WO2022145707A1 - 피페론구민계 화합물 및 이를 포함하는 면역조절제 - Google Patents

피페론구민계 화합물 및 이를 포함하는 면역조절제 Download PDF

Info

Publication number
WO2022145707A1
WO2022145707A1 PCT/KR2021/016597 KR2021016597W WO2022145707A1 WO 2022145707 A1 WO2022145707 A1 WO 2022145707A1 KR 2021016597 W KR2021016597 W KR 2021016597W WO 2022145707 A1 WO2022145707 A1 WO 2022145707A1
Authority
WO
WIPO (PCT)
Prior art keywords
group
compound
formula
mmol
aryl
Prior art date
Application number
PCT/KR2021/016597
Other languages
English (en)
French (fr)
Inventor
주성수
하나름
유정민
경영수
전종갑
정헌세
장수길
Original Assignee
주식회사 휴사이온
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020210128774A external-priority patent/KR20220095094A/ko
Application filed by 주식회사 휴사이온 filed Critical 주식회사 휴사이온
Publication of WO2022145707A1 publication Critical patent/WO2022145707A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D211/00—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/68—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having one double bond between ring members or between a ring member and a non-ring member
    • C07D211/72—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having one double bond between ring members or between a ring member and a non-ring member with hetero atoms or with carbon atoms having three bonds to hetero atoms, with at the most one bond to halogen, directly attached to ring carbon atoms
    • C07D211/74—Oxygen atoms
    • C07D211/76—Oxygen atoms attached in position 2 or 6
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/40—Complete food formulations for specific consumer groups or specific purposes, e.g. infant formula
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0053—Mouth and digestive tract, i.e. intraoral and peroral administration
    • A61K9/0056—Mouth soluble or dispersible forms; Suckable, eatable, chewable coherent forms; Forms rapidly disintegrating in the mouth; Lozenges; Lollipops; Bite capsules; Baked products; Baits or other oral forms for animals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C231/00—Preparation of carboxylic acid amides
    • C07C231/02—Preparation of carboxylic acid amides from carboxylic acids or from esters, anhydrides, or halides thereof by reaction with ammonia or amines
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C231/00—Preparation of carboxylic acid amides
    • C07C231/08—Preparation of carboxylic acid amides from amides by reaction at nitrogen atoms of carboxamide groups
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C235/00—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms
    • C07C235/70—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups and doubly-bound oxygen atoms bound to the same carbon skeleton
    • C07C235/72—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups and doubly-bound oxygen atoms bound to the same carbon skeleton with the carbon atoms of the carboxamide groups bound to acyclic carbon atoms
    • C07C235/76—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups and doubly-bound oxygen atoms bound to the same carbon skeleton with the carbon atoms of the carboxamide groups bound to acyclic carbon atoms of an unsaturated carbon skeleton
    • C07C235/78—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups and doubly-bound oxygen atoms bound to the same carbon skeleton with the carbon atoms of the carboxamide groups bound to acyclic carbon atoms of an unsaturated carbon skeleton the carbon skeleton containing rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C235/00—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms
    • C07C235/88—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having the nitrogen atom of at least one of the carboxamide groups further acylated
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D207/00—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D207/02—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D207/18—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having one double bond between ring members or between a ring member and a non-ring member
    • C07D207/22—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having one double bond between ring members or between a ring member and a non-ring member with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D207/24—Oxygen or sulfur atoms
    • C07D207/26—2-Pyrrolidones
    • C07D207/263—2-Pyrrolidones with only hydrogen atoms or radicals containing only hydrogen and carbon atoms directly attached to other ring carbon atoms
    • C07D207/27—2-Pyrrolidones with only hydrogen atoms or radicals containing only hydrogen and carbon atoms directly attached to other ring carbon atoms with substituted hydrocarbon radicals directly attached to the ring nitrogen atom
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D207/00—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D207/02—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D207/30—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having two double bonds between ring members or between ring members and non-ring members
    • C07D207/34—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having two double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D207/36—Oxygen or sulfur atoms
    • C07D207/38—2-Pyrrolones
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D211/00—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/80—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having two double bonds between ring members or between ring members and non-ring members
    • C07D211/84—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having two double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms, with at the most one bond to halogen directly attached to ring carbon atoms
    • C07D211/86—Oxygen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D211/00—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/80—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having two double bonds between ring members or between ring members and non-ring members
    • C07D211/84—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having two double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms, with at the most one bond to halogen directly attached to ring carbon atoms
    • C07D211/86—Oxygen atoms
    • C07D211/88—Oxygen atoms attached in positions 2 and 6, e.g. glutarimide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D295/00—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms
    • C07D295/16—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms acylated on ring nitrogen atoms
    • C07D295/18—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms acylated on ring nitrogen atoms by radicals derived from carboxylic acids, or sulfur or nitrogen analogues thereof
    • C07D295/182—Radicals derived from carboxylic acids
    • C07D295/185—Radicals derived from carboxylic acids from aliphatic carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/02—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
    • C07D405/06—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
    • C07D413/12—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a chain containing hetero atoms as chain links
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs

Definitions

  • the present invention relates to a novel piperongumin-based compound, an immunomodulatory agent comprising the same, and a health functional food for immunomodulation.
  • Immunity refers to a reaction that maintains the homeostasis of the body by distinguishing between self and non-self in the human body, recognizing and removing harmful substances that occur naturally in the human body or enter from outside.
  • the immune response is important in resisting harmful bacteria such as viruses, bacteria and parasites that have invaded the human body from the outside, and in resisting or eliminating cancer cells generated inside.
  • Congenital immunodeficiency is a disease in which immune cells such as B cells and T cells do not originally exist, and can be treated only with treatment methods such as gene therapy, antibody injection, or bone marrow transplantation.
  • acquired immunodeficiency refers to the presence of immune components themselves, but an abnormality in the immune response process shown by them, and by enhancing the functions of these components, the state of the disease can be improved.
  • the present inventors synthesized a novel piperongumin compound having a predetermined chemical structure, and found that this novel compound has excellent antioxidant activity, cytokine production inhibitory ability and/or intracytoplasmic signal transduction inhibitory ability targeting immune cells.
  • the present invention was completed by finding.
  • an object of the present invention is to provide a novel piperongumin-based compound, a derivative thereof, a pharmaceutically acceptable salt, or a solvate thereof.
  • Another technical object of the present invention is to provide an immunomodulatory agent comprising the above-described novel piperongumin-based compound as an active ingredient, and a health functional food for immunomodulation.
  • the present invention provides a compound represented by the following formula (1), a pharmaceutically acceptable salt, or a solvate thereof.
  • R 2 To R 4 are the same as or different from each other, and each independently hydrogen, deuterium, halogen, nitro group, hydroxy group, amino group, C 1 ⁇ C 40 alkyl group, C 2 ⁇ C 40 alkenyl group, C 2 ⁇ C 40 alkynyl group, C 3 ⁇ C 40 cycloalkyl group, heterocycloalkyl group having 3 to 40 nuclear atoms, C 1 ⁇ C 20 alkoxy group, C 1 ⁇ C 20 ketone group, C 1 ⁇ C 20 ester A group, C 6 -C 20 Aryl group, a heteroaryl group having 5 to 20 nuclear atoms, and a C 6 -C 20 aryloxy group are selected from the group consisting of, or these are combined with an adjacent group to form a C 6 -C 20 Aryl or 5 to 20 nuclear atoms It may form a heteroaryl ring, except when R 2 To R 4 are the same,
  • R 1 is a substituent selected from the following structural formula,
  • X is a halogen element selected from the group consisting of F, Cl, Br and I,
  • Y is a C 1 ⁇ C 10 alkyl group
  • the R 2 ⁇ R 4 Alkyl group, ketone group, ester group, aryl group, heteroaryl group is each independently deuterium, halogen, cyano group, nitro group, C 1 ⁇ C 40 alkyl group, C 2 ⁇ C 40 alkenyl group , C 2 ⁇ C 40 alkynyl group, C 6 ⁇ C 40 aryl group, heteroaryl group of 5 to 40 nuclear atoms, C 6 ⁇ C 40 aryloxy group, C 1 ⁇ C 40 alkyloxy group, C 6 ⁇ C 40 arylamine group, C 3 ⁇ C 40 cycloalkyl group, heterocycloalkyl group of 3 to 40 nuclear atoms, C 1 ⁇ C 40 alkylsilyl group, C 1 ⁇ C 40 alkylboron group, C 6 ⁇ C 40 Aryl boron group, C 6 ⁇ C 40 Aryl boron group, C 6 ⁇ C 40 Aryl boron group, C 6 ⁇ C 40 Aryl phos
  • the present invention also provides an immunomodulatory agent comprising the compound represented by Formula 1, a pharmaceutically acceptable salt, or solvate thereof as an active ingredient.
  • the present invention provides a health functional food for immunomodulation comprising the compound represented by the above formula (1), a pharmaceutically acceptable salt, or solvate thereof as an active ingredient.
  • the present invention also provides an immunomodulatory method comprising administering to a subject the compound represented by Formula 1, a pharmaceutically acceptable salt, or solvate thereof.
  • the present invention provides the use of a compound represented by the above-mentioned formula 1, a pharmaceutically acceptable salt, or a solvate thereof for use in the manufacture of a medicament for immunomodulation.
  • the compound represented by Formula 1 is a novel piperongumin derivative not previously known, and exhibits excellent antioxidant activity against immune cells, cytokine production inhibition, and/or intracytoplasmic signal transduction inhibitory ability. Since they appear at the same time, it can be usefully used as an immunomodulatory agent.
  • 1 is a graph showing the result of inhibiting the production of nitrogen monoxide using the piperongumin compound according to the present invention.
  • FIG. 2 is a graph showing the result of inhibiting hydroxyl radicals using the piperongumin-based compound according to the present invention.
  • 3 to 5 are graphs showing the results of inhibition of inflammatory cytokine gene expression using the piperongumin compound according to the present invention, respectively.
  • 6 to 10 are graphs showing the results of inhibition of T cell-dependent cytokine gene expression using the piperongumin compound according to the present invention, respectively.
  • 11 to 14 are graphs showing the results of suppression of reporter gene expression using the piperongumin-based compound according to the present invention, respectively.
  • prevention mean to inhibit or delay the occurrence from the cause of a disease
  • treatment inhibit the progression and/or exacerbation of symptoms even without completely curing the progression of damage It means to lead in the direction of healing by stopping or improving some or all of the symptoms.
  • An example of the present invention relates to a compound represented by the following formula (1), specifically, a novel piperongumine-based compound and a derivative thereof, a pharmaceutically acceptable salt thereof, or a solvate thereof.
  • R 2 To R 4 are the same as or different from each other, and each independently hydrogen, deuterium, halogen, nitro group, hydroxy group, amino group, C 1 ⁇ C 40 alkyl group, C 2 ⁇ C 40 alkenyl group, C 2 ⁇ C 40 alkynyl group, C 3 ⁇ C 40 cycloalkyl group, heterocycloalkyl group having 3 to 40 nuclear atoms, C 1 ⁇ C 20 alkoxy group, C 1 ⁇ C 20 ketone group, C 1 ⁇ C 20 ester group, C 6 -C 20 Aryl group, heteroaryl group having 5 to 20 nuclear atoms, C 6 -C 20 aryloxy group selected from the group consisting of, or combined with an adjacent group, C 6 -C 20 aryl or 5 to 20 nuclear atoms It may form a heteroaryl ring, except that R 2 To R 4 are the same,
  • R 1 is a substituent selected from the following structural formula,
  • the wavy part means a part where the bond with Chemical Formula 1 is made
  • X is a halogen element selected from the group consisting of F, Cl, Br and I,
  • Y is a C 1 ⁇ C 10 alkyl group
  • the R 2 ⁇ R 4 Alkyl group, ketone group, ester group, aryl group, heteroaryl group is each independently deuterium, halogen, cyano group, nitro group, C 1 ⁇ C 40 alkyl group, C 2 ⁇ C 40 alkenyl group , C 2 ⁇ C 40 alkynyl group, C 6 ⁇ C 40 aryl group, heteroaryl group of 5 to 40 nuclear atoms, C 6 ⁇ C 40 aryloxy group, C 1 ⁇ C 40 alkyloxy group, C 6 ⁇ C 40 arylamine group, C 3 ⁇ C 40 cycloalkyl group, heterocycloalkyl group of 3 to 40 nuclear atoms, C 1 ⁇ C 40 alkylsilyl group, C 1 ⁇ C 40 alkylboron group, C 6 ⁇ C 40 Aryl boron group, C 6 ⁇ C 40 Aryl boron group, C 6 ⁇ C 40 Aryl boron group, C 6 ⁇ C 40 Aryl phos
  • piperongumine is a compound in the form of a chalcone in which two rings are connected to an ⁇ , ⁇ -unsaturated carbonyl chain, one of the two rings is a benzene ring with three methoxy groups (-OMe) connected and , the other has a 2-piperidone structure.
  • the benzene ring 3,4-position of piperongumine is changed to a nitro group or other substituent, and the other ring is 2-pyrrolidone and/or various types of nitrogen compounds are synthesized.
  • it has a structure linking it to the ⁇ , ⁇ -unsaturated carbonyl chain.
  • R 1 may be a moiety selected from the following structural formula.
  • R 2 to R 4 are the same as or different from each other, and each independently selected from the group consisting of hydrogen, a nitro group, a hydroxy group, an ester group including a C 1 -C 6 alkyl, and a C 1 -C 6 alkoxy group Or, two adjacent substituents may combine with each other to form a C 6 -C 10 aryl group, or a heterocycle having 5 to 10 nuclear atoms including at least one nitrogen and oxygen atom.
  • the alkyl group, ketone group, ester group, aryl group, and heteroaryl group of R 2 to R 4 are each independently deuterium, halogen, cyano group, nitro group, C 1 to C 40 alkyl group, C 2 to C 40 alkenyl group, C 2 ⁇ C 40 alkynyl group, C 6 ⁇ C 40 aryl group, heteroaryl group of 5 to 40 nuclear atoms, C 6 ⁇ C 40 aryloxy group, C 1 ⁇ C 40 Alkyloxy group, C 6 ⁇ C 40 arylamine group, C 3 ⁇ C 40 cycloalkyl group, heterocycloalkyl group having 3 to 40 nuclear atoms, C 1 ⁇ C 40 alkylsilyl group, C 1 ⁇ C 40 Alkyl boron group, C 6 ⁇ C 40 Aryl boron group, C 6 ⁇ C 40 Aryl boron group, C 6 ⁇ C 40 Aryl phosphine group, C 6 ⁇ C 40 Aryl pho
  • the compound of Formula 1 may be more specific to any one of Formulas 2 to 5 below, depending on the type of R 2 to R 4 .
  • the present invention is not limited thereto.
  • R 1 is as defined in Formula 1 above.
  • R 5 To R 7 are the same as or different from each other, and each independently hydrogen, a hydroxyl group, a C 1 ⁇ C 6 alkyl group, a C 1 ⁇ C 6 alkoxy group, a C 1 ⁇ C 6 ketone group, and C 1 ⁇ It is selected from the group consisting of an ester group of C 6 .
  • Ring A may be a monocyclic or polycyclic hydrocarbon ring group having 20 or less carbon atoms, and may be specifically selected from the group consisting of a cycloalkyl ring, a heterocycloalkyl ring, an aryl ring, and a heteroaryl ring. At least one carbon constituting the ring A is deuterium, halogen, cyano group, nitro group, C 1 ⁇ C 40 alkyl group, C 6 ⁇ C 40 aryl group, and a heteroaryl group having 5 to 40 nuclear atoms consisting of It may be substituted with one or more substituents selected from the group.
  • the compound represented by Chemical Formula 1 of the present invention described above may be further embodied as a compound exemplified below.
  • the compound represented by Formula 1 of the present invention is not limited by those exemplified below.
  • alkyl refers to a monovalent substituent derived from a linear or branched saturated hydrocarbon having 1 to 40 carbon atoms. Examples thereof include, but are not limited to, methyl, ethyl, propyl, isobutyl, sec-butyl, pentyl, iso-amyl, hexyl, and the like.
  • alkenyl refers to a monovalent substituent derived from a linear or branched unsaturated hydrocarbon having 2 to 40 carbon atoms and having one or more carbon-carbon double bonds. Specific examples thereof include, but are not limited to, vinyl (vinyl), allyl (allyl), isopropenyl (isopropenyl), 2-butenyl (2-butenyl) and the like.
  • alkynyl refers to a monovalent substituent derived from a straight or branched unsaturated hydrocarbon having 2 to 40 carbon atoms and having one or more carbon-carbon triple bonds. Specific examples thereof include, but are not limited to, ethynyl, 2-propynyl, and the like.
  • aryl refers to a monovalent substituent derived from an aromatic hydrocarbon having 6 to 40 carbon atoms in which a single ring or two or more rings are combined.
