WO2023224136A1 - 수퍼옥시드 디스뮤타제 및 이의 당뇨망막병증 또는 포도막염의 예방 또는 치료용 용도 - Google Patents

수퍼옥시드 디스뮤타제 및 이의 당뇨망막병증 또는 포도막염의 예방 또는 치료용 용도 Download PDF

Info

Publication number
WO2023224136A1
WO2023224136A1 PCT/KR2022/007004 KR2022007004W WO2023224136A1 WO 2023224136 A1 WO2023224136 A1 WO 2023224136A1 KR 2022007004 W KR2022007004 W KR 2022007004W WO 2023224136 A1 WO2023224136 A1 WO 2023224136A1
Authority
WO
WIPO (PCT)
Prior art keywords
sod
uveitis
pharmaceutical composition
soda2
diabetic retinopathy
Prior art date
Application number
PCT/KR2022/007004
Other languages
English (en)
French (fr)
Inventor
반재구
김의중
장인익
김정현
김정훈
Original Assignee
주식회사 제노포커스
주식회사 바이옴로직
서울대학교병원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 제노포커스, 주식회사 바이옴로직, 서울대학교병원 filed Critical 주식회사 제노포커스
Priority to PCT/KR2022/007004 priority Critical patent/WO2023224136A1/ko
Publication of WO2023224136A1 publication Critical patent/WO2023224136A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/189—Enzymes
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17—Amino acids, peptides or proteins
    • A23L33/195—Proteins from microorganisms
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/44—Oxidoreductases (1)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics

