Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y401/00—Carbon-carbon lyases (4.1)
  • C12Y401/01—Carboxy-lyases (4.1.1)
  • C12Y401/01011—Aspartate 1-decarboxylase (4.1.1.11)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/52—Genes encoding for enzymes or proenzymes
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/70—Vectors or expression systems specially adapted for E. coli
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/88—Lyases (4.)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
  • C12P13/00—Preparation of nitrogen-containing organic compounds
  • C12P13/02—Amides, e.g. chloramphenicol or polyamides; Imides or polyimides; Urethanes, i.e. compounds comprising N-C=O structural element or polyurethanes
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
  • C12R2001/00—Microorganisms ; Processes using microorganisms
  • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
  • C12R2001/185—Escherichia
  • C12R2001/19—Escherichia coli

Definitions

• the present invention relates to the field of microorganisms, and in particular to the application of aspartate decarboxylase in fermentative production of vitamin B5.
• Vitamin B5 also known as D-Pantothenic acid, is a water-soluble vitamin. It is a component of coenzyme A and acyl carrier protein. It serves as a cofactor for more than 70 enzymes and participates in the synthesis of sugar and fat. , protein and energy metabolism, and plays an important role in regulating physiological metabolism.
• VB5 is mainly used in animal feed additives, food additives and pharmaceutical raw materials. With the discovery of new functions of VB5 and the expansion of application fields, its market demand will still show a steady growth trend.
• the industrial production method of VB5 is chemical synthesis. Enterprises basically use the isobutyraldehyde-formaldehyde-hydrocyanic acid method to synthesize DL-pantolactone. DL-pantolactone further L-pantolactone is obtained through chemical or enzymatic separation, and finally L-pantolactone is synthesized with ⁇ -alanine produced from acrylonitrile to synthesize VB5.
• the main raw materials for chemical synthesis of VB5 are flammable, explosive, and highly toxic. The production process will produce cyanide-containing wastewater, which is difficult to treat, causing VB5 to become a heavily polluting industry.
• ⁇ -Alanine serves as a C3 substrate and D-pantoic acid to synthesize VB5.
• ⁇ -Alanine is produced from aspartate by catalyzing L-aspartate ⁇ -decarboxylase encoded by the panD gene. The initially translated and synthesized PanD is a zymogen without catalytic activity.
• the zymogen is spontaneously cleaved at the Gly-Ser bond to produce two subunits, of which the N-terminal subunit containing a pyruvyl group has a catalytic effect.
• the mature PanD pyruvyl group has formed with the substrate When transitioning to an intermediate state, amino transfer occurs easily, leading to irreversible loss of enzyme activity.
• the accumulation of ⁇ -alanine is also regulated by the concentration of coenzyme A, a downstream metabolite of VB5.
• the protein complex formed by coenzyme A and PanD/PanZ feedback negatively regulates the expression of PanD.
• PanD not only has a slow maturation process of post-translational modifications, but also has problems with catalytic inactivation and feedback inhibition, resulting in a very low synthesis efficiency of ⁇ -alanine, the C3 precursor of VB5, limiting the efficient synthesis of VB5.
• a large amount of ⁇ -alanine needs to be exogenously added to the fermentation medium (Sahm, H., et al., (1999) Appl Environ Microb, 65, 1973-1979; Dusch, N. , et al., (1999) Appl Environ Microb, 65, 1530-1539; Zhang, B., et al., (2019) Food Chemistry, 294, 267-275.). Therefore, the biosynthesis of ⁇ -alanine is the metabolic bottleneck for fermentation production of VB5.
• L-aspartate ⁇ -decarboxylase 16 key enzymes, L-aspartate ⁇ -decarboxylase, originating from different bacterial genera and with large evolutionary differences.
