WO2023120828A1 - 수퍼옥시드 디스뮤타제 및 이의 건성 황반변성의 예방 또는 치료용 용도 - Google Patents

수퍼옥시드 디스뮤타제 및 이의 건성 황반변성의 예방 또는 치료용 용도 Download PDF

Info

Publication number
WO2023120828A1
WO2023120828A1 PCT/KR2022/007001 KR2022007001W WO2023120828A1 WO 2023120828 A1 WO2023120828 A1 WO 2023120828A1 KR 2022007001 W KR2022007001 W KR 2022007001W WO 2023120828 A1 WO2023120828 A1 WO 2023120828A1
Authority
WO
WIPO (PCT)
Prior art keywords
sod
macular degeneration
superoxide dismutase
pharmaceutical composition
strain
Prior art date
Application number
PCT/KR2022/007001
Other languages
English (en)
French (fr)
Inventor
반재구
김의중
장인익
김정현
Original Assignee
주식회사 제노포커스
주식회사 바이옴로직
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 제노포커스, 주식회사 바이옴로직 filed Critical 주식회사 제노포커스
Publication of WO2023120828A1 publication Critical patent/WO2023120828A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/189—Enzymes
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17—Amino acids, peptides or proteins
    • A23L33/195—Proteins from microorganisms
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/44—Oxidoreductases (1)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A61P27/04—Artificial tears; Irrigation solutions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)

