WO2023158024A1 - 오리방풀 유래 화합물을 유효성분으로 포함하는 염증성 장질환의 예방, 개선 또는 치료용 조성물 - Google Patents

오리방풀 유래 화합물을 유효성분으로 포함하는 염증성 장질환의 예방, 개선 또는 치료용 조성물 Download PDF

Info

Publication number
WO2023158024A1
WO2023158024A1 PCT/KR2022/008376 KR2022008376W WO2023158024A1 WO 2023158024 A1 WO2023158024 A1 WO 2023158024A1 KR 2022008376 W KR2022008376 W KR 2022008376W WO 2023158024 A1 WO2023158024 A1 WO 2023158024A1
Authority
WO
WIPO (PCT)
Prior art keywords
acid
inflammatory bowel
bowel disease
formula
active ingredient
Prior art date
Application number
PCT/KR2022/008376
Other languages
English (en)
French (fr)
Inventor
김진희
강민주
이은지
Original Assignee
주식회사 힐리노엘에스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 힐리노엘에스 filed Critical 주식회사 힐리노엘에스
Priority to US17/916,240 priority Critical patent/US20240216317A1/en
Publication of WO2023158024A1 publication Critical patent/WO2023158024A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/21—Esters, e.g. nitroglycerine, selenocyanates
    • A61K31/215—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids
    • A61K31/216—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acids having aromatic rings, e.g. benactizyne, clofibrate
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/111—Aromatic compounds
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/53—Lamiaceae or Labiatae (Mint family), e.g. thyme, rosemary or lavender
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
    • A61K2236/30—Extraction of the material
    • A61K2236/33—Extraction of the material involving extraction with hydrophilic solvents, e.g. lower alcohols, esters or ketones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
    • A61K2236/30—Extraction of the material
    • A61K2236/39—Complex extraction schemes, e.g. fractionation or repeated extraction steps
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
    • A61K2236/50—Methods involving additional extraction steps
    • A61K2236/51—Concentration or drying of the extract, e.g. Lyophilisation, freeze-drying or spray-drying