  • two or more rings may be simply attached to each other (pendant) or condensed form may be included.
  • Specific examples of such aryl include, but are not limited to, phenyl, naphthyl, phenanthryl, anthryl, and the like.
  • heteroaryl refers to a monovalent substituent derived from a monoheterocyclic or polyheterocyclic aromatic hydrocarbon having 5 to 40 nuclear atoms.
  • one or more carbons in the ring preferably 1 to 3 carbons, are substituted with a heteroatom such as N, O, S or Se.
  • a form in which two or more rings are simply attached to each other or condensed may be included, and further, a form condensed with an aryl group may be included.
  • heteroaryl examples include 6-membered monocyclic rings such as pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, triazinyl, phenoxathienyl, indolizinyl, indolyl ( polycyclic rings such as indolyl), purinyl, quinolyl, benzothiazole, and carbazolyl, and 2-furanyl, N-imidazolyl, 2-isoxazolyl , 2-pyridinyl, 2-pyrimidinyl, and the like, but is not limited thereto.
  • 6-membered monocyclic rings such as pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, triazinyl, phenoxathienyl, indolizinyl, indolyl ( polycyclic rings such as indolyl), purinyl, quinolyl, benzothiazole
  • alkyloxy is a monovalent substituent represented by R'O-, wherein R' means an alkyl having 1 to 40 carbon atoms, and has a linear, branched or cyclic structure. may include.
  • alkyloxy include, but are not limited to, methoxy, ethoxy, n-propoxy, 1-propoxy, t-butoxy, n-butoxy, pentoxy, and the like.
  • cycloalkyl means a monovalent substituent derived from a monocyclic or polycyclic non-aromatic hydrocarbon having 3 to 40 carbon atoms.
  • examples of such cycloalkyl include, but are not limited to, cyclopropyl, cyclopentyl, cyclohexyl, norbornyl, adamantine, and the like.
  • heterocycloalkyl means a monovalent substituent derived from a non-aromatic hydrocarbon having 3 to 40 nuclear atoms, and at least one carbon in the ring, preferably 1 to 3 carbons, is N, O, S or a hetero atom such as Se.
  • heterocycloalkyl include, but are not limited to, morpholine and piperazine.
  • condensed ring means a condensed aliphatic ring, a condensed aromatic ring, a condensed heteroaliphatic ring, a condensed heteroaromatic ring, or a combination thereof.
  • the present invention also provides a salt, preferably a pharmaceutically acceptable salt, of the compound represented by the formula (1).
  • pharmaceutically acceptable salt means a salt suitable for use in contact with human and lower animal tissues without causing excessive toxicity, irritation, allergic reaction, etc. within the scope of pure medical judgment.
  • the pharmaceutically acceptable salts are well known in the art and are described in detail in, for example, the literature (S.M. Berge et al., J. Pharmaceutical Sciences, 66, 1, 1977).
  • the salt may be prepared in situ during final isolation and purification of the compound of the present invention, or may be prepared by separately reacting with an inorganic base or an organic base.
  • Preferred examples of the base addition salt form include ammonium salts, alkali salts such as salts of lithium, sodium, potassium, magnesium, calcium, etc.
  • alkaline earth metal salts, salts with organic bases for example primary, secondary and tertiary Aliphatic and aromatic amines such as methylamine, ethylamine, propylamine, isopropylamine, four butylamine isomers, dimethylamine, diethylamine, diethanolamine, dipropylamine, diisopropylamine, di-n -Butylamine, pyrrolidine, piperidine, morpholine, trimethylamine, triethylamine, tripropylamine, quinuclidine, pyridine, quinoline and isoquinoline, benzathine, N-methyl-D-glucamine, 2 -amino-2-(hydroxymethyl)-1,3-propanediol, hydrabamine salts, and salts with amino acids such as arginine and lysine.
  • Aliphatic and aromatic amines such as methylamine, ethylamine, propylamine, isopropyl
  • the present invention may include a hydrate or solvate of the compound represented by Formula 1, and derivatives thereof.
  • the solvent is not particularly limited, and may include all common solvents known in the art.
  • an immunomodulatory agent comprising a compound represented by the following Chemical Formula 1, a pharmaceutically acceptable salt, or a solvate thereof as an active ingredient.
  • the immunomodulatory agent may be an immunosuppressive agent that suppresses an immune response.
  • active ingredient means a component capable of exhibiting the desired activity alone or in combination with a carrier having no activity by itself, and the specific content value is not particularly limited.
  • the immunomodulatory agent according to the present invention may contain 0.01 to 99% by weight of the compound of Formula 1 as an active ingredient, specifically 0.1 to 95% by weight, based on the total weight of the composition.
  • the immunomodulatory agent of the present invention may further include at least one active ingredient exhibiting the same or similar function in addition to the active ingredient.
  • the immunomodulatory agent of the present invention may include a carrier, diluent, excipient, or a mixture thereof that is commonly used in pharmaceutically suitable and physiologically acceptable formulations.
  • Any pharmaceutically acceptable carrier may be used as long as it is suitable for delivering the composition in vivo.
  • the carrier is Merck Index, 13th ed., Merck & Co. Inc., saline, sterile water, Ringer's solution, dextrose solution, maltodextrin solution, glycerol, ethanol, or mixtures thereof.
  • conventional additives such as antioxidants, buffers, and bacteriostats may be added as needed.
  • composition When formulating the composition, commonly used fillers, extenders, binders, wetting agents, disintegrants, diluents or excipients such as surfactants may be added.
  • the immunomodulatory agent of the present invention may be formulated as an oral preparation or a parenteral preparation.
  • Oral formulations may include solid formulations and liquid formulations.
  • the solid preparation may be a tablet, pill, powder, granule, capsule, or troche, and the solid preparation may be prepared by adding at least one excipient to the composition.
  • the excipient may be starch, calcium carbonate, sucrose, lactose, gelatin, or a mixture thereof.
  • the solid formulation may contain a lubricant, examples of which include magnesium stearate, talc, and the like.
  • the liquid formulation may be a suspension, an internal solution, an emulsion, or a syrup.
  • the liquid formulation may include excipients such as wetting agents, sweetening agents, fragrances, and preservatives.
  • the parenteral formulation may include injections, suppositories, powders for respiratory inhalation, aerosols for sprays, powders and creams, and the like.
  • the injection may include a sterile aqueous solution, a non-aqueous solution, a suspension solution, an emulsion, and the like.
  • non-aqueous solvent or suspension solution vegetable oils such as propylene glycol, polyethylene glycol, and olive oil, or injectable esters such as ethyl oleate may be used.
  • the immunomodulatory agent of the present invention may be administered orally or parenterally according to a desired method.
  • Parenteral administration may include intraperitoneal, rectal, subcutaneous, intravenous, intramuscular or intrathoracic injection.
  • the immunomodulatory agent may be administered in a pharmaceutically effective amount. This may vary depending on the type of disease, severity, drug activity, patient's sensitivity to the drug, administration time, administration route, treatment period, drugs used at the same time, and the like. However, for a desirable effect, the amount of the active ingredient included in the pharmaceutical composition according to the present invention may be 0.0001 to 1,000 mg/kg, specifically 0.001 to 500 mg/kg. The administration may be once or several times a day.
  • the immunomodulatory agent of the present invention may be administered alone or in combination with other therapeutic agents. When administered in combination, the administration may be sequential or simultaneous.
  • Another embodiment of the present invention relates to a health functional food for immune regulation, comprising the compound represented by the following formula (1), a pharmaceutically acceptable salt, or solvate thereof as an active ingredient.
  • 'health functional food' is a food manufactured and processed by methods such as extracting, concentrating, refining, mixing, or extracting, concentrating, refining, mixing, etc., a specific ingredient having a function useful to the human body as a raw material for the purpose of health supplementation. As meaning, it may have functions related to disease prevention and disease recovery.
  • the health functional food according to the present invention may be used with the compound as it is or in combination with other foods or food compositions.
  • the amount of the active ingredient used may be suitably determined according to the purpose of its use, and is not particularly limited.
  • the compound of Formula 1 according to the present invention, an isomer, a pharmaceutically acceptable salt or solvate thereof is added in an amount of 0.001 to 99% by weight based on the total weight of the raw material of the food or beverage in the preparation of the food or beverage. It may be, specifically, 0.1 to 95% by weight.
  • the health functional food of the present invention may include ingredients commonly used in food compositions in the art in addition to the compound of Formula 1, an isomer, a pharmaceutically acceptable salt or solvate thereof.
  • ingredients commonly used in food compositions in the art in addition to the compound of Formula 1, an isomer, a pharmaceutically acceptable salt or solvate thereof.
  • one or more additives selected from the group consisting of organic acids, phosphates, antioxidants, lactose casein, dextrin, glucose, sugar and sorbitol may be further included.
  • various nutrients, vitamins, minerals (electrolytes), synthetic flavoring agents and flavoring agents such as natural flavoring agents, coloring agents and thickening agents, facic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusting agents, It may further contain stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like.
  • the health functional food of the present invention may be prepared in any dosage form conventionally prepared in the art, and for example, it is also provided in the form of tablets, granules, pills, capsules, liquid preparations, syrups or beverages of the present invention. belong to the category
  • the type of food to which the compound of Formula 1, an isomer, a pharmaceutically acceptable salt or solvate thereof can be added is not particularly limited.
  • examples include various foods, powders, granules, tablets, capsules, syrups, beverages, gums, teas, vitamin complexes, health functional foods, and the like. More specific examples include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages and vitamin complexes , and other nutritional supplements, but are not limited to these types of foods.
  • the present invention also provides an immunomodulatory method comprising administering to a subject the compound represented by Formula 1, a pharmaceutically acceptable salt, or solvate thereof.
  • the subject may be a mammal, specifically, a human.
  • the administration may be oral or parenteral administration depending on the desired method.
  • Parenteral administration may include intraperitoneal, rectal, subcutaneous, intravenous, intramuscular or intrathoracic injection.
  • the administration may be administered in a pharmaceutically effective amount. This may vary depending on the type of disease, severity, drug activity, patient's sensitivity to the drug, administration time, administration route, treatment period, drugs used at the same time, and the like.
  • the amount of the active ingredient included in the pharmaceutical composition according to the present invention may be 0.0001 to 1,000 mg/kg, specifically 0.001 to 500 mg/kg.
  • the administration may be once or several times a day.
  • the administration may be performed alone or in combination with other therapeutic agents.
  • the administration may be sequential or simultaneous.
  • the present invention provides the use of a compound represented by Formula 1, a pharmaceutically acceptable salt, or a solvate thereof, used in the manufacture of a medicament for immunomodulation.
  • the compound represented by Formula 1, a pharmaceutically acceptable salt, or a solvate thereof used for the preparation of a medicament for immunomodulation according to the present invention may have the characteristics as described above.
  • Phenyl selenyl chloride (0.14 g, 0.75 mmol) was dissolved in tetrahydrofuran (3.75 mL), put slowly at -78 °C, and stirred for 4.5 hours. After the reaction was completed, water was added to decompose the remaining LDA, stirred at 0° C. for 15 minutes, extracted twice with methane dichloride, and the organic layer was washed once with saturated sodium chloride solution, dried over anhydrous sodium sulfate, evaporated under reduced pressure, and then chromatographed on silica gel.
  • Aqueous potassium carbonate solution (1.06 g/2.50 mL distilled water, 7.64 mmol), ethylene glycol (2.50 mL), acrylic acid (0.48 mL, 6.76 mmol), ethanol (0.25 mL), sodium formate (14.0 mg, 0.20 mmol), and PdCl2(DMAP)4 (13.0 mg, 0.02 mmol) was added to a stirred mixture of methyl-5-iodo-2-methoxybenzoate (compound 5a) (1.50 g, 5.14 mmol). The mixture was carefully stirred for 5 minutes and then refluxed until a black palladium precipitate formed.
  • Piperidin-2-one (compound 9e) (2.00 g, 20.18 mmol) (2.00 g, 20.18 mmol) was placed in a 100 mL round-bottom flask under an argon atmosphere, dichloromethane (40.00 mL) was added, and the temperature was lowered to 0° C. and phosphorus pentachloride (8.40). g, 40.36 mmol) was added slowly over 5 min and stirred for 5 min. After adding zinc iodide (0.20 g, 0.61 mmol) at the same temperature, the temperature was raised to room temperature and stirred for 1 hour.
  • Acetate chloride (11.4 ⁇ L, 0.16 mmol) was slowly added at the same temperature, and the mixture was stirred for 1 hour while maintaining the temperature at 0°C. The reaction was confirmed by TLC, and after the reaction was completed, the reaction was terminated with 2.0 mL of distilled water.
  • Acetate chloride (17.1 ⁇ L, 0.24 mmol) was slowly added at the same temperature, and the mixture was stirred for 1 hour while maintaining the temperature at 0°C. The reaction was confirmed by TLC, and after the reaction was completed, the reaction was terminated with 2.0 mL of distilled water.
  • Acetic anhydride (8.0 mL, 84.6 mmol) was slowly added to a round-bottom flask containing potassium carbonate (3.32 g, 24.0 mmol) at 0° C. under an argon atmosphere, and the temperature was slowly raised to room temperature and stirred for 5 minutes.
  • 3-nitrobenzalaldehyde (Compound 14a) (3.02 g, 20.0 mmol) was added slowly.
  • the reaction mixture was refluxed at 165° C. and stirred for 15 hours. After the reaction was completed, the temperature was lowered to room temperature, ice water was added, the solid was filtered using a filtration device, washed with water several times, and then dried.
  • Phenyl selenyl chloride (0.13 g, 0.66 mmol) was dissolved in tetrahydrofuran (3.50 mL), put slowly at -78°C, and stirred for 4 hours. After the reaction was completed, water was added to decompose the remaining LDA, and the mixture was further stirred at 0° C. for 15 minutes and extracted twice with methane dichloride.
  • acetic anhydride (4.0 mL, 42.2 mmol) was slowly put into a round-bottom flask containing potassium carbonate (1.04 g, 7.54 mmol) at 0 °C, the temperature was slowly raised to room temperature, and stirred for 5 minutes.
  • 3-dihydrobenzo[bi][1,4]dioxin-6-carbaldehyde (Compound 18a) (0.99 g, 6.03 mmol) was added slowly. The reaction mixture was refluxed at 165° C. and stirred for 15 hours.
  • the reaction mixture was stirred at 65° C. for 6 hours. After the reaction was completed, the temperature was lowered to room temperature, the solid was filtered using a filtration device, and washed with ethyl acetate (25.0 mL) and water (20.0 mL). Water (20.0 mL) was added to the filtered liquid, followed by extraction twice with ethyl acetate (50.0 mL) solvent.
  • the NO production inhibitory ability was evaluated using a grease reagent (Sigma-Aldrich) for measuring the amount of nitrite, which is a metabolite of nitric oxide (NO).
  • a grease reagent Sigma-Aldrich
  • LPS lipopolysaccharide
  • the same amount of grease reagent was mixed with the culture solution and reacted for 10 minutes, and absorbance was measured at 540 nm with a spectrophotometer within 30 minutes.
  • sodium nitrate Promega was used by gradually diluting from a concentration of 100 ⁇ M.
  • bovine serum albumin (BSA, Sigma-Aldrich) was used to confirm the effect of an antioxidant that protects proteins or enzymes from damage caused by reactive active species (ROS) through metal ion catalysis.
  • the target protein, BSA is made to a concentration of 8 ⁇ g/mL, and as a primary reaction, Cu 2+ (100 ⁇ M) and H 2 O 2 (2.5 mM) are added to generate hydroxyl radicals, and BSA and Compound 1 ⁇ After mixing each compound of 19 (1 ⁇ g/mL) together, a secondary reaction was performed.
  • each group was electrophoresed on a 10% sodium dodecyl sulfate (SDS)-polyacrylamide gel to check the level of inhibition of BSA proteolysis by each compound, and the results are shown in FIG. 2 below.
  • SDS sodium dodecyl sulfate
  • the mouse macrophage cell line Raw264.7 for use in the experiment was cultured in a CO 2 incubator adjusted to 37° C. and 5% CO 2 using Dulbecco's Modified Eagle Medium (DMEM) or RPMI1640 medium containing 10% fetal bovine serum, respectively. did When the cells were 90% proliferated, they were used for the experiments described later, and the cell line was controlled not to exceed 20 passages.
  • the cells cultured as described above were suspended in 0.25% trypsin-EDTA, and the number of cells was counted using a hemocytometer. For gene expression test, the cells were aliquoted to 1.5 ⁇ 10 6 cells/well in a 6-well plate and incubated in advance for 2 hours.