Definitions

  • the present invention relates to superoxide dismutase and its use for preventing, ameliorating or treating dry age-related macular degeneration. More specifically, the present invention relates to a superoxide dismutase, composition or method for preventing, treating or ameliorating dry macular degeneration.
  • Macular degeneration also referred to as Age-related Macular Degeneration (“AMD”), refers to a chronic progressive degenerative disease of the macula, resulting in loss of central vision. Macular degeneration is the leading cause of vision loss and irreversible central vision loss in adults over 50 years of age. Worldwide, 25 million patients suffer from macular degeneration, and the number of patients with macular degeneration continues to increase rapidly due to the rapid growth of the aging population. In addition, excessive use of electronic devices such as smartphones and laptops causes early onset and increased prevalence of macular degeneration in modern people.
  • the most common cause of macular degeneration is age-related atrophy and deterioration of the retinal pigment epithelium (RPE).
  • the retinal pigment epithelium plays an important role in maintaining retinal homeostasis and physiological functions, which play a key role in visual function.
  • age-related abnormal changes in Bruch's membrane and degeneration of choroidal capillaries are also thought to contribute to the pathogenesis of macular degeneration.
  • Bruch's membrane serves as the basement membrane of the RPE, while choroidal capillaries are located at the outermost part of the sensory nerve retina and supply nutrients and oxygen to the photoreceptor cells where light conversion occurs.
  • Macular degeneration can be broadly classified into two types: wet and dry.
  • the dry type accounts for 85 to 90% of cases diagnosed with macular degeneration, and the wet type also starts from the dry type.
  • the main features of dry macular degeneration are medium-sized or larger yellow deposits called drusen present under the retinal pigment epithelium, pigmentary abnormalities of the retinal pigment epithelium, and reticular pseudodrusen present under the retina. It is a deposit called pseudodrusen).
  • Drusen production is a typical feature of dry macular degeneration, and large numbers of medium-sized drusen and large-sized drusen are known risk factors for progression to late-stage macular degeneration. In addition, drusen size and density correlate with loss of choriocapillaris.
  • Dry macular degeneration usually progresses slowly and may progress to geographic atrophy (GA) at the end.
  • GA geographic atrophy
  • irreversible degeneration of the retinal pigment epithelium occurs confluently or sporadically, damaging photoreceptors and, if continued, leading to loss of vision.
  • geographic atrophy is a major factor in age-related visual impairment, there are currently no approved treatment methods or therapeutic drugs that can delay or inhibit the progression of dry macular degeneration.
  • wet macular degeneration In wet macular degeneration, another type of terminal macular degeneration, immature blood vessels form from the choroid toward the retina, leaking blood or body fluid, damaging photoreceptors and their connected nerve cells, and eventually causing loss of central vision. Wet macular degeneration progresses faster than the dry type and can lead to blindness within months if left untreated.
  • a treatment method of stopping the angiogenesis process by injecting an anti-VEGF agent into the eye to suppress abnormally generated VEGF has been developed.
  • the object of the present invention is to solve the problems of the prior art described above.
  • Another object of the present invention is to provide a superoxide dismutase for preventing, improving or treating dry macular degeneration.
  • Another object of the present invention is to provide a pharmaceutical composition or treatment method for preventing or treating dry macular degeneration.
  • Another object of the present invention is to provide a food or feed composition for preventing or improving dry macular degeneration.
  • Another object of the present invention is to provide a pharmaceutical composition or treatment method for preventing or treating dry macular degeneration by reducing or eliminating drusen formation or drusenoid lesions.
  • Another object of the present invention is to provide a food or feed composition that prevents or improves dry macular degeneration by reducing or eliminating drusen formation or drusenic lesions.
  • an improved superoxide dismutase (SOD) exhibiting preventive, ameliorative or therapeutic effects on dry macular degeneration is provided.
  • GRAS superoxide dismutase from a generally regarded as safe (GRAS) bacterium such as Bacillus for the prevention, amelioration or treatment of dry macular degeneration.
  • a superoxide dismutase derived from Bacillus amyloliquefaciens that secures oral administration efficacy and safety for the prevention, improvement or treatment of dry macular degeneration.
  • a superoxide dismutase derived from Bacillus or Bacillus amyloliquefaciens that is conveniently produced and secreted extracellularly for the prevention or treatment of dry macular degeneration is provided.
  • a pharmaceutical composition for preventing or treating dry macular degeneration comprising the superoxide dismutase (SOD) as an active ingredient.
  • SOD superoxide dismutase
  • a food or feed composition for improving or preventing dry macular degeneration containing the superoxide dismutase as an active ingredient is provided.
  • a method for preventing, improving or treating dry macular degeneration comprising administering the superoxide dismutase to a subject.
  • the use of the superoxide dismutase for preparing a medicament for preventing or treating dry macular degeneration is provided.
  • An expression vector comprising the sequence or a cell line transformed with the expression vector is provided.
  • Bacillus species strain comprising the above polynucleotide sequence and having a partial gene deletion is provided.
  • the superoxide dismutase, composition and method according to the present invention can be effectively used to prevent, ameliorate or treat dry macular degeneration by reducing or preventing drusen formation and/or drusenic lesions.
  • the superoxide dismutase according to the present invention is effective in preventing or treating dry macular degeneration when administered orally.
  • the superoxide dismutase according to the present invention is derived from Bacillus or Bacillus amyloliquefaciens, which is a generally regarded as safe (GRAS) bacterium, so that oral administration efficacy and safety are secured, as well as when cultured. Production advantages of direct recovery from the supernatant can also be taken.
  • GRAS Bacillus amyloliquefaciens
  • Effective ingredients for reducing or preventing lesions can be effectively produced.
  • Example 1 shows a schematic diagram for double crossover recombination performed in Example 1.1.
  • Figure 2 shows the results of confirming the defective gene using PCR in the expression host GFBS220 and the production strain BSBA310.
  • W represents wild-type B. subtilis KCTC 3135
  • 220 represents expression host GFBS220
  • 310 represents SodA2 production strain BSBA310.
  • Figure 3 shows the amino acid sequence of SodA (Mn-SOD identified through N-terminal sequencing in the culture supernatant of Bacillus amyloliquesfaciens strain GF423) and superoxide dismutase (SodA2) of the present invention. was compared.
  • Figure 4 shows an expression vector for overexpression of the sodA2 gene.
  • rrnB T1T2 represents a transcription terminator
  • rep(pBR322) represents the replicon from pBR322 that works in E. coli
  • rep(pUB110) is a replicon from pUB110 that works in B. subtilis
  • Kan R represents kanamycin resistance gene (aminoglycoside O-nucleotidyltransferase)
  • the BJ27 promoter represents a strong promoter for B. subtilis .
  • Figure 5 shows the overall procedure for making production strain BSBA310.
  • Figure 6 shows the criteria for measuring clinical outcome used in the examples of the present invention.
  • Figure 7 shows the change from baseline in the total area of drusenic lesions according to an embodiment of the present invention. Compared to the area change in the vehicle group, *p ⁇ 0.05.
  • Figure 8 shows the change from baseline in the size of the largest drusenic lesion according to an embodiment of the present invention.
  • 9a and 9b show blood biochemistry results performed in an embodiment of the present invention.
  • 10A to 10C show blood hematology results performed in an embodiment of the present invention.
  • subject is used interchangeably with “patient,” and is a mammal, such as a primate (eg, human), companion animal (eg, dog, cat, etc.), livestock in need of prevention or treatment of dry macular degeneration. animals (eg, cows, pigs, horses, sheep, goats, etc.) and laboratory animals (eg, rat mice, guinea pigs, etc.). In one embodiment of the invention, the subject is a human.
  • primate eg, human
  • companion animal eg, dog, cat, etc.
  • livestock in need of prevention or treatment of dry macular degeneration.
  • animals eg, cows, pigs, horses, sheep, goats, etc.
  • laboratory animals eg, rat mice, guinea pigs, etc.
  • the subject is a human.
  • treatment includes prophylactic and/or therapeutic treatment.
  • the prophylactic and/or therapeutic treatment includes all types of treatment recognized in the art and includes, for example, administering the pharmaceutical composition or SOD of the present invention to a subject. If administered prior to clinical signs of an undesirable or undesirable condition (e.g., a disease or other undesirable or undesirable condition of a subject), such treatment or treatment is a prophylactic treatment or treatment (e.g., an undesirable or undesirable condition of a subject). to protect the subject from progressing the state). On the other hand, if administered after clinical signs of an undesirable or undesirable condition, such treatment or treatment is therapeutic, such as reducing, alleviating or stabilizing an existing undesirable or undesirable condition or its side effects.
  • prevention When used in connection with a medical condition such as dry macular degeneration, administering a pharmaceutical composition or SOD of the present invention reduces the incidence or incidence of the medical condition (eg, blurred vision or vision loss) compared to subjects not receiving it. and delaying symptoms.
  • a medical condition such as dry macular degeneration
  • administering a pharmaceutical composition or SOD of the present invention reduces the incidence or incidence of the medical condition (eg, blurred vision or vision loss) compared to subjects not receiving it. and delaying symptoms.
  • administration means providing an active ingredient to achieve a prophylactic or therapeutic purpose (eg, prevention or treatment of dry macular degeneration) to a subject.
  • the present invention is based, at least in part, on the discovery that administration of superoxide dismutase (SOD), particularly oral administration, is effective in preventing or treating dry macular degeneration. Therefore, according to one aspect of the present invention, use of SOD for preventing or treating dry macular degeneration is provided.
  • SOD superoxide dismutase
  • dry macular degeneration is used interchangeably with “dry age-related macular degeneration”. This includes all early, intermediate and advanced dry macular degeneration.
  • the dry macular degeneration is characterized by drusen or drusenoid lesions.
  • drusen refers to a product of accumulation of waste products in the retina with increasing age between the RPE cells and Bruch's membrane or inside the Bruch's membrane (B). Drusen production is a hallmark of the dry type of AMD, and multiple medium-sized and large-sized drusen are known risk factors for progression to late-stage macular degeneration. In addition, drusen size and density correlate with loss of choriocapillaris.
  • drusen lesion refers to a lesion caused by drusen.
  • the SOD of the present invention can effectively prevent, ameliorate, or treat dry macular degeneration by reducing drusen or drusen-like lesions or preventing their formation.
  • the present inventors conducted an animal test using a rhesus monkey, not a mouse, as an animal model for generating drusen having a position and composition similar to that of humans.
  • the reason is that there is no evidence that the light-induced oxidative stress model affects retinal function in normal mice rather than transgenic mice (P. Sicard, et. al., "Dietary Superoxide Dismutase Protects Against Light- Induced Retinal Oxidative Stress in Young Senescence Accelerated Mice (SAM,” Invest Ophthalmol Vis Sci 2006;47: E-Abstract 2089)), and the drusen characteristic of dry AMD is not produced (Hema L. Ramkumar, et. al.
  • an improved superoxide dismutase (SOD) exhibiting preventive, ameliorative or therapeutic effects of dry macular degeneration is provided.
  • Superoxide dismutase is an enzyme that alternately catalyzes the dismutation of superoxide (O 2 ⁇ -) radicals into ordinary molecular oxygen (O 2 ) and hydrogen peroxide (H 2 O 2 ).
  • SOD plays an important role in reducing oxidative stress by scavenging reactive oxygen species.
  • SODs are widely distributed in prokaryotic and eukaryotic cells and are classified into four classes according to the different types of metal centers (copper/zinc, nickel, manganese, and iron).
  • Manganese-containing SOD [Mn-SOD] is widely present in the chloroplasts, mitochondria, and cytoplasm of several bacterial and eukaryotic cells.
  • the term "SOD” can be used interchangeably with a polypeptide having superoxide dismutase activity.
  • the SOD may bind to manganese (Mn-SOD).
  • the SOD may be deamidated Mn-SOD.
  • the SOD may be one in which amino acid residues at positions 73 and 136 of SEQ ID NO: 2 are substituted with Asp.
  • the SOD may include or consist of the amino acid sequence represented by SEQ ID NO: 4.
  • the SOD or polypeptide having SOD activity of the present invention also includes an amino acid sequence showing substantial identity to the above amino acid sequence.
  • the substantial identity is 80% or more, preferably 90% or more, more preferably 95% or more, and most preferably 98% or more when the aligned sequences are analyzed using an algorithm commonly used in the art. Means an amino acid sequence that exhibits identity.
  • the SOD is a modified or engineered polypeptide having SOD enzymatic activity that does not affect or affect various aspects (in vivo, in vitro or ex vivo stability, uniformity, and/or morphological alteration). may include one or more mutations, such as deletions, insertions or substitutions of one or more amino acids.
  • the polypeptide may further include a heterologous material (e.g., a tag known in the art including HIS tag, Ha tag, myc tag, GFC and/or Fc domain of an antibody) for purification, detection, or increased stability. there is.
  • SOD may be derived from natural or recombinant microorganisms, and may be enzymes prepared through isolation or purification from various sources.
  • the SOD may be derived from natural or recombinant microorganisms.
  • SOD is derived from bacteria.
  • the SOD is sourced from bacteria generally regarded as safe (GRAS) for use in drugs or foods.
  • GRAS bacteria generally regarded as safe
  • the SOD may be derived from a Bacillus species strain.
  • the SOD may be derived from a Bacillus amyloliquefaciens strain.
  • the SOD may be derived from Bacillus amyloliquefaciens GF423 strain (KCTC 13222 BP).
  • the GF423 strain (KCTC 13222 BP) was deposited with the Korea Research Institute of Bioscience and Biotechnology on March 6, 2017.
  • the SOD may be derived from a recombinant strain containing the expression vector shown in FIG. 4 .
  • the SOD may be derived from a recombinant strain prepared by a method including the method shown in FIG. 5 .
  • the recombinant strain may be a Bacillus strain containing a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 4 and having the following genes deleted: AprE, NprE, Bpr, Epr, NprB, Vpr, Mpr, IspA, SrfAC, spoIIAc, EpsE and Xpf . See Example 1 for detailed procedures for the preparation of the strain.
  • SOD derived from the strain is an enzyme secreted outside the cell, when manufacturing SOD using the strain, SOD that is safe for humans can be produced in large quantities without going through an expensive purification process (eg, column purification). Since it can be produced, efficient production is possible.
  • SOD can be isolated or purified from a variety of sources, including natural or recombinant hosts.
  • SOD having an activity to prevent or treat dry macular degeneration can be extracted from a culture supernatant of Bacillus amyloliquefaciens strain GF423.
  • a culture medium can be obtained by first culturing the Bacillus amyloliquefaciens strain GF423 in various types of media. For example, the strain is grown at about 25° C. to about 42° C. for about 1 day to about 4 days using a complex medium (pH 6.0 to 7.0).
  • LB medium Luria-Bertani (LB) medium, International Streptomyces Project (ISP) medium, nutrient agar (NA) medium, brain heart infusion agar (BHI) medium, SDA ( sabouraud dextrose agar) medium, PDA (potato dextrose agar) medium, NB (nutrient broth) medium, and the like.
  • LB medium, ISP medium, BHI medium, SDA medium, or NB medium may be used.
  • SOD can also be sourced from other natural or recombinant hosts using information provided in databases such as PubMed or BRENDA (brenda-enzymes.org on the World Wide Web).
  • the SOD may be an isolated or purified enzyme.
  • the isolated or purified SOD or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which it was derived.
  • the purified product may be a pure product separated from a strain culture through ultrafiltration, ammonium sulfate treatment, column purification, concentration, or the like, or a culture concentrate obtained through ultrafiltration, concentration, or the like.
  • substantially free of cellular material includes preparations of the protein in which the protein is isolated from cellular components of the cell from which the protein is isolated or recombinantly produced.
  • the phrase “substantially free of cellular material” means less than about 30%, preferably less than about 20%, more preferably less than about 10%, and most preferably less than about 10% by dry weight of unwanted proteins. Preferably it includes preparations of less than about 5% protein.
  • SOD may be preferably purified by the following purification method, but is not limited thereto.
  • the culture solution obtained by culturing the Bacillus amyloliquefaciens strain GF423 is centrifuged to collect the culture supernatant.
  • the supernatant fraction is pretreated by solid phase extraction and then isolated and purified by chromatography.
  • SOD may be purified using various methods of chromatography. Preferably, hydrophobic interaction chromatography is used.
  • the SOD may be included in the form of a strain lysate, a strain culture solution, a strain culture concentrate, a strain culture extract, or a dry form thereof.
  • the "strain lysate” may be obtained by culturing the strain and mechanically or chemically disrupting it.
  • strain culture medium may refer to the culture medium itself obtained by culturing the strain or a supernatant thereof.
  • strain culture concentrate refers to a culture concentrate obtained through ultrafiltration, ammonium sulfate treatment, column purification, concentration, or the like, or ultrafiltration, concentration, etc., from a strain culture.
  • strain culture extract refers to an extract obtained from the culture medium or a concentrate thereof, and may include an extract, a dilution or concentrate of the extract, a dried product obtained by drying the extract, or a crude or purified product thereof, or a fraction thereof.
  • the dried form may include a freeze-dried form.
  • the SOD of the present invention can reduce drusen or drusenic lesions or prevent their formation and/or effectively prevent, ameliorate or treat dry macular degeneration.
  • the SOD of the present invention is useful for preventing, improving or treating dry macular degeneration characterized by drusen or drusen-like lesions.
  • a pharmaceutical composition for treating or preventing dry macular degeneration containing superoxide dismutase (SOD) as an active ingredient is provided.
  • SOD superoxide dismutase
  • the pharmaceutical composition can reduce drusen or drusenic lesions or prevent their formation.
  • the SOD according to the present invention may be combined with a pharmaceutically acceptable carrier, excipient and/or diluent to form a pharmaceutical composition for preventing or treating dry macular degeneration.
  • a pharmaceutically acceptable carrier for preventing or treating dry macular degeneration.
  • the pharmaceutical composition of the present invention may be used interchangeably with the term veterinary composition when applied to animals other than humans.
  • the pharmaceutical or veterinary composition of the present invention may further include a pharmaceutically acceptable carrier, excipient and/or diluent.
  • the pharmaceutically acceptable carrier, excipient and/or diluent may be one commonly used in the art.
  • Carriers, excipients or diluents include, for example, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginates, gelatin, calcium phosphate, calcium silicate, cellulose, methyl Mineral oils such as cellulose, hydroxypropyl methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and silicon dioxide, etc. It may include, but is not limited thereto.
  • additives such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants.
  • Additives for the formulation may be selected from those commonly used in the pharmaceutical field.
  • the pharmaceutical or veterinary composition of the present invention may be formulated in a preferred form depending on the method of use, and particularly known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal. It can be formulated by adopting a method. Specific examples of such formulations include tablets, pills, powders, granules, syrups, solutions, capsules, suspensions, emulsions, injection solutions, plasters, lotions, liniments, limonade, aerosols, and extracts. There are extracts, elixirs, ointments, fluid extracts, infusions, creams, soft or hard gelatin capsules, and patches.
  • compositions of the present invention can be prepared using a suitable method known in the art or using a method disclosed in Remington's Pharmaceutical Science (latest edition), Mack Publishing Company, Easton PA). can be formulated accordingly.
  • the SOD can be administered orally or parenterally.
  • SOD may be coated with shellac for protection from gastric acid, but the coating agent is not limited thereto.
  • coatings suitable for use in the present invention include shellac, ethyl cellulose, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose phthalate, zein, Eudragit, and combinations thereof.
  • SOD may be coated in solution. Specifically, the purified solution and the shellac-containing solution are mixed and then freeze-dried. This lyophilized sample can be made into a powder and stored at about 4°C until use.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in a complex composition, for example, starch, calcium carbonate, sucrose, lactose, gelatin, etc. It can be prepared by mixing. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used.