Definitions

  • the present invention relates to the use of superoxide dismutase for the prevention or treatment of diabetic retinopathy or uveitis. More specifically, the present invention relates to the use, composition or method of superoxide dismutase for the prevention or treatment of diabetic retinopathy or uveitis.
  • vision damage due to various diseases such as retinal nerve decline due to aging is on the rise, and the eye, including the retina, is a nervous tissue related to visual function, and once damage progresses, recovery is difficult, so special care is needed.
  • Diseases that cause vision impairment include, for example, diabetic retinopathy, uveitis, cataracts, macular degeneration, and retinal detachment.
  • Diabetic retinopathy is one of the chronic complications of diabetes and one of the major causes of blindness worldwide. Because vision deteriorates without any particular pain, treatment may be delayed. Diabetic retinopathy is treated with laser treatment, a common treatment, to prevent the development of new blood vessels and bleeding in the eye and prevent rapid loss of vision. However, in the case of diabetic macular edema, it is difficult to improve vision and the application of laser treatment is limited. . To compensate for this, a method of injecting steroids or vascular endothelial growth factor inhibitors (for example, dexamethasone) into the vitreous body is used, which inhibits vascular endothelial cell growth factors and reduces chronic inflammation in the retina of patients with diabetic retinopathy. It has the advantage of improving the condition, but there is a risk of side effects when used for a long time.
  • steroids or vascular endothelial growth factor inhibitors for example, dexamethasone
  • Uveitis is an inflammatory disease of the uveal tract of the eye. Although it is a transient disease and can be recovered after treatment, the inflammation usually occurs repeatedly and continuously and is mostly idiopathic with an unknown cause, so it can eventually cause serious visual impairment and lead to blindness. . Uveitis occurs due to infectious causes, such as viruses, bacteria, fungi, and parasites, and non-infectious causes, such as autoimmune diseases. Since uveitis is a specific endogenous disease in which no causative bacteria is found in most cases and abnormalities in the immune system are involved, corticosteroid preparations are mainly administered in the form of eye drops. If acute inflammation occurs, it is treated by topical steroid drops and a paralytic agent. If inflammation is severe, systemic steroids are administered, or in chronic diseases, immunosuppressants such as cyclosporine are administered.
  • the purpose of the present invention is to solve all of the above-mentioned problems.
  • One object of the present invention is to provide superoxide dismutase for preventing, improving or treating diabetic retinopathy or uveitis.
  • Another object of the present invention is to provide superoxide dismutase derived from Bacillus amyloliquefaciens that ensures oral administration efficacy and safety for the prevention, improvement or treatment of diabetic retinopathy or uveitis.
  • Another object of the present invention is to provide superoxide dismutase derived from Bacillus or Bacillus amyloliquefaciens that is secreted extracellularly and is convenient to produce for the prevention or treatment of diabetic retinopathy or uveitis.
  • Another object of the present invention is to provide a pharmaceutical composition or treatment method for preventing or treating diabetic retinopathy or uveitis.
  • Another object of the present invention is to provide a food or feed composition for preventing or improving diabetic retinopathy or uveitis.
  • Another object of the present invention is to provide a composition for oral administration containing superoxide dismutase for the prevention, improvement or treatment of diabetic retinopathy or uveitis.
  • a representative configuration of the present invention to achieve the above object is as follows.
  • an improved superoxide dismutase that exhibits the effect of preventing, improving or treating diabetic retinopathy or uveitis.
  • GRAS superoxide dismutase from a generally regarded as safe (GRAS) bacterium, such as Bacillus, for the prevention, amelioration or treatment of diabetic retinopathy or uveitis. .
  • superoxide dismutase derived from Bacillus or Bacillus amyloliquefaciens that is secreted extracellularly and is convenient to produce for the prevention, improvement or treatment of diabetic retinopathy or uveitis is provided.
  • an improved superoxide dismutase that exhibits effects in preventing, improving or treating diabetic retinopathy or uveitis even when administered orally.
  • superoxide dismutase derived from Bacillus amyloliquefaciens that ensures oral administration efficacy and safety for preventing, improving or treating diabetic retinopathy or uveitis is provided.
  • a pharmaceutical composition for preventing or treating diabetic retinopathy or uveitis comprising the superoxide dismutase as an active ingredient.
  • a food or feed composition for preventing or improving diabetic retinopathy or uveitis containing the superoxide dismutase as an active ingredient is provided.
  • composition for oral administration for preventing, improving, or treating diabetic retinopathy or uveitis
  • comprising the superoxide dismutase as an active ingredient comprising the superoxide dismutase as an active ingredient.
  • a method for preventing, improving or treating diabetic retinopathy or uveitis comprising administering the superoxide dismutase or the composition to a subject.
  • use of the superoxide dismutase is provided for preparing a medicament for preventing, improving, or treating diabetic retinopathy or uveitis.
  • Superoxide dismutase, composition, method and kit according to the present invention can be effectively used for preventing or treating diabetic retinopathy or uveitis.
  • superoxide dismutase according to the present invention is effective in preventing or treating diabetic retinopathy or uveitis even when administered orally.
  • Superoxide dismutase according to the present invention is derived from Bacillus or Bacillus amyloliquefaciens, which are generally regarded as safe (GRAS) bacteria, and not only ensures efficacy and safety when administered orally, but also when cultured. The production advantage of being able to recover directly from the supernatant can also be taken.
  • GRAS safe
  • the SOD of the present invention was orally administered to diabetes-induced mice and normal mice, and retinal vascular leakage evaluation, astrocyte immunofluorescence staining, and retinal blood vessel staining were evaluated.
  • the SOD-administered diabetes-induced mice were evaluated. It was confirmed that it had the effect of reducing retinal vascular permeability, recovering astrocyte foot processes, suppressing pericyte cell loss, and suppressing the development of acellular capillaries.
  • fundus evaluation and tissue evaluation by orally administering SOD to mice with acute and chronic uveitis it was confirmed that the inflammation was improved to a low grade. Therefore, superoxide dismutase according to the present invention can be effectively used to prevent, improve, or treat diabetic retinopathy or uveitis by reducing retinal vascular leakage and improving inflammatory conditions.
  • Figure 1 shows a schematic diagram for the double crossover recombination performed in Example 1.1.
  • Figure 2 shows the results of confirming the defective gene using PCR in the expression host GFBS220 and the production strain BSBA310.
  • W represents wild-type B. subtilis KCTC 3135
  • 220 represents the expression host GFBS220
  • 310 represents the SodA2 producing strain BSBA310.
  • Figure 3 shows the amino acid sequences of SodA (Mn-SOD confirmed through N-terminal sequencing in the culture supernatant of Bacillus amyloliquefaciens strain GF423) and superoxide dismutase (SodA2) of the present invention. is compared.
  • Figure 4 shows an expression vector for overexpression of the sodA2 gene.
  • rrnB T1T2 represents a transcription terminator
  • rep(pBR322) represents a replicon from pBR322 that works in E. coli
  • rep(pUB110) is a replicon from pUB110 that operates in B. subtilis
  • Kan R represents kanamycin resistance gene (aminoglycoside O-nucleotidyltransferase)
  • the BJ27 promoter represents a strong promoter for B. subtilis .
  • Figure 5 shows the overall procedure for preparing production strain BSBA310.
  • Figures 6a and 6b are diagrams showing the qualitative evaluation results of retinal vascular leakage in the 3-week diabetic retinopathy experimental group (scale bar is 500 ⁇ m), and Figure 6c is a diagram showing the quantitative evaluation results.
  • Figures 7a and 7b are diagrams showing the qualitative evaluation results of retinal vascular leakage in the diabetic retinopathy 16-week experimental group (scale bar is 500 ⁇ m), and Figure 7c is a diagram showing the quantitative evaluation results.
  • Figures 8A and 8B are diagrams showing the qualitative evaluation results of astrocyte immunofluorescence staining in the 3-week diabetic retinopathy experimental group
  • Figure 8C is a diagram showing the quantitative evaluation results.
  • Figures 9A and 9B are diagrams showing the qualitative evaluation results of astrocyte immunofluorescence staining in the diabetic retinopathy 16-week experimental group
  • Figure 9C is a diagram showing the quantitative evaluation results.
  • Figures 10A and 10B are diagrams showing the qualitative evaluation results of retinal blood vessel staining in the diabetic retinopathy 16-week experimental group (scale bar is 100 ⁇ m), and Figures 10C and 10D are diagrams showing the quantitative evaluation results.
  • Figures 11a and 11b are diagrams showing clinical score results of uveitis fundus evaluation.
  • Figure 11a shows the fundus evaluation results of the endotoxin-induced uveitis model
  • Figure 11b shows the fundus evaluation results of the experimental autoimmune uveitis model.
  • Figure 12 is a diagram showing four regions of the retina within the eye divided for uveitis tissue evaluation.
  • Figures 13a to 13c show the results of uveitis tissue evaluation in the endotoxin-induced uveitis model.
  • Figure 13a shows the results of the normal control group and the SodA2-administered normal mouse group
  • Figure 13b shows the results of the endotoxin-induced uveitis model and the SodA2-administered model.
  • the scale bars in FIGS. 13A and 13B indicate left: 200 ⁇ m and right: 100 ⁇ m, respectively.
  • Figure 13c shows the grade distribution results of the experimental group.
  • Figures 14a, 14b, and 14c show the results of uveitis tissue evaluation in an experimental autoimmune uveitis model.
  • Figure 14a shows the results of normal mice and the SodA2-administered normal mouse group
  • Figure 14b shows the results of the experimental autoimmune uveitis model and the SodA2-administered model.
  • the scale bars in FIGS. 14A and 14B indicate left: 200 ⁇ m and right: 100 ⁇ m, respectively.
  • Figure 14c shows the grade distribution results of the experimental group.
  • subject is used interchangeably with “patient” and refers to mammals in need of prevention or treatment of diabetic retinopathy or uveitis, such as primates (e.g. humans), companion animals (e.g. dogs, cats, etc.) ), domestic animals (e.g., cattle, pigs, horses, sheep, goats, etc.), and laboratory animals (e.g., rat mice, guinea pigs, etc.).
  • the subject is a human.
  • treatment includes prophylactic and/or therapeutic treatment.
  • the prophylactic and/or therapeutic treatment includes all types of treatment recognized in the art and includes, for example, administering a pharmaceutical composition or SOD of the present invention to a subject. If administered prior to clinical signs of an unwanted or undesirable condition (e.g., a disease or other undesirable or undesirable condition in the subject), such treatment or treatment is a prophylactic treatment or treatment (e.g., a disease or other undesirable condition in the subject). protecting the subject from the progression of the condition). On the other hand, if administered after clinical signs of an undesirable or undesirable condition, such treatment or treatment is therapeutic, such as to reduce, alleviate or stabilize the existing undesirable or undesirable condition or its side effects.
  • prevention is well known in the art.
  • administration of a pharmaceutical composition or SOD of the present invention can be compared to subjects not receiving the medical condition (discomfort, visual impairment, ocular vascular leakage, ocular surface damage, This means reducing the frequency of ocular surface inflammation, etc.) or delaying the onset and symptoms.
  • administration means providing an active ingredient to achieve a prophylactic or therapeutic purpose (e.g., prevention or treatment of diabetic retinopathy or uveitis) to a subject.
  • the present invention is based, at least in part, on the discovery that administration, especially oral administration, of superoxide dismutase (SOD) is effective in preventing or treating diabetic retinopathy or uveitis. Accordingly, according to one aspect of the present invention, the use of SOD for preventing or treating diabetic retinopathy or uveitis is provided.
  • SOD superoxide dismutase
  • diabetic retinopathy or uveitis may exhibit one or more symptoms selected from the group including vision impairment, ocular vascular leakage, or ocular inflammation.
  • Diabetic retinopathy refers to an eye complication in which capillaries are damaged due to persistent high blood sugar levels caused by diabetes, resulting in decreased vision. Diabetic retinopathy has no symptoms in the early stages, but as macular involvement occurs, vision deteriorates. Diabetic retinopathy is a disease that develops or progresses with various pathological characteristics such as microaneurysm, venous dilatation, retinal hemorrhage, retinal infarction, macular edema, new blood vessels, vitreous hemorrhage, and traction membrane.
  • pathological characteristics such as microaneurysm, venous dilatation, retinal hemorrhage, retinal infarction, macular edema, new blood vessels, vitreous hemorrhage, and traction membrane.
  • SOD may produce one or more effects selected from reducing vascular permeability in diabetic retinopathy, restoring astrocyte foot processes, inhibiting pericyte loss, and inhibiting acellular capillary development.
  • uveitis refers to inflammation of the interior part of the eye, particularly inflammation of the middle layer of the eye (uvea). More specifically, uveitis includes anterior uveitis, which is inflammation of the anterior half of the uveal system, including inflammation of the iris (iritis) and inflammation of the iris and ciliary body (cyclitis); intermediate uveitis, inflammation of the hyaline; and posterior uveitis, which is inflammation of the part of the uveal system behind the lens of the eye, including inflammation of the choroid (choroiditis) and inflammation of the choroid and retina (chorioretinitis), as well as panuveitis, which is uveitis that affects the entire uveal system. .
  • anterior uveitis which is inflammation of the anterior half of the uveal system, including inflammation of the iris (iritis) and inflammation of the iris and ciliary body (cyclitis); intermediate uveitis, inflammation of the
  • uveitis may include, but is not limited to, one or more selected from the group including infectious causes and non-infectious causes.
  • infectious causes of uveitis may include one or more selected from bacteria, viruses, fungi, and parasites
  • non-infectious causes may include one or more selected from autoimmune diseases, tumors, trauma, surgery, and systemic diseases. You can.
  • the SOD is an improvement in one or more fundus evaluation parameters selected from focal lesions of uveitis, linear lesions, chorioretinal lesions, confluent lesions, vasculitis, vitritis, vitreous hemorrhage, optic nerve papilledema, and retinal detachment. or palliative effect; an improvement or alleviation effect in one or more tissue evaluation indicators selected from inflammatory cell infiltration, retinal wrinkling, intra/subretinal hemorrhage, intra/subretinal exudate and retinal damage; and may exhibit improvement or alleviation effects of both of the above.
  • an improved superoxide dismutase that exhibits effects in preventing, improving or treating diabetic retinopathy or uveitis.
  • Superoxide dismutase is an enzyme that alternately catalyzes the dismutation of superoxide radicals (O 2 ⁇ - ) into general molecular oxygen (O 2 ) and hydrogen peroxide (H 2 O 2 ), and SOD is an active It plays an important role in reducing oxidative stress by removing oxygen species.
  • SODs are widely distributed in prokaryotic and eukaryotic cells and are classified into four classes based on different types of metal centers (copper/zinc, nickel, manganese, and iron).
  • Manganese-containing SOD [Mn-SOD] is widely present in the chloroplasts, mitochondria, and cytoplasm of several bacteria and eukaryotic cells.
  • the term “SOD” may be used interchangeably with polypeptide having superoxide dismutase activity.
  • the SOD may be one that binds manganese (Mn-SOD).
  • SOD may be deamidated Mn-SOD.
  • SOD may be one in which amino acid residues 73 and 136 of SEQ ID NO: 2 are substituted with Asp. More specifically, it may include or consist of the amino acid sequence represented by SEQ ID NO: 4.
  • the SOD or polypeptide having SOD activity of the present invention is interpreted to include amino acid sequences showing substantial identity to the above amino acid sequences.
  • the substantial identity is 80% or more, preferably 90% or more, more preferably 95% or more, and most preferably 98% or more of the sequence when analyzing the aligned sequences using an algorithm commonly used in the art. It refers to an amino acid sequence showing identity.
  • the SOD is a modified or engineered polypeptide with SOD enzymatic activity that may or may not affect various aspects (in vivo, in vitro, or in vitro stability, uniformity, and/or conformational changes). may include one or more mutations, such as deletion, insertion, or substitution of one or more amino acids.
  • the polypeptide may further include heterologous substances (e.g., tags known in the art, including HIS tag, Ha tag, myc tag, GFC, and/or Fc domain of an antibody) for purification, detection, or increased stability. there is.
  • SOD may be derived from natural or recombinant microorganisms, and may be an enzyme produced through a process of isolation or purification from various sources.
  • SOD may be derived from natural or recombinant microorganisms.
  • SOD can be derived from bacteria.
  • the SOD may be sourced from bacteria that are generally regarded as safe (GRAS) for use in drugs or food.
  • GRAS generally regarded as safe
  • SOD may be derived from a Bacillus species strain.
  • the SOD may be derived from a Bacillus amyloliquefaciens strain.
  • the SOD may be derived from Bacillus amyloliquefaciens GF423 strain (KCTC 13222 BP).
  • the GF423 strain (KCTC 13222 BP) was deposited at the Korea Research Institute of Bioscience and Biotechnology on March 6, 2017.
  • SOD may be derived from a recombinant strain containing the expression vector shown in Figure 4. Additionally, the SOD may be derived from a recombinant strain produced by a method including the method shown in FIG. 5.
  • the recombinant strain may be a Bacillus species strain that contains a nucleotide sequence encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 4 and has the following genes deleted: AprE, NprE, Bpr, Epr, NprB, Vpr, Mpr, IspA, SrfAC, spoIIAc, EpsE and Xpf .
  • Example 1 For detailed procedures for preparing the strain, refer to Example 1.
  • SOD derived from the above strain is an enzyme secreted outside the cell, when producing SOD using the above strain, SOD that is safe for humans is produced in large quantities without going through an expensive purification process (e.g., column purification). Because it can be produced, efficient production is possible.
  • SOD can be isolated or purified from a variety of sources, including natural or recombinant hosts.
  • SOD with activity to prevent or treat diabetic retinopathy or uveitis can be extracted from the culture supernatant of Bacillus amyloliquefaciens strain GF423.
  • a culture medium can be obtained by first cultivating Bacillus amyloliquefaciens strain GF423 in various types of media. For example, the strain is grown at 25°C to 42°C for 1 to 4 days using complex medium (pH 6.0 to 7.0).
  • LB medium Luria-Bertani
  • ISP International Streptomyces Project
  • NA nutrient agar
  • BHI brain heart infusion agar
  • SDA SDA
  • LB medium, ISP medium, BHI medium, SDA medium, or NB medium can be used.
  • SODs can be sourced from other natural or recombinant hosts using information provided in databases such as PubMed or BRENDA (brenda-enzymes.org on the World Wide Web).
  • the SOD may be an isolated or purified enzyme.
  • the isolated or purified SOD or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which it was derived.
  • the purified product may be purified from a strain culture through ultrafiltration, ammonium sulfate treatment, column purification, concentration, etc., or may be a culture concentrate obtained through ultrafiltration, concentration, etc.
  • the phrase “substantially free of cellular material” includes preparations of a protein in which such protein has been separated from cellular components of the cell from which the protein was isolated or recombinantly produced.
  • the phrase "substantially free of cellular material” means less than about 30%, preferably less than about 20%, more preferably less than about 10%, and most preferably less than about 10%, by dry weight, of unwanted proteins.
  • the preparation may contain less than about 5% protein.
  • the culture medium obtained by culturing Bacillus amyloliquefaciens strain GF423 is centrifuged and the culture supernatant is collected.
  • the supernatant fraction is pretreated by solid phase extraction and then isolated and purified by chromatography.
  • SOD can be purified using various methods of chromatography. Preferably, hydrophobic interaction chromatography is used.
  • the SOD may be included in the form of a strain lysate, a strain culture, a strain culture concentrate, a strain culture extract, or a dried form thereof.
  • strain lysate refers to a product obtained by cultivating a strain and crushing it mechanically or chemically, and may include anything that has undergone additional processes such as extraction, dilution, concentration, and purification.
  • strain culture may refer to the culture itself or its supernatant obtained by cultivating a strain.
  • strain culture concentrate refers to a culture concentrate purified from a strain culture through ultrafiltration, ammonium sulfate treatment, column purification, concentration, etc., or obtained through ultrafiltration, concentration, etc.
  • strain culture extract refers to an extract from the culture medium or its concentrate, and may include an extract, a diluted or concentrated liquid of the extract, a dried product obtained by drying the extract, or a crude or purified product thereof, or a fraction thereof.
  • the dried form may include a freeze-dried form.
  • the SOD is administered orally to a subject in need of prevention or treatment of diabetic retinopathy, thereby reducing one or more of the following: reducing vascular permeability, restoring astrocyte foot processes, inhibiting pericyte cell loss, and inhibiting the development of acellular capillaries. It was confirmed that it was effective.
  • the SOD is administered orally to a subject in need of prevention or treatment of uveitis to cause focal lesions, linear lesions, chorioretinal lesions, confluent lesions, vasculitis, vitritis, vitreous hemorrhage, and optic nerve papilledema. and an improvement or alleviation effect in one or more fundus evaluation parameters selected from retinal detachment; an improvement or alleviation effect in one or more tissue evaluation indicators selected from inflammatory cell infiltration, retinal wrinkling, intra/subretinal hemorrhage, intra/subretinal exudate and retinal damage; Or it showed an improvement or alleviation effect of both of the above.
  • a pharmaceutical composition for preventing or treating diabetic retinopathy or uveitis containing SOD as an active ingredient is provided.
  • the SOD according to the present invention can be combined with a pharmaceutically acceptable carrier, excipient and/or diluent to form a pharmaceutical composition for preventing or treating diabetic retinopathy or uveitis.
  • a pharmaceutically acceptable carrier for preventing or treating diabetic retinopathy or uveitis.
  • the pharmaceutical composition of the present invention may be used interchangeably with the term veterinary composition when applied to animals other than humans.
  • the pharmaceutical or veterinary composition of the present invention may further include one or more selected from the group consisting of pharmaceutically acceptable carriers, excipients, and diluents.
  • the pharmaceutically acceptable carrier, excipient and/or diluent may be those commonly used in the art.
  • Carriers, excipients or diluents include, for example, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginates, gelatin, calcium phosphate, calcium silicate, cellulose, methyl.
  • Cellulose hydroxypropyl methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, mineral oils such as methylhydroxybenzoate, propylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and silicon dioxide, etc. Examples include, but are not limited to.
  • additives such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants.
  • Additives for the formulation may be selected from those commonly used in the pharmaceutical field.
  • the pharmaceutical or veterinary composition of the present invention may be formulated in a desired form depending on the method of use, and may be formulated in a form known in the art to provide rapid, sustained or delayed release of the active ingredient, especially after administration to a mammal. It can be formulated by adopting a method.
  • Specific examples of such dosage forms include tablets, pills, powders, granules, syrups, solutions, capsules, suspensions, emulsions, injection solutions, plasters, lotions, liniments, limonade, aerosols, and extracts. There are extracts, elixirs, ointments, fluid extracts, needles, creams, soft or hard gelatin capsules, patches, etc.
  • compositions of the present invention are preferably prepared using appropriate methods known in the art or methods disclosed in Remington's Pharmaceutical Science (latest edition), Mack Publishing Company, Easton PA. It can be formulated as follows.
  • the SOD can be administered orally or parenterally.
  • SOD may be coated with shellac for protection from gastric acid, but the coating agent is not limited to this.
  • coatings suitable for use in the present invention include shellac, ethyl cellulose, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose phthalate, zein, Eudragit, and combinations thereof.
  • the SOD may be coated in solution. Specifically, the purified solution and the shellac-containing solution are mixed and then freeze-dried. These freeze-dried samples can be made into powder and stored at approximately 4°C until use.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations contain at least one excipient in a complex composition, such as starch, calcium carbonate, sucrose, lactose, gelatin, etc. It can be prepared by mixing. Additionally, in addition to simple excipients, lubricants such as magnesium stearate and talc may also be used.
  • Liquid preparations for oral administration include suspensions, oral solutions, emulsions, and syrups. In addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives are included. can be used
  • injection methods include sublingual administration, intraocular administration including intravitreal administration, nasal spray, topical dermal application, patch, intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection. You can choose.
  • the pharmaceutical or veterinary composition of the present invention is administered in a pharmaceutically or veterinarily effective amount.
  • pharmaceutically effective amount or "veterinary effective amount” means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical or veterinary treatment, and the effective dose level is defined as that of the patient or animal. Weight, gender, age, health status, severity, drug activity, sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, factors including concurrently used drugs, and other factors well known in the medical field. You can.
  • the pharmaceutical or veterinary composition of the present invention has about 2 to about 1500 U/mg, specifically about 5 to about 1000 U/mg, more specifically about 10 to about 800 U/mg, based on the total weight of the composition. mg, and more specifically, may include SOD in an amount of about 100 to about 500 U/mg.
  • the pharmaceutical or veterinary composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously. Additionally, the pharmaceutical composition may be administered singly or multiple times as needed. Considering all of the above factors, it is important to administer an amount that can achieve the maximum effect with the minimum amount without side effects, and this amount can be easily determined by a person skilled in the art.
  • a method for the treatment or prevention of diabetic retinopathy or uveitis, comprising administering the SOD or pharmaceutical composition according to the present invention to a subject having or at risk of diabetic retinopathy or uveitis.
  • administration includes any of a variety of administrations that perform the desired action and enable treatment.
  • the route of administration may be oral, parenteral, inhalation, topical or topical (eg, intralesional administration).
  • parenteral administration may include, but is not limited to, intravenous, subcutaneous, intraperitoneal, intraarterial, and intraocular administration.
  • SOD may be administered in a form coated with a coating agent such as shellac.
  • the effective or effective non-toxic amount of SOD according to the present invention can be determined by routine experimentation.
  • the therapeutically active amount of the SOD of the present invention may vary depending on factors such as disease stage, disease severity, subject's age, gender, medical comorbidities, and body weight.
  • the dosage and dosing regimen of the SOD of the present invention can be adjusted to provide optimal therapeutic response. For example, several divided doses may be administered daily, weekly, every two weeks, every three weeks, every four weeks, etc., and/or the dosage may be proportionally reduced or increased depending on the exigencies of the treatment situation.
  • the method may include administering one or more additional agents to treat or prevent diabetic retinopathy or uveitis.
  • the other agents include, but are not limited to, any agents that can improve or improve diabetic retinopathy or uveitis, such as compounds, gene therapy, and proteins (including antibodies).
  • the one or more additional agents may be administered simultaneously, sequentially, or in reverse order with the SOD or pharmaceutical composition. Additionally, the individual components may be administered to the subject by the same or different routes.
  • a food composition for improving or preventing diabetic retinopathy or uveitis containing SOD according to the present invention as an active ingredient is provided.
  • Such food compositions include medical or nutraceutical food compositions.
  • medical food or “nutraceutical food” refers to food manufactured from raw materials or ingredients that have the potential to perform beneficial functions in the human body, and that maintain or improve health by maintaining normal function or activating physiological functions of the human body. It refers to food, and is regulated by the Ministry of Food and Drug Safety, but is not limited thereto, and does not exclude any common health food from its meaning.
  • the above foods include, but are not limited to, various foods, food additives, beverages (e.g., functional drinks, natural fruit juices and vegetable drinks), gum, tea, vitamin complexes, health functional foods, and other functional foods. .
  • beverages e.g., functional drinks, natural fruit juices and vegetable drinks
  • gum e.g., gum, tea, vitamin complexes, health functional foods, and other functional foods.
  • the food can be manufactured by conventional methods known in the art.
  • the medical food, nutraceutical food, or health functional food may further include one or more of carriers, diluents, excipients, and additives in addition to the SOD for the purpose of preventing or improving diabetic retinopathy or uveitis, such as tablets, pills, It can be formulated as one selected from the group consisting of powder, granule, powder, capsule, and liquid formulation.
  • Specific examples of the carriers, excipients, diluents and additives are well known in the art, and those skilled in the art can prepare them by combining appropriate ingredients according to the formulation.
  • the content of superoxide dismutase according to the present invention as an active ingredient in the above-described formulation can be appropriately adjusted depending on the form and purpose of use, patient condition, type and severity of symptoms, etc., and is about 0.001 to about 0.001 to about 0.001 based on solid weight. It may be 99.9% by weight, preferably about 0.01 to about 50% by weight, but is not limited thereto.
  • the administered dose of the food of the present invention may vary depending on the patient's age, weight, gender, dosage form, health condition, and degree of disease, and is administered in divided doses from once to several times a day at regular time intervals according to the judgment of a doctor or pharmacist. You may. For example, based on the active ingredient content, the daily dosage may be about 10 to about 1000 mg/kg. The above dosage is an example of an average case, and the dosage may be higher or lower depending on individual differences. If the daily dosage of the health functional food of the present invention is less than the above dosage, significant effects may not be obtained, and if it exceeds the dosage, it is not only uneconomical but also outside the range of the usual dosage, so undesirable side effects may occur. there is.
  • a feed composition for preventing or improving diabetic retinopathy or uveitis containing SOD according to the present invention as an active ingredient is provided.
  • the food composition may include a feed composition.
  • feed compositions can be prepared in any formulation commonly used in the art.
  • the feed composition of the present invention includes auxiliary ingredients such as amino acids, inorganic salts, vitamins, antibiotics, antibacterial substances, antioxidants, antifungal enzymes, and other microbial agents in the form of live bacteria; Grains such as ground or broken wheat, oats, barley, corn and rice; Vegetable protein feeds, such as those based on rapeseed, soybean and sunflower; Animal protein feeds such as blood meal, meat meal, bone meal and fish meal; dry ingredients consisting of sugar and dairy products, such as various powdered milk and whey powder; Main ingredients such as lipids, such as animal fats and vegetable fats optionally liquefied by heating; Additional additives such as nutritional supplements, digestion and absorption enhancers, growth promoters, and disease prevention agents may be included.
  • auxiliary ingredients such as amino acids, inorganic salts, vitamins, antibiotics, antibacterial substances, antioxidants, antifungal enzymes, and other microbial agents in the form of live bacteria
  • Grains such as ground or broken wheat, oats
  • the feed composition of the present invention may be in the form of a powder or liquid preparation, and may contain excipients for adding feed (calcium carbonate, horse meal, zeolite, jade meal, or rice bran, etc.).
  • composition of the present invention may be provided in the form of a kit.
  • the composition of the present invention e.g., a modified polypeptide, a pharmaceutical composition, a food composition, a feed composition, a combination administration composition comprising at least one additional agent, or a combination thereof
  • Kits may also include components such as administration tools packaged in separate containers.
  • the expression host GFBS220 was prepared using Bacillus subtilis KCTC 3135.
  • B. subtilis KCTC 3135 was obtained from the Korea Research Institute of Bioscience and Biotechnology Biological Resources Center (KCTC). To facilitate post-processing, the genes shown in Table 1 below were removed from the B. subtilis KCTC 3135 genome.
  • PCR steps temperature hour first transformation 95°C 30 seconds 30 cycles 95°C50°C 72°C 30 seconds 30 seconds 1 minute/kb final height 72°C 10 minutes
  • the DNA polymerase used in PCR was Taq DNA polymerase (NEB, USA).
  • transformants single crossover homologous recombination
  • medium containing chloramphenicol 37°C (non-replication temperature).
  • the selected transformants were cultured (second crossover) in LB medium without antibiotics at 30°C (permissive temperature for replication) and then cultured at 39°C in LB agar medium without antibiotics.
  • Strains plasmid curing
  • PCR was performed on the selected colonies to obtain a double cross-over recombinant, and a second pure separation was performed to select the final recombinant, which was named GFBS220.
  • the defective gene region of GFBS220 was amplified using the primers and PCR shown in Table 4 and then confirmed using agarose gel electrophoresis. The results of confirming the defective gene using PCR in the expression host GFBS220 are shown in Figure 2.
  • Mn-SOD was confirmed in the culture supernatant of Bacillus amyloliquefaciens strain GF423 through N-terminal sequencing (Kang et al., 2018).
  • the GF423 strain was deposited at the Korea Research Institute of Bioscience and Biotechnology on March 6, 2017 (accession number KCTC 13222 BP).
  • the gene of the Mn-SOD was named sodA according to the nomenclature for bacterial SOD, and its amino acid sequence is shown in FIG. 3 and SEQ ID NO: 2 (its nucleotide sequence is referenced in SEQ ID NO: 1).
  • the sodA2 gene was amplified using duplicate extension PCR using four primers (Table 5) and the Bacillus amyloliquefaciens GF423 genome as a template. Nucleotides for substitution of Asn to Asp are underlined.
  • Expression vector pBE1-sodA2 was transformed into B. subtilis GFBS220. Strains were selected from the transformants, and pure clones were established by two single colony isolation procedures in LB2 medium. The selected strain was named BSBA310 and stored at -80°C using the glycerol stock method. The results of confirming the defective gene using PCR in this production strain BSBA310 are shown in Figure 2. Additionally, the overall procedure for preparing production strain BSBA310 is summarized in Figure 5.
  • Example 2 Isolation and purification of superoxide dismutase (SodA2) from production strain BSBA310
  • LB agar medium (LB (Luria-Bertani) agar; tryptophan 10 g/L, yeast extract 5 g/L, NaCl 10 g/L, agar 15 g/L)
  • the single colony formed was inoculated into 30 ml of LB medium and cultured at 37°C for 12 hours.
  • This seed culture was again inoculated into 3 L of LB medium containing 1 mM manganese sulfate (MnSO4) and cultured at 37°C for 20 hours.
  • MnSO4 manganese sulfate
  • Example 2.1 The cell culture obtained in Example 2.1 was centrifuged at 4°C and 3,578 390 g of ammonium sulfate was added per liter of concentrated cell culture, stirred for 20 minutes, centrifuged, and the supernatant was taken. The taken supernatant was purified using a phenylsepharose HP column. In the purification process, the column was equilibrated using 50mM potassium phosphate pH 7.0 with a 2M ammonium sulfate concentration. Afterwards, the supernatant obtained by adding ammonium sulfate was passed through the column, and SodA2 attached to the column was equilibrated with 50mM potassium phosphate pH 7.0 containing 1.6M ammonium sulfate.
  • SodA2 was analyzed using the SOD assay kit (Cayman Chemical, Michigan, USA). One unit of SOD activity is defined as the amount of enzyme that inhibits superoxide radicals by 50%. The activity of dried SodA2 enzyme was 1000 to 1200 U/mg.
  • Shellac (EXCELACS co., LTD., Bangkok) was dissolved to a 3% ethanol concentration and sterilized using a 0.2 um sterile filter. Shellac dissolved in ethanol was diluted with PBS. Freeze-dried SodA2 was dissolved at 20 mg/mL, shellac solution and SOD solution were mixed 1:1, and then freeze-dried. The material used in animal testing was prepared by mixing freeze-dried shellac-coated SodA2 with dextrin at a ratio of 1:9 to 12 (shellac-coated SodA2:dextrin). The SOD activity of the final material was set to be 90 to 110 U/mg.
  • mice 120 6-week-old male C57BL/6 mice (source: Coretech) were purchased, maintained on a 12-hour light/dark cycle, and the mice were allowed free access to food and water.
  • Diabetes mellitus (hereinafter “DM”) mice were induced by intraperitoneal injection of Streptozotocin (STZ) solution (10 mM citrate buffer (pH 4.5), 180 mg/kg), 3 days after injection. After checking the blood sugar level, only mice with a blood sugar level of 300 mg/dl or higher were selected as diabetic mice.
  • STZ Streptozotocin
  • C57BL/6 mice were classified into 10 groups as shown in Table 6 depending on the concentration of the administered oral drug and the presence or absence of diabetes, and were divided into a 3-week experimental group (60 mice) and a 16-week experimental group (60 mice) according to the SodA2 administration period. The experiment was conducted separately. In the case of the SodA2 administration group, SodA2 was administered daily from the streptozotocin induction stage regardless of the presence or absence of diabetes.
  • n 6 Normal mouse group administered 1 unit SodA2 C57BL/6 control group + SodA2 1 unit, 150 ul oral administration once a day
  • n 6 Normal mouse group administered with 5 unit SodA2 C57BL/6 control group + SodA2 5 units, 150 ul oral administration once a day
  • n 6 Normal mouse group administered 10 unit SodA2 C57BL/6 control group + SodA2 10 units, 150 ul oral administration once a day
  • n 6 Normal mouse group administered 20 unit SodA2 C57BL/6 control group + SodA2 20 units, 150 ul oral administration once a day
  • n 6 Diabetic control group STZ-injected C57BL/6 mice (DM)
  • n 6 Diabetes group administered 1 unit SodA2 STZ-injected C57BL/6 mice (DM) + SodA2 1 unit, 150 ul oral administration once a day
  • n 6 Diabetic control group STZ-injected C57BL/6 mice (DM)
  • n 6 Diabetes group administered 1 unit SodA2 STZ
  • mice 120 6-week-old male C57BL/6 mice (source: Coretech) were purchased, maintained on a 12-hour light/dark cycle, and the mice were allowed free access to food and water.
  • 60 animals were used in the experimental group of the endotoxin-induced uveitis model, and 60 animals were used in the experimental autoimmune uveitis model. All animal experiments were conducted in accordance with the Statement of the Association for Research in Vision and Ophthalmology for the Use of Animals in Ophthalmology and Vision Research and were approved by the Institutional Animal Care and Use Committees of Seoul National University and Seoul National University Hospital. received.
  • EIU Endotoxin-Induced Uveitis
  • Endotoxin-induced uveitis model normal control C57BL/6 vehicle-administered control group
  • n 6 Normal mouse group administered 1 unit SodA2 C57BL/6 control + SodA2 1 unit, 150 ul oral administration once a day
  • n 6 Normal mouse group administered with 5 unit SodA2 C57BL/6 control group + SodA2 5 units, 150 ul oral administration once a day
  • n 6 Normal mouse group administered 10 unit SodA2 C57BL/6 control group + SodA2 10 units, 150 ul oral administration once a day
  • n 6 Normal mouse group administered 20 unit SodA2 C57BL/6 control group + SodA2 20 units, 150 ul oral administration once a day
  • n 6 EIU control group LPS-administered uveitis-induced C57BL/6 mice (LPS)
  • n 6 1 unit SodA2 administered EIU mouse group LPS-administered uveitis-induced C57BL/6 mice (LPS)
  • Example 5.2 Construction of experimental autoimmune uveitis model and SodA2 administration
  • CFA complete Freund's adjuvant
  • mice normal control C57BL/6 vehicle-administered control group
  • n 6 Normal mouse group administered 1 unit SodA2 C57BL/6 control + SodA2 1 unit, 150 ul oral administration once a day
  • n 6 Normal mouse group administered with 5 unit SodA2 C57BL/6 control group + SodA2 5 units, 150 ul oral administration once a day
  • n 6 Normal mouse group administered 10 unit SodA2 C57BL/6 control group + SodA2 10 units, 150 ul oral administration once a day
  • n 6 Normal mouse group administered 20 unit SodA2 C57BL/6 control group + SodA2 20 units, 150 ul oral administration once a day
  • Example 6 Example of confirmation of effect in diabetic retinopathy model
  • mice were anesthetized and Evans blue (20 mg/ml, 150 ul, dissolved in PBS) was intravenously injected and perfused for 1 hour, and then the eyes were perfused. It was extracted. All eye enucleation procedures were performed in accordance with the Association for Research in Vision and Ophthalmology's Statement on the Use of Animals in Ophthalmology and Vision Research.
  • the enucleated eyeball was fixed with 4% paraformaldehyde (PFA), flatmounted in 1x PBS, placed on a slide, and then examined under a fluorescence microscope (Eclipse 90i, Nikon, Tokyo, Japan). The entire retina was photographed at x 40 magnification using .
  • the entire retina was photographed with red fluorescence, and the images were adjusted to a color threshold based on the automatic ISODATA algorithm using the ImageJ (1.47v, NIH, Bethesda, MD, USA) program. After adjusting accordingly, the red area was measured and expressed as the degree of retinal vascular leakage (%), and compared with the non-diabetic normal control group.
  • retinal vascular leakage As a result of quantitative analysis of retinal vascular leakage, consistent with the qualitative evaluation results, there was no retinal vascular leakage in both the SodA2-unadministered normal control group and the SodA2-administered normal mouse group, and high retinal vascular leakage was confirmed in the diabetic control group.
  • retinal vascular permeability was decreased compared to the diabetic control group, and in particular, a statistically significant decrease was observed in the diabetic group administered 5 units SodA2.
  • Quantitative evaluation of retinal vascular leakage in the 3-week experimental group is shown in Figure 6c.
  • retinal vascular leakage was not observed in the normal control group not administered SodA2 and the normal mouse group administered SodA2 (retinal vascular permeability increased in the normal mouse group administered 20 units SodA2). pattern, but not significant), the diabetic control group showed high retinal vascular permeability.
  • retinal vascular permeability was decreased compared to the diabetic control group, and in particular, a statistically significant decrease was observed in the diabetes group administered 5 units SodA2.
  • Quantitative evaluation of retinal vascular leakage in the 16-week experimental group is shown in Figure 7c.
  • anti-GFAP antibody (1:100; Invitrogen, 53-9392-82) was added to Perm/Block solution (PBS containing 0.3% Triton-X and 0.2% BSA).
  • PBS Perm/Block solution
  • isolectin B4-594 (1:100; Invitrogen, I21412) were added and incubated overnight at 4°C. The next day, the cells were washed with PBS, and the retina was mounted with fluoromount aqueous mounting medium (Sigma-Aldrich).
  • the retina was stained and photographed using a confocal microscope (Leica TCS STED, Leica Microsystems, Wetzlar, Germany), and the middle part of the retina was photographed at x 400 magnification using ImageJ (1.47v, NIH, Bethesda, MD, USA). Astrocytes were quantified for each group using the program.
  • the retina was placed in a 24-well plate and washed four times with PBS. Next, 3% trypsin solution (Difco 1:250, 0.1M Tris (pH 7.8)) was added to the plate containing the retina and incubated at 37°C for 2 hours. After the reaction was over, trypsin was carefully removed, washed with water, transferred to a slide, and non-vascular tissues were carefully removed using water. After drying the slide with only blood vessels remaining, H&E staining was performed.
  • trypsin solution Difco 1:250, 0.1M Tris (pH 7.8)
  • Diabetic retinopathy may result in the development of acellular capillaries accompanied by pericyte loss around blood vessels, and this was confirmed through retinal blood vessel staining.
  • EIU endotoxin-induced uveitis
  • EAU experimental autoimmune uveitis
  • chronic induction a fundus examination was performed.
  • scores range from 0 in the absence of intraocular inflammation to 4 depending on the criteria for bleeding or ocular conditions. Refer to Table 9 for scoring criteria.
  • Uveitis Fundus Evaluation Criteria score standard 4 points Vitreous hemorrhage filling the vitreous cavity or large retinal detachment (more than 1/2) 3.5 points Vitreous hemorrhage (more than 1/2) or small retinal detachment 3 points Small vitreous hemorrhage, pattern of linear lesions, large confluent lesions, or optic nerve papilledema 2.5 points Chorioretinal lesions (more than 5) or linear lesions (2 or more, 1/4 area) 2 points Small focal lesions (3 to 5) or linear lesions (less than 1, more than 1/2 area) 1.5 points Small focal lesions (3 to 5) or linear lesions (less than 1, 1/4 area) 1 point Small focal lesions (1 to 2) or minimal vasculitis/vitritis (more than 1/2 area) 0.5 points Small focal lesions (1 to 2) or minimal vasculitis/vitritis (1/4 area) 0 points If there is no inflammation
  • SodA2 administration showed a reduction effect in fundus evaluation scoring of uveitis compared to the non-administered group (FIG. 11b). In particular, inflammation was most improved in the 5 unit SodA2 administered group.
  • the enucleated eye was fixed in 4% paraformaldehyde and a paraffin block was made.
  • the paraffin block was cut into 4 ⁇ m-thick sections and subjected to H&E (hematoxylin & eosin) staining. See Table 10 and Figure 12 for information regarding uveitis tissue evaluation criteria.
  • Uveitis tissue evaluation criteria score standard 4 points Retinal folds (4 areas), intra-/subretinal hemorrhage or exudate (4 areas), inner and outer retinal layer damage (4 areas), inflammatory cell infiltration (4 areas) 3.5 points Retinal folds (3 areas), intra-/subretinal hemorrhage or exudate (3 areas), inner and outer retinal layer damage (3 areas), inflammatory cell infiltration (3 areas) 3 points Retinal folds (3 areas), intra-/subretinal hemorrhages or exudates (2 areas), damage to inner and outer retinal layers (2 areas), and inflammatory cell infiltration (3 areas).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Health & Medical Sciences (AREA)
  • Polymers & Plastics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Food Science & Technology (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Animal Husbandry (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Ophthalmology & Optometry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 수퍼옥시드 디스뮤타제 및 이의 당뇨망막병증 또는 포도막염의 예방 또는 치료를 위한 이의 용도에 관한 것이다. 본 발명에 따른 수퍼옥시드 디스뮤타제는, 특히 경구 투여를 통해, 당뇨망막병증 또는 포도막염의 예방 또는 치료에 효과적으로 사용될 수 있다.