  • Trizol reagent Invitrogen
  • RNA precipitate was washed with 0.75 mL of 70% ethanol diluted with distilled water treated with diethyl pyrocarbonate (DEPC Sigma-Aldrich), dried in air, and used as a reverse transcription sample. 1st strand cDNA synthesis was performed using 1 ⁇ g of the extracted total RNA, and reverse transcription was performed using Improm-II reverse transcription system (Promega) and oligo dT primers. Also, for qPCR analysis, Rotor-Gene 6000 (Qiagen, CA, USA) was used, and gene expression was quantitatively measured using the primers in Table 1, and the relative values normalized to ⁇ -actin were comparatively analyzed.
  • Rotor-Gene 6000 Qiagen, CA, USA
  • Balb/c mouse splenocytes were isolated and T cell-dependent cytokines, such as Th1 cytokines (IL-2, IFN ⁇ ), Th2 cytokines (IL-4, IL- 10) and Th17 cytokine (IL-17a) gene expression analysis to confirm the ability of piperongumin compounds 1 to 19 to inhibit immune cell activity.
  • T cell-dependent cytokines such as Th1 cytokines (IL-2, IFN ⁇ ), Th2 cytokines (IL-4, IL- 10) and Th17 cytokine (IL-17a) gene expression analysis to confirm the ability of piperongumin compounds 1 to 19 to inhibit immune cell activity.
  • T cell-dependent cytokines such as Th1 cytokines (IL-2, IFN ⁇ ), Th2 cytokines (IL-4, IL- 10) and Th17 cytokine (IL-17a) gene expression analysis to confirm the ability of piperongumin compounds 1 to 19 to inhibit immune cell activity.
  • FIG. 6 to 7 are graphs of inhibition of Th1 cytokine-derived IL-2 and IFN ⁇ gene expression among T cell-dependent cytokines.
  • piperongumin compounds 1-11 and 13-16 of the present invention exhibited IL-2 gene expression inhibitory activity, and in particular, in the case of compounds 1, 3 and 9, cyclosporine (CsA, IL-2 gene expression inhibitory activity at a level equal to or greater than that of an immunosuppressant) was observed.
  • CsA cyclosporine
  • FIG. 8 to 9 are graphs of inhibition of the expression of IL-4 and IL-10 genes, which are Th2-derived cytokines among T cell-dependent cytokines.
  • IL-4 gene expression inhibitory activity was exhibited, and in particular, in the case of compounds 1, 3, 9 and 11, the comparative material cyclosporine (CsA, immunosuppressant) and IL-4 gene expression inhibitory activity equivalent to or higher was demonstrated.
  • FIG. 10 is a graph showing the inhibition of expression of the Th17-derived cytokine IL-17a gene among T cell-dependent cytokines.
  • piperongumin compounds 1-10 and 12-19 of the present invention exhibited IL-17a gene expression inhibitory activity, and in particular, compounds 1, 3-5, 9 and 14-15 were superior to those of compounds 1, 3-5, 9 and 14-15. activity was observed.
  • piperongumin compound 1 of the present invention not only exhibited superior IL-17a expression inhibitory activity compared to cyclosporine (CSA, immunosuppressant) as a comparison group, but also compared to compounds 3 and 9, unlike IL-2 and IL-4, respectively. It exhibited high gene expression inhibition activity of at least 6-fold and 3-fold or more.
  • CSA cyclosporine
  • the piperongumin compounds of the present invention are judged to be novel compounds that effectively inhibit IL-2, IL-4 and IFN ⁇ .
  • all of the piperongumin compounds of the present invention, except for compound 7, have IL-10-regulating activity overexpressed by Th2 (helper T-2 cells), and also contain IL-17a that helps the axis of the cytokine IL-23. Through effective suppression, the potential as an immunomodulatory agent was sufficiently confirmed.
  • THP1-Lucia NF- ⁇ B, HEK-Lucia RIG-1, HEK-Blue-IL-4/IL-13 and HEK-Blue IL-10 cell lines were purchased from InVivoGen, and suppression of immune cell signaling Activity was evaluated, and the assay was performed according to the manufacturer's assay method. Specifically, the four cell lines were treated with each test substance, piperongumin compounds 1 to 19, and then treated with promoter stimulants (LPS, 3p-hpRNA, interleukin-4 and interleukin-10), respectively, and instructions After induction of the reaction according to the activity inhibitory ability was analyzed. The results are shown in FIGS. 11 to 14, respectively.
  • FIG. 11 is a graph analyzing whether or not each compound modulates the NF- ⁇ B signaling pathway after treating the cells stimulated with lipopolysaccharide (LPS) for NF- ⁇ B activity with a piperongumin-based compound.
  • LPS lipopolysaccharide
  • FIG. 12 is a graph analyzing whether piperongumin-based compounds inhibit RIG1 activity through the HEK RIG1 system.
  • the piperongumin compounds 1-5, 8-15, and 19 of the present invention exhibited an inhibitory effect on RIG1 activity, and in particular, compounds 1, 3, 9 and 10 had very high RIG1 activity. Inhibitory ability was confirmed.
  • FIG. 13 is a graph analyzing whether the STAT3 signaling pathway of the piperongumin-based compound is modulated through the HEK Blue IL-10 system.
  • STAT3 is an important transcription factor that transmits a signal from the cytoplasm to the nucleus after cytokine stimulation. As shown in FIG. 13 , in the case of piperongumin compounds 1, 3-6, 8-16, and 19 of the present invention, STAT3 activity inhibitory effect was exhibited, and in particular, compounds 1, 3, 9-10, 12-13 , and 16 confirmed very high STAT3 activity inhibition ability.
  • FIG. 14 is a graph analyzing whether the STAT6 signaling pathway of the piperongumin-based compound is modulated through the HEK Blue IL4/IL-13 system.
  • STAT6 is a transcription factor that plays a role in regulating the expression of various cytokines, hormones and growth factors by signals coming from the outside.
  • IL-4/IL-13 and STAT6 are also important regulators of Th2.
  • piperongumin compounds 1, 3-5, 9-10, 12-13, and 16 of the present invention exhibited an inhibitory effect on STAT6 activity, and in particular, compounds 1, 3, 12- 13, and 16 showed very high STAT6 activity inhibition ability.
  • the novel piperongumin-based compound of the present invention has excellent inhibitory activity on immune cell signaling such as NF- ⁇ B, RIG1, STAT3, STAT6, and thus the piperongumin-based compound It was confirmed that the compound can be usefully applied as an immunomodulatory agent.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nutrition Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Mycology (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Physiology (AREA)
  • Epidemiology (AREA)
  • Transplantation (AREA)
  • Pediatric Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Plural Heterocyclic Compounds (AREA)
  • Pyrrole Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)

Abstract

본 발명은 신규한 피페론구민계 화합물 및 상기 화합물, 이의 약학적으로 허용 가능한 염 또는 용매화물을 유효성분으로 포함하는 면역조절제, 면역조절용 건강기능식품을 제공한다.

Description

피페론구민계 화합물 및 이를 포함하는 면역조절제
본 발명은 신규한 피페론구민계 화합물, 이를 포함하는 면역조절제 및 면역조절용 건강기능식품에 관한 것이다.
면역이란 인체 내 자기(self)와 비자기(non-self)를 구별하여 인체 내에서 자연적으로 발생하거나 외부에서 들어온 유해물질을 인지한 후 제거함으로써, 신체의 항상성을 유지시키는 반응을 의미한다. 면역반응은 외부로부터 인체로 침입한 바이러스, 박테리아 및 기생충과 같은 유해균에 저항하고, 내부에 생긴 암세포에 저항하거나 이들을 제거하는데 중요하다.
그러나, 면역계의 일부 구성요소에 결함이 발생하면 유해물질에 의해서도 면역반응이 일어나지 않는데, 이러한 면역 결핍은 선천성 면역결핍 및 후천성 면역결핍으로 나뉜다. 선천성 면역결핍은 B 세포 및 T 세포 등 면역세포가 원래부터 존재하지 않는 질병으로 유전자 치료, 항체주입 또는 골수이식 등의 치료방법만으로 치료가 가능하다. 한편, 후천성 면역결핍은 면역 구성요소 자체는 존재하나 이들에 의해 나타나는 면역반응 과정에 이상이 생긴 것으로, 이들 구성요소의 기능을 증진시킴으로써 질환의 상태를 개선할 수 있다.
한편, 면역기능이 비정상적으로 증진되는 경우에는 면역억제제를 사용하여 치료하고 있다. 그러나, 면역억제제는 신체의 면역력을 떨어뜨려 다른 부작용을 야기하는 경우가 많다는 문제가 있다.
최근 이와 같이 면역기능의 이상으로 발생하는 면역질환이 증가하고 있으며, 따라서 면역기능을 증진 또는 억제할 수 있는 면역조절 물질의 개발이 활발히 이루어지고 있다. 이러한 면역조절 물질은 면역세포들을 자극하여 체내의 면역기능을 증진 또는 억제시키는데, 이와 관련하여, 대한민국 특허공개 제10-2006-0047447호에는 특정 화학식으로 표시되는 모노아세틸 디아실글리세롤 화합물이 각종 면역체계의 기능 저하에 의해 발생하는 질환이나, 암, 관절염, 아토피, 치매 등과 같은 다양한 질병의 치료에 사용될 수 있음을 개시하고 있다.
한편 본 발명자들은 소정의 화학 구조를 갖는 신규 피페론구민계 화합물을 합성하였으며, 이러한 신규 화합물이 면역세포를 대상으로 하여 우수한 항산화 활성, 사이토카인 생성 억제능 및/또는 세포질내 신호전달 억제능을 갖는다는 것을 발견함으로써 본 발명을 완성하였다.
이에, 본 발명은 신규 피페론구민계 화합물 및 그 유도체, 이의 약학적으로 허용가능한 염, 또는 용매화물을 제공하는 것을 기술적 과제로 한다.
또한 본 발명은 전술한 신규 피페론구민계 화합물을 유효성분으로 포함하는 면역조절제, 및 면역조절용 건강기능식품을 제공하는 것을 다른 기술적 과제로 한다.
본 발명의 다른 목적 및 이점은 하기 발명의 상세한 설명 및 청구범위에 의해 보다 명확하게 설명될 수 있다.
상기한 기술적 과제를 달성하기 위해, 본 발명은 하기 화학식 1로 표시되는 화합물, 이의 약학적으로 허용 가능한 염, 또는 용매화물을 제공한다.
Figure PCTKR2021016597-appb-img-000001
상기 화학식 1에서,
R2 내지 R4는 서로 동일하거나 또는 상이하며, 각각 독립적으로 수소, 중수소, 할로겐, 니트로기, 히드록시기, 아미노기, C1~C40의 알킬기, C2~C40의 알케닐기, C2~C40의 알키닐기, C3~C40의 시클로알킬기, 핵원자수 3 내지 40개의 헤테로시클로알킬기, C1~C20의 알콕시기, C1~C20의 케톤기, C1~C20의 에스터기, C6~C20의 아릴기, 핵원자수 5 내지 20의 헤테로아릴기, 및 C6~C20의 아릴옥시기로 이루어진 군에서 선택되거나, 또는 이들이 인접한 기와 결합하여 C6-C20의 아릴 또는 핵원자수 5 내지 20의 헤테로아릴 고리를 형성할 수 있으며, 다만 R2 내지 R4가 동일한 경우는 제외되며,
R1은 하기 구조식에서 선택되는 치환기이며,
Figure PCTKR2021016597-appb-img-000002
상기 식에서,
X는 F, Cl, Br 및 I로 이루어진 군에서 선택되는 할로겐 원소이며,
Y는 C1~C10의 알킬기이며,
상기 R2~R4의 알킬기, 케톤기, 에스터기, 아릴기, 헤테로아릴기는 각각 독립적으로 중수소, 할로겐, 시아노기, 니트로기, C1~C40의 알킬기, C2~C40의 알케닐기, C2~C40의 알키닐기, C6~C40의 아릴기, 핵원자수 5 내지 40의 헤테로아릴기, C6~C40의 아릴옥시기, C1~C40의 알킬옥시기, C6~C40의 아릴아민기, C3~C40의 시클로알킬기, 핵원자수 3 내지 40의 헤테로시클로알킬기, C1~C40의 알킬실릴기, C1~C40의 알킬보론기, C6~C40의 아릴보론기, C6~C40의 아릴포스핀기, C6~C40의 아릴포스핀옥사이드기 및 C6~C40의 아릴실릴기로 이루어진 군에서 선택된 1종 이상의 치환기로 치환될 수 있으며, 이때 상기 치환기가 복수인 경우, 이들은 서로 동일하거나 상이할 수 있다.
또한 본 발명은 전술한 화학식 1로 표시되는 화합물, 이의 약학적으로 허용 가능한 염, 또는 용매화물을 유효성분으로 포함하는 면역조절제를 제공한다.
아울러 본 발명은 전술한 화학식 1로 표시되는 화합물, 이의 약학적으로 허용 가능한 염, 또는 용매화물을 유효성분으로 포함하는 면역조절용 건강기능식품을 제공한다.
또한 본 발명은 전술한 화학식 1로 표시되는 화합물, 이의 약학적으로 허용 가능한 염, 또는 용매화물을 개체에 투여하는 단계를 포함하는 면역조절 방법을 제공한다.
나아가, 본 발명은 면역조절을 위한 약제의 제조에 사용하기 위한 전술한 화학식 1로 표시되는 화합물, 이의 약학적으로 허용 가능한 염, 또는 용매화물의 용도를 제공한다.
본 발명의 일 실시예에 따르면, 상기 화학식 1로 표시되는 화합물은 종래 알려지지 않은 신규한 피페론구민계 유도체로서, 면역세포에 대해 우수한 항산화 활성, 사이토카인 생성억제 및/또는 세포질내 신호전달 억제능을 동시에 나타내므로, 면역조절제로서 유용하게 사용될 수 있다.
본 발명에 따른 효과는 이상에서 예시된 내용에 의해 제한되지 않으며, 보다 다양한 효과들이 본 명세서 내에 포함되어 있다.
도 1은 본 발명에 따른 피페론구민계 화합물을 이용한 일산화질소 생성 억제능 결과 그래프이다.
도 2는 본 발명에 따른 피페론구민계 화합물을 이용한 하이드록시 라디칼 억제 결과 그래프이다.
도 3 내지 도 5는 각각 본 발명에 따른 피페론구민계 화합물을 이용한 염증성 사이토카인 유전자 발현 억제 결과를 나타내는 그래프이다.
도 6 내지 도 10은 각각 본 발명에 따른 피페론구민계 화합물을 이용한 T세포 의존성 사이토카인 유전자 발현 억제 결과를 나타내는 그래프이다.
도 11 내지 도 14는 각각 본 발명에 따른 피페론구민계 화합물을 이용한 리포터 유전자 발현 억제 결과를 나타내는 그래프이다.
이하, 본 발명을 상세히 설명하기로 한다.
본 명세서에서 사용되는 모든 용어(기술 및 과학적 용어를 포함)는 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 공통적으로 이해될 수 있는 의미로 사용될 수 있을 것이다. 또 일반적으로 사용되는 사전에 정의되어 있는 용어들은 명백하게 특별히 정의되어 있지 않은 한 이상적으로 또는 과도하게 해석되지 않는다.
본 명세서 전체에서, 어떤 부분이 어떤 구성요소를 "포함" 한다고 할 때, 이는 특별히 반대되는 기재가 없는 한, 다른 구성요소를 제외하는 것이 아니라 다른 구성요소를 더 포함할 수 있는 것을 의미한다. 그리고, 본원 명세서에서 "예방" 등의 용어는 질환의 원인으로부터 발생을 억제하거나 지연시키는 것을 의미하며, "치료" 등의 용어는 완전히 치유하지 않아도 증상의 진전 및/또는 악화를 억제하여 손상의 진행을 멈추거나, 또는 증상의 일부 혹은 전부를 개선하여 치유의 방향으로 유도하는 것을 의미한다.
<피페론구민계 화합물>
본 발명의 일 예는 하기 화학식 1로 표시되는 화합물, 구체적으로 신규 피페론구민계 화합물 및 그 유도체, 이의 약학적으로 허용 가능한 염, 또는 용매화물에 관한 것이다.