  • Liquid preparations for oral administration include suspensions, internal solutions, emulsions, syrups, etc., and various excipients such as wetting agents, sweeteners, aromatics, and preservatives in addition to water and liquid paraffin, which are commonly used simple diluents. can be used
  • intraocular administration including sublingual administration, intravitreal administration, nasal spray, external skin application, patch, intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, intramuscular injection or intrathoracic injection You can choose.
  • the pharmaceutical or veterinary composition of the present invention is administered in a pharmaceutically or veterinarily effective amount.
  • pharmaceutically effective amount or “veterinarily effective amount” means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical or veterinary treatment, and the effective dose level is the level of the patient or animal. Weight, gender, age, health condition, severity, activity of drug, sensitivity to drug, time of administration, route of administration and rate of excretion, duration of treatment, factors including concomitantly used drugs, and other factors well known in the medical field. can
  • the pharmaceutical or veterinary composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously.
  • the pharmaceutical composition may be administered single or multiple times as needed. Considering all of the above factors, it is important to administer an amount that can obtain the maximum effect with the minimum amount without side effects, and this amount can be easily determined by a person skilled in the art.
  • a method for treating or preventing dry macular degeneration comprising administering an SOD or pharmaceutical composition according to the present invention to a subject having or at risk of dry macular degeneration.
  • the SOD, dry macular degeneration, treatment or prevention is as described above with respect to the pharmaceutical composition.
  • administration includes any of a variety of administrations that effect a desired action to enable treatment.
  • the administration may include oral or parenteral administration.
  • the route of administration may be oral, parenteral, inhalational, topical or topical administration (eg intralesional administration).
  • parenteral administration may include intravenous, subcutaneous, intraperitoneal, intraarterial, or intraocular administration, but is not limited thereto.
  • SOD may be administered in a form coated with a coating agent such as shellac.
  • an effective or effective non-toxic amount of SOD according to the present invention can be determined by routine experimentation.
  • the therapeutically active amount of an SOD of the present invention may vary depending on factors such as disease stage, severity of disease, age, sex, medical complication, and body weight of the subject.
  • Dosages and dosing regimens of the SODs of the present invention can be adjusted to provide the optimal therapeutic response. For example, several divided doses can be administered daily, weekly, every 2 weeks, every 3 weeks, every 4 weeks, etc., and/or the dose can be proportionally reduced or increased according to the exigencies of the therapeutic situation.
  • the method may include administering one or more additional agents to treat or prevent dry macular degeneration.
  • the one or more additional agents may be administered simultaneously with the SOD or pharmaceutical composition, sequentially or in reverse order.
  • individual components may be administered to a subject by the same or different routes.
  • a food composition for improving or preventing dry macular degeneration comprising SOD according to the present invention as an active ingredient.
  • Such food compositions include medical or nutraceutical food compositions.
  • medical food or “nutraceutical food” refers to food made from raw materials or ingredients that have the potential to have beneficial functions in the human body, which maintain or improve health by maintaining normal functions or activating the physiological functions of the human body.
  • a food it is defined by, but not limited to, the Ministry of Food and Drug Safety, and does not exclude any conventional health food in that sense.
  • the food includes, but is not limited to, various foods, food additives, beverages (eg, functional drinks, natural fruit juice and vegetable drinks), gum, tea, vitamin complexes, health functional foods, and other functional foods. .
  • beverages eg, functional drinks, natural fruit juice and vegetable drinks
  • gum e.g., tea
  • vitamin complexes e.g., vitamin complexes, health functional foods, and other functional foods.
  • the food may be prepared by a conventional method known in the art.
  • the medical food, nutraceutical food, or health functional food may further include at least one of a carrier, diluent, excipient, and additive in addition to the SOD for the purpose of preventing or improving mucositis, such as tablets, pills, powders, granules, It may be formulated as one selected from the group consisting of powder, capsule and liquid formulations.
  • Specific examples of the carrier, excipient, diluent, and additive are well known in the art, and a person skilled in the art can prepare them by combining appropriate components according to the formulation.
  • the content of the superoxide dismutase according to the present invention as an active ingredient in the above-described formulation can be appropriately adjusted according to the form and purpose of use, the patient's condition, the type and severity of symptoms, etc., and is about 0.001 to about 0.001 to about 99.9% by weight, preferably from about 0.01 to about 50% by weight, but is not limited thereto.
  • the dosage of the food of the present invention may vary depending on the patient's age, weight, sex, dosage form, state of health and degree of disease, and divided administration once a day to several times at regular time intervals according to the judgment of a doctor or pharmacist You may.
  • the daily dosage may be 10 to 1000 mg/kg based on the active ingredient content.
  • the above dosage is an example of an average case, and the dosage may be higher or lower depending on individual differences. If the daily dose of the health functional food of the present invention is less than the above dose, a significant effect may not be obtained, and if it exceeds more than that, it is uneconomical and may cause undesirable side effects because it is out of the range of the usual dose. there is.
  • a feed composition for preventing or improving dry macular degeneration comprising the SOD according to the present invention as an active ingredient.
  • the food composition may include a feed composition.
  • feed compositions can be prepared in any formulation commonly used in the art.
  • the feed composition of the present invention may include auxiliary components such as amino acids, inorganic salts, vitamins, antibiotics, antimicrobial substances, antioxidants, antifungal enzymes, and other probiotic-type microorganism preparations; grains such as ground or crushed wheat, oats, barley, corn and rice; vegetable protein feeds such as those based on rape, soybean and sunflower; animal protein feed such as blood meal, meat meal, bone meal and fish meal; dry ingredients consisting of sugar and dairy products, such as various powdered milk and whey powder; main components such as lipids, for example, animal fats and vegetable fats optionally liquefied by heating; Additives such as nutritional supplements, digestion and absorption enhancers, growth promoters, and disease preventives may be further included.
  • auxiliary components such as amino acids, inorganic salts, vitamins, antibiotics, antimicrobial substances, antioxidants, antifungal enzymes, and other probiotic-type microorganism preparations
  • grains such as ground or crushed wheat, oats, barley
  • the feed composition of the present invention may be in the form of a powder or liquid formulation, and may include an excipient for feed additives.
  • Excipients for feed additives include, for example, calcium carbonate, horse powder, zeolite, jade powder or rice bran, but are not limited thereto.
  • a polynucleotide encoding the superoxide dismutase polypeptide is provided. Specifically, a nucleic acid encoding a polypeptide comprising or consisting of the amino acid sequence of SEQ ID NO: 4 is provided.
  • an expression vector comprising the above nucleic acid.
  • the vector may be the expression vector shown in FIG. 4 .
  • a host cell comprising the nucleic acid or the expression vector.
  • the host cell is a bacterial cell. More specifically, the host cell is a Bacillus species strain.
  • Bacillus species strain comprising a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 4 and having the following genes deleted: AprE , NprE , Bpr , Epr , NprB , Vpr , Mpr , IspA , SrfAC , spoIIAc , EpsE and Xpf .
  • a Bacillus species strain comprising a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 4 and having the following genes deleted: AprE , NprE , Bpr , Epr , NprB , Vpr , Mpr , IspA , SrfAC , spoIIAc , EpsE and Xpf .
  • Expression host GFBS220 was prepared using Bacillus subtilis KCTC 3135.
  • B. subtilis KCTC 3135 was purchased from the Korea Research Institute of Bioscience and Biotechnology (KCTC). To facilitate post-processing, the genes shown in Table 1 below were removed from the B. subtilis KCTC 3135 genome.
  • Deletion of the gene was performed using double cross-over recombination on the genome (FIG. 1). Specifically, DNA fragments (up fragments and down fragments) having homology to DNA sequences on both sides of the gene to be manipulated were cloned into the vector pUCori-ts-cm having a temperature-sensitive replication origin. PCR conditions and primers used for cloning are shown in Table 2 and Table 3, respectively.
  • PCR step temperature hour initial denaturation 95°C 30 seconds 30 cycles 95°C 50°C 72°C 30 seconds 30 seconds 1 minute/kb final height 72°C 10 minutes
  • DNA polymerase used for PCR was Taq DNA polymerase (NEB, USA).
  • transformants single crossover homologous recombination
  • the selected transformants were cultured (second cross) at 30 °C (cloning permissive temperature) in LB medium without antibiotics, and then cultured at 39 °C in LB agar medium without antibiotics.
  • a strain plasmid curing having chloramphenicol sensitivity was selected for the resulting colony.
  • PCR was performed on the selected colonies to obtain a double cross-over recombinant, and a final recombinant was selected by performing secondary pure separation and named GFBS220.
  • the defective gene region of GFBS220 was amplified using the primers and PCR shown in Table 4, and then confirmed using agarose gel electrophoresis. The result of confirming the defective gene using PCR in the expression host GFBS220 is shown in FIG. 2 .
  • Mn-SOD was confirmed in the culture supernatant of Bacillus amyloliquesfaciens strain GF423 through N-terminal sequencing (Kang et al., 2018).
  • the GF423 strain was deposited with the Korea Research Institute of Bioscience and Biotechnology on March 6, 2017, respectively (accession number KCTC 13222 BP).
  • the gene of the Mn-SOD was named sodA according to the nomenclature for bacterial SOD, and its amino acid sequence is shown in Figure 3 and SEQ ID NO: 2 (its nucleotide sequence is SEQ ID NO: 1).
  • the sodA2 gene was amplified using four primers (Table 5) and overlapping extension PCR using the Bacillus amyloliquefaciens GF423 genome as a template. Nucleotides for substitution of Asn to Asp are underlined.
  • the amplified DNA fragment containing the sodA2 gene and the plasmid pBE1 linearized by Nde I and Hind III treatment were assembled in vitro by the SLIC method (Jeong et al. 2012), and the resulting construct was then E was transformed into E. coli C2984H. Correct clones were screened by restriction enzyme mapping and confirmed by nucleotide sequencing.
  • the expression vector pBE1-sodA2 thus generated is shown in FIG. 4 .
  • the expression vector pBE1-sodA2 was transformed into B. subtilis GFBS220. Strains were selected from the transformants and pure clones were established by two single colony isolation procedures in LB2 medium. The selected strain was named BSBA310 and was stored at -80°C by the glycerol stock method. The result of confirming the defective gene using PCR in this production strain BSBA310 is shown in FIG. 2 . In addition, the overall procedure for making production strain BSBA310 is summarized in FIG. 5 .
  • Example 2 Isolation and purification of superoxide dismutase (SodA2) from production strain BSBA310
  • LB agar medium (LB (Luria-Bertani) agar; tryptophan 10 g/L, yeast extract 5 g/L, NaCl 10 g/L, agar 15 g/L)
  • LB Lia-Bertani
  • tryptophan 10 g/L tryptophan 10 g/L
  • yeast extract 5 g/L tryptophan 10 g/L
  • NaCl 10 g/L agar 15 g/L
  • a single colony formed in was inoculated into 30 ml of LB medium and incubated at 37° C. for 12 hours.
  • the seed culture was again inoculated into 3 L of LB medium containing 1 mM manganese sulfate (MnSO 4 ) and cultured at 37° C. for 20 hours.
  • MnSO 4 manganese sulfate
  • the cell culture medium obtained in Example 2.1 was centrifuged at 4° C. and 3,578 x g for 20 minutes to obtain a supernatant, and then concentrated 10 times using ultrafiltration (UF, MWCO 10,000). 390 g of ammonium sulfate was added per 1 L of the concentrated cell culture medium, stirred for 20 minutes, centrifuged, and the supernatant was taken. The collected supernatant was purified using a PhenylSepharose HP column. In the purification process, the column was equilibrated using 50 mM potassium phosphate pH 7.0 at a concentration of 2 M ammonium sulfate, and then the supernatant obtained by adding ammonium sulfate was passed through the column.
  • the purified liquid purified through the column was collected and concentrated by ultrafiltration to remove high-concentration salts formed during the purification process.
  • the concentrated solution was filtered through a sterilization filter and lyophilized.
  • the activity of SodA2 was analyzed using a SOD assay kit (Cayman Chemical, Michigan, USA). One unit of SOD activity is defined as the amount of enzyme that inhibits superoxide radicals by 50%.
  • the activity of the dried SodA2 enzyme was 1000 to 1200 U/mg.
  • Shellac (EXCELACS co., LTD., Bangkok) was dissolved in 100% ethanol to a concentration of 3%, and the filter was prepared using a 0.2um sterile filter.
  • Shellac solution dissolved in ethanol A shellac solution was prepared by diluting shellac by a factor of 1/20 with sterile 1x PBS.
  • the lyophilized purified SodA2 was dissolved at 20 mg/ml and prepared to be sterile using a 0.2um filter.
  • the prepared shellac solution and the dissolved SOD were mixed with stirring at a ratio of 1:1. Then, stirring was continued for 10 minutes.
  • the well stirred material was lyophilized. Through this, the finally freeze-dried shellac coating SodA2 was prepared.
  • Dextrin was added to lyophilized shellac-coated SodA2 at a ratio of 1:9 to 12 (shellac-coated SodA2:dextrin), and the final activity was determined to be 90 to 110 U/mg through activity measurement.
  • SodA2 prepared in Example 3 was orally administered to rhesus monkeys with idiopathic moderate dry age-related macular degeneration (AMD), and its safety and efficacy were evaluated.
  • AMD idiopathic moderate dry age-related macular degeneration
  • Vehicles administered to SodA2 and controls had the following characteristics and conditions.
  • the rhesus monkeys used in this example were selected and supplied according to the following criteria.
  • At least one moderate dry AMD diagnosed using the AREDS classification for retinal drusen size and area in fundus photographs characterized by any of the following features: Monkey in the Snow:
  • - multiple drusen including at least one large drusen (grade 4, drusen diameter greater than 116 ⁇ m);
  • Total lesion area of drusenic lesions is at least grade 4 (grade 4, drusen area I-2 is greater than or equal to 0.089 mm 2 ).
  • Drusen size (maximum) 0: absent 1: Doubt 2: sure, C-0 & less diameter (less than 58 ⁇ m) 3: Diameter larger than C-0 and smaller than C-1 (59 to 116 ⁇ m) 4: Diameter larger than C-1 and smaller than C-2 (117 to 233 ⁇ m) 5: Diameter greater than C-2 (234 ⁇ m or greater) 8: Unable to rank drusen area # 0: area less than C-0 1: area greater than C-0 and smaller than C-1 2: Area greater than or equal to C-1 and smaller than C-2 3: Area greater than C-2 and smaller than I-2 4: Area greater than I-2 and smaller than O-2 5: area greater than O-2 and less than 1 ⁇ 2 DA 6: area greater than 1 ⁇ 2 DA and less than 1 DA 7: area greater than 1 DA 8: Unable to rank # Regions within the Modified Early Treatment of Diabetic Retinopathy Study (ETDRS).
  • EDRS Eye Retinopathy Study
  • Disruptive eye diseases such as aphakia; Optic nerve atrophy (blanking of the optic disc); Any eye disease that the investigator considered could be a confounding factor in this study.
  • the prepared monkeys were reared under the following conditions. All procedures of this experiment were performed in a laboratory that complied with animal welfare regulations and was approved for experimental animal welfare.
  • the monkeys were housed in a temperature controlled (18° C. to 26° C.) and humidity controlled (40% to 70%) facility with a 12 hour light/dark cycle.
  • Each monkey was fed 350 g of PriMed diet daily. Food intake was quantitatively assessed daily.
  • the retinal drusen area of two monkeys met grade 6 (area greater than or equal to 1 ⁇ 2 DA but less than 1 DA) and grade 4 (area greater than or equal to I-2 but less than O-2) to grade 5 in six monkeys. (area greater than O-2 but less than 1 ⁇ 2 DA); Monkeys were randomly divided into two groups, each group containing 4 monkeys.
  • SodA2 and vehicle were filled into dried kiwi slices. Vehicle and SodA2 were orally administered once a day to monkeys in the vehicle group and SodA2 group, respectively, for 4 months. SodA2 and vehicle were prepared prior to daily oral administration.
  • Retinal drusen size and area (including changes from baseline in retinal drusen size and area) of test animals were measured at Day 30 (D30), Day 60 (D60), Day 90 (D90) and Day 120 (D120) after dosing. It was measured through fundus photography (FP). Each baseline was measured during the pre-study period.
  • ketamine:xylazine mixture (1:1, 8 mg/kg of ketamine).
  • a ketamine:xylazine mixture (1:1, 8 mg/kg of ketamine).
  • 2 drops of tropicamide phenylephrine ophthalmic solution were applied to each eye after anesthesia. After anesthesia, the monkeys were kept in the dark until the pupil diameter was greater than 6 mm. A self-retaining speculum was placed in the eye.
  • FP images were acquired using a retinal camera (KOWA VX-20) according to the following procedure.
  • the monkey's forehead was held against the forehead support. The working distance was adjusted and focused before taking the image. It was confirmed whether a macular central image was obtained.
  • Monkeys were managed according to relevant standard operating procedures (SOPs) during the examination. Drusen size and area were measured by two experienced image raters using Image J (Version 1.52, Wayne Rasband National Institutes of Health, USA). Drusenic lesions and AMD were graded using the Age-Related Eye Disease Study 2 (AREDS2) system (Table 11).
  • AREDS2 Age-Related Eye Disease Study 2
  • the grading includes a modified grid template modified from the Early Treatment Diabetic Retinopathy Study (ETDRS), which uses a series of graduated circles to assess the largest drusen size and the total area associated with pigment abnormalities and drusen. All measurements included the number of drusenic lesions, the total area of lesions and the size of the largest lesion.
  • EDRS Early Treatment Diabetic Retinopathy Study
  • Drusen size (maximum) 0: absent 1: Doubt 2: sure, C-0 & less diameter (less than 58 ⁇ m) 3: Diameter larger than C-0 and smaller than C-1 (59 to 116 ⁇ m) 4: Diameter larger than C-1 and smaller than C-2 (117 to 233 ⁇ m) 5: Diameter greater than C-2 (234 ⁇ m or greater) 8: Unable to rank drusen area # 0: area less than C-0 1: area greater than C-0 and less than C-1 2: Area greater than or equal to C-1 and smaller than C-2 3: Area greater than C-2 and smaller than I-2 4: Area greater than I-2 and smaller than O-2 5: area greater than O-2 and less than 1 ⁇ 2 DA 6: area greater than 1 ⁇ 2 DA and less than 1 DA 7: area greater than 1 DA 8: Unable to rank
  • Frequency Baseline and post-dose Day 14, Day 30, Day 45, Day 60, Day 75, Day 90, Day 105, Day 120.
  • MDA and C3 were only measured at three time points (Day 90, Day 105 and Day 120). Parameters of the blood biochemistry test are presented in Table 12.
  • Enzymatic reference method total cholesterol TC mmol/L
  • Enzymatic colorimetry 1-point endpoint low density lipoprotein LDL mmol/L
  • Homogeneous enzyme colorimetric assay triglycerides TG mmol/L
  • Homogeneous enzyme colorimetric assay aspartate aminotransferase AST IU/L colorimetry alanine aminotransferase ALT IU/L IFCC rate method total bilirubin TBIL ⁇ mol/L Diazo method
  • 2-point endpoint direct bilirubin DBIL ⁇ mol/L Diazo method 2-point endpoint Creatine phosphokinase C.K.
  • Frequency Baseline and post-dose Day 14, Day 30, Day 45, Day 60, Day 75, Day 90, Day 105, Day 120.
  • red blood cells RBC nx 10 12 /L laser beam method hemoglobin HGB g/L Colorimetric method using cyanomethemoglobin hematocrit HCT % laser beam method Mean red blood cell hemoglobin concentration MCHC g/L laser beam method average red blood cell volume MCV fL laser beam method average red blood cell hemoglobin MCH pg laser beam method Erythrocyte distribution width RDW % laser beam method hemoglobin distribution width HDW g/L laser beam method Reticulocyte percent count Retic% % laser beam method Reticulocyte absolute count Retic# n x 10 ⁇ 9 /L Laser beam method using colorimetric reaction for nucleic acid fluorescence staining platelets PLT nx 10 9 /L laser beam method Mean platelet volume MPV fL laser beam method platelet distribution width PDW fl laser beam method platelet hematocrit PCT % laser beam method leukocyte WBC nx 10 9 /L laser beam method WBC differential percent count:
  • Data analysis consisted of total area of drusen lesion, size of largest drusen lesion, volume of drusen lesion, body weight, blood biochemistry, and blood hematology.
  • Example 4.4.1 Total area of drusenic lesions
  • the total area of drusenic lesions is presented in Table 14, and the change in area is presented in Table 15 and FIG. 7 .
  • Example 4.4.2 The size of the largest drusenic lesion
  • the size of the largest drusen lesion is shown in Table 16, and the amount of change in area is shown in Table 17 and FIG. 8.
  • the total area of drusenic lesions significantly increased compared to baseline at 30 days, 60 days, 90 days and 120 days after administration (p ⁇ 0.05); The size of the largest drusenoid lesions increased at Day 90 and Day 120, but no statistical significance was found compared to baseline; This suggests that drusen-like lesions developed in monkeys in the vehicle group that received vehicle for 4 months.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Engineering & Computer Science (AREA)
  • Polymers & Plastics (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Food Science & Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Physics & Mathematics (AREA)
  • Animal Husbandry (AREA)
  • Biophysics (AREA)
  • Nutrition Science (AREA)
  • Mycology (AREA)
  • Plant Pathology (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