• L-aspartate ⁇ -decarboxylase encoded by the panD gene, catalyzes the decarboxylation of L-aspartate to produce ⁇ -alanine.
• the present invention provides the application of enhancing the expression of L-aspartate ⁇ -decarboxylase gene panD in the production of vitamin B5;
• the L-aspartate ⁇ -decarboxylase is derived from Bacillus licheniformis.
• the L-aspartate alpha-decarboxylase gene panD has:
• nucleotide sequence shown in (I) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (I), and having the same or similar function as the nucleotide sequence shown in (I) the nucleotide sequence; or
• panB, panC and/or panE genes (3). Increase the copy number of panB, panC and/or panE genes.
• the present invention also provides an expression vector comprising the L-aspartate ⁇ -decarboxylase gene panD;
• the L-aspartate ⁇ -decarboxylase is derived from Bacillus licheniformis.
• the expression vector further includes:
• the present invention also provides a host expressing the L-aspartate ⁇ -decarboxylase gene panD derived from Bacillus licheniformis.
• the host further includes:
• the host is transfected or transformed with the expression vector as described in claim 4 or 5;
• the host is derived from Escherichia coli, preferably Escherichia coli K12, more preferably Escherichia coli K12MG1655 strain.
• the present invention also provides the use of the expression vector and the host in producing vitamin B5.
• the present invention also provides a method for producing vitamin B5.
• the host is used as a fermentation strain, fermentation is carried out without adding ⁇ -alanine, the fermentation liquid is collected, and the supernatant is centrifuged to obtain vitamin B5.
• the invention discloses a highly active aspartate decarboxylase and a method for producing vitamin B5.
• the present invention screens out L-aspartate ⁇ -decarboxylase derived from Bacillus licheniformis, and its activity in catalyzing the production of ⁇ -alanine is significantly higher than that of PanD from other sources.
• PanD derived from B.licheniformis was used to construct engineering bacteria for fermentation and production of vitamin B5, which relieved the ⁇ -alanine metabolism bottleneck in the biosynthesis of vitamin B5.
• the biological method of the present invention produces vitamin B5, which has renewable raw materials, waste residue, waste water and waste gas. It has the advantages of easy processing and resource utilization, so it can be used in the industrial production of vitamin B5 in practice and has important application value.
• the invention discloses the application of aspartate decarboxylase in the fermentation production of vitamin B5. , those skilled in the art can learn from the content of this article and appropriately improve the implementation of process parameters. It should be noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are deemed to be included in the present invention.
• the methods and applications of the present invention have been described through preferred embodiments. Relevant persons can obviously make modifications or appropriate changes and combinations to the methods and applications described herein without departing from the content, spirit and scope of the present invention to achieve and Apply the technology of this invention.
• panD genes of the present invention are respectively derived from Bacillus amyloliquefaciens, Bacillus subtilis, Bacillus licheniformis, Chlorobium phaeobacteroides, Corynebacterium efficiens, Corynebacterium glutamicum, Corynebacterium marinum, Escherichia coli, Haloquadratum walsbyi, Hydrothermal vent metagenome, methane Methanocaldococcus jannaschii, Magnetospirillum magneticum, Metarhizium robertsii, Mine drainage metagenome, Rhodopirellula baltica and Thermotoga maritima).
• the present invention uses the same bicistronic design element BCD2 (Nature Methods, 2013, 10 (4): 354-360) to regulate the above 16 different sources.
• BCD2 bicistronic design element