Description

수퍼옥시드 디스뮤타제 및 이의 당뇨망막병증 또는 포도막염의 예방 또는 치료용 용도
본 발명은 당뇨망막병증 또는 포도막염의 예방 또는 치료를 위한 수퍼옥시드 디스뮤타제의 용도에 관한 것이다. 더욱 구체적으로, 본 발명은 당뇨망막병증 또는 포도막염의 예방 또는 치료를 위한 수퍼옥시드 디스뮤타제의 용도, 조성물 또는 방법에 관한 것이다.
최근 노화로 인한 망막 신경 쇠퇴와 같은 다양한 질병에 의한 시력 손상이 증가하는 추세이며, 망막을 포함한 안구는 시각기능과 관련된 신경조직으로 일단 손상이 진행되면 회복이 힘들기 때문에 각별한 주의가 필요하다. 시력 손상을 일으키는 질환에는 예를 들어, 당뇨망막병증, 포도막염, 백내장, 황반변성, 망막박리 등이 포함된다.
당뇨망막병증은 당뇨병의 만성합병증 중 하나로 전 세계적으로 주요 실명 원인 중 하나이며, 특별한 통증 없이 시력이 나빠지기 때문에 치료 시기가 늦어질 수 있다. 당뇨망막병증은 보편적인 치료법인 레이저 치료를 통해 눈의 신생 혈관 발생 및 출혈을 막아 급격한 시력 상실을 억제하는 방법으로 치료되고 있으나, 당뇨황반부종이 있는 경우 시력 호전이 어렵고 레이저 치료의 적용에 제한이 있다. 이를 보완하기 위한 방법으로 스테로이드 또는 혈관내피성장인자 억제제(예를 들면, 덱사메타손)를 유리체 내에 주사하는 방법이 이용되는데, 이는 혈관내피세포 성장인자들을 억제하고 당뇨망막병증 환자의 망막에서 만성적인 염증상태를 호전시키는 장점이 있지만 장기간 사용시 부작용의 위험이 있다.
포도막염은 눈의 포도막관의 염증성 질환이며, 일과성 발병으로 치료 후 회복할 수도 있지만 대개는 염증이 반복적, 지속적으로 나타나며 원인불명한 특발성인 것이 대부분이기 때문에 종국에는 심각한 시력장애를 일으켜 실명에 이를 수 있다. 포도막염은 바이러스, 박테리아, 곰팡이, 기생충 등에 의한 감염성 원인과 자가면역질환에 의한 비감염성 원인으로 발병한다. 포도막염은 대부분 원인균이 발견되지 않는 특이성 내인성 질환이고 면역 체계의 이상이 관여하므로 주로 부신 피질 호르몬 제제를 점안액 형태로 투여한다. 급성 염증이 발생한 경우는 국소적인 스테로이드 점안과 함께 조절마비제를 점안하여 치료하며, 염증이 심한 경우는 전신적인 스테로이드를 투여하거나 만성적인 질환의 경우 사이클로스포린 등의 면역억제제를 투여한다.
종래의 스테로이드 제제는 장기간 사용시 부작용의 위험이 있으며, 조절마비제는 눈 부심과 가까운 글씨를 보는 데 어려움을 유발하는 등 단점이 많다. 따라서, 안구 질환 특히, 당뇨망막병증 및/또는 포도막염을 예방 또는 치료할 수 있는 제제의 개발이 필요하다.
본 발명은 상술한 문제점을 모두 해결하는 것을 그 목적으로 한다.
본 발명은 당뇨망막병증 또는 포도막염의 예방, 개선 또는 치료를 위한 수퍼옥시드 디스뮤타제를 제공하는 것을 일 목적으로 한다.
본 발명은 당뇨망막병증 또는 포도막염의 예방, 개선 또는 치료를 위한 경구 투여 효능 및 안전성을 확보한 바실러스 아밀로리퀴파시엔스 유래의 수퍼옥시드 디스뮤타제를 제공하는 것을 다른 목적으로 한다.
본 발명은 당뇨망막병증 또는 포도막염의 예방 또는 치료를 위하여 생산하기 편리하게 세포외 분비되는 바실러스 유래 또는 바실러스 아밀로리퀴파시엔스 유래의 수퍼옥시드 디스뮤타제를 제공하는 것을 다른 목적으로 한다.
본 발명은 당뇨망막병증 또는 포도막염의 예방 또는 치료를 위한 약학 조성물 또는 치료 방법을 제공하는 것을 다른 목적으로 한다.
본 발명은 당뇨망막병증 또는 포도막염의 예방 또는 개선을 위한 식품 또는 사료 조성물을 제공하는 것을 또 다른 목적으로 한다.
본 발명은 당뇨망막병증 또는 포도막염의 예방, 개선 또는 치료를 위한 수퍼옥시드 디스뮤타제를 포함하는 경구 투여용 조성물을 제공하는 것을 또 다른 목적으로 한다.
본 발명의 목적은 이상에서 언급한 목적으로 제한되지 않는다. 본 발명의 목적은 이하의 설명으로 보다 분명해질 것이며, 특허청구범위에 기재된 수단 및 그 조합으로 실현될 것이다.
상기 목적을 달성하기 위한 본 발명의 대표적인 구성은 다음과 같다.
본 발명의 일 태양에 따르면, 당뇨망막병증 또는 포도막염의 예방, 개선 또는 치료 효과를 나타내는 개선된 수퍼옥시드 디스뮤타제(superoxide dismutase; SOD)가 제공된다.
본 발명의 다른 태양에 따르면, 당뇨망막병증 또는 포도막염의 예방, 개선 또는 치료를 위한, 일반적으로 안전한 것으로 간주되는(generally regarded as safe, GRAS) 박테리아, 예컨대 바실러스 유래의 수퍼옥시드 디스뮤타제가 제공된다.
본 발명의 또 다른 태양에 따르면, 당뇨망막병증 또는 포도막염의 예방, 개선 또는 치료를 위하여 생산하기 편리하게 세포외 분비되는 바실러스 유래 또는 바실러스 아밀로리퀴파시엔스 유래의 수퍼옥시드 디스뮤타제가 제공된다.
본 발명의 또 다른 태양에 따르면, 경구 투여되는 경우에도 당뇨망막병증 또는 포도막염의 예방, 개선 또는 치료 효과를 나타내는 개선된 수퍼옥시드 디스뮤타제가 제공된다.
본 발명의 또 다른 태양에 따르면, 당뇨망막병증 또는 포도막염의 예방, 개선 또는 치료를 위한, 경구 투여 효능 및 안전성을 확보한 바실러스 아밀로리퀴파시엔스 유래의 수퍼옥시드 디스뮤타제가 제공된다.
본 발명의 또 다른 태양에 따르면, 상기 수퍼옥시드 디스뮤타제를 유효성분으로 포함하는 당뇨망막병증 또는 포도막염의 예방 또는 치료를 위한 약학 조성물이 제공된다.
본 발명의 또 다른 태양에 따르면, 상기 수퍼옥시드 디스뮤타제를 유효성분으로 포함하는 당뇨망막병증 또는 포도막염의 예방 또는 개선을 위한 식품 또는 사료 조성물이 제공된다.
본 발명의 또 다른 태양에 따르면, 상기 수퍼옥시드 디스뮤타제를 유효성분으로 포함하는 당뇨망막병증 또는 포도막염의 예방, 개선 또는 치료를 위한 경구 투여용 조성물이 제공된다.
본 발명의 또 다른 태양에 따르면, 상기 수퍼옥시드 디스뮤타제 또는 상기 조성물을 대상에 투여하는 단계를 포함하는 당뇨망막병증 또는 포도막염의 예방, 개선 또는 치료를 위한 방법이 제공된다.
본 발명의 또 다른 태양에 따르면, 상기 수퍼옥시드 디스뮤타제의 당뇨망막병증 또는 포도막염의 예방, 개선 또는 치료를 위한 용도가 제공된다.
본 발명의 또 다른 태양에 따르면, 상기 수퍼옥시드 디스뮤타제의 당뇨망막병증 또는 포도막염의 예방, 개선 또는 치료용 약제 제조를 위한 용도가 제공된다.
본 발명에 따른 수퍼옥시드 디스뮤타제, 조성물, 방법 및 키트는 당뇨망막병증 또는 포도막염의 예방 또는 치료에 효과적으로 사용될 수 있다. 특히 본 발명에 따른 수퍼옥시드 디스뮤타제는 경구로 투여되는 경우에도 당뇨망막병증 또는 포도막염의 예방 또는 치료에 효과적임이 확인되었다.
본 발명에 따른 수퍼옥시드 디스뮤타제는 일반적으로 안전한 것으로 간주되는(generally regarded as safe, GRAS) 박테리아인 바실러스 또는 바실러스 아밀로리퀴파시엔스에서 유래하여 경구 투여 효능 및 안전성이 확보될 뿐만 아니라 배양 시 상등액에서 직접 회수할 수 있는 생산 장점도 취할 수 있다.
본 발명의 실시예에 따르면, 당뇨병 유발 마우스와 정상 마우스에 본 발명의 SOD를 경구 투여하여 망막 혈관 누출 평가, 성상교세포 면역형광염색 평가, 망막 혈관 염색 평가를 수행한 결과, SOD 투여 당뇨병 유발 마우스에서 망막 혈관 투과성 감소, 성상교세포 발돌기의 회복, 주피세포 손실 억제 및 무세포 모세혈관 발생 억제 효과가 있음을 확인하였다. 또한, 포도막염을 급성 및 만성으로 유발한 마우스에 SOD를 경구 투여하여 안저평가 및 조직평가를 진행한 결과, 염증 소견이 낮은 등급으로 개선됨을 확인하였다. 따라서, 본 발명에 따른 수퍼옥시드 디스뮤타제는 망막 혈관 누출의 감소, 염증 상태 호전을 통해 당뇨망막병증 또는 포도막염의 예방, 개선 또는 치료하는 데에 효과적으로 사용될 수 있다.
도 1은 실시예 1.1에서 수행된 이중 교차 재조합을 위한 모식도를 나타낸다.
도 2는 발현 숙주 GFBS220과 생산 균주 BSBA310에서 PCR을 이용하여 결손 유전자를 확인한 결과를 나타낸다. W는 야생형 B. subtilis KCTC 3135를 나타내고, 220은 발현 숙주 GFBS220를 나타내고, 310은 SodA2 생산 균주 BSBA310을 나타낸다.
도 3은 SodA(바실러스 아밀로리퀴파시엔스(Bacillus amyloliquefaciens) 균주 GF423의 배양 상층액에서 N-말단 시퀀싱을 통해 확인된 Mn-SOD)와 본 발명의 수퍼옥시드 디스뮤타제(SodA2)의 아미노산 서열을 비교한 것이다.
도 4는 sodA2 유전자의 과발현을 위한 발현 벡터를 나타낸다. 여기서, rrnB T1T2는 전사 종결인자를 나타내고; rep(pBR322)는 E. coli에서 작동하는 pBR322로부터의 레플리콘을 나타내고; rep(pUB110)는 B. subtilis에서 작동하는 pUB110로부터의 레플리콘이고; KanR은 카나마이신 내성 유전자(아미노글리코시드 O-뉴클레오티딜트랜스퍼라제)를 나타내고; BJ27 promoter는 B. subtilis에 대한 강력한 프로모터를 나타낸다.
도 5는 생산 균주 BSBA310을 제조하기 위한 전체 절차를 나타낸다.
도 6a 및 6b는 당뇨망막병증 3주 실험군의 망막 혈관 누출의 정성 평가 결과를 나타내는 도면이며(scale bar는 500μm임), 도 6c는 정량 평가 결과를 나타내는 도면이다.
도 7a 및 7b는 당뇨망막병증 16주 실험군의 망막 혈관 누출의 정성 평가 결과를 나타내는 도면이며(scale bar는 500μm임), 도 7c는 정량 평가 결과를 나타내는 도면이다.
도 8a 및 8b는 당뇨망막병증 3주 실험군의 성상교세포 면역형광염색 정성 평가 결과를 나타내는 도면이며, 도 8c는 정량 평가 결과를 나타내는 도면이다.
도 9a 및 9b는 당뇨망막병증 16주 실험군의 성상교세포 면역형광염색 정성 평가 결과를 나타내는 도면이며, 도 9c는 정량 평가 결과를 나타내는 도면이다.
도 10a 및 10b는 당뇨망막병증 16주 실험군의 망막 혈관 염색 정성 평가 결과를 나타내는 도면이며(scale bar는 100μm임), 도 10c 및 도 10d는 정량 평가 결과를 나타내는 도면이다.
도 11a 및 11b는 포도막염 안저평가의 임상 점수 결과를 나타내는 도면이다. 도 11a는 엔도톡신 유도된 포도막염 모델의 안저평가 결과이고, 도 11b는 실험적 자가면역성 포도막염 모델의 안저평가 결과를 나타낸다.
도 12는 포도막염 조직 평가를 위해 구분된 안구 내 망막의 4개 영역을 나타내는 도면이다.
도 13a 내지 도 13c는 엔도톡신 유도된 포도막염 모델의 포도막염 조직 평가 결과를 나타낸다. 도 13a는 정상 대조군 및 SodA2 투여 정상 마우스군에 관한 결과이며, 도 13b는 엔도톡신 유도된 포도막염 모델 및 SodA2 투여 모델에 관한 결과를 나타낸다. 도 13a 및 도13b의 scale bar는 각각 왼쪽:200μm 및 오른쪽:100μm를 나타낸다. 도 13c는 실험군의 등급 분포 결과를 나타낸다.
도 14a, 도 14b 및 도 14c는 실험적 자가면역성 포도막염 모델의 포도막염 조직 평가 결과를 나타낸다. 도 14a는 정상 마우스 및 SodA2 투여 정상 마우스군에 관한 결과이며, 도 14b는 실험적 자가면역성 포도막염 모델 및 SodA2 투여 모델에 관한 결과를 나타낸다. 도 14a 및 도14b의 scale bar는 각각 왼쪽:200μm 및 오른쪽:100μm를 나타낸다. 도 14c는 실험군의 등급 분포 결과를 나타낸다.
후술하는 본 발명에 대한 상세한 설명은, 본 발명이 실시될 수 있는 특정 구현예에 관하여 특정 도면을 참조하여 기술될 것이지만, 본 발명은 이에 한정되지 않고, 적절하게 설명된다면, 그 청구항들이 주장하는 것과 균등한 모든 범위와 더불어 첨부된 청구항에 의해서만 한정된다. 본 발명의 다양한 구현예는 서로 다르지만 상호 배타적일 필요는 없음이 이해되어야 한다. 예를 들어, 본 명세서에 기재되어 있는 특정 형상, 구조 및 특성은 본 발명의 정신과 범위를 벗어나지 않으면서 일 구현예에서 다른 구현예로 변경되거나 구현예들이 조합되어 구현될 수 있다. 본 발명을 설명하면서 제시된 용어는 달리 나타내지 않는 한, 일반적으로 그의 통상적인 의미로 이해되어야 하며, 그 용어가 정의된 발명의 태양 또는 구현예뿐만 아니라 본 명세서에 사용된 동일한 용어에 모두 적용된다. 본 명세서를 해석할 목적으로 하기 정의들이 적용될 것이고, 단수로 사용된 용어는 적절한 경우에는 복수형을 포함할 것이며 그 반대도 마찬가지이다.
정의
본 명세서에 사용되는 용어 "약"은 당해 기술 분야에서 통상의 기술자에게 알려진 각각의 값에 대한 통상적인 오차 범위를 지칭한다.
용어 "대상"은 "환자"와 상호교환적으로 사용되고, 당뇨망막병증 또는 포도막염의 예방 또는 치료를 필요로 하는 포유동물, 예를 들어, 영장류(예컨대 인간), 반려 동물(예컨대, 개, 고양이 등), 가축 동물(예컨대, 소, 돼지, 말, 양, 염소 등) 및 실험실 동물(예컨대, 랫트 마우스, 기니피그 등)일 수 있다. 본 발명의 일 구현예에서, 대상체는 인간이다.
용어 "치료"는 예방적 및/또는 치료적 처치를 포함한다. 상기 예방적 및/또는 치료적 처치는 당업계에서 인정되는 모든 종류의 처치를 포함하며 예컨대, 대상에 본 발명의 약학 조성물 또는 SOD를 투여하는 것을 포함한다. 만약 원하지 않거나 바람직하지 않은 상태(예컨대 질병 또는 대상의 다른 원하지 않거나 바람직하지 않은 상태)의 임상적 징후 전에 투여된다면, 그러한 처치 또는 치료는 예방적 처치 또는 치료이다(예컨대, 대상의 원하지 않거나 바람직하지 않은 상태가 진행되는 것으로부터 대상을 보호하는 것). 반면에 원하지 않거나 바람직하지 않은 상태의 임상적 징후 후에 투여된다면, 그러한 처치 또는 치료는 존재하는 원하지 않거나 바람직하지 않은 상태 또는 이의 부작용을 감소, 완화 또는 안정화하는 등의 치료적 처치이다.
용어 "예방"의 의미는 당업계에 잘 알려져 있다. 당뇨망막병증 또는 포도막염과 같은 의학적 상태와 관련하여 사용될 때, 본 발명의 약학 조성물 또는 SOD를 투여하여 이를 투여받지 않은 대상과 비교하여 의학적 상태(불편감, 시력장애, 눈 혈관 누출, 안구표면 손상, 안구표면 염증 등)의 빈도를 감소시키거나 발병 및 증상을 지연시키는 것을 의미한다.
용어 "투여"는 대상에 예방적 또는 치료적 목적(예컨대 당뇨망막병증 또는 포도막염의 예방 또는 치료)을 달성하기 위한 유효성분을 제공하는 것을 의미한다.
당뇨망막병증 및 포도막염
본 발명은 적어도 부분적으로 수퍼옥시드 디스뮤타제(SOD)의 투여, 특히 경구 투여가 당뇨망막병증 또는 포도막염을 예방 또는 치료하는 데 효과적이라는 발견에 기초한다. 따라서, 본 발명의 일 태양에 따르면, SOD의 당뇨망막병증 또는 포도막염의 예방 또는 치료용 용도가 제공된다.
일 구현예에서, 당뇨망막병증 또는 포도막염은 시력 손상, 안구 혈관 누출 또는 안구 염증을 포함하는 군으로부터 선택되는 하나 이상의 증상을 나타낼 수 있다.
용어 "당뇨망막병증"은 당뇨병에 의한 지속적인 고혈당으로 모세혈관에 손상이 생겨 시력 감소가 발생하는 눈의 합병증을 의미한다. 당뇨망막병증은 초기에는 증상이 없으나, 황반부의 침범이 일어나게 되면서 시력 저하를 나타낸다. 당뇨망막병증은 미세혈관류, 정맥확장, 망막출혈, 망막경색, 황반부종, 신생혈관, 초자체출혈, 견인성 막 등 다양한 병리학적 특징을 수반하여 발병 또는 진행하는 질환이다.
일 구현예에서, SOD는 당뇨망막병증의 혈관 투과성 감소, 성상교세포 발 돌기의 회복, 주피세포 손실 억제 및 무세포 모세혈관 발생 억제로부터 선택되는 하나 이상의 효과를 가져올 수 있다.
용어 "포도막염"은 눈의 내부 부분의 염증, 특히 눈의 중간층(포도막)의 염증을 의미한다. 더욱 구체적으로, 포도막염은 홍채의 염증(홍채염) 및 홍채와 모양체의 염증(모양체염)을 비롯한 포도막계의 전반부의 염증인 전방 포도막염; 유리질에서의 염증인 중간 포도막염; 그리고 맥락막의 염증(맥락막염) 및 맥락막과 망막의 염증(맥락망막염)을 비롯한 눈의 수정체 뒤의 포도막계의 일부의 염증인 후방 포도막염뿐만 아니라 전체 포도막계에 영향을 주는 포도막염인 전체 포도막염을 포함한다.
일 구현예에서, 포도막염은 감염성 원인 및 비감염성 원인을 포함하는 군으로부터 선택되는 하나 이상을 포함할 수 있으나, 이로 한정되지 않는다. 구체적으로, 포도막염의 감염성 원인은 세균, 바이러스, 진균 및 기생충으로부터 선택되는 하나 이상을 포함할 수 있고, 비감염성 원인은 자가면역질환, 종양, 외상, 수술 및 전신질환으로부터 선택되는 하나 이상을 포함할 수 있다.
일 구현예에서, 상기 SOD는 포도막염의 초점 병변, 선형 병변, 맥락망막 병변, 융합성 병변, 혈관염, 유리체염, 유리체 출혈, 시각 신경 유두 부종, 망막 박리로부터 선택되는 하나 이상의 안저 평가 지표에서의 개선 또는 완화 효과; 염증 세포 침윤, 망막 주름, 망막 내/하 출혈, 망막 내/하 삼출물 및 망막 손상으로부터 선택되는 하나 이상의 조직 평가 지표에서의 개선 또는 완화 효과; 및 상기 둘 모두의 개선 또는 완화 효과를 나타낼 수 있다.
수퍼옥시드 디스뮤타제(Superoxide dismutase; SOD)
본 발명의 다른 태양에 따르면, 당뇨망막병증 또는 포도막염의 예방, 개선 또는 치료 효과를 나타내는 개선된 수퍼옥시드 디스뮤타제(SOD)가 제공된다.
수퍼옥시드 디스뮤타제는 수퍼옥시드 라디칼 (O2 ㆍ-)의 일반 분자 산소(O2)와 과산화수소(H2O2)로의 디스뮤테이션(dismutation)을 번갈아 촉매하는 효소로서, SOD는 활성 산소 종을 제거하여 산화 스트레스를 줄이는 데 중요한 역할을 한다. SOD는 원핵 세포와 진핵 세포에 널리 분포하고 있으며, 다양한 유형의 금속 중심(구리/아연, 니켈, 망간, 및 철)에 따라 4가지 부류로 분류된다. 망간 함유 SOD[Mn-SOD]는 여러 세균, 진핵 세포의 엽록체, 미토콘드리아, 및 세포질에 광범위하게 존재한다. 용어 "SOD"는 수퍼옥시드 디스뮤타제 활성을 갖는 폴리펩티드와 상호교환적으로 사용될 수 있다.
일 구현예에서, SOD는 망간에 결합하는 것(Mn-SOD)일 수 있다. 구체적으로, SOD는 탈아미드화된 Mn-SOD일 수 있다. 보다 구체적으로, SOD는 서열번호 2를 기준으로 73번 및 136번 아미노산 잔기가 Asp로 치환된 것일 수 있다. 보다 더 구체적으로, 서열번호 4로 표시되는 아미노산 서열을 포함하거나 이로 이루어질 수 있다.
본 발명의 SOD 또는 SOD 활성을 갖는 폴리펩티드는 상기 아미노산 서열에 대하여 실질적인 동일성을 나타내는 아미노산 서열도 포함되는 것으로 해석된다. 상기 실질적인 동일성은 당업계에 통상적으로 이용되는 알고리즘을 이용하여 정렬된 서열을 분석하는 경우, 80% 이상, 바람직하게는 90% 이상, 보다 바람직하게는 95% 이상, 가장 바람직하게는 98% 이상의 서열 동일성을 나타내는 아미노산 서열을 의미한다.
