WO2012111877A1 - Ｆｋ506 결합 단백질 융합 단백질을 함유하는 안과 질환 예방 및 치료용 점안제 조성물 - Google Patents

Ｆｋ506 결합 단백질 융합 단백질을 함유하는 안과 질환 예방 및 치료용 점안제 조성물 Download PDF

Info

Publication number
WO2012111877A1
WO2012111877A1 PCT/KR2011/002393 KR2011002393W WO2012111877A1 WO 2012111877 A1 WO2012111877 A1 WO 2012111877A1 KR 2011002393 W KR2011002393 W KR 2011002393W WO 2012111877 A1 WO2012111877 A1 WO 2012111877A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
eye
fusion protein
fk506bp
seq
Prior art date
Application number
PCT/KR2011/002393
Other languages
English (en)
French (fr)
Inventor
최수영
김대원
이성호
박진서
음원식
Original Assignee
한림대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한림대학교 산학협력단 filed Critical 한림대학교 산학협력단
Priority to US13/985,845 priority Critical patent/US8962567B2/en
Publication of WO2012111877A1 publication Critical patent/WO2012111877A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0048—Eye, e.g. artificial tears
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/52—Isomerases (5)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/001—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof by chemical synthesis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y502/00—Cis-trans-isomerases (5.2)
    • C12Y502/01—Cis-trans-Isomerases (5.2.1)
    • C12Y502/01008—Peptidylprolyl isomerase (5.2.1.8), i.e. cyclophilin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/10—Fusion polypeptide containing a localisation/targetting motif containing a tag for extracellular membrane crossing, e.g. TAT or VP22