• the BCD element introduces a leading cistron sequence before the exogenous structural gene.
• the translation intensity of BCD is highly related to the affinity of the RBS core sequence and the ribosomal subunit, and has little correlation with the gene coding sequence, thereby avoiding interference from 16 different panD gene sequences on the same translation initiation element.
• the present invention connects the above 16 BCD2-panD sequences to plasmids to construct 16 recombinant plasmids pET28a-BCD2-panD, using the corresponding The same promoter regulates transcription.
• the plasmid vector used in the present invention can be a pET series vector, such as pET28a, pET32a, pET3, etc.; it can also be a pQE series vector or other Escherichia coli expression vector.
• the promoter of the present invention may be a T7 promoter or the like.
• the present invention transforms the above recombinant plasmid into derivative strains of E. coli B, including BL21, BL21-Codonplus (RIL), BL21 (DE3), BL21 Star, C41 (DE3), BL21 (DE3) pLys S/E, BL21-CodonPlus (DE3) strain, Origami (DE3) strain, Rosetta-gammi (DE3) strain, etc., to obtain whole-cell catalytic engineering bacteria.
• the obtained target gene and vector are usually digested with restriction endonucleases and ligated with T4 ligase to construct a recombinant vector.
• the recombinant vector can be transformed into host cells through conventional calcium chloride chemical transformation or electroporation transformation methods in molecular biology experiments to obtain engineered bacteria that can be used for whole-cell catalysis.
• the present invention uses a whole-cell catalysis method to screen efficient L-aspartate ⁇ -decarboxylase.
• bacterial cells are first cultured in a liquid culture medium, and the expression of L-aspartate ⁇ -decarboxylase is induced at an appropriate time.
• the medium used for the growth of engineered bacteria can be a rich medium or an inorganic salt medium.
• the culture medium contains carbon sources, nitrogen sources, inorganic ions, antibiotics and other nutritional factors.
• carbon source sugars such as glucose, lactose, and galactose may be used; alcohols such as glycerin and mannitol may be used; and organic acids such as gluconic acid, citric acid, and succinic acid may be used.
• inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium phosphate, and ammonium chloride can be used; organic nitrogen sources such as corn steep liquor, soybean meal hydrolyzate, hair powder, yeast extract, and peptone can also be used.
• Inorganic ions include one or more of iron, calcium, magnesium, manganese, molybdenum, cobalt, copper, potassium and other ions.
• Other nutritional factors also include vitamins such as vitamin B1, pyridoxal, and biotin.
• the culture process is preferably carried out under aerobic conditions for about 5-48 hours.
• the culture temperature is usually controlled at 25-45°C, and the pH is usually controlled at 5-8.
• After culturing for 3 to 40 hours start adding at least one inducer selected from IPTG, lactose, and allolactose.
• the inducer can be added in a one-time, intermittent, or continuous manner.
• the amount of inducer added is 0.01 to 1 mmol.
• the substrate L-aspartic acid added at once is usually preferably L-aspartic acid, L-aspartic acid sodium salt, or L-aspartic acid potassium salt. , L-aspartate ammonium salt, etc.
• the pH value of the catalytic solution continues to rise, and acid needs to be added to maintain the pH in a range conducive to whole-cell catalysis, usually above 4.0, preferably 5.0 or above, more preferably 5.5 or more, usually 8.0 or less, preferably 7.5 or less, more preferably 6.8 or less.
• the acid used here is L-aspartic acid.
• the temperature of the catalytic reaction is usually between 25°C and 60°C, preferably between 30°C and 45°C.
• the temperature during the catalytic process can be set to a fixed value in the above range, or it can be a variable value from low to high.