본 발명은 수퍼옥시드 디스뮤타제 및 건성 연령 관련 황반변성의 예방 또는 치료를 위한 이의 용도에 관한 것이다. 더욱 구체적으로, 본 발명은 건성 황반변성의 예방 또는 치료를 위한 약학 조성물 또는 치료 방법에 관한 것이다. 본 발명에 따른 조성물 및 방법은 드루젠 형성 및/또는 드루젠성 병변을 감소시키거나 방지하여 건성 황반변성을 예방하거나 치료하는 데에 효과적으로 사용될 수 있다.

Description

수퍼옥시드 디스뮤타제 및 이의 건성 황반변성의 예방 또는 치료용 용도
본 발명은 수퍼옥시드 디스뮤타제 및 건성 연령 관련 황반변성의 예방, 개선 또는 치료를 위한 이의 용도에 관한 것이다. 더욱 구체적으로, 본 발명은 건성 황반변성의 예방, 치료 또는 개선을 위한 수퍼옥시드 디스뮤타제, 조성물 또는 방법에 관한 것이다.
연령 관련 황반변성(Age-related Macular Degeneration; "AMD")이라고도 하는 황반변성은 황반의 만성 진행성 퇴행성 질환을 지칭하며, 중심 시력의 상실을 초래한다. 황반 변성은 50세 이상의 성인에서 시력 상실 및 비가역적 중심 시력 상실의 주요 원인이다. 전 세계적으로 2,500만 명의 환자가 황반 변성을 앓고 있으며, 황반 변성 환자 수는 고령 인구의 급속한 성장으로 인해 계속 빠르게 증가하고 있다. 또한, 스마트폰 및 노트북과 같은 전자 장치의 과도한 사용은 현대인에게서 황반변성의 조기 발병 및 증가된 유병률을 유발한다.
황반변성의 가장 주요한 원인은 연령 관련 위축과 망막 색소 상피(RPE)의 기능 저하이다. 망막 색소 상피는 시각 기능의 핵심 역할을 하는 망막의 항상성과 생리 기능을 유지하는 데 중요한 역할을 한다. 또한, 연령 관련된 부르크막(Bruch's membrane)의 비정상적 변화와 맥락막 모세혈관의 변성도 황반변성의 병인에 기여하는 것으로 생각된다. 부르크막은 RPE의 기저막 역할을 하는 한편, 맥락막 모세혈관은 감각신경 망막의 가장 바깥쪽에 위치하여 광전환이 일어나는 광수용기 세포에 영양분과 산소를 공급한다. 황반변성의 발병원인은 과도한 활성산소, 미토콘드리아의 기능장애, 염증, 지질 대사의 이상, 유전적 요소, 환경적 요소(예를 들어, 흡연, 자외선에 대한 장기 노출)가 역할을 하는 것으로 알려져 있으나, 정확한 기전은 완벽하게 밝혀져 있지 않다.
황반변성은 크게 습성과 건성 두 가지로 분류될 수 있다. 건성 타입은 황반변성으로 진단되는 사례의 85 내지 90%를 차지하며, 습성 타입도 건성 타입으로부터 시작된다. 건성 황반변성의 주요 특징은 망막 색소 상피 층 아래에 존재하는 드루젠(drusen)으로 불리는 중간 크기 이상의 노란색 침착물, 망막 색소 상피의 색소이상(pigmentary abnormalities), 망막 아래에 존재하는 망상 슈도드루젠(reticular pseudodrusen)으로 불리는 침착물이다. 드루젠 생성은 건성 황반변성의 전형적인 특징으로, 다수의 중간 크기의 드루젠 및 큰 크기의 드루젠은 말기 황반변성으로의 진행에 대한 위험인자로 알려져 있다. 또한, 드루젠의 크기와 밀도는 맥락막 모세혈관(choriocapillaris)의 손실과도 상관관계가 있다.
건성 황반변성은 일반적으로 천천히 진행되고 말기에 이르면, 지도모양 위축(geographic atrophy; GA)으로 진행될 수 있다. 지도모양 위축은 비가역적인 망막 색소 상피의 변성이 융합적(confluent) 또는 산발적(scattered)으로 발생하여 광수용체를 손상시키며, 계속 진행되면 시력의 상실을 초래하게 된다. 지도모양 위축은 노화에 따른 시력 장애의 주요한 요인이지만, 현재 건성 황반변성의 진행을 지연하거나 억제할 수 있는 승인된 치료 방법이나 치료 약물은 존재하지 않는다.
말기 황반변성의 다른 타입인 습성 황반변성은 맥락막으로부터 미성숙된 혈관이 망막쪽으로 생성되어, 혈액 또는 체액이 누출되면서 광수용체와 그에 연결된 신경세포를 손상시키고 결국 중심 시력(central vision)의 손실을 유발한다. 습성 황반변성은 건식 타입에 비해 빠르게 진행되어, 치료하지 않고 방치된 경우 수개월 내에 실명으로 이어질 수 있다. 하지만 신생 혈관의 형성 방지를 위한 항신생혈관 요법으로, 항-VEGF 제제를 안구에 주입하여 비정상적으로 생성되는 VEGF를 억제함으로써 혈관 형성 과정을 정지시키는 치료 방법이 개발되어 있다.
따라서, 건성 황반변성을 효과적으로 예방 또는 치료할 수 있는 물질 및 방법이 필요하다.
본 발명은 상술한 종래 기술의 문제점을 해결하는 것을 그 목적으로 한다.
본 발명은 건성 황반변성의 예방, 개선 또는 치료를 위한 수퍼옥시드 디스뮤타제를 제공하는 것을 다른 목적으로 한다.
본 발명은 건성 황반변성의 예방 또는 치료를 위한 약학 조성물 또는 치료 방법을 제공하는 것을 또 다른 목적으로 한다.
본 발명은 건성 황반변성의 예방 또는 개선을 위한 식품 또는 사료 조성물을 제공하는 것을 또 다른 목적으로 한다.
본 발명은 드루젠 형성 또는 드루젠성 병변(drusenoid lesion)을 감소시키거나 제거하여 건성 황반 변성을 예방 또는 치료하는 약학 조성물 또는 치료 방법을 제공하는 것을 또 다른 목적으로 한다.
본 발명은 드루젠 형성 또는 드루젠성 병변을 감소시키거나 제거하여 건성 황반 변성을 예방하거나 개선하는 식품 또는 사료 조성물을 제공하는 것을 또 다른 목적으로 한다.
본 발명의 목적은 이상에서 언급한 목적으로 제한되지 않는다. 본 발명의 목적은 이하의 설명으로 보다 분명해질 것이며, 특허청구범위에 기재된 수단 및 그 조합으로 실현될 것이다.
상기 목적을 달성하기 위한 본 발명의 대표적인 구성은 다음과 같다.
본 발명의 일 태양에 따르면, 건성 황반변성의 예방, 개선 또는 치료 효과를 나타내는 개선된 수퍼옥시드 디스뮤타제(superoxide dismutase; SOD)가 제공된다.
본 발명의 다른 태양에 따르면, 건성 황반변성의 예방, 개선 또는 치료를 위한, 일반적으로 안전한 것으로 간주되는(generally regarded as safe, GRAS) 박테리아, 예컨대 바실러스 유래의 수퍼옥시드 디스뮤타제가 제공된다.
본 발명의 또 다른 태양에 따르면, 건성 황반변성의 예방, 개선 또는 치료를 위한 경구 투여 효능 및 안전성을 확보한 바실러스 아밀로리퀴파시엔스 유래의 수퍼옥시드 디스뮤타제가 제공된다.
본 발명의 또 다른 태양에 따르면, 건성 황반변성의 예방 또는 치료를 위하여 생산하기 편리하게 세포외 분비되는 바실러스 유래 또는 바실러스 아밀로리퀴파시엔스 유래의 수퍼옥시드 디스뮤타제가 제공된다.
본 발명의 또 다른 태양에 따르면, 상기 수퍼옥시드 디스뮤타제(superoxide dismutase; SOD)를 유효성분으로 포함하는 건성 황반변성을 예방 또는 치료하기 위한 약학 조성물이 제공된다.
본 발명의 또 다른 태양에 따르면, 상기 수퍼옥시드 디스뮤타제를 유효성분으로 포함하는 건성 황반변성을 개선 또는 예방하기 위한 식품 또는 사료 조성물이 제공된다.
본 발명의 또 다른 태양에 따르면, 상기 수퍼옥시드 디스뮤타제를 대상에 투여하는 단계를 포함하는 건성 황반변성을 예방, 개선 또는 치료하기 위한 방법이 제공된다.
본 발명의 또 다른 태양에 따르면, 상기 수퍼옥시드 디스뮤타제의 건성 황반변성의 예방 또는 치료를 위한 용도가 제공된다.
본 발명의 또 다른 태양에 따르면, 상기 수퍼옥시드 디스뮤타제의 건성 황반변성의 예방 또는 치료용 약제 제조를 위한 용도가 제공된다.
본 발명의 또 다른 태양에 따르면, 바실러스 종 균주로부터 유래되고 서열번호 2를 기준으로 73번 및 136번 아미노산 잔기가 Asp로 치환된 수퍼옥시드 디스뮤타제, 이를 코딩하는 폴리뉴클레오티드 서열, 상기 폴리뉴클레오티드 서열을 포함하는 발현 벡터, 또는 상기 발현 벡터로 형질전환된 세포주가 제공된다.
본 발명의 또 다른 태양에 따르면, 상기 폴리뉴클레오티드 서열을 포함하고 일부 유전자가 결실된 바실러스 종 균주가 제공된다.
본 발명에 따른 수퍼옥시드 디스뮤타제, 조성물 및 방법은 드루젠 형성 및/또는 드루젠성 병변을 감소시키거나 방지하여 건성 황반변성을 예방, 개선 또는 치료하는 데에 효과적으로 사용될 수 있다. 특히, 본 발명에 따른 수퍼옥시드 디스뮤타제는 경구로 투여되어 건성 황반변성의 예방 또는 치료에 효과적임이 확인되었다.
본 발명에 따른 수퍼옥시드 디스뮤타제는 일반적으로 안전한 것으로 간주되는(generally regarded as safe, GRAS) 박테리아인 바실러스 또는 바실러스 아밀로리퀴파시엔스에서 유래하여 경구 투여 효능 및 안전성이 확보될 뿐만 아니라 배양 시 상등액에서 직접 회수할 수 있는 생산 장점도 취할 수 있다.
본 발명에 따른 수퍼옥시드 디스뮤타제를 코딩하는 폴리뉴클레오티드 서열, 상기 서열을 포함하는 발현 벡터, 또는 상기 발현 벡터로 형질전환된 세포주, 및 바실러스 종 균주를 이용하여 드루젠 형성 및/또는 드루젠성 병변을 감소시키거나 방지하기 위한 유효성분을 효과적으로 생산할 수 있다.
도 1은 실시예 1.1에서 수행된 이중 교차 재조합을 위한 모식도를 나타낸다.
도 2는 발현 숙주 GFBS220과 생산 균주 BSBA310에서 PCR을 이용하여 결손 유전자를 확인한 결과를 나타낸다. W는 야생형 B. subtilis KCTC 3135를 나타내고, 220은 발현 숙주 GFBS220를 나타내고, 310은 SodA2 생산 균주 BSBA310을 나타낸다.
도 3은 SodA(바실러스 아밀로리퀴파시엔스(Bacillus amyloliquesfaciens) 균주 GF423의 배양 상층액에서 N-말단 시퀀싱을 통해 확인된 Mn-SOD)와 본 발명의 수퍼옥시드 디스뮤타제(SodA2)의 아미노산 서열을 비교한 것이다.
도 4는 sodA2 유전자의 과발현을 위한 발현 벡터를 나타낸다. 여기서, rrnB T1T2는 전사 종결인자를 나타내고; rep(pBR322)는 E. coli에서 작동하는 pBR322로부터의 레플리콘을 나타내고; rep(pUB110)는 B. subtilis에서 작동하는 pUB110로부터의 레플리콘이고; KanR은 카나마이신 내성 유전자(아미노글리코시드 O-뉴클레오티딜트랜스퍼라제)를 나타내고; BJ27 promoter는 B. subtilis에 대한 강력한 프로모터를 나타낸다.
도 5는 생산 균주 BSBA310을 제조하기 위한 전체 절차를 나타낸다.
도 6은 본 발명의 실시예에서 사용된 임상 결과 측정을 위한 기준을 나타낸다.
도 7은 본 발명의 실시예에 따른 드루젠성 병변의 총 면적의 기준선으로부터의 변화량을 나타낸다. 비히클(vehicle) 그룹의 면적 변화량과 비교하여, *p<0.05 이다.
도 8은 본 발명의 실시예에 따른 가장 큰 드루젠성 병변 크기의 기준선으로부터의 변화량을 나타낸다.
도 9a 및 도 9b는 본 발명의 실시예에서 수행된 혈액 생화학 결과를 나타낸다.
도 10a 내지 도 10c는 본 발명의 실시예에서 수행된 혈액 혈액학 결과를 나타낸다.
후술하는 본 발명에 대한 상세한 설명은, 본 발명이 실시될 수 있는 특정 구현예에 관하여 특정 도면을 참조하여 기술될 것이지만, 본 발명은 이에 한정되지 않고, 적절하게 설명된다면, 그 청구항들이 주장하는 것과 균등한 모든 범위와 더불어 첨부된 청구항에 의해서만 한정된다. 본 발명의 다양한 구현예는 서로 다르지만 상호 배타적일 필요는 없음이 이해되어야 한다. 예를 들어, 본 명세서에 기재되어 있는 특정 형상, 구조 및 특성은 본 발명의 정신과 범위를 벗어나지 않으면서 일 구현예에서 다른 구현예로 변경되거나 구현예들이 조합되어 구현될 수 있다. 본 발명을 설명하면서 제시된 용어는 달리 나타내지 않는 한, 일반적으로 그의 통상적인 의미로 이해되어야 하며, 그 용어가 정의된 발명의 태양 또는 구현예뿐만 아니라 본 명세서에 사용된 동일한 용어에 모두 적용된다. 본 명세서를 해석할 목적으로 하기 정의들이 적용될 것이고, 단수로 사용된 용어는 적절한 경우에는 복수형을 포함할 것이며 그 반대도 마찬가지이다.
정의
본 명세서에 사용되는 용어 "약"은 당해 기술 분야에서 통상의 기술자에게 알려진 각각의 값에 대한 통상적인 오차 범위를 지칭한다.
용어 "대상"은 "환자"와 상호교환적으로 사용되고, 건성 황반변성의 예방 또는 치료를 필요로 하는 포유동물, 예를 들어, 영장류(예컨대 인간), 반려 동물(예컨대, 개, 고양이 등), 가축 동물(예컨대, 소, 돼지, 말, 양, 염소 등) 및 실험실 동물(예컨대, 랫트 마우스, 기니피그 등)일 수 있다. 본 발명의 일 구현예에서, 대상체는 인간이다.
용어 "치료"는 예방적 및/또는 치료적 처치를 포함한다. 상기 예방적 및/또는 치료적 처치는 당업계에서 인정되는 모든 종류의 처치를 포함하며 예컨대, 대상에 본 발명의 약학 조성물 또는 SOD를 투여하는 것을 포함한다. 만약 원하지 않거나 바람직하지 않은 상태(예컨대 질병 또는 대상의 다른 원하지 않거나 바람직하지 않은 상태)의 임상적 징후 전에 투여된다면, 그러한 처치 또는 치료는 예방적 처치 또는 치료이다(예컨대, 대상의 원하지 않거나 바람직하지 않은 상태가 진행되는 것으로부터 대상을 보호하는 것). 반면에 원하지 않거나 바람직하지 않은 상태의 임상적 징후 후에 투여된다면, 그러한 처치 또는 치료는 존재하는 원하지 않거나 바람직하지 않은 상태 또는 이의 부작용을 감소, 완화 또는 안정화하는 등의 치료적 처치이다.
용어 "예방"의 의미는 당업계에 잘 알려져 있다. 건성 황반변성과 같은 의학적 상태와 관련하여 사용될 때, 본 발명의 약학 조성물 또는 SOD를 투여하여 이를 투여받지 않은 대상과 비교하여 의학적 상태(예를 들어, 흐릿한 시야 또는 시력 상실)의 빈도를 감소시키거나 발병 및 증상을 지연시키는 것을 의미한다.
용어 "투여"는 대상에 예방적 또는 치료적 목적(예컨대 건성 황반변성의 예방 또는 치료)을 달성하기 위한 유효성분을 제공하는 것을 의미한다.
건성 황반변성
본 발명은 적어도 부분적으로 수퍼옥시드 디스뮤타제(SOD)의 투여, 특히 경구 투여가 건성 황반변성을 예방 또는 치료하는 데 효과적이라는 발견에 기초한다. 따라서, 본 발명의 일 태양에 따르면, SOD의 건성 황반변성의 예방 또는 치료용 용도가 제공된다.
용어 "건성 황반변성"은 "건성 연령 관련 황반변성"과 상호 교환적으로 사용된다. 이는 초기, 중기 및 진행된 건성 황반변성을 모두 포함한다.
상기 건성 황반변성은 드루젠 또는 드루젠성 병변을 특징으로 한다. 용어 "드루젠"은 연령 증가에 따라 망막에서 발생되는 노폐물이 RPE 세포와 브루크막 사이 또는 브루크막(B) 내부에 쌓여 생긴 생성물을 지칭한다. 드루젠 생성은 건성 타입의 AMD의 전형적인 특징(hallmark)이며, 다수의 중간 크기의 드루젠 및 큰 크기의 드루젠은 말기 황반변성으로의 진행에 대한 위험인자로 알려져 있다. 또한, 드루젠의 크기와 밀도는 맥락막 모세혈관(choriocapillaris)의 손실과도 상관관계가 있다. 한편, 용어 "드루젠성 병변"은 드루젠으로 인해 발생한 병변을 지칭한다.
본 발명의 SOD는 드루젠 또는 드루젠성 병변을 감소시키거나 그의 형성을 방지함으로써 건성 황반변성을 효과적으로 예방, 개선 또는 치료할 수 있다.
본 발명자들은 인간과 유사한 위치 및 조성을 갖는 드루젠을 발생시키는 동물 모델로서 마우스가 아닌 레서스 원숭이(Rhesus monkey)을 사용하여 동물 시험을 진행하였다. 그 이유는 트랜스제닉 마우스가 아닌 일반 마우스의 경우에 광-유도된 산화적 스트레스 모델이 망막의 기능에 영향을 준다는 증거가 없고(P. Sicard, et. al., "Dietary Superoxide Dismutase Protects Against Light-Induced Retinal Oxidative Stress in Young Senescence Accelerated Mice (SAM)," Invest Ophthalmol Vis Sci 2006;47: E-Abstract 2089)), 건성 AMD의 특징인 드루젠이 생성되지 않는다(Hema L. Ramkumar, et. al., "Retinal ultrastructure of murine models of dry age-related macular degeneration (AMD)," Progress In Retinal And Eye Research 2010;29(3), 169-190)는 점에서 건성 AMD의 효과적인 모델이 될 수 없기 때문이다. 또한, 문헌[Erica L. Fletcher, et. al., "Studying Age-Related Macular Degeneration Using Animal Models," Optom Vis Sci. 2014;91(8), 878-886]에 따르면, 현재까지 유인원 영장류가 인간과 유사한 조성 및 위치를 가진 드루젠을 발생시키는 유일한 동물로 설명되었고; 일부 마우스가 연령 증가에 따라 백색 병변을 발생시키지만, 이는 인간과 위치 및 조성이 다르기 때문에 드루젠 형성을 이해하는 데 효과적인 모델이 아니기 때문이다.
수퍼옥시드 디스뮤타제(Superoxide dismutase; SOD)
본 발명의 다른 태양에 따르면, 건성 황반변성의 예방, 개선 또는 치료 효과를 나타내는 개선된 수퍼옥시드 디스뮤타제(SOD)가 제공된다.
수퍼옥시드 디스뮤타제(Superoxide dismutase; SOD)는 수퍼옥시드(O2 ㆍ-) 라디칼의 일반 분자 산소(O2)와 과산화수소(H2O2)로의 디스뮤테이션(dismutation)을 번갈아 촉매하는 효소로서, SOD는 활성 산소 종을 제거하여 산화 스트레스를 줄이는 데 중요한 역할을 한다. SOD는 원핵 세포와 진핵 세포에 널리 분포하고 있으며, 다양한 유형의 금속 중심(구리/아연, 니켈, 망간, 및 철)에 따라 4가지 부류로 분류된다. 망간 함유 SOD[Mn-SOD]는 여러 세균, 진핵 세포의 엽록체, 미토콘드리아, 및 세포질에 광범위하게 존재한다. 용어 "SOD"는 수퍼옥시드 디스뮤타제 활성을 갖는 폴리펩티드와 상호교환적으로 사용될 수 있다.
일 구현예에서, 상기 SOD는 망간에 결합하는 것(Mn-SOD)일 수 있다. 구체적으로, 상기 SOD는 탈아미드화된 Mn-SOD일 수 있다. 보다 구체적으로, 상기 SOD는 서열번호 2를 기준으로 73번 및 136번 아미노산 잔기가 Asp로 치환된 것일 수 있다. 보다 더 구체적으로, 상기 SOD는 서열번호 4로 표시되는 아미노산 서열을 포함하거나 이로 이루어질 수 있다.
본 발명의 SOD 또는 SOD 활성을 갖는 폴리펩티드는 상기 아미노산 서열에 대하여 실질적인 동일성을 나타내는 아미노산 서열도 포함되는 것으로 해석된다. 상기 실질적인 동일성은 당업계에 통상적으로 이용되는 알고리즘을 이용하여 정렬된 서열을 분석하는 경우, 80% 이상, 바람직하게는 90% 이상, 보다 바람직하게는 95% 이상, 가장 바람직하게는 98% 이상의 서열 동일성을 나타내는 아미노산 서열을 의미한다.
다른 구현예에서, SOD는 SOD 효소 활성을 갖는 개질된(modified 또는 engineered) 폴리펩티드로서 다양한 측면(생체내, 시험관내 또는 생체외 안정성, 균일성, 및/또는 형태적 변경)에 영향을 미치거나 미치지 않는 하나 이상의 변이, 예컨대, 하나 이상의 아미노산의 결실, 삽입 또는 치환을 포함할 수 있다. 또한, 상기 폴리펩티드는 정제, 검출 또는 안정성 증가를 위한 이종성 물질(예컨대, HIS tag, Ha tag, myc tag를 포함한 당업계에 공지된 tag, GFC 및/또는 항체의 Fc 도메인)을 추가로 포함할 수 있다.