다른 구현예에서, SOD는 SOD 효소 활성을 갖는 개질된(modified 또는 engineered) 폴리펩티드로서 다양한 측면(생체내, 시험관내 또는 생체외 안정성, 균일성, 및/또는 형태적 변경)에 영향을 미치거나 미치지 않는 하나 이상의 변이, 예컨대, 하나 이상의 아미노산의 결실, 삽입 또는 치환을 포함할 수 있다. 또한, 상기 폴리펩티드는 정제, 검출 또는 안정성 증가를 위한 이종성 물질(예컨대, HIS tag, Ha tag, myc tag를 포함한 당업계에 공지된 tag, GFC 및/또는 항체의 Fc 도메인)을 추가로 포함할 수 있다.
일 구현예에서, SOD는 천연 또는 재조합 미생물로부터 유래될 수 있으며, 다양한 공급원으로부터 단리 또는 정제되는 과정을 거쳐 제작된 효소일 수 있다.
일 구현예에서, SOD는 천연 또는 재조합 미생물로부터 유래될 수 있다. 예를 들어, SOD는 박테리아로부터 유래될 수 있다. 바람직하게는, SOD는 약물 또는 식품에 사용하기에 일반적으로 안전한 것으로 간주되는(generally regarded as safe, GRAS) 박테리아로부터 공급될 수 있다. 구체적으로, SOD는 바실러스 종 균주에서 유래될 수 있다. 보다 구체적으로, 상기 SOD는 바실러스 아밀로리퀴파시엔스 균주로부터 유래된 것일 수 있다. 예컨대, 상기 SOD는 바실러스 아밀로리퀴파시엔스 GF423 균주(KCTC 13222 BP)로부터 유래된 것일 수 있다. GF423 균주(KCTC 13222 BP)는 한국생명공학연구원에 2017년 3월 6일자로 기탁된 것이다. 또한, SOD는 도 4에 도시된 발현 벡터를 포함하는 재조합 균주로부터 유래된 것일 수 있다. 또한 상기 SOD는 도 5에 도시된 방법을 포함하는 방법에 의해 제조된 재조합 균주로부터 유래된 것일 수 있다. 상기 재조합 균주는 서열번호 4의 아미노산 서열을 포함하는 폴리펩티드를 코딩하는 뉴클레오티드 서열을 포함하고 하기 유전자가 결실된 바실러스 종 균주일 수 있다: AprE, NprE, Bpr, Epr, NprB, Vpr, Mpr, IspA, SrfAC, spoIIAc, EpsE 및 Xpf. 상기 균주의 제조를 위한 상세한 과정은 실시예 1을 참조한다.
상기 균주 유래의 SOD는 세포 외부로 분비되는 효소이므로, 상기 균주를 이용하여 SOD를 제조하는 경우, 고가의 정제과정(예를 들어, 컬럼 정제)을 거치지 않고 인간에게 안전성이 확보된 SOD를 대량으로 생산할 수 있기 때문에, 효율적인 생산이 가능하다.
일 구현예에서, SOD는 천연 또는 재조합 숙주를 비롯한 다양한 공급원으로부터 단리되거나 정제될 수 있다. 예를 들어, 당뇨망막병증 또는 포도막염을 예방하거나 치료하는 활성을 갖는 SOD는 바실러스 아밀로리퀴파시엔스 균주 GF423의 배양 상층액으로부터 추출될 수 있다. 간략하게 말하면, 먼저 바실러스 아밀로리퀴파시엔스 균주 GF423을 다양한 유형의 배지에서 배양하여 배양액을 얻을 수 있다. 예를 들어, 복합 배지(pH 6.0 내지 7.0)를 사용하여 상기 균주를 25℃내지 42℃에서 1일 내지 4일 동안 성장시킨다. 바실러스 아밀로리퀴파시엔스 균주 GF423을 배양하기 위한 다른 적합한 배지에는 LB(Luria-Bertani) 배지, ISP(International Streptomyces Project) 배지, NA(nutrient agar) 배지, BHI(brain heart infusion agar) 배지, SDA(sabouraud dextrose agar) 배지, PDA(potato dextrose agar) 배지, NB(nutrient broth) 배지 등이 포함된다. 바람직하게는, LB 배지, ISP 배지, BHI 배지, SDA 배지, 또는 NB 배지가 사용될 수 있다. 또한, SOD는 PubMed 또는 BRENDA(월드 와이드 웹의 brenda-enzymes.org)와 같은 데이터베이스에 제공된 정보를 사용하여 다른 천연 또는 재조합 숙주로부터 공급될 수 있다.
일 구현예에서, 상기 SOD는 단리 또는 정제된 효소일 수 있다. 이때, 단리되거나 정제된 SOD 또는 그의 생물학적 활성 부분에는 그것이 유래된 세포 또는 조직 공급원으로부터의 세포 물질 또는 기타 오염 단백질이 실질적으로 없다. 예를 들어, 정제물은 균주 배양물로부터 한외 여과(Ultrafiltration), 황산암모늄 처리, 컬럼 정제, 농축 등을 통해 순수 분리된 것이거나, 한외 여과, 농축 등을 통해 얻어진 배양 농축액일 수 있다. "세포 물질이 실질적으로 없는"이라는 문구는, 단백질이 단리되거나 재조합적으로 생산되는 세포의 세포 성분으로부터 그러한 단백질이 분리된 단백질의 제조물을 포함한다. 구체적으로, "세포 물질이 실질적으로 없는"이라는 문구는 원하지 않는 단백질이 건조 중량을 기준으로 약 30% 미만, 바람직하게는 약 20% 미만, 더욱 바람직하게는 약 10% 미만, 그리고 가장 바람직하게는 약 5% 미만인 단백질의 제조물을 포함할 수 있다.
다른 구현예에서, SOD는 다음과 같은 정제 방법으로 정제하는 것이 바람직할 수 있지만, 이로 한정되지는 않는다. 바실러스 아밀로리퀴파시엔스 균주 GF423을 배양하여 얻은 배양액을 원심분리하여 배양 상층액을 수집한다. 상층액 분획을 고체상 추출로 전처리하고, 이어서 크로마토그래피로 단리하고 정제한다. 이때, SOD는 다양한 방식의 크로마토그래피를 사용하여 정제될 수 있다. 바람직하게는, 소수성 상호작용 크로마토그래피가 사용된다.
일 구현예에서, 상기 SOD는 균주 용해물(lysate), 균주 배양물, 균주 배양 농축액, 균주 배양 추출물, 또는 그의 건조 형태로 포함될 수 있다. 이때, "균주 용해물"은 균주를 배양하여 기계적 또는 화학적으로 파쇄하여 얻은 것을 의미하며 이로부터 추출, 희석, 농축, 정제 등의 추가 공정을 거친 것을 모두 포함할 수 있다. "균주 배양물"은 균주를 배양하여 얻은 배양액 그 자체 또는 그의 상층액을 의미할 수 있다. "균주 배양 농축액"은 균주 배양물로부터 한외 여과, 황산암모늄 처리, 컬럼 정제, 농축 등을 통해 순수 분리된 것이거나, 한외 여과, 농축 등을 통해 얻어진 배양 농축액을 지칭한다. "균주 배양 추출물"은 상기 배양액 또는 그의 농축액으로부터 추출한 것을 의미하며, 추출액, 추출액의 희석액 또는 농축액, 추출액을 건조하여 얻어지는 건조물, 또는 이의 조정제물 또는 정제물, 이를 분획한 분획물을 포함할 수 있다. 상기 건조 형태는 동결 건조 형태를 포함할 수 있다.
일 실시예에서, 상기 SOD는 당뇨망막병증의 예방 또는 치료를 필요로 하는 대상에 경구로 투여되어 혈관 투과성 감소, 성상교세포 발 돌기의 회복, 주피세포 손실 억제, 무세포 모세혈관 발생 억제 중 하나 이상의 효과를 나타냄이 확인되었다.
다른 일 실시예에서, 상기 SOD는 포도막염의 예방 또는 치료를 필요로 하는 대상에 경구로 투여되어 초점 병변, 선형 병변, 맥락망막 병변, 융합성 병변, 혈관염, 유리체염, 유리체 출혈, 시각 신경 유두 부종 및 망막 박리로부터 선택되는 하나 이상의 안저 평가 지표에서의 개선 또는 완화 효과; 염증 세포 침윤, 망막 주름, 망막 내/하 출혈, 망막 내/하 삼출물 및 망막 손상으로부터 선택되는 하나 이상의 조직 평가 지표에서의 개선 또는 완화 효과; 또는 상기 둘 모두의 개선 또는 완화 효과를 나타내었다.
약학 조성물
본 발명의 다른 태양에 따르면, SOD를 유효성분으로 포함하는 당뇨망막병증 또는 포도막염의 예방 또는 치료를 위한 약학 조성물이 제공된다.
일 구현예에서, 본 발명에 따른 SOD는 약학적으로 허용가능한 담체, 부형제 및/또는 희석제와 조합되어 당뇨망막병증 또는 포도막염의 예방 또는 치료를 위한 약학 조성물을 형성할 수 있다. 본 발명의 약학 조성물은 인간을 제외한 동물에 적용되는 경우에 수의학적 조성물이라는 용어와 상호 교환적으로 사용될 수 있다.
본 발명의 약학 또는 수의학적 조성물은 약학적으로 허용되는 담체, 부형제 및 희석제로 이루어진 군에서 선택되는 하나 이상을 추가로 포함할 수 있다. 상기 약학적으로 허용되는 담체, 부형제 및/또는 희석제는 당업계에 통상적으로 사용되는 것일 수 있다. 담체, 부형제 또는 희석제로는, 예를 들어, 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 하이드록시 프로필 메틸 셀룰로오즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 이산화규소 등의 광물유 등을 들 수 있지만, 이에 제한되지 않는다.
제제화할 경우에는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 첨가제를 사용하여 조제될 수 있다. 상기 제제화를 위한 첨가제는 약제 분야에서 통상 사용하는 것 중에서 적합한 것을 선택할 수 있다.
또한, 본 발명의 약학 또는 수의학적 조성물은 사용 방법에 따라 바람직한 형태로 제형화될 수 있으며, 특히 포유 동물에 투여된 후 활성 성분의 신속, 지속 또는 지연 방출을 제공할 수 있도록 당업계에 공지된 방법을 채택하여 제형화될 수 있다. 그러한 제형의 구체적인 예로는 정제, 환제, 산제, 과립제, 시럽제, 액제, 캡슐제, 현탁제, 유제, 주사용액, 경고제(Plasters), 로션제, 리니멘트제, 리모나데제, 에어로졸제, 엑스제(Extracts), 엘릭실제, 연고제, 유동엑스제, 침제, 크림제, 연질 또는 경질 젤라틴 캡슐, 패치제 등이 있다.
더 나아가 본 발명의 약학 또는 수의학적 조성물은 당해 기술 분야의 공지된 적절한 방법을 사용하여 또는 레밍턴의 문헌(Remington's Pharmaceutical Science(최신판), Mack Publishing Company, Easton PA)에 개시되어 있는 방법을 이용하여 바람직하게 제형화될 수 있다.
일 구현예에서, 상기 SOD는 경구 또는 비경구 투여될 수 있다. 경구 투여의 경우, 위산으로부터의 보호를 위해 SOD가 쉘락(shellac)으로 코팅될 수 있지만, 코팅제는 이로 한정되지는 않는다. 본 발명에서 사용하기에 적합한 코팅제의 예에는 쉘락, 에틸 셀룰로스, 히드록시프로필 메틸셀룰로스, 히드록시프로필 메틸셀룰로스 프탈레이트, 제인(zein), 유드라짓(Eudragit), 및 이들의 조합이 포함된다. SOD가 코팅되는 경우, SOD는 용액 중에서 코팅될 수 있다. 구체적으로, 정제된 용액과 쉘락 함유 용액이 혼합되고, 이어서 동결 건조된다. 이 동결 건조된 샘플은 분말로 만들어져 사용 시까지 약 4°C에서 보관될 수 있다. 경구 투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 복합 조성물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 탄산칼슘, 수크로스, 락토오스, 젤라틴 등을 섞어 조제될 수 있다. 또한, 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제도 사용될 수 있다. 경구 투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 포함되며, 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면, 습윤제, 감미제, 방향제, 보존제 등이 사용될 수 있다.
비경구 투여의 경우, 설하 투여, 유리체내 투여를 포함한 안내 투여, 비강 분무, 피부 외용, 패치제, 복강내 주사, 직장내 주사, 피하 주사, 정맥 주사, 근육내 주사 또는 흉부내 주사 주입방식을 선택할 수 있다.
또한, 본 발명의 약학 또는 수의학적 조성물은 약학적으로 또는 수의학적으로 유효한 양으로 투여된다. 용어 "약학적으로 유효한 양" 또는 "수의학적으로 유효한 양"은 의학적 또는 수의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 환자 또는 동물의 체중, 성별, 연령, 건강상태, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료 기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 바람직하게는, 본 발명의 약학 또는 수의학적 조성물은 조성물의 총 중량에 기초하여 약 2 내지 약 1500 U/mg, 구체적으로 약 5 내지 약 1000 U/mg, 보다 구체적으로 약 10 내지 약 800 U/mg, 보다 더 구체적으로 약 100 내지 약 500 U/mg의 양으로 SOD를 포함할 수 있다.
본 발명의 약학 또는 수의학적 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 순차적 또는 동시에 투여될 수 있다. 또한, 상기 약학 조성물은 필요에 따라 단일 또는 다중 투여될 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이러한 양은 통상의 기술자에 의해 용이하게 결정될 수 있다.
치료 또는 예방 방법
본 발명의 또 다른 태양에 따르면, 본 발명에 따른 SOD 또는 약학 조성물을 당뇨망막병증 또는 포도막염을 갖거나 이의 위험이 있는 대상에 투여하는 단계를 포함하는, 당뇨망막병증 또는 포도막염의 치료 또는 예방을 위한 방법이 제공된다.
본 발명에서 "투여"는 목적하는 작용을 수행하여 치료를 가능하게 하는 임의의 다양한 투여를 포함한다. 투여 경로는 경구, 비경구, 흡입, 국소 또는 국부 투여(예컨대 병변내 투여)일 수 있다. 예컨대 비경구 투여는 정맥 내, 피하, 복강 내, 동맥 내, 안구 내 투여를 포함할 수 있으나 이에 제한되지 않는다. 경구 투여의 경우에, 앞서 설명한 바와 같이, SOD는 쉘락 등과 같은 코팅제로 코팅된 형태로 투여될 수 있다.
본 발명에 따른 SOD의 유효량 또는 효과적인 무독성 양은 통상적인 실험에 의해 결정될 수 있다. 예를 들어, 본 발명의 SOD의 치료 활성량은 질환 단계, 질환의 중증도, 대상체의 연령, 성별, 의학적 합병증, 및 체중과 같은 요인에 따라 변할 수 있다. 본 발명의 SOD의 투여량 및 투여요법은 최적 치료 반응을 제공하기 위해 조정될 수 있다. 예를 들어, 몇몇 분할 용량이 매일, 매주, 2주마다, 3주마다, 4주마다 등으로 투여될 수 있고/거나, 용량이 치료 상황의 긴박함에 따라 비례적으로 감소되거나 증가될 수 있다.
일 구현예에서, 상기 방법은 당뇨망막병증 또는 포도막염을 치료하거나 예방하기 위한 하나 이상의 추가 제제를 투여하는 것을 포함할 수 있다. 상기 다른 제제에는 화합물, 유전자 치료제, 단백질(항체 포함) 등 당뇨망막병증 또는 포도막염을 호전 또는 개선시킬 수 있는 임의의 제제를 포함하나 이에 제한되지 않는다. 상기 하나 이상의 추가 제제는 상기 SOD 또는 약학 조성물과 동시에, 순차적으로 또는 역순으로 투여될 수 있다. 또한, 개별 성분은 동일하거나 상이한 경로에 의해 대상체에 투여될 수 있다.
식품 조성물
본 발명의 또 다른 태양에 따르면, 본 발명에 따른 SOD를 유효성분으로 포함하는 당뇨망막병증 또는 포도막염의 개선 또는 예방을 위한 식품 조성물이 제공된다. 이러한 식품 조성물은 의료용 또는 뉴트라슈티컬(nutraceutical) 식품 조성물을 포함한다.
용어 "의료용 식품" 또는 "뉴트라슈티컬 식품"은 인체에 유익한 기능을 할 가능성이 있는 원료 또는 성분으로 제조된 식품으로서, 정상적인 기능을 유지하거나 인체의 생리적 기능을 활성화함으로써 건강을 유지시키거나 개선시키는 식품을 지칭하고, 식품의약품안전처에 의해 규정되지만 이로 한정되지 않으며, 임의의 통상적인 건강 식품을 그 의미에서 배제하지 않는다.
또한, 상기 식품에는 각종 식품류, 식품 첨가제, 음료(예를 들어, 기능성 음료, 천연 과일 주스 및 야채 음료), 껌, 차, 비타민 복합제, 건강기능식품, 기타 기능성 식품 등이 포함되지만 이로 한정되지 않는다.
상기 식품은 당업계에 알려진 통상의 방법으로 제조될 수 있다. 예컨대, 상기 의료용 식품, 뉴트라슈티컬 식품 또는 건강기능식품은 당뇨망막병증 또는 포도막염을 예방하거나 개선시킬 목적으로 상기 SOD에 더하여 담체, 희석제, 부형제 및 첨가제 중 하나 이상을 추가로 포함하여 정제, 환제, 산제, 과립제, 분말제, 캡슐제 및 액제 제형으로 이루어진 군에서 선택된 하나로 제형화될 수 있다. 상기 담체, 부형제, 희석제 및 첨가제의 구체적인 예는 당업계에 잘 알려져 있으며 통상의 기술자는 그 제형에 따라 적절한 성분을 조합하여 제조할 수 있다.
상기 상술한 제형 내 유효 성분으로서의 본 발명에 따른 수퍼옥시드 디스뮤타제의 함량은 사용 형태 및 목적, 환자 상태, 증상의 종류 및 경중 등에 의하여 적절하게 조절할 수 있으며, 고형분 중량 기준으로 약 0.001 내지 약 99.9 중량%, 바람직하게는 약 0.01 내지 약 50 중량% 일 수 있으나, 이에 한정되지 않는다.
본 발명의 식품의 투여 용량은 환자의 나이, 몸무게, 성별, 투여형태, 건강상태 및 질환 정도에 따라 달라질 수 있으며, 의사 또는 약사의 판단에 따라 일정 시간간격으로 1일 1회 내지 수회로 분할 투여할 수도 있다. 예컨대, 유효성분 함량을 기준으로 1일 투여량이 약 10 내지 약 1000 ㎎/kg일 수 있다. 상기한 투여량은 평균적인 경우를 예시한 것으로서 개인적인 차이에 따라 그 투여량이 높거나 낮을 수 있다. 본 발명의 건강기능식품의 1일 투여량이 상기 투여 용량 미만이면 유의성 있는 효과를 얻을 수 없을 수 있으며, 그 이상을 초과하는 경우 비경제적일 뿐만 아니라 상용량의 범위를 벗어나므로 바람직하지 않은 부작용이 나타날 수 있다.
사료 조성물
본 발명의 또 다른 태양에 따르면, 본 발명에 따른 SOD를 유효 성분으로 포함하는 당뇨망막병증 또는 포도막염의 예방 또는 개선을 위한 사료 조성물이 제공된다. 본 발명에서 식품 조성물은 사료 조성물을 포함할 수 있다. 이러한 사료 조성물은 당업계에서 통상적으로 이용되는 어떠한 제형으로도 제조될 수 있다. 예를 들어, 본 발명의 사료 조성물은 아미노산, 무기염류, 비타민, 항생물질, 항균물질, 항산화, 항곰팡이 효소, 다른 생균 형태의 미생물 제제 등과 같은 보조제 성분; 곡물, 예를 들면 분쇄 또는 파쇄된 밀, 귀리, 보리, 옥수수 및 쌀; 식물성 단백질 사료, 예를 들면 평지, 콩 및 해바라기를 주성분으로 하는 것; 동물성 단백질 사료, 예를 들면 혈분, 육분, 골분 및 생선분; 당분 및 유제품, 예를 들면 각종 분유 및 유장 분말로 이루어지는 건조성분; 지질, 예를 들면 가열에 의해 임의로 액화시킨 동물성 지방 및 식물성 지방 등과 같은 주성분; 영양보충제, 소화 및 흡수향상제, 성장촉진제, 질병 예방제와 같은 첨가제가 추가로 포함될 수 있다.
본 발명의 사료 조성물은 분말 또는 액체 상태의 제제 형태일 수 있으며, 사료첨가용 부형제(탄산칼슘, 말분, 제올라이트, 옥분 또는 미강 등)를 포함할 수 있다.
키트