Definitions

  • the present invention relates to a composition for preventing, improving or treating inflammatory bowel disease comprising a compound derived from duckweed as an active ingredient.
  • IBD Inflammatory Bowel Disease
  • IBD ulcerative colitis
  • Crohn's disease Crohn's disease
  • ulcerative colitis inflammation is confined to the large intestine
  • Crohn's disease inflammation occurs throughout the digestive tract, from the mouth to the anus.
  • Inflammatory bowel disease is a disease that occurs at a high rate in Westerners, but due to a westernized diet, the incidence of inflammatory bowel disease has more than doubled in 10 years in Korea. It is known that patients with inflammatory bowel disease have a 2 to 11-fold increased risk of developing colorectal cancer compared to healthy individuals.
  • TNF ⁇ pro-inflammatory cytokines
  • IL-6 pro-inflammatory cytokines
  • IL-8 pro-inflammatory cytokines
  • TNF ⁇ is highly expressed in the epithelial cells of the colon of patients with ulcerative colitis, and infliximab, an anti-TNF ⁇ antibody treatment, is recently prescribed and used not only for ulcerative colitis but also for Crohn's disease.
  • these antibody therapeutics have problems with drug resistance or drug resistance due to mutations in the antibody-binding portion, and form very high drug prices.
  • TNF ⁇ is induced by the transcriptional regulator NF- ⁇ B, and the activation pathway of NF-k ⁇ is the most important signaling pathway in innate immunity.
  • NOD proteins NOD1 and NOD2 have an important role in the innate immune response as sensors for recognizing microbial substances derived from bacterial peptidoglycan.
  • mutations in NOD2 are well known as biomarkers associated with susceptibility to inflammatory bowel disease.
  • NOD protein signaling is the activation of NF- ⁇ B. Abnormal NOD-related signaling induces excessive NF-kB activity. This signal transduction process is performed by the kinase, RIPK2 (Receptor-interacting serine/threonine-protein kinase 2).
  • RIPK2 has been reported in patients with Crohn's disease, and RIPK2 has potential in inflammatory bowel disease. It is not only a therapeutic target, but also a key target protein for the study of the pathogenesis of inflammatory bowel disease.
  • Korean Patent No. 1661423 discloses a composition for antioxidant and anti-inflammatory containing a compound derived from duckweed and an extraction method thereof
  • Korean Patent No. 2117487 discloses inflammatory bowel disease containing browsers chalcone A as an active ingredient.
  • a pharmaceutical composition for prevention or treatment has been disclosed, a composition for preventing, improving or treating inflammatory bowel disease comprising the compound derived from duckweed as an active ingredient has not yet been disclosed.
  • the present invention has been derived from the above needs, and the present invention provides a composition for preventing, improving or treating inflammatory bowel disease comprising a compound derived from duckweed as an active ingredient, and the compound represented by Formula 1 of the present invention has phosphorylation inhibitory activity of RIPK2 and increases the expression level of tight junction proteins (ZO-1, occludin and claudin1), which are intercellular connecting proteins in epithelial cells, as well as pro-inflammatory cytokines in zebrafish inflammatory bowel disease animal models. By confirming that the amount of mRNA transcription was reduced, the present invention was completed.
  • tight junction proteins ZO-1, occludin and claudin1
  • the present invention provides a pharmaceutical composition for preventing or treating inflammatory bowel disease containing the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the present invention provides a health functional food composition for preventing or improving inflammatory bowel disease containing the compound represented by Formula 1 or a food-acceptable salt thereof as an active ingredient.
  • the present invention provides a feed composition for preventing or improving inflammatory bowel disease containing the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the present invention relates to a composition for preventing, improving, or treating inflammatory bowel disease comprising a compound derived from duckweed as an active ingredient, wherein the compound represented by Formula 1 of the present invention inhibits an inflammatory response by inhibiting RIPK2 phosphorylation activity,
  • the compound represented by Formula 1 of the present invention inhibits an inflammatory response by inhibiting RIPK2 phosphorylation activity
  • Figure 1 is a Western blot result confirming the efficacy of inhibiting the phosphorylation activity of RIPK2 according to the treatment of the compound represented by Formula 1 of the present invention.
  • Figure 2 is an immunofluorescence microscope analysis result confirming the change in the expression level of ZO-1, a tight junction-related protein, in a serosal epithelial barrier model in order to confirm the effect of the compound represented by Formula 1 of the present invention on improving the intestinal barrier.
  • **, *** are ZO-1 in the positive control group (5ASA) or the group treated with the compound represented by Formula 1 of the present invention, compared to the ZO-1 expression level in the ulcerative colitis model group by DSS treatment That the expression level was statistically significantly increased, ** is p ⁇ 0.01, *** is p ⁇ 0.001.
  • ns means there is no statistically significant difference.
  • FIG. 3 is an immunofluorescence microscope analysis result confirming the change in the expression level of occludin, a tight junction-related protein, in a serosal epithelial barrier model in order to confirm the effect of the compound represented by Formula 1 of the present invention on improving the intestinal barrier.
  • *, ** are statistically significant in the occludin expression level of the positive control group (5ASA) or the group treated with the compound represented by Formula 1 of the present invention, compared to the occludin expression level in the ulcerative colitis model group by DSS treatment As it increased, * is p ⁇ 0.05, ** is p ⁇ 0.01.
  • Figure 5 is the result of confirming the inhibitory effect of pro-inflammatory cytokines TNF ⁇ (B) and IL1 ⁇ (C) expression of the compound represented by Formula 1 of the present invention in the zebrafish inflammatory bowel disease animal model (A).
  • *, ** are the positive control group (5ASA) or the group treated with the compound represented by Formula 1 of the present invention, compared to the expression level of TNF- ⁇ or IL-1 ⁇ in the ulcerative colitis model group by DSS treatment
  • the expression level of TNF- ⁇ or IL-1 ⁇ was statistically significantly decreased.
  • * indicates p ⁇ 0.05 and ** indicates p ⁇ 0.01.
  • ns means there is no statistically significant difference.
  • Figure 7 is a result confirming the change in DAI according to the administration of the compound represented by Formula 1 of the present invention in the DSS-induced inflammatory bowel disease animal model.
  • Figure 8 is a photograph (A) and a graph (B) showing the change in the length of the large intestine according to the administration of the compound represented by Formula 1 of the present invention in an animal model of DSS-induced inflammatory bowel disease.
  • the present invention relates to a compound represented by Formula 1 (3-[3,4-dihydroxyphenyl]acrylic acid 1-[3,4-dihydroxyphenyl]2-methoxycarbonylethyl ester) or a pharmaceutically acceptable salt thereof as an active ingredient. It relates to a pharmaceutical composition for preventing or treating inflammatory bowel disease.
  • the inflammatory bowel disease is preferably any one selected from the group consisting of ulcerative colitis (UC), Crohn's disease (CD), ischemic colitis, enteric Behcet's disease, hemorrhagic rectal ulcer and ileum pouchitis However, it is not limited thereto.
  • 'pharmaceutically acceptable salt refers to any organic or inorganic addition salt that is relatively non-toxic to patients and does not cause side effects caused by the salt that lowers the beneficial effect of the compound of Formula 1.
  • inorganic acids, organic acids, or non-toxic salts may be used as free acids, and hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, or tartaric acid may be used as preferred inorganic acids, and methanesulfonic acid, p-toluenesulfonic acid, Acetic acid, trifluoroacetic acid, maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid, citric acid, lactic acid, glycolic acid, gluconic acid, galacturonic acid, glutamic acid, glutaric acid, glucuronic acid, aspartic acid, ascorbic acid, carbonic acid, vanillic acid or hydroio
  • Acid addition salts such as inorganic acids or organic acids can be prepared by conventional methods, for example, by dissolving a compound in an excess aqueous acid solution and precipitating the salt using a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. . Equimolar amounts of the compound and an acid or alcohol in water may be heated, and then the mixture may be evaporated to dryness, or the precipitated salt may be suction filtered.
  • a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile.
  • the non-toxic salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate chloride, bromide, iodide, fluoride , acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, suberate, sebacate, Fumarate, maleate, butyne-1,4-dioate, hexane-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitro benzoate, hydroxybenzoate, methoxybenzoate phthalate , terephthalate, benzenesulfonate, toluene sulfonate,
  • 'prevention' in the present invention refers to any action that suppresses or delays the onset of inflammatory bowel disease by administration of the pharmaceutical composition according to the present invention
  • 'treatment' refers to the treatment of inflammatory bowel disease by administration of the pharmaceutical composition. It refers to all actions that improve or beneficially change the symptoms of suspected or affected individuals.
  • the administration route for effective administration of the pharmaceutical composition according to the present invention is not particularly limited, and can be used for patients by adopting an appropriate administration route.
  • oral, rectal, transdermal, parenteral (subcutaneous, intramuscular, vascular), epidermal, topical, inhalation, and other administration methods may be used.
  • the dosage form of the pharmaceutical composition according to the present invention may be administered through various formulations according to conventional methods known in the field of pharmaceuticals.
  • Preferred examples include powders, granules, tablets, troches, dispersants, suspensions, and solutions.
  • Oral formulations such as capsules, emulsions, syrups, and aerosols, external preparations, suppositories, injections, patches, and other suitable formulations may be used.
  • the pharmaceutical composition of the present invention may further include suitable carriers, excipients and diluents commonly used in the preparation of pharmaceutical compositions.
  • Carriers, excipients, and diluents that may be included in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, and cellulose. , methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and various compounds or mixtures including mineral oil and the like.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations contain at least one excipient, for example, starch, calcium carbonate, in the strain or endoplasmic reticulum derived from the strain. It is prepared by mixing sucrose or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.
  • Liquid preparations for oral use include suspensions, solutions for oral use, emulsions, syrups, etc.
  • Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories.
  • Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents.
  • witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogelatin, and the like may be used as a base for the suppository.
  • the pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount, and the term 'pharmaceutically effective amount' of the present invention is sufficient to prevent or treat a disease with a reasonable benefit/risk ratio applicable to medical prevention or treatment. It means the amount, and the effective dose level is the severity of the disease, the activity of the drug, the patient's age, weight, health, sex, the patient's sensitivity to the drug, the administration time of the composition of the present invention used, the route of administration and the excretion rate, treatment It may be determined according to factors including duration, drugs used in combination or simultaneous use with the composition of the present invention used, and other factors well known in the medical arts.
  • the pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. And it can be single or multiple administrations. It is important to administer the amount that can obtain the maximum effect with the minimum amount without side effects in consideration of all the above factors.
  • the frequency of administration of the composition of the present invention is not particularly limited thereto, but may be administered once a day or administered several times by dividing the dose, and the dosage is the patient's age, weight, sex, dosage form, health condition and disease It may vary depending on, and as a preferred example, based on an adult patient weighing 70 kg, the dosage is 0.1 to 300 mg / day, more preferably 0.5 to 100 mg / day, and even more preferably 1 -60 mg/day, but is not limiting the scope of the present invention in any way.
  • the present invention relates to a health functional food composition for preventing or improving inflammatory bowel disease, containing a compound represented by Formula 1 below or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the active ingredient is preferably prepared in any one formulation selected from powder, granule, pill, tablet, capsule, candy, syrup and beverage, but is not limited thereto.
  • the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof is used as a health functional food composition
  • the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof is added as it is or together with other foods or food ingredients. It can be used, and it can be used appropriately according to a conventional method.