일 구현예에서, SOD는 천연 또는 재조합 미생물로부터 유래될 수 있으며, 다양한 공급원으로부터 단리 또는 정제되는 과정을 거쳐 제작된 효소일 수 있다.
일 구현예에서, SOD는 천연 또는 재조합 미생물로부터 유래될 수 있다. 예를 들어, SOD는 박테리아로부터 유래된다. 바람직하게는, SOD는 약물 또는 식품에 사용하기에 일반적으로 안전한 것으로 간주되는(generally regarded as safe, GRAS) 박테리아로부터 공급된다. 구체적으로, SOD는 바실러스 종 균주에서 유래될 수 있다. 보다 구체적으로, 상기 SOD는 바실러스 아밀로리퀴파시엔스 균주로부터 유래된 것일 수 있다. 예컨대, 상기 SOD는 바실러스 아밀로리퀴파시엔스 GF423 균주(KCTC 13222 BP)로부터 유래된 것일 수 있다. GF423 균주(KCTC 13222 BP)는 한국생명공학연구원에 2017년 3월 6일자로 기탁된 것이다. 또한, 상기 SOD는 도 4에 도시된 발현 벡터를 포함하는 재조합 균주로부터 유래된 것일 수 있다. 또한 상기 SOD는 도 5에 도시된 방법을 포함하는 방법에 의해 제조된 재조합 균주로부터 유래된 것일 수 있다. 상기 재조합 균주는 서열번호 4의 아미노산 서열을 포함하는 폴리펩티드를 코딩하는 뉴클레오티드 서열을 포함하고 하기 유전자가 결실된 바실러스 종 균주일 수 있다: AprE, NprE, Bpr, Epr, NprB, Vpr, Mpr, IspA, SrfAC, spoIIAc, EpsE 및 Xpf. 상기 균주의 제조를 위한 상세한 과정은 실시예 1을 참조한다.
상기 균주 유래의 SOD는 세포 외부로 분비되는 효소이므로, 상기 균주를 이용하여 SOD를 제조하는 경우, 고가의 정제과정(예를 들어, 컬럼 정제)을 거치지 않고 인간에게 안전성이 확보된 SOD를 대량으로 생산할 수 있기 때문에, 효율적인 생산이 가능하다.
일 구현예에서, SOD는 천연 또는 재조합 숙주를 비롯한 다양한 공급원으로부터 단리되거나 정제될 수 있다. 예를 들어, 건성 황반변성을 예방하거나 치료하는 활성을 갖는 SOD는 바실러스 아밀로리퀴파시엔스 균주 GF423의 배양 상층액으로부터 추출될 수 있다. 간략하게 말하면, 먼저 바실러스 아밀로리퀴파시엔스 균주 GF423을 다양한 유형의 배지에서 배양하여 배양액을 얻을 수 있다. 예를 들어, 복합 배지(pH 6.0 내지 7.0)를 사용하여 상기 균주를 약 25℃ 내지 약 42℃에서 약 1일 내지 약 4일 동안 성장시킨다. 바실러스 아밀로리퀴파시엔스 균주 GF423을 배양하기 위한 다른 적합한 배지에는 LB(Luria-Bertani) 배지, ISP(International Streptomyces Project) 배지, NA(nutrient agar) 배지, BHI(brain heart infusion agar) 배지, SDA(sabouraud dextrose agar) 배지, PDA(potato dextrose agar) 배지, NB(nutrient broth) 배지 등이 포함된다. 바람직하게는, LB 배지, ISP 배지, BHI 배지, SDA 배지, 또는 NB 배지가 사용될 수 있다. 또한, SOD는 PubMed 또는 BRENDA(월드 와이드 웹의 brenda-enzymes.org)와 같은 데이터베이스에 제공된 정보를 사용하여 다른 천연 또는 재조합 숙주로부터 공급될 수 있다.
일 구현예에서, 상기 SOD는 단리 또는 정제된 효소일 수 있다. 이때, 단리되거나 정제된 SOD 또는 그의 생물학적 활성 부분에는 그것이 유래된 세포 또는 조직 공급원으로부터의 세포 물질 또는 기타 오염 단백질이 실질적으로 없다. 예를 들어, 정제물은 균주 배양물로부터 한외 여과(Ultrafiltration), 황산암모늄 처리, 컬럼 정제, 농축 등을 통해 순수 분리된 것이거나, 한외 여과, 농축 등을 통해 얻어진 배양 농축액일 수 있다. "세포 물질이 실질적으로 없는"이라는 문구는, 단백질이 단리되거나 재조합적으로 생산되는 세포의 세포 성분으로부터 그러한 단백질이 분리된 단백질의 제조물을 포함한다. 일 구현예에서, "세포 물질이 실질적으로 없는"이라는 문구는 원하지 않는 단백질이 건조 중량을 기준으로 약 30% 미만, 바람직하게는 약 20% 미만, 더욱 바람직하게는 약 10% 미만, 그리고 가장 바람직하게는 약 5% 미만인 단백질의 제조물을 포함한다.
다른 구현예에서, SOD는 다음과 같은 정제 방법으로 정제하는 것이 바람직할 수 있지만, 이로 한정되지는 않는다. 바실러스 아밀로리퀴파시엔스 균주 GF423을 배양하여 얻은 배양액을 원심분리하여 배양 상층액을 수집한다. 상층액 분획을 고체상 추출로 전처리하고, 이어서 크로마토그래피로 단리하고 정제한다. 이때, SOD는 다양한 방식의 크로마토그래피를 사용하여 정제될 수 있다. 바람직하게는, 소수성 상호작용 크로마토그래피가 사용된다.
다른 구현예에서, 상기 SOD는 균주 용해물(lysate), 균주 배양액, 균주 배양 농축액, 균주 배양 추출물 또는 그의 건조 형태로 포함될 수 있다. 이때, "균주 용해물"은 균주를 배양하여 기계적 또는 화학적으로 파쇄하여 얻은 것일 수 있다. "균주 배양액"은 균주를 배양하여 얻은 배양액 그 자체 또는 그의 상층액을 의미할 수 있다. "균주 배양 농축액"이란 균주 배양물로부터 한외 여과, 황산암모늄 처리, 컬럼 정제, 농축 등을 통해 순수 분리된 것이거나, 한외 여과, 농축 등을 통해 얻어진 배양 농축액을 지칭한다. "균주 배양 추출물"은 상기 배양액 또는 그의 농축액으로부터 추출한 것을 의미하며, 추출액, 추출액의 희석액 또는 농축액, 추출액을 건조하여 얻어지는 건조물, 또는 이의 조정제물 또는 정제물, 이를 분획한 분획물을 포함할 수 있다. 상기 건조 형태는 동결 건조 형태를 포함할 수 있다.
본 발명의 SOD는 드루젠 또는 드루젠성 병변을 감소시키거나 그의 형성을 방지하고/거나 건성 황반변성을 효과적으로 예방, 개선 또는 치료할 수 있다. 특히, 본 발명의 SOD는 드루젠 또는 드루젠성 병변을 특징으로 하는 건성 황반변성의 예방, 개선 또는 치료에 유용하다.
약학 조성물
본 발명의 일 태양에 따르면, 수퍼옥시드 디스뮤타제(SOD)를 유효성분으로 포함하는 건성 황반변성을 치료 또는 예방하기 위한 약학 조성물이 제공된다.
상기 약학 조성물은 드루젠 또는 드루젠성 병변을 감소시키거나 그의 형성을 방지할 수 있다.
일 구현예에서, 본 발명에 따른 SOD는 약학적으로 허용가능한 담체, 부형제 및/또는 희석제와 조합되어 건성 황반변성의 예방 또는 치료를 위한 약학 조성물을 형성할 수 있다. 본 발명의 약학 조성물은 인간을 제외한 동물에 적용되는 경우에 수의학적 조성물이라는 용어와 상호 교환적으로 사용될 수 있다.
본 발명의 약학 또는 수의학적 조성물은 약학적으로 허용되는 담체, 부형제 및/또는 희석제를 추가로 포함할 수 있다. 상기 약학적으로 허용되는 담체, 부형제 및/또는 희석제는 당업계에 통상적으로 사용되는 것일 수 있다. 담체, 부형제 또는 희석제로는, 예를 들어, 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 하이드록시 프로필 메틸 셀룰로오즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 이산화규소 등의 광물유 등을 들 수 있지만, 이에 제한되지 않는다.
제제화할 경우에는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 첨가제를 사용하여 조제될 수 있다. 상기 제제화를 위한 첨가제는 약제 분야에서 통상 사용하는 것 중에서 적합한 것을 선택할 수 있다.
또한, 본 발명의 약학 또는 수의학적 조성물은 사용 방법에 따라 바람직한 형태로 제형화될 수 있으며, 특히 포유 동물에 투여된 후 활성 성분의 신속, 지속 또는 지연 방출을 제공할 수 있도록 당업계에 공지된 방법을 채택하여 제형화될 수 있다. 그러한 제형의 구체적인 예로는 정제, 환제, 산제, 과립제, 시럽제, 액제, 캡슐제, 현탁제, 유제, 주사용액, 경고제(Plasters), 로션제, 리니멘트제, 리모나데제, 에어로졸제, 엑스제(Extracts), 엘릭실제, 연고제, 유동엑스제, 침제, 크림제, 연질 또는 경질 젤라틴 캡슐, 패치제 등이 있다.
더 나아가 본 발명의 약학 또는 수의학적 조성물은 당해 기술 분야의 공지된 적절한 방법을 사용하여 또는 레밍턴의 문헌(Remington's Pharmaceutical Science(최신판), Mack Publishing Company, Easton PA)에 개시되어 있는 방법을 이용하여 바람직하게 제형화될 수 있다.
일 구현예에서, 상기 SOD는 경구 또는 비경구 투여될 수 있다. 경구 투여의 경우, 위산으로부터의 보호를 위해 SOD가 쉘락(shellac)으로 코팅될 수 있지만, 코팅제는 이로 한정되지는 않는다. 본 발명에서 사용하기에 적합한 코팅제의 예에는 쉘락, 에틸 셀룰로스, 히드록시프로필 메틸셀룰로스, 히드록시프로필 메틸셀룰로스 프탈레이트, 제인(zein), 유드라짓(Eudragit), 및 이들의 조합이 포함된다. SOD가 코팅되는 경우, SOD는 용액 중에서 코팅될 수 있다. 구체적으로, 정제된 용액과 쉘락 함유 용액이 혼합되고, 이어서 동결 건조된다. 이 동결 건조된 샘플은 분말로 만들어져 사용 시까지 약 4°C에서 보관될 수 있다. 경구 투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 복합 조성물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 탄산칼슘, 수크로스, 락토오스, 젤라틴 등을 섞어 조제될 수 있다. 또한, 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제도 사용될 수 있다. 경구 투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 포함되며, 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면, 습윤제, 감미제, 방향제, 보존제 등이 사용될 수 있다.
비경구 투여의 경우, 설하 투여, 유리체내 투여를 포함한 안내 투여, 비강 분무, 피부 외용, 패치제, 복강내 주사, 직장내 주사, 피하 주사, 정맥 주사, 근육내 주사 또는 흉부내 주사 주입방식을 선택할 수 있다.
또한, 본 발명의 약학 또는 수의학적 조성물은 약학적으로 또는 수의학적으로 유효한 양으로 투여된다. 용어 “약학적으로 유효한 양” 또는 “수의학적으로 유효한 양”은 의학적 또는 수의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 환자 또는 동물의 체중, 성별, 연령, 건강상태, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료 기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.
본 발명의 약학 또는 수의학적 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 순차적 또는 동시에 투여될 수 있다. 또한, 상기 약학 조성물은 필요에 따라 단일 또는 다중 투여될 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이러한 양은 통상의 기술자에 의해 용이하게 결정될 수 있다.
예방 또는 치료 방법
본 발명의 또 다른 태양에 따르면, 본 발명에 따른 SOD 또는 약학 조성물을 건성 황반변성을 갖거나 이의 위험이 있는 대상에 투여하는 단계를 포함하는, 건성 황반변성을 치료 또는 예방하기 위한 방법이 제공된다.
또한, 수퍼옥시드 디스뮤타제를 대상에 투여하는 단계를 포함하는, 건성 황반변성을 치료 또는 예방하기 위한 방법이 제공된다. 상기 SOD, 건성 황반변성, 치료 또는 예방에 관한 내용은 약학 조성물에 관하여 상술한 바와 같다.
용어 "투여"는 목적하는 작용을 수행하여 치료를 가능하게 하는 임의의 다양한 투여를 포함한다. 상기 투여는 경구 또는 비경구 투여를 포함할 수 있다. 경구 또는 비경구 투여에 대해서는, 상기 약학 조성물과 관련하여 설명된 내용을 참조한다. 투여 경로는 경구, 비경구, 흡입, 국소 또는 국부 투여(예컨대 병변내 투여)일 수 있다. 예컨대 비경구 투여는 정맥 내, 피하, 복강 내, 동맥 내, 안구 내 투여를 포함할 수 있으나 이에 제한되지 않는다. 경구 투여의 경우에, 앞서 설명한 바와 같이, SOD는 쉘락 등과 같은 코팅제로 코팅된 형태로 투여될 수 있다.
본 발명에 따른 SOD의 유효량 또는 효과적인 무독성 양은 통상적인 실험에 의해 결정될 수 있다. 예를 들어, 본 발명의 SOD의 치료 활성량은 질환 단계, 질환의 중증도, 대상체의 연령, 성별, 의학적 합병증, 및 체중과 같은 요인에 따라 변할 수 있다. 본 발명의 SOD의 투여량 및 투여요법은 최적 치료 반응을 제공하기 위해 조정될 수 있다. 예를 들어, 몇몇 분할 용량이 매일, 매주, 2주마다, 3주마다, 4주마다 등으로 투여될 수 있고/거나, 용량이 치료 상황의 긴박함에 따라 비례적으로 감소되거나 증가될 수 있다.
일 구현예에서, 상기 방법은 건성 황반변성을 치료하거나 예방하기 위한 하나 이상의 추가 제제를 투여하는 것을 포함할 수 있다. 상기 하나 이상의 추가 제제는 상기 SOD 또는 약학 조성물과 동시에, 순차적으로 또는 역순으로 투여될 수 있다. 또한, 개별 성분은 동일하거나 상이한 경로에 의해 대상체에 투여될 수 있다.
식품 조성물
본 발명의 또 다른 태양에 따르면, 본 발명에 따른 SOD를 유효성분으로 포함하는 건성 황반변성의 개선 또는 예방을 위한 식품 조성물이 제공된다. 이러한 식품 조성물은 의료용 또는 뉴트라슈티컬(nutraceutical) 식품 조성물을 포함한다.
용어 "의료용 식품" 또는 "뉴트라슈티컬 식품"은 인체에 유익한 기능을 할 가능성이 있는 원료 또는 성분으로 제조된 식품으로서, 정상적인 기능을 유지하거나 인체의 생리적 기능을 활성화함으로써 건강을 유지시키거나 개선시키는 식품으로 식품의약품안전처에 의해 규정되지만 이로 한정되지 않으며, 임의의 통상적인 건강 식품을 그 의미에서 배제하지 않는다.
또한, 상기 식품에는 각종 식품류, 식품 첨가제, 음료(예를 들어, 기능성 음료, 천연 과일 주스 및 야채 음료), 껌, 차, 비타민 복합제, 건강기능식품, 기타 기능성 식품 등이 포함되지만 이로 한정되지 않는다.
상기 식품은 당업계에 알려진 통상의 방법으로 제조될 수 있다. 예컨대, 상기 의료용 식품, 뉴트라슈티컬 식품 또는 건강기능식품은 점막염을 예방하거나 개선시킬 목적으로 상기 SOD에 더하여 담체, 희석제, 부형제 및 첨가제 중 하나 이상을 추가로 포함하여 정제, 환제, 산제, 과립제, 분말제, 캡슐제 및 액제 제형으로 이루어진 군에서 선택된 하나로 제형화될 수 있다. 상기 담체, 부형제, 희석제 및 첨가제의 구체적인 예는 당업계에 잘 알려져 있으며 통상의 기술자는 그 제형에 따라 적절한 성분을 조합하여 제조할 수 있다.
상기 상술한 제형 내 유효 성분으로서의 본 발명에 따른 수퍼옥시드 디스뮤타제의 함량은 사용 형태 및 목적, 환자 상태, 증상의 종류 및 경중 등에 의하여 적절하게 조절할 수 있으며, 고형분 중량 기준으로 약 0.001 내지 약 99.9 중량%, 바람직하게는 약 0.01 내지 약 50 중량% 일 수 있으나, 이에 한정되지 않는다.
본 발명의 식품의 투여 용량은 환자의 나이, 몸무게, 성별, 투여형태, 건강상태 및 질환 정도에 따라 달라질 수 있으며, 의사 또는 약사의 판단에 따라 일정 시간간격으로 1일 1회 내지 수회로 분할 투여할 수도 있다. 예컨대, 유효 성분 함량을 기준으로 1일 투여량이 10 내지 1000 ㎎/kg일 수 있다. 상기한 투여량은 평균적인 경우를 예시한 것으로서 개인적인 차이에 따라 그 투여량이 높거나 낮을 수 있다. 본 발명의 건강기능식품의 1일 투여량이 상기 투여 용량 미만이면 유의성 있는 효과를 얻을 수 없을 수 있으며, 그 이상을 초과하는 경우 비경제적일 뿐만 아니라 상용량의 범위를 벗어나므로 바람직하지 않은 부작용이 나타날 수 있다.
사료 조성물
본 발명의 또 다른 태양에 따르면, 본 발명에 따른 SOD를 유효 성분으로 포함하는 건성 황반변성의 예방 또는 개선을 위한 사료 조성물이 제공된다. 본 발명에서 식품 조성물은 사료 조성물을 포함할 수 있다. 이러한 사료 조성물은 당업계에서 통상적으로 이용되는 어떠한 제형으로도 제조될 수 있다. 예를 들어, 본 발명의 사료 조성물은 아미노산, 무기염류, 비타민, 항생물질, 항균물질, 항산화, 항곰팡이 효소, 다른 생균 형태의 미생물 제제 등과 같은 보조제 성분; 곡물, 예를 들면 분쇄 또는 파쇄된 밀, 귀리, 보리, 옥수수 및 쌀; 식물성 단백질 사료, 예를 들면 평지, 콩 및 해바라기를 주성분으로 하는 것; 동물성 단백질 사료, 예를 들면 혈분, 육분, 골분 및 생선분; 당분 및 유제품, 예를 들면 각종 분유 및 유장 분말로 이루어지는 건조성분; 지질, 예를 들면 가열에 의해 임의로 액화시킨 동물성 지방 및 식물성 지방 등과 같은 주성분; 영양보충제, 소화 및 흡수향상제, 성장촉진제, 질병 예방제와 같은 첨가제가 추가로 포함될 수 있다.
본 발명의 사료 조성물은 분말 또는 액체 상태의 제제 형태일 수 있으며, 사료첨가용 부형제를 포함할 수 있다. 사료첨가용 부형제로는 예를 들어, 탄산칼슘, 말분, 제올라이트, 옥분 또는 미강 등을 들 수 있으나, 이로 한정되지는 않는다.
폴리뉴클레오티드, 발현 벡터 및 숙주세포
본 발명의 또 다른 태양에 따르면, 상기 수퍼옥시드 디스뮤타제 폴리펩티드를 코딩하는 폴리뉴클레오티드가 제공된다. 구체적으로, 서열번호 4의 아미노산 서열을 포함하거나 이로 구성되는 폴리펩티드를 코딩하는 핵산이 제공된다.
본 발명의 또 다른 태양에 따르면, 상기 핵산을 포함하는 발현 벡터가 제공된다. 구체적으로, 상기 벡터는 도 4에 도시된 발현 벡터일 수 있다.
본 발명의 또 다른 태양에 따르면, 상기 핵산 또는 상기 발현 벡터를 포함하는 숙주 세포가 제공된다. 구체적으로 상기 숙주 세포는 박테리아 세포이다. 보가 구체적으로 상기 숙주 세포는 바실러스 종 균주이다.
본 발명의 또 다른 태양에 따르면, 서열번호 4의 아미노산 서열을 포함하는 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열을 포함하고 하기 유전자가 결실된 바실러스 종 균주가 제공된다: AprE, NprE, Bpr, Epr, NprB, Vpr, Mpr, IspA, SrfAC, spoIIAc, EpsE 및 Xpf. 상기 균주의 제조를 위한 상세한 과정은 하기 실시예 1을 참조한다.
이하, 본 발명을 하기 실시예에 의하여 더욱 상세하게 설명한다. 하기 실시예는 본 발명의 이해를 돕기 위해 제시된 것으로, 어떠한 방식으로든 이의 범위를 제한하려는 의도가 아니며, 제한하려는 것으로 해석되어서는 안 된다.
실시예 1. 수퍼옥시드 디스뮤타제(SodA2)를 발현하는 재조합 균주의 제조
실시예 1.1. 발현 숙주 GFBS220의 제조
발현 숙주 GFBS220는 Bacillus subtilis KCTC 3135를 이용하여 제조하였다. B. subtilis KCTC 3135는 한국생명공학연구원 생물자원센터(KCTC)로부터 분양받았다. 후공정을 용이하게 하게 위해 B. subtilis KCTC 3135 지놈에서 하기 표 1에 제시된 유전자를 제거하였다.