• the present invention further applies the screened high-efficiency L-aspartate ⁇ -decarboxylase to construct engineering bacteria for producing vitamin B5 through fermentation, thereby relieving the ⁇ -alanine metabolism bottleneck in biosynthesizing vitamin B5.
• the E. coli for producing VB5 by fermentation method of the present invention expresses the panB, panC and panE genes on the VB5 terminal synthesis pathway.
• the panB gene of Escherichia coli encodes ketopantoate hydroxymethyltransferase, which catalyzes the addition of a methyl group to the substrate a-ketoisovalerate to form ketopantoate.
• Ketopantoate is reduced to pantoate by ketopantoate reductase encoded by the panE gene.
• Pantothenate synthase encoded by the panC gene further catalyzes the condensation of pantoate and ⁇ -alanine to form VB5.
• the panBC gene was amplified by PCR using the genome of E. coli K12MG1655 as a template.
• the strong promoter Ptrc was designed to be introduced into the amplification primer, and BamHI and SphI restriction endonuclease sites were designed at both ends of the primer.
• the Ptrc-panBC product obtained by PCR amplification was identified and recovered by gel electrophoresis, and then double-digested with BamHI and SphI, and simultaneously double-digested the pACYC184 plasmid.
• the double-digested Ptrc-panBC and pACYC184 plasmids were recovered by gel electrophoresis.
• the ligation products were chemically transformed into Escherichia coli DH5 ⁇ competent cells. After recovery for 1 hour, the plasmids were spread on chloramphenicol plates. The coated plate was placed in a 37°C incubator for 12 hours, a single colony was picked for passage, and the recombinant plasmid was extracted and sequenced to obtain the correct recombinant plasmid pACYC184-Ptrc-panBC.
• the panE gene was amplified by PCR using the genome of E. coli K12MG1655 as a template.
• the strong promoter PJ23119 was designed to be introduced into the amplification primer, and SphI and BsaBI restriction endonuclease sites were designed at both ends of the primer.
• the PJ23119-panE product obtained by PCR amplification was identified and recovered by gel electrophoresis, and then double-digested with BamHI and SphI to simultaneously double-digest the pACYC184-Ptrc-panBC plasmid.
• the double-digested PJ23119-panE and pACYC184-Ptrc-panBC plasmids were recovered by gel electrophoresis.
• the ligation products were chemically transformed into E. coli DH5 ⁇ competent cells. After recovery for 1 hour, the plasmids were spread on chloramphenicol plates. The coated plate was placed in a 37°C incubator for 12 hours, a single colony was picked for passage, the recombinant plasmid was extracted and sequenced, and the correct recombinant plasmid pACYC184-Ptrc-panBC-PJ23119-panE was obtained, thereby overexpressing the vitamin B5 terminal Recombinant plasmids for synthetic pathway genes.
• the ilvG gene of Escherichia coli K12MG1655 is mutated and inactivated.
• the present invention introduces the active ilvG gene of Escherichia coli BL21 to improve the synthesis supply of VB5 precursors.
• the present invention inserts the ilvG + M gene derived from E. coli BL21 into the chromosome of E. coli K12MG1655, uses the trc strong promoter to regulate the transcription initiation of ilvG + M, and uses the terminator Ter to regulate the transcription termination of ilvG + M.
• the insertion site of the ilvG + M gene in the chromosome is the coding sequence of the avtA gene, which causes the inactivation of AvtA and weakens the synthesis of valine, thus weakening the competition pathway of VB5 and favoring the biosynthesis of VB5.
• the engineered strain E.coli MG1655 avtA:ilvG + M was constructed to improve the synthesis pathway of VB5 precursor acetolactate and weaken the valine competition pathway.
• the avtA gene of E. coli K12 MG1655 is integrated with the three panD genes with higher activity selected above, which are respectively derived from Bacillus subtilis, Bacillus licheniformis and Corynebacterium glutamicum. glutamicum). These three genes use the same strong promoter PPL and the same BCD2 to regulate transcription and translation initiation respectively.