  • the mixing amount of the active ingredient can be suitably determined depending on the purpose of use.
  • the health functional food composition of the present invention is typically added during food preparation and may further include ingredients that are acceptable in food science.
  • ingredients that are acceptable in food science.
  • one or more components from citric acid, high fructose corn syrup, sucrose, glucose, acetic acid, malic acid, fruit juice, etc. may be further included. there is.
  • the amount that can be included as an active ingredient in the health functional food composition according to the present invention can be appropriately selected according to the age, sex, weight, condition, and symptoms of the disease of a person who wants a health functional food for preventing or improving inflammatory bowel disease, Preferably, it is preferably included in an amount of about 0.01 to 10.0 g per day for adults, and by ingesting foods having such a content, the effect of preventing or improving inflammatory bowel disease can be obtained.
  • the present invention relates to a feed composition for preventing or improving inflammatory bowel disease containing a compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof is as described above, and may be added to a feed composition for the purpose of preventing or improving inflammatory bowel disease.
  • the feed composition may include a feed additive.
  • the feed additive of the present invention corresponds to supplementary feed under the Feed Management Act.
  • the term 'feed' may refer to any natural or artificial diet, one meal, etc., or a component of the one meal meal, suitable for or suitable for consumption by animals.
  • the type of feed is not particularly limited, and feeds commonly used in the art may be used.
  • Non-limiting examples of the feed include vegetable feeds such as grains, root fruits, food processing by-products, algae, fibers, pharmaceutical by-products, oils and fats, starches, meal or grain by-products; Animal feed such as proteins, inorganic materials, oils, mineral oils, oils, single cell proteins, zooplankton, or food may be mentioned. These may be used alone or in combination of two or more.
  • Caco-2 cells were adjusted to a density of 2 ⁇ 10 5 cells/ml, and 0.5 ml of the cell suspension was dispensed on the membrane of the upper layer (transwell insert apical side phase) of a 12-well plate, and cultured in the lower layer (basolateral side phase) After adding 1.5 ml of the medium, the cells were differentiated and cultured for about 21 days while changing the medium every 2 to 3 days until the monolayer reached an appropriate TEER (Transepithelial Electrical Resistance) value.
  • TEER Transepithelial Electrical Resistance
  • EVOM resistance meter (EVOM2, WPI) was used to measure the electrical resistance (TEER value, ⁇ cm2) between the upper and lower layers.
  • TEER value of Caco-2 cells reached 200 ⁇ cm or more
  • MDP and the compound represented by Formula 1 of the present invention were treated in the insert for 24 hours, and the Caco-2 cells in the insert were washed with 1 ⁇ PBS and then trypsinized. was processed. After centrifugation and washing with cold 1 ⁇ PBS, Caco-2 cells were lysed by adding lysis buffer (50 mM Tris-HCl (pH 8.0), 5 mM EDTA, 15 mM NaCl, 1% NP-40, 1 mM PMSF) , After centrifugation at 12,000 rpm, 4 ° C.
  • lysis buffer 50 mM Tris-HCl (pH 8.0), 5 mM EDTA, 15 mM NaCl, 1% NP-40, 1 mM PMSF
  • the compound represented by Formula 1 of the present invention inhibits the activation of RIPK2 at a lower concentration. Based on the results of this experiment, it was determined that the compound represented by Formula 1 of the present invention has about 2-fold higher RIPK2 phosphorylation inhibitory activity than Gefitinib (positive control), which is known as a RIPK2 inhibitor, in actual cells (FIG. 1).
  • Caco-2 cell line Human intestinal epithelial cell line
  • mouse-derived macrophage RAW264.7 cell line were treated with 10% FBS (Fetal bovine serum, #16000044, Gibco) and 1% streptomycin/penicillin (#15140122, Gibco). It was cultured at 37°C and 5% CO 2 conditions using the included DMEM (Dulbecco's Modified Eagle Medium, #11995065, Gibco) medium. In the culture, the medium was replaced every 2 to 3 days, and when the cells grew to about 80% in the cell culture dish (# 353003, Falcon), they were maintained while being passaged.
  • FBS Fetal bovine serum, #16000044, Gibco
  • streptomycin/penicillin #15140122, Gibco
  • the Caco-2 cells were adjusted to a density of 2 ⁇ 10 5 cells/ml, and 0.5 ml of the cell suspension was dispensed on the membrane of the upper layer (transwell insert apical side phase) of the 12-well plate, and in the lower layer (basolateral side phase) After adding 1.5 ml of the culture medium, the cells were differentiated and cultured for about 21 days while changing the medium every 2 to 3 days until the monolayer reached an appropriate TEER (Transepithelial Electrical Resistance) value.
  • An EVOM resistance meter (EVOM2, WPI) was used to measure the electrical resistance (TEER value, ⁇ cm 2 ) between the upper and lower layers.
  • RAW 264.7 cells were adjusted to a density of 5 ⁇ 10 5 cells/ml, and then 2 ml of RAW 264.7 cell suspension was dispensed into a new 12-well plate. Incubated for 24 hours. Thereafter, the Caco-2 cell culture medium was exchanged, and the cultured Caco-2 cells were inserted into a 12-well plate containing RAW 264.7 cells to construct a serous epithelial barrier model.
  • Caco-2 cells were adjusted to a density of 2 ⁇ 10 5 cells/ml, and 0.5 ml of the cell suspension was dispensed on the membrane of the upper layer (transwell insert apical side phase) of a 12-well plate, and cultured in the lower layer (basolateral side phase) After adding 1.5 ml of the medium, the cells were differentiated and cultured for about 21 days while changing the medium every 2 to 3 days until the monolayer reached an appropriate TEER (Transepithelial Electrical Resistance) value.
  • An EVOM resistance meter (EVOM2, WPI) was used to measure the electrical resistance (TEER value, ⁇ cm 2 ) between the upper and lower layers.
  • the culture medium of Caco-2 cells cultured for 21 days in the insert was removed, and 3% DSS; 3% DSS + the compound represented by Formula 1 of the present invention (0.3, 1, 3 ⁇ M); And 3% DSS + 5ASA (500 ⁇ M); replaced with each culture medium containing and cultured for 24 hours.
  • the Caco-2 cells in the insert were washed twice with 1x PBS, treated with 4% paraformaldehyde and fixed for 10 minutes at room temperature, washed three times with 1x PBS, treated with 0.1% Triton-X 100, After permeabilizing the cell membrane for 10 minutes at room temperature, it was washed three times with 1 ⁇ PBS.
  • Example 4 Zebrafish inflammatory bowel disease animal model construction and pro-inflammatory cytokine mRNA expression level analysis
  • zebrafish wild-type-Danio rerio As a zebrafish inflammatory bowel disease animal model, zebrafish wild-type-Danio rerio (AB) was used, and the zebrafish wild type had a light / dark cycle of 14 hours / 10 hours in a zebrafish breeding facility. cycle, and the temperature was raised under the conditions of 28 ° C. All animal experiments were conducted according to the protocol of the Animal Experiment Ethics Committee of Helino LS Co., Ltd. (registration number: AEC-20210720-0001), and all experimental materials were sterilized before use.
  • Induced inflammatory bowel disease in zebrafish by treating 0.5% of DSS (Dextran sulfate sodium, M.W. 36,000-50,000, #160110, MP), a drug that damages colonic epithelial cells and induces 'ulcerative colitis' among inflammatory bowel diseases And, the compound represented by Formula 1 of the present invention was treated at different concentrations (0.3 ⁇ M and 1 ⁇ M) to confirm the efficacy of inhibiting inflammatory bowel disease.
  • DSS Extran sulfate sodium, M.W. 36,000-50,000, #160110, MP
  • the zebrafish animal model of ulcerative colitis caused by DSS used fertilized 3-day-old zebrafish larvae (3 dpf; days post fertilization). 20 3dpf zebrafish larvae per well were placed in a 24-well plate, and ulcerative colitis was induced by treatment with 0.5% DSS. After breeding until the 6 dpf zebrafish larvae, DSS was removed and treated with the compound represented by Formula 1 of the present invention for 5 hours.
  • TRIzol reagent 300 ⁇ l was added to zebrafish larvae treated with the compound represented by Formula 1 of the present invention, and then pulverized with a tissue grinder (G20, GINKO).
  • the crushed zebrafish larvae were left at room temperature for 5 minutes, treated with 60 ⁇ l of chloroform to remove protein or cell debris, and then centrifuged at 12,000xg, 4° C. for 15 minutes.
  • 100 ⁇ l of the clear supernatant was transferred to a new microcentrifuge tube, and an equal volume of isopropanol was added and mixed by vortexing. After standing at room temperature for 10 minutes, centrifugation was performed at 12,000 xg and 4° C.
  • the precipitated pellet was washed with 75% ethanol and centrifuged at 12,000xg, 4°C for 10 minutes. After removing the supernatant and drying the pellet, it was dissolved in 20 ⁇ l of RNase free water, and the purity and concentration were measured using a microplate reader (FLUOstar omega, BMG Labtech). The extracted total RNA was - Stored at 80°C.
  • cDNA Reverse Transcriptase Kit (#4368814, Thermo scientific) was used. To 2 ⁇ g of extracted total RNA, 2 ⁇ l of 10X RT buffer, 0.8 ⁇ l of 25X dNTP mix, 2 ⁇ l of 10X RT random primer, 1 ⁇ l of reverse transcriptase, and 4.2 ⁇ l of RNase free water were added to a PCR tube (#4358293 , Thermo scientific), and cDNA was synthesized in a PCR machine. PCR conditions were reacted at 25°C for 10 minutes, 37°C for 120 minutes, and 85°C for 5 minutes.
  • Dynabeads TM mRNA DIRECTTM Purification Kit #61012, Invitrogen
  • DynaMag TM -2 Magnet #12321D, Invitrogen
  • 50 ⁇ l of the magnetic beads included in the kit was dispensed into a 1.5 ml microcentrifuge tube and left on a magnetic stand for 30 seconds to separate the amount of magnetic beads to be used. After adding 150 ⁇ l of digestion/binding buffer to the separated magnetic beads, they were mixed by vortexing, and the extracted total RNA was added and left in a rotator for 5 minutes. After leaving on the magnetic stand for 30 seconds, the solution except for the magnetic beads attached to the stand was removed.
  • TOPscript TM RT DryMix (dT18 plus, Enzynomics) was used. cDNA was synthesized using 2 ⁇ g of the extracted mRNA.
  • SYBR TM Green PCR master mix was used for the qPCR reaction.
  • the qPCR condition was performed at 95 ° C for 10 minutes with a pre-denaturation step, followed by 40 cycles of 95 ° C for 30 seconds (denaturation step), 55 ° C for 30 seconds (annealing step), and 72 ° C for 30 seconds (extension step). did
  • TNF_F ACAAGGCAATTTCACTTCCA (SEQ ID NO: 1)
  • TNF_R AGCTGATGTGCAAAGACACC
  • Il1b_F TTGTGGGAGACAGACGGTGC
  • Il1b_R GATTGGGGTTTGATGTGCTTCAT (SEQ ID NO: 4)
  • the level of transcription of each gene was expressed as a relative increase or decrease using GAPDH as an endogenous control.
  • the compound represented by Formula 1 of the present invention 5ASA currently used as a treatment for inflammatory bowel disease, and a steroid agent (Prednisolone) were treated to confirm the pro-inflammatory cytokine inhibitory effect.
  • 5ASA currently used as a treatment for inflammatory bowel disease
  • Prednisolone a steroid agent
  • the compound represented by Formula 1 of the present invention was found to reduce the transcription amount of pro-inflammatory cytokines at significantly lower concentrations than 5ASA and Prednisolone (FIG. 5).
  • Example 5 Evaluation of treatment efficacy in DSS-induced inflammatory bowel disease model
  • Inflammatory bowel disease was induced using 6-week-old C57BL/6 mice, and was induced by administering DSS (Dextran Sulfate Sodium, MW 36000 to 50000, MP Biomedicals). normal control group (3 mice) with no treatment; DSS-treated group (6 animals); DSS+5ASA (5-Aminosalicylic acid, Sigma) administration group (6 animals); and DSS+administered group of the compound represented by Formula 1 of the present invention (6 mice);
  • DAI Disease Activity Index
  • inflammatory bowel disease is evaluated by a disease activity index (DAI) through clinical symptoms such as weight loss, diarrhea, and bloody stool.
  • DAI evaluation index is measured by assigning points according to the weight loss rate, stool condition, and bloody stool condition (Table 1).
  • 100 mg/kg of 5ASA dispersed in 2.5% CMC Carboxymethylcellulose sodium, Sigma
  • 2 mg/kg of the compound represented by Formula 1 according to the present invention was administered daily for 7 days. It was administered as a single intraperitoneal injection.
  • DAI disease activity index
  • DAI Disease Activation Index
  • DAI on the 8th day after administering the compound represented by Formula 1 of the present invention for 7 days experimental group DAI normal control group 0.00 DSS administration group (2.5%) 11.75 ⁇ 0.15 DSS and compound 1 administration group (2mg/kg, intraperitoneal administration) 8.75 ⁇ 0.21 DSS and 5ASA administration group (100mg/kg, oral administration) 10.67 ⁇ 0.19
  • the inflammatory response can evaluate the extent of symptoms by reducing the length of the colon.
  • the mice of each experimental group were sacrificed and the large intestine was removed. The length of the colon was measured from the removed colon.
  • the shortest colon length was confirmed in the DSS-treated group due to the inflammatory response caused by DSS, in the order of DSS and 5ASA administration group, DSS and the compound administration group represented by Formula 1 of the present invention. As a result, the length of the large intestine gradually increased.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Polymers & Plastics (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Mycology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Food Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medical Informatics (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Microbiology (AREA)
  • Botany (AREA)
  • Animal Husbandry (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Emergency Medicine (AREA)
  • Nutrition Science (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