Definitions

  • the present invention relates to a therapeutic agent for ophthalmic diseases, and more particularly, to a pharmaceutical composition for treating ophthalmic diseases containing a fusion protein of FK506 binding protein capable of penetrating into eye tissue as an active ingredient.
  • immunosuppressive agents are being studied as eye drop dosage forms, and the side effects are increasing because corneal permeability of drugs currently being used is low due to excessive use.
  • the cornea is well permeable if the drug to be permeated has both hydrophilic and fatty properties.
  • Corneal transplantation is a surgical procedure that restores vision by replacing the cloudy cornea of a patient with vision loss due to corneal disease with a donated clean cornea. Corneal transplantation is the most frequently performed transplantation worldwide due to the development of corneal preservation methods, the development of surgical techniques and instruments, and the treatment of rejection reactions. The eyeball can be transplanted even after cardiopulmonary arrest. This is the only activated organ transplantation in Korea, where brain death is not legally recognized with a high success rate compared to other organs. According to the National Organ Transplantation Management Center in Korea, corneal transplantation is increasing every year, and the number of corneal transplants in 2007 was 405, and in the United States, the number exceeds 40,000 from 1990 to 2007.
  • Corneal graft rejection is an immune mediated inflammatory response and accounts for the majority of corneal graft failure.
  • steroids have been used mainly to reduce rejection in corneal transplantation, complications such as increased intraocular pressure, delayed wound healing, and cataracts can occur if steroids are used for a long time, and high doses do not prevent rejection.
  • immunosuppressants rather than steroids.
  • the group treated with cyclosporine A, an immunosuppressive agent showed higher rejection than the steroid-only group. was reported.
  • Autoimmune disease is an autoimmune disease that occurs when the body's defense mechanisms, ie when the immune system starts to damage it against its body tissues, and patients are still on the rise.
  • Autoimmune disease is a disease caused by excessive or inadequate control of the autoimmune response by inducing an inappropriate immune response as the environment of the body's cytokine (signaling substance that controls and stimulates the body's defense system) against viruses or bacteria is induced.
  • the exact cause of the disease is not known and may be caused by environmental, genetic, or immunological factors.
  • autoimmune ophthalmic diseases include uveitis, Behcet's disease, and keratoconjunctivitis, and dry eye is also regarded as an inflammatory disease due to an abnormal immune response, and dryness is also regarded as an autoimmune disease. Most autoimmune diseases use steroids or immunosuppressants in recent years.
  • One of the representative autoimmune eye diseases is uveitis.
  • the uvea consists of the iris, ciliary and choroid.
  • the uvea is rich in blood vessels and connective tissue.
  • Inflammation of the uvea is called uveitis, and the cause of the disease is unclear until now, but the cause is considered syphilis and tuberculosis.
  • the cause of uveitis is currently looking at the immune system abnormalities. Inflammation at the uveal may be caused by bacteria or viruses, but the immune response is a lot of inflammation is classified as an autoimmune disease.
  • Uveitis has been treated with topical or systemic steroids. However, topical treatments such as eye drops or systemic steroid treatments require high doses when the drug does not reach the uveal tissue, which often results in serious side effects.
  • immunosuppressive drugs are used in patients who do not respond to steroid treatment or patients who cannot tolerate the severe side effects of systemic steroids, which have been discontinued due to side effects such as bone marrow suppression, hemorrhagic cystitis and kidney damage. These patients often lead to blindness. Therefore, it is urgent to develop eye drops for eye diseases with good eye penetration and few side effects.
  • Dry eye syndrome is a syndrome in which tear film is insufficient or the tear film is excessively evaporated and the tear film becomes unstable, resulting in various symptoms such as foreign body or stinging. Dry eye syndrome is associated with decreased tear secretion, disease of the eyeballs and eye appendages, such as eyelid abnormalities or inflammation, and skin diseases (Stevenson-Johnson syndrome, pemphigoid), and systemic diseases ( Vitamin A deficiency, Sjogren's syndrome) (Ophthalmology, 7th edition, Sculpture, Yoon Dong-ho. According to a recent survey by Chung-Ang University Hospital, 75% of Korean adults suffer from dry eye, and one out of three is a serious patient with inflammation of the cornea.
  • Treatment for dry eye syndrome focused on maintaining a certain amount of tears by conservative methods such as supplementing artificial eye drops or temporarily or permanently preventing tears, but recently dry eye syndrome has been newly recognized as an inflammatory disease.
  • Anti-inflammatory treatments for dry eye syndrome have been actively attempted, and the effects have been reported for severe dry eye patients.
  • Inflammation of the ocular surface became a concern in the treatment of dry eye syndrome, as evidenced by increased T-lymphocytes and high levels of cytokines and various inflammatory mediators.
  • One such drug is cyclosporin A 0.05% eye drop (Restasis).
  • side effects occur in dry eye patients, and the most common adverse reaction is burning sensation in the eye (a sensation of burning when the drug touches the skin or tongue) and conjunctival hyperemia in 1-5% of patients.
  • Secretions, seborrhea, eye pain, foreign body sensation, pruritus, pain, visual acuity (often blurred vision) have been reported. Therefore, there is a need for the development of new inflammatory and immunosuppressive agents with fewer side effects.
  • Immunosuppressants refer to a variety of substances used by the host to reduce or block the ability to make antibodies (humoral immunity) or cellular immune responses, and mainly include selective immunosuppression, such as autoimmune diseases and fetal fibrosis; Used for therapeutic purposes to prevent rejection after organ transplantation.
  • immunosuppressants have side effects such as anemia, leukopenia, thrombocytopenia, and hair loss, and are therefore limited in use.
  • Cytotoxic agents with low cytotoxicity have been developed from secondary metabolites of bacteria and fungi, and cyclosporin A and FK506 (Tacrolimus), which are currently the most widely used in organ transplant patients, are typically used, but side effects are not completely reduced.
  • Ophthalmic disease therapies need to be changed from systemic to topical use and new drug development to reduce side effects of existing drugs.
  • the most commonly used immunosuppressive agents, cyclosporin and FK506 are used systemically. Both drugs can cause damage to the kidneys and nervous system, which makes it difficult to use them widely.
  • Development studies into eye drop formulations are actively underway. There has been a published paper showing that the use of FK506 in eye drops to suppress rejection after corneal transplantation has been shown to have an excellent effect on delaying rejection. All have been reported to have had a good effect.
  • eye drops containing cyclosporine in patients with dry eye syndrome were reported to have increased tear secretion, especially in dry eye associated with systemic diseases.
  • corneas are well penetrated by drugs having amphoteric and hydrophilic amphoteric properties. Therefore, in order to increase the permeability of the drug that does not penetrate the cornea well, the amount to be used in excess of the amount originally administered may result in side effects.
  • Patent No. 472938 relates to a transport domain-target protein-transport domain fusion protein and its use for improved cell penetration efficiency, wherein protein transport domains such as HIV-1 Tat peptide, oligolysine, oligoarginine, Disclosed is a fusion protein covalently attached to the terminal and / or C-terminus to enhance cell permeability.
  • Patent No. 493662 discloses a technique in which oligolysine as a protein transport domain is covalently bonded to the N-terminus and / or C-terminus of a protein to improve cell permeability.
  • HIV-a Tat peptide oligolysine, oligoarginine, oligos (lysine, arginine) and PEP-1 peptides enhance the cellular permeability of proteins.
  • Patent No. 787393 discloses a composition for improving atopic dermatitis and allergy containing the FK506BP fusion protein.
  • an object of the present invention is to develop and apply a FK506 binding protein, a modulator that effectively attaches to FK506 and effectively suppresses an overactive immune response, and to use it as an effective protein therapeutic means for ophthalmic diseases.
  • the present inventors studied to develop a protein agent, which is an immune response suppressing drug, into a formulation for enhancing the ocular penetration ability, and completed the present invention by identifying an ophthalmic disease therapeutic effect of an ophthalmic protein preparation.
  • the inventors have used one of the PEP-1 peptide and HIV-1 Tat peptide to carry a natural protein into a cell, the N- and / or C- of human FK506BP (hereafter mixed with "FK506 binding protein"), which is an external protein. It was fused at the end, and this fusion protein was overexpressed in E. coli and purified easily and conveniently by metal chelating affinity chromatography. In addition, it was confirmed through experiments that the purified fusion protein effectively improves eye diseases including dry eye.
  • the present invention has raised the possibility of application of the FK506BP fusion protein as a protein therapeutic for ophthalmic diseases.
  • the present invention provides a fusion protein of FK506 binding protein in which protein transport domains such as PEP-1 and Tat are covalently bound to at least one of the N-terminus and C-terminus of FK506 binding protein (hereinafter, In combination with “FK506BP fusion protein”.
  • the present invention contains a fusion protein of FK506 binding protein, and provides a pharmaceutical composition for the treatment of eye diseases such as dry eye.
  • the fusion protein of the FK506 binding protein of the present invention is useful for the treatment of ophthalmic diseases, typically for the treatment of dry eye syndrome.
  • ophthalmic disease refers to Stevenson-Johnson syndrome, Sjogren's syndrome, dry eye syndrome, trauma, eye trauma by eye surgery (eye surgery means any surgery to incision the eye, typically cataract surgery, Glaucoma surgery, retinal surgery, LASIK surgery, Lasek surgery, etc.), infectious / non-infective uveitis, immunorejection after corneal transplantation, or corneal epithelial disorder due to exogenous disease caused by wearing hard contact lenses.
  • the ophthalmic disease is not necessarily limited thereto, and preferably includes dry eye syndrome.
  • dry eye refers to a syndrome in which tear generation is insufficient or tears of the tear film are excessively evaporated, resulting in unstable tear film and various symptoms such as foreign body or stinging. More specifically, “dry eye syndrome” refers to Stevenson-Johnson syndrome or pemphigoid, which is a condition that is accompanied by decreased tear secretion or disease of the eyeballs and eye appendages, such as eyelid abnormalities, inflammation, or skin diseases. Vitamin A deficiency and Sjogren's syndrome, which is associated with the disease, impairs the surface of the eyeballs in the gaps of the exposed eyelids and causes irritation such as discomfort, foreign bodies, and dryness, and inflammation of the eye surface when the corneal damage is severe. Say disease. As the lesion progresses, congestion may be seen. Complications may include mild visual impairment at first, followed by corneal ulcers, corneal perforation, and secondary bacterial infections, and severe corneal scarring and angiogenesis. .
  • the fusion protein of the FK506 binding protein is basically an immunoassay method (eg, a radioimmunoassay method, a radioimmunoprecipitation method, an enzyme-linked immunosorbent method) using genetic recombination of the protein and an antigen-antibody reaction.
  • an immunoassay method eg, a radioimmunoassay method, a radioimmunoprecipitation method, an enzyme-linked immunosorbent method
  • the verification of the efficacy of the ophthalmic disease represented by the fusion protein of the FK506 binding protein can be carried out using many related articles and known dry eye animal models.
  • the inventors used a dry blowing induced lett eye dry model as a short-term dry eye syndrome model.
  • Surgical epithelial damage of 0.4 mm2 was applied to the median portion of the cornea using a surgical knife, and then dry eye was caused by exposure to a dry blower with a humidity of 25-30% and 2.4 m / sec.
  • the tear secretion was measured, and corneal damage rate was measured using a fluorescent dye.
  • the conjunctival eye and bleeding conjunctiva were extracted and examined histopathologically.
  • Apoptosis of corneal epithelial cells was evaluated immunohistochemically using PARP ⁇ poly (ADP-ribose) polymerase ⁇ .
  • the efficacy of the fusion protein of FK506 binding protein on dry eye syndrome was compared with the verified 0.1% sodium hyaluronate (see Johnson et al. 2006, 2008) eye groups.
  • a botulinum toxin-A induced mouse dry eye model was used as another dry eye model. 20 mU of BTX-A is injected into the lacrimal gland into the transconjunctival root to inject BTX-A into the tear-secreting portion of the lacrimal gland orbital lobe, causing dry eye I was. The corneal damage rate was measured using fluorescent dyes for dry eye efficacy test, and the conjunctiva attached eye and bleeding conjunctiva were removed and histopathologically observed.
  • the FK506BP fusion protein according to the present invention significantly increased tear secretion in the dry eye animal model, increased the thickness of conjunctival epithelium thinned due to inflammation, and increased the number of mucus producing cells.
  • the FK506BP fusion protein according to the present invention reduced apoptosis during eye injury, and reduced corneal damage.
  • the present invention relates to an eye drop composition for preventing and treating ophthalmic diseases comprising a fusion protein having a protein transport domain covalently bonded to at least one of the N-terminus and the C-terminus of the FK506 binding protein.
  • the protein transport domain In the present invention, the protein transport domain
  • a hydrophobic domain consisting of 15-30 amino acids, comprising at least five tryptophan, a hydrophilic domain containing at least four lysines, and a spacer separating the two domains ( protein transport domain, consisting of
  • a protein transport domain consisting of 6-12 amino acid residues and comprising at least 3/4 of arginine or lysine residues
  • oligolysine protein transport domain consisting of 6 to 12 lysines
  • an oligoarginine protein transport domain consisting of 6 to 12 arginine and
  • an oligo (lysine, arginine) protein transport domain consisting of 6 to 12 lysine or arginine and at least one selected from derivatives of a) to e).
  • the present invention is characterized in that the fusion protein is one selected from SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, and SEQ ID NO: 14.
  • the ocular disease may be caused by Stevenson-Johnson syndrome, Sjogren's syndrome, dry eye syndrome, trauma, ocular trauma due to ocular surgery, uveitis (infectious or non-infectious), immunorejection after corneal graft surgery, or wearing hard contact lenses. Corneal epithelial disorder caused by exogenous disease.
  • compositions containing FK506BP fusion protein as an active ingredient can be formulated into eye drops by conventional methods in combination with a carrier that is conventionally acceptable in the pharmaceutical art.
  • the eye drop composition is preferably an isotonic aqueous solution or suspension, and the composition mentioned is sterile and / or contains an adjuvant such as a preservative, stabilizer, wetting agent or salt / or buffer for osmotic pressure control. In addition, they may contain other therapeutically valuable substances.
  • eye drop compositions have been known to moisturize and lubricate anionic polymers such as hyaluronic acid and carboxymethylcellulose or their pharmaceutically acceptable salts in eye drops, and include, in addition to these components, pharmaceutically acceptable carriers.
  • pharmaceutically acceptable carriers include isotonic agents, buffers, stabilizers, pH adjusting agents and solvents. Isotonic agents play a role in controlling the isotonicity of eye drops, and typically, sodium chloride or potassium chloride may be selected.
  • the buffer performs the function of adjusting the acidity or alkalinity of the eye drops. Buffers usually used in the preparation of eye drops include aminocapronic acid, sodium dihydrogen phosphate and sodium dihydrogen phosphate.
  • Stabilizers play a role of stabilizing eye drops, and it is usually possible to use sodium edetate and / or sodium perborate as stabilizers.
  • pH adjusters adjust the pH of the eye drop composition, such as hydrochloric acid and / or sodium hydroxide. It is preferable to use sterile purified water or distilled water for injection as a solvent.
  • the eye drop according to the present invention is preferably a liquid formulation. A preservative, a preservative, etc. can be added to the said eye drop composition as needed.