본 발명의 조성물은 키트의 형태로 제공될 수 있다. 예를 들어, 본 발명의 조성물(예컨대, 개질된 폴리펩티드, 약학 조성물, 식품 조성물, 사료 조성물, 적어도 하나 이상의 추가 제제를 포함하는 병용 투여 조성물 또는 이들의 조합)이 적절한 용기에 포장되어 포함될 수 있으며, 이러한 사용에 대한 지침이 추가로 포함될 수 있다. 또한, 키트에는 별도의 용기에 포장된 투여 도구와 같은 구성 요소도 포함될 수 있다.
이하, 본 발명을 하기 실시예에 의하여 더욱 상세하게 설명한다. 하기 실시예는 본 발명의 이해를 돕기 위해 제시된 것으로, 어떠한 방식으로든 이의 범위를 제한하려는 의도가 아니며, 제한하려는 것으로 해석되어서는 안 된다.
실시예 1. 수퍼옥시드 디스뮤타제(SodA2)를 발현하는 재조합 균주의 제조
실시예 1.1. 발현 숙주 GFBS220의 제조
발현 숙주 GFBS220는 Bacillus subtilis KCTC 3135를 이용하여 제조하였다. B. subtilis KCTC 3135는 한국생명공학연구원 생물자원센터(KCTC)로부터 분양받았다. 후공정을 용이하게 하게 위해 B. subtilis KCTC 3135 지놈에서 하기 표 1에 제시된 유전자를 제거하였다.
유전자명칭 단백질 명칭 기능
AprE 세린 알칼리 프로테아제(서브틸리신 E) 세포외 프로테아제
NprE 세포외 중성 메탈로프로테아제 세포외 프로테아제
Bpr 바실로펩티다제(bacillopeptidase) F 세포외 프로테아제
Epr 세포외 세린 프로테아제 세포외 프로테아제
NprB 세포외 중성 프로테아제 B 세포외 프로테아제
Vpr 세포외 세린 프로테아제 세포외 프로테아제
Mpr 세포외 메탈로프로테아제 세포외 프로테아제
IspA 세포내 세린 프로테아제 세포내 프로테아제
SrfAC 서팩틴 신타제 서팩틴(surfactin) 합성
spoIIAC RNA 폴리머라제 포자형성-특이적 시그마 인자(시그마-F) 포자형성
EpsE 추정 글리코실트랜스퍼라제 세포외 다당류
Xpf RNA 폴리머라제 시그마 인자 PBSX 프로파지 유전자의 전사
유전자의 제거는 지놈 상에서 이중 교차 재조합(double cross-over recombination)을 이용하여 수행하였다(도 1). 구체적으로, 온도 민감성 복제 기점을 가지는 벡터 pUCori-ts-cm에 조작 대상 유전자 양 옆의 DNA 염기 서열과 상동성을 갖는 DNA 절편(up frag. 및 down frag.)을 클로닝하였다. 클로닝에 사용된 PCR 조건 및 프라이머는 각각 표 2 및 표 3에 제시되어 있다.
PCR 단계 온도 시간
최초 변성 95℃ 30초
30회 주기 95℃50℃
72℃		 30초
30초
1분/kb
최종 신장 72℃ 10분
PCR에 사용한 DNA 중합효소는 Taq DNA 중합효소(NEB, USA)임.
표적 유전자 상동 쌍 프라이머 서열(5'→3') 서열번호
AprE 단편 1 F ctacggggtctgacgcagatatcgtaaccgaagaacg 5
R tgttgcagacatgttgctgaacgccatc 6
단편 2 F caacatgtctgcaacatatcttggaaac 7
R gataagctgtcaaaccagagattggataggctatcaag 8
NprE 단편 1 F ctacggggtctgacgcagggcattactgcaccataatc 9
R gaggtacgccttcagcagcctgaacacc 10
단편 2 F gctgaaggcgtacctcacgccttcttcc 11
R gataagctgtcaaaccagttgtcagatttgcatccttc 12
Bpr 단편 1 F ctacggggtctgacgcagagcaatttccagcccgcttc 13
R gtatgatgaggcatgaacagcaatcccg 14
단편 2 F tcatgcctcatcatactcaacaagggtg 15
R gataagctgtcaaaccagttcccagccggatgttcaac 16
Epr 단편 1 F ctacggggtctgacgcaggctttctgccagccgatagg 17
R tgtgtcaaagccgttatgcttggctccg 18
단편 2 F taacggctttgacacagcacaaactgcc 19
R gataagctgtcaaaccaggtctcccatacatgaacgac 20
NprB 단편 1 F ctacggggtctgacgcagagtaatcttgtaggaggctg 21
R tgtgactgtcatattcaccgtcgtgtgg 22
단편 2 F tgaatatgacagtcacacagtattccgcc 23
R gataagctgtcaaaccagattaggatacggtctggctg 24
Vpr 단편 1 F ctacggggtctgacgcagatgtacgctgagccgaatag 25
R ggaatcacatttgcggagatacggcgtc 26
단편 2 F ccgcaaatgtgattccggcacatcaaac 27
R gataagctgtcaaaccagaccgttttccgaatctgacc 28
Mpr 단편 1 F ctacggggtctgacgcagcgttatcccgaatgcccgtg 29
R ggctttgttcctttagtgtcaaccaccc 30
단편 2 F ctaaaggaacaaagccgattcgctccgc 31
R gataagctgtcaaaccagaaattgactgctccacgctg 32
SrfAC 단편 1 F ctacggggtctgacgcaggatatgtattacctatcgcc 33
R gccccttcatccagttcactgcttccttg 34
단편 2 F ggaagcagtgaactggatgaaggggcttcgctg 35
R gataagctgtcaaaccagaacgcttcgacatcactttc 36
spoIIA
 단편 1 F ctacggggtctgacgcagagcggacgatgggagactgg 37
R gccacctcatgcagccgatctggaagag 38
단편 2 F ggctgcatgaggtggctgagcggctcgg 39
R gataagctgtcaaaccagctcattgttttggtgagctg 40
IspA 단편 1 F ctacggggtctgacgcagtgctgcttggcattcatttc 41
R gccattgaagcaatgcctccgtttgaatc 42
단편 2 F acggaggcattgcttcaatggctgcccctcatg 43
R gataagctgtcaaaccagtcaatgctctcgtcatattc 44
EpsE 단편 1 F ctacggggtctgacgcagcaagcaaatgggctgggagg 45
R gacaagccatgctttctgccaaagtgcg 46
단편 2 F gaaagcatggcttgtcaagcatgaatag 47
R gataagctgtcaaaccagtgttgtatacattcagcagc 48
Xpf 단편 1 F gatcctctacggttcatccatgtccgaac 49
R tctatgatcctcctcatttttg 50
단편 2 F gaggaggatcatagaaagcttgtcatacgtttgcc 51
R gagttttcgttcggatcctccgctttttgtttg 52
이렇게 제조된 벡터를 B. subtilis 세포로 도입한 후, 37℃(비복제온도)에서 클로람페니콜이 함유된 배지를 이용하여 형질전환체(단일 교차 상동 재조합)를 선별하였다. 선별된 형질전환체를 항생제가 없는 LB 배지로 30℃복제 허용 온도)에서 배양(제2 교차)한 후, 항생제가 없는 LB 한천배지로 39℃에서 배양하였다. 생성된 콜로니를 대상으로 클로람페니콜 감수성을 가지는 균주(plasmid curing)를 선별하였다. 선별된 콜로니를 대상으로 PCR을 수행하여 이중 교차 재조합체(double cross-over recombinant)를 확보하고, 2차 순수 분리를 수행하여 최종 재조합체를 선별하고, GFBS220으로 명명하였다.
GFBS220의 결손 유전자 부위는 표 4에 제시된 프라이머와 PCR을 이용하여 증폭한 후 아가로스 겔 전기영동을 이용하여 확인하였다. 발현 숙주 GFBS220에서 PCR을 이용하여 결손 유전자를 확인한 결과를 도 2에 나타낸다.
유전자 부위(locus) PCR 프라이머(서열번호) B. subtilis
KCTC 3135의 PCR 산물의 크기		 GFBSL210 PCR 산물의 크기
AprE F caaggcttgaaataacgttg (서열 번호 53)
R ttcgctgattacaacattgg (서열 번호 54)		 3115bp 2116bp
NprE F ggaacagatgatagctcatc (서열 번호 55)
R acactccgagaaggctgaag (서열 번호 56)		 3487bp 2145bp
Vpr F ctgcggcctgcacagccgcc (서열 번호 57)
R cgctgaatgacggtggtaag (서열 번호 58)		 3733bp 2293bp
NprB F agtaatcttgtaggaggctg (서열 번호 59)
R cgccaatgaagtgaaggagg (서열 번호 60)		 2666bp 2153bp
Mpr F ggttgaggcgattgcgacgg (서열 번호 61)
R ccattctgcaaaatcagctc (서열 번호 62)		 2734bp 2076bp
spoIIAC F aagatatgaagaaagccggg (서열 번호 63)
R acagccgcttcataagcctg (서열 번호 64)		 2628bp 2102bp
ThrC F tcaagctgtcatgtacggag (서열 번호 65)
R tccgatacgaatggctgtcg (서열 번호 66)		 376bp 5455bp
실시예 1.2. 발현 벡터 pBE1-sodA2의 제작
바실러스 아밀로리퀴파시엔스(Bacillus amyloliquefaciens) 균주 GF423의 배양 상층액에서 N-말단 시퀀싱(문헌[Kang et al., 2018])을 통해 Mn-SOD를 확인하였다. 상기 GF423 균주는 한국생명공학연구원에 각각 2017년 3월 6일자로 기탁된 것이다(수탁번호 KCTC 13222 BP). 상기 Mn-SOD의 유전자는 박테리아 SOD에 대한 명명법에 따라 sodA로 명명되었고, 그의 아미노산 서열은 도 3 및 서열번호 2를 참조한다(그의 뉴클레오티드 서열은 서열번호 1을 참조함). 효소 제조물의 LC-UV-MS/MS 펩티드 매핑은 100% 아미노산 서열 커버리지를 생성했지만, Asn73 및 Asn136 잔기에서 각각 73% 및 17% 존재비로 탈아미드화가 관찰되었다. 따라서, 정제된 효소의 균질성을 개선하기 위해 두 Asn 잔기를 Asp로 치환하였다. SodA2로 명명된 이러한 변이체 sodA의 아미노산 서열은 도 3 및 서열번호 4(그의 뉴클레오티드 서열은 서열번호 3을 참조함)를 참조한다.
4개의 프라이머(표 5)와 주형인 바실러스 아밀로리퀴파시엔스 GF423 지놈을 사용하는 중복 신장 PCR을 이용하여 sodA2 유전자를 증폭시켰다. Asn의 Asp로의 치환을 위한 뉴클레오티드에는 밑줄이 그어져 있다.
프라이머 서열(5'→3') 서열번호
1 SOD F GGAGGAATTACAATGGCTTACAA 45
2 D74 R TGCATGTCCGCCGCCATCGTTGCGGAC 46
3 D74 F CAGTCCGCAACGATGGCGGCGGACATG 47
4 D137 R TTCAAGTTTGCCGTCGTTTACAACGAGC 48
5 D137 F CTCGTTGTAAACGACGGCAAACTTG 49
6 SOD R CAAAACAGAAGCTTCATTATTTTGCT 50
sodA2 유전자를 포함하는 증폭된 DNA 단편 및 NdeI 및 HindIII 처리에 의해 선형화된 플라스미드 pBE1을 SLIC 방법(문헌[Jeong et al. 2012])으로 시험관내에서 어셈블링하고, 이어서 생성된 작제물을 E. coli C2984H 내로 형질전환시켰다. 제한 효소 매핑으로 정확한 클론을 스크리닝하고, 뉴클레오티드 시퀀싱으로 확인했다. 이렇게 생성된 발현 벡터 pBE1-sodA2는 도 4에 도시되어 있다.
실시예 1.3. 생산 균주 BSBA310의 제조
발현 벡터 pBE1-sodA2를 B. subtilis GFBS220 내로 형질전환시켰다. 형질전환체들로부터 균주를 선택하고, LB2 배지에서 2회의 단일 콜로니 분리 절차에 의해 순수한 클론을 확립하였다. 선택된 균주를 BSBA310으로 명명하고, 글리세롤 스톡법으로 -80℃에서 보관하였다. 이러한 생산 균주 BSBA310에서 PCR을 이용하여 결손 유전자를 확인한 결과를 도 2에 나타낸다. 또한, 생산 균주 BSBA310을 제조하기 위한 전체 절차는 도 5에 요약되어 있다.
실시예 2. 생산 균주 BSBA310으로부터 수퍼옥시드 디스뮤타아제(SodA2)의 분리 및 정제
실시예 2.1. 생산 균주 BSBA310의 배양
실시예 1에서 얻은 생산 균주 BSBA310의 배양을 위해, LB 한천 배지(LB(Luria-Bertani) 한천; 트립토판 10 g/L, 효모 추출물 5 g/L, NaCl 10 g/L, 한천 15 g/L)에서 형성된 단일 콜로니를 LB 배지 30 ml에 접종하고, 37℃에서 12시간 동안 배양하였다. 이 종배양액(seed culture)을 다시 1 mM 황산망간(MnSO4)이 포함된 LB 배지 3 L에 접종하고, 37℃에서 20시간 동안 배양하였다.
실시예 2.2. SodA2의 분리 및 정제
실시예 2.1에서 얻은 세포 배양액을 4℃, 3,578 x g에서 20분간 원심분리하여 상등액을 취한 후, 초미세여과(Ultrafiltration, 이하 UF, MWCO 10,000)를 이용하여 10배 농축하였다. 농축된 세포 배양액 1L당 390 g의 황산암모늄을 넣고 20분간 교반을 하고 원심분리를 하고 상등액을 취하였다. 취한 상등액을 페닐세파로스 HP 컬럼을 사용하여 정제를 하였다. 정제 과정은 2M 황산암모늄 농도의 50mM 인산칼륨 pH 7.0을 사용해서 컬럼을 평형화하였으며, 이후 황산암모늄을 넣고 얻은 상등액을 컬럼에 통과시켰고, 컬럼에 붙은 SodA2를 1.6M 황산암모늄을 포함한 50mM 인산칼륨 pH 7.0을 사용해서 회수하였다. 컬럼을 통해 정제를 한 정제액을 모아서 초미세여과를 통해 정제 과정중에 형성된 고농도 염을 제거하며 농축을 하였다. 농축액을 제균 필터로 여과한 후, 동결건조하였다. SodA2의 활성은 SOD 분석 키트(Cayman Chemical, Michigan, USA)를 이용하여 분석하였다. SOD 활성 1 단위(unit)는 수퍼옥시드 라디칼을 50% 억제하는 효소의 양으로 정의된다. 건조된 SodA2 효소의 활성은 1000 내지 1200 U/mg이었다.
실시예 3. 투여 물질의 제조
쉘락(Shellac)(EXCELACS co., LTD., Bangkok)을 3% 에탄올 농도가 되도록 녹이고 0.2 um 무균 필터를 사용해서 제균하였다. 에탄올로 녹인 쉘락을 PBS로 희석하였다. 동결건조한 SodA2를 20 mg/mL로 녹이고, 쉘락 용액과 SOD 용액을 1:1로 섞은 후, 동결건조시켰다. 동결건조된 쉘락 코팅 SodA2에 덱스트린을 사용해서 1:9 내지 12(쉘락 코팅 SodA2 : 덱스트린) 비율로 혼합하여, 동물 시험 시 사용한 물질을 제조하였다. 최종 물질의 SOD 활성은 90 내지 110 U/mg이 되도록 하였다.
실시예 4. 당뇨망막병증 모델의 제작
6주령 수컷 C57BL/6 마우스(입수처: 코아텍) 120마리를 구입하여 12시간 명암 주기를 유지하고 마우스가 음식과 물에 자유롭게 접근할 수 있게 하였다. 당뇨병(diabetes mellitus, 이하 "DM") 마우스는 스트렙토조토신(Streptozotocin, 이하 "STZ") 용액(10 mM citrate buffer (pH 4.5), 180 mg/kg)을 복강 내 주사하여 유발하였으며, 주사 3일 후 혈당 수치를 확인하여 300 mg/dl 이상인 마우스만 당뇨병 마우스로 선별하였다. 투여하는 경구용 약물의 농도와 당뇨병 유발 유무에 따라 C57BL/6 마우스를 표 6과 같이 10개의 군으로 분류하였으며, SodA2 투여 기간에 따라 3주 실험군(60마리) 및 16주 실험군(60마리)으로 나누어 실험하였다. SodA2 투여군의 경우 당뇨병 유무에 상관없이 스트렙토조토신 유발 단계부터 SodA2를 매일 투여하였다.
3주 실험군
(총 60마리)		 16주 실험군
(총 60마리)
정상 대조군 C57BL/6 비히클 투여 대조군, n=6
1 unit SodA2 투여 정상 마우스군 C57BL/6 대조군 + SodA2 1 unit, 1일 1회 150 ul 경구 투여, n=6
5 unit SodA2 투여 정상 마우스군 C57BL/6 대조군 + SodA2 5 unit, 1일 1회 150 ul 경구 투여, n=6
10 unit SodA2 투여 정상 마우스군 C57BL/6 대조군 + SodA2 10 unit, 1일 1회 150 ul 경구 투여, n=6
20 unit SodA2 투여 정상 마우스군 C57BL/6 대조군 + SodA2 20 unit, 1일 1회 150 ul 경구 투여, n=6
당뇨병 대조군 STZ 주사 C57BL/6 마우스(DM), n=6
1 unit SodA2 투여 당뇨병군 STZ 주사 C57BL/6 마우스(DM) + SodA2 1 unit, 1일 1회 150 ul 경구 투여, n=6
5 unit SodA2 투여 당뇨병군 STZ 주사 C57BL/6 마우스(DM) + SodA2 5 unit, 1일 1회 150 ul 경구 투여, n=6
10 unit SodA2 투여 당뇨병군 STZ 주사 C57BL/6 마우스(DM) + SodA2 10 unit, 1일 1회 150 ul 경구 투여, n=6
20 unit SodA2 투여 당뇨병군 STZ 주사 C57BL/6 마우스(DM) + SodA2 20 unit, 1일 1회 150 ul 경구 투여, n=6
실시예 5. 포도막염 모델의 제작
6주령 수컷 C57BL/6 마우스(입수처: 코아텍) 120마리를 구입하여 12시간 명암 주기를 유지하고 마우스가 음식과 물에 자유롭게 접근할 수 있게 하였다. 총 120마리 중 엔도톡신 유도된 포도막염 모델 실험군에 60마리를 사용하고, 실험적 자가면역성 포도막염 모델에 60마리를 사용하였다. 모든 동물 실험은 안과 및 시력 연구에 동물을 사용하기 위한 시력 및 안과 연구 협회(Association for Research in Vision and Ophthalmology)의 성명서에 따라 수행되었으며 서울대학교와 서울대학교 병원의 기관 동물 관리 및 사용 위원회의 승인을 받았다.
실시예 5.1. 엔도톡신 유도된 포도막염 모델의 제작 및 SodA2 투여
엔도톡신 유도된 포도막염(Endotoxin-Induced Uveitis, 이하 "EIU") 모델을 제작하기 위하여 SodA2 약물을 농도에 따라 1, 5, 10, 20 unit을 7일 동안 경구투여(1일 1회, 200 ul) 후 그람음성균의 외막 구성요소인 LPS(Lipopolysaccharide, L2880-10MG) 1 ng을 유리체내 약물 주입하여 급성으로 유발하였다. 급성 포도막염 실험에 사용된 마우스 모델은 표 7을 참조한다.
엔도톡신 유도된 포도막염 모델(EIU, 1주 경구투여)
정상 대조군 C57BL/6 비히클 투여 대조군, n=6
1 unit SodA2 투여 정상 마우스군 C57BL/6 대조군
+ SodA2 1 unit, 1일 1회 150 ul 경구 투여, n=6