본 발명은 오리방풀 유래 화합물을 유효성분으로 포함하는 염증성 장질환의 예방, 개선 또는 치료용 조성물에 관한 것으로, 본 발명의 화학식 1로 표시되는 화합물은 RIPK2 인산화 활성 저해를 통해 염증반응을 억제하고, 세포간 연결인자인 Tight junction 관련 단백질의 회복에 따른 장 점막 재생 효능 뿐만 아니라, 제브라피쉬 염증성 장질환 동물모델에서 전염증성 사이토카인 mRNA 전사량을 감소시키는 효과가 있으므로, 염증성 장질환의 예방, 개선 또는 치료용 의약품, 건강기능식품 또는 동물용 사료에 유용하게 사용할 수 있다.

Description

오리방풀 유래 화합물을 유효성분으로 포함하는 염증성 장질환의 예방, 개선 또는 치료용 조성물
본 발명은 오리방풀 유래 화합물을 유효성분으로 포함하는 염증성 장질환의 예방, 개선 또는 치료용 조성물에 관한 것이다.
자가면역질환의 하나인 염증성 장질환(Inflammatory Bowel Disease, IBD)은 장관 내 비정상적인 만성염증이 호전과 재발을 반복하는 특징을 가지며, 일반적으로 궤양성 대장염(Ulcerative colitis, UC)과 크론병(Crohn's disease, CD)의 형태로 구분된다. 궤양성 대장염은 염증이 대장에 국한되는 반면, 크론병은 입에서 항문까지 소화관 전체에 걸처 염증이 발생하는 특징을 가진다. 염증성 장질환은 서양인에서 높은 비율로 발생하는 질병이나 서구화된 식생활로 우리나라에서도 발병빈도가 10년 동안 2배 이상 급증하고 있으며, 30~40대에서 발생했던 염증성 장질환이 최근 20대로 확대되고 있는 상황이며, 염증성 장질환 환자는 건강인에 비해 대장암 발생 위험이 2~11배 증가하는 것으로 알려져 있다.
염증성 장질환의 발병 원인은 아직 밝혀지지 않았으나, 유전적, 환경적 또는 비정상적 면역인자 등에 따른 장점막 파괴로 장내 미생물이 침범하면 장내 면역세포의 활성화가 진행된다. 이러한 과도한 활성화는 면역세포 조절시스템에 비정상적인 이상을 초래하여 만성염증으로 진행되면 염증성 장질환이 발병한다.
현재 염증성 장질환을 완치시키는 약물의 보고는 없지만 일반적으로 처방되는 약은 5-아미노살리실산(항염증제, 제형의 형태로 설파살라진과 메살라진 등으로 구분), 부신피질 스테로이드제, 면역조절제(Thiopurine) 및 항-TNFa 생물학제제 등으로 증상의 경중에 따라 단계적으로 처방되어 사용된다. 그러나 현재 염증성 장질환에 처방되는 이러한 약들은 다양한 부작용이 나타나고 있다. 근본적으로 염증성 장질환 치료의 목표는 염증 반응을 가라앉히고 손상된 조직을 치유 및 재생하는 것이다. 따라서 항염증 기능 및 세포재생 효능을 모두 가진 새로운 치료제의 개발이 필요한 실정이다.
염증성 장질환 발병에는 TNFα, IL-6 및 IL-8과 같은 전염증성 사이토카인 관련 염증반응이 동반된다. 특히 TNFα는 궤양성 대장염 환자의 대장 상피세포에서 높게 나타나며, 최근 항-TNFα 항체 치료제인 인플릭시맙은 궤양성 대장염 뿐만아니라 크론병에도 처방되어 사용된다. 그러나 이러한 항체치료제는 항체가 결합하는 부분의 돌연변이에 의한 약물 무반응이나 내성 문제가 있으며, 매우 높은 약가를 형성하고 있다. TNFα는 전사조절인자인 NF-κB에 의해 유도되며, NF-kβ의 활성화 경로는 선천면역에서 가장 중요한 신호전달 경로이다.
한편, NOD 단백질인 NOD1과 NOD2는 박테리아의 펩티도글리칸 유래의 미생물 물질을 인지하는 센서로서 선천적 면역반응에서 중요한 역할을 가진다. 특히 NOD2의 돌연변이는 염증성 장질환 질병의 감수성과 관련되어 있는 바이오마커로 잘 알려져 있다. NOD 단백질의 신호전달의 주요 결과 중 하나는 NF-κB의 활성화이다. 비정상적인 NOD관련 신호전달은 과도한 NF-kB 활성을 유도한다. 이러한 신호전달 과정은 인산화효소인 RIPK2(Receptor-interacting serine/threonine-protein 인산화효소 2)에 의해 이루어지며, 염증성 장질환 중 크론병 환자에서 과도하게 활성화된 RIPK2가 보고되어 RIPK2는 염증성 장질환에서 잠재적인 치료 표적일 뿐만아니라 염증성 장질환의 발병기전에 대한 연구를 위한 핵심 타겟 단백질이다.
하지만, RIPK2가 다양한 질병에서 치료적 타겟으로 많은 연구가 진행됨에도 불구하고, 염증성 장질환 치료제 개발에서 RIPK2를 타겟하는 연구는 아직까지 미비한 실정이다.
한편, 한국등록특허 제1661423호에 오리방풀 유래 화합물을 함유하는 항산화 및 항염용 조성물 및 그 추출방법이 개시되어 있고, 한국등록특허 제2117487호에 브라우쏘칼콘 A를 유효성분으로 포함하는 염증성 장질환 예방 또는 치료용 약학 조성물이 개시되어 있으나, 아직까지 본 발명의 오리방풀 유래 화합물을 유효성분으로 포함하는 염증성 장질환의 예방, 개선 또는 치료용 조성물에 대해서 개시된 바 없다.
본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명은 오리방풀 유래 화합물을 유효성분으로 포함하는 염증성 장질환의 예방, 개선 또는 치료용 조성물을 제공하고, 본 발명의 화학식 1로 표시되는 화합물은 RIPK2의 인산화 저해 활성이 있으며, 상피세포에서 세포간 연결 단백질인 Tight junction 단백질(ZO-1, occludin 및 claudin1)의 발현량을 증가시킬 뿐만 아니라, 제브라피쉬 염증성 장질환 동물모델에서 전염증성 사이토카인 mRNA 전사량을 감소시키는 것을 확인함으로써, 본 발명을 완성하였다.
상기 목적을 달성하기 위하여, 본 발명은 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 염증성 장질환의 예방 또는 치료용 약학 조성물을 제공한다.
또한, 본 발명은 화학식 1로 표시되는 화합물 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 함유하는 염증성 장질환의 예방 또는 개선용 건강기능식품 조성물을 제공한다.
또한, 본 발명은 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 염증성 장질환의 예방 또는 개선용 사료 조성물 제공한다.
본 발명은 오리방풀 유래 화합물을 유효성분으로 포함하는 염증성 장질환의 예방, 개선 또는 치료용 조성물에 관한 것으로, 본 발명의 화학식 1로 표시되는 화합물은 RIPK2 인산화 활성 저해를 통해 염증반응을 억제하고, 세포간 연결인자인 Tight junction 관련 단백질의 회복에 따른 장 점막 재생 효능 뿐만 아니라, 제브라피쉬 염증성 장질환 동물모델에서 전염증성 사이토카인 mRNA 전사량을 감소시키는 효과가 있는 것이다.
도 1은 본 발명의 화학식 1로 표시되는 화합물의 처리에 따른 RIPK2의 인산화 활성을 저해하는 효능을 확인한 웨스턴 블랏 결과이다.
도 2는 본 발명의 화학식 1로 표시되는 화합물의 장막 개선 효과를 확인하기 위하여 장막상피 장벽 모델에서 Tight junction 관련 단백질인 ZO-1의 발현량 변화를 확인한 면역형광 현미경 분석결과이다. **, ***은 DSS 처리에 의한 궤양성 대장염 모델군에서의 ZO-1 발현량에 대비하여, 양성대조군(5ASA) 또는 본 발명의 화학식 1로 표시되는 화합물을 처리한 군의 ZO-1 발현량이 통계적으로 유의미하게 증가하였다는 것으로, **는 p<0.01이고, ***은 p<0.001이다. ns는 통계적으로 유의미한 차이가 없다는 것을 의미한다.
도 3은 본 발명의 화학식 1로 표시되는 화합물의 장막 개선 효과를 확인하기 위하여 장막 상피 장벽 모델에서 Tight junction 관련 단백질인 occludin의 발현량 변화를 확인한 면역형광 현미경 분석결과이다. *, **은 DSS 처리에 의한 궤양성 대장염 모델군에서의 occludin 발현량에 대비하여, 양성대조군(5ASA) 또는 본 발명의 화학식 1로 표시되는 화합물을 처리한 군의 occludin 발현량이 통계적으로 유의미하게 증가하였다는 것으로 *는 p<0.05이고, **은 p<0.01이다.
도 4는 본 발명의 화학식 1로 표시되는 화합물의 장막 개선 효과를 확인하기 위하여 장막 상피 장벽 모델에서 Tight junction 관련 단백질인 claudin1의 발현량 변화를 확인한 면역형광 현미경 분석결과이다. **은 DSS 처리에 의한 궤양성 대장염 모델군에서의 claudin1 발현량에 대비하여, 양성대조군(5ASA) 또는 본 발명의 화학식 1로 표시되는 화합물을 처리한 군의 claudin1 발현량이 통계적으로 유의미하게 증가하였다는 것으로, p<0.01이다.
도 5는 제브라피쉬 염증성 장질환 동물모델(A)에서 본 발명의 화학식 1로 표시되는 화합물에 대한 전염증성 사이토카인 TNFα(B) 및 IL1β(C) 발현 억제 효능을 확인한 결과이다. *, **은 DSS 처리에 의한 궤양성 대장염 모델군에서의 TNF-α 또는 IL-1β의 발현량에 대비하여, 양성대조군(5ASA) 또는 본 발명의 화학식 1로 표시되는 화합물을 처리한 군의 TNF-α 또는 IL-1β의 발현량이 통계적으로 유의미하게 감소하였다는 것으로 *는 p<0.05이고, **은 p<0.01이다. ns는 통계적으로 유의미한 차이가 없다는 것을 의미한다.
도 6은 DSS 유도 염증성 장질환 동물모델에서 각 투여군에 대한 상대적 체중 변화를 확인한 결과이다.
도 7은 DSS 유도 염증성 장질환 동물모델에서 본 발명의 화학식 1로 표시되는 화합물 투여에 따른 DAI 변화를 확인한 결과이다.
도 8은 DSS 유도 염증성 장질환 동물모델에서 본 발명의 화학식 1로 표시되는 화합물 투여에 따른 대장 길이 변화를 나타낸 사진(A)과 그래프(B)이다.
본 발명은 하기 화학식 1로 표시되는 화합물(3-[3,4-dihydroxyphenyl]acrylic acid 1-[3,4-dihydroxyphenyl]2-methoxycarbonylethyl ester) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 염증성 장질환의 예방 또는 치료용 약학 조성물에 관한 것이다.
Figure PCTKR2022008376-appb-img-000001
상기 염증성 장질환은 궤양성 대장염(Ulcerative colitis, UC), 크론병(Crohn's disease, CD), 허혈성 대장염, 장관형 베체트병, 출혈성 직장 궤양 및 회장낭염(pouchitis)으로 이루어진 군으로부터 선택된 어느 하나인 것이 바람직하지만 이에 한정하는 것은 아니다.
본 발명에 있어서, '약학적으로 허용가능한 염'이란 환자에게 비교적 비독성이고, 상기 화학식 1의 화합물의 이로운 효능을 저하시키는 이 염에 기인한 부작용이 나타나지 않는 임의의 모든 유기 또는 무기 부가염을 말하며, 예컨대 유리산으로 무기산, 유기산 또는 무독성 염류 등을 사용할 수 있으며, 바람직한 무기산으로는 염산, 인산, 황산, 질산 또는 주석산을 사용할 수 있고, 바람직한 유기산으로는 메탄설폰산, p-톨루엔설폰산, 아세트산, 트라이플루오로아세트산, 말레인산(maleic acid), 석신산, 옥살산, 벤조산, 타르타르산, 푸마르산(fumaric acid), 만데르산, 프로피온산 (propionic acid), 구연산(citric acid), 젖산(lactic acid), 글리콜산(glycollic acid), 글루콘산(gluconic acid), 갈락투론산, 글루탐산, 글루타르산(glutaric acid), 글루쿠론산(glucuronic acid), 아스파르트산, 아스코르브산, 카본산, 바닐릭산 또는 요오드화수소산(hydroiodic acid)을 사용할 수 있다.
상기 무기산 또는 유기산과 같은 산부가염은 통상의 방법, 예컨대 화합물을 과량의 산 수용액에 용해시키고, 이 염을 수혼화성 유기용매, 예컨대 메탄올, 에탄올, 아세톤 또는 아세토니트릴을 사용하여 침전시켜서 제조할 수 있다. 동 몰량의 화합물 및 물 중의 산 또는 알코올을 가열하고, 이어서 상기 혼합물을 증발시켜서 건조시키거나, 석출된 염을 흡인 여과시킬 수 있다.
상기 무독성 염류로는 설페이트, 피로설페이트, 바이설페이트, 설파이트, 바이설파이트, 니트레이트, 포스페이트, 모노하이드로겐 포스페이트, 디하이드로겐 포스페이트, 메타포스페이트, 피로포스페이트 클로라이드, 브로마이드, 아이오다이드, 플루오라이드, 아세테이트, 프로피오네이트, 데카노에이트, 카프릴레이트, 아크릴레이트, 포메이트, 이소부티레이트, 카프레이트, 헵타노에이트, 프로피올레이트, 옥살레이트, 말로네이트, 석시네이트, 수베레이트, 세바케이트, 푸마레이트, 말리에이트, 부틴-1,4-디오에이트, 헥산-1,6-디오에이트, 벤조에이트, 클로로벤조에이트, 메틸벤조에이트, 디니트로 벤조에이트, 하이드록시벤조에이트, 메톡시벤조에이트프탈레이트, 테레프탈레이트, 벤젠설포네이트, 톨루엔 설포네이트, 클로로벤젠설포네이트, 크실렌설포네이트, 페닐아세테이트, 페닐프로피오네이트, 페닐부티레이트, 시트레이트, 락테이트, 베타-하이드록시부티레이트, 글리콜레이트, 말레이트, 타트레이트, 메탄설포네이트, 프로판설포네이트, 나프탈렌-1-설포네이트, 나프탈렌-2-설포네이트 또는 만델레이트가 바람직하게 사용될 수 있다.