• the recombinant plasmid pACYC184-Ptrc-panBC-PJ23119-panE constructed above was transformed into the engineering strain E.coli MG1655 avtA:panDBs-ilvG + M, the engineering strain E.coli MG1655 avtA:panDBl-ilvG + M and the engineering strain E.coli From MG1655 avtA:panDCg-ilvG + M, an engineering strain for producing VB5 by fermentation was obtained. Compare the VB5 production of engineering bacteria through shake flask fermentation to verify the optimal PanD.
• the culture medium contains carbon sources, nitrogen sources, inorganic ions, antibiotics and other nutritional factors.
• carbon source sugars such as glucose, lactose, and galactose can be used.
• inorganic nitrogen source you can use ammonia, ammonium sulfate, ammonium phosphate, ammonium chloride and other inorganic nitrogen sources;
• organic nitrogen source you can use corn steep liquor, soybean meal hydrolyzate, hair powder, yeast extract, peptone and other organic nitrogen sources.
• Inorganic ions include one or more of iron, calcium, magnesium, manganese, molybdenum, cobalt, copper, potassium and other ions.
• the experimental methods in the following examples are all conventional methods unless otherwise specified.
• the test materials used in the following examples were all purchased from conventional biochemical reagent stores unless otherwise specified.
• the quantitative experiments in the following examples were repeated three times, and the results were averaged.
• the technical means used in the examples are conventional means well known to those skilled in the art and commercially available commonly used instruments and reagents. Please refer to "Molecular Cloning Experiment Guide (3rd Edition)" ( Science Press), “Microbiology Experiments (4th Edition)” (Higher Education Press) and manufacturers' instructions for corresponding instruments and reagents.
• the HPLC method was used to quantitatively determine the accumulation of ⁇ -alanine in the fermentation broth.
• the specific method is as follows. Take the supernatant of the fermentation broth, add purified water to dilute it to an appropriate concentration, and filter it with a 0.22 ⁇ m filter membrane.
• the o-phthalaldehyde (OPA) online pre-column derivatization method was used to determine the ⁇ -alanine concentration.
• the chromatographic column used was Agilent AdvanceBio AAA C18, 4.6x100mm, 2.7 ⁇ m, the column temperature was 40°C, the detection wavelength was 338nm, and the mobile phase flow rate was is 1mL/min.
• ⁇ -alanine purchased from Sigma Company as a standard, determine the standard curve of alanine concentration and light absorption value under the chromatographic conditions.
• the HPLC method was used to quantitatively determine the production of VB5 in the fermentation broth.
• the specific method is as follows. Take the supernatant of the fermentation broth, add purified water to dilute it to an appropriate concentration, and filter it with a 0.22 ⁇ m filter membrane.
• the chromatographic column used is Agilent ZORBAX SB-Aq, 4.6x250mm, the column temperature is 30°C, the detection wavelength is 210nm, and the mobile phase flow rate is 1mL/min.
• the mobile phase is 3.12g/L NaH2PO4 ⁇ 2H2O, and phosphoric acid is used to adjust the pH to 2.2.
• Calcium pantothenate purchased from sigma company was used as a standard to measure the standard curve of concentration and light absorption value of 0.1-0.5g/L calcium pantothenate.
• Example 2 Construction of a vector for overexpression of L-aspartate ⁇ -decarboxylase and whole-cell catalytic ⁇ -alanine-producing engineering bacteria
• 16 L-aspartate ⁇ -decarboxylase genes panD were synthesized, which were derived from Bacillus amyloliquefaciens (as shown in SEQ ID No. 1) and Bacillus subtilis (as shown in SEQ ID No. 1). No. 2), Bacillus licheniformis (SEQ ID No. 3), Chlorobium phaeobacteroides (SEQ ID No. 4), Corynebacterium efficiens (shown in SEQ ID No. 5), Corynebacterium glutamicum (shown in SEQ ID No. 6), Corynebacterium marinum (shown in SEQ ID No.