  • the recommended amount of the eye drop composition and the number of times of use according to the present invention can be appropriately increased or decreased depending on the symptoms, once or three times a day, 5 to 6 times a day. Dosage levels for a particular patient may vary depending on the patient's weight, age, sex, health status, time of administration, frequency of administration, severity of the disease, and the like.
  • Intracellular delivery of the FK506BP protein molecule according to the present invention consists of 15-30 amino acids in FK506BP, a hydrophilic domain comprising 5 or more tryptophans, and a hydrophilic domain comprising 4 or more of lysine.
  • An example of the transport domain of the present invention includes a PEP-1 peptide consisting of 21 amino acids and an amino acid sequence such as SEQ ID NO: 1, and an HIV Tat 49 to 57 peptide consisting of an amino acid sequence such as SEQ ID NO: 2.
  • the protein transport domain of the present invention is not limited only to the PEP-1 peptide of SEQ ID NO: 1, the HIV Tat 49-57 residue peptide of SEQ ID NO: 2, and lacks a partial substitution, addition or addition of the amino acid sequence of PEP-1 or HIV Tat.
  • a protein transport domain consisting of a non-hydrophobic domain, a hydrophilic domain containing four or more lysines, and a spacer separating the two domains, and the same and similar amino acid substitutions.
  • the present invention relates to an eye drop composition for treating ophthalmic diseases comprising the FK506BP fusion protein covalently bonded with the above protein transport domain.
  • FK506BP fusion protein refers to a covalent complex formed by genetic fusion or chemical bonding of a protein transport domain and FK506BP, comprising a protein transport domain and a cargo molecule (ie, FK506BP in the present invention).
  • FK506 binding protein fusion protein was used interchangeably.
  • PEP-1-FK506BP refers to the binding of the PEP-1 protein transport domain to the N-terminus of FK506BP in the FK506BP fusion protein. .
  • the "genetic fusion” means a linear, covalent linkage formed through the genetic expression of the DNA sequence encoding the protein.
  • Target cell also means a cell to which a cargo molecule is delivered by a transport domain, i.e., a target cell is a cell in the body, ie, a cell constituting an organ or tissue of a living animal or human, or a living animal or human It is meant to include the microorganisms found.
  • target cells are meant to include extracellular cells, ie cultured animal cells, human cells or microorganisms. Specifically, in the present specification, the target cell refers to an eye cell.
  • protein transport domain refers to a covalent bond with a cargo molecule (target protein) peptide or protein, so that the peptide or protein can be introduced into a cell without the need for a separate receptor, carrier, or energy.
  • a cargo molecule target protein
  • PEP-1 peptide SEQ ID NO: 1
  • target protein refers to a molecule that is covalently bound to a PEP-1 protein transport domain and introduced into a cell to exhibit activity. It is synonymous with "cargo molecule”.
  • the protein transport domain is composed of 15 to 30 amino acids, a non-hydrophilic domain including 5 or more tryptophan, a hydrophilic domain including a large number of lysine and a protein transport domain consisting of a spacer separating the two domains, A transport domain consisting of 6 to 12 amino acid residues and containing at least 3/4 of an arginine or lysine residue, an oligolysine transport domain consisting of 6 to 12 lysines, an oligoarginine transport domain consisting of 6 to 12 arginines, or 6 And oligo (lysine, arginine) transport domains composed of from twelve lysine or arginine.
  • the target protein (cargo molecule) is FK506BP.
  • the protein transport domain and the target protein may be substituted with other amino acid (s) of similar polarity in which one or more amino acids in the sequence are functionally equivalent in response to a silent change.
  • Amino acid substitutions in the sequence may be selected from other members of the class to which the amino acid belongs.
  • hydrophobic amino acid classifications include alanine, valine, leucine, isoleucine, phenylalanine, valine, tryptophan, proline and methionine.
  • Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine.
  • Positive basic amino acids include arginine, lysine and histidine.
  • Negatively charged acidic amino acids include aspartic acid and glutamic acid.
  • fragments or derivatives thereof having the same or similar biological activity within a range of homology between the fusion protein and the amino acid sequence of the present invention, such as 85-100%, are also included in the scope of the present invention.
  • the present invention is characterized in that the cell introducing FK506BP fusion protein has an amino acid sequence of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12 or SEQ ID NO: 14.
  • the present invention is characterized in that the protein transducing domain (PTD) is covalently bonded to one or both sides of the carboxy terminus and amino terminus of the FK506BP protein.
  • PTD protein transducing domain
  • the present invention also relates to an eye drop composition for treating ophthalmic diseases comprising the cell-transducing FK506BP fusion protein as an active ingredient.
  • the present invention also relates to a composition
  • a composition comprising the cell-introducing FK506BP fusion protein as an active ingredient and comprising a pharmaceutically acceptable carrier.
  • FK506BP fusion protein according to the present invention significantly increased tear secretion in dry eye animal model.
  • the FK506BP fusion protein according to the present invention increased the thickness of the conjunctival epithelium thinned due to inflammation and increased the number of mucus producing cells.
  • the FK506BP fusion protein according to the present invention reduced apoptosis during eye damage, corneal damage, and as a result of toxicological experiments in vivo, no abnormal findings were used as protein therapeutics for eye diseases It is possible.
  • FIG. 1 is a diagram showing a cumulative test using 1 ⁇ 15 mm cobalt chloride paper and showing changes in tear secretion before and after dry blowing.
  • B represents before dry blowing
  • A represents after dry blowing.
  • the two controls were intact, that is, the group that did not perform dry blowing and the negative eye group that caused dry eye and did not receive the drug.
  • the drug control group is a control group to which hyaluronic acid is added
  • the test group is a group treated with the FK506BP fusion protein of the present invention. Each drug was administered 5 ⁇ l per eye once every hour for 5 hours.
  • FIG. 2 is a photograph of histopathologically observed the effect of FK506BP fusion protein drug on the conjunctival epithelial thickness, the number of mucus producing cells in a dry blowing-induced dry eye model using PAS staining.
  • A is a normal control group
  • B is a dry blowing induced negative control group
  • C is a drug control group administered hyaluronic acid
  • D is a test group administered FK506BP fusion protein.
  • Each drug was administered 5 ⁇ l per eye for 1 hour for 5 hours.
  • ThE in FIG. 2A shows the epithelial thickness measurement range.
  • Figure 3 is a photograph of the immunohistochemical observation of the degree of apoptosis of the cornea in a dry blowing induced eye dry model using PARP ⁇ Poly (ADP-ribose) polymerase ⁇ .
  • A is a normal control group
  • B is a dry blowing induced negative control group
  • C is a drug control group
  • D is a test group administered the FK506BP fusion protein of the present invention.
  • Each drug was administered 5 ⁇ l per eye for 1 hour for 5 hours.
  • the scale bar in the figure is 80 ⁇ m.
  • FIG. 4 is a photograph taken with a slit lamp after illuminating a fluorescent light source after 1 ⁇ l of 1% fluorescein in a BTX-A-induced dry eye syndrome model.
  • Control is normal control group
  • Saline is saline added control group
  • BTX is BTX-A added control group
  • FK506BP is a test group administered FK506BP protein which is not a fusion protein
  • PEP-1-FK506BP Is the test group to which the fusion protein of FK506 binding protein was administered. Each drug was administered 5 ⁇ l per eye for 1 hour for 5 hours.
  • Restriction enzymes and T4 DNA ligase were purchased from Promega (USA) and Pfu polymerase was purchased from stratagene (USA). Tat oligonucleotides were synthesized in Gibco BRL custom primer (USA). IPTG was purchased from Duchefa (Netherland). pET-15b and BL21 (DE3) plasmids were purchased from Novagen (USA) and Ni-nitrilo-triacetic acid Sepharose superflow was purchased from Qiagen (Germany). Human FK506 binding protein (FK506BP) cDNA was isolated from human liver cDNA library by PCR method. All other reagents were used as express products.
  • FK506BP Human FK506 binding protein
  • a fusion protein expression vector capable of delivering a target protein into a cell was prepared, and human FK506BP was used to easily analyze the ability of a PEP-1 peptide to deliver a protein into a cell. was selected.
  • PEP-1-FK506BP To produce a fusion protein, a pET-PEP expression vector containing a PEP-1 peptide (KETWWE TWWTEW SQP KKKRKV) (SEQ ID NO: 1) was prepared. Two kinds of oligonucleotides corresponding to the PEP-1 peptide (upper chain, 5'-TATGAAAGAAACCTGGTGGGAAACCTGGTGGACCGAATGGTCTCAGCCGAAAAAAAAACGTAAAGTGC-3 '(SEQ ID NO: 15); lower chain, 5'-TCGAGCACTTTACGTTTTTTTTGGGGCTGACCCCATTGTGGCCCACCAGGT (SEQ ID NO.
  • NdeI - XhoI It was inserted by ligation to pET-15b cut with restriction enzyme. Subsequently, two kinds of oligonucleotides were synthesized based on the sequence of the cDNA of human FK506BP.
  • Forward primer is 5'-CTCGAGATGGGAGTGC AGGTGGAAACCATC-3 '(SEQ ID NO: 17)
  • PCR Polymerase chain reaction
  • coli BL21 (DE3) transformed with PEP-1-FK506BP was selected and then overexpressed of the recombinant PEP-1-FK506BP fusion protein by inoculating colonies in 100 ml LB medium and adding IPTG (0.5 mM) into the medium. Induced. Overexpressed PEP-1-FK506BP fusion protein was confirmed by SDS-PAGE and Western blot analysis.
  • the method was modified to produce FK506BP-PEP-1 fusion protein and PEP-1-FK506BP-PEP-1 fusion protein.
  • 5mM imidazole 0.5M NaCl, 20mM Tris-HCl, pH 7.9
  • the supernatant was immediately centrifuged Ni 2+ - acrylonitrile triazol setik acid Sepharose Super flow (Ni 2+ -nitrilotriacetic acid sepharose super flow ) load the column and binding buffer of 10 times by volume with 6-fold volume wash buffer (60mM of The fusion protein was washed with imidazole, 0.5M NaCl, 20mM Tris-HCl, pH 7.9) followed by elution buffer (1M imidazole, 0.5M NaCl, 20mM Tris-HCl, pH 7.9). Subsequently, the fractions containing the fusion protein were collected and PD-10 column chromatography was performed to remove salts contained in the fractions.
  • Purified protein concentration was determined by Bradford method using bovine serum albumin as a standard.
  • FK506BP-PEP-1 fusion protein and PEP-1-FK506BP-PEP-1 fusion protein were overexpressed and purified in the same manner as above.
  • a pET-Tat-FK506BP expression vector that contains FK506BP, a transduction site of HIV-1 Tat (Tat49-57) and cDNA for six histidines in succession.
  • a pET-Tat expression vector containing a basic domain of HIV-1 Tat ie, amino acids 49-57 was prepared.
  • oligonucleotides corresponding to the Tat base domain top strand, 5'-TAGGAAGAAGCGGAGACAGCGACGAAGAC-3 '(SEQ ID NO: 19); bottom strand, 5'-TCGAGTCTTCGTCGCTGTCTCCGCTTCTTCC-3' (SEQ ID NO: 20) )
  • top strand 5'-TAGGAAGAAGCGGAGACAGCGACGAAGAC-3 '(SEQ ID NO: 19); bottom strand, 5'-TCGAGTCTTCGTCGCTGTCTCCGCTTCTTCC-3' (SEQ ID NO: 20)
  • the forward primer has a Xho I restriction site as SEQ ID NO: 17 of Example 1 above
  • the reverse primer has a BamH I restriction site with SEQ ID NO: 18 of Example 1 above.
  • PCR Polymerase chain reaction
  • the reaction mixture was placed in a 50 ⁇ l silicon tube (siliconized reaction tube) and heated at 94 ° C. for 5 minutes.
  • PCR reactions consisted of 30 extensions for 40 seconds at 94 ° C, denaturation for 1 minute at 54 ° C, annealing for 3 minutes at 70 ° C, and final extension for 5 minutes at 20 ° C for 10 minutes at 72 ° C. final extension).
  • the reactants were separated by agarose gel electrophoresis and ligated to TA cloning vectors (Invitrogen, Sandiego, USA).
  • This vector was then transformed into transformant cells and the plasmids were isolated from the transformed bacteria by alkaline lysis method [Sambrook, J., Fritsch, F.E. and Maniatis, T (1989) Molecular cloning, Cold spring harbor laboratory press, Cold spring harbor].
  • TA vectors containing human FK506BP cDNA were digested with Xho I and BamH I and inserted into pET-15b and pET-15b-Tat expression vectors. Expression of the vector is under the control of the T7 promoter and lacO-operator.
  • E. coli BL21 (DE3) transformed with pET-Tat-FK506BP was selected and then colonies were inoculated in 100 ml LB medium and IPTG (0.5 mM) was added into the medium to induce overexpression.
  • E. coli cells, which induced overexpression of the fusion protein with IPTG, were disrupted by sonication at 4 ° C, and then centrifuged to separate proteins from the supernatant by 15% SDS-polyacrylamide gel electrophoresis. Overexpressed SOD and Tat-SOD were confirmed by SDS-polyacrylamide gel electrophoresis and Western blot analysis.
  • the method was modified to produce FK506BP-Tat fusion protein and Tat-FK506BP-Tat fusion protein.
  • the supernatant was immediately loaded by centrifugation into a 2.5 ml Ni 2+ -nitrilotriacetic acid sepharose column and 10-fold volume of binding buffer and 6-volume washing buffer (60 mM imidazole). , 0.5M NaCl, 20mM Tris-HCl, pH 7.9), and then the fusion protein was eluted with elution buffer (1M imidazole, 0.5M NaCl, 20mM Tris-HCl, pH 7.9). Subsequently, the fractions containing the fusion protein were collected, and Sephadex G-15 column chromatography was performed to remove the salts contained in the fractions.
  • the fusion protein contained six histidines at the N-terminus, the fusion protein was purified almost purely (purity> 90%) in a single step of immobilized metal-chelate affinity chromatography. Protein concentrations of the fractions were determined by Bradford method using bovine serum albumin as standard [Bradford, M.A. (1976) Anal. Biochem. 72, 248-254.
  • FK506BP-Tat fusion protein and Tat-FK506BP-Tat fusion protein were overexpressed and purified in the same manner as above.
  • Surgical epithelial damage of 0.4 mm2 was applied to the median cornea with a surgical knife, and then dry eye was induced by exposure to dry air with a humidity of 25-30% and 2.4 m / sec.
  • Tear secretion changes were tested according to the Schirmer method (cobalt chloride paper; Toyo Roshi Kaisha, Japan).
  • Schirmer test using a phenol red thread is known as the most common method of measuring changes in tear secretion and is the most basic method for evaluating corneal dryness. Fujihara et al. 2001, Invest.Ophthalmol.Vis.Sci. 2001; 42: 96-100, Nakamura et al., Cornea 2004; 23: 390-7).
  • a change in tear secretion amount before and after dry blowing was observed using 1 ⁇ 15 mm cobalt chloride paper.
  • the drug was administered using a dry blowing-induced dry eye model, and the conjunctiva-attached eye was extracted and histopathological observation was performed by PAS (Periodic acid-Schiff) staining.
  • PAS Periodic acid-Schiff
  • the corneal epithelial cell death was assessed immunohistochemically using PARP ⁇ poly (ADP-ribose) polymerase ⁇ .
  • PARP is a representative apoptosis marker (see Barrett et al., J Histochem Cytochem 2001; 49: 821-32). Increased PARP in corneal epithelium indicates increased corneal epithelial damage due to apoptosis and is caused by dry eye Eye injury is also known to be involved in some degree of cell death (see Yeh et al., Invest.Ophthalmol. Vis. Sci. 2003; 44: 124-9).
  • Dry-secreted portion of the botulinum toxin-A-induced mouse dry eye model was injected with 20 mU of BTX-A into the transconjunctival root in the lacrimal gland and the tear-secreting portion of the lacrimal gland orbital lobe. ) was injected with BTX-A to cause dry eye syndrome.
  • BTX-A-induced dry eye model was examined for corneal damage using a fluorescent dye (fluorescein sodium salt, Sigma Co., USA) to test the dry eye efficacy of the FK506BP fusion protein.
  • Corneal penetration rate of fluorescent dyes is the most common method of assessing corneal permeability. Increased permeability is known to mean increased corneal damage (see Yokoi & Kinoshita, Cornea 1995; 14: 485-9, Nakamura et. al., Invest.Ophthalmol.Vis.Sci.
  • the corneal permeability was significantly increased compared to the normal group.
  • the test group was divided into FK506BP protein and FK506BP fusion protein.
  • the FK506BP fusion protein group significantly decreased the fluorescence transmittance compared to the FK506BP protein group. The results are summarized in FIG.
  • the main toxicological observations were mortality, clinical symptoms, weight change, autopsy findings, organ weight, histopathological changes, and long-term observations were lung, heart, thymus, kidney, adrenal gland, spleen, testis / ovary, liver, pancreas, brain, 17 sites including the epididymis / uterus, the submandibular lymph nodes, the bladder, the prostate gland, and the dorsal vein.
  • FK506BP fusion protein showed no death in both low and high dose groups, and clinical results, weight, organ weight, gross and histological abnormalities due to drug administration were considered to be safe.
  • the FK506BP fusion protein according to the present invention can be used as a protein therapeutic agent for ophthalmic diseases.
  • Sequences attached to the present invention are primer sequences, fusion protein sequences associated with protein transport domain sequences and protein transport domains.