본 발명에서의 용어 '예방'이란 본 발명에 따른 약학 조성물의 투여에 의해 염증성 장질환의 발병을 억제 또는 지연시키는 모든 행위를 의미하고, '치료'란 상기 약학 조성물의 투여에 의해 염증성 장질환의 의심 및 발병 개체의 증상이 호전되거나 이롭게 변경되는 모든 행위를 의미한다.
본 발명에 따른 상기 약학 조성물의 효과적 투여를 위한 투약 경로는 특별히 제한하지 않고, 적절하게 투약 경로를 채택하여 환자에게 사용될 수 있다. 예를 들어, 경구, 직장, 경피, 비경구(피하, 근육, 혈관), 경막, 국부, 흡입 및 기타의 투여방법이 사용될 수 있다.
본 발명에 따른 상기 약학 조성물의 투여형태로는 제제학 분야에 알려진 통상의 방법에 따라 다양한 제형을 통해서 투여할 수 있는데, 바람직한 일례로는 산제, 과립제, 정제, 트로키제, 분산제, 현탁제, 액제, 캡슐제, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제, 주사제, 패치제 및 기타 적당한 제형이 사용될 수 있다.
본 발명의 약학 조성물은 약학 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다. 상기 약학 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유 등을 포함한 다양한 화합물 혹은 혼합물을 들 수 있다.
제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 균주 또는 상기 균주 유래 소포체에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로젤라틴 등이 사용될 수 있다.
본 발명의 약학 조성물은 약학적으로 유효한 양으로 투여될 수 있는데, 본 발명의 용어 '약학적으로 유효한 양'이란 의학적 예방 또는 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 예방 또는 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 질환의 중증도, 약물의 활성, 환자의 연령, 체중, 건강, 성별, 환자의 약물에 대한 민감도, 사용된 본 발명 조성물의 투여 시간, 투여 경로 및 배출 비율, 치료기간, 사용된 본 발명의 조성물과 배합 또는 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 약학 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적으로 또는 동시에 투여될 수 있다. 그리고 단일 또는 다중 투여될 수 있다. 상기 요소를 모두 고려하여 부작용없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하다.
본 발명의 조성물의 투여 빈도는 특별히 이에 제한되지 않으나, 1일 1회 투여하거나 또는 용량을 분할하여 수회 투여할 수 있고, 투여량은 환자의 나이, 몸무게, 성별, 투여형태, 건강상태 및 질환 정도에 따라 달라질 수 있으며, 바람직한 일례로는 몸무게가 70㎏인 성인 환자를 기준으로 할 때, 상기 투여량은 0.1∼300㎎/일, 더 바람직하게는 0.5∼100㎎/일, 더욱더 바람직하게는 1∼60㎎/일의 범위일 수 있으나, 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
또한, 본 발명은 하기 화학식 1로 표시되는 화합물 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 함유하는 염증성 장질환의 예방 또는 개선용 건강기능식품 조성물에 관한 것이다.
[화학식 1]
Figure PCTKR2022008376-appb-img-000002
상기 유효성분은 분말, 과립, 환, 정제, 캡슐, 캔디, 시럽 및 음료 중에서 선택된 어느 하나의 제형으로 제조되는 것이 바람직하지만 이에 한정하지 않는다.
상기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용 가능한 염을 건강기능식품 조성물로 사용할 경우, 상기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용 가능한 염을 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용할 수 있으며, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효 성분의 혼합양은 그 사용 목적에 따라 적합하게 결정될 수 있다.
본 발명의 건강기능식품 조성물은 식품 제조 시에 통상적으로 첨가되고, 식품학적으로 허용되는 성분을 더 포함할 수 있다. 예컨대, 음료로 제조되는 경우에는 본 발명의 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용 가능한 염 이외에 구연산, 액상과당, 설탕, 포도당, 초산, 사과산, 과즙 등에서 하나 이상의 성분을 추가로 포함할 수 있다.
본 발명에 따른 건강기능식품 조성물의 유효성분으로 포함될 수 있는 양은 염증성 장질환의 예방 또는 개선용 건강기능식품을 원하는 사람의 연령, 성별, 체중, 상태, 질병의 증상에 따라 적절히 선택될 수 있으며, 바람직하게는 성인기준 1일 0.01~10.0g 정도로 포함되는 것이 바람직하며, 이러한 함량을 갖는 식품을 섭취함으로써 염증성 장질환의 예방 또는 개선 효과를 얻을 수 있다.
또한 본 발명은 하기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 염증성 장질환의 예방 또는 개선용 사료 조성물에 관한 것이다.
[화학식 1]
Figure PCTKR2022008376-appb-img-000003
상기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용 가능한 염에 대해서는 전술한 바와 같으며, 염증성 장질환의 예방 또는 개선을 목적으로 사료 조성물로 첨가할 수 있다. 상기 사료용 조성물은 사료 첨가제를 포함할 수 있다. 본 발명의 사료첨가제는 사료관리법상의 보조사료에 해당한다.
본 발명에서 용어 '사료'는 동물이 먹고, 섭취하며, 소화시키기 위한 또는 이에 적당한 임의의 천연 또는 인공 규정식, 한끼식 등 또는 상기 한끼식의 성분을 의미할 수 있다. 상기 사료의 종류는 특별히 제한되지 아니하며, 당해 기술 분야에서 통상적으로 사용되는 사료를 사용할 수 있다. 상기 사료의 비제한적인 예로는, 곡물류, 근과류, 식품 가공 부산물류, 조류, 섬유질류, 제약 부산물류, 유지류, 전분류, 박류 또는 곡물 부산물류 등과 같은 식물성 사료; 단백질류, 무기물류, 유지류, 광물성류, 유지류, 단세포 단백질류, 동물성 플랑크톤류 또는 음식물 등과 같은 동물성 사료를 들 수 있다. 이들은 단독으로 사용되거나 2종 이상을 혼합하여 사용될 수 있다.
이하, 실시예를 이용하여 본 발명을 더욱 상세하게 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로 본 발명의 범위가 이들에 의해 제한되지 않는다는 것은 당해 기술분야에서 통상의 지식을 가진 자에게 있어 자명한 것이다.
실시예 1. 오리방풀에서 화학식 1로 표시되는 화합물의 분리
지리산 일원에서 채집한 후 건조한 2.5kg의 오리방풀(Isodon excisus (Max.) Kudo)을 100% 메탄올로, 48시간 동안 추출하여 감압농축한 후 에틸아세테이트로 추출하였다. 상기 에틸아세테이트 층을 농축하여 클로로포름과 메탄올(100:1)을 혼합한 소량의 혼합용매에 용해시킨 후 실리카젤 칼럼 크로마토그래피(20-230 mes, Merk)를 수행하여 활성분획을 농축하였다. 상기 농축된 활성분획을 메탄올에 용해시킨 후 세파덱스 LH-20 젤 칼럼 크로마토그래피(Sephadex LH-20 gel column chromatography)를 수행하여 활성분획을 수집하였다.
상기 농축된 활성분획을 물 및 아세토나이트릴(80:20~100:0의 물:아세토나이트릴, 30분)을 용출용매로 이용하는 고압액체크로마토그래피(컬럼: C18, 유속: 1.5㎖/분, 220nm 검출)를 수행하여 활성분획을 분리하고 감압 건조기로 용매를 제거한 후 얻은 잔사(화학식 1로 표시되는 화합물; 3-[3,4-dihydroxyphenyl]acrylic acid 1-[3,4-dihydroxyphenyl]-2-methoxycarbonylethyl ester)를 냉동 건조하였다. 이후 1H, 13C 및 HMBC NMR 분석을 수행하여 화학식 1로 표시되는 화합물의 구조를 동정하였다(Journal of Natural Products, 2001, vol. 64, No. 5, pp. 659~660).
실시예 2. 웨스턴 블랏을 이용한 RIPK2 인산화 저해 활성 확인
Caco-2 세포를 2×105 세포/㎖의 밀도로 조절하고, 그 세포 부유액 0.5㎖을 12웰 플레이트의 상층부(transwell insert apical side phase) 멤브레인 상에 분주하였으며, 하층부(basolateral side phase)에는 배양배지 1.5㎖을 넣은 후 세포가 분화되고 단층이 적절한 TEER(Transepithelial electrical resistance) 값에 도달할 때까지 2~3일마다 배지를 교체하면서 21일 정도 배양하였다.
상층부와 하층부 사이의 전기저항도(TEER value, Ω·㎠) 측정은 EVOM resistance meter (EVOM2, WPI)를 사용하였다.
Caco-2 세포의 TEER 값이 200Ω·㎠ 이상이 되었을 때, Insert 내에 MDP와 본 발명의 화학식 1로 표시되는 화합물을 24시간 동안 처리하고 Insert 내의 Caco-2 세포를 1× PBS로 세척한 후 트립신을 처리하였다. 이후 원심분리하고 차가운 1× PBS로 세척한 후, 분해 완충용액(50mM Tris-HCl(pH 8.0) 5mM EDTA, 15mM NaCl, 1% NP-40, 1mM PMSF)를 첨가하여 Caco-2 세포를 용해시키고, 12,000rpm, 4℃에서 20분 동안 원심분리 후, 상층액만 취하여 BCA 단백질 어세이 키트를 사용하여 단백질을 정량한 후, 시료 완충용액(1M Tris-HCl (pH 6.8), 50% 글리세롤, 10% SDS, 1% 브로모페놀 블루 및 5% 머캡토에탄올)에 넣어 혼합한 후, 100℃에서 5분 동안 끓인 다음, 15% 아크릴아미드 젤에서 전기영동 후 NC 멤브레인으로 100V에서 1시간 동안 트랜스퍼하였다. 멤브레인을 분리하여 5% 스킴밀크로 1시간 동안 블로킹한 후, 5% BSA에 희석한 1차 항체에 첨가하여 밤샘 배양하였다. 이후 1× TBS-T로 10분씩 3회 세척하고 5% 스킴밀크에 희석한 HRP-컨쥬게이트 된 2차 항체를 첨가하여 2시간 동안 반응시켰다. 1× TBS-T로 10분씩 3회 세척하고 ECL(enhanced chemiluminescence) 용액을 이용하여 단백질 발현량 변화를 확인하였다.
그 결과, 본 발명의 화학식 1로 표시되는 화합물은 더 낮은 농도에서 RIPK2의 활성화를 저해하는 것이 확인되었다. 이 실험 결과를 토대로 본 발명의 화학식 1로 표시되는 화합물이 실제 세포 안에서 RIPK2 저해자로 알려진 제피티닙(양성대조군) 보다 약 2배 이상 높은 RIPK2 인산화 저해 활성이 있는 것으로 판단하였다(도 1).
실시예 3. Tight junction 관련 단백질 회복에 따른 장막 개선 평가
(1) 장막 상피 장벽 모델 구축
Caco-2 세포주(Human intestinal epithelial cell line) 및 마우스 유래 대식세포인 RAW264.7 세포주를 10% FBS(Fetal bovine serum, #16000044, Gibco), 1%의 스트렙토마이신/페니실린(#15140122, Gibco)이 포함된 DMEM(Dulbecco's Modified Eagle Medium, #11995065, Gibco) 배지를 사용하여 37℃, 5%의 CO2 조건에서 배양하였다. 상기 배양에서 배지는 2~3일마다 교체하였으며, 세포배양 디쉬(#353003, Falcon)에 세포가 80% 정도 자라면 계대하면서 유지하였다.
상기 Caco-2 세포를 2×105 세포/㎖의 밀도로 조절하고, 그 세포 부유액 0.5㎖을 12웰 플레이트의 상층부(transwell insert apical side phase) 멤브레인 상에 분주하였으며, 하층부(basolateral side phase)에는 배양배지 1.5㎖을 넣은 후 세포가 분화되고 단층이 적절한 TEER(Transepithelial electrical resistance) 값에 도달할 때까지 2~3일마다 배지를 교체하면서 21일 정도 배양하였다. 상층부와 하층부 사이의 전기저항도(TEER value, Ω·㎠) 측정은 EVOM 저항 측정기(EVOM2, WPI)를 사용하였다.
Caco-2 세포의 TEER 값이 200 Ω·㎠ 이상이 되었을 때, RAW 264.7 세포를 5×105 세포/㎖의 밀도로 조절한 후, 2㎖의 RAW 264.7 세포 부유액을 새로운 12웰 플레이트에 분주하여 24시간 동안 배양하였다. 이후, Caco-2 세포 배양배지를 교환하고, RAW 264.7 세포가 있는 12웰 플레이트에, 상기 배양한 Caco-2 세포를 삽입하여 장막 상피 장벽 모델을 구축하였다.