유전자 명칭 단백질 명칭 기능
AprE 세린 알칼리 프로테아제(서브틸리신 E) 세포외 프로테아제
NprE 세포외 중성 메탈로프로테아제 세포외 프로테아제
Bpr 바실로펩티다제(bacillopeptidase) F 세포외 프로테아제
Epr 세포외 세린 프로테아제 세포외 프로테아제
NprB 세포외 중성 프로테아제 B 세포외 프로테아제
Vpr 세포외 세린 프로테아제 세포외 프로테아제
Mpr 세포외 메탈로프로테아제 세포외 프로테아제
IspA 세포내 세린 프로테아제 세포내 프로테아제
SrfAC 서팩틴 신타제 서팩틴(surfactin) 합성
spoIIAC RNA 폴리머라제 포자형성-특이적 시그마 인자(시그마-F) 포자형성
EpsE 추정 글리코실트랜스퍼라제 세포외 다당류
Xpf RNA 폴리머라제 시그마 인자 PBSX 프로파지 유전자의 전사
유전자의 제거는 지놈 상에서 이중 교차 재조합(double cross-over recombination)을 이용하여 수행하였다(도 1). 구체적으로, 온도 민감성 복제 기점을 가지는 벡터 pUCori-ts-cm에 조작 대상 유전자 양 옆의 DNA 염기 서열과 상동성을 갖는 DNA 절편(up frag. 및 down frag.)을 클로닝하였다. 클로닝에 사용된 PCR 조건 및 프라이머는 각각 표 2 및 표 3에 제시되어 있다.
PCR 단계 온도 시간
최초 변성 95°C 30초
30회 주기 95°C
50°C
72°C		 30초
30초
1분/kb
최종 신장 72°C 10분
PCR에 사용한 DNA 중합효소는 Taq DNA 중합효소(NEB, USA)임.
표적 유전자 상동 쌍 프라이머 서열(5'→3') 서열번호
AprE 단편 1 F ctacggggtctgacgcagatatcgtaaccgaagaacg 5
R tgttgcagacatgttgctgaacgccatc 6
단편 2 F caacatgtctgcaacatatcttggaaac 7
R gataagctgtcaaaccagagattggataggctatcaag 8
NprE 단편 1 F ctacggggtctgacgcagggcattactgcaccataatc 9
R gaggtacgccttcagcagcctgaacacc 10
단편 2 F gctgaaggcgtacctcacgccttcttcc 11
R gataagctgtcaaaccagttgtcagatttgcatccttc 12
Bpr 단편 1 F ctacggggtctgacgcagagcaatttccagcccgcttc 13
R gtatgatgaggcatgaacagcaatcccg 14
단편 2 F tcatgcctcatcatactcaacaagggtg 15
R gataagctgtcaaaccagttcccagccggatgttcaac 16
Epr 단편 1 F ctacggggtctgacgcaggctttctgccagccgatagg 17
R tgtgtcaaagccgttatgcttggctccg 18
단편 2 F taacggctttgacacagcacaaactgcc 19
R gataagctgtcaaaccaggtctcccatacatgaacgac 20
NprB 단편 1 F ctacggggtctgacgcagagtaatcttgtaggaggctg 21
R tgtgactgtcatattcaccgtcgtgtgg 22
단편 2 F tgaatatgacagtcacacagtattccgcc 23
R gataagctgtcaaaccagattaggatacggtctggctg 24
Vpr 단편 1 F ctacggggtctgacgcagatgtacgctgagccgaatag 25
R ggaatcacatttgcggagatacggcgtc 26
단편 2 F ccgcaaatgtgattccggcacatcaaac 27
R gataagctgtcaaaccagaccgttttccgaatctgacc 28
Mpr 단편 1 F ctacggggtctgacgcagcgttatcccgaatgcccgtg 29
R ggctttgttcctttagtgtcaaccaccc 30
단편 2 F ctaaaggaacaaagccgattcgctccgc 31
R gataagctgtcaaaccagaaattgactgctccacgctg 32
SrfAC 단편 1 F ctacggggtctgacgcaggatatgtattacctatcgcc 33
R gccccttcatccagttcactgcttccttg 34
단편 2 F ggaagcagtgaactggatgaaggggcttcgctg 35
R gataagctgtcaaaccagaacgcttcgacatcactttc 36
spoIIA
 단편 1 F ctacggggtctgacgcagagcggacgatgggagactgg 37
R gccacctcatgcagccgatctggaagag 38
단편 2 F ggctgcatgaggtggctgagcggctcgg 39
R gataagctgtcaaaccagctcattgttttggtgagctg 40
IspA 단편 1 F ctacggggtctgacgcagtgctgcttggcattcatttc 41
R gccattgaagcaatgcctccgtttgaatc 42
단편 2 F acggaggcattgcttcaatggctgcccctcatg 43
R gataagctgtcaaaccagtcaatgctctcgtcatattc 44
EpsE 단편 1 F ctacggggtctgacgcagcaagcaaatgggctgggagg 45
R gacaagccatgctttctgccaaagtgcg 46
단편 2 F gaaagcatggcttgtcaagcatgaatag 47
R gataagctgtcaaaccagtgttgtatacattcagcagc 48
Xpf 단편 1 F gatcctctacggttcatccatgtccgaac 49
R tctatgatcctcctcatttttg 50
단편 2 F gaggaggatcatagaaagcttgtcatacgtttgcc 51
R gagttttcgttcggatcctccgctttttgtttg 52
이렇게 제조된 벡터를 B. subtilis 세포로 도입한 후, 37°C(비복제온도)에서 클로람페니콜이 함유된 배지를 이용하여 형질전환체(단일 교차 상동 재조합)를 선별하였다. 선별된 형질전환체를 항생제가 없는 LB 배지로 30°C(복제 허용 온도)에서 배양(제2 교차)한 후, 항생제가 없는 LB 한천배지로 39°C에서 배양하였다. 생성된 콜로니를 대상으로 클로람페니콜 감수성을 가지는 균주(plasmid curing)를 선별하였다. 선별된 콜로니를 대상으로 PCR을 수행하여 이중 교차 재조합체(double cross-over recombinant)를 확보하고, 2차 순수 분리를 수행하여 최종 재조합체를 선별하고, GFBS220으로 명명하였다.
GFBS220의 결손 유전자 부위는 표 4에 제시된 프라이머와 PCR을 이용하여 증폭한 후 아가로스 겔 전기영동을 이용하여 확인하였다. 발현 숙주 GFBS220 에서 PCR을 이용하여 결손 유전자를 확인한 결과를 도 2에 나타낸다.
유전자 부위
(locus)		 PCR 프라이머(서열번호) B. subtilis
KCTC 3135의 PCR 산물의 크기		 GFBSL210 PCR 산물의 크기
AprE F caaggcttgaaataacgttg (서열 번호 53)
R ttcgctgattacaacattgg (서열 번호 54)		 3115bp 2116bp
NprE F ggaacagatgatagctcatc (서열 번호 55)
R acactccgagaaggctgaag (서열 번호 56)		 3487bp 2145bp
Vpr F ctgcggcctgcacagccgcc (서열 번호 57)
R cgctgaatgacggtggtaag (서열 번호 58)		 3733bp 2293bp
NprB F agtaatcttgtaggaggctg (서열 번호 59)
R cgccaatgaagtgaaggagg (서열 번호 60)		 2666bp 2153bp
Mpr F ggttgaggcgattgcgacgg (서열 번호 61)
R ccattctgcaaaatcagctc (서열 번호 62)		 2734bp 2076bp
spoIIAC F aagatatgaagaaagccggg (서열 번호 63)
R acagccgcttcataagcctg (서열 번호 64)		 2628bp 2102bp
ThrC F tcaagctgtcatgtacggag (서열 번호 65)
R tccgatacgaatggctgtcg (서열 번호 66)		 376bp 5455bp
실시예 1.2. 발현 벡터 pBE1-sodA2의 제작
바실러스 아밀로리퀴파시엔스(Bacillus amyloliquesfaciens) 균주 GF423의 배양 상층액에서 N-말단 시퀀싱(문헌[Kang et al., 2018])을 통해 Mn-SOD를 확인하였다. 상기 GF423 균주는 한국생명공학연구원에 각각 2017년 3월 6일자로 기탁된 것이다(수탁번호 KCTC 13222 BP). 상기 Mn-SOD의 유전자는 박테리아 SOD에 대한 명명법에 따라 sodA로 명명되었고, 그의 아미노산 서열은 도 3 및 서열번호 2를 참조한다(그의 뉴클레오티드 서열은 서열번호 1을 참조함). 효소 제조물의 LC-UV-MS/MS 펩티드 매핑은 100% 아미노산 서열 커버리지를 생성했지만, Asn73 및 Asn136 잔기에서 각각 73% 및 17% 존재비로 탈아미드화가 관찰되었다. 따라서, 정제된 효소의 균질성을 개선하기 위해 두 Asn 잔기를 Asp로 치환하였다. SodA2로 명명된 이러한 변이체 sodA의 아미노산 서열은 도 3 및 서열번호 4(그의 뉴클레오티드 서열은 서열번호 3을 참조함)를 참조한다.
4개의 프라이머(표 5)와 주형인 바실러스 아밀로리퀴파시엔스 GF423 지놈을 사용하는 중복 신장 PCR을 이용하여 sodA2 유전자를 증폭시켰다. Asn의 Asp로의 치환을 위한 뉴클레오티드에는 밑줄이 그어져 있다.
프라이머 서열(5'→3') 서열번호
1 SOD F GGAGGAATTACAATGGCTTACAA 67
2 D74 R TGCATGTCCGCCGCCATCGTTGCGGAC 68
3 D74 F CAGTCCGCAACGATGGCGGCGGACATG 69
4 D137 R TTCAAGTTTGCCGTCGTTTACAACGAGC 70
5 D137 F CTCGTTGTAAACGACGGCAAACTTG 71
6 SOD R CAAAACAGAAGCTTCATTATTTTGCT 72
sodA2 유전자를 포함하는 증폭된 DNA 단편 및 NdeI 및 HindIII 처리에 의해 선형화된 플라스미드 pBE1을 SLIC 방법(문헌[Jeong et al. 2012])으로 시험관내에서 어셈블링하고, 이어서 생성된 작제물을 E. coli C2984H 내로 형질전환시켰다. 제한 효소 매핑으로 정확한 클론을 스크리닝하고, 뉴클레오티드 시퀀싱으로 확인했다. 이렇게 생성된 발현 벡터 pBE1-sodA2는 도 4에 도시되어 있다.
실시예 1.3. 생산 균주 BSBA310의 제조
발현 벡터 pBE1-sodA2를 B. subtilis GFBS220 내로 형질전환시켰다. 형질전환체들로부터 균주를 선택하고, LB2 배지에서 2회의 단일 콜로니 분리 절차에 의해 순수한 클론을 확립하였다. 선택된 균주를 BSBA310으로 명명하고, 글리세롤 스톡법으로 -80℃에서 보관하였다. 이러한 생산 균주 BSBA310에서 PCR을 이용하여 결손 유전자를 확인한 결과를 도 2에 나타낸다. 또한, 생산 균주 BSBA310을 제조하기 위한 전체 절차는 도 5에 요약되어 있다.
실시예 2. 생산 균주 BSBA310로부터 수퍼옥시드 디스뮤타아제(SodA2)의 분리 및 정제
실시예 2.1. 생산 균주 BSBA310의 배양
실시예 1에서 얻은 생산 균주 BSBA310의 배양을 위해, LB 한천 배지(LB(Luria-Bertani) 한천; 트립토판 10 g/L, 효모 추출물 5 g/L, NaCl 10 g/L, 한천 15 g/L)에서 형성된 단일 콜로니를 LB 배지 30 ml에 접종하고, 37℃에서 12시간 동안 배양하였다. 이 종 배양액(seed culture)을 다시 1 mM 황산망간(MnSO4)이 포함된 LB 배지 3 L에 접종하고, 37℃에서 20시간 동안 배양하였다.
실시예 2.2. SodA2의 분리 및 정제
실시예 2.1에서 얻은 세포 배양액을 4℃, 3,578 x g에서 20분간 원심분리하여 상등액을 취한 후, 초미세여과(Ultrafiltration, 이하 UF, MWCO 10,000)를 이용하여 10배 농축하였다. 농축된 세포 배양액 1L당 390g의 황산암모늄을 넣고 20분간 교반을 하고 원심분리를 하고 상등액을 취하였다. 취한 상등액을 페닐세파로스 HP 컬럼을 사용하여 정제를 하였다. 정제 과정은 2M 황산암모늄 농도의 50mM 인산칼륨 pH 7.0을 사용해서 컬럼을 평형화하였으며, 이후 황산암모늄을 넣고 얻은 상등액을 컬럼에 통과시켰고, 컬럼에 붙은 SodA2를 1.6M 황산암모늄을 포함한 50mM 인산칼륨 pH 7.0을 사용해서 회수하였다. 컬럼을 통해 정제를 한 정제액을 모아서 초미세여과를 통해 정제 과정중에 형성된 고농도 염을 제거하며 농축을 하였다. 농축액을 제균 필터로 여과한 후, 동결건조하였다. SodA2의 활성은 SOD 분석 키트(Cayman Chemical, Michigan, USA)를 이용하여 분석하였다. SOD 활성 1 단위(unit)는 수퍼옥시드 라디칼을 50% 억제하는 효소의 양으로 정의된다. 건조된 SodA2 효소의 활성은 1000 내지 1200 U/mg이었다.
실시예 3. 동물 시험용 SodA2의 제조
투여 물질 제조
쉘락(Shellac)(EXCELACS co., LTD., Bangkok)을 3% 농도가 되도록 100% 에탄올로 녹이고 0.2um 무균 필터를 사용해서 필터 준비하였다. 에탄올로 녹인 쉘락 용액쉘락을 무균처리 된 1x PBS로 1/20 배로 희석해서 쉘락 용액을 준비하였다.
동결건조한 정제 SodA2를 20 mg/ml로 녹여서 0.2um 크기의 필터를 사용해서 무균상태가 되도록 준비하였다.
준비된 쉘락 용액과 녹여서 준비한 SOD를 1:1로 교반하며 섞었다. 이후 교반을 10분간 지속하였다.
잘 교반된 물질을 동결건조시켰다. 이를 통해 최종적으로 동걸건조된 쉘락 코팅 SodA2를 준비하였다.
동결건조된 쉘락 코팅 SodA2에 덱스트린을 사용해서 1:9 내지 12(쉘락 코팅 SodA2 : 덱스트린) 비율로 넣어 준비하였으며 활성 측정을 통하여 최종적으로 활성이 90 내지 110 U/mg이 되도록 하였다.
실시예 4. 동물 시험
본 실시예에서는 특발성 중등도 건성 연령 관련 황반변성(AMD)이 있는 레서스 원숭이에게 실시예 3에서 제조된 SodA2을 경구 투여하여 그의 안전성 및 효능을 평가하였다.
본 실시예에서 사용된 약어는 하기와 같이 정의된다:
Figure PCTKR2022007001-appb-img-000001
실시예 4.1. 시험 물질 및 대조 물질의 준비
SodA2 및 대조군에 투여된 비히클은 다음과 같은 특성 및 조건을 가진다.
물품 로트 번호 양/용적 보관 조건 물리적 특성 활성 단위
SodA2 200605 24 g/바이알 2℃ 내지 8℃
빛으로부터 보호		 화이트 핑크 분말 100 U/mg
대조군
비히클		 200605 20 g/바이알 2℃ 내지 8℃
빛으로부터 보호		 화이트 핑크 분말 NA
실시예 4.2. 시험 동물의 준비
본 실시예에서 사용된 레서스 원숭이는 다음과 같은 기준으로 선별하여 공급받아 사용하였다.
종 레서스 원숭이
공급업체 Ya'an PriMed Breed Bio-tech Co., Ltd.
원숭이 마리수 수컷 1마리 및 암컷 7마리
체중 5.14 내지 10.41 kg
연령 17세 내지 25세(인간: 레서스 연령에 대해 일반적으로 인정되는 3:1 비를 사용하면 인간 연령 55세 내지 80세에 상당함)
포함 기준
다음 특징들 중 임의의 것을 특징으로 하는 안저 사진에서 망막 드루젠 크기 및 면적에 대한 AREDS 분류(디지털 안저 사진을 등급화하기 위한 표 8의 AREDS 분류 참조)를 이용하여 진단된 중등도 건성 AMD가 적어도 한쪽 눈에 있는 원숭이:
- 연성 드루젠 및 2년 이내의 드루젠 크기 또는 면적의 발달을 보임;
- 적어도 하나의 큰 드루젠을 포함한 다수의 드루젠(4등급, 드루젠 직경이 116 μm를 초과함);
- 드루젠성 병변의 총 병변 면적은 적어도 4등급임(4등급, 드루젠 면적 I-2이 0.089 mm2 이상임).
망막 소견 평가된 등급 코드 및 영역
드루젠 크기(최대) 0: 부재
1: 의심스러움
2: 확실, C-0& 미만의 직경(58μm 이하)
3: C-0보다 크고 C-1보다 작은 직경(59 내지 116 μm)
4: C-1보다 크고 C-2보다 작은 직경(117 내지 233 μm)
5: C-2 초과의 직경(234μm 이상)
8: 등급화 불가
드루젠 면적 # 0: C-0 미만의 면적
1: C-0 이상이고 C-1보다 작은 면적
2: C-1 이상이고 C-2보다 작은 면적
3: C-2 이상이고 I-2보다 작은 면적
4: I-2 이상이고 O-2보다 작은 면적
5: O-2 이상이고 ½ DA보다 작은 면적
6: ½ DA 이상이고 1 DA보다 작은 면적
7: 1 DA 이상의 면적
8: 등급화 불가
# 수정된 ETDRS(Early Treatment of Diabetic Retinopathy Study) 내의 영역.
제곱밀리미터로 측정된 등급화를 위한 원 면적은 다음과 같다: C-0 = 0.003 mm2, C-1 = 0.011 mm2, C-2 = 0.043 mm2, I-2 = 0.089 mm2, O-2 = 0.297 mm2, 1/2 DA(disc area) = 0.77 mm2, 1 DA = 1.54 mm2.
제외 기준
- 신생혈관성 AMD 또는 당뇨병성 망막병증의 증거 또는 병력[어느 한쪽 눈];
- 모든 검사에서 중증 심부전(뉴욕 심장 협회의 등급 III 및 IV)이 있거나 좌심실 박출률이 35% 미만임;
- 중증 간 질환, ALT 수치가 정상 상한치의 3배가 넘게 증가함.
- 다음 징후 중 하나가 있는 중증 신장 질환: (1) 투석 또는 20 ml/min/1.73m2 미만의 eGFR; (2) 뇨 단백/뇨 크레아티닌이 1g/g 이상임; (3) 혈액 크레아티닌 또는 알부민/뇨 크레아티닌이 600 mg/g 이상임;
- 무수정체증과 같은 교란성 안질환; 시신경 위축(시신경 유두 창백); 조사자가 본 연구에서 교란 요인이 될 수 있다고 생각하는 모든 안질환.
준비된 원숭이를 다음과 같은 조건으로 사육하였다. 본 실험의 모든 과정은 동물 복지 규정을 준수하고 실험 동물 복지에 대해 승인받은 실험실에서 수행하였다.
환경 조건
원숭이를 12시간 명암 주기로 온도 제어되고(18℃ 내지 26℃) 습도 제어되는(40% 내지 70%) 시설에 수용하였다.
음식 섭취
각 원숭이에게 매일 350 g의 PriMed 규정식을 공급하였다. 음식 섭취는 매일 정량적으로 평가하였다.
물
모든 원숭이는 정수 수돗물에 자유롭게 접근할 수 있었다.
실시예 4.3. 시험 설계
실시예 4.3.1. 그룹 할당
최근 2년 내에 확인된 총 8마리의 특발성 중등도 건성 AMD 레서스 원숭이를 기준선 영상 검사를 위한 사전 연구 기간(4주) 동안 등록하였다. 8마리 원숭이 가운데 2마리 원숭이의 망막 드루젠 면적은 6등급(½ DA 이상이지만 1 DA 미만인 면적)을 충족하고, 6마리 원숭이는 4등급(I-2 이상이지만 O-2 미만인 면적) 내지 5등급(O-2 이상이지만 ½ DA 미만인 면적)이며; 원숭이를 무작위로 두 그룹으로 나누었고 각 그룹은 4마리의 원숭이를 포함하였다.
원숭이의 기준선 특성은 표 9에 제시되어 있고, 동물 그룹화 및 투약은 표 10에 제시되어 있다.
그룹 원숭이
ID		 성별 연령 BW 총 드루젠 면적
(OD/ OS)		 최대 병변 크기