Abstract

본 발명은 안과 질환 치료제에 관한 것으로서, 좀더 구체적으로는 안구 조직내 투과가 가능한 FK506 결합단백질의 융합 단백질을 유효성분으로 함유하는 안과 질환 치료용 약제학적 조성물에 관한 것이다.

Description

ＦＫ506 결합 단백질 융합 단백질을 함유하는 안과 질환 예방 및 치료용 점안제 조성물
본 발명은 안과 질환 치료제에 관한 것으로서, 좀더 구체적으로는 안구 조직내 투과가 가능한 FK506 결합단백질의 융합 단백질을 유효성분으로 함유하는 안과 질환 치료용 약제학적 조성물에 관한 것이다.
최근 안과 분야에서는 각막 이식 및 자가면역 질환 환자의 증가로 치료제로서 면역억제제의 사용이 증대되고 있고, 이러한 면역억제제의 부작용을 줄이기 위해 새로운 약물들이 활발하게 개발되고 있다. 안과 질환에서 면역억제제는 점안 투여 제형으로 연구되고 있는 실정인데, 현재 사용 중인 약물들의 각막 투과율은 낮아서 과량을 사용하게 되기 때문에 부작용이 증대되고 있다. 각막은 투과시키려는 약제가 친수성과 지방성의 양 성질을 가진 경우 잘 투과하게 되어 있다.
각막 이식은 각막 질병으로 인해 시력을 잃은 환자의 혼탁해진 각막을 기증받은 깨끗한 각막으로 교환하여 줌으로써 시력을 회복시켜 주는 수술법이다. 각막이식술은 각막 보존방법, 수술 기법과 기구의 발전, 거부반응 치료 등의 발달에 힘입어 성공률이 높아지면서 전 세계적으로 가장 많이 시행되는 이식술이고, 안구는 심폐가 정지된 후에도 각막 이식을 할 수 있고, 다른 장기에 비해 높은 성공률로 뇌사가 법적으로 인정되지 않는 우리나라 실정에서 유일하게 활성화된 장기이식술이다. 우리나라 국립장기이식관리센터에 따르면 해마다 각막 이식은 증가되고 있고 2007년 각막 이식 건수는 405건이었고, 미국의 경우 1990년부터 2007년까지 40,000건이 훨씬 넘어 서고 있다.
이렇게 각막 이식이 증가되면서 여러 가지 문제가 나타나고, 이를 줄이기 위한 노력도 활발하게 이루어지고 있다. 각막 이식 거부반응은 면역 매개성 염증반응으로서 각막 이식 실패의 대부분을 차지한다. 각막 이식에서 거부 반응을 줄이기 위해서 스테로이드제를 주로 사용해 왔으나, 스테로이드를 장기간 사용할 경우 안압상승, 창상치유 지연, 백내장 등의 합병증이 발생할 수 있고 고위험군일 경우 고용량을 사용해도 거부반응을 막지 못한다. 최근에는 스테로이드제보다 면역억제제를 사용하여 거부반응을 줄이려는 시도가 계속되고 있는데, 고위험 각막이식 군에서 면역억제제인 사이클로스포린 A(cyclosporine A)를 처리한 군이 스테로이드를 단독으로 사용한 군보다 거부 반응이 적었음이 보고되었다. 실험적 동물모델에서는 이종 각막이식 후 FK506(Tacrolimus)을 사용한 군에서 사용하지 않은 군보다 수술 후 염증세포의 침윤이 덜하다는 사실이 보고되었다. 장기 이식환자에서 FK506(Tacrolimus)이나 사이클로스포린 A 사용시 면역 억제효과는 뛰어나지만, 신독성, 고혈압, 대사장애, 당뇨병 발생의 위험성 등 약제의 부작용이 문제가 되고 있어서 사용의 문제점으로 지적되고 있다.
자가면역질환(autoimmune disease)은 신체의 방어 기작, 즉 면역시스템이 자신의 신체 조직에 대항하게 되어 손상을 입히기 시작할 때 일어나는 질환이며, 환자는 현재도 계속 증가 추세에 있다. 자가면역질환은 바이러스나 세균에 대해 신체의 사이토카인(신체의 방어 체계를 제어하고 자극하는 신호물질) 환경이 변화되면서 부적절한 면역반응이 유도되어 자가면역반응이 과도하거나 부적절하게 제어되면서 병이 생기는 것이라고 보지만, 정확한 발병원인은 밝혀지지 않았으며 환경적 요인, 유전적 요소, 면역학적 요인에 의해 발병할 수 있는 것으로 보인다. 현재까지 알려진 자가면역질환은 80여종에 이르고, 그중 미국에서 조사한 바에 따르면 류마티스 관절염은 210만 명에 달하며, 섬유근통(fibromyalgia)은 370만 명, 건선(psoriasis)은 400-450만 명인데 이중 10-30%는 또한 관절염 환자이기도 하며 또한 400만 명의 백반증 환자가 있으며, 쇼그렌 증후군(Sjogren syndrome) 환자는 200-300만 명에 달하고 있다. 또한 이미 알려진 자가면역 안과 질환으로는 포도막염, 베체트병, 각결막염을 비롯하여, 최근에는 안구건조증이 면역반응 이상으로 인한 염증성 질환으로 여겨지면서 건조증 또한 자가면역 질환으로 여겨지고 있다. 대부분의 자가면역 질환에서는 스테로이드제를 사용하거나 최근에는 면역억제제를 사용하고 있다. 대표적인 자가면역 안과 질환 중 하나가 포도막염(uveitis)이다. 포도막은 홍체, 섬모체, 맥락막으로 구성되어 있는데, 포도막에는 혈관이 풍부하고 결합조직이 많아서 염증이 생기기 쉽다. 이 포도막에 생긴 염증을 포도막염이라 하는데 현재까지 그 병의 원인이 불분명한 편인데, 그나마 원인으로 여겨지는 경우는 매독과 결핵 정도이다. 현재 포도막염의 원인으로 면역체계의 이상을 보고 있는데, 포도막에서의 염증이 균이나 바이러스에 의해 생기기도 하지만 면역학적 반응의 염증이 많아서 자가 면역질환으로 분류하게 된다. 포도막염의 치료는 국소 또는 전신성 스테로이드를 사용해 치료해 왔다. 그러나 점안제와 같은 국소 치료나 전신성 스테로이드의 치료는 약물이 포도막 조직에 충분히 도달하지 않을 경우, 고용량을 사용할 수밖에 없는데 이럴 경우 심각한 부작용이 나타나는 경우가 많다. 또한 스테로이드 치료에 반응하지 않는 환자 또는 전신 스테로이드의 심각한 부작용을 견디지 못하는 환자들에게는 면역억제제를 사용하는데, 이 역시 골수 억제, 출혈방광염, 신장 손상 등의 부작용으로 결국 치료를 중단하는 사례가 있었다. 이런 환자들은 실명에 이르게 되는 경우가 많다. 따라서 안구 침투가 잘 되고 부작용이 적은 안과 질환용 점안제 개발이 시급한 실정이다.
안구건조증은 눈물생성이 부족하거나 눈물막이 너무 과도하게 증발하여 눈물막이 불안정하게 되고 이에 따라 이물감이나 따가움 등 여러 가지 증상이 발생하는 증후군이다. 안구건조증은 눈물분비가 저하되거나 눈알과 눈 부속기관의 질환, 즉 눈꺼풀의 이상이나 염증, 피부질환과 동반된 경우{스티븐슨-존슨증후군, 유사물집증(pemphigoid)}, 전신 질환과 동반된 경우(비타민 A 결핍증, 쇼그렌 증후군)에 나타난다(안과학 제7판, 일조각, 윤동호.이상욱.최억 저, 2005). 중앙대병원의 최근 조사에 따르면 우리나라 성인의 75%가 안구건조증을 앓고 있고, 3명 중 1명은 각막에 염증까지 생긴 중증 환자라고 발표하였다.
안구건조증에 대한 치료는 인공눈물 점안액을 보충해주거나 눈물길을 일시적 혹은 영구적으로 막아 주는 등의 보존적인 방법으로 일정량 이상의 눈물을 유지시켜주는데 초점을 두었지만 최근 들어 안구건조증이 염증성 질환으로 새로이 인식되면서 안구건조증에 대한 항염증 치료가 활발히 시도되었고, 심한 건성안 환자의 증상 호전에 그 효과가 보고되고 있다.
안구건조증에서 T-임파구가 증가되어 있고 사이토카인을 비롯한 여러 가지 염증매개물질이 높은 농도로 검출되는 등 안구표면의 염증변화 소견이 증명되면서, 안구표면의 염증억제가 안구건조증 치료의 관심사가 되었고, 그러한 약물 중 하나가 사이클로스포린 A 0.05% 점안액(레스타시스)이다. 그러나 안구건조증 환자들에게서 부작용이 발생되며, 가장 흔한 이상 반응은 눈의 작열감(의약품 등이 피부나 혀에 닿았을 때 그 자극으로 인해 탈 것 같은 감각)이고, 1-5%의 환자에게서는 결막충혈, 분비물, 유루증, 눈의 동통, 이물감, 소양감, 자통, 시력 장애(종종 시야혼탁) 등이 보고되고 있다. 따라서, 부작용이 적은 새로운 염증 및 면역억제제 개발이 필요한 실정이다.
안과 질환에서 점차 면역억제제의 사용빈도가 증가되고 있지만 부작용이 심해서 사용에 제한이 있다. 면역억제제란 숙주가 항체를 만드는 능력(체액성 면역)이나 세포성 면역반응 능력을 저하시키거나, 차단하기 위해 사용되는 다양한 물질들을 말하며, 주로 자가면역질환, 태아적아구증과 같은 선택적인 면역억제 및 장기이식 후 거부반응 방지를 위한 치료 목적으로 사용된다. 면역 억제제는 면역억제기능 외에 빈혈, 백혈구 감소증, 혈소판 감소증, 탈모 등의 부작용이 있어, 사용에 제한을 두고 있다. 세포독성이 적은 대용제제들이 세균과 진균의 2차 대사산물로부터 개발되어, 현재 장기 이식환자들에게 가장 널리 사용되고 있는 사이클로스포린 A와 FK506(Tacrolimus)이 대표적으로 사용되나 부작용이 완전히 줄어들지는 않고 있다.
안과 질환 치료제는 기존 약제의 부작용을 줄이기 위해 전신성에서 점안으로의 사용법 변화와 새로운 약물 개발이 필요하다. 최근에 주로 사용되는 면역억제제인 사이클로스포린과 FK506은 전신성으로 사용되고 있는데, 두 가지 약물 모두 신장과 신경계에 손상을 가져올 수 있어서 의학적으로 널리 사용하기에는 어려운 점이 있어서 기존 약품의 부작용을 줄이며 효과를 증진하는 방향인 점안 제형으로의 개발 연구가 활발히 진행되고 있다. 각막 이식 후 거부반응 억제를 위하여 점안으로 FK506을 투여하였을 때 거부반응을 지연시키는데 탁월한 효과를 보인다는 논문이 게재된바 있으며, 안구건조증 환자에게서도 점안으로 FK506을 투여하였을 때 일반 건조증 약제를 사용하였을 때보다 좋은 효과를 나타냈다고 보고된 바 있다. 가톨릭대학교 안과학 교실에서도 사이클로스포린을 포함한 점안액을 3개월간 안구건조증환자에게 투여시 눈물 분비량이 증가하였고, 특히 전신질환과 동반된 안구건조증에서 더 효과가 나타났다고 보고하였다. 하지만 임상기간이 너무 짧아 한계가 존재한다. 펜실베니아 의과대 연구팀은 '미의학협회저널'을 통해 노년층에서 15~34%에서 발병하는 안구건조증 환자 중 기존 치료에 반응하지 않는 중등도 이상의 안구건조증이 있는 환자에서 사이클로스포린을 포함한 점안액 투여시 건조증에 매우 효과적인 것으로 나타났다.
점안 제형이 전신 투여보다 더 효과적이고 부작용을 최소화할 수 있음에도 불구하고 약물의 안구내 침투는 매우 어렵기 때문에 새로운 기술의 도입이 필요하다. 특히 고분자인 단백질 제제는 화학약물에 비해 더욱 침투가 용이하지 않다. 약물의 각막 내 투과는 각막의 상피와 실질과의 화학적 성분의 상위에 따라서 다르기 때문에 많은 방해 요인이 존재한다. 각막의 상피는 실질부분에 비해 지질분자량이 많으면 비해리형 약물이 잘 투과하나, 실질층은 해리형만을 투과시킨다. 또한 내피는 리포이드(lipoid)를 함유하고 있어서 지용성 물질만 통과시키는 특징을 보인다. 따라서, 각막은 지용성과 친수성의 양쪽성 성질을 갖춘 약물이 잘 투과하게 되어 있다. 그렇기 때문에 각막을 잘 투과하지 못하는 약물의 투과율을 높이기 위해 원래 투여해야 할 양보다 과량을 사용하게 되어 그에 따른 부작용이 나타날 수 있는 것이다.
특허 제472938호는 세포 침투 효율을 향상시킨 수송 도메인-목표 단백질-수송 도메인 융합 단백질 및 그 용도에 관한 것으로서, HIV-1 Tat 펩타이드, 올리고라이신, 올리고아르기닌과 같은 단백질 수송 도메인이 목표 단백질의 N-말단 및/또는 C-말단에 공유결합되어 세포 침투성을 향상시킨 융합 단백질에 대해 개시하고 있다.
또한, 특허 제490362호는 단백질 수송 도메인으로서 올리고라이신이 단백질의 N-말단 및/또는 C-말단에 공유결합되어 세포 침투성을 향상시킨 기술에 대해 개시하고 있다.
상기 특허들을 비롯하여 많은 연구자들의 논문을 통해 HIV-a Tat 펩타이드, 올리고라이신, 올리고아르기닌, 올리고(라이신, 아르기닌) 및 PEP-1 펩타이드 등이 단백질의 세포 침투성을 향상시킨다는 사실이 밝혀졌다.
또한, 특허 제787393호는 FK506BP 융합 단백질 및 이를 함유한 아토피 피부염 및 알러지 개선용 조성물에 대해 개시하고 있다.
그러나, FK506BP 또는 FK506BP 융합 단백질의 안과 질환 예방 또는 치료 용도에 관해서는 지금까지 알려진 바가 없다.
따라서 기존의 면역억제제보다 부작용이 적은 새로운 단백질 성분 치료제가 안구를 잘 통과할 수 있도록 하는 제형으로의 개발은 안구건조증후군을 비롯한 안과 질환 치료분야에서 매우 중요하다. 따라서 본 발명은 FK506에 부착하여 효과적으로 과민성 면역반응을 억제하는 모듈레이터인 FK506 결합단백질을 세포침투가 용이하도록 개발하고 적용하여 안과 질환에 효과적인 단백질 치료 수단으로 이용하는데 그 목적이 있다.
상기 목적을 달성하기 위하여 본 발명자들은 면역반응 억제 약물인 단백질제를 안구 침투 능력을 높이는 제형으로 개발하고자 연구하였고, 점안용 단백질 제제의 안과 질환 치료 효과를 규명함으로써 본 발명을 완성하게 되었다.
본 발명자들은 자연상태의 단백질을 세포 내로 운반하는 PEP-1 펩타이드 및 HIV-1 Tat 펩타이드 중 1종을 외부 단백질인 사람 FK506BP(이하 "FK506 결합 단백질"과 혼용함)의 N- 및/또는 C- 말단에 융합시켰고, 이 융합 단백질을 대장균에서 과대발현시켰으며, 금속 킬레이팅 친화 크로마토그래피로 쉽고 편리하게 정제하였다. 또한, 정제된 융합 단백질이 효과적으로 안구건조증을 비롯한 안과 질환을 개선함을 실험을 통하여 확인하였다. 본 발명은 FK506BP 융합 단백질이 안과 질환에 대한 단백질 치료제로서의 응용 가능성을 제기하였다.