5 unit SodA2 투여 정상 마우스군 C57BL/6 대조군 + SodA2 5 unit, 1일 1회 150 ul 경구 투여, n=6
10 unit SodA2 투여 정상 마우스군 C57BL/6 대조군 + SodA2 10 unit, 1일 1회 150 ul 경구 투여, n=6
20 unit SodA2 투여 정상 마우스군 C57BL/6 대조군 + SodA2 20 unit, 1일 1회 150 ul 경구 투여, n=6
EIU 대조군 LPS 투여 포도막염 유발 C57BL/6 마우스(LPS), n=6
1 unit SodA2 투여 EIU 마우스군 LPS 투여 포도막염 유발 C57BL/6 마우스(LPS)
+ SodA2 1 unit, 1일 1회 150 ul 경구 투여, n=6
5 unit SodA2 투여 EIU 마우스군 LPS 투여 포도막염 유발 C57BL/6 마우스(LPS)+ SodA2 5 unit, 1일 1회 150 ul 경구 투여, n=6
10 unit SodA2 투여 EIU 마우스군 LPS 투여 포도막염 유발 C57BL/6 마우스(LPS)+ SodA2 10 unit, 1일 1회 150 ul 경구 투여, n=6
20 unit SodA2 투여 EIU 마우스군 LPS 투여 포도막염 유발 C57BL/6 마우스(LPS)+ SodA2 20 unit, 1일 1회 150 ul 경구 투여, n=6
실시예 5.2. 실험적 자가면역성 포도막염 모델의 제작 및 SodA2 투여
실험적 자가면역성 포도막염(Experimental autoimmune uveitis, 이하 "EAU") 모델을 제작하기 위한 T 세포 매개 만성 포도막염 유발 과정은 다음의 과정을 따른다. 인간 IRBP1-20(Peptron, GPTHLFQPSLVLDMAKVLLD 95%)(Peptron) 30 mg을 PBS에 용해하여 26℃에서 30분간 인큐베이션한다. 다음, 결핵균 H37 Ra(BD, 231141)와 완전 프로인트 항원보강제(CFA; Sigma, F5881)를 혼합하여 26℃에서 30분간 인큐베이션한 후, 인간 IRBP1-20와 1:1로 섞는다. 혼합된 시약을 C57BL/6 마우스의 목 뒤 및 뒷다리 두 부분에 총 200 ul를 피하 주사한 후, 백일해균의 백일해균 독소(sigma, P7208)를 200 ul 복강 내 주사하여 포도막염을 만성으로 유발하였다. 다음, SodA2 약물을 농도에 따라 1, 5, 10, 20 unit을 21일 동안 경구투여하였다(1일 1회, 200 ul). 만성 포도막염 실험에 사용된 마우스 모델은 표 8을 참조한다.
실험적 자가면역성 포도막염 모델(EAU, 3주 경구투여)
정상 대조군 C57BL/6 비히클 투여 대조군, n=6
1 unit SodA2 투여 정상 마우스군 C57BL/6 대조군
+ SodA2 1 unit, 1일 1회 150 ul 경구 투여, n=6
5 unit SodA2 투여 정상 마우스군 C57BL/6 대조군 + SodA2 5 unit, 1일 1회 150 ul 경구 투여, n=6
10 unit SodA2 투여 정상 마우스군 C57BL/6 대조군 + SodA2 10 unit, 1일 1회 150 ul 경구 투여, n=6
20 unit SodA2 투여 정상 마우스군 C57BL/6 대조군 + SodA2 20 unit, 1일 1회 150 ul 경구 투여, n=6
EAU 대조군 자가면역성 포도막염 유발 C57BL/6 마우스(EAU), n=6
1 unit SodA2 투여 EAU 마우스군 자가면역성 포도막염 유발 C57BL/6 마우스(EAU)
+ SodA2 1 unit, 1일 1회 150 ul 경구 투여, n=6
5 unit SodA2 투여 EAU 마우스군 자가면역성 포도막염 유발 C57BL/6 마우스(EAU)+ SodA2 5 unit, 1일 1회 150 ul 경구 투여, n=6
10 unit SodA2 투여 EAU 마우스군 자가면역성 포도막염 유발 C57BL/6 마우스(EAU)+ SodA2 10 unit, 1일 1회 150 ul 경구 투여, n=6
20 unit SodA2 투여 EAU 마우스군 자가면역성 포도막염 유발 C57BL/6 마우스(EAU)+ SodA2 20 unit, 1일 1회 150 ul 경구 투여, n=6
실시예 6. 당뇨망막병증 모델에서의 효과 확인실시예
6.1. 망막 혈관 누출 평가
SodA2 투여 기간 종료 후 3주 실험군 및 16주 실험군의 혈관 누출 정도 확인을 위하여, 마우스를 마취한 후 Evans blue(20 mg/ml, 150 ul, PBS 용해)를 정맥 주사하여 1시간 동안 관류 후 안구를 적출하였다. 모든 안구 적출 과정은 안과 및 시력 연구에서 동물 사용에 관한 시력 및 안과 연구 협회(Association for Research in Vision and Ophthalmology)의 성명서에 따라 수행되었다. 망막 혈관 누출 정성 분석은 적출한 안구를 4% 파라포름알데히드(Paraformaldehyde, PFA)로 고정한 후 1x PBS에서 플랫마운트(flatmount)를 진행하여 슬라이드 위에 올린 뒤 형광 현미경(Eclipse 90i, Nikon, Tokyo, Japan)을 사용하여 x 40 배율로 전체 망막을 촬영하여 진행하였다. 또한, 망막 혈관 누출의 정량 분석을 위하여 전체 망막을 빨간색 형광으로 촬영을 진행하고, 이미지를 ImageJ(1.47v, NIH, Bethesda, MD, USA) 프로그램을 이용하여 자동 ISODATA 알고리즘을 기반으로 색상 임계값에 맞게 조정한 후 빨간색 영역을 측정하여 망막 혈관 누출 정도(%)로 표시하였으며, 비당뇨병의 정상 대조군과 비교하였다.
3주 투여군
현미경을 통한 정성 분석 결과, SodA2 미투여 정상 대조군 및 SodA2 투여 정상 마우스군(SodA2 농도 1, 5, 10, 20 unit) 모두에서 혈관 누출이 관찰되지 않았고, SodA2의 복용에 관계없이 정상 망막 혈관 투과성에는 변화가 없음을 확인하였다(도 6a). 당뇨병 대조군에서는 당뇨 유발 3주 후 혈관 투과성 증가에 의한 망막 조직 내의 조영 증강이 확인되었다(도 6b의 첫 번째 사진). 반면, SodA2 투여 당뇨병군에서는 대조군 대비 망막 혈관 투과성이 유의하게 감소됨이 관찰되었다(도 6b의 두 번째 사진 내지 다섯 번째 사진).
망막 혈관 누출의 정량 분석 결과, 정성적 평가 결과와 동일하게, SodA2 미투여 정상 대조군 및 SodA2 투여 정상 마우스군 모두에서 망막 혈관 누출이 없었고, 당뇨병 대조군에서는 높은 망막 혈관 누출이 확인되었다. SodA2를 투여한 당뇨 유발 3주 실험군에서는 당뇨병 대조군 대비 망막 혈관 투과성이 감소하는 양상이 나타났으며, 특히 5 unit SodA2 투여 당뇨병군에서 통계적으로 유의한 감소가 나타났다. 3주 실험군의 망막 혈관 누출의 정량 평가는 도 6c에 도시하였다.
16주 투여군
현미경을 통한 정성 분석 결과, SodA2 미투여 정상 대조군 및 SodA2 투여 정상 마우스군 모두에서 혈관 누출이 관찰되지 않았다(도 7a). 10 및 20 unit SodA2 투여 정상 마우스군 일부에서 망막 혈관 투과성이 비당뇨병 대조군에 비해 증가하는 양상이 있었으나 유의한 증가는 아니었다. 당뇨병 대조군에서는 당뇨 유발 16주 후 혈관 투과성 증가에 의한 망막 조직내의 조영 증강이 관찰되었다(도 7b의 첫 번째 사진). 반면, SodA2 투여 당뇨병군에서 대조군 대비 망막 혈관 투과성이 감소하였으며(도 7b의 두 번째 사진 내지 다섯 번째 사진), 특히, 5 unit SodA2 투여 당뇨병군에서 혈관 투과성이 유의하게 감소하였다.
망막 혈관 누출의 정량 분석 결과, 정성적 평가 결과와 유사하게, SodA2 미투여 정상 대조군 및 SodA2 투여 정상 마우스군에서 망막 혈관 누출이 관찰되지 않았고(20 unit SodA2 투여 정상 마우스군에서 망막 혈관 투과성이 증가하는 양상이 있었으나 유의하지 않음), 당뇨병 대조군에서는 높은 망막 혈관 투과성을 나타내었다. 반면, SodA2 투여한 당뇨 유발 16주 투여군에서는 당뇨 대조군 대비 망막 혈관 투과성이 감소하는 양상이 나타났으며, 특히 5 unit SodA2 투여 당뇨병군에서 통계적으로 유의한 감소가 나타났다. 16주 실험군의 망막 혈관 누출의 정량 평가는 도 7c에 도시하였다.
실시예 6.2. 성상교세포 면역형광염색 평가
4% 파라포름알데히드에 고정한 안구에서 망막을 분리한 후 Perm/Block 용액(0.3% Triton-X 및 0.2% BSA을 넣은 PBS 용액)에 항-GFAP 항체(1:100; Invitrogen, 53-9392-82) 및 isolectin B4-594(1:100; Invitrogen, I21412)를 넣고 4℃에서 밤새 인큐베이션하였다. 다음날 PBS로 세척하였으며 이어 망막을 fluoromount aqueous mounting medium(Sigma-Aldrich)으로 마운팅하였다. 망막 혈관망 주변을 둘러싸고 있는 주피세포(pericyte) 외부의 성상교세포 발 돌기(astrocyte foot process)의 분포를 확인하기 위해(성상교세포의 발 돌기가 잘 분포할수록 혈관의 투과성이 잘 억제되는 것으로 해석됨), 망막을 염색 후 공초점 현미경(Leica TCS STED, Leica Microsystems, Wetzlar, Germany)으로 촬영을 진행하였으며, 망막의 중간 부분을 x 400 배율로 촬영 후 ImageJ(1.47v, NIH, Bethesda, MD, USA) 프로그램을 이용하여 성상교세포를 군별로 정량화 하였다.
3주 투여군
현미경을 통한 정성 분석 결과, SodA2 미투여 정상 대조군 및 SodA2 투여 정상 마우스군(SodA2 농도 1, 5, 10, 20 unit) 모두에서 SodA2의 복용에 관계없이 성상교세포 발 돌기의 분포에 변화가 없었다(도 8a). 당뇨병 대조군에서는 당뇨 유발 3주 후 정상 대조군에 비해 성상교세포 발 돌기의 감소가 확인되었다(도 8b의 첫 번째 사진). 반면, SodA2 투여 당뇨병군에서는 대조군 대비 성상교세포 발 돌기의 분포가 유의하게 증가되어 회복됨이 관찰되었다(도 8b의 두 번째 사진 내지 다섯 번째 사진).
성상교세포 면역형광염색의 정량 분석 결과, 정성적 평가 결과와 동일하게, SodA2 미투여 정상 대조군 및 SodA2 투여 정상 마우스군 모두에서 성상교세포 발 돌기 분포에 변화가 관찰되지 않았다. 당뇨병 대조군은 당뇨 유발 3주 후 성상교세포 발 돌기가 감소하였다. 성상교세포 발 돌기의 감소를 보인 당뇨병 대조군과 비교하여, SodA2 투여한 당뇨 유발 3주 실험군에서는 성상교세포 발 돌기 분포가 증가하였다. 3주 실험군의 성상교세포 면역형광염색 정량 평가는 도 8c에 도시하였다.
16주 투여군
현미경을 통한 정성 분석 결과, SodA2 미투여 정상 대조군과 달리 SodA2 투여 정상 마우스 일부에서 성상교세포 발 돌기의 분포가 감소하는 양상이 나타났지만 유의한 변화는 아니었다(도 9a). 당뇨병 대조군에서는 당뇨 유발 16주 후 정상 대조군에 비해 성상교세포 발 돌기의 현저한 감소가 확인되었다(도 9b의 첫 번째 사진). 대조군 대비, SodA2 투여 당뇨병군에서는 성상교세포 발 돌기의 분포가 확연히 증가되어 회복됨이 관찰되었다(도 9b의 두 번째 사진 내지 다섯 번째 사진).
성상교세포 면역형광염색의 정량 분석 결과, 정성 분석 결과와 동일한 양상을 나타내었다. 당뇨 유발 16주 후 성상교세포 발 돌기가 감소한 당뇨 대조군에 비해 SodA2 투여한 당뇨 유발 16주 실험군에서는 성상교세포 발 돌기 분포가 유의하게 증가하는 양상이 나타내었다. 16주 실험군의 성상교세포 면역형광염색 정량 평가는 도 9c에 도시하였다.
실시예 6.3. 망막 혈관 염색 평가
4% 파라포름알데히드에 고정한 안구에서 망막을 분리한 후, 24 웰 플레이트에 망막을 넣고 PBS로 4회 세척하였다. 그 다음, 3% 트립신 용액(Difco 1:250, 0.1M Tris(pH 7.8))을 망막이 들어있는 플레이트에 넣고 37℃에서 2시간 동안 인큐베이션하였다. 반응이 끝난 후, 트립신을 조심스럽게 제거하고 물을 이용하여 세척을 진행하였으며 슬라이드로 옮겨 물을 이용하여 비혈관 조직들을 조심스럽게 제거하였다. 혈관만 남은 슬라이드를 건조한 후 H&E 염색을 진행하였다.
당뇨망막병증에 의해서 혈관 주변의 주피세포 손실(pericyte loss)과 동반한 무세포 모세혈관(acellular capillary)의 발생이 나타날 수 있으며, 이를 망막 혈관 염색을 통해 확인하였다.
현미경을 통한 정성 분석 결과, 16주 SodA2 미투여 정상 대조군 및 SodA2 투여 정상 마우스군에서는 주피세포(화살표로 표시) 손실 및 무세포 모세혈관(화살표머리로 표시)의 발생이 관찰되지 않았다(도 10a). 당뇨병 대조군은 당뇨 유발 16주 후 주피세포 손실이 증가했으며, 무세포 모세혈관 발생이 증가하였다(도 10b의 첫 번째 사진). 반면, SodA2를 투여한 당뇨병군에서는 주피세포 손실 억제와 무세포 모세혈관 발생의 억제가 관찰되었다(도 10b 두 번째 내지 다섯 번째 사진).
추가적인 정량 분석 결과, SodA2 미투여 정상 대조군 및 SodA2 투여 정상 마우스군 모두에서 주피세포 수치 및 무세포 모세혈관 수치에 변화가 없었다(도 10c 및 도 10d의 왼쪽부터 1 내지 5번째 컬럼). 당뇨 유발 16주 후, 당뇨병 대조군에서는 주피세포 수치의 감소(주피세포 손실 증가)가 확인되었으나, 16주간 SodA2를 투여한 군에서는 주피세포의 수치가 유의하게 증가하였다(도 10c의 왼쪽부터 6 내지 10번째 컬럼). 뿐만 아니라, 당뇨 유발 16주 후 SodA2 투여를 받은 당뇨병군, 특히 5 unit 투여군에서, 비록 통계적 유의성은 확보되지 않았으나, 무세포 모세혈관 발생이 감소된 양상을 보였다(도 10d).
실시예 7. 포도막염 모델의 안구질환 실험 평가
실시예 7.1. 포도막염 안저평가
엔도톡신 유도된 포도막염(EIU) 모델은 LPS 주사 24시간 후(급성 유발) 안저 검사를 진행하였으며, 실험적 자가면역성 포도막염(EAU) 모델은 포도막염 유발 후 14일, 16일, 18일, 21일(만성 유발)에 안저 검사를 진행하였다. 포도막염 안저평가는 안구 내 염증이 없는 경우 0점부터 출혈이나 안구 상태의 기준에 따라 4점까지 점수를 부여하며, 점수 부여 기준은 표 9를 참조한다.
포도막염 안저 평가 기준
점수 기준
4점 유리체 출혈이 유리체강 내 가득 찬 경우 또는 큰 망막 박리(1/2 이상)
3.5점 유리체 출혈(1/2 이상) 또는 작은 망막 박리
3점 소량의 유리체 출혈, 선형 병변의 패턴, 큰 융합성 병변 또는 시각 신경 유두 부종
2.5점 맥락망막 병변(5개 초과) 또는 선형 병변(2개 이상, 1/4 영역)
2점 작은 초점 병변(3개 내지 5개) 또는 선형 병변(1개 이하, 1/2 영역 이상)
1.5점 작은 초점 병변(3개 내지 5개) 또는 선형 병변(1개 이하, 1/4 영역)
1점 작은 초점 병변(1개 내지 2개) 또는 최소의 혈관염/유리체염(1/2 영역 이상)
0.5점 작은 초점 병변(1개 내지 2개) 또는 최소의 혈관염/유리체염(1/4 영역)
0점 염증 없는 경우
위 평가 기준에 따라 평가했을 때, EIU 모델(급성 유발 군)의 경우, SodA2의 투여가 미투여군 대비 유의한 감소 효과를 나타냈다(도 11a).
EAU 모델(만성 유발 군)의 경우, SodA2 투여가 미투여군 대비 포도막염의 안저 평가 점수 매김에서 감소 효과를 나타내었다(도 11b). 특히, 5 unit SodA2 투여군에서 염증이 가장 개선되었다.
실시예 7.2. H&E 염색 및 조직 평가
포도막염 조직 평가를 위해 적출한 안구를 4% 파라포름알데히드에 고정한 후 파라핀 블록을 만들었다. 파라핀 블록을 4 μm 두께의 절편으로 제작한 후 H&E(hematoxylin & eosin) 염색을 진행하였다. 포도막염 조직 평가 기준에 관한 정보는 표 10 및 도 12을 참조한다.
포도막염 조직 평가 기준
점수 기준
4점 망막 주름(4 영역), 망막 내/망막 하 출혈 또는 삼출물(4 영역), 망막 내외층 손상(4 영역), 염증 세포 침윤(4 영역)
3.5점 망막 주름(3 영역), 망막 내/망막 하 출혈 또는 삼출물(3 영역), 망막 내외층 손상(3 영역), 염증 세포 침윤(3 영역)
3점 망막 주름(3 영역), 망막 내/망막 하 출혈 또는 삼출물(2 영역), 망막 내외층 손상(2 영역), 염증 세포 침윤(3 영역)
2.5점 망막 주름(2 영역), 망막 내 출혈 또는 삼출물(2 영역), 망막 내층 손상(2 영역), 염증 세포 침윤(2 영역)
2점 망막 주름(2 영역), 망막 내 출혈 또는 삼출물(1 영역), 망막 내층 손상(1 영역), 염증 세포 침윤(2 영역)
1.5점 망막 주름(1 영역), 염증 세포 침윤(1 영역), 망막 내층 손상(1 영역)
1점 망막 주름(1 영역), 염증 세포 침윤(1 영역)
0.5점 염증 세포 침윤(1 영역), 망막 주름 없음, 망막 출혈 또는 삼출물 없음, 망막 손상 없음
0점 정상 망막
EIU 모델(급성 유발 군)
SodA2 미투여 정상 대조군 및 SodA2 투여 정상 마우스군(SodA2 농도 1, 5, 10, 20 unit) 모두에서 조직학적 이상 소견이 나타나지 않았다(도 13a). LPS 주입에 의하여 유발된 EIU 대조군의 경우, 심한 유리체강 내 염증과 망막 조직 내 염증이 관찰되었다(도 13b의 첫 번째 사진). 반면, SodA2 투여 EIU 마우스 군에서 EIU 대조군에 비해 유리체강 내 염증 감소 및 망막 조직 내 염증 세포의 침윤 감소가 관찰되었다(도 13b의 두 번째 내지 다섯 번째 사진).
조직학적인 등급 매김 결과, SodA2 투여 EIU 마우스 군에서 EIU 대조군에 비해 조직학적 염증이 낮은 등급으로 개선됨이 확인되었다(도 13c).
EAU 모델(만성 유발 군)
SodA2 미투여 정상 대조군 및 SodA2 투여 정상 마우스군(SodA2 농도 1, 5, 10, 20 unit) 모두에서 조직학적 이상 소견이 나타나지 않았다(도 14a). 자가면역에 의해 포도막염이 유발된 EIU 대조군의 경우, 망막 조직 내 염증 세포 침윤과 이에 따른 망막 변화가 관찰되었다(도 14b의 첫 번째 사진). 반면, SodA2 투여 EAU 마우스 군에서 EAU 대조군에 비해 망막조직 내 염증 세포의 침윤과 이에 따른 망막 변화의 유의한 감소가 관찰되었으며, 특히 5 unit과 10 unit에서는 현저한 감소가 관찰되었다(도 14b의 두 번째 내지 네 번째 사진).
조직학적인 등급 매김 결과, 조직 평가와 유사하게 SodA2 투여 EAU 마우스 군에서 EAU 대조군에 비해 조직학적 염증 소견이 낮은 등급으로 개선됨이 확인되었으며, 특히 5 unit 및 10 unit SodA2 투여 EAU 마우스 군이 낮은 등급으로 개선됨을 확인하였다(도 14c).
통계적 처리
통계는 one-way ANOVA 와 tukey`s multiple comparisons test 사용하였다. 통계 처리 프로그램은 GraphPad Prism 7.0을 이용하였다.