(2) Tight junction 관련 단백질의 면역형광 현미경 분석
Caco-2 세포를 2×105 세포/㎖의 밀도로 조절하고, 그 세포 부유액 0.5㎖을 12웰 플레이트의 상층부(transwell insert apical side phase) 멤브레인 상에 분주하였으며, 하층부(basolateral side phase)에는 배양배지 1.5㎖을 넣은 후 세포가 분화되고 단층이 적절한 TEER(Transepithelial electrical resistance) 값에 도달할 때까지 2~3일마다 배지를 교체하면서 21일 정도 배양하였다. 상층부와 하층부 사이의 전기저항도(TEER value, Ω·㎠) 측정은 EVOM 저항 측정기(EVOM2, WPI)를 사용하였다.
Insert내에서 21일 동안 배양한 Caco-2 세포의 배양배지를 제거하고, 3% DSS; 3% DSS+본 발명의 화학식 1로 표시되는 화합물(0.3, 1, 3μM); 및 3% DSS+5ASA(500μM);이 포함된 각각의 배양배지로 교체하여 24시간 동안 배양하였다.
이후 Insert 내의 Caco-2 세포를 1× PBS로 2회 세척 후, 4% 파라포름알데히드를 처리하여 상온에서 10분 동안 고정시키고, 1× PBS로 3회 세척 후 0.1% Triton-X 100를 처리하여 상온에서 10분 동안 세포막을 투과시킨 후, 1× PBS로 3회 세척하였다.
이후 1% BSA를 처리하여 상온에서 30분 동안 블로킹하고, 1차 항체를 처리하여 4℃에서 밤샘 처리하여 부착시킨 후, 1× PBS로 5분 동안 3회 세척한 다음 형광물질이 부착된 2차 항체를 처리한 후, 상온에서 빛을 차단하여 1시간 동안 부착시켰다.
이후 1× PBS로 5분 동안 3회 세척한 후, Hoechst 33342를 처리하여 5분 동안 핵을 염색시키고, 1× PBS로 3회 세척한 다음 메스로 멤브레인을 분리한 후, 글라스 슬라이드에 올려 ProLongTM Gold Antifade 시약으로 마운팅한 후 공초점형광현미경으로 확인하였다.
장막상피 장벽 모델에서 Caco-2 세포에 대한 Tight junction 관련 단백질의 발현량 변화를 확인한 면역형광 분석 결과, Tight junction 관련 단백질인 ZO-1, 오클루딘(occludin) 및 클라우딘1(claudin1) 모두 3% DSS(Dextran sulfate sodium)에 의해 유도된 염증성 장질환(궤양성 대장염)이 회복되는 것을 확인하였을 뿐만 아니라, 본 발명의 대상물질은 세포간 연결 단백질인 Tight junction 관련 단백질의 회복에 따른 점막 재생 효능이 현재 염증성 장질환 치료제로 사용 중인 5ASA보다 우수한 것을 확인하였다(도 2~4).
실시예 4. 제브라피쉬 염증성 장질환 동물모델 구축 및 전염증성 사이토카인 mRNA 발현량 분석
제브라피쉬 염증성 장질환 동물모델로, 제브라피쉬 와일드 타입(Zebrafish Wild-type-Danio rerio: AB)을 사용하였으며, 상기 제브라피쉬 와일드 타입은 제브라피쉬 전용 사육시설에서 명/암 주기가 14시간/10시간 주기이고, 온도가 28℃인 조건 하에 사육되었다. 모든 동물실험은 ㈜힐리노엘에스 동물실험윤리위원회 (등록번호 : AEC-20210720-0001)의 프로토콜에 따라 진행되었으며, 모든 실험재료는 멸균처리하여 사용하였다.
대장 상피세포를 손상시킴으로써, 염증성 장질환 중의 '궤양성 대장염'을 유발하는 약물인 DSS(Dextran sulfate sodium, M.W. 36,000-50,000, #160110, MP) 0.5%를 처리하여 제브라피쉬에 염증성 장질환을 유도하고, 본 발명의 화학식 1로 표시되는 화합물을 농도별 (0.3μM 및 1μM)로 처리하여 염증성 장질환 저해 효능을 확인하였다.
DSS에 의한 궤양성 대장염의 제브라피쉬 동물모델은 수정된지 3일된 제브라피쉬 유충(3dpf; days post fertilization)을 사용하였다. 24웰 플레이트에 각 웰당 20마리의 3dpf 제브라피쉬 유충을 넣어주고, 0.5% DSS를 처리하여 궤양성 대장염을 유도하였다. 이후 6dpf 제브라피쉬 유충기 까지 사육한 후, DSS를 제거하고, 5시간 동안 본 발명의 화학식 1로 표시되는 화합물을 처리하였다.
본 발명의 화학식 1로 표시되는 화합물이 처리된 제브라피쉬 유충에 TRIzol 시약 300㎕를 첨가하여 조직 분쇄기(G20, GINKO)로 분쇄하였다. 분쇄된 제브라피쉬 유충을 5분 동안 상온에서 방치한 후 클로로포름 60㎕를 처리하여 단백질 또는 세포 파괴물(cell debris)을 제거한 후 12,000xg, 4℃에서 15분 동안 원심분리하였다. 투명한 상층액 100㎕을 새로운 마이크로원심분리 튜브에 옮기고, 같은 부피의 이소프로판올을 첨가한 후 볼텍스하여 혼합하였다. 상온에 10분 동안 방치한 후 12,000 xg, 4℃에서 10분 동안 원심분리하여 침전된 펠렛만 남기고 상층액은 제거하였다. 침전된 펠렛에 75% 에탄올을 처리하여 세척한 후 12,000xg, 4℃에서 10 분 동안 원심분리하였다. 상층액을 제거하고 펠렛을 건조시킨 후 알앤에이즈 프리 수(RNase free water) 20㎕에 용해시키고 순도와 농도를 마이크로플레이트 리더(FLUOstar omega, BMG Labtech)를 이용하여 측정하였으며, 추출된 total RNA는 -80℃에 보관하였다.
cDNA 합성을 위해 High-Capacity cDNA Reverse Transcriptase Kit (#4368814, Thermo scientific)를 사용하였다. 추출된 total RNA 2㎍에 10× RT 완충용액 2㎕, 25X dNTP 믹스 0.8㎕, 10X RT 랜덤 프라이머 2㎕, 역전사효소 1㎕, 알앤에이즈 프리 수(RNase free water) 4.2㎕를 PCR 튜브(#4358293, Thermo scientific)에 첨가한 후, PCR 기기에서 cDNA를 합성하였다. PCR 조건은 25℃에서 10 분, 37℃에서 120 분, 85℃에서 5 분 동안 반응시켰다. DSS에 의해 유도된 궤양성 대장염 제브라피쉬 모델의 경우, RNA 추출과정에서 잔존하는 DSS에 의하여 cDNA의 합성에 관여하는 역전사 효소의 활성이 저해하기 때문에, RNA의 추출과정에 DSS를 완전히 제거하는 세척을 추가하여 진행하였다.
이를 위해서 DynabeadsTM mRNA DIRECTTM 정제 키트(#61012, Invitrogen) 및 DynaMagTM-2 Magnet(#12321D, Invitrogen)를 사용하였다. 키트에 포함된 자성비드 50㎕를 1.5㎖ 마이크로원심분리 튜브에 분주하고 자성 스탠드에서 30초 동안 방치하여 사용할 분량의 자성비드를 분리하였다. 분리된 자성비드에 분해/결합 완충용액 150㎕를 첨가한 후 볼텍스하여 혼합하고 추출된 총 RNA를 첨가하여 5분 동안 회전기에서 방치하였다. 자성 스탠드에서 30초 동안 방치한 후 스탠드에 부착된 자성 비드를 제외한 용액을 제거하였다. 자성 스탠드에서 분리하여 세척 완충용액으로 세척하고 용리 완충용액 20㎕를 첨가하여 총 RNA에서 mRNA만 분리하였다. 정제된 mRNA에 대한 cDNA 합성은 TOPscriptTM RT DryMix(dT18 plus, Enzynomics)를 사용하였다. 추출된 mRNA 2㎍을 사용하여 cDNA를 합성하였다.
qPCR 반응을 위해 SYBRTM Green PCR 마스터 믹스를 사용하였다. qPCR condition은 95℃에서 10분 동안 Pre-변성 단계를 수행하고, 95℃에서 30초(변성 단계), 55℃에서 30초(어닐링 단계), 72℃에서 30초(연장 단계)를 40주기로 실시하였다.
실험에 사용한 프라이머(5'->3')는 TNF_F: ACAAGGCAATTTCACTTCCA(서열번호 1), TNF_R: AGCTGATGTGCAAAGACACC(서열번호 2); Il1b_F: TTGTGGGAGACAGACGGTGC(서열번호 3), Il1b_R: GATTGGGGTTTGATGTGCTTCAT(서열번호 4);이며, 각각의 유전자 전사 정도는 GAPDH를 endogenous control로 사용하여 상대적 증감으로 나타내었다.
DSS로 유도된 제브라피쉬 염증성 장질환 동물모델에서 본 발명의 화학식 1로 표시되는 화합물과, 현재 염증성 장질환 치료제로 사용 중인 5ASA 및 스테로이드제(Prednisolone)을 처리하여 전염증성 사이토카인 억제 효능을 확인하였다.
그 결과, 본 발명의 화학식 1로 표시되는 화합물은 5ASA 및 프레드니솔론(Prednisolone) 보다 상당히 낮은 농도에서 전염증성 사이토카인의 전사량을 감소시키는 것으로 나타났다(도 5).
실시예 5. DSS 유도 염증성 장질환 모델에서 치료 효능 평가
염증성 장질환 유도 마우스는 6주령 C57BL/6을 사용하였으며, DSS(Dextran Sulfate Sodium, MW 36000~50000, MP Biomedicals)를 투여하여 유도하였다. 아무 것도 처리하지 않은 정상 대조군(3 마리); DSS 투여군(6 마리); DSS+5ASA(5-Aminosalicylic acid, Sigma) 투여군(6 마리); 및 DSS+본 발명의 화학식 1로 표시되는 화합물 투여군(6 마리);으로 분류하였다.
(1) 질병 활성 지수(Disease Activity Index, DAI)로 평가
일반적으로 염증성 장질환은 체중 감소, 설사, 혈변 등의 임상증상을 통해 질병 활성 지수(Disease Activity Index, DAI)로 평가된다. DAI 평가 지수는 체중 감소율, 변의 상태 및 혈변의 상태에 따라 점수를 부여하여 측정한다(표 1).
체중 감소율, 분변 상태 및 장출혈에 대한 평가 지수
점수 체중 감소율(%) 변의 상태 혈변(출혈)
0 <1 정상 정상
1 1~5 - -
2 5~10 항문 주위에 들러붙지 않는 묽은 변 약간의 출혈
3 10~15 - -
4 >15 항문 주위에 들러붙는 설사 눈에 보이는 출혈
본 실시예에서는 각 실험군에서 7일 동안 평가를 진행하였다. 정상 대조군을 제외한 모든 실험군에서 2.5% DSS로 희석된 음용수 100㎖를 2일 간격으로 교체하며 7일 동안 급여하여 염증성 장질환을 유도하였다. 5ASA 투여군은 2.5% CMC(Carboxymethylcellulose sodium, Sigma)에 분산된 100mg/kg의 5ASA를 7일 동안 매일 1회 경구투여 하였고, 본 발명에 따른 2mg/kg의 화학식 1로 표시되는 화합물 을 7일 동안 매일 1회 복강 내 주사로 투여하였다. 실험 시작일부터 매일 각 실험군의 마우스의 체중을 측정하여 체중 감소율을 측정하였다.그 결과, 아무것도 처리하지 않은 정상 대조군에서는 실험 마지막 일까지 체중감소는 나타나지 않았으나, DSS를 처리하여 염증성 장질환이 유도된 모든 실험군에서 5일째 되는 날부터 체중감소가 시작되었다. DSS 투여군 대비 DSS 및 5ASA 투여군과 DSS 및 본 발명의 화학식 1로 표시되는 화합물 투여군 대비 체중 감소율이 낮은 것으로 확인되었다(도 6).
또한, 실험 시작일부터 매일 1회 질병 활성 지수(DAI)의 평가를 진행하였다. 아무것도 처리하지 않은 정상 대조군을 제외한 모든 DSS 처리에 의한 염증성 장질환 유도 실험군에서 5일째 되는 날부터 질병 활성 지수가 높아지기 시작하였다. DSS 처리군에서 가장 가파른 증가 양상이 나타났으며, DSS 및 5ASA 투여군, DSS 및 본 발명의 화학식 1로 표시되는 화합물 투여군 순으로 질병 활성 지수 증가 양상이 나타났다 (도 7).
8일째, 표 1의 평가 지수에 따라 분석된 각 항목의 합을 질병 활성 지수(Disease Activation Index, DAI)로 표 2에 개시하였으며, DSS 및 본 발명의 화학식 1로 표시되는 화합물 투여군에서 가장 낮은 DAI 평가 지수가 확인되었다.
본 발명의 화학식 1로 표시되는 화합물을 7일 동안 투여한 후 8일째 DAI
실험군 DAI
정상대조군 0.00
DSS 투여군(2.5%) 11.75±0.15
DSS 및 화합물 1 투여군 (2mg/kg, 복강투여) 8.75±0.21
DSS 및 5ASA 투여군 (100mg/kg, 경구투여) 10.67±0.19
(2) 대장 길이 측정
염증성 장질환에서 염증 반응은 대장 길이의 감소 정도로 그 증상의 정도를 평가할 수 있다. 8일 째 되는 날, 각 실험군의 마우스를 희생하여 대장 부위를 제거하였다. 제거된 대장으로부터 대장의 길이를 측정하였다.
그 결과, 도 8 및 표 3에 개시한 바와 같이, DSS에 의한 염증 반응으로 DSS 처리군에서는 가장 짧은 대장 길이가 확인되었으며, DSS 및 5ASA 투여군, DSS 및 본 발명의 화학식 1로 표시되는 화합물 투여군 순으로 대장 길이가 점차 증가하였다.
본 발명의 화학식 1로 표시되는 화합물 투여에 따른 대장 길이 변화 확인
실험군 대장의 길이(cm)
정상대조군 8.4
DSS 투여군(2.5%) 4.9
DSS 및 화합물 1 투여군(2mg/kg, 복강투여) 7.4
DSS 및 5ASA 투여군(100mg/kg, 경구투여) 5.7