본 발명의 일 양태에 따르면, 본 발명은 FK506 결합단백질의 N-말단 및 C-말단 중 한 군데 이상에 PEP-1, Tat과 같은 단백질 수송 도메인이 공유결합되어 있는 FK506 결합단백질의 융합 단백질(이하 "FK506BP 융합 단백질"과 혼용함)을 함유하는 안과 질환 치료용 약제학적 조성물을 제공한다.
본 발명의 다른 양태에 따르면, 본 발명은 FK506 결합단백질의 융합 단백질을 함유하며, 안구건조증등 안과 질환 치료용 약제학적 조성물을 제공한다. 본 발명의 FK506 결합단백질의 융합 단백질은 안과 질환의 치료에 유용하며, 대표적으로 안구건조증 치료에 유용하다.
본 명세서에서 사용되는 용어 "안과 질환"은 스티븐슨-존슨 증후군, 쇼그렌 증후군, 안구건조 증후군, 외상, 안구 수술에 의한 안구 외상(안구 수술은 안구를 절개하는 모든 수술을 의미하며, 대표적으로 백내장 수술, 녹내장 수술, 망막 수술, 라식 수술, 라섹 수술 등을 말한다), 감염성/비감염성 포도막염, 각막 이식수술 후 면역거부반응 또는 하드 콘택즈 렌즈 착용에 의한 외인성 질환에 의한 각결막 상피 장해를 말한다. 상기 안과 질환은 반드시 이에 한정되는 것은 아니지만, 바람직하게는 안구건조증을 포함한다.
본 명세서에서 사용되는 용어 “안구건조증”은 눈물 생성이 부족하거나 눈물막의 눈물이 과도하게 증발하여 눈물막이 불안정하게 되고 이에 따라 이물감이나 따가움 등 여러 가지 증상이 발생하는 증후군을 의미한다. 좀더 구체적으로는 "안구건조증"이란 눈물 분비가 저하되거나 눈알과 눈 부속기관의 질환, 즉 눈꺼풀의 이상이나 염증, 피부질환과 동반된 경우로서 스티븐슨-존슨 증후군 혹은 유사물집증 (pemphigoid), 또한 전신 질환과 동반된 경우인 비타민 A 결핍증 및 쇼그렌증후군을 의미하며, 노출된 눈꺼풀 틈새 내의 눈알 표면이 손상되고 눈에 불쾌감, 이물감, 건조감 같은 자극증상을 일으키며, 각막손상이 심해질 경우 안구표면에 염증이 발생하는 질환을 말한다. 병변이 진행되면 충혈이 보일 수 있으며, 합병증으로 처음에는 약한 시력장애가 있을 수 있고, 그 후에 각막궤양, 각막천공, 이차적인 세균감염도 올 수 있으며, 각막흉터와 혈관신생 등이 생기면 시력장애가 심해진다.
본 발명에서는 FK506 결합단백질의 융합 단백질에 대하여 기본적으로, 단백질의 유전자 재조합, 항원-항체 반응을 이용하는 면역분석 (immunoassay) 방법 (예컨대, 방사능 면역분석 방법, 방사능 면역-침전 방법, 효소-결합 면역흡착 방법(ELISA), 도트 블롯 분석, 웨스턴 블롯, 억제 또는 경쟁 분석 및 샌스위치 분석) (참조: Enzyme Immunoassay, E. T. Maggio, ed., CRC Press, Boca Raton, Florida, 1980; 및 Gaastra, W., Enzyme-linked immunosorbent assay (ELISA), in Methods in Molecular Biology, Vol. 1, Walker, J.M. ed., Humana Press, NJ, 1984), PCR등을 이용한 분자검사법 등에 따라 정량적으로 또는 정성적으로 실시하였다.
본 발명에서 FK506 결합단백질의 융합 단백질이 나타내는 안과 질환에 대한 효능 검증은 많은 관련 논문과 공지된 안구건조증 동물모델을 이용하여 실시할 수 있다.
예를 들어, 본 발명자들은 단기 안구건조증모델로서 건조송풍 유발 렛트 안구건조 모델을 이용하였다. 외과용 칼을 이용하여 각막 정중부에 0.4㎟의 외과적 상피 손상을 가한 다음, 습도 25~30%, 2.4m/sec의 건조송풍에 노출시켜 안구건조증을 유발시켰으며, 스커머(Schirmer) 방법으로 눈물 분비량을 측정하였으며, 형광염료를 이용하여 각막 손상율을 측정하였다. 또한 결막이 부착된 안구와 안검결막을 각각 적출하여 조직병리학적으로 관찰하였으며, PARP{poly(ADP-ribose)polymerase}를 이용하여 각막 상피세포의 세포사멸(apoptosis)을 면역조직화학적으로 평가하였다. 또한, FK506 결합단백질의 융합 단백질의 안구건조증에 대한 효력은 검증되어 있는 0.1% 히알루론산 나트륨(sodium hyaluronate) (참고: Johnson et al. 2006, 2008) 점안군과 비교하였다.
다른 안구건조증 모델로서 BTX-A(botulinum toxin-A) 유발 마우스 안구건조 모델을 이용하였다. 20 mU의 BTX-A를 눈물샘에 경결막(transconjunctival) 루트로 주사하여 눈물샘 안와엽(lacrimal gland orbital lobe)의 눈물 분비 부위(tear-secreting portion)에 BTX-A가 주입되게 되며, 안구건조증을 유발시켰다. 안구건조증 효능검사를 위해 형광염료를 이용한 각막손상율을 측정하고, 결막이 부착된 안구와 안검결막을 각각 적출하여 조직병리학적으로 관찰하였다.
신규한 안구건조증 치료물질로서 FK506 결합단백질의 융합 단백질을 렛트 단회 정맥투여독성 실험을 위해서 유효용량인 0.1% 용액 총 6번 점안에 해당하는 0.01mg/kg으로 계산한 후 500배에 해당하는 5mg/kg을 고용량군으로 설정하고, 2.5mg/kg을 저용량군으로 설정하여 독성실험을 실시하였다.
그 결과, 본 발명에 따른 FK506BP 융합 단백질은 안구건조 동물모델에서 눈물 분비량을 현저히 증가시켰으며, 염증으로 인하여 얇아진 결막 상피 두께를 증가시켰고, 점액 생산세포 수를 증가시켰다. 뿐만 아니라, 본 발명에 따른 FK506BP 융합 단백질은 안구 손상시 세포사멸을 감소시키며, 각막 손상을 감소시켰다.
본 발명은 FK506 결합단백질의 N-말단 및 C-말단 중 한 군데 이상에 단백질 수송 도메인이 공유결합된 융합 단백질을 함유하는 안과 질환 예방 및 치료용 점안제 조성물에 대한 것이다.
본 발명은 상기 단백질 수송 도메인이
a) 15∼30개의 아미노산으로 구성되고, 5개 이상의 트립토판을 포함하는 비친수성 도메인(hydrophobic domain), 라이신을 4개 이상 다수 포함하는 친수성 도메인(hydrophilic domain) 및 상기 두 도메인을 분리시켜 주는 스페이서(spacer)로 구성된 단백질 수송 도메인,
b) 6 내지 12개의 아미노산 잔기로 구성되며 아르기닌 또는 라이신 잔기를 3/4 이상 포함하는 단백질 수송 도메인,
c) 6 내지 12개의 라이신으로 구성되는 올리고라이신 단백질 수송 도메인,
d) 6 내지 12개의 아르기닌으로 구성되는 올리고아르기닌 단백질 수송 도메인 및
e) 6 내지 12개의 라이신 또는 아르기닌으로 구성되는 올리고(라이신,아르기닌) 단백질 수송 도메인 및 상기 a) 내지 e)의 유도체(derivatives) 들 중 선택된 1종 이상임을 특징으로 한다.
또한, 본 발명은 상기 융합 단백질이 서열번호 4, 서열번호 6, 서열번호 8, 서열번호 10, 서열번호 12 및 서열번호 14 중 선택된 1종인 것을 특징으로 한다.
또한, 상기 안과 질환은 스티븐슨-존슨 증후군, 쇼그렌 증후군, 안구건조 증후군, 외상, 안구 수술에 의한 안구 외상, 포도막염(감염성 또는 비감염성), 각막 이식수술 후 면역거부반응 또는 하드 콘택즈 렌즈 착용에 의한 외인성 질환에 의한 각결막 상피 장해임을 특징으로 한다.
FK506BP 융합 단백질을 유효성분으로 함유하는 약제학적 조성물은 약제학적 분야에서 통상적으로 허용되는 담체와 함께 배합하여 통상적인 방법에 의해 점안제로 제형화할 수 있다. 점안제 조성물은 등장성 수용액 또는 현탁액이 바람직하고, 언급한 조성물은 멸균되고/되거나 보조제(예: 방부제, 안정화제, 습윤제 또는 삼투압 조절을 위한 염/또는 완충제)를 함유한다. 또한, 이들은 기타 치료적으로 유용한 물질을 함유할 수 있다.
통상 점안제 조성물에는 히알루론산 및 카르복시메틸셀룰로오스와 같은 음이온성 중합체나 이들의 약제학적으로 허용 가능한 염이 점안액에서 보습작용과 윤활작용을 하는 것으로 알려져 왔으며, 이들 성분 외에 약제학적으로 허용 가능한 담체를 포함할 수 있다. 상기 약제학적으로 허용가능한 담체로는 등장화제, 완충제, 안정제, pH 조절제 및 용제 등을 들 수 있다. 등장화제는 점안제의 등장성을 조절하는 역할을 하며, 대표적으로 염화나트륨 또는 염화칼륨 등을 선택할 수 있다. 완충제는 점안제의 산도 또는 알칼리도를 조정하는 기능을 수행한다. 통상 점안제 제조에 사용되는 완충제는 아미노카프론산, 인산일수소나트륨 및 인산이수소나트륨 등을 들 수 있다. 안정제는 점안제를 안정화시키는 역할을 수행하며, 통상 안정제로서 에데트산 나트륨 및/또는 과붕산나트륨을 이용할 수 있다. pH 조절제는 점안제 조성물의 pH를 조절하며, 예컨대 염산 및/또는 수산화나트륨을 들 수 있다. 용제로는 멸균 정제수 또는 주사용 증류수를 사용하는 것이 바람직하다. 본 발명에 따른 점안제는 액제 제형인 것이 바람직하다. 상기 점안제 조성물에는 필요에 따라 보존제, 방부제 등을 부가할 수 있다.
본 발명에 따른 점안제 조성물의 권장량 및 사용 횟수는 1회 1~3적, 1일 5~6회 점안하되 증상에 따라 적절히 증감할 수 있다. 특정 환자에 대한 투여용량 수준은 환자의 체중, 연령, 성별, 건강상태, 투여시간, 투여횟수, 질환의 중증도 등에 따라 변화될 수 있다.
본 발명에 따른 FK506BP 단백질 분자의 세포 내 전달은 FK506BP에 15∼30개의 아미노산으로 구성되고, 5개 이상의 트립토판을 포함하는 비친수성 도메인(hydrophobic domain), 라이신을 4개 이상 다수 포함하는 친수성 도메인(hydrophilic domain) 및 상기 두 도메인을 분리시켜 주는 스페이서(spacer)로 구성된 수송 도메인이 공유결합된, Pep-1을 비롯한 세포투과성 수송도메인 또는 HIV Tat 세포투과성 도메인이 목표 단백질인 FK506BP의 N-말단 및/또는 C-말단과 공유결합된 형태의 융합 단백질을 구성하여 수행된다. 본 발명의 상기 수송도메인의 일례로는 21개의 아미노산으로 구성되고 서열번호 1과 같은 아미노산 서열로 이루어진 PEP-1 펩타이드, 서열번호 2와 같은 아미노산 서열로 이루어진 HIV Tat 49~57 펩타이드를 들 수 있다. 그러나, 본 발명의 단백질 수송 도메인이 서열번호 1의 PEP-1 펩타이드, 서열번호 2의 HIV Tat 49~57 잔기 펩타이드로만 한정되는 것은 아니고, PEP-1 또는 HIV Tat의 아미노산 서열 일부 치환이나 부가, 결여로 PEP-1 펩타이드 또는 HIV Tat 펩타이드와 유사한 기능을 하는 펩타이드를 제조하는 것이 본 발명이 속하는 분야에서 통상의 지식을 가진 당업자에게는 용이하므로, 15∼30개의 아미노산으로 구성되고, 5개 이상의 트립토판을 포함하는 비친수성 도메인(hydrophobic domain), 라이신을 4개 이상 다수 포함하는 친수성 도메인(hydrophilic domain) 및 상기 두 도메인을 분리시켜 주는 스페이서(spacer)로 구성된 단백질 수송 도메인과 이로부터 아미노산 일부 치환으로 동일·유사한 단백질 수송기능을 수행하는 단백질 수송 도메인, 또는 6 내지 12개의 아미노산 잔기로 구성되며 아르기닌 또는 라이신 잔기를 3/4 이상 포함하는 수송도메인, 6 내지 12개의 라이신으로 구성되는 올리고라이신 수송 도메인, 6 내지 12개의 아르기닌으로 구성되는 올리고아르기닌 수송 도메인 또는 6 내지 12개의 라이신 또는 아르기닌으로 구성되는 올리고(라이신,아르기닌) 수송 도메인도 발명의 범위에 속함은 자명하다고 할 것이다.
구체적으로, 본 발명은 상기와 같은 단백질 수송 도메인과 공유결합된 FK506BP 융합 단백질을 포함하는 안과 질환 치료용 점안제 조성물에 관한 것이다.
본 발명의 상세한 설명 등에서 사용되는 주요 용어의 정의는 다음과 같다.
"FK506BP 융합 단백질"이란 단백질 수송 도메인과 FK506BP를 포함하며, 단백질 수송 도메인과 화물 분자(cargo molecule, 즉 본 발명에서는 FK506BP를 의미함)의 유전적 융합이나 화학 결합으로 형성된 공유결합 복합체를 의미한다. 본 명세서와 도면에서는 "FK506 결합단백질 융합 단백질"과 혼용하였고, 구체적인 일 실시예로서 "PEP-1-FK506BP"는 FK506BP 융합 단백질 중 FK506BP의 N-말단에 PEP-1 단백질 수송 도메인이 결합된 것을 말한다.
또한, 상기 "유전적 융합"이란 단백질을 코딩하는 DNA 서열의 유전적 발현을 통해서 형성된 선형, 공유결합으로 이루어진 연결을 의미한다.
또한, "표적 세포"란 수송 도메인에 의해 화물 분자가 전달되는 세포를 의미하는 것으로서 즉, 표적 세포는 체내 세포, 다시 말하여 살아있는 동물 또는 인간의 장기 또는 조직을 구성하는 세포 또는 살아있는 동물 또는 인간에서 발견되는 미생물을 포함하는 의미이다. 또한, 표적 세포는 체외 세포, 즉 배양된 동물 세포, 인체 세포 또는 미생물을 포함하는 의미이다. 구체적으로 본 명세서에서 표적 세포는 안구 세포를 의미한다.
본 명세서의 "단백질 수송 도메인"은 화물 분자(목표 단백질) 펩타이드 또는 단백질과 공유결합을 이루어 별도의 수용체나 운반체, 에너지를 필요로 하지 않고 상기 펩타이드나 단백질을 세포 내로 도입시킬 수 있는 것을 말하며, 예를 들면 PEP-1 펩타이드(서열번호 1)를 말한다.
본 명세서의 "목표 단백질"은 PEP-1 단백질 수송 도메인과 공유결합을 이루어 세포 내로 도입되어 활성을 나타내는 분자를 의미한다. "화물 분자"와 동일한 의미이다.