• the present invention connects the above 16 BCD2-panD sequences to plasmids to construct 16 recombinant plasmids pET28a-BCD2-panD.
• the same BCD2 sequence (as shown in SEQ ID No. 17) was synthesized before each panD sequence, and XbaI and HindIII restriction enzymes were added to both ends of the BCD2-panD sequence. site. The synthesized sequence is ligated into the vector.
• the above synthesized BCD2-panD vector and pET28a(+) plasmid were double digested using restriction endonucleases XbaI and HindIII, and the digested BCD2-panD gene fragment and linearized vector segment were recovered by gel electrophoresis, and further used T4 Ligase connects the two fragments, and the ligation product is transformed into E. coli DH5 ⁇ competent cells, and screened on LB plates containing 50 mg/L kanamycin to obtain transformants containing the recombinant plasmid. After the transformants were expanded, the plasmids were extracted and sent for sequencing.
• 16 correct plasmids were obtained: pET28a-BCD2-panDBa, pET28a-BCD2-panDBs, pET28a-BCD2-panDBl, pET28a-BCD2-panDCp, pET28a-BCD2-panDCe, pET28a-BCD2-panDCg, pET28a-BCD2-panDCm, pET28a-BCD2-panDEc, pET28a-BCD2-panDHw, pET28a-BCD2-panDHv, pET28a-BCD2-panDMj, pET28a-BCD2-panDMm, pET28a-BCD2-panDMr, pET28a- BCD2-panDMd, pET28a-BCD2-panDRb, pET28a-BCD2-panDTm.
• 16 panD genes from different sources use the same promoter (T7) to regulate transcription initiation and
• the 16 extracted pET28a-BCD2-panD plasmids expressing panD genes from different sources were transformed into competent cells of E.coli BL21 (DE3), screened on LB plates containing 50 mg/L kanamycin, and 16 strains were obtained.
• the overexpression is derived from B. subtilis (shown in SEQ ID No. 2), B. licheniformis (such as The ⁇ -alanine production of the engineered bacteria with the panD gene of Corynebacterium glutamicum C. glutamicum and the magnetotactic bacterium M. magneticum is about ten times higher than that of other engineered bacteria.
• B. subtilis shown in SEQ ID No. 2
• B. licheniformis such as The ⁇ -alanine production of the engineered bacteria with the panD gene of Corynebacterium glutamicum C. glutamicum and the magnetotactic bacterium M. magneticum is about ten times higher than that of other engineered bacteria.
• the L-aspartate ⁇ -decarboxylase of Bacillus licheniformis has the highest catalytic efficiency.
• a 5L fermentation tank was further used to verify the catalytic performance of the engineering strain E.coli BL21/pET28a-BCD2-panDBl.
• DO is controlled above 30%, and the tank pressure is controlled at 0.02 ⁇ 0.10MPa.
• Ammonia is added back to control the pH to be maintained at 6.9, and the concentration of glucose in the culture medium is maintained below 5g/L by feeding the feed solution.
• the culture medium is When the bacterial cell OD 600 reaches 30, add 0.1mM inducer IPTG. After 4 hours, the bacterial culture medium OD 600 reaches about 80.
• the components of the inorganic salt culture medium and the feeding solution are as follows: Inorganic salt culture medium: 2g/L (NH 4 ) 2 HPO 4, 4g/L KH 2 PO 4 , 0.85g/L Citric acid, 0.7g /L MgSO 4 ⁇ 7H 2 O, 10mg/L FeSO 4 ⁇ 7H 2 O, 2.25mg/L ZnSO 4 ⁇ 7H 2 O, 0.2mg/L CuSO 4 ⁇ 5H 2 O, 0.5mg/L MnSO 4 ⁇ 5H 2 O, 0.23mg/L NaB 4 O 7 ⁇ 10H 2 O, 2.0mg/L CaCl 2 ⁇ 2H 2 O, 0.1mg/L NH 4 Mo 7 O 24 , 0.15mg/L CoCl 2 ⁇ 6H 2 O, balance for water.
• the feeding solution contains 700g/L glucose and 20g/L MgSO 4 ⁇ 7H 2 O, and the balance is water.
• Example 4 Construction of engineering bacteria for fermentation and production of VB5.
• Primer P1 was designed to introduce a strong promoter trc, and BamHI and SphI restriction endonuclease sites were designed at the 5' ends of primers P1 and P2 respectively.
• the PCR program was: denaturation at 98°C for 30 seconds, annealing at 65°C for 15 seconds, extension at 72°C for 90 seconds, 26 cycles to obtain a P trc -panBC gene fragment of approximately 1800 bp.