[화학식 1]
Figure PCTKR2021016597-appb-img-000003
상기 화학식 1에서,
R2 내지 R4는 서로 동일하거나 또는 상이하며, 각각 독립적으로 수소, 중수소, 할로겐, 니트로기, 히드록시기, 아미노기, C1~C40의 알킬기, C2~C40의 알케닐기, C2~C40의 알키닐기, C3~C40의 시클로알킬기, 핵원자수 3 내지 40개의 헤테로시클로알킬기, C1~C20의 알콕시기, C1~C20의 케톤기, C1~C20의 에스터기, C6~C20의 아릴기, 핵원자수 5 내지 20의 헤테로아릴기, C6~C20의 아릴옥시기로 이루어진 군에서 선택되거나, 또는 이들이 인접한 기와 결합하여 C6-C20의 아릴 또는 핵원자수 5 내지 20의 헤테로아릴 고리를 형성할 수 있으며, 다만, R2 내지 R4가 동일한 경우는 제외되며,
R1은 하기 구조식에서 선택되는 치환기이며,
Figure PCTKR2021016597-appb-img-000004
상기 식에서,
물결부는 상기 화학식 1과 결합이 이루어지는 부분을 의미하며,
X는 F, Cl, Br 및 I로 이루어진 군에서 선택되는 할로겐 원소이며,
Y는 C1~C10의 알킬기이며,
상기 R2~R4의 알킬기, 케톤기, 에스터기, 아릴기, 헤테로아릴기는 각각 독립적으로 중수소, 할로겐, 시아노기, 니트로기, C1~C40의 알킬기, C2~C40의 알케닐기, C2~C40의 알키닐기, C6~C40의 아릴기, 핵원자수 5 내지 40의 헤테로아릴기, C6~C40의 아릴옥시기, C1~C40의 알킬옥시기, C6~C40의 아릴아민기, C3~C40의 시클로알킬기, 핵원자수 3 내지 40의 헤테로시클로알킬기, C1~C40의 알킬실릴기, C1~C40의 알킬보론기, C6~C40의 아릴보론기, C6~C40의 아릴포스핀기, C6~C40의 아릴포스핀옥사이드기 및 C6~C40의 아릴실릴기로 이루어진 군에서 선택된 1종 이상의 치환기로 치환될 수 있으며, 이때 상기 치환기가 복수인 경우, 이들은 서로 동일하거나 상이할 수 있다.
종래 피페론구민은 두 개의 고리가 α, β-불포화카보닐 사슬에 연결되는 찰콘(chalcone) 형태의 화합물로서, 상기 두 개의 고리 중 하나는 벤젠고리에 3개의 메톡시기(-OMe)가 연결되고, 다른 하나는 2-피페리돈 구조를 갖는다. 이에 비해, 본 발명에 따른 화학식 1의 화합물은 피페론구민의 벤젠 고리 3, 4-위치를 니트로기 혹은 다른 치환체로 변경하고, 다른 고리는 2-피롤리돈 및/또는 다양한 형태의 질소 화합물을 합성하여 이를 α, β-불포화카보닐 사슬에 연결하는 구조를 갖는다.
상기 화학식 1의 일 구체예를 들면, R1은 하기 구조식에서 선택되는 모이어티일 수 있다.
Figure PCTKR2021016597-appb-img-000005
또한 R2 내지 R4는 서로 동일하거나 또는 상이하며, 각각 독립적으로 수소, 니트로기, 히드록시기, C1-C6의 알킬을 포함하는 에스터기, 및 C1-C6의 알콕시기로 이루어진 군에서 선택되거나, 또는 인접한 2개의 치환기가 서로 결합하여 C6-C10의 아릴기, 또는 질소 및 산소 원자를 적어도 하나 이상 포함하는 핵원자수 5 내지 10의 헤테로고리를 형성할 수 있다.
본 발명에서, 상기 R2~R4의 알킬기, 케톤기, 에스터기, 아릴기, 헤테로아릴기는 각각 독립적으로 중수소, 할로겐, 시아노기, 니트로기, C1~C40의 알킬기, C2~C40의 알케닐기, C2~C40의 알키닐기, C6~C40의 아릴기, 핵원자수 5 내지 40의 헤테로아릴기, C6~C40의 아릴옥시기, C1~C40의 알킬옥시기, C6~C40의 아릴아민기, C3~C40의 시클로알킬기, 핵원자수 3 내지 40의 헤테로시클로알킬기, C1~C40의 알킬실릴기, C1~C40의 알킬보론기, C6~C40의 아릴보론기, C6~C40의 아릴포스핀기, C6~C40의 아릴포스핀옥사이드기 및 C6~C40의 아릴실릴기로 이루어진 군에서 선택된 1종 이상의 치환기로 치환될 수 있으며, 이때 상기 치환기가 복수인 경우, 이들은 서로 동일하거나 상이할 수 있다.
바람직한 일 구체예를 들면, 상기 화학식 1의 화합물은 R2 내지 R4의 종류에 따라 하기 화학식 2 내지 화학식 5 중 어느 하나로 보다 구체화될 수 있다. 그러나 이에 한정되는 것은 아니다.
[화학식 2]
Figure PCTKR2021016597-appb-img-000006
[화학식 3]
Figure PCTKR2021016597-appb-img-000007
[화학식 4]
Figure PCTKR2021016597-appb-img-000008
[화학식 5]
Figure PCTKR2021016597-appb-img-000009
상기 화학식 2 내지 5에서,
R1은 상기 화학식 1에서 정의된 바와 같다.
R5 내지 R7는 서로 동일하거나 또는 상이하며, 각각 독립적으로 수소, 히드록시기, C1~C6의 알킬기, C1~C6의 알콕시기, C1~C6의 케톤기, 및 C1~C6의 에스터기로 이루어진 군에서 선택된다.
환 A는 탄소수 20 이하의 단환 또는 다환의 탄화수소 고리기일 수 있으며, 구체적으로 사이클로알킬환, 헤테로사이클로알킬환, 아릴환 및 헤테로아릴환으로 이루어진 군에서 선택될 수 있다. 이러한 환 A를 구성하는 적어도 하나의 탄소는 중수소, 할로겐, 시아노기, 니트로기, C1~C40의 알킬기, C6~C40의 아릴기, 및 핵원자수 5 내지 40의 헤테로아릴기로 이루어진 군에서 선택된 1종 이상의 치환기로 치환될 수 있다.
이상에서 설명한 본 발명의 화학식 1로 표시되는 화합물은 하기 예시되는 화합물로 보다 구체화될 수 있다. 그러나 본 발명의 화학식 1로 표시되는 화합물이 하기 예시된 것들에 의해 한정되는 것은 아니다.
Figure PCTKR2021016597-appb-img-000010
Figure PCTKR2021016597-appb-img-000011
본 발명에서 "알킬"은 탄소수 1 내지 40의 직쇄 또는 측쇄의 포화 탄화수소에서 유래되는 1가의 치환기를 의미한다. 이의 예로는 메틸, 에틸, 프로필, 이소부틸, sec-부틸, 펜틸, iso-아밀, 헥실 등을 들 수 있으나, 이에 한정되지는 않는다.
본 발명에서 "알케닐(alkenyl)"은 탄소-탄소 이중 결합을 1개 이상 가진 탄소수 2 내지 40의 직쇄 또는 측쇄의 불포화 탄화수소에서 유래되는 1가의 치환기를 의미한다. 이의 구체예로는 비닐(vinyl), 알릴(allyl), 이소프로펜일(isopropenyl), 2-부텐일(2-butenyl) 등을 들 수 있으나, 이에 한정되지는 않는다.
본 발명에서 "알키닐(alkynyl)"은 탄소-탄소 삼중 결합을 1개 이상 가진 탄소수 2 내지 40의 직쇄 또는 측쇄의 불포화 탄화수소에서 유래되는 1가의 치환기를 의미한다. 이의 구체예로는 에티닐(ethynyl), 2-프로파닐(2-propynyl) 등을 들 수 있으나, 이에 한정되지는 않는다.
본 발명에서 "아릴"은 단독 고리 또는 2이상의 고리가 조합된 탄소수 6 내지 40의 방향족 탄화수소로부터 유래된 1가의 치환기를 의미한다. 또한, 2 이상의 고리가 서로 단순 부착(pendant)되거나 축합된 형태도 포함될 수 있다. 이러한 아릴의 구체예로는 페닐, 나프틸, 페난트릴, 안트릴 등을 들 수 있으나, 이에 한정되지는 않는다.
본 발명에서 "헤테로아릴"은 핵원자수 5 내지 40의 모노헤테로사이클릭 또는 폴리헤테로사이클릭 방향족 탄화수소로부터 유래된 1가의 치환기를 의미한다. 이때, 고리 중 하나 이상의 탄소, 바람직하게는 1 내지 3개의 탄소가 N, O, S 또는 Se와 같은 헤테로원자로 치환된다. 또한, 2 이상의 고리가 서로 단순 부착(pendant)되거나 축합된 형태도 포함될 수 있고, 나아가 아릴기와의 축합된 형태도 포함될 수 있다. 이러한 헤테로아릴의 예로는 피리딜, 피라지닐, 피리미디닐, 피리다지닐, 트리아지닐과 같은 6-원 모노사이클릭 고리, 페녹사티에닐(phenoxathienyl), 인돌리지닐(indolizinyl), 인돌릴(indolyl), 퓨리닐(purinyl), 퀴놀릴(quinolyl), 벤조티아졸(benzothiazole), 카바졸릴(carbazolyl)과 같은 폴리사이클릭 고리 및 2-퓨라닐, N-이미다졸릴, 2-이속사졸릴, 2-피리디닐, 2-피리미디닐 등을 들 수 있으나, 이에 한정되지는 않는다.
본 발명에서 "알킬옥시"는 R'O-로 표시되는 1가의 치환기로, 상기 R'는 탄소수 1 내지 40의 알킬을 의미하며, 직쇄(linear), 측쇄(branched) 또는 사이클릭(cyclic) 구조를 포함할 수 있다. 알킬옥시의 예로는 메톡시, 에톡시, n-프로폭시, 1-프로폭시, t-부톡시, n-부톡시, 펜톡시 등을 들 수 있으나, 이에 한정되지는 않는다.
본 발명에서 "시클로알킬"은 탄소수 3 내지 40의 모노사이클릭 또는 폴리사이클릭 비-방향족 탄화수소로부터 유래된 1가의 치환기를 의미한다. 이러한 사이클로알킬의 예로는 사이클로프로필, 사이클로펜틸, 사이클로헥실, 노르보닐(norbornyl), 아다만틴(adamantine) 등을 들 수 있으나, 이에 한정되지는 않는다.
본 발명에서 "헤테로시클로알킬"은 핵원자수 3 내지 40의 비-방향족 탄화수소로부터 유래된 1가의 치환기를 의미하며, 고리 중 하나 이상의 탄소, 바람직하게는 1 내지 3개의 탄소가 N, O, S 또는 Se와 같은 헤테로 원자로 치환된다. 이러한 헤테로시클로알킬의 예로는 모르폴린, 피페라진 등을 들 수 있으나, 이에 한정되지는 않는다.
본 발명에서 "축합고리"는 축합 지방족 고리, 축합 방향족 고리, 축합 헤테로지방족 고리, 축합 헤테로방향족 고리 또는 이들의 조합된 형태를 의미한다.
또한 본 발명은 화학식 1로 표시되는 화합물의 염, 바람직하게는 약학적으로 허용되는 염을 제공한다.
여기서, "약학적으로 허용되는 염"은 순수한 의학적 판단의 범위 내에서 과다한 독성, 자극, 알레르기 반응 등의 유발 없이 사람 및 하등 동물의 조직과 접촉하여 사용하기에 적합한 염을 의미한다. 상기 약학적으로 허용되는 염은 당 분야에 잘 알려져 있으며, 일례로 문헌(S.M. Berge et al., J. Parmaceutical Sciences, 66, 1, 1977)에 상세히 기술되어 있다. 염은 본 발명의 화합물을 최종적으로 분리 및 정제하는 동안에 동일 반응계에서 제조하거나 별도로 무기 염기 또는 유기 염기와 반응시켜 제조할 수 있다. 염기 부가염 형태의 바람직한 일례를 들면, 암모늄염, 리튬, 소듐, 포타슘, 마그네슘, 칼슘 등의 염과 같은 알칼리염 및 알칼리토금속염, 유기염기와의 염, 예를 들면 1차, 2차 및 3차 지방족 및 방향족 아민, 예를 들면 메틸아민, 에틸아민, 프로필아민, 이소프로필아민, 4가지 부틸아민 이성체, 디메틸아민, 디에틸아민, 디에탄올아민, 디프로필아민, 디이소프로필아민, 디-n-부틸아민, 피롤리딘, 피페리딘, 모폴린, 트리메틸아민, 트리에틸아민, 트리프로필아민, 퀴누클리딘, 피리딘, 퀴놀린 및 이소퀴놀린, 벤자틴, N-메틸-D-글루카민, 2-아미노-2-(하이드록시메틸)-1,3-프로판디올, 하이드라바민 염, 및 아르기닌, 라이신 등의 아미노산과의 염 등이 있다.
또한, 본 발명은 상기 화학식 1로 표시되는 화합물의 수화물 또는 용매화물, 이들의 유도체 화합물을 포함할 수 있다. 상기 용매화물 중에서 용매는 특별히 제한되지 않으며, 당 분야에 공지된 통상의 용매를 모두 포함할 수 있다.
<면역조절제>
본 발명의 다른 일 예는 하기 화학식 1로 표시되는 화합물, 이의 약학적으로 허용 가능한 염, 또는 용매화물을 유효성분으로 포함하는 면역조절제에 관한 것이다. 구체적으로, 상기 면역조절제는 면역반응을 억제하는 면역억제제일 수 있다.
본 명세서에서, "유효성분"이란 단독으로 목적하는 활성을 나타내거나 또는 그 자체는 활성이 없는 담체와 함께 활성을 나타낼 수 있는 성분을 의미하며, 구체적인 함량 수치에 대해서는 특별히 한정되지 않는다.
본 발명에 따른 면역조절제는 조성물 전체 중량에 대하여 유효성분인 화학식 1의 화합물을 0.01 내지 99 중량%로 포함할 수 있으며, 구체적으로 0.1 내지 95 중량%일 수 있다. 또한, 본 발명의 면역조절제는 상기 유효성분 이외에 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1종 이상 추가로 포함할 수 있다.
본 발명의 면역조절제는 약제학적으로 적합하고 생리학적으로 허용되는 제제에 통상적으로 사용되는 담체, 희석제, 부형제 또는 이의 혼합물을 포함할 수 있다. 약학적으로 허용가능한 담체는 조성물을 생체 내에 전달하는데 적합한 것이면 모두 사용할 수 있다. 구체적으로, 담체는 Merck Index, 13th ed., Merck & Co. Inc.에 기재된 화합물, 식염수, 멸균수, 링거액, 덱스트로스 용액, 말토덱스트린 용액, 글리세롤, 에탄올 또는 이의 혼합물일 수 있다. 또한, 필요에 따라 항산화제, 완충액, 정균제 등과 같은 통상의 첨가제를 첨가할 수 있다.
상기 조성물을 제제화하는 경우, 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 첨가할 수 있다.
본 발명의 면역조절제는 경구용 제제 또는 비경구용 제제로 제형화될 수 있다. 경구용 제제로는 고형 제제 및 액상 제제가 포함될 수 있다. 상기 고형 제제는 정제, 환제, 산제, 과립제, 캡슐제 또는 트로키제일 수 있고, 이러한 고형 제제는 상기 조성물에 적어도 하나 이상의 부형제를 첨가하여 조제할 수 있다. 상기 부형제는 전분, 탄산칼슘, 수크로스, 락토오스, 젤라틴 또는 이의 혼합물일 수 있다. 또한, 상기 고형 제제는 윤활제를 포함할 수 있고, 그 예로는 마그네슘 스테아레이트, 탈크 등이 있다. 한편, 상기 액상 제제는 현탁제, 내용액제, 유제 또는 시럽제일 수 있다. 이때, 상기 액상 제제에는 습윤제, 감미제, 방향제, 보존제 등과 같은 부형제가 포함될 수 있다.
상기 비경구용 제제는 주사제, 좌제, 호흡기 흡입용 분말, 스프레이용 에어로졸제, 파우더 및 크림 등을 포함할 수 있다. 상기 주사제는 멸균된 수용액, 비수성용제, 현탁용제, 유제 등을 포함할 수 있다. 이때, 비수성용제 또는 현탁용제로서는 프로필렌글리콜, 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름이나, 에틸올레이트와 같이 주사가능한 에스테르 등이 사용될 수 있다.
본 발명의 면역조절제는 목적하는 방법에 따라 경구 또는 비경구로 투여될 수 있다. 비경구 투여는 복강내, 직장내, 피하, 정맥, 근육내 또는 흉부내 주사 방식을 포함할 수 있다.
상기 면역조절제는 약학적으로 유효한 양으로 투여될 수 있다. 이는 질환의 종류, 중증도, 약물의 활성, 약물에 대한 환자의 민감도, 투여 시간, 투여 경로, 치료기간, 동시에 사용되는 약물 등에 따라 달라질 수 있다. 그러나, 바람직한 효과를 위해서, 본 발명에 따른 약학적 조성물에 포함되는 유효성분의 양은 0.0001 내지 1,000 ㎎/㎏, 구체적으로 0.001 내지 500 ㎎/㎏일 수 있다. 상기 투여는 하루에 1회 또는 수회일 수 있다.