Claims (8)

  1. 하기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 염증성 장질환의 예방 또는 치료용 약학 조성물.
    [화학식 1]
    Figure PCTKR2022008376-appb-img-000004
  2. 제1항에 있어서, 상기 염증성 장질환은 궤양성 대장염(Ulcerative colitis, UC), 크론병(Crohn's disease, CD), 허혈성 대장염, 장관형 베체트병, 출혈성 직장 궤양 및 회장낭염(pouchitis)으로 이루어진 군으로부터 선택된 어느 하나인 것을 특징으로 하는 염증성 장질환의 예방 또는 치료용 약학 조성물.
  3. 제1항에 있어서, 상기 화학식 1로 표시되는 화합물은 오리방풀 유래의 화합물인 것을 특징으로 하는 염증성 장질환의 예방 또는 치료용 약학 조성물.
  4. 제1항에 있어서, 상기 약학적으로 허용가능한 염은 염산, 인산, 황산, 질산 및 주석산 중에서 선택된 어느 하나의 무기산; 메탄설폰산, p-톨루엔설폰산, 아세트산, 트라이플루오로아세트산, 말레인산(maleic acid), 석신산, 옥살산, 벤조산, 타르타르산, 푸마르산(fumaric acid), 만데르산, 프로피온산 (propionic acid), 구연산(citric acid), 젖산(lactic acid), 글리콜산(glycollic acid), 글루콘산(gluconic acid), 갈락투론산, 글루탐산, 글루타르산(glutaric acid), 글루쿠론산(glucuronic acid), 아스파르트산, 아스코르브산, 카본산, 바닐릭산 및 요오드화수소산(hydroiodic acid) 중에서 선택된 어느 하나의 유기산; 또는 설페이트, 피로설페이트, 바이설페이트, 설파이트, 바이설파이트, 니트레이트, 포스페이트, 모노하이드로겐 포스페이트, 디하이드로겐 포스페이트, 메타포스페이트, 피로포스페이트 클로라이드, 브로마이드, 아이오다이드, 플루오라이드, 아세테이트, 프로피오네이트, 데카노에이트, 카프릴레이트, 아크릴레이트, 포메이트, 이소부티레이트, 카프레이트, 헵타노에이트, 프로피올레이트, 옥살레이트, 말로네이트, 석시네이트, 수베레이트, 세바케이트, 푸마레이트, 말리에이트, 부틴-1,4-디오에이트, 헥산-1,6-디오에이트, 벤조에이트, 클로로벤조에이트, 메틸벤조에이트, 디니트로 벤조에이트, 하이드록시벤조에이트, 메톡시벤조에이트프탈레이트, 테레프탈레이트, 벤젠설포네이트, 톨루엔 설포네이트, 클로로벤젠설포네이트, 크실렌설포네이트, 페닐아세테이트, 페닐프로피오네이트, 페닐부티레이트, 시트레이트, 락테이트, 베타-하이드록시부티레이트, 글리콜레이트, 말레이트, 타트레이트, 메탄설포네이트, 프로판설포네이트, 나프탈렌-1-설포네이트, 나프탈렌-2-설포네이트 및 만델레이트 중에서 선택된 어느 하나의 무독성 염류;인 것을 특징으로 하는 염증성 장질환의 예방 또는 치료용 약학 조성물.
  5. 제1항에 있어서, 상기 유효성분 이외에 약학적으로 허용 가능한 담체, 부형제 또는 희석제를 더 포함하는 것을 특징으로 하는 염증성 장질환의 예방 또는 치료용 약학 조성물.
  6. 하기 화학식 1로 표시되는 화합물 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 함유하는 염증성 장질환의 예방 또는 개선용 건강기능식품 조성물.
    [화학식 1]
    Figure PCTKR2022008376-appb-img-000005
  7. 제6항에 있어서, 상기 유효성분은 분말, 과립, 환, 정제, 캡슐, 캔디, 시럽 및 음료 중에서 선택된 어느 하나의 제형으로 제조되는 것을 특징으로 하는 염증성 장질환의 예방 또는 개선용 건강기능식품 조성물.
  8. 하기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 염증성 장질환의 예방 또는 개선용 사료 조성물.
    [화학식 1]
    Figure PCTKR2022008376-appb-img-000006
PCT/KR2022/008376 2022-02-21 2022-06-14 오리방풀 유래 화합물을 유효성분으로 포함하는 염증성 장질환의 예방, 개선 또는 치료용 조성물 WO2023158024A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US17/916,240 US20240216317A1 (en) 2022-02-21 2022-06-14 Composition for preventing, ameliorating or treating inflammatory bowel disease comprising compound isolated from isodon excisus as effective component