• the Ptrc -panBC product obtained by PCR amplification was identified and recovered by gel electrophoresis, and then double-digested with BamHI and SphI, and simultaneously double-digested the pACYC184 plasmid.
• the above-mentioned PCR electrophoresis band was recovered by cutting the gel, and the amplified DNA fragment of the P trc -panBC gene and the pACYC184 plasmid were double-digested using restriction endonucleases BamHI and SphI.
• the double-digested Ptrc-panBC and pACYC184 plasmids were recovered by gel electrophoresis.
• the ligation products were chemically transformed into Escherichia coli DH5 ⁇ competent cells. After recovery for 1 hour, the plasmids were spread on chloramphenicol plates. The coated plate was placed in a 37°C incubator for 12 hours, a single colony was picked for passage, and the recombinant plasmid was extracted and sequenced to obtain the correct recombinant plasmid pACYC184-panBC.
• the sequence obtained by PCR amplification is shown in SEQ ID No. 19, in which 11nt-45nt is the PJ23119 promoter and 66nt-977nt is the coding sequence of the panE gene. 988nt-1731nt is the terminator sequence.
• the promoter PJ23119 was designed on the amplification primer P3, the terminator L3S2P56 sequence was designed on the primer P4, and SphI and BsaBI restriction endonuclease sites were designed at the 5' end of the primers P3 and P4 respectively.
• the PJ23119-panE product was amplified using the above PCR reaction conditions.
• the coated plate was placed in a 37°C incubator for 12 hours, a single colony was picked for passage, and the recombinant plasmid was extracted and sequenced to obtain the correct recombinant plasmid pACYC184-panBCE, thereby obtaining a recombinant plasmid that overexpresses the vitamin B5 terminal synthesis pathway gene. .
• the mutated N20 sequence is CTTTCCAAGC TGGGTCTACC, targeting the avtA gene.
• the mutated pTargetF was named pTargetFavtA.
• primers P7 and P8 to amplify the upstream sequence of avtA gene, use primers P9 and P10 to amplify the PL promoter, and use primers P11 and P12 to amplify pET28a-BCD2-panDBs, pET28a-BCD2-panDBl, and E.coli BL21/pET28a-BCD2 respectively.
• -panDCg was used as a template to amplify the BCD2-panDBs-Ter, BCD2-panDBl-Ter, and BCD2-panDCg-Ter gene fragments
• primers P13 and P14 were used to amplify the downstream sequence of the avtA gene.
• DonorBs as shown in SEQ ID No. 20
• DonorBl as shown in SEQ ID No. 21
• DonorCg as shown in SEQ ID No. 22
• 1nt-312nt of SEQ ID No. 20, 21 and 22 are the upstream sequence of the target gene avtA gene
• 313nt-474nt are the PL promoter
• 475nt-560nt are the BCD2 sequence. 560nt-943nt of SEQ ID No.
• the pCas9 plasmid was transformed into MG1655, spread on a plate containing 50 mg/L kanamycin resistance, and cultured at 30°C to obtain strain MG655/pCas9.
• the OD600 of the medium is 0.2, add arabinose with a final concentration of 10mM for induction.
• the OD600 is 0.45 Preparation of competent cells.
• the ilvG gene of wild-type E. coli K12MG1655 is mutated, and the acetolactate synthase encoded by it is inactive.
• the present invention introduces the active ilvG gene of E. coli BL21 into the chromosome of E. coli MG1655, thereby improving the synthesis of acetolactate, the precursor of VB5.
• the present invention inserts the ilvG + M gene derived from E. coli BL21 into the chromosome of E. coli K12MG1655, uses the trc strong promoter to regulate the transcription initiation of ilvG + M, and uses the terminator Ter to regulate the transcription termination of ilvG + M.
• the ilvG + M gene is integrated into another N20 target sequence of the avtA gene.
• the mutation kit and primers P17 and P18 mutate the pTargetF vector, and the mutated pTargetF is named pTargetFavtA1.
• P25 CACGTTCGGA TATGAACTG (as shown in SEQ ID No. 48);
• P26 CGTCAAGCTT CAGCAACTC (as shown in SEQ ID No. 49).
• Primers P19 and P20 were used to amplify the avtA gene upstream sequence