또한, 본 명세서에서는 단백질 또는 펩타이드를 세포 내로 "도입"시키는 것에 대하여 "형질도입", "운반", "침투", "수송", "전달", "투과", "통과"한다는 표현들과 혼용하였다.
본 발명에서 단백질 수송 도메인으로는 15∼30개의 아미노산으로 구성되고, 5개 이상의 트립토판을 포함하는 비친수성 도메인, 라이신을 다수 포함하는 친수성 도메인 및 상기 두 도메인을 분리시켜 주는 스페이서로 구성된 단백질 수송 도메인, 6 내지 12개의 아미노산 잔기로 구성되며 아르기닌 또는 라이신 잔기를 3/4 이상 포함하는 수송도메인, 6 내지 12개의 라이신으로 구성되는 올리고라이신 수송 도메인, 6 내지 12개의 아르기닌으로 구성되는 올리고아르기닌 수송 도메인 또는 6 내지 12개의 라이신 또는 아르기닌으로 구성되는 올리고(라이신,아르기닌) 수송 도메인을 들 수 있다. 또한, 목표 단백질(화물 분자)는 FK506BP이다. 상기 단백질 수송 도메인 및 목표 단백질은 silent change에 따라 서열 내에서 하나 이상의 아미노산이 기능적으로 동등하게 작용하는 유사한 극성의 다른 아미노산(들)로 치환될 수 있다. 서열 내 아미노산 치환은 그 아미노산이 속하는 클래스의 다른 구성원들로부터 선택될 수 있다. 예컨대, 소수성 아미노산 분류는 알라닌, 발린, 류이신, 이소류이신, 페닐알라닌, 발린, 트립토판, 프롤린 및 메티오닌을 포함한다. 극성 중성 아미노산은 글리신, 세린, 트레오닌, 시스테인, 티로신, 아스파라긴 및 글루타민을 포함한다. 양성 염기성 아미노산은 아르기닌, 라이신 및 히스티딘을 포함한다. 음성전하를 띤 산성 아미노산은 아스파르트산 및 글루탐산을 포함한다. 또한, 본 발명의 융합 단백질과 아미노산 서열간의 일정 범위의 상동성 예컨대 85-100% 범위 내에서 동일·유사한 생물학적 활성을 갖는 절편 또는 이들의 유도체들도 본 발명의 권리범위에 포함된다.
또한, 본 발명은 상기 세포 도입성 FK506BP 융합 단백질이 서열번호 4, 서열번호 6, 서열번호 8, 서열번호 10, 서열번호 12 또는 서열번호 14의 아미노산 서열을 갖는 것을 특징으로 한다.
또한, 본 발명은 상기 단백질 수송도메인(protein transducing domain; "PTD")이 FK506BP 단백질의 카복시 말단과 아미노 말단의 일측 또는 양측에 공유결합된 것을 특징으로 한다.
또한, 본 발명은 상기 세포 도입성(cell-transducing) FK506BP 융합 단백질을 유효성분으로 함유하는 것을 특징으로 하는 안과 질환 치료용 점안제 조성물에 관한 것이다.
또한, 본 발명은 상기 세포 도입성 FK506BP 융합 단백질을 유효성분으로 함유하고 약학적으로 허용되는 담체를 포함하는 것을 특징으로 하는 조성물에 관한 것이다.
본 발명에 따른 FK506BP 융합 단백질은 안구건조 동물모델에서 눈물 분비량을 현저히 증가시켰다.
또한, 본 발명에 따른 FK506BP 융합 단백질은 염증으로 인하여 얇아진 결막 상피 두께를 증가시켰고, 점액 생산세포 수를 증가시켰다.
뿐만 아니라, 본 발명에 따른 FK506BP 융합 단백질은 안구 손상시 세포사멸을 감소시키며, 각막 손상을 감소시켰고, 생체에 대하여 독성 실험을 수행한 결과, 이상 소견이 발견되지 않아 안과 질환에 대한 단백질 치료제로서 사용 가능하다.
도 1은 1X15mm의 코발트 클로라이드 페이퍼를 사용하여 스커머 시험을 수행하고 건조 송풍 전후 눈물 분비량 변화를 보여주는 도면이다. 도 1에서 B는 건조 송풍 전을 나타내며, A는 건조 송풍 후를 나타낸 것이다. 2개의 대조군은 정상대조군(intact) 즉, 건조 송풍을 수행하지 않은 군과 안구건조를 유발하고 약물을 투여하지 않은 음성대조군(Dry Eye Control)이다. 약물대조군은 히알루론산(Hyaluronate)을 가한 대조군이며 시험군은 본 발명의 FK506BP 융합 단백질을 처리한 군이다. 각 약물은 5시간 동안 1시간에 한 번씩 안구당 5㎕ 씩 투여하였다.
도 2는 PAS 염색을 이용하여 건조 송풍 유발 안구건조 모델에서 FK506BP 융합 단백질 약물이 결막 상피두께, 점액생산세포의 수에 대하여 미치는 영향을 조직병리학적으로 관찰한 사진이다. 도 2에서 A는 정상대조군, B는 건조 송풍 유발 음성대조군, C는 히알루론산을 투여한 약물대조군, D는 FK506BP 융합 단백질을 투여한 시험군이다. 각 약물은 5시간 동안 1시간에 한 번씩 안구당 5㎕씩 투여하였다. 도 2A 내 ThE는 상피 두께측정 범위를 나타내는 것이다.
도 3은 PARP{Poly(ADP-ribose)polymerase}를 이용하여 건조송풍 유발 안구건조 모델에서 각막의 세포사멸 정도를 면역조직화학적으로 관찰한 사진이다. A는 정상 대조군, B는 건조 송풍 유발 음성대조군, C는 약물대조군, D는 본 발명의 FK506BP 융합 단백질을 투여한 시험군이다. 각 약물은 5시간 동안 1시간에 한 번씩 안구당 5㎕씩 투여하였다. 도면 내 스케일 바(scale bar)는 80㎛이다.
도 4는 BTX-A 유발 안구건조증 모델에서 1% 형광물질(fluorescein)을 1㎕ 점안 후 형광 광원을 비추고 슬릿 램프(slit-lamp)로 촬영한 사진이다. "Control"은 정상 대조군, "Saline"은 식염수를 가한 대조군, "BTX"는 BTX-A를 가한 대조군, "FK506BP"는 융합 단백질이 아닌 FK506BP 단백질을 투여한 시험군이고, "PEP-1-FK506BP"는 FK506 결합단백질의 융합 단백질을 투여한 시험군이다. 각 약물은 5시간 동안 1시간에 한 번씩 안구당 5㎕씩 투여하였다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 본 발명을 좀 더 구체적으로 설명하기 위한 것으로서, 본 발명의 범위가 이들 실시예의 기재 범위 내로 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 자명하다. 특히, 각 실험예의 결과로서 구체적인 실시예에서 제조한 여러 가지 융합 단백질 중 PEP-1-FK506BP 융합 단백질을 시료로 한 데이터를 기재하였으나, 그 외의 융합 단백질들 또한 PEP-1-FK506BP 융합 단백질을 시료로 한 결과와 유사한 정도(74~96%)의 결과를 나타내었음을 밝힌다.
<재료>
제한 효소와 T4 DNA 리가아제(ligase)는 Promega(USA)에서 구입하였고, Pfu 폴리머라아제는 stratagene(USA)에서 구입하였다. Tat 올리고뉴클레오타이드는 Gibco BRL custom primer(USA)에서 합성하였다. IPTG는 Duchefa(Netherland)에서 구입하였다. pET-15b와 BL21(DE3) 플라스미드는 Novagen(USA)에서 구입하였고, Ni-니트릴로-트리아세틱 애시드 세파로즈 슈퍼플로우는 Qiagen(Germany)에서 구입하였다. 사람 FK506 결합 단백질(FK506BP) cDNA는 PCR 방법으로 사람 간 cDNA 라이브러리에서 분리하였다. 이외 모든 시약은 특급 제품을 이용하였다.
<실시예 1: PEP-1-FK506BP 융합 단백질의 발현벡터 제조 및 형질변환>
기능을 가진 단백질을 세포 내로 침투시키는 기술을 개발하기 위하여 세포 내로 목표 단백질을 전달할 수 있는 융합 단백질 발현벡터를 제조하였고, PEP-1 펩타이드가 단백질을 세포 내로 전달하는 능력을 용이하게 분석하기 위하여 사람 FK506BP를 선택하였다.
먼저, PEP-1-FK506BP 융합 단백질을 생산하기 위해 PEP-1 펩타이드(KETWWE TWWTEW SQP KKKRKV)(서열번호 1)가 포함된 pET-PEP 발현벡터를 제조하였다. PEP-1 펩타이드에 해당하는 두 종류의 올리고뉴클레오타이드(윗 사슬, 5'-TATGAAAGAAACCTGGTGGGAAACCTGGTGGACCGAATGGTCTCAGCCGAAAAAAAAACGTAAAGTGC-3'(서열번호 15); 아랫 사슬, 5'-TCGAGCACTTTACGTTTTTTTTTCGGCTGACACCATTCGGTCCACCAGGTTTCCCACCAGGTTTCTTTCC-3'(서열번호 16))를 NdeⅠ-XhoⅠ 제한효소로 자른 pET-15b에 연결(ligation)하여 삽입하였다. 이어, 사람 FK506BP의 cDNA의 서열을 기본으로 하여 두 종류의 올리고뉴클레오타이드를 합성하였다. 정방향 프라이머는 5’-CTCGAGATGGGAGTGC AGGTGGAAACCATC-3'(서열번호 17)로 XhoⅠ 제한 부위를 지니고 있으며 역방향 프라이머는 5'-GGATCCTCATTCCAGTTTTAGAAGCTCCAC-3'(서열번호 18)로 BamHⅠ 제한 부위를 갖고 있다.
중합효소 연쇄반응(PCR)은 온열 순환반응기(Perkin-Elmer, model 9600)에서 수행하였다. 반응 혼합액을 50㎕ 실리콘 튜브에 넣고 94℃에서 5분간 가열하였다. PCR 반응을 수행하였다. PCR 수행 후, 아가로즈 젤 전기영동으로 분리하여 반응물을 분리하고 이것을 TA 클로닝 벡터(Invitrogen, Sandiego, USA)에 연결(ligation)한 다음, 클로닝이 용이한 컴피턴트 세포(competent cell)에 형질변환시키고 형질변환된 박테리아로부터 플라스미드를 알칼리 용균법(alkaline lysis method)으로 분리하였다. 사람 FK506BP cDNA가 포함된 TA 벡터를 XhoⅠ과 BamHⅠ로 절단한 다음 PEP 발현 벡터에 삽입하였다. PEP-1-FK506BP로 형질변환된 E. coli BL21(DE3)를 선택한 다음, 콜로니를 100ml LB 배지에 접종하고 IPTG(0.5mM)를 배지 내에 첨가하여 재조합된 PEP-1-FK506BP 융합 단백질의 과대발현을 유도하였다. 과대발현된 PEP-1-FK506BP 융합 단백질은 SDS-PAGE와 웨스턴 블랏 분석으로 확인하였다.
상기 방법을 변형하여 FK506BP-PEP-1 융합 단백질 및 PEP-1-FK506BP-PEP-1 융합 단백질을 제조하였다.
<실시예 2: PEP-1-FK506BP 융합단백질의 발현 및 정제>
상기 실시예 1과 같이 제조한 인간 FK506BP cDNA가 PEP-1-FK506BP 형태로 포함되어 있는 E. coli BL21(DE3)세포를 암피실린이 포함된 LB 배지에 넣고 37℃에서 200rpm으로 교반하며 배양하였다. 배양액 내의 박테리아 농도가 O.D600 = 0.5～1.0을 나타낼 때 IPTG를 배지 내에 첨가하여 최종농도가 0.5와 1mM 되게 한 다음 30℃에서 12시간을 더 배양하였다. 배양한 세포를 원심분리하여 모은 뒤 5ml 결합완충액(5mM 이미다졸, 0.5M NaCl, 20mM Tris-HCl, pH 7.9)를 넣고 초음파 분쇄기로 분쇄(sonication)하였다. 원심분리하여 상층액을 즉시 Ni2+-니트릴로 트리아세틱 애시드 세파로즈 슈퍼 플로우(Ni2+-nitrilotriacetic acid sepharose super flow) 컬럼에 부하하고 10배 부피의 결합 완충액과 6배 부피의 세척 완충액(60mM 이미다졸, 0.5M NaCl, 20mM Tris-HCl, pH 7.9)으로 세척한 다음 용출 완충액(1M 이미다졸, 0.5M NaCl, 20mM Tris-HCl, pH 7.9)로 융합 단백질을 용출하였다. 이어, 융합 단백질이 포함된 분획들을 모아 PD-10 컬럼 크로마토그래피를 수행하여 분획 중에 포함된 염분을 제거하였다.
정제된 단백질 농도는 우혈청 알부민을 표준물질로 사용하여 브래드포드(Bradford) 방법으로 측정하였다.
상기 방법과 동일한 방법으로 FK506BP-PEP-1 융합 단백질 및 PEP-1-FK506BP-PEP-1 융합 단백질을 과대발현 및 정제하였다.
<실시예 3: Tat-FK506BP 융합 단백질 발현벡터의 제조 및 형질변환>
Tat-FK506BP 융합 단백질을 과다 발현시키기 위하여 FK506BP, HIV-1 Tat의 형질 도입부위(Tat49-57) 및 6개의 히스티딘에 대한 cDNA가 연속적으로 포함되어 있는 pET-Tat-FK506BP 발현 벡터를 제조하였다. 먼저, HIV-1 Tat의 기본 도메인(basic domain, 즉 아미노산 49-57)이 포함된 pET-Tat 발현벡터를 만들었다. Tat 기본 도메인에 해당하는 두 종류의 올리고뉴클레오타이드(상위 쇄(top strand), 5'-TAGGAAGAAGCGGAGACAGCGACGAAGAC-3'(서열번호 19); 하위 쇄(bottom strand), 5'-TCGAGTCTTCGTCGCTGTCTCCGCTTCTTCC-3'(서열번호 20))를 NdeI-XhoI 제한효소로 자른 pET15b에 결찰(ligation)하여 삽입하였다. 이어 인간 FK506BP의 cDNA의 서열을 기본으로 하여 2종류의 올리고뉴클레오타이드를 합성하였다. 정방향 프라이머(Forward primer)는 위 실시예 1의 서열번호 17로 Xho I 제한부위를 지니고 있으며 역방향 프라이머(reverse primer)는 위 실시예 1의 서열번호 18로 BamH I제한부위를 갖고 있다.