본 발명의 면역조절제는 단독 또는 다른 치료제와 병용하여 투여될 수 있다. 병용 투여시, 투여는 순차적 또는 동시일 수 있다.
<면역조절용 건강기능식품>
본 발명의 다른 일 예는, 하기 화학식 1로 표시되는 화합물, 이의 약학적으로 허용 가능한 염, 또는 용매화물을 유효성분으로 포함하는, 면역조절용 건강 기능 식품에 관한 것이다.
여기서, '건강기능식품'이란, 건강 보조의 목적으로 인체에 유용한 기능성을 가진 특정 성분을 원료로 하거나 식품 원료에 들어있는 특정 성분을 추출, 농축, 정제, 혼합 등의 방법으로 제조 및 가공된 식품을 의미하는 것으로서, 질병의 예방 및 질병의 회복 등과 관련된 기능을 가질 수 있다.
본 발명에 따른 건강기능식품은, 상기 화합물을 그대로 첨가하거나 혹은 다른 식품 또는 식품 조성물과 함께 사용될 수 있다. 이때 유효 성분의 사용량은 그의 사용 목적에 따라 적합하게 결정될 수 있으며, 특별히 제한되지 않는다. 일반적으로, 본 발명에 따른 화학식 1의 화합물, 이의 이성질체, 약학적으로 허용가능한 염 또는 용매화물은, 식품 또는 음료의 제조시 당해 식품 또는 음료의 원료 전체 중량에 대하여 0.001 내지 99 중량%로 첨가될 수 있으며, 구체적으로 0.1 내지 95 중량%일 수 있다.
본 발명의 건강기능식품은, 전술한 화학식 1의 화합물, 이의 이성질체, 약학적으로 허용가능한 염 또는 용매화물 이외에, 당 분야에서 식품 조성물에 통상적으로 이용되는 성분들을 포함할 수 있다. 예를 들면, 유기산, 인산염, 항산화제, 유당 카제인, 덱스트린, 포도당, 설탕 및 솔비톨로 이루어진 군으로부터 선택되는 하나 이상의 첨가제를 더 포함할 수 있다. 또한 여러 가지 영양제, 비타민, 광물 (전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제, 팩트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 추가로 함유할 수 있다.
본 발명의 건강기능식품은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 일례로 정제, 과립제, 환제, 캡슐제, 액상 제제, 시럽 또는 음료의 형태로도 제공되는 것도 본 발명의 범주에 속한다.
본 발명에 따른 건강기능식품에서, 상기 화학식 1의 화합물, 이의 이성질체, 약학적으로 허용가능한 염 또는 용매화물이 첨가될 수 있는 식품의 종류에는 특별히 제한되지 않는다. 일례를 들면, 각종 식품류, 분말, 과립, 정제, 캡슐, 시럽제, 음료, 껌, 차, 비타민 복합제, 건강 기능성 식품류 등이 있다. 보다 구체적인 일례를 들면, 육류, 소세지, 빵, 쵸코렛, 캔디류, 스낵류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알콜 음료 및 비타민 복합제, 기타 영양제 등을 들 수 있으나, 이들 종류의 식품으로 제한되는 것은 아니다.
또한 본 발명은 전술한 화학식 1로 표시되는 화합물, 이의 약학적으로 허용 가능한 염, 또는 용매화물을 개체에 투여하는 단계를 포함하는 면역조절 방법을 제공한다.
상기 개체는 포유동물일 수 있고, 구체적으로 인간일 수 있다.
상기 투여는 목적하는 방법에 따라 경구 또는 비경구 투여일 수 있다. 비경구 투여는 복강내, 직장내, 피하, 정맥, 근육내 또는 흉부내 주사 방식을 포함할 수 있다. 또한, 상기 투여는 약학적으로 유효한 양으로 투여될 수 있다. 이는 질환의 종류, 중증도, 약물의 활성, 약물에 대한 환자의 민감도, 투여 시간, 투여 경로, 치료기간, 동시에 사용되는 약물 등에 따라 달라질 수 있다. 그러나, 바람직한 효과를 위해서, 본 발명에 따른 약학적 조성물에 포함되는 유효성분의 양은 0.0001 내지 1,000 ㎎/㎏, 구체적으로 0.001 내지 500 ㎎/㎏일 수 있다. 상기 투여는 하루에 1회 또는 수회일 수 있다.
또한, 상기 투여는 단독 또는 다른 치료제와 병용하여 수행될 수 있다. 병용 투여시, 투여는 순차적 또는 동시일 수 있다.
아울러, 본 발명은 면역조절을 위한 약제의 제조에 사용되는, 화학식 1로 표시되는 화합물, 이의 약학적으로 허용 가능한 염, 또는 용매화물의 용도를 제공한다.
본 발명에 따른 면역조절을 위한 약제의 제조에 사용되는 화학식 1로 표시되는 화합물, 이의 약학적으로 허용 가능한 염, 또는 용매화물은 상술한 바와 같은 특징을 가질 수 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당 업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
[제조예 1: 화합물 1의 합성]
Figure PCTKR2021016597-appb-img-000012
1-1: (E)-메틸-2-메톡시-5-(3-옥소-3-(2-옥소-3-(페닐셀라닐)피페리딘-1-일)프로프-1-엔-1-일)벤조에이트((E)-methyl-2-methoxy-5-(3-oxo-3-(2-oxo-3-(phenylselanyl)piperidin-1-yl)prop-1-en-1-yl)benzoate)(화합물 1f)의 제조
아르곤 분위기 하에 25 mL 둥근바닥플라스크에 (E)-메틸-2-메톡시-5-(3-옥소-3-(2-옥소피페리딘-1-일)프로-1-엔-1-일)벤조에이트 (화합물 1e) (0.22 g, 0.68 mmol)를 넣고 테트라하이드로퓨란 (3.70 mL)을 채운 후 -78℃로 온도를 내리고 LDA (0.45 mL, 0.88 mmol, 2.0 M 용액)를 적가하고 45분 동안 교반하였다. 페닐셀레닐클로라이드 (0.14 g, 0.75 mmol)를 테트라하이드로퓨란 (3.75 mL)에 녹여 -78℃에서 천천히 넣어주고 4.5시간 동안 교반하였다. 반응이 끝나면 물을 첨가하여 남아있는 LDA를 분해한 후 0℃에서 15분동안 추가적으로 교반하고 이염화메탄으로 2번 추출하고 유기층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산나트륨으로 건조하여 감압 증발 후 실리카겔 크로마토그래피 (아세트산에틸/헥세인 = 1/4 to 1/3)로 분리하여 흰색 고체인 (E)-메틸-2-메톡시-5-(3-옥소-3-(2-옥소-3-(페닐셀라닐)피페리딘-1-일)프로프-1-엔-1-일)벤조에이트 (화합물 1f) (100 mg, 31.2 %)를 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 7.95 (d, J = 2.3 Hz, 1H), 7.72 - 7.68 (m, 2H), 7.67 - 7.60 (m, 2H), 7.38 - 7.31 (m, 3H), 7.05 (d, J = 15.6 Hz, 1H), 6.98 (d, J = 8.8 Hz, 1H), 4.11 (t, J = 5.3 Hz, 1H), 3.95 (s, 3H), 3.92 (s, 3H), 3.71 (ddd, J = 13.7, 9.2, 4.6 Hz, 1H), 2.32 (tq, J = 10.5, 5.4 Hz, 1H), 2.19 - 2.05 (m, 2H), 1.26 (d, J = 2.7 Hz, 2H).
1-2: (E)-메틸-2-메톡시-5-(3-옥소-3-(2-옥소-5,6-디하이드로피리딘-1(2에이치)-일)프로프-1-엔-1-일)벤조에이트((E)-methyl-2-methoxy-5-(3-oxo-3-(2-oxo-5,6-dihydropyridin-1(2H)-yl)prop-1-en-1-yl)benzoate)(화합물 1)
아르곤 분위기 하에 25 mL 둥근바닥플라스크에 상기 1-1에서 제조된 (E)-메틸-2-메톡시-5-(3-옥소-3-(2-옥소-3-(페닐셀라닐)피페리딘-1-일)프로프-1-엔-1-일)벤조에이트 (화합물 1f) (0.10 g, 0.21 mmol)를 넣고 테트라하이드로퓨란 (2.00 mL)을 채운 후 0℃로 온도를 내리고 과산화수소 (0.05 mL, 0.59 mmol, 30% 용액)를 방울방울 첨가하고 15분 동안 교반한 후 온도를 실온으로 승온하여 추가적으로 30분 더 교반한다. 반응이 끝나면 포화 탄산수소나트륨 용액을 첨가하고 이염화메탄으로 2번 추출하고 유기층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산나트륨으로 건조하여 감압 증발 후 실리카겔 크로마토그래피 (아세트산에틸/헥세인 = 1/1.5)로 분리하여 흰색 고체인 (E)-메틸-2-메톡시-5-(3-옥소-3-(2-옥소-5,6-디하이드로피리딘-1(2에이치)-일)프로프-1-엔-1-일)벤조에이트 (화합물 1) (40 mg, 60.6 %)를 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 8.01 (d, J = 2.4 Hz, 1H), 7.74 - 7.66 (m, 2H), 7.43 (d, J = 15.7 Hz, 1H), 7.00 - 6.92 (m, 2H), 6.05 (dt, J = 9.6, 1.8 Hz, 1H), 4.04 (t, J = 6.5 Hz, 2H), 3.94 (s, 3H), 3.90 (s, 3H), 2.48 (tdd, J = 6.3, 4.2, 1.9 Hz, 2H).
13C NMR (101 MHz, Chloroform-d) δ 168.92, 166.08, 165.86, 160.38, 145.51, 142.33, 133.42, 131.75, 127.39, 125.87, 120.69, 120.48, 112.24, 56.22, 52.20, 41.65, 24.81.
[제조예 2: (E)-메틸-2-메톡시-5-(3-(4-메틸피페라진-1-일)-3-옥소프로프-1-엔-1-일)벤조에이트((E)-methyl-2-methoxy-5-(3-(4-methylpiperazin-1-yl)-3-oxoprop-1-en-1-yl)benzoate)(화합물 2)의 합성]
Figure PCTKR2021016597-appb-img-000013
아르곤 분위기 하에 25 mL 둥근바닥플라스크에 (E)-3-(4-메톡시-3-(메톡시카보닐)페닐)아크릴산 (화합물 2b) (0.20 g, 0.85 mmol)을 넣고 다이클로로메테인 (12.0 mL)을 채운 후 0℃로 온도를 내리고 트리에틸아민 (0.18 mL, 1.28 mmol)과 피바로일 클로라이드 (0.12 mL, 0.94 mmol)를 천천히 넣고 같은 온도에서 45분 동안 교반하였다. 그 후 메틸피페라진 (2d) (0.15 mL, 1.28 mmol)을 반응 혼합물에 천천히 넣어주고 실온에서 2시간 동안 교반하였다. 반응이 끝나면 포화 탄산수소나트륨 용액을 혼합물에 넣어서 반응을 종결하고 물을 첨가하여 혼합물을 희석하였다. 수용액층을 이염화메탄으로 3번 추출하고 유기층은 포화 염화나트륨 용액으로 2번 씻어주고 무수 황산나트륨으로 건조하여 혼합물의 용매를 감압증류 하여 제거한 후 실리카겔 크로마토그래피 (메탄올/이염화메탄 = 1/25 )로 분리하여 연한 노란색 오일인 (E)-메틸-2-메톡시-5-(3-(4-메틸피페라진-1-일)-3-옥소프로프-1-엔-1-일)벤조에이트 (화합물 2) (250 mg, 61.4%)를 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 8.00 (d, J = 2.3 Hz, 1H), 7.66 - 7.56 (m, 2H), 6.98 (d, J = 8.7 Hz, 1H), 6.80 (d, J = 15.4 Hz, 1H), 3.94 (s, 3H), 3.92 (s, 3H), 3.73 - 3.62 (m, 4H), 2.45 (t, J = 5.1 Hz, 4H), 2.33 (s, 3H).
[제조예 3: 화합물 3의 합성]
Figure PCTKR2021016597-appb-img-000014
3-1: 3,3-디클로로피페리딘-2-온(3,3-dichloropiperidin-2-one)(화합물 3f)의 제조
아르곤 분위기 하에 100 mL 둥근바닥플라스크에 피페리딘-2-온 (화합물 3e) (2.00 g, 20.18 mmol)을 넣고 클로로포름 (20.00 mL)을 채운 후 0℃로 온도를 내리고 오염화인 (12.80 g, 61.33 mmol)을 10분 동안 천천히 첨가하고 60℃에서 환류하며 교반하였다. 반응이 끝나면 온도를 실온으로 낮춰준 뒤 얼음물에 혼합물을 투입하였다. 수용액층을 이염화메탄으로 3번 추출하고 유기층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산마그네슘으로 건조하여 감압 증발 후 추가적인 정제 과정 없이 흰색 고체인 3,3-디클로로피페리딘-2-온 (화합물 3f) (4.00 g)을 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 6.18 (s, 1H), 3.44 (td, J = 6.2, 2.4 Hz, 2H), 2.82 - 2.74 (m, 2H), 2.15 - 2.05 (m, 2H).
3-2: 3-클로로-5,6-디하이드로피리딘-2(1에이치)-온(3-chloro-5,6-dihydropyridin-2(1H)-one) (화합물 3d)의 제조
아르곤 분위기 하에 50 mL 둥근바닥플라스크에 상기 3-1에서 제조된 3,3-디클로로피페리딘-2-온 (화합물 3f) (4.00 g, 24.04 mmol)을 넣고 디메틸포름아마이드 (12.00 mL)를 채운 후 탄산리튬 (3.70 g, 49.30 mmol)을 첨가하고 7시간 동안 120℃에서 가열하며 교반하였다. 반응이 끝나면 온도를 실온으로 낮춰준 뒤 얼음물에 혼합물을 투입하였다. 수용액층을 이염화메탄으로 3번 추출하고 유기층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산마그네슘으로 건조한 후 실리카겔 크로마토그래피 (아세트산에틸/헥세인 = 1/1.5 to 1/1)로 분리하여 갈색 고체인 3-클로로-5,6-디하이드로피리딘-2(1에이치)-온 (화합물 3d) (0.55 g, 17.6 %)을 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 6.78 (t, J = 4.6 Hz, 1H), 6.70 (s, 1H), 3.53 - 3.43 (m, 2H), 2.48 (td, J = 7.1, 4.5 Hz, 2H).
3-3: (E)-메틸-5-(3-(3-클로로-2-옥소-5,6-디하이드로피리딘-1(2에이치)-일)-3-옥소프로프-1-엔-1-일)-2-메톡시벤조에이트((E)-methyl-5-(3-(3-chloro-2-oxo-5,6-dihydropyridin-1(2H)-yl)-3-oxoprop-1-en-1-yl)-2-methoxybenzoate)(화합물 3)의 제조
아르곤 분위기 하에 25 mL 둥근바닥플라스크에 상기 3-2에서 제조된 3-클로로-5,6-디하이드로피리딘-2(1에이치)-온 (화합물 3d) (0.10 g, 0.77 mmol)을 넣고 테트라하이드로퓨란 (1.50 mL)을 채운 후 -78℃로 온도를 내리고 LDA (0.40 mL, 0.77 mmol, 2.0 M 용액)를 적가하여 첨가하고 45분 동안 교반하였다. (E)-메틸 5-(3-클로로-3-옥소프로-1-펜-1-일)-2- 메톡시벤조에이트 (화합물 3c) (0.16 g, 0.64 mmol)를 테트라하이드로퓨란 (1.50 mL)에 녹여 -78℃에서 천천히 넣어주고 1시간 동안 교반하였다. 반응이 끝나면 1N 염산으로 남아있는 LDA를 분해한 후 아세트산에틸로 2번 추출하고 아세트산에틸층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산나트륨으로 건조하여 감압증류를 실시한 후 컬럼크로마토그래피 (아세트산에틸/헥세인 = 1/2 to 1/1)로 분리하여 흰색 고체인 (E)-메틸-5-(3-(3-클로로-2-옥소-5,6-디하이드록시피리딘-1(2에이치)-일)-3-옥소프로프-1-엔-1-일)-2-메톡시벤조에이트 (화합물 3) (98 mg, 43.8 %)를 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 8.02 (d, J = 2.3 Hz, 1H), 7.74 (d, J = 15.3 Hz, 1H), 7.71 - 7.69 (m, 1H), 7.43 (d, J = 15.6 Hz, 1H), 7.09 (t, J = 4.6 Hz, 1H), 6.98 (d, J = 8.7 Hz, 1H), 4.09 (t, J = 6.5 Hz, 2H), 3.95 (s, 3H), 3.91 (s, 3H), 2.57 (td, J = 6.5, 4.6 Hz, 2H).