(OD/ OS)		 RPE
두께
(OD/ OS)		 RPE
부피
(OD/ OS)
세 kg mm2 mm μm mm3
SodA2
2.5 mg/kg
(n=4, 7개 눈)		 275 수컷 25 10.41 0.810/1.310 0.429/0.461 32/33 0.83/0.88
3702 암컷 19 5.88 1.656/1.375 0.268/0.309 32/31 0.87/0.86
5214 암컷 22 7.59 NA/2.692 NA /0.234 NA/36 NA/1.00
2026 암컷 21 6.14 0.400/0.559 0.167/0.198 29/29 0.81/0.82
평균±SD / 22±3 7.51±2.08 1.257±0.781 0.295±0.113 32±2 0.87±0.06
비히클
(n=4, 7개 눈)		 13116 암컷 19 5.81 7.937/9.685 0.335/0.309 46/47 1.27/1.31
1976 암컷 17 6.16 1.012/0.761 0.223/0.229 31/33 0.82/0.86
5170 암컷 22 6.57 7.523/NA 0.571/NA 48/NA 1.36/NA
5196 암컷 22 7.56 1.214/1.221 0.257/0.320 30/30 0.81/0.81
평균±SD / 20±2 6.53±0.76 4.193±3.976 0.321±0.119 38±9 1.03±0.26
그룹 원숭이 마리수 등록된 눈 개수 투여량 빈도 투여 경로
비히클 4 7 2.5 mg/kg 1일 1회 경구 투여
SodA2 4 7 2.5 mg/kg 1일 1회 경구 투여
실시예 4.3.2. 투여
SodA2과 비히클을 말린 키위 조각에 채웠다. 비히클 그룹 및 SodA2 그룹의 원숭이에게 각각 4개월 동안 비히클 및 SodA2을 1일 1회 경구 투여하였다. SodA2 및 비히클은 매일 경구 투여 전에 준비하였다.
실시예 4.3.3. 시험 절차
망막 드루젠 관찰
시험 동물의 망막 드루젠 크기 및 면적(망막 드루젠 크기 및 면적의 기준선으로부터의 변화 포함)을 투여 후 30일차(D30), 60일차(D60), 90일차(D90) 및 120일차(D120)에 안저 촬영(fundus photography; FP)을 통해 측정하였다. 각 기준선은 사전 연구 기간 동안 측정하였다.
이미지 획득에 앞서, 원숭이를 케타민:자일라진 혼합물(1:1, 8 mg/kg의 케타민)을 근육내 주사하여 마취시켰다. 동공 확장을 위해 마취 후 트로피카미드 페닐에프린 점안액 2방울을 각 눈에 적용했다. 마취 후, 원숭이를 동공 직경이 6 mm보다 커질 때까지 암실에 두었다. 자가-보전(self-retaining) 개검기를 눈에 배치하였다.
FP 이미지를 망막 카메라(KOWA VX-20)을 사용하여 다음과 같은 절차에 따라 획득하였다. 원숭이의 이마를 이마 지지대에 기댄 상태로 유지했다. 작업 거리를 조정하고, 이미지를 촬영하기 전에 초점을 맞추었다. 황반 중심 이미지가 얻어지는지 확인하였다. 검사 동안 관련 표준 작업 지침(standard operating procedure, SOP)에 따라 원숭이를 관리하였다. 드루젠의 크기와 면적은 Image J(Version 1.52, Wayne Rasband National Institutes of Health, USA)를 사용하여 두 명의 숙련된 이미지 평가자에 의해 측정되었다. 드루젠성 병변 및 AMD는 연령 관련 안질환 연구 2(AREDS2) 시스템을 이용하여 등급화되었다(표 11). 등급화에는 ETDRS(Early Treatment Diabetic Retinopathy Study)로부터 변형된 수정 그리드 템플릿이 포함되며, 이는 일련의 눈금이 있는 원을 사용하여 가장 큰 드루젠 크기와 색소 이상 및 드루젠과 관련된 총 면적을 평가한다. 모든 측정치에는 드루젠성 병변의 수, 병변의 총 면적 및 가장 큰 병변의 크기가 포함되었다.
망막 소견 평가된 등급 코드 및 영역
드루젠 크기(최대) 0: 부재
1: 의심스러움
2: 확실, C-0& 미만의 직경(58μm 이하)
3: C-0보다 크고 C-1보다 작은 직경(59 내지 116 μm)
4: C-1보다 크고 C-2보다 작은 직경(117 내지 233 μm)
5: C-2 초과의 직경(234μm 이상)
8: 등급화 불가
드루젠 면적 # 0: C-0 미만의 면적
1: C-0 이상이고 C-1보다 작은 면적
2: C-1 이상이고 C-2보다 작은 면적
3: C-2 이상이고 I-2보다 작은 면적
4: I-2 이상이고 O-2보다 작은 면적
5: O-2 이상이고 ½ DA보다 작은 면적
6: ½ DA 이상이고 1 DA보다 작은 면적
7: 1 DA 이상의 면적
8: 등급화 불가
케이지 관찰
행동, 자율신경 활성도, 정신 능력, 신체 표면 색, 배설 및 눈 외관의 변화에 대해 각 원숭이를 1일 1회 관찰하고 물리적으로 검사하였다.
음식 섭취
음식 섭취는 질적으로 평가하였고, 연구 기간 동안 1일 1회 평가하였다.
체중
14시간의 하룻밤 금식 후, 사전 연구 기간(기준선) 및 투여 후 7일차, 14일차, 21일차, 30일차, 37일차, 45일차, 52일차, 60일차, 67일차, 75일차, 82일차, 90일차, 97일차, 105일차, 112일차, 120일차에 저울을 사용하여 원숭이를 칭량했다.
혈액 생화학 검사
장비: Roche Cobas6000 Analyzer Series C501
샘플 유형: 혈장
빈도: 기준선 및 투여 후 14일차, 30일차, 45일차, 60일차, 75일차, 90일차, 105일차, 120일차.
MDA 및 C3는 3개의 시점(90일차, 105일차 및 120일차)에서만 측정하었다. 혈액 생화학 검사의 파라미터는 표 12에 제시되어 있다.
파라미터 코드 단위 방법
공복 혈장 글루코스 FPG mmol/L 헥소키나제를 사용한 UV. 효소 기준 방법
총 콜레스테롤 TC mmol/L 효소 비색법, 1-포인트 종점
저밀도 지단백질 LDL mmol/L 균질 효소 비색 분석
고밀도 지단백질 HDL mmol/L 균질 효소 비색 분석
트리글리세리드 TG mmol/L 균질 효소 비색 분석
아스파테이트 아미노전이효소 AST IU/L 비색법
알라닌 아미노전이효소 ALT IU/L IFCC 레이트(rate) 방법
총 빌리루빈 TBIL μmol/L 디아조(Diazo)법, 2-포인트 종점
직접 빌리루빈 DBIL μmol/L 디아조법, 2-포인트 종점
크레아틴 포스포키나제 CK g/L 비색법, 레이트 방법
요소 질소 BUN mmol/L 비색법, 레이트 방법
크레아티닌 CR-S μmol/L 레이트 방법
알칼리성 인산분해효소 ALP IU/L 비색법, 레이트 방법
총 단백질 TP g/L 비색법, 2-포인트 종점
알부민 ALB g/L 비색법, 2-포인트 종점
Γ-글루타밀 트랜스펩티다제 GGT IU/L 효소 비색법
고감도 C 반응성 단백질 hs-CRP mg/L 입자 강화 탁도 면역분석
시스타틴 C CYSC mg/L 면역 탁도측정
말론다이알데히드# MDA ng/ml 효소 면역측정법(Enzyme-Linked Immunosorbent Assay)
보체 단편 3d# C3d μg/ml 효소 면역측정법
혈액 혈액학 검사
장비: Siemens ADVIA 212i/SYSMEX XN1000
샘플 유형: 전혈
빈도: 기준선 및 투여 후 14일차, 30일차, 45일차, 60일차, 75일차, 90일차, 105일차, 120일차.
혈액 혈액학 검사의 파라미터는 표 13에 제시되어 있다.
파라미터 코드 단위 방법
적혈구 RBC n x 1012/L 레이저빔 방법
헤모글로빈 HGB g/L 시안메트헤모글로빈을 사용한 비색법
헤마토크릿 HCT % 레이저빔 방법
평균 적혈구 헤모글로빈 농도 MCHC g/L 레이저빔 방법
평균 적혈구 부피 MCV fL 레이저빔 방법
평균 적혈구 헤모글로빈 MCH pg 레이저빔 방법
적혈구 분포 폭 RDW % 레이저빔 방법
헤모글로빈 분포 폭 HDW g/L 레이저빔 방법
망상적혈구 퍼센트 카운트 Retic% % 레이저빔 방법
망상적혈구 절대 카운트 Retic# n x 10^9/L 핵산 형광 염색을 위한 비색 반응을 이용한 레이저빔 방법
혈소판 PLT n x 109/L 레이저빔 방법
평균 혈소판 부피 MPV fL 레이저빔 방법
혈소판 분포 폭 PDW fl 레이저빔 방법
혈소판 헤마토크릿 PCT % 레이저빔 방법
백혈구 WBC n x 109/L 레이저빔 방법
WBC 감별 퍼센트 카운트:
호중구
림프구
호산구
호염기구
단핵구		 NEUT%
LYMPH%
EOS%
BASO%
MOMO%		 % 퍼옥시아제 염색을 위한 비색 반응을 이용한 레이저빔 방법
WBC 감별 절대 카운트:
호중구
림프구
호산구
호염기구
단핵구
NEUT
LYMPH
EOS
BASO
MOMO		 n x 109/L
데이터 분석
데이터 분석은 드루젠성 병변의 총 면적, 가장 큰 드루젠성 병변의 크기, 드루젠성 병변의 양, 체중, 혈액 생화학, 혈액 혈액학 등으로 이루어진다.
Microsoft Office Excel 2013 및 SPSS Statistics 23.0을 데이터 처리 및 통계 분석에 사용하였다. 드루젠성 병변의 총 면적, 가장 큰 드루젠성 병변의 크기, 드루젠성 병변의 양을 대응 표본 T 검정으로 분석하였다. 차이는 p 값이 <0.05일 때 통계적으로 유의한 것으로 간주되었다.
임상 결과 측정을 위한 기준은 도 6를 참조한다.
실시예 4.4. 결과
실시예 4.4.1. 드루젠성 병변의 총 면적
드루젠성 병변의 총 면적은 표 14에 제시되어 있고, 면적 변화는 표 15 및 도 7에 제시되어 있다.
비히클 그룹의 7개 눈의 경우, 드루젠성 병변의 총 면적이 기준선과 비교하여 투여 후 30일차, 60일차, 90일차, 120일차에 유의하게 증가하였다(p<0.05). 이는 비히클 그룹의 건성 AMD가 4개월의 비히클 투여 후 뚜렷이 발생했음을 시사한다.
2.5 mg/kg SodA2 그룹의 7개 눈의 경우, 드루젠성 병변의 총 면적은 기준선과 비교하여 투여 후 30일차, 60일차, 90일차 및 120일차에 유의하게 변화하지 않았고, 2.5 mg/kg SodA2 그룹에서 드루젠 병변의 총 면적 변화량은 비히클 그룹보다 유의하게 낮았다(p<0.05). 이는 SodA2이 건성 AMD의 진행을 지연시켰음을 시사한다.
그룹 원숭이 ID-눈 Area (mm2)
기준선 D30 D60 D90 D120
2.5mg/kg SodA2
(n=7개 눈)		 275 OD 0.810 0.757 0.779 0.807 0.805
275 OS 1.310 1.280 1.222 1.252 1.285
2026 OD 0.400 0.457 0.443 0.451 0.541
2026 OS 0.559 0.642 0.654 0.626 0.717
3702 OD 1.656 1.871 1.884 1.963 2.268
3702 OS 1.375 1.698 1.622 1.708 1.670
5214 OS 2.692 2.578 2.663 2.532 2.432
평균±SD 1.257±0.781 1.326±0.769 1.324±0.788 1.334±0.768 1.388±0.760
비히클
(n=7개 눈)		 1976 OD 1.012 0.840 0.958 0.961 1.052
1976 OS 0.761 0.779 0.750 0.778 0.820
5170 OD 7.523 9.225 9.090 9.058 9.571
5196 OD 1.214 1.518 1.498 1.550 1.584
5196 OS 1.221 1.455 1.341 1.486 1.541
13116 OD 7.937 8.644 9.141 9.097 9.051
13116 OS 9.685 10.478 10.504 10.486 10.508
평균±SD 4.193±3.976 4.706±4.479* 4.755±4.542* 4.774±4.498* 4.875±4.550*
기준선과 비교하여, * p<0.05
그룹 원숭이 ID-눈 면적 변화(mm2)
기준선 D30 D60 D90 D120
2.5mg/kg SodA2
(n=7개 눈)		 275 OD 0.000 -0.053 -0.031 -0.003 -0.005
275 OS 0.000 -0.030 -0.088 -0.058 -0.025
2026 OD 0.000 0.057 0.043 0.051 0.141
2026 OS 0.000 0.083 0.095 0.067 0.158
3702 OD 0.000 0.215 0.228 0.307 0.612
3702 OS 0.000 0.323 0.247 0.333 0.295
5214 OS 0.000 -0.114 -0.029 -0.160 -0.260
평균 ± SD 0.000±0.000 0.069±0.155* 0.066±0.131* 0.077±0.183* 0.131±0.275*
비히클
(n=7개 눈)		 1976 OD 0.000 -0.172 -0.054 -0.051 0.040
1976 OS 0.000 0.018 -0.011 0.017 0.059
5170 OD 0.000 1.702 1.567 1.535 2.048
5196 OD 0.000 0.304 0.284 0.336 0.370
5196 OS 0.000 0.234 0.120 0.265 0.320
13116 OD 0.000 0.707 1.204 1.160 1.114
13116 OS 0.000 0.793 0.819 0.801 0.823
평균 ± SD 0.000±0.000 0.512±0.628 0.561±0.641 0.580±0.602 0.682±0.719
면적 변화 = 현재 면적 - 기준선 면적;
비히클 그룹의 면적 변화와 비교하여, *p<0.05.
실시예 4.4.2 가장 큰 드루젠성 병변의 크기
가장 큰 드루젠성 병변의 크기는 표 16에 제시되어 있고, 면적 변화량은 표 17 및 도 8에 제시되어 있다.
비히클 그룹의 7개 눈의 경우, 가장 큰 드루젠성 병변의 크기는 90일차 및 120일차에 증가하였지만, 기준선과 비교하여 통계적 유의성은 없었다. 이는 비히클 그룹에서 건성 AMD의 진행은 4개월의 비히클 투여 후 뚜렷이 진척되었음을 시사한다.
2.5 mg/kg SodA2그룹의 7개 눈의 경우, 가장 큰 드루젠성 병변의 크기는 기준선과 비교하여 투여 후 유의한 변화가 없었다. 이는 2.5 mg/kg의 SodA2이 건성 AMD의 진행을 지연시켰음을 시사한다.
그룹 원숭이 ID-눈 직경(mm)
기준선 D30 D60 D90 D120
2.5mg/kg SodA2
(n=7개 눈) 		275 OD 0.429 0.428 0.422 0.426 0.424
275 OS 0.461 0.485 0.476 0.481 0.481
2026 OD 0.167 0.169 0.163 0.161 0.161
2026 OS 0.198 0.202 0.200 0.197 0.187
3702 OD 0.268 0.280 0.282 0.288 0.289
3702 OS 0.309 0.327 0.319 0.307 0.310
5214 OS 0.234 0.223 0.221 0.210 0.194
평균 ± SD 0.295±0.113 0.302±0.119 0.298±0.117 0.296±0.120 0.292±0.123
비히클
(n=7개 눈) 		1976 OD 0.223 0.183 0.187 0.180 0.178
1976 OS 0.229 0.238 0.232 0.239 0.232
5170 OD 0.571 0.615 0.613 0.626 0.608
5196 OD 0.257 0.255 0.245 0.252 0.264
5196 OS 0.320 0.322 0.338 0.334 0.336
13116 OD 0.335 0.327 0.332 0.330 0.337
13116 OS 0.309 0.315 0.316 0.382 0.361
평균 ± SD 0.321±0.119 0.322±0.140 0.323±0.140 0.335±0.146 0.331±0.139
그룹 원숭이 ID-눈 크기 변화(mm)
기준선 D30 D60 D90 D120
2.5mg/kg SodA2
(n=7개 눈) 		275 OD 0.000 -0.001 -0.007 -0.003 -0.005
275 OS 0.000 0.024 0.015 0.020 0.020
2026 OD 0.000 0.002 -0.004 -0.006 -0.006
2026 OS 0.000 0.004 0.002 -0.001 -0.011
3702 OD 0.000 0.012 0.014 0.020 0.021
3702 OS 0.000 0.018 0.010 -0.002 0.001
5214 OS 0.000 -0.011 -0.013 -0.024 -0.040
평균 ± SD 0.000±0.000 0.007±0.012 0.002±0.011 0.001±0.015 -0.003±0.021
비히클
(n=7개 눈) 		1976 OD 0.00 -0.040 -0.036 -0.043 -0.045
1976 OS 0.00 0.009 0.003 0.010 0.003
5170 OD 0.00 0.044 0.042 0.055 0.037
5196 OD 0.00 -0.002 -0.012 -0.005 0.007
5196 OS 0.00 0.002 0.018 0.014 0.016
13116 OD 0.00 -0.008 -0.003 -0.005 0.002
13116 OS 0.00 0.006 0.007 0.073 0.052
평균 ± SD 0.000±0.000 0.002±0.025 0.003±0.024 0.014±0.039 0.010±0.031
크기 변화 = 현재 크기 - 기준선 크기
실시예 4.4.3. 케이지 관찰
투여 전후에 각 그룹의 원숭이의 행동, 자율신경 활성도, 피부, 털, 배설, 및 눈에서 유의한 이상은 발견되지 않았다. 본 연구에서는 독성 관련 문제가 발견되지 않았다.
실시예 4.4.4. 체중
투여 기간 동안 각 그룹의 원숭이에서 체중의 뚜렷한 변화는 발견되지 않았다. 관련 결과는 표 18에 제시되어 있으며, 체중은 kg(평균 ± SD)이다.
연구 일자 2.5 mg/kg SodA2
（n=4）		 비히클
（n=4）
기준선 7.51±2.08 6.53±0.76
D7 7.51±1.97 6.58±0.59
D14 7.60±2.08 6.60±0.45
D22 7.61±2.12 6.71±0.61
D30 7.68±2.37 6.71±0.61
D37 7.58±2.28 6.62±0.56
D45 7.73±2.44 6.56±0.44
D52 7.86±2.59 6.67±0.55
D60 7.85±2.55 6.69±0.68
D67 7.64±2.39 6.62±0.46
D75 7.72±2.40 6.62±0.49
D82 7.83±2.60 6.67±0.40
D90 7.96±2.82 6.69±0.44
D97 7.94±2.79 6.71±0.37
D105 8.03±2.88 6.62±0.44
D112 8.12±2.96 6.86±0.43
D120 8.07±2.82 6.82±0.43
실시예 4.4.5. 혈액 생화학
투여 기간 동안 각 그룹의 원숭이에서 혈액 생화학의 뚜렷한 변화는 발견되지 않았다. 관련 결과를 도 9에 도시하였다(평균±SD로 표시됨).
실시예 4.4.6 혈액 혈액학
투여 기간 동안 각 그룹의 원숭이에서 혈액 혈액학의 뚜렷한 변화는 발견되지 않았다. 관련 결과를 도 10에 도시하였다(평균±SD로 표시됨).
실시예 4.4.7. 결론
비히클 그룹의 7개 눈의 경우, 투여 후 30일차, 60일차, 90일차 및 120일차에 드루젠성 병변의 총 면적이 기준선과 비교하여 유의하게 증가하였고(p<0.05); 가장 큰 드루젠형 병변의 크기는 90일차 및 120일차에 증가했지만, 기준선과 비교하여 통계적 유의성은 발견되지 않았고; 이는 드루젠형 병변이 비히클을 4개월 투여받은 비히클 그룹의 원숭이에서 발생하였음을 시사한다.
2.5 mg/kg SodA2 그룹의 7개 눈의 경우, 드루젠형 병변의 총 면적은 기준선과 비교하여 투여 후 유의하게 변화하지 않았고; 드루젠형 병변의 총 면적 변화는 비히클 그룹보다 유의하게 낮았고(p<0.05); 가장 큰 드루젠형 병변의 크기는 기준선과 비교하여 투여 후 유의하게 변화하지 않았으나, 감소하는 경향성을 보였다. 이는 2.5 mg/kg의 SodA2이 드루젠형 병변의 진행을 지연시켰음을 시사한다.
한편, 4개월 투여 동안 각 그룹의 원숭이의 체중, 혈액 생화학 및 혈액학에 있어서 명백한 변화는 발견되지 않았다. 이 연구에서는 독성 관련 문제가 발견되지 않았다. 결론적으로, SodA2의 경구 투여는 독성 관련 문제 없이 건성 AMD의 드루젠성 병변의 진행을 지연시킬 수 있다.