중합효소 연쇄반응(PCR)은 thermal cycler(Perkin-Elmer, model 9600)에서 수행하였으며, 반응 혼합액을 50 ㎕ 실리콘 튜브(siliconized reaction tube)에 넣고 94℃에서 5 분간 가열하였다. PCR 반응은 94℃에서 40초간 30회의 연장(extension), 54℃에서 1분간 변성(denaturation), 70℃에서 3분간 어닐링(annealing), 그리고 72℃에서 10분, 20℃에서 5분간 최종 연장(final extension)을 유도하였다. PCR 수행후 아가로즈 젤 전기이동(agarose gel electrophoresis)으로 분리하여 반응물을 분리하고 이것을 TA 클로닝 벡터(Invitrogen, Sandiego, USA)에 결찰하였다. 이어 이 벡터를 형질변환용 세포(competent cell)에 형질변환(transformation)시키고 형질변환된 박테리아로부터 플라스미드를 알칼리 용균 방법(alkaline lysis method)으로 분리하였다[Sambrook, J., Fritsch, F.E. and Maniatis, T(1989) Molecular cloning, Cold spring harbor laboratory press, Cold spring harbor]. 인간 FK506BP cDNA가 포함된 TA 벡터를Xho I과BamH I로 절단한 다음 pET-15b 및 pET-15b-Tat 발현 벡터에 삽입하였다. 벡터의 발현은 T7 프로모터와 lacO-오퍼레이터의 조절 하에 있다.
pET-Tat-FK506BP로 형질변환된 E. coli BL21(DE3)를 선택한 다음, 콜로니(colony)를 100ml LB 배지에 접종하고 IPTG (0.5 mM)를 배지 내에 첨가하여 과다 발현을 유도하였다. IPTG로 융합단백질의 과다 발현을 유도한 대장균 세포를 4℃에서 초음파처리(sonication)로 파쇄한 다음, 원심분리하여 상청액의 단백질을 15% SDS-폴리아크릴아미드 젤 전기이동방법으로 분리하였다. 과다 발현된 SOD와 Tat-SOD는 SDS-폴리아크릴아미드 젤 전기이동과 웨스턴 블랏 분석으로 확인하였다.
상기 방법을 변형하여 FK506BP-Tat 융합 단백질 및 Tat-FK506BP-Tat 융합 단백질을 제조하였다.
<실시예 4: Tat-FK506BP 융합 단백질 과다 발현 및 정제>
형질전환된 E. coli BL21을 앰피실린이 포함된 LB 배지에 넣고 37℃에서 200rpm으로 교반하며 배양하였다. 배양액 내의 박테리아 농도가 O.D 600 = 0.5∼1.0를 나타낼 때 IPTG를 배지 내에 첨가하여 최종농도가 0.5mM가 되게 한 다음 3시간을 더 배양하였다. 배양한 세포를 원심분리하여 모은 뒤 5ml 결합 완충용액(binding buffer; 5 mM 이미다졸, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9)을 넣고 초음파처리(sonication)하였다.
원심분리하여 상청액을 즉시 2.5 ml Ni 2+ -니트릴로트리아세틱 애시드 세파로즈 컬럼(nitrilotriacetic acid sepharose column)에 부하하고 10배 부피의 결합 완충용액과 6배 부피의 세척 완충액(washing buffer; 60mM 이미다졸, 0.5M NaCl, 20mM Tris-HCl, pH 7.9)으로 세척한 다음 용출 완충액(elution buffer; 1M 이미다졸, 0.5M NaCl, 20mM Tris-HCl, pH 7.9)로 융합단백질을 용출하였다. 이어 융합단백질이 포함된 분획들을 모아 세파덱스 G-15 컬럼 크로마토그래피를 수행하여 분획 중에 포함된 염분을 제거하였다. 융합단백질은 N-말단에 6개의 히스티딘을 포함하고 있기 때문에 고정 금속-킬레이트 친화 크로마토그래피(immobilized metal-chelate affinity chromatography) 단일 단계로 융합단백질을 거의 순수하게(순도 > 90%) 정제하였다. 분획의 단백질 농도는 우혈청 알부민을 표준물질로 사용하여 브래드포드(Bradford) 방법으로 측정하였다[Bradford, M.A. (1976) Anal. Biochem. 72, 248-254].
상기 방법과 동일한 방법으로 FK506BP-Tat 융합 단백질 및 Tat-FK506BP-Tat 융합 단백질을 과대발현 및 정제하였다.
<실시예 5: 시료 제조>
상기 실시예 2 및 4에서 정제된 각종 FK506BP 융합 단백질을 생리식염수에 5㎍/5㎕로 용해하여 이후 실험에 시료로 사용하였다.
실험예 1: 건조송풍 유발 안구건조 모델에서 스커머(Schirmer) 방법을 통한 눈물 분비량의 변화
1-1. 건조송풍 안구건조증 유발 동물 모델
실험동물 렛트에 외과용 칼로 각막 정중부에 0.4㎟의 외과적 상피 손상을 가한 다음 습도 25~30%, 2.4m/sec의 건조송풍에 노출시켜 안구건조증을 유발시켰다.
1-2. 눈물 분비량의 변화
눈물 분비량 변화 검사는 스커머(Schirmer) 방법 (cobalt chloride paper; Toyo Roshi Kaisha, Japan)에 따라 실시하였다. 일반적으로 페놀 레드 쓰레드(phenol red thread)를 이용한 스커머 시험법(Schirmer test)은 눈물 분비량의 변화를 측정하는 가장 일반적인 방법으로 알려져 있으며, 각막 건조증을 평가하는데 있어서 가장 기본적인 실험법으로 사용되고 있다(참조:Fujihara et al. 2001, Invest. Ophthalmol. Vis. Sci. 2001;42:96-100, Nakamura et al., Cornea 2004;23:390-7). 본 실시예에서는 1X15㎜의 코발트 클로라이드 페이퍼(cobalt chloride paper)를 사용하여, 건조 송풍 전후의 눈물 분비량의 변화를 관찰하였다.
안구건조증 유발 대조군에서는 정상 대조군에 비해 현저한 눈물 분비량의 감소가 일어났으며, 대조 약물인 히알루론산(Hyaluronate; Samil Pharm. Co., Seoul, Korea)과 비교할 때 본 발명의 FK506BP 융합 단백질을 가한 시험군에서 눈물 분비량의 감소가 억제되었다. 그 결과는 도 1 및 표 1에 정리되어 있다.
표 1
눈물 분비량(mm)
시험 전 시험 후 변화량
정상대조군 정상 8.86± 0.97 10.19± 0.70 1.33± 1.15
건조안구 9.02± 1.50 7.65± 0.72 -1.36± 1.43
약물대조군 히알루론산(Hyaluronate) 8.95± 0.84 9.43± 1.52 0.48± 1.16
시험군 FK506BP 융합 단백질 8.98± 0.88 10.78± 1.02 1.80± 1.38
실험예 2: 건조송풍 유발 안구건조 모델에서 안구결막의 조직병리학적 변화
건조 송풍 유발 안구건조 모델을 이용하여 약물을 투여하고 결막이 부착된 안구를 적출하여 PAS(Periodic acid-Schiff) 염색을 통하여 조직병리학적 관찰을 수행하였다.
안구건조증은 각막 및 결막 손상이 초래되며, 이러한 변화는 조직병리학적으로 쉽게 측정할 수 있다(참고; Nakamura et al., Invest. Ophthalmol. Vis. Sci. 2003;44:4682-8, Higuchi et al., Curr Eye Res 2007;32:83-8). 정상군에 비해 안구건조증 유발 대조군에서는 결막 상피의 국소적인 탈락과 점액 생산세포의 감소를 주요증상으로 하는 손상이 나타났으며, 결막 상피두께, 점액 생산세포의 수 및 비율의 유의성 있는 감소와 결막 상피 손상부위의 유의성 있는 증가가 각각 나타났다. 이러한 안구결막 손상은 안구건조증 유발 대조군에 비해 시험군인 FK506BP 융합 단백질 처리군에서 유의하게 억제되었다. 그 결과는 표 2와 도 2에 정리되어 있다.
표 2
결막 상피 두께 (㎛) 점액 생산세포
세포수(cells/mm epithelium) 범위(%of mm epithelium)
정상대조군 정상 113.21± 12.06 17.25± 3.15 40.03± 9.56
건조 안구 38.13± 10.26 4.00± 1.93 10.02± 5.35
약물대조군 히알루론산 63.22± 10.53 8.63± 2.26 22.19± 7.02
시험군 FK506BP 융합 단백질 103.53± 15.12 14.88± 2.36 35.01± 9.66
실험예 3: 건조송풍 유발 안구건조 모델에서 안구 각막의 세포사 멸(apoptosis) 변화
건조 송풍 유발 안구건조 모델을 이용하여 약물을 투여하고 안구를 적출하여 PARP{poly(ADP-ribose)polymerase}를 이용하여 각막 상피 세포사멸을 면역조직화학적으로 평가하였다.
PARP는 대표적인 세포사멸 마커로서(참고; Barrett et al., J Histochem Cytochem 2001;49:821-32) 각막 상피에서 PARP의 증가는 세포사멸에 의한 각막 상피의 손상 증가를 의미하고, 안구 건조증에 의한 안구손상 역시 세포사멸이 어느 정도 관여하는 것으로 알려져 있다(참고; Yeh et al., Invest. Ophthalmol. Vis. Sci. 2003;44:124-9).
안구건조증 유발 대조군에서는 정상군에 비해 세포사멸 마커인 PARP 면역반응성의 유의성 있는 증가가 관찰되었다. 대조 약물인 히알루론산(Hyaluronate)과 시험군인 FK506BP 융합 단백질 투여군은 비슷하게 안구 건조증 유발 대조군에 비해 유의하게 세포사멸이 감소되었다. 그 결과는 도 3에 정리되어 있다.
실험예 4: BTX-A 유발 안구건조 모델에서 안구 각막 손상정도
4-1. BTX-A 안구건조증 유발 동물 모델
BTX-A(botulinum toxin-A) 유발 마우스 안구건조 모델은 20mU의 BTX-A를 눈물샘에 경결막(transconjunctival) 루트로 주사하여 눈물샘 안와엽(lacrimal gland orbital lobe)의 눈물 분비부분(tear-secreting portion)에 BTX-A가 주입되게 하여 안구건조증을 유발시켰다.
4-2. 각막 형광염료 투과율의 변화
BTX-A 유발 안구건조증 모델은 FK506BP 융합 단백질의 안구건조증 효능검사를 위해 형광염료(fluorescein sodium salt, Sigma Co., USA)를 이용하여 각막 손상정도를 관찰하였다.
형광염료의 각막침투 정도는 각막의 투과성을 평가하는 가장 일반적인 방법으로 투과도의 증가는 각막의 손상의 증가를 의미하는 것으로 알려져 있으며 (참고; Yokoi & Kinoshita, Cornea 1995;14:485-9, Nakamura et al., Invest. Ophthalmol. Vis. Sci. 2003;44:4682-8, Nakamura et al., Invest. Ophthalmol. Vis. Sci. 2005;46:2379-87, Steinfeld et al., Br. J. Ophthalmol 2004;88:48-53), 각막에 형광염료가 침착되거나 투과되어 침습된 손상부위를 쉽게 확인할 수 있다(참고; Koh et al., Am J Ophthalmol 2003;136:513-9).
안구건조증 유발군에서는 정상군에 비해 각막 투과율을 나타내는 안구 형광성이 크게 증가하였다. 시험군은 FK506BP 단백질과 FK506BP 융합 단백질로 나누어 실험하였으며, FK506BP 융합 단백질군이 FK506BP 단백질군에 비해 유의하게 형광 투과율이 감소하였다. 그 결과는 도 4에 정리되어 있다.
실험예 5: FK506BP 융합 단백질의 렛트 단회 정맥투여독성 실험
신규한 안구건조증 치료물질 FK506BP 융합 단백질의 렛트 단회 정맥투여독성 실험을 위해서 유효용량인 0.1% 용액 총 6번 점안량에 해당하는 0.01mg/kg으로 계산한 후 500배에 해당하는 5mg/kg을 고용량군으로 설정하고, 2.5mg/kg을 저용량군으로 설정하여 독성실험을 실시하였다. 각 실험군은 각각 5마리씩 실험하였다.
주 독성 관찰은 사망률, 임상증상, 체중변화, 부검소견, 장기중량, 조직병리학적 변화 등이었으며, 장기관찰은 폐, 심장, 가슴샘, 신장, 부신, 비장, 정소/난소, 간, 췌장, 뇌, 부고환/자궁, 악하 임파절, 방광, 전립샘 및 투여부위인 미정맥등 17부위였다.
실험 결과 FK506BP 융합 단백질은 저용량군 및 고용량군 모두에서 사망례가 나타나지 않았으며, 약물 투여에 따른 임상증상, 체중, 장기중량, 육안 및 조직학적 이상소견이 나타나지 않아 점안시 매우 안전할 것으로 판단되었다.
* 제형예 1
상기 실시예에서 제조한 FK506BP 융합 단백질을 포함하는 점안액 조성물을 표 3과 같이 제조하였다.
표 3
조성성분 함량(mg)
주성분 PEP-1-FK506BP 5
pH조절제 염산 적량
수산화나트륨 적량
등장화제 염화나트륨 700
염화칼륨 150
완충제 아미노카프론산 200
안정제 에테트산나트륨 10
용제 멸균정제수 적량
총량 100ml
제형예 2
상기 실시예에서 제조한 FK506BP 융합 단백질을 포함하는 점안액 조성물을 표 4와 같이 제조하였다.
표 4
조성성분 함량(mg)
주성분 FK506BP-Tat 5
pH조절제 염산 적량
수산화나트륨 적량
등장화제 염화나트륨 700
염화칼륨 150
완충제 아미노카프론산 200
안정제 에테트산나트륨 10
보존제 염화벤잘코늄 30
용제 멸균정제수 적량
총량 100ml
본 발명에 따른 FK506BP 융합 단백질은 안과 질환에 대한 단백질 치료제로서 사용 가능하다.
본 발명에 첨부된 서열은 프라이머 서열과, 단백질 수송 도메인 서열 및 단백질 수송 도메인과 결합한 융합 단백질 서열이다.