13C NMR (101 MHz, Chloroform-d) δ 168.52, 166.01, 161.46, 160.58, 143.43, 141.09, 133.53, 131.84, 128.29, 127.13, 120.59, 119.91, 112.27, 56.24, 52.23, 41.76, 25.32.
[제조예 4: 화합물 5의 합성]
Figure PCTKR2021016597-appb-img-000015
4-1: (E)-3-(4-메톡시-3-(메톡시카보닐)페닐)아크릴산((E)-3-(4-methoxy-3-(methoxycarbonyl)phenyl)acrylic acid)(화합물 5b)의 제조
탄산칼륨 수용액 (1.06 g/2.50 mL 증류수, 7.64 mmol), 에틸렌 글라이콜 (2.50 mL), 아크릴산 (0.48 mL, 6.76 mmol), 에탄올(0.25 mL), 소듐포메이트 (14.0 mg, 0.20 mmol), 와 PdCl2(DMAP)4 (13.0 mg, 0.02 mmol)을 교반한 혼합물을 메틸-5-아이오도-2-메톡시벤조에이트 (화합물 5a) (1.50 g, 5.14 mmol)에 가하였다. 혼합물을 5분 동안 주의하여 교반한 후 검은색 팔라듐 침전물이 생길 때까지 환류하였다. 반응 혼합물을 실온으로 식혀준 뒤 1N 염산 용액을 이용하여 pH 1까지 맞춰주었다. 생성된 고체를 필터해준 뒤 물로 3번 세척하고 건조하여 백색 고체상의 화합물 (E)-3-(4-메톡시-3-(메톡시카보닐)페닐)아크릴산 (화합물 5b) (1.02 g, 83.4 %)을 얻었다.
1H NMR (400 MHz, DMSO-d6) δ 12.30 (s, 1H), 7.94 - 7.87 (m, 2H), 7.56 (d, J = 16.0 Hz, 1H), 7.20 (d, J = 8.7 Hz, 1H), 6.45 (d, J = 15.9 Hz, 1H), 3.86 (s, 3H), 3.80 (s, 3H), 2.09 (s, 1H).
13C NMR (101 MHz, DMSO-d6) δ 167.60, 165.81, 159.23, 142.53, 133.05, 130.48, 126.40, 120.66, 117.98, 112.96, 60.19, 56.08, 52.02.
4-2: 1H-피롤-2(5H)-온(1H-pyrrol-2(5H)-one)(화합물 5d)의 제조
아르곤 분위기하에 있는 둥근바닥플라스크에 피롤 (5.0 mL, 72.0 mmol)과 탄산바륨 (1.50 g, 7.60 mmol)을 넣은 후 증류수 (0.30 L)를 채운 후 30% 과산화수소 (9.0 mL)를 적가하였다. 콘덴서를 장착하고 5시간 동안 환류시켜 준 후 실온으로 온도를 내려주고 10% 아질산나트륨 용액을 사용하여 남아있는 과산화수소를 제거하였다. 거품이 그칠 때까지 교반한 후 거름종이에 걸러주어 용매를 감압증류하였다. 검붉은 고체를 1,4-다이옥세인 (50.0 mL)으로 녹인 후 다시 거름종이로 걸러내 주고 1,4-다이옥세인 (50.0 mL)으로 씻어준 후 무수 황산나트륨으로 건조하고 감압 증류하여 검붉은 액체인 1H-피롤-2(5H)-온 (화합물 5d) (1.42 g, 23.9 %)을 얻었다.
1H NMR (400 MHz, CDCl3): δ 9.27 (1H, br s), 7.16-7.19 (1H, dt, J = 6.0, 1.8 Hz), 6.17-6.19(1H, d, J = 6.0 Hz). 4.50 (2H, d, J = 1.8 Hz).
13C NMR (101 MHz, CDCl3): δ 175.5, 146.2, 127.8, 49.2.
4-3: (E)-메틸-2-메톡시-5-(3-옥소-3-(2-옥소-2,5-디하이드로-1에이치-피롤-1-일)프로프-1-엔-1-일)벤조에이트((E)-methyl-2-methoxy-5-(3-oxo-3-(2-oxo-2,5-dihydro-1H-pyrrol-1-yl)prop-1-en-1-yl)benzoate)(화합물 5)의 제조
아르곤 분위기 하에 50 mL 둥근바닥플라스크에 상기 제조예 4-2에서 제조된 1H-피롤-2(5H)-온 (화합물 5d) (0.21 g, 2.55 mmol)을 넣고 테트라하이드로퓨란 (3.30 mL)을 채운 후 -78℃로 온도를 내리고 LDA (1.30 mL, 2.55 mmol, 2.0 M 용액)를 적가하여 첨가하고 45분 동안 교반하였다. (E)-메틸-5-(3-클로로-3-옥소프로-1-펜-1-일)-2-메톡시벤조에이트 (화합물 5c) (0.54 g, 2.12 mmol)를 테트라하이드로퓨란 (2.70 mL)에 녹여 -78℃에서 천천히 넣어주고 1시간 동안 교반하였다. 반응이 끝나면 1N 염산으로 남아있는 LDA를 분해한 후 아세트산에틸로 추출하고 아세트산에틸층은 포화 염화나트륨 용액으로 씻어주고 무수 황산나트륨으로 건조하여 감압증류 후 컬럼크로마토그래피 (아세트산에틸/헥세인 = 1/2 to 1/1)로 분리하여 황색 고체인 (E)-메틸-2-메톡시-5-(3-옥소-3-(2-옥소-2,5-디하이드로-1에이치-피롤-1-일)프로프-1-엔-1-일)벤조에이트 (화합물 5) (75 mg, 30.0 %)를 얻었다.
1H NMR (400 MHz, CDCl3) δ 8.06 (d, J = 2.3 Hz, 1H), 7.96 (d, J = 15.7 Hz, 1H), 7.86 (d, J = 15.7 Hz, 1H), 7.78 (dd, J = 8.7, 2.3 Hz, 1H), 7.35 (dt, J = 6.0, 2.1 Hz, 1H), 7.01 (d, J = 8.8 Hz, 1H), 6.22 (dt, J = 6.0, 1.9 Hz, 1H), 4.54 (t, J = 2.0 Hz, 2H), 3.96 (s, 3H), 3.92 (s, 3H).
13C NMR (101 MHz, Chloroform-d) δ 170.21, 166.02, 165.20, 160.68, 146.84, 144.71, 133.49, 132.25, 127.87, 127.16, 120.56, 117.39, 112.32, 56.25, 52.25, 51.11.
[제조예 5: 화합물 4의 합성]
5-1: (E)-메틸-2-하이드록시-5-(3-옥소-3-(2-옥소-2,5-디하이드로-1H-피롤-1-일)프로프-1-엔-1-일)벤조에이트((E)-methyl-2-hydroxy-5-(3-oxo-3-(2-oxo-2,5-dihydro-1H-pyrrol-1-yl)prop-1-en-1-yl)benzoate)(화합물 4a)의 제조
아르곤 분위기의 둥근바닥플라스크에, 상기 제조예 4에서 제조된 (E)-메틸-2-메톡시-5-(3-옥소-3-(2-옥소-2,5-디하이드로-1-피롤-1-엔-1-일)프로프-1-엔-1-일)벤조에이트 (화합물 5) (70 mg, 0.23 mmol)와 테트라하이드로퓨란 (4.0 mL)을 넣고 0℃로 온도를 내리고 10분 뒤 삼브로모보론 용액 (1.0M 이염화메탄용액, 0.70 mL, 0.69 mmol)을 천천히 첨가하고 4시간 동안 교반하며 반응온도는 서서히 실온이 되도록 하였다. 반응의 여부는 TLC로 확인하고, 반응이 완결되면 반응 온도를 다시 0℃로 하여 1N 염산 용액 0.50 mL를 이용하여 반응을 종결시켰다. 같은 온도에서 10분동안 더 교반한 뒤, 이염화메탄으로 3번 추출하고 유기층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산나트륨으로 건조하여 감압 증발 후 실리카겔 크로마토그래피 (아세트산에틸/헥세인 = 1/2 to 1/1)로 분리하여 갈색 고체인 (E)-메틸-2-하이드록시-5-(3-옥소-3-(2-옥소-2,5-디하이드로-1H-피롤-1-일)프로프-1-엔-1-일)벤조에이트 (화합물 4a) (10 mg, 15.2 %)를 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 11.05 (s, 1H), 8.11 (d, J = 2.3 Hz, 1H), 7.95 (d, J = 15.8 Hz, 1H), 7.85 (d, J = 15.8 Hz, 1H), 7.80 (dd, J = 8.7, 2.3 Hz, 1H), 7.35 (dt, J = 6.0, 2.1 Hz, 1H), 7.03 (d, J = 8.7 Hz, 1H), 6.22 (dt, J = 6.0, 1.9 Hz, 1H), 4.54 (t, J = 1.9 Hz, 2H), 3.99 (s, 3H).
5-2: (E)-메틸-2-아세톡시-5-(3-옥소-3-(2-옥소-2,5-디히드로-1H-피롤-1-일)프로프-1-엔-1-일)벤조에이트((E)-methyl-2-acetoxy-5-(3-oxo-3-(2-oxo-2,5-dihydro-1H-pyrrol-1-yl)prop-1-en-1-yl)benzoate) (화합물 4)의 제조
아르곤 분위기 하에 둥근바닥플라스크에, 상기 제조예 5-1에서 제조된 (E)-메틸-2-하이드록시-5-(3-옥소-3-(2-옥소-2,5-디하이드로-1H-피롤-1-일)프로프-1-엔-1-일)벤조에이트 (화합물 4a) (10 mg, 0.04 mmol)와 이염화메탄 (1.0 mL)를 넣고 0℃로 온도를 내려주었다. 10분 뒤 트리에틸아민 (11.2 μL, 0.08 mmol)을 넣고 5분동안 교반하였다. 같은 온도에서 염화아세테이트 (5.70 μL, 0.08 mmol)를 천천히 첨가하고, 0℃로 온도를 계속 유지하면서 한시간 동안 교반하였다. 반응의 여부는 TLC로 확인하고, 반응이 끝난 뒤 증류수 1.0 mL로 반응을 종결하고 이염화메탄으로 3번 추출하고 유기층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산 나트륨으로 건조하여 감압 증발 후 실리카겔 크로마토그래피 (아세트산에틸/헥세인 = 1/2 to 1/1)로 분리하여 노란색 고체인 (E)-메틸-2-아세톡시-5-(3-옥소-3-(2-옥소-2,5-디하이드로-1H-피롤-1-일)프로프-1-엔-1-일)벤조에이트 (화합물 4) (5.0 mg, 43.5 %)를 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 8.24 (d, J = 2.2 Hz, 1H), 8.05 (d, J = 15.8 Hz, 1H), 7.89 (d, J = 15.8 Hz, 1H), 7.85 (dd, J = 8.4, 2.3 Hz, 1H), 7.37 (dt, J = 6.2, 2.1 Hz, 1H), 7.16 (d, J = 8.4 Hz, 1H), 6.23 (dt, J = 6.1, 1.9 Hz, 1H), 4.55 (t, J = 2.0 Hz, 2H), 3.91 (s, 3H), 2.37 (s, 3H).
[제조예 6: (E)-메틸-5-(3-아세트아미도-3-옥소프로프-1-엔-1-일)-2-메톡시벤조에이트((E)-methyl-5-(3-acetamido-3-oxoprop-1-en-1-yl)-2-methoxybenzoate)(화합물 6)의 합성]
Figure PCTKR2021016597-appb-img-000016
아르곤 분위기 하에 25 mL 둥근바닥플라스크에 (E)-메틸 5-(3-클로로-3-옥소프로-1-펜-1-일)-2- 메톡시벤조에이트 (화합물 6c) (0.22 g, 0.85 mmol)를 넣고 디메틸포름아마이드 (12.00 mL)를 채운 후 아세트아마이드 (0.06 mL, 1.23 mmol)를 첨가하고 16시간 동안 환류하며 교반하였다. 반응이 끝나면 온도를 실온으로 낮춰준 뒤 혼합물의 용매를 감압증류하여 제거한 후, 실리카겔 크로마토그래피 (아세트산에틸/헥세인 = 1/2 to 1/1)로 분리하여 흰색 고체인 (E)-메틸-5-(3-아세타미도-3-옥소프로프-1-엔-1-일)-2-메톡시벤조에이트 (화합물 6) (30 mg, 12.7%)를 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 8.11 (s, 1H), 8.03 (d, J = 2.4 Hz, 1H), 7.77 (d, J = 15.6 Hz, 1H), 7.68 (dd, J = 8.8, 2.5 Hz, 1H), 7.01 (d, J = 8.7 Hz, 1H), 6.79 (d, J = 15.7 Hz, 1H), 3.96 (s, 3H), 3.92 (s, 3H), 2.45 (s, 3H).
[제조예 7: (E)-메틸-5-(3-(알릴아미노)-3-옥소프로프-1-엔-1-일)-2-메톡시벤조에이트((E)-methyl 5-(3-(allylamino)-3-oxoprop-1-en-1-yl)-2-methoxybenzoate)(화합물 7)의 합성]
Figure PCTKR2021016597-appb-img-000017
아르곤 분위기 하에 25 mL 둥근바닥플라스크에 (E)-메틸 5-(3-클로로-3-옥소프로-1-펜-1-일)-2- 메톡시벤조에이트 (화합물 7c) (0.22 g, 0.85 mmol)를 넣고 다이에틸 에터 (2.50 mL)를 채운 후 0℃로 온도를 내리고 알릴아민 (7d) (0.64 mL, 8.50 mmol)을 천천히 넣고 같은 온도에서 10분 동안 교반하였다. 반응이 끝나면 혼합물의 용매를 감압증류 하여 제거한 후, 실리카겔 크로마토그래피 (아세트산에틸/헥세인 = 1/3 to 1/2)로 분리하여 흰색 고체인 (E)-메틸-5-(3-(알릴아미노)-3-옥소프로프-1-엔-1-일)-2-메톡시벤조에이트 (화합물 7) (172 mg, 73.5%)를 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 7.99 (d, J = 2.4 Hz, 1H), 7.63 - 7.56 (m, 2H), 6.98 (d, J = 8.7 Hz, 1H), 6.34 (d, J = 15.6 Hz, 1H), 5.90 (ddt, J = 17.1, 10.2, 5.6 Hz, 1H), 5.63 (s, 1H), 5.29 - 5.13 (m, 2H), 4.03 (tt, J = 5.8, 1.5 Hz, 2H), 3.94 (s, 3H), 3.91 (s, 3H).
[제조예 8: ( E )-메틸-2-메톡시-5-(3-옥소-3-(2-옥소피페리딘-1-일)프로프-1-엔-1-일)벤조에이트(( E )-methyl-2-methoxy-5-(3-oxo-3-(2-oxopiperidin-1-yl)prop-1-en-1-yl)benzoate)(화합물 8)의 합성]
Figure PCTKR2021016597-appb-img-000018
아르곤 분위기 하에 25 mL 둥근바닥플라스크에, 2-피페리디논 (화합물 8d) (0.15 g, 1.53 mmol)를 넣고 테트라하이드로퓨란 (2.00 mL)을 채운 후 -78℃로 온도를 내리고 LDA (0.80 mL, 1.53 mmol, 2.0 M 용액)를 적가하여 첨가하고 45분 동안 교반하였다. (E)-메틸 5-(3-클로로-3-옥소프로-1-펜-1-일)-2-메톡시벤조에이트 (화합물 8c) (0.32 g, 1.27 mmol)를 테트라하이드로퓨란 (1.60 mL)에 녹여 -78℃에서 천천히 넣어주고 1시간 동안 교반하였다. 반응이 끝나면 1N 염산으로 남아있는 LDA를 분해한 후 아세트산에틸로 두번 추출하고, 아세트산에틸층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산나트륨으로 건조하여 감압증류를 실시한 후 컬럼크로마토그래피 (아세트산에틸/헥세인 = 1/2.5 to 1/2)로 분리하여 흰색 고체인 (E)-메틸-2-메톡시-5-(3-옥소-3-(2-옥소피페리딘-1-일)프로프-1-엔-1-일)벤조에이트 (화합물 8) (215 mg, 53.5 %)를 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 8.00 (d, J = 2.3 Hz, 1H), 7.69 - 7.64 (m, 2H), 7.36 (d, J = 15.6 Hz, 1H), 6.98 (d, J = 8.7 Hz, 1H), 3.94 (s, 3H), 3.90 (s, 3H), 3.80 (td, J = 5.2, 4.2, 2.2 Hz, 2H), 2.65 - 2.57 (m, 2H), 1.95 - 1.84 (m, 4H).