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2022-0022078 2022-02-21
KR1020220022078A KR102417919B1 (ko) 2022-02-21 2022-02-21 오리방풀 유래 화합물을 유효성분으로 포함하는 염증성 장질환의 예방, 개선 또는 치료용 조성물

Publications (1)

Publication Number Publication Date
WO2023158024A1 true WO2023158024A1 (ko) 2023-08-24

Family

ID=82400264

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/008376 WO2023158024A1 (ko) 2022-02-21 2022-06-14 오리방풀 유래 화합물을 유효성분으로 포함하는 염증성 장질환의 예방, 개선 또는 치료용 조성물

Country Status (3)

Country Link
US (1) US20240216317A1 (ko)
KR (1) KR102417919B1 (ko)
WO (1) WO2023158024A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240072339A (ko) * 2022-11-14 2024-05-24 주식회사 힐리노엘에스 교모세포종의 예방, 개선 또는 치료용 화합물을 유효성분으로 포함하는 조성물

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101661423B1 (ko) * 2015-04-23 2016-09-29 대구한의대학교산학협력단 오리방풀 유래 화합물을 함유하는 항산화 및 항염용 조성물 및 그 추출방법
KR102117487B1 (ko) * 2017-06-30 2020-06-02 (주)바이오파마리서치랩 브라우쏘칼콘 a를 유효성분으로 포함하는 염증성 장질환 예방 또는 치료용 약학 조성물

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101661423B1 (ko) * 2015-04-23 2016-09-29 대구한의대학교산학협력단 오리방풀 유래 화합물을 함유하는 항산화 및 항염용 조성물 및 그 추출방법
KR102117487B1 (ko) * 2017-06-30 2020-06-02 (주)바이오파마리서치랩 브라우쏘칼콘 a를 유효성분으로 포함하는 염증성 장질환 예방 또는 치료용 약학 조성물

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CHENG Z-J, ET AL.: "BROUSSOCHALCONE A, A POTENT ANTIOXIDANT AND EFFECTIVE SUPPRESSOR OF INDUCIBLE NITRIC OXIDE SYNTHASE IN LIPOPOLYSACCHARIDE-ACTIVATED MACROPHAGES", BIOCHEMICAL PHARMACOLOGY, ELSEVIER, US, vol. 61, no. 08, 15 April 2001 (2001-04-15), US , pages 939 - 946, XP001149401, ISSN: 0006-2952, DOI: 10.1016/S0006-2952(01)00543-3 *
LEE, C.; KIM, J.; LEE, H.; KHO, Y.*: "Two new constituents of Isodon excisus and their evaluation in an apoptosis inhibition assay", MEDICINAL & AROMATIC PLANTS ABSTRACTS, SCIENTIFIC PUBLISHERS, SCIENTIFIC PUBLISHERS, NEW DELHI - INDIA, vol. 23, no. 5, 1 October 2001 (2001-10-01), Scientific Publishers, New Delhi - India , XP018010332, ISSN: 0250-4367 *
ZHANG Y ET AL.: "Anti-inflammatory lignans and phenylethanoid glycosides from the root of Isodon ternifolius (D.Don) Kudô", PHYTOCHEMISTRY, ELSEVIER, AMSTERDAM , NL, 1 May 2018 (2018-05-01), Amsterdam , NL , pages 36 - 47, XP018530149, ISSN: 0031-9422 *

Also Published As

Publication number Publication date
US20240216317A1 (en) 2024-07-04
KR102417919B1 (ko) 2022-07-06

Similar Documents

Publication Publication Date Title
WO2018048056A1 (ko) 담팔수 추출물 또는 이의 분획물을 유효 성분으로 포함하는 알파 계열 허피스 바이러스 감염증의 예방 및 치료용 약제학적 조성물
WO2023158024A1 (ko) 오리방풀 유래 화합물을 유효성분으로 포함하는 염증성 장질환의 예방, 개선 또는 치료용 조성물
WO2020246777A1 (ko) 이리도이드 고함유 노니 열매 추출물 또는 이의 분획물의 제조방법, 면역증진 활성물질 고함유 노니 열매 추출물 또는 이의 분획물의 제조방법 및 노니 열매 추출물 또는 이의 분획물의 용도
WO2022131428A1 (ko) 오를리스타트 및 아커만시아 뮤시니필라 eb-amdk19 균주를 포함하는 조성물
WO2013105693A1 (ko) 벼 겉껍질 및 보리 겉껍질 추출물을 유효성분으로 포함하는 약학 조성물
WO2016080691A1 (ko) 노린재나무 및 황기의 추출물을 포함하는 관절염의 예방 또는 치료용 약학 조성물 및 그 제조방법
WO2017183902A1 (ko) 인진, 지유 및 울금 추출물 및 항바이러스제를 유효성분으로 포함하는 간질환 예방 또는 치료용 조성물
Yao et al. Protective effects of curcumin against rat intestinal inflammation‑related motility disorders
WO2021230581A1 (ko) 신규한 아커만시아 뮤시니필라 ak32 균주의 발견 및 장 손상의 예방 또는 치료를 위한 응용
KR20120017465A (ko) 마크로락틴 화합물을 포함하는 염증성 장질환의 예방 또는 치료용 약학 조성물
KR101653884B1 (ko) 항 콕사키바이러스 활성을 갖는 오리방풀 유래 화합물
WO2013012117A1 (en) Pharmaceutical compositions for preventing or treating inflammatory diseases, comprising phytosterol compound
WO2016167444A1 (ko) 백출 추출물을 포함하는 비만 또는 지질 관련 대사성 질환의 예방 또는 치료용 약학적 조성물
WO2022177236A1 (ko) 진토닌을 포함하는 근위축 또는 악액질의 예방 또는 치료용 약학적 조성물
CN111973587B (zh) 槲皮素在制备抗草鱼呼肠孤病毒药物中的用途
WO2012144854A2 (ko) 리코찰콘 ａ의 신규 용도
WO2019203555A1 (ko) Ｐｒｏｇｒａｎｕｌｉｎ 단백질을 포함하는 간질환의 예방 또는 치료용 조성물
WO2022045834A1 (ko) 과남풀 추출물을 포함하는 인슐린 민감성 개선용 조성물
WO2024106739A1 (ko) 교모세포종의 예방, 개선 또는 치료용 화합물을 유효성분으로 포함하는 조성물
CN113413465B (zh) 岩藻糖基化抑制剂在抗癌导致炎症中的应用
WO2023075491A1 (ko) 근이영양증의 예방, 개선 또는 치료용 조성물
WO2023048504A1 (ko) 생열귀나무 추출물을 유효성분으로 하는 근력 약화 관련 질환 또는 근감소증 예방 또는 치료용 조성물
WO2012036344A1 (ko) 특정 화합물을 유효성분으로 포함하는 식욕억제 식품성분 조성물
WO2021162505A1 (ko) 사상자로부터 분리한 화합물 및 이를 유효성분으로 포함하는 항암용 약학 조성물
WO2023128452A1 (ko) 대청엽 및 가래나무의 복합 추출물을 포함하는 염증성 장질환의 치료용 조성물

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 17916240

Country of ref document: US

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22927422

Country of ref document: EP

Kind code of ref document: A1