Claims (23)

  1. 수퍼옥시드 디스뮤타제(superoxide dismutase; SOD)를 유효성분으로 포함하는
    당뇨망막병증 또는 포도막염의 치료 또는 예방을 위한 약학 조성물.
  2. 제1항에 있어서,
    상기 당뇨망막병증 또는 포도막염은 시력 손상, 안구 혈관 누출 및 안구 염증을 포함하는 군으로부터 선택되는 하나 이상의 증상을 포함하는
    약학 조성물.
  3. 제1항에 있어서,
    상기 SOD는 당뇨망막병증의 혈관 투과성 감소, 성상교세포 발 돌기(astrocyte foot process)의 회복, 주피세포 손실(pericyte loss) 억제, 무세포 모세혈관(acellular capillary) 발생 억제로부터 선택되는 하나 이상의 효과를 유발하는
    약학 조성물.
  4. 제1항에 있어서,
    상기 SOD는 포도막염의 초점 병변, 선형 병변, 맥락망막 병변, 융합성 병변, 혈관염, 유리체염, 유리체 출혈, 시각 신경 유두 부종, 망막 박리로부터 선택되는 하나 이상의 안저 평가 지표의 개선 또는 완화;
    염증 세포 침윤, 망막 주름, 망막 내/하 출혈, 망막 내/하 삼출물, 망막 손상으로부터 선택되는 하나 이상의 조직 평가 지표에서의 개선 또는 완화; 또는
    상기 안저 평가 지표의 개선 또는 완화 및 상기 조직 평가 지표에서의 개선 또는 완화 둘 모두를 유발하는
    약학 조성물.
  5. 제1항에 있어서,
    상기 포도막염은 감염성 원인 또는 비감염성 원인으로부터 발생되는
    약학 조성물.
  6. 제5항에 있어서,
    상기 포도막염의 감염성 원인은 세균, 바이러스, 진균 및 기생충으로부터 선택되는 하나 이상을 포함하는
    약학 조성물.
  7. 제5항에 있어서,
    상기 포도막염의 비감염성 원인은 자가면역질환, 종양, 외상, 수술 및 전신질환으로부터 선택되는 하나 이상을 포함하는
    약학 조성물.
  8. 제1항에 있어서,
    상기 SOD는 단리 또는 정제된 효소인
    약학 조성물.
  9. 제1항에 있어서,
    상기 SOD는 균주 용해물(lysate), 균주 배양물, 균주 배양 농축액, 균주 배양 추출물 또는 그의 건조 형태로 포함되는
    약학 조성물.
  10. 제1항에 있어서,
    상기 SOD는 Mn-SOD인
    약학 조성물.
  11. 제1항에 있어서,
    상기 SOD는 탈아미드화된 Mn-SOD인
    약학 조성물.
  12. 제1항에 있어서,
    상기 SOD는 바실러스 종 균주로부터 유래된 것인
    약학 조성물.
  13. 제1항에 있어서,
    상기 SOD는 바실러스 아밀로리퀴파시엔스 GF423 균주(KCTC 13222 BP)로부터 유래된 것인
    약학 조성물.
  14. 제1항에 있어서,
    상기 SOD는 서열번호 2를 기준으로 73번 및 136번 아미노산 잔기가 Asp로 치환된 것인
    약학 조성물.
  15. 제1항에 있어서,
    상기 SOD는 서열번호 4로 표시되는 아미노산 서열을 갖는,
    약학 조성물.
  16. 제1항에 있어서,
    상기 조성물은 경구 투여용인
    약학 조성물.
  17. 제16항에 있어서,
    상기 SOD는 코팅제로 코팅된 것인
    약학 조성물.
  18. 수퍼옥시드 디스뮤타제(superoxide dismutase; SOD)를 유효성분으로 포함하는
    당뇨망막병증 또는 포도막염의 치료 또는 예방을 위한 수의학적 조성물.
  19. 수퍼옥시드 디스뮤타제(superoxide dismutase; SOD)를 유효성분으로 포함하는
    당뇨망막병증 또는 포도막염의 개선 또는 예방을 위한 식품 조성물.
  20. 수퍼옥시드 디스뮤타제(superoxide dismutase; SOD)를 유효성분으로 포함하는
    당뇨망막병증 또는 포도막염의 개선 또는 예방을 위한 사료 조성물.
  21. 제1항 내지 제17항 중 어느 한 항에 따른 약학 조성물 또는 수퍼옥시드 디스뮤타제(superoxide dismutase; SOD)를 대상에 투여하는 단계를 포함하는
    당뇨망막병증 또는 포도막염을 치료 또는 예방하기 위한 방법.
  22. 제1항 내지 제17항 중 어느 한 항에 따른 약학 조성물 또는 수퍼옥시드 디스뮤타제(superoxide dismutase; SOD)의 당뇨망막병증 또는 포도막염을 예방 또는 치료하기 위한 용도.
  23. 제1항 내지 제17항 중 어느 한 항에 따른 약학 조성물 또는 수퍼옥시드 디스뮤타제(superoxide dismutase; SOD)의 당뇨망막병증 또는 포도막염 예방 또는 치료를 위한 약제 제조용 용도.
PCT/KR2022/007004 2022-05-16 2022-05-16 수퍼옥시드 디스뮤타제 및 이의 당뇨망막병증 또는 포도막염의 예방 또는 치료용 용도 WO2023224136A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/KR2022/007004 WO2023224136A1 (ko) 2022-05-16 2022-05-16 수퍼옥시드 디스뮤타제 및 이의 당뇨망막병증 또는 포도막염의 예방 또는 치료용 용도