[제조예 9: 화합물 9의 합성]
Figure PCTKR2021016597-appb-img-000019
9-1: 3,3-디브로모피페리딘-2-온(3,3-dibromopiperidin-2-one)(화합물 9f)의 제조
아르곤 분위기 하에 100 mL 둥근바닥플라스크에 피페리딘-2-온 (화합물 9e) (2.00 g, 20.18 mmol)을 넣고 다이클로로메테인 (40.00 mL)을 채운 후 0℃로 온도를 내리고 오염화인 (8.40 g, 40.36 mmol)을 5분 동안 천천히 첨가하고 5분 동안 교반하였다. 같은 온도에서 요오드화아연 (0.20 g, 0.61 mmol)를 넣어준 뒤 온도를 실온으로 승온하여 1시간 동안 교반하였다. 1시간 후에 다이클로로메테인 (20.00 mL)에 녹아져 있는 이원자 브롬 (2.20 mL, 40.36 mmol)을 천천히 넣은 후 같은 온도에서 12시간 동안 교반하였다. 반응이 끝나면 온도를 실온으로 낮춰준 뒤 얼음물에 혼합물을 넣어주었다. 수용액층을 이염화메탄으로 5번 추출하고 유기층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산마그네슘으로 건조하여 혼합물의 용매를 감압증류하여 제거한 후, 실리카겔 크로마토그래피 (아세트산에틸/헥세인 = 1/2.5 to 1/1)로 분리하여 흰색 고체인 3,3-디브로모피페리딘-2-온 (화합물 9f) (1.32 g, 25.5 %)을 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 6.17 (s, 1H), 3.47 (td, J = 6.2, 2.4 Hz, 2H), 3.02 - 2.95 (m, 2H), 2.08 - 2.01 (m, 2H).
9-2: 3-브로모-5,6-디하이드로피리딘-2(1에이치)-온(3-bromo-5,6-dihydropyridin-2(1H)-one)(화합물 9d)의 제조
아르곤 분위기 하에 50 mL 둥근바닥플라스크에, 상기 제조예 9-1에서 제조된 3,3-디브로모피페리딘-2-온 (화합물 9f) (1.32 g, 5.14 mmol)를 넣고 디메틸포름아마이드 (10.00 mL)를 채운 후 탄산리튬 (0.72 g, 9.80 mmol)과 염화 리튬 (0.22 g, 5.24 mmol)을 첨가하고 13시간 동안 120℃에서 가열하며 교반하였다. 반응이 끝나면 온도를 실온으로 낮춰준 뒤 얼음물에 혼합물을 넣어주었다. 수용액층을 이염화메탄으로 3번 추출하고 유기층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산마그네슘으로 건조한 후, 실리카겔 크로마토그래피 (아세트산에틸/헥세인 = 1/1.5 to 1/1)로 분리하여 밝은 갈색 고체인 3-브로모-5,6-디하이드로피리딘-2(1에이치)-온 (화합물 9d) (0.36 g, 39.9 %)을 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 7.05 (t, J = 4.6 Hz, 1H), 6.96 (s, 1H), 3.49 (td, J = 7.1, 2.8 Hz, 2H), 2.43 (td, J = 7.1, 4.5 Hz, 2H)
9-3: (E)-메틸-5-(3-(3-브로모-2-옥소-5,6-디하이드로피리딘-1(2에이치)-일)-3-옥소프로프-1-엔-1-일)-2-메톡시벤조에이트((E)-methyl-5-(3-(3-bromo-2-oxo-5,6-dihydropyridin-1(2H)-yl)-3-oxoprop-1-en-1-yl)-2-methoxybenzoate)(화합물 9)의 제조
아르곤 분위기 하에 25 mL 둥근바닥플라스크에, 상기 제조예 9-2에서 제조된 3-브로모-5,6-디하이드로피리딘-2(1에이치)-온 (화합물 9d) (0.14 g, 0.77 mmol)를 넣고 테트라하이드로퓨란 (1.50 mL)을 채운 후 -78℃로 온도를 내리고 LDA (0.40 mL, 0.77 mmol, 2.0 M 용액)를 적가하여 첨가하고 45분 동안 교반하였다. (E)-메틸 5-(3-클로로-3-옥소프로-1-펜-1-일)-2-메톡시벤조에이트 (화합물 9c) (0.16 g, 0.64 mmol)를 테트라하이드로퓨란 (1.50 mL)에 녹여 -78℃에서 천천히 넣어주고 1시간 동안 교반하였다. 반응이 끝나면 1N 염산으로 남아있는 LDA를 분해한 후 아세트산에틸로 2번 추출하고 아세트산에틸층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산나트륨으로 건조하여 감압증류한 후, 컬럼크로마토그래피 (아세트산에틸/헥세인 = 1/2 to 1/1)로 분리하여 흰색 고체인 (E)-메틸-5-(3-(3-브로모-2-옥소-5,6-디하이드록시피리딘-1(2에이치)-일)-3-옥소프로프-1-엔-1-일)-2-메톡시벤조에이트 (화합물 9) (91 mg, 36.1 %)를 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 8.01 (d, J = 2.3 Hz, 1H), 7.77 - 7.68 (m, 2H), 7.42 (d, J = 15.6 Hz, 1H), 7.36 (t, J = 4.6 Hz, 1H), 6.98 (d, J = 8.7 Hz, 1H), 4.10 (t, J = 6.5 Hz, 2H), 3.95 (s, 3H), 3.91 (s, 3H), 2.53 (td, J = 6.5, 4.5 Hz, 2H).
[제조예 10: ( E )-메틸-5-(3-(3-브로모-2-옥소-5,6-디하이드로피리딘-1(2에이치)-일)-3-옥소프로프-1-엔-1-일)-2-하이드록시벤조에이트, ( E )-methyl 5-(3-(3-bromo-2-oxo-5,6-dihydropyridin-1(2H)-yl)-3-oxoprop-1-en-1-yl)-2-hydroxybenzoate (화합물 10)의 합성]
Figure PCTKR2021016597-appb-img-000020
아르곤 분위기의 둥근바닥플라스크에, 상기 제조예 9에서 제조된 (E)-메틸-5-(3-(3-브로모-2-옥소-5,6-디하이드로피리딘-1(2에이치)-일)-3-옥소프로프-1-엔-1-일)-2-메톡시벤조에이트 (화합물 9) (220 mg, 0.56 mmol)와 테트라하이드로퓨란 (10.0 mL)을 넣고 -10℃로 온도를 내리고 10분 후 삼브로모보론 용액 (1.0M 이염화메탄용액, 1.60 mL, 1.67 mmol)을 천천히 첨가하고 1시간 동안 교반하며 반응온도는 서서히 상온이 되도록 하였다. 반응의 여부는 TLC로 확인하고 반응이 완결되면 반응 온도를 다시 0℃로 하여 1N 염산 용액 1.50 mL를 이용하여 반응을 종결시켰다. 같은 온도에서 10분 동안 더 교반 한 뒤, 이염화메탄으로 3번 추출하고 유기층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산나트륨으로 건조하여 감압증류 후 실리카겔 크로마토그래피 (아세트산에틸/헥세인 = 1/3 to 1/2)로 분리하여 흰색 고체인 (E)-메틸-5-(3-(3-브로모-2-옥소-5,6-디하이드로피리딘-1(2에이치)-일)-3-옥소프로프-1-엔-1-일)-2-하이드록시벤조에이트 (화합물 10) (76.5 mg, 35.9 %)를 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 11.03 (s, 1H), 8.07 (d, J = 2.3 Hz, 1H), 7.76 - 7.68 (m, 2H), 7.41 (d, J = 15.6 Hz, 1H), 7.36 (t, J = 4.6 Hz, 1H), 7.00 (d, J = 8.6 Hz, 1H), 4.10 (t, J = 6.5 Hz, 2H), 3.99 (s, 3H), 2.53 (td, J = 6.5, 4.6 Hz, 2H).
[제조예 11: ( E )-메틸-2-아세톡시-5-(3-(3-브로모-2-옥소-5,6-디하이드로피리딘-1(2에이치)-일)-3-옥소프로프-1-엔-1-일)벤조에이트, ( E )-methyl-2-acetoxy-5-(3-(3-bromo-2-oxo-5,6-dihydropyridin-1(2H)-yl)-3-oxoprop-1-en-1-yl)benzoate (화합물 11)의 합성]
아르곤 분위기 하에 둥근바닥플라스크에, 상기 제조예 10에서 제조된 (E)-메틸-5-(3-(3-브로모-2-옥소-5,6-디하이드로피리딘-1(2에이치)-일)-3-옥소프로프-1-엔-1-일)-2-하이드록시벤조에이트 (화합물 10) (30 mg, 0.08 mmol)와 이염화메탄 (2.0 mL)를 넣고 0℃로 온도를 내려주었다. 10분 후 트리에틸아민 (20.3 μL, 0.16 mmol)을 넣고 5분 동안 교반하였다. 같은 온도에서 염화아세테이트 (11.4 μL, 0.16 mmol)를 천천히 첨가한 후, 0℃로 온도를 계속 유지하면서 1시간 동안 교반하였다. 반응의 여부는 TLC로 확인하고 반응이 끝난 뒤 증류수 2.0 mL로 반응을 종결하였다. 이후 이염화메탄으로 3번 추출하고 유기층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산 나트륨으로 건조하여 감압증류한 후, 실리카겔 크로마토그래피 (아세트산에틸/헥세인 = 1/3 to 1/2)로 분리하여 노란색 고체인 (E)-메틸-2-아세톡시-5-(3-(3-브로모-2-옥소-5,6-디하이드로피리딘-1(2에이치)-일)-3-옥소프로프-1-엔-1-일)벤조에이트 (화합물 11) (34.0 mg, 87.4 %)를 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 8.20 (d, J = 2.2 Hz, 1H), 7.78 (dd, J = 8.5, 2.4 Hz, 1H), 7.74 (d, J = 15.7 Hz, 1H), 7.49 (d, J = 15.6 Hz, 1H), 7.37 (t, J = 4.6 Hz, 1H), 7.13 (d, J = 8.4 Hz, 1H), 4.11 (t, J = 6.5 Hz, 2H), 3.90 (s, 3H), 2.54 (td, J = 6.4, 4.5 Hz, 2H), 2.36 (s, 3H).
[제조예 12: ( E )-메틸-5-(3-(3-클로로-2-옥소-5,6-디하이드로피리딘-1(2에이치)-일)-3-옥소프로프-1-엔-1-일)-2-하이드록시벤조에이트, ( E )-methyl-5-(3-(3-chloro-2-oxo-5,6-dihydropyridin-1(2H)-yl)-3-oxoprop-1-en-1-yl)-2-hydroxybenzoate (화합물 12)의 합성]
Figure PCTKR2021016597-appb-img-000021
아르곤 분위기의 둥근바닥플라스크에, 상기 제조예 3에서 제조된 (E)-메틸-5-(3-(3-클로로-2-옥소-5,6-디하이드록시피리딘-1(2에이치)-일)-3-옥소프로프-1-엔-1-일)-2-메톡시벤조에이트 (화합물 3) (240 mg, 0.69 mmol)와 테트라하이드로퓨란 (13.0 mL)을 넣고 -10℃로 온도를 내렸다. 10분 후 삼브로모보론 용액 (1.0M 이염화메탄용액, 2.06 mL, 2.06 mmol)을 천천히 첨가하고 1시간 동안 교반하였으며 반응온도는 서서히 상온이 되도록 하였다. 반응의 여부는 TLC로 확인하고 반응이 완결되면 반응 온도를 다시 0℃로 하여 1N 염산 용액 1.50 mL를 이용하여 반응을 종결시켰다. 같은 온도에서 10분 동안 더 교반한 뒤, 이염화메탄으로 3번 추출하고 유기층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산나트륨으로 건조하여 감압증류한 후, 실리카겔 크로마토그래피 (아세트산에틸/헥세인 = 1/3 to 1/2)로 분리하여 흰색 고체인 (E)-메틸-5-(3-(3-클로로-2-옥소-5,6-디하이드로피리딘-1(2에이치)-일)-3-옥소프로프-1-엔-1-일)-2-하이드록시벤조에이트 (화합물 12) (55.7 mg, 24.1 %)를 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 11.03 (s, 1H), 8.08 (d, J = 2.5 Hz, 1H), 7.76 - 7.69 (m, 2H), 7.42 (d, J = 15.6 Hz, 1H), 7.10 (t, J = 4.6 Hz, 1H), 7.00 (d, J = 8.6 Hz, 1H), 4.09 (t, J = 6.5 Hz, 2H), 3.99 (s, 3H), 2.57 (td, J = 6.5, 4.6 Hz, 2H).
[제조예 13: ( E )-메틸-2-아세톡시-5-(3-(3-클로로-2-옥소-5,6-디하이드로피리딘-1(2에이치)-일)-3-옥소프로프-1-엔-1-일)벤조에이트, ( E )-methyl-2-acetoxy-5-(3-(3-chloro-2-oxo-5,6-dihydropyridin-1(2H)-yl)-3-oxoprop-1-en-1-yl)benzoate (화합물 13)의 합성]
아르곤 분위기 하에 둥근바닥플라스크에, 상기 제조예 12에서 제조된 (E)-메틸-5-(3-(3-클로로-2-옥소-5,6-디하이드로피리딘-1(2에이치)-일)-3-옥소프로프-1-엔-1-일)-2-하이드록시벤조에이트 (화합물 12) (41 mg, 0.12 mmol)와 이염화메탄 (2.0 mL)를 넣고 0℃로 온도를 내려주었다. 10분 뒤 트리에틸아민 (33.5 μL, 0.24 mmol)을 넣고 5분 동안 교반하였다. 같은 온도에서 염화아세테이트 (17.1 μL, 0.24 mmol)를 천천히 첨가한 후, 0℃로 온도를 계속 유지하면서 1시간 동안 교반하였다. 반응의 여부는 TLC로 확인하고 반응이 끝난 뒤 증류수 2.0 mL로 반응을 종결하였다. 이염화메탄으로 3번 추출하고 유기층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산 나트륨으로 건조하여 감압증류한 후, 실리카겔 크로마토그래피 (아세트산에틸/헥세인 = 1/3 to 1/2)로 분리하여 노란색 고체인 (E)-메틸-2-아세톡시-5-(3-(3-클로로-2-옥소-5,6-디하이드로피리딘-1(2에이치)-일)-3-옥소프로프-1-엔-1-일)벤조에이트 (화합물 13) (30.0 mg, 66.2 %)를 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 8.20 (d, J = 2.2 Hz, 1H), 7.81 - 7.71 (m, 2H), 7.50 (d, J = 15.6 Hz, 1H), 7.15 - 7.09 (m, 2H), 4.10 (t, J = 6.5 Hz, 2H), 3.90 (s, 3H), 2.59 (td, J = 6.4, 4.6 Hz, 2H), 2.36 (s, 3H).
[제조예 14: 화합물 14의 합성]
Figure PCTKR2021016597-appb-img-000022
14-1: ( E )-3-(3-니트로페닐)아크릴산, ( E )-3-(3-nitrophenyl)acrylic acid (화합물 14b)의 제조
아르곤 분위기 하에 탄산 칼륨 (3.32 g, 24.0 mmol)이 들어 있는 둥근바닥플라스크에 무수 아세트산 (8.0 mL, 84.6 mmol)을 0℃에서 천천히 넣어주고, 온도를 서서히 상온으로 올려주며 5분 동안 교반한 후, 3-니트로벤잘알데히드 (화합물 14a) (3.02 g, 20.0 mmol)를 천천히 첨가하였다. 반응 혼합물을 165℃에서 환류하며 15시간 동안 교반하였다. 반응이 끝나면 온도를 상온으로 낮춰 주고 얼음물을 첨가한 후 여과장치를 이용하여 고체를 걸러 주고 물로 여러 번 씻어준 뒤 건조하였다. 얻어진 고체 혼합물을 아세트산에틸 (30.0 mL) 용매에 녹이고 포화 탄산수소나트륨 수용액 (20.0 mL)으로 2번 닦아준 뒤 아세트산에틸층은 버렸다. 탄산수소나트륨 수용액층을 3N 염화수소 수용액으로 산성화한 후, 아세트산에틸 용매로 2번 추출하였다. 유기층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산 나트륨으로 건조하여 감압증류한 후 충분히 건조하여 베이지색 고체인 (E)-3-(3-니트로페닐)아크릴산 (화합물 14b) (2.20 g, 56.8 %)을 얻었다.
1H NMR (400 MHz, CDCl3+CD3OD): δ 8.28 (1H, t, J = 1.6 Hz), 8.14 (1H, ddd, J = 8.4, 2.4, 1.2 Hz), 7.76 (1H, dt, J = 8.0, 1.6 Hz), 7.62 (1H, d, J = 16.0 Hz), 7.50 (1H, t, J = 8.0 Hz), 6.46 (1H, d, J = 16.0 Hz).