Claims (4)

  1. FK506 결합단백질의 N-말단 및 C-말단 중 한 군데 이상에 단백질 수송 도메인이 공유결합된 융합 단백질을 함유하는 안과 질환 예방 및 치료용 점안제 조성물.
  2. 청구항 1에 있어서,
    상기 단백질 수송 도메인은
    a) 15∼30개의 아미노산으로 구성되고, 5개 이상의 트립토판을 포함하는 비친수성 도메인(hydrophobic domain), 라이신을 4개 이상 다수 포함하는 친수성 도메인(hydrophilic domain) 및 상기 두 도메인을 분리시켜 주는 스페이서(spacer)로 구성된 단백질 수송 도메인,
    b) 6 내지 12개의 아미노산 잔기로 구성되며 아르기닌 또는 라이신 잔기를 3/4 이상 포함하는 단백질 수송 도메인,
    c) 6 내지 12개의 라이신으로 구성되는 올리고라이신 단백질 수송 도메인,
    d) 6 내지 12개의 아르기닌으로 구성되는 올리고아르기닌 단백질 수송 도메인 및
    e) 6 내지 12개의 라이신 또는 아르기닌으로 구성되는 올리고(라이신,아르기닌) 단백질 수송 도메인 중 선택된 1종 이상임을 특징으로 하는 조성물.
  3. 청구항 1에 있어서,
    상기 융합 단백질은 서열번호 4, 서열번호 6, 서열번호 8, 서열번호 10, 서열번호 12 및 서열번호 14 중 선택된 1종인 것을 특징으로 하는 조성물.
  4. 청구항 1에 있어서,
    상기 안과 질환은 스티븐슨-존슨 증후군, 쇼그렌 증후군, 안구건조 증후군, 외상, 안구 수술에 의한 안구 외상, 포도막염(감염성 또는 비감염성), 각막 이식수술 후 면역거부반응 또는 하드 콘택즈 렌즈 착용에 의한 외인성 질환에 의한 각결막 상피 장해임을 특징으로 하는 조성물.
PCT/KR2011/002393 2011-02-15 2011-04-06 Ｆｋ506 결합 단백질 융합 단백질을 함유하는 안과 질환 예방 및 치료용 점안제 조성물 WO2012111877A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US13/985,845 US8962567B2 (en) 2011-02-15 2011-04-06 Eye drop composition for prevention and treatment of ophthalmic diseases containing fusion protein of FK506 binding protein

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2011-0013166 2011-02-15
KR1020110013166A KR101214362B1 (ko) 2011-02-15 2011-02-15 Ｆｋ506 결합 단백질 융합 단백질을 함유하는 안과 질환 예방 및 치료용 점안제 조성물

Publications (1)

Publication Number Publication Date
WO2012111877A1 true WO2012111877A1 (ko) 2012-08-23

Family

ID=46672771

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/002393 WO2012111877A1 (ko) 2011-02-15 2011-04-06 Ｆｋ506 결합 단백질 융합 단백질을 함유하는 안과 질환 예방 및 치료용 점안제 조성물

Country Status (3)

Country Link
US (1) US8962567B2 (ko)
KR (1) KR101214362B1 (ko)
WO (1) WO2012111877A1 (ko)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010138555A2 (en) 2009-05-26 2010-12-02 University Of Florida Research Foundation, Inc. Small peptide expression system in mammalian cells
KR20140108411A (ko) * 2013-02-27 2014-09-11 한림대학교 산학협력단 Ｆｋ506 결합 단백질 융합 단백질을 함유하는 관절염 예방 및 치료용 약학 조성물
CA2940513C (en) 2013-03-11 2023-08-15 University Of Florida Research Foundation, Inc. Delivery of card protein as therapy for ocular inflammation
US11053291B2 (en) 2014-02-19 2021-07-06 University Of Florida Research Foundation, Incorporated Delivery of Nrf2 as therapy for protection against reactive oxygen species
EP3116898B1 (en) * 2014-03-11 2022-01-26 University of Florida Research Foundation, Inc. Aav-expressed m013 protein as an anti-inflammatroy therapeutic for use in a method of treating inflammatory ocular disease
KR102433799B1 (ko) * 2020-04-21 2022-08-19 한림제약(주) 세포 침투성 펩타이드와 fkbp12를 포함하는 융합 단백질 및 이의 용도

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030228299A1 (en) * 2001-06-07 2003-12-11 Marie-Therese Droy-Lefaix Use of antioxidant for treating and/or preventing surface ocular disorders
KR20040075236A (ko) * 2003-02-20 2004-08-27 최진희 세포투과성 수송도메인 융합단백질과 그 용도
US20060258698A1 (en) * 2005-02-09 2006-11-16 Sreenivasu Mudumba Liquid formulations for treatment of diseases or conditions
KR100787393B1 (ko) * 2006-03-23 2007-12-21 학교법인 한림대학교 세포 도입성 ｆｋ506 결합 단백질의 융합 단백질

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100490362B1 (ko) 2000-07-26 2005-05-17 학교법인 한림대학교 올리고라이신 수송 도메인, 올리고라이신-화물분자 복합체및 그 용도
KR100472938B1 (ko) 2002-10-31 2005-03-11 학교법인 한림대학교 세포침투 효율을 향상시킨 수송도메인-목표단백질-수송도메인 융합단백질 및 그 용도

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030228299A1 (en) * 2001-06-07 2003-12-11 Marie-Therese Droy-Lefaix Use of antioxidant for treating and/or preventing surface ocular disorders
KR20040075236A (ko) * 2003-02-20 2004-08-27 최진희 세포투과성 수송도메인 융합단백질과 그 용도
US20060258698A1 (en) * 2005-02-09 2006-11-16 Sreenivasu Mudumba Liquid formulations for treatment of diseases or conditions
KR100787393B1 (ko) * 2006-03-23 2007-12-21 학교법인 한림대학교 세포 도입성 ｆｋ506 결합 단백질의 융합 단백질

Also Published As

Publication number Publication date
KR101214362B1 (ko) 2012-12-21
US20130330368A1 (en) 2013-12-12
US8962567B2 (en) 2015-02-24
KR20120093540A (ko) 2012-08-23

Similar Documents

Publication Publication Date Title
US20120315256A1 (en) Use of transforming growth factor - beta 1 (tgf-b1) inhibitor peptides for the treatment of corneal fibrosis and/or haze
WO2012111877A1 (ko) Ｆｋ506 결합 단백질 융합 단백질을 함유하는 안과 질환 예방 및 치료용 점안제 조성물
US11759499B2 (en) Compositions and methods for prevention and treatment of corneal haze and scarring
US10059742B2 (en) Peptides and methods and uses thereof for preventing retinal disorders
US10010586B2 (en) Method of treating intraocular tissue pathologies with nerve growth factor
KR20080031195A (ko) 각결막 질환의 예방 또는 치료제
WO2012111878A1 (ko) 수퍼옥사이드 디스뮤테이즈 융합 단백질을 함유하는 안과 질환 예방 또는 치료용 약제학적 조성물
EP3448388B1 (en) Dipeptidyl peptidase-4 inhibitors for topical eye treatment of retinal neurodegenerative diseases
KR101906494B1 (ko) 콜라겐 타입 ι 및 색소 상피성 인자 펩타이드를 유효성분으로 함유하는 신생혈관질환 예방 또는 치료용 약학조성물
KR20220063190A (ko) 안과 장애의 치료 또는 예방에 사용하기 위한 제제
KR20130143484A (ko) 변형된 인간 종양 괴사 인자 수용체-1 폴리펩티드의 신규 용도
JP5851692B2 (ja) 網膜神経節ニューロン変性を予防又は治療するためのビコイドファミリーのホメオタンパク質の使用
KR102646717B1 (ko) 세포 침투성 펩타이드와 fkbp12를 포함하는 융합 단백질 및 이의 용도
KR102653532B1 (ko) 수퍼옥시드 디스뮤타제 및 이의 건성안의 예방 또는 치료용 용도
KR102593195B1 (ko) 수퍼옥시드 디스뮤타제 및 이의 건성안의 예방 또는 치료용 용도
KR20230099595A (ko) 수퍼옥시드 디스뮤타제 및 이의 건성안의 예방 또는 치료용 용도
KR20050011350A (ko) 인간 인테그린 결합 단백질 또는 펩타이드를 유효성분으로하는 안질환 치료제
WO2001064242A1 (fr) Medicaments ameliorant la fonction retinienne

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11858491

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 13985845

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11858491

Country of ref document: EP

Kind code of ref document: A1