• primers P21 and P22 were used to amplify the ilvG + M sequence of E.coli BL21
• primers P23 and P24 were used to amplify the avtA gene downstream sequence.
• Introduction of trc promoter TTGA through primers P20 and P21 CAATTAATCATCCGGCTCGTATAATGTGTGGA, introduce the terminator sequence CCAGAAAAGAGACGCT TTTAG AGCGTCTTTTTTCGTTTT through primers P22 and P23.
• Use overlapping PCR to connect the above three fragments to obtain the combination DonorilvGM (shown as SEQ ID No.
• SEQ ID No. 23 which serves as a template for gene editing.
• 1-305nt of SEQ ID No. 23 is the upstream sequence of the target gene avtA gene
• 306nt-341nt is the trc promoter
• 367nt-2013nt is the coding sequence of the ilvG + gene derived from E.coli BL21
• 2010nt-2273nt is the ilvM gene Coding sequence
• 2274-2328 is the terminator sequence
• 2329-2629 is the downstream sequence of avtA gene.
• E.coli MG1655 avtA:panDBs/pCas Take 2 ⁇ l of pTargetFavtA1 plasmid and 10 ⁇ l of DonorilvGM template DNA and electrotransform them into E.coli MG1655 avtA:panDBs/pCas, E.coli MG1655 avtA:panDBl/pCas, and E.coli MG1655 avtA:panDCg/pCas competent cells respectively.
• panDBl-ilvG + M and E.coli MG1655 avtA:panDCg-ilvG + M By integrating active ilvG + M on the chromosome, the synthesis of the VB5 precursor acetolactate is increased.
• the vector pACYC184-panBCE constructed above was transformed into the above-mentioned engineering bacteria E.coli MG1655 avtA:panDBs-ilvG + M, E.coli MG1655 avtA:panDBl-ilvG + M and E.coli MG1655 avtA:panDCg-ilvG + M, The engineering bacteria E.coli MG1655 avtA:panDBs-ilvG + M/pACYC184-panBCE, E.coli MG1655 avtA:panDBl-ilvG + M/pACYC184-panBCE and E.coli MG1655 avtA:panDCg-ilvG + M/pACYC184- were obtained respectively. panBCE, used for fermentation production of VB5.
• E.coli MG1655 avtA:panDBs-ilvG + M/pACYC184-panBCE Take the test strains E.coli MG1655 avtA:panDBs-ilvG + M/pACYC184-panBCE, E.coli MG1655 avtA:panDBl-ilvG + M/pACYC184-panBCE and E.coli MG1655 avtA:panDCg-ilvG + M/pACYC184-panBCE , streak inoculated on a solid LB medium plate containing 34 mg/L chloramphenicol, and incubated at 37°C for 12 hours. Pick the bacterial lawn on the plate, inoculate it into the LB medium slant, and incubate at 37°C for 10-12 hours.
• Fermentation medium MOPS 80g/L, glucose 20.0g/L, ammonium sulfate 10.0g/L, potassium dihydrogen phosphate 2.0g/L, magnesium sulfate heptahydrate 2.0g/L, yeast powder 5.0g/L, trace elements mixed
• the liquid is 5mL/L, and the balance is water.
• Trace element mixture FeSO 4 ⁇ 7H 2 O10g/L, CaCl 2 1.35g/L, ZnSO 4 ⁇ 7H 2 O2.25g/L, MnSO 4 ⁇ 4H 2 O0.5g/L, CuSO 4 ⁇ 5H 2 O1g/ L.
• the present invention verifies that the PanD derived from Bacillus licheniformis screened by the present invention has the highest activity and can significantly increase the fermentation yield of VB5.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Organic Chemistry (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• Biotechnology (AREA)
• Biomedical Technology (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Microbiology (AREA)
• Molecular Biology (AREA)
• Physics & Mathematics (AREA)
• Biophysics (AREA)
• Plant Pathology (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Medicinal Chemistry (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)

Priority Applications (3)

Applications Claiming Priority (2)

Publications (1)

Family

ID=84842029

Family Applications (1)

Country Status (5)

Cited By (1)

Families Citing this family (3)

Citations (5)

Family Cites Families (3)

• 2022
  • 2022-03-07 CN CN202210214711.3A patent/CN115595328B/zh active Active
• 2023
  • 2023-02-16 JP JP2024553525A patent/JP2025516090A/ja active Pending
  • 2023-02-16 US US18/841,587 patent/US20260002145A1/en active Pending
  • 2023-02-16 EP EP23765746.5A patent/EP4458972A1/en active Pending
  • 2023-02-16 WO PCT/CN2023/076309 patent/WO2023169168A1/zh not_active Ceased

Patent Citations (5)

Non-Patent Citations (6)

Also Published As

Similar Documents

Legal Events