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2022/007004 WO2023224136A1 (ko) 2022-05-16 2022-05-16 수퍼옥시드 디스뮤타제 및 이의 당뇨망막병증 또는 포도막염의 예방 또는 치료용 용도

Publications (1)

Publication Number Publication Date
WO2023224136A1 true WO2023224136A1 (ko) 2023-11-23

Family

ID=88835313

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/007004 WO2023224136A1 (ko) 2022-05-16 2022-05-16 수퍼옥시드 디스뮤타제 및 이의 당뇨망막병증 또는 포도막염의 예방 또는 치료용 용도

Country Status (1)

Country Link
WO (1) WO2023224136A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003082081A2 (en) * 2002-03-29 2003-10-09 Maxim Pharmaceuticals, Inc. Use of rom production and release inhibitors to treat and prevent intraocular damage
KR100951606B1 (ko) * 2001-12-14 2010-04-09 알콘 인코포레이티드 안과 질환 및 질병의 치료를 위한 과산화물 디스뮤타제모방체
EP2433640A1 (en) * 2010-09-24 2012-03-28 Visiotact Pharma Composition comprising SOD, lutein and zeaxanthin
KR20120093541A (ko) * 2011-02-15 2012-08-23 한림대학교 산학협력단 수퍼옥사이드 디스뮤테이즈 융합 단백질을 함유하는 안과 질환 예방 또는 치료용 약제학적 조성물
US20210275645A1 (en) * 2020-02-12 2021-09-09 Genofocus, Inc. Compositions and methods for preventing or treating macular degeneration

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100951606B1 (ko) * 2001-12-14 2010-04-09 알콘 인코포레이티드 안과 질환 및 질병의 치료를 위한 과산화물 디스뮤타제모방체
WO2003082081A2 (en) * 2002-03-29 2003-10-09 Maxim Pharmaceuticals, Inc. Use of rom production and release inhibitors to treat and prevent intraocular damage
EP2433640A1 (en) * 2010-09-24 2012-03-28 Visiotact Pharma Composition comprising SOD, lutein and zeaxanthin
KR20120093541A (ko) * 2011-02-15 2012-08-23 한림대학교 산학협력단 수퍼옥사이드 디스뮤테이즈 융합 단백질을 함유하는 안과 질환 예방 또는 치료용 약제학적 조성물
US20210275645A1 (en) * 2020-02-12 2021-09-09 Genofocus, Inc. Compositions and methods for preventing or treating macular degeneration

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ANONYMOUS: "Diagnosis of the Bio Industry⑥_Genofocus Co., Ltd.", NEWSWORKER, 29 November 2021 (2021-11-29), XP093108173, Retrieved from the Internet <URL:http://www.newsworker.co.kr/news/articleView.html?idxno=138240> [retrieved on 20231203] *
주식회사 제노포커스. 2021년 1분기 분기보고서. 17 May 2021, non-official translation (GENOFOCUS CO., LTD. First Quarter of 2021 Quarterly Report). Retrieved from (URL: https://dart.fss.or.kr/dsaf001/main.do?rcpNo=20210517000528). *

Similar Documents

Publication Publication Date Title
WO2016105086A1 (ko) 안질환 치료 펩티드 및 이를 포함하는 안질환 치료용 조성물
WO2016137162A1 (ko) 청력 손상 방어용 펩타이드 및 이를 포함하는 조성물
WO2017074037A1 (ko) 효소 생산능이 우수한 전통 발효식품 유래 신규 균주 및 이를 이용하여 곡물 발효 효소식품을 제조하는 방법
US20210275645A1 (en) Compositions and methods for preventing or treating macular degeneration
WO2017048028A1 (ko) 마이시니딘 펩타이드로부터 유래한 신규 항균 펩타이드 및 이의 용도
WO2020060117A1 (ko) 돼지 열병 백신용 조성물 및 이의 제조 방법
WO2012036391A2 (ko) 돼지 써코바이러스２(ｐｃｖ２) 유전자의 표면발현용 벡터 및 이로 형질전환된 살모넬라 백신 균주
WO2018097402A1 (ko) 유산균 유래 단백질 및 이의 제조방법
WO2012111877A1 (ko) Ｆｋ506 결합 단백질 융합 단백질을 함유하는 안과 질환 예방 및 치료용 점안제 조성물
US20230285517A1 (en) Compositions comprising enzymes and probiotics, and methods for preventing or treating macular degeneration
WO2023224136A1 (ko) 수퍼옥시드 디스뮤타제 및 이의 당뇨망막병증 또는 포도막염의 예방 또는 치료용 용도
KR102518033B1 (ko) 수퍼옥시드 디스뮤타제 및 이의 당뇨망막병증 또는 포도막염의 예방 또는 치료용 용도
WO2012111878A1 (ko) 수퍼옥사이드 디스뮤테이즈 융합 단백질을 함유하는 안과 질환 예방 또는 치료용 약제학적 조성물
WO2023128078A1 (ko) 수퍼옥시드 디스뮤타제 및 이의 건성안의 예방 또는 치료용 용도
WO2023224135A1 (ko) 수퍼옥시드 디스뮤타제 및 이의 점막염 예방 또는 치료용 용도
WO2023120828A1 (ko) 수퍼옥시드 디스뮤타제 및 이의 건성 황반변성의 예방 또는 치료용 용도
WO2019172666A1 (ko) Ll37 펩타이드로부터 유래한 신규 항균 펩타이드 및 이의 용도
CA3176797A1 (en) Novel protein, and therapeutic and cosmetic uses thereof
WO2013077534A1 (en) Protein p14 with anti-cancer and anti-allergy activity and pharmaceutical composition comprising the same
KR20230099595A (ko) 수퍼옥시드 디스뮤타제 및 이의 건성안의 예방 또는 치료용 용도
KR101443233B1 (ko) 황색포도상구균 감염 치료용 의약을 제조하기 위한 활성 성분으로서의 ｔｒａｐ 자체의 용도
WO2013009103A9 (ko) Ａｂｃ 트랜스포터를 통한 ｅｇｆ 분비 재조합 미생물 및 이를 유효성분으로 포함하는 소화기 궤양 개선 또는 치료용 조성물
WO2018044018A1 (ko) 사균 백신 제조용 펩타이드 및 이를 이용한 사균 백신
WO2023282622A1 (ko) 락토바실러스 사케아이 또는 이로부터 유래된 세포밖 소포체를 유효성분으로 포함하는 자가면역질환의 치료용 조성물
WO2023158204A1 (en) Pharmaceutical composition for preventing or treating cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22942800

Country of ref document: EP

Kind code of ref document: A1