Claims (30)

  1. 수퍼옥시드 디스뮤타제(superoxide dismutase; SOD)를 유효성분으로 포함하는 건성 황반변성을 치료 또는 예방하기 위한 약학 조성물.
  2. 제1항에 있어서,
    상기 조성물은 드루젠 또는 드루젠성 병변을 감소시키거나 그의 형성을 방지하는
    약학 조성물.
  3. 제1항에 있어서,
    상기 SOD는 단리 또는 정제된 효소인
    약학 조성물.
  4. 제1항에 있어서,
    상기 SOD는 망간에 결합하는 것인
    약학 조성물.
  5. 제1항에 있어서,
    상기 SOD는 탈아미드화된 Mn-SOD인
    약학 조성물.
  6. 제1항에 있어서,
    상기 SOD는 바실러스 종 균주로부터 유래된 것인
    약학 조성물.
  7. 제1항에 있어서,
    상기 SOD는 바실러스 아밀로리퀴파시엔스 GF423 균주(KCTC 13222 BP)로부터 유래된 것인
    약학 조성물.
  8. 제1항에 있어서,
    상기 SOD는 서열번호 2를 기준으로 73번 및 136번 아미노산 잔기가 Asp로 치환된 것인
    약학 조성물.
  9. 제1항에 있어서,
    상기 SOD는 서열번호 4로 표시되는 아미노산 서열을 갖는,
    약학 조성물.
  10. 제1항에 있어서,
    상기 SOD는 경구 또는 비경구 투여되는
    약학 조성물.
  11. 수퍼옥시드 디스뮤타제(superoxide dismutase; SOD)를 유효성분으로 포함하는 건성 황반변성을 치료 또는 예방하기 위한 수의학적 조성물.
  12. 수퍼옥시드 디스뮤타제(superoxide dismutase; SOD)를 유효성분으로 포함하는 건성 황반변성을 개선 또는 예방하기 위한 식품 조성물.
  13. 제12항에 있어서,
    상기 SOD는 단리 또는 정제된 효소인
    식품 조성물.
  14. 제12항에 있어서,
    상기 SOD는 균주 배양물, 균주 배양 농축액, 또는 그의 건조 형태로 포함되는
    식품 조성물.
  15. 제12항에 있어서,
    상기 SOD는 망간에 결합하는 것인
    식품 조성물.
  16. 제12항에 있어서,
    상기 SOD는 탈아미드화된 Mn-SOD인
    식품 조성물.
  17. 제12항에 있어서,
    상기 SOD는 바실러스 종 균주로부터 유래된 것인
    식품 조성물.
  18. 제12항에 있어서,
    상기 SOD는 바실러스 아밀로리퀴파시엔스로부터 유래된 것인
    식품 조성물.
  19. 제12항에 있어서,
    상기 SOD는 서열번호 2를 기준으로 73번 및 136번 아미노산 잔기가 Asp로 치환된 것인
    식품 조성물.
  20. 수퍼옥시드 디스뮤타제(superoxide dismutase; SOD)를 유효성분으로 포함하는 건성 황반변성을 개선 또는 예방하기 위한 사료 조성물.
  21. 제1항 내지 제10항 중 어느 한 항에 따른 약학 조성물 또는 수퍼옥시드 디스뮤타제(superoxide dismutase; SOD)를 대상에 투여하는 단계를 포함하는 건성 황반변성을 치료 또는 예방하기 위한 방법.
  22. 제21항에 있어서,
    상기 SOD의 투여를 통해 대상에서 드루젠 또는 드루젠성 병변을 감소시키거나 그의 형성을 방지하는
    방법.
  23. 제21항에 있어서,
    상기 SOD는 경구 또는 비경구 투여하는
    방법.
  24. 바실러스 종 균주로부터 유래되고 서열번호 2를 기준으로 73번 및 136번 아미노산 잔기가 Asp로 치환된 수퍼옥시드 디스뮤타제.
  25. 제24항에 있어서,
    서열번호 4의 아미노산 서열로 이루어진 수퍼옥시드 디스뮤타제.
  26. 제24항 또는 제25항에 따른 수퍼옥시드 디스뮤타제 폴리펩티드를 코딩하는 폴리뉴클레오티드.
  27. 서열번호 2를 기준으로 73번 및 136번 아미노산 잔기가 Asp로 치환된 아미노산 서열을 포함하는 폴리펩티드를 코딩하는 뉴클레오티드 서열을 포함하고 하기 유전자가 결실된 바실러스 종 균주:
    AprE, NprE, Bpr, Epr, NprB, Vpr, Mpr, IspA, SrfAC, spoIIAc, EpsE 및 Xpf.
  28. 도 4에 도시된 발현 벡터를 포함하는 재조합 균주.
  29. 제1항 내지 제10항 중 어느 한 항에 따른 약학 조성물 또는 수퍼옥시드 디스뮤타제(superoxide dismutase; SOD)의 건성 황반변성을 예방 또는 치료하기 위한 용도.
  30. 제1항 내지 제10항 중 어느 한 항에 따른 약학 조성물 또는 수퍼옥시드 디스뮤타제(superoxide dismutase; SOD)의 건성 황반변성 예방 또는 치료를 위한 약제 제조용 용도.
PCT/KR2022/007001 2021-12-23 2022-05-16 수퍼옥시드 디스뮤타제 및 이의 건성 황반변성의 예방 또는 치료용 용도 WO2023120828A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0185912 2021-12-23
KR20210185912 2021-12-23

Publications (1)

Publication Number Publication Date
WO2023120828A1 true WO2023120828A1 (ko) 2023-06-29

Family

ID=86378974

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/007001 WO2023120828A1 (ko) 2021-12-23 2022-05-16 수퍼옥시드 디스뮤타제 및 이의 건성 황반변성의 예방 또는 치료용 용도

Country Status (2)

Country Link
KR (1) KR102531246B1 (ko)
WO (1) WO2023120828A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040063943A (ko) * 2001-12-14 2004-07-14 알콘 인코포레이티드 안과 질환 및 질병의 치료를 위한 과산화물 디스뮤타제모방체
US7270991B2 (en) * 2001-07-10 2007-09-18 The Secretary Of State For Defense Expression system
JP2012200168A (ja) * 2011-03-24 2012-10-22 Kao Corp 遺伝子欠損株及びそれを用いたタンパク質の製造方法
US20140335068A1 (en) * 2007-03-22 2014-11-13 The Catholic University Of Korea Industry-Academic Cooperation Foundation Novel use of ec-sod for treating angiogenesis-mediated eye diseases
US20210275645A1 (en) * 2020-02-12 2021-09-09 Genofocus, Inc. Compositions and methods for preventing or treating macular degeneration

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2729605A1 (en) * 2008-06-30 2010-01-14 The Johns Hopkins University Compositions and methods for the treatment of ocular oxidative stress and retinitis pigmentosa
PL2433640T3 (pl) * 2010-09-24 2020-06-01 Omnivision Gmbh Kompozycja zawierająca SOD, luteinę i zeaksantynę
KR101214364B1 (ko) * 2011-02-15 2012-12-21 한림대학교 산학협력단 수퍼옥사이드 디스뮤테이즈 융합 단백질을 함유하는 안과 질환 예방 또는 치료용 약제학적 조성물

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7270991B2 (en) * 2001-07-10 2007-09-18 The Secretary Of State For Defense Expression system
KR20040063943A (ko) * 2001-12-14 2004-07-14 알콘 인코포레이티드 안과 질환 및 질병의 치료를 위한 과산화물 디스뮤타제모방체
US20140335068A1 (en) * 2007-03-22 2014-11-13 The Catholic University Of Korea Industry-Academic Cooperation Foundation Novel use of ec-sod for treating angiogenesis-mediated eye diseases
JP2012200168A (ja) * 2011-03-24 2012-10-22 Kao Corp 遺伝子欠損株及びそれを用いたタンパク質の製造方法
US20210275645A1 (en) * 2020-02-12 2021-09-09 Genofocus, Inc. Compositions and methods for preventing or treating macular degeneration

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
"GENOFOCUS CO., LTD. Quarterly Report", 17 May 2021, GENOFOCUS, South Korea, article ANONYMOUS: "GENOFOCUS CO., LTD. Quarterly Report", pages: 1 - 226, XP009547499 *
"Remington's Pharmaceutical Science", MACK PUBLISHING COMPANY
ERICA L. FLETCHER: "Studying Age-Related Macular Degeneration Using Animal Models", OPTOM VIS SCI., vol. 91, no. 8, 2014, pages 878 - 886
HEMA L. RAMKUMAR: "Retinal ultrastructure of murine models of dry age-related macular degeneration (AMD", PROGRESS IN RETINAL AND EYE RESEARCH, vol. 29, no. 3, 2010, pages 169 - 190, XP002690745, DOI: 10.1016/j.preteyeres.2010.02.002
LEE HYEJOONG, DAESUNG SHIN: "Newswalker_Bio Industry Diagnosis⑥_Genofocus] Debts soared due to decrease in deficit accumulated capital", 29 November 2021 (2021-11-29), pages 1 - 9, XP093074080, Retrieved from the Internet <URL:http://www.newsworker.co.kr/news/articleView.html?idxno=138240> [retrieved on 20230816] *
P. SICARD: "Dietary Superoxide Dismutase Protects Against Light- Induced Retinal Oxidative Stress in Young Senescence Accelerated Mice (SAM", INVEST OPHTHALMOL VIS SCI, vol. 47, 2006, pages 2089

Also Published As

Publication number Publication date
KR102531246B1 (ko) 2023-05-11

Similar Documents

Publication Publication Date Title
AU2020336649B2 (en) Akkermansia muciniphila EB-AMDK19 strainand use thereof
WO2019216662A1 (ko) 락토바실러스 파라카제이 균주 및 그 용도
AU2020339348B2 (en) Akkermansia muciniphila EB-AMDK27 strain and use thereof
WO2013129739A1 (ko) 봉독-ｐｌａ2를 포함하는 이상 조절 ｔ 세포 활성 저하 관련 질환의 치료 또는 예방용 약학적 조성물
WO2022131791A1 (ko) 다중구리 산화효소 펩타이드를 포함하는 구리대사 관련 신경계 질환의 예방 또는 치료용 조성물
US20230285517A1 (en) Compositions comprising enzymes and probiotics, and methods for preventing or treating macular degeneration
WO2023120828A1 (ko) 수퍼옥시드 디스뮤타제 및 이의 건성 황반변성의 예방 또는 치료용 용도
WO2011102690A2 (ko) 둥근잎유홍초 추출물을 함유하는 당뇨병 치료용 약학적 조성물
WO2020226438A1 (ko) 염증성 장질환의 예방 또는 치료용 펩타이드
WO2023113541A1 (en) Pharmaceutical composition for preventing or treating cancer or inflammatory disease
WO2022092919A1 (ko) 신규한 비피도박테리움 롱검 z1 균주 및 이의 용도
WO2022163971A1 (ko) 콜린에스터라제 억제제 및 항산화제를 포함하는 뇌질환 치료용 약학적 복합 조성물
WO2023128078A1 (ko) 수퍼옥시드 디스뮤타제 및 이의 건성안의 예방 또는 치료용 용도
WO2023224136A1 (ko) 수퍼옥시드 디스뮤타제 및 이의 당뇨망막병증 또는 포도막염의 예방 또는 치료용 용도
WO2019078381A1 (ko) 엔테로코커스 패칼리스, 이의 배양액 또는 이의 사균체를 유효성분으로 함유하는 근육감퇴, 약화 및 근위축 예방, 개선 또는 치료용 약학 조성물, 식품 조성물 및 식품첨가제
KR102518033B1 (ko) 수퍼옥시드 디스뮤타제 및 이의 당뇨망막병증 또는 포도막염의 예방 또는 치료용 용도
KR20230099595A (ko) 수퍼옥시드 디스뮤타제 및 이의 건성안의 예방 또는 치료용 용도
WO2021201507A1 (ko) 갈색거저리 유충 단백질 또는 이의 가수분해물을 유효성분으로 포함하는 근감소증의 예방, 개선 또는 치료용 조성물
WO2023106839A1 (ko) Il-12를 발현하는 재조합 백시니아 바이러스 및 이의 용도
WO2022071753A1 (ko) Plgf를 포함하는 신경정신질환의 예방 또는 치료용 조성물
WO2023224135A1 (ko) 수퍼옥시드 디스뮤타제 및 이의 점막염 예방 또는 치료용 용도
WO2024215162A1 (ko) 단일 융합 단백질 및 이를 포함하는 약학적 조성물
WO2024096644A1 (ko) 락토바실러스 델브루키 subsp. 락티스 균주의 신규 용도
WO2013024968A1 (ko) 유홍초속에서 분리한 신규화합물 및 이를 유효성분으로 포함하는 당뇨병의 예방 또는 치료용 조성물
WO2023158204A1 (en) Pharmaceutical composition for preventing or treating cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22911468

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022911468

Country of ref document: EP

Effective date: 20240723