르기 질환 예방 또는 치료용 조성물
WO2022018729A1 (en) * 2020-07-20 2022-01-27 Brainstorm Cell Therapeutics Ltd. Methods and compositions for treating lung conditions

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101520536B1 (ko) 2013-05-16 2015-05-14 이화여자대학교 산학협력단 편도유래 줄기세포의 간세포로의 분화 방법 및 편도유래 줄기세포를 포함하는 간 기능 손상 치료용 세포치료제 조성물

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160109358A (ko) * 2015-03-11 2016-09-21 이화여자대학교 산학협력단 면역 질환 예방 또는 치료용 조성물
KR101791347B1 (ko) * 2016-06-29 2017-10-27 단국대학교 천안캠퍼스 산학협력단 편도유래 중간엽 줄기세포 스페로이드를 포함하는 알레르기 질환 예방 또는 치료용 조성물
WO2022018729A1 (en) * 2020-07-20 2022-01-27 Brainstorm Cell Therapeutics Ltd. Methods and compositions for treating lung conditions

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
FERNÁNDEZ-FRANCOS SILVIA, EIRO NOEMI, GONZÁLEZ-GALIANO NATALIA, VIZOSO FRANCISCO J.: "Mesenchymal Stem Cell-Based Therapy as an Alternative to the Treatment of Acute Respiratory Distress Syndrome: Current Evidence and Future Perspectives", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, MOLECULAR DIVERSITY PRESERVATION INTERNATIONAL (MDPI), BASEL, CH, vol. 22, no. 15, 22 July 2021 (2021-07-22), Basel, CH , pages 7850, XP093122023, ISSN: 1422-0067, DOI: 10.3390/ijms22157850 *
MEDICINE NEWS: "Green Cross Labcell, Applied for Phase 1 Clinical Test for Acute Respiratory Distress Syndrome (ARDS) Stem-cell Therapy in Korea etc. ", NEWSMP, 23 August 2021 (2021-08-23), XP093122022, Retrieved from the Internet <URL:http://www.newsmp.com/news/articleView.html?idxno=217238> [retrieved on 20240122] *

Also Published As

Publication number Publication date
KR20240003167A (ko) 2024-01-08

Similar Documents

Publication Publication Date Title
WO2018026203A1 (ko) 지방 유래 줄기세포로부터 추출된 엑소좀을 유효성분으로 포함하는 폐 섬유증 예방 또는 치료용 조성물
JP2015508780A (ja) 免疫不全患者のインフルエンザ及びパラインフルエンザウイルスを処置するための方法、化合物、及び組成物
KR102145197B1 (ko) 코로나바이러스를 치료하기 위한 l-뉴클레오사이드의 용도
WO2017018698A1 (ko) M i l k F a t g l o b u l e - E G F F a c t o r (MFG - E 8) 을 이용한 조직섬유화 예방 또는 치료용 조성물
RU2596785C2 (ru) Композиция, содержащая пептид и ингибитор вирусной нейраминидазы
CN111467338B (zh) 焦谷氨酸在制备预防和治疗抗新冠肺炎新型冠状病毒的药物中的应用
CN111420024A (zh) 杆菌酞a在制备预防和治疗冠状病毒的药物中的应用
JP7045670B2 (ja) 多能性幹細胞による虚血再灌流肺障害の軽減及び治療
WO2019151744A1 (ko) 성체줄기세포 유래의 나노베시클 및 이의 표적 치료용 용도
CN112694463B (zh) 一种异戊烯基色原酮类化合物在制备抗冠状病毒药物中的用途
WO2021158000A1 (en) Composition for preventing or treating pulmonary diseases comprising hyaluronan and proteoglycan link protein 1
WO2024005563A1 (ko) 편도유래줄기세포를 유효성분으로 포함하는 감염성 폐 질환의 예방 또는 치료용 조성물
CN111566204B (zh) 培养细胞的制造方法、脊髓损伤疾病的治疗剂的制造方法
WO2022131603A1 (ko) 현초 추출물을 유효성분으로 포함하는 항바이러스 조성물
WO2021045595A1 (ko) 치아 주변조직 유래 다분화능 줄기세포를 포함하는 비만 또는 비알코올성 지방간의 예방 또는 치료용 약학적 조성물
WO2014051338A2 (ko) 말초혈액 단핵세포를 유효성분으로 포함하는 예방 또는 치료용 약제학적 조성물
WO2023149725A1 (ko) 코비드-19 항바이러스제
WO2021218154A1 (zh) 一种抗新冠病毒感染的药物、食物与应用
WO2021253338A1 (zh) 罗米地辛在预防和治疗冠状病毒相关疾病中的应用
WO2018088821A1 (ko) 히스톤 탈아세틸화 저해제 및 프라이밍 인자를 유효성분으로 포함하는 줄기세포 활성 촉진용 조성물
CN113384688A (zh) 一种糜蛋白酶在抗冠状病毒中的应用
WO2022108424A1 (ko) 호흡기 바이러스 감염의 치료 또는 예방을 위한 수퍼옥시드 디스무타아제 활성을 갖는 폴리펩티드 및 세포외 소포체의 용도
US20230149494A1 (en) Herbal composition, preparation method thereof and method for preventing or treating respiratory disorder by administering the same
WO2021162525A1 (ko) 히드록시유레아를 포함하는 염증 반응 억제용 약학 조성물
WO2020216349A1 (zh) 一种肠道病毒抑制剂

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23831921

Country of ref document: EP

Kind code of ref document: A1