14-2: ( E )-1-(3-(3-니트로페닐)아크릴로일)-1에이치-피롤-2(5에이치)-온, ( E )-1-(3-(3-nitrophenyl)acryloyl)-1H-pyrrol-2(5H)-one (화합물 14)의 제조
아르곤 분위기 하에 50 mL 둥근바닥플라스크에 1H-피롤-2(5에이치)-온 (화합물 14d) (0.11 g, 1.25 mmol)을 넣고 테트라하이드로퓨란 (1.50 mL)을 채운 후 -78℃로 온도를 내리고 LDA (0.63 mL, 1.25 mmol, 2.0 M 용액)를 적가하여 첨가하고 45분 동안 교반하였다. (E)-3-(3-니트로페닐)아크릴로일 클로라이드 (화합물 14c) (0.22 g, 1.04 mmol)를 테트라하이드로퓨란 (2.0 mL)에 녹여 -78℃에서 천천히 넣어주고 1시간 동안 교반하였다. 반응이 끝나면 1N 염산으로 남아있는 LDA를 분해한 후 아세트산에틸로 추출하고, 아세트산에틸층은 포화 염화나트륨 용액으로 씻어주고 무수 황산나트륨으로 건조하여 감압증류한 후 컬럼크로마토그래피 (아세트산에틸/헥세인 = 1/3 to 1/2)로 분리하여 연갈색 고체인 (E)-1-(3-(3-니트로페닐)아크릴로일)-1에이치-피롤-2(5에이치)-온 (화합물 14) (81 mg, 30.2 %)을 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 8.39 (t, J = 2.0 Hz, 1H), 8.23 (ddd, J = 8.2, 2.3, 1.1 Hz, 1H), 7.83 (dt, J = 7.8, 1.4 Hz, 1H), 7.71 (d, J = 16.0 Hz, 1H), 7.59 (t, J = 7.9 Hz, 1H), 6.57 (d, J = 16.0 Hz, 1H), 4.24 (t, J = 6.7 Hz, 2H).
13C NMR (100 MHz, CDCl3): δ 170.3, 164.6, 148.9, 147.4, 143.0, 136.8, 133.9, 130.1, 127.9, 124.8, 123.4, 121.9, 51.2.
[제조예 15: 화합물 15의 합성]
Figure PCTKR2021016597-appb-img-000023
15-1: ( E )-1-(3-(3-니트로페닐)아크릴로일)피페리딘-2-온, ( E )-1-(3-(3 nitrophenyl)acryloyl)piperidin-2-one (화합물 15e)
아르곤 분위기 하에 25 mL 둥근바닥플라스크에 2-피페리디논 (화합물 15d) (0.14 g, 1.40 mmol)을 넣고 테트라하이드로퓨란 (1.50 mL)을 채운 후 -78℃로 온도를 내리고 LDA (0.70 mL, 1.40 mmol, 2.0 M 용액)를 적가하여 첨가하고 45분 동안 교반하였다. (E)-3-(3-니트로페닐)아크릴로일 클로라이드 (화합물 15c) (0.25 g, 1.16 mmol)를 테트라하이드로퓨란 (1.80 mL)에 녹여 -78℃에서 천천히 넣어주고 1시간 동안 교반하였다. 반응이 끝나면 1N 염산으로 남아있는 LDA를 분해한 후 아세트산에틸로 두번 추출하고, 아세트산에틸층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산나트륨으로 건조하여 감압증류한 후 컬럼크로마토그래피 (아세트산에틸/헥세인 = 1/2 to 1/1)로 분리하여 흰색 고체인 (E)-1-(3-(3-니트로페닐)아크릴로일)피페리딘-2-온 (화합물 15e) (165 mg, 52.1 %)을 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 8.39 (t, J = 2.0 Hz, 1H), 8.20 (ddd, J = 8.1, 2.2, 1.0 Hz, 1H), 7.86 (dt, J = 7.8, 1.4 Hz, 1H), 7.67 (d, J = 15.7 Hz, 1H), 7.56 (t, J = 8.0 Hz, 1H), 7.50 (d, J = 15.6 Hz, 1H), 3.82 (ddd, J = 6.4, 4.2, 1.5 Hz, 2H), 2.67 - 2.59 (m, 2H), 1.95 - 1.86 (m, 4H).
15-2: ( E )-1-(3-(3-니트로페닐)아크릴로일)-3-(페닐셀라닐)피페리딘-2-온, ( E )-1-(3-(3-nitrophenyl)acryloyl)-3-(phenylselanyl)piperidin-2-one (화합물 15f)의 제조
아르곤 분위기 하에 25 mL 둥근바닥플라스크에, 상기 제조예 15-1에서 제조된 (E)-1-(3-(3-니트로페닐)아크릴로일)피페리딘-2-온 (화합물 15e) (0.16 g, 0.60 mmol)을 넣고 테트라하이드로퓨란 (3.50 mL)을 채운 후 -78℃로 온도를 내리고 LDA (0.40 mL, 0.78 mmol, 2.0 M 용액)를 적가하여 첨가하고 45분 동안 교반하였다. 페닐셀레닐클로라이드 (0.13 g, 0.66 mmol)를 테트라하이드로퓨란 (3.50 mL)에 녹여 -78℃에서 천천히 넣어주고 4시간 동안 교반하였다. 반응이 끝나면 물을 첨가하여 남아있는 LDA를 분해한 후 0℃에서 15분 동안 추가적으로 교반하고 이염화메탄으로 2번 추출하였다. 유기층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산나트륨으로 건조하여 감압증류한 후 실리카겔 크로마토그래피 (아세트산에틸/헥세인 = 1/4 to 1/3)로 분리하여 흰색 고체인 (E)-1-(3-(3-니트로페닐)아크릴로일)-3-(페닐셀라닐)피페리딘-2-온 (화합물 15f) (30 mg, 11.7 %)을 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 8.33 (t, J = 2.0 Hz, 1H), 8.21 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 7.78 (dt, J = 7.8, 1.4 Hz, 1H), 7.72 - 7.69 (m, 2H), 7.65 (d, J = 15.6 Hz, 1H), 7.56 (t, J = 8.0 Hz, 1H), 7.43 - 7.34 (m, 3H), 7.10 (d, J = 15.6 Hz, 1H), 4.13 (ddd, J = 5.2, 4.2, 1.0 Hz, 1H), 4.08 - 3.95 (m, 1H), 3.70 (ddd, J = 14.0, 9.7, 4.6 Hz, 1H), 2.46 - 2.28 (m, 1H), 2.25 - 2.05 (m, 2H), 1.90 (dt, J = 14.3, 5.1 Hz, 1H).
15-3: ( E )-1-(3-(3-니트로페닐)아크릴로일)-5,6-디하이드로피리딘-2(1에이치)-온, ( E )-1-(3-(3-nitrophenyl)acryloyl)-5,6-dihydropyridin-2(1H)-one (화합물 15)의 제조
아르곤 분위기 하에 25 mL 둥근바닥플라스크에, 상기 제조예 15-2에서 제조된 (E)-1-(3-(3-니트로페닐)아크릴로일)-3-(페닐셀라닐)피페리딘-2-온 (화합물 15f) (28 mg, 0.07 mmol)를 넣고 테트라하이드로퓨란 (1.00 mL)을 채운 후 0℃로 온도를 내리고 과산화수소 (20 μL, 0.18 mmol, 30% 용액)를 적가하여 첨가하고 15분 동안 교반한 후 온도를 상온으로 승온하여 추가적으로 30분 더 교반하였다. 반응이 끝나면 포화 탄산수소나트륨 용액을 첨가하고 이염화메탄으로 2번 추출하였다. 유기층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산나트륨으로 건조하여 감압증류한 후, 실리카겔 크로마토그래피 (아세트산에틸/헥세인 = 1/2)로 분리하여 흰색 고체인 (E)-1-(3-(3-니트로페닐)아크릴로일)-5,6-디하이드로피리딘-2(1에이치)-온 (화합물 15) (7.10 mg, 37.4 %)을 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 8.41 (t, J = 2.0 Hz, 1H), 8.21 (ddd, J = 8.1, 2.2, 1.0 Hz, 1H), 7.88 (d, J = 7.7 Hz, 1H), 7.73 (d, J = 15.7 Hz, 1H), 7.60 - 7.54 (m, 2H), 7.03 - 6.94 (m, 1H), 6.07 (dt, J = 9.7, 1.9 Hz, 1H), 4.06 (t, J = 6.5 Hz, 2H), 2.51 (tdd, J = 6.4, 4.2, 1.9 Hz, 2H).
[제조예 16: ( E )-3-클로로-1-(3-(3-니트로페닐)아크릴로일)-5,6-디하이드로피리딘-2(1에이치)-온, ( E )-3-chloro-1-(3-(3-nitrophenyl)acryloyl)-5,6-dihydropyridin-2(1H)-one (화합물 16)의 합성]
Figure PCTKR2021016597-appb-img-000024
아르곤 분위기 하에 25 mL 둥근바닥플라스크에, 3-클로로-5,6-디하이드로피리딘-2(1에이치)-온 (화합물 16d) (0.17 g, 1.31 mmol)을 넣고 테트라하이드로퓨란 (2.0 mL)을 채운 후 -78℃로 온도를 내리고 LDA (0.70 mL, 1.31 mmol, 2.0 M 용액)를 적가하여 첨가하고 45분 동안 교반하였다. (E)-3-(3-니트로페닐)아크릴로일 클로라이드 (화합물 16c) (0.23 g, 1.09 mmol)를 테트라하이드로퓨란 (1.50 mL)에 녹여 -78℃에서 천천히 넣어주고 1시간 동안 교반하였다. 반응이 끝나면 1N 염산으로 남아있는 LDA를 분해한 후 아세트산에틸로 2번 추출하였다. 아세트산에틸층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산나트륨으로 건조하여 감압증류한 후, 컬럼크로마토그래피 (아세트산에틸/헥세인 = 1/2 to 1/1)로 분리하여 연노란색 고체인 (E)-3-클로로-1-(3-(3-니트로페닐)아크릴로일)-5,6-디하이드로피리딘-2(1에이치)-온 (화합물 16) (135 mg, 40.7 %)을 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 8.40 (t, J = 2.0 Hz, 1H), 8.23 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 7.90 (d, J = 7.7 Hz, 1H), 7.75 (d, J = 15.7 Hz, 1H), 7.61 - 7.53 (m, 2H), 7.13 (t, J = 4.6 Hz, 1H), 4.11 (t, J = 6.5 Hz, 2H), 2.60 (td, J = 6.5, 4.6 Hz, 2H).
[제조예 17: ( E )-3-브로모-1-(3-(3-니트로페닐)아크릴로일)-5,6-디하이드로피리딘-2(1에이치)-온, ( E )-3-bromo-1-(3-(3-nitrophenyl)acryloyl)-5,6-dihydropyridin-2(1H)-one (화합물 17)의 합성]
Figure PCTKR2021016597-appb-img-000025
아르곤 분위기 하에 25 mL 둥근바닥플라스크에 3-브로모-5,6-디하이드로피리딘-2(1에이치)-온 (화합물 17d) (0.22 g, 1.25 mmol)을 넣고 테트라하이드로퓨란 (2.0 mL)을 채운 후 -78℃로 온도를 내리고 LDA (0.63 mL, 1.25 mmol, 2.0 M 용액)를 적가하여 첨가하고 45분 동안 교반하였다. (E)-3-(3-니트로페닐)아크릴로일 클로라이드 (화합물 17c) (0.22 g, 1.04 mmol)를 테트라하이드로퓨란 (1.50 mL)에 녹여 -78℃에서 천천히 넣어주고 1시간 동안 교반하였다. 반응이 끝나면 1N 염산으로 남아있는 LDA를 분해한 후 아세트산에틸로 2번 추출하고, 아세트산에틸층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산나트륨으로 건조하여 감압증류한 후 컬럼크로마토그래피 (아세트산에틸/헥세인 = 1/2.5 to 1/2)로 분리하여 연노란색 고체인 (E)-3-브로모-1-(3-(3-니트로페닐)아크릴로일)-5,6-디하이드로피리딘-2(1에이치)-온 (화합물 17) (110 mg, 30.1 %)을 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 8.40 (t, J = 2.0 Hz, 1H), 8.22 (ddd, J = 8.1, 2.3, 1.0 Hz, 1H), 7.90 (d, J = 7.6 Hz, 1H), 7.75 (d, J = 15.6 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.39 (t, J = 4.6 Hz, 1H), 4.12 (t, J = 6.5 Hz, 2H), 2.56 (td, J = 6.4, 4.6 Hz, 2H).
[제조예 18: 화합물 18의 합성]
Figure PCTKR2021016597-appb-img-000026
18-1: ( E )-3-(2,3-디하이드로벤조[비][1,4]다이옥신-6-일)아크릴산, ( E )-3-(2,3-dihydrobenzo[b][1,4]dioxin-6-yl)acrylic acid (화합물 18b)의 제조
아르곤 분위기 하에 무수 아세트산 (4.0 mL, 42.2 mmol)을 탄산 칼륨 (1.04 g, 7.54 mmol)이 들어 있는 둥근바닥플라스크에 0℃에서 천천히 넣어주고 온도를 서서히 상온으로 올려주며 5분 동안 교반한 후 2,3-디하이드로벤조[비][1,4]다이옥신-6-카바알데하이드 (화합물 18a) (0.99 g, 6.03 mmol)를 천천히 넣어주었다. 반응 혼합물을 165℃에서 환류하며 15시간 동안 교반하였다. 반응이 끝나면 온도를 상온으로 낮춰 주고 (1시간 내 고체 생성) 얼음물을 첨가한 후 여과장치를 이용하여 고체를 걸러주고 물로 여러 번 씻어준 후 건조하였다. 얻어진 고체 혼합물을 아세트산에틸 (30.0 mL) 용매에 녹이고 포화 탄산수소나트륨 수용액 (20.0 mL)으로 2번 닦아준 뒤 아세트산에틸 층은 버려주었다. 탄산수소 나트륨 수용액층을 3N 염화수소 수용액으로 산성화해준 후 아세트산에틸 용매로 2번 추출하였다. 유기층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산마그네슘으로 건조하여 감압증류한 후 충분히 건조하여 흰색 고체인 (E)-3-(2,3-디하이드로벤조[비][1,4]다이옥신-6-일)아크릴산 (화합물 18b) (0.48 g, 38.9 %)을 얻었다.
1H NMR (400 MHz, CDCl3): δ 7.67 (1H, d, J = 16.0 Hz), 7.08 (1H, d, J = 2.0 Hz), 7.06 (1H, dd, J = 8.4, 2.0 Hz), 6.88 (1H, d, J = 8.4 Hz), 6.29 (1H, d, J = 15.6 Hz), 4.31 - 4.26 (4H, m).
18-2: ( E )-1-(3-(2,3-디하이드로벤조[비][1,4]다이옥신-6-일)아크릴로일)-1에이치-피롤-2(5에이치)-온, ( E )-1-(3-(2,3-dihydrobenzo[b][1,4]dioxin-6-yl)acryloyl)-1H-pyrrol-2(5H)-one (화합물 18)의 제조
아르곤 분위기 하에 50 mL 둥근바닥플라스크에 1H-피롤-2(5에이치)-온 (화합물 18d) (58 mg, 0.69 mmol)을 넣고 테트라하이드로퓨란 (1.0 mL)을 채운 후 -78℃로 온도를 내리고 LDA (0.35 mL, 0.69 mmol, 2.0 M 용액)를 적가하여 첨가하고 45분 동안 교반하였다. (E)-3-(2,3-디하이드로벤조[비][1,4]다이옥신-6-일)아크릴로일 클로라이드 (화합물 18c) (120 mg, 0.58 mmol)를 테트라하이드로퓨란 (1.2 mL)에 녹여 -78℃에서 천천히 넣어주고 1시간 동안 교반하였다. 반응이 끝나면 1N 염산으로 남아있는 LDA를 분해한 후 아세트산에틸로 추출하고 아세트산에틸층은 포화 염화나트륨 용액으로 씻어주고 무수 황산마그네슘으로 건조하여 감압증류한 후 컬럼크로마토그래피 (아세트산에틸/헥세인 = 1/2 to 1/1)로 분리하여 흰색 고체인 (E)-1-(3-(2,3-디하이드로벤조[비][1,4]다이옥신-6-일)아크릴로일)-1에이치-피롤-2(5에이치)-온 (화합물 18) (10 mg, 10.1 %)을 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 7.90 (d, J = 15.7 Hz, 1H), 7.80 (d, J = 15.7 Hz, 1H), 7.33 (dt, J = 6.1, 2.0 Hz, 1H), 7.21 - 7.13 (m, 2H), 6.87 (d, J = 8.3 Hz, 1H), 6.21 (dt, J = 6.1, 1.9 Hz, 1H), 4.52 (t, J = 2.0 Hz, 2H), 4.31 - 4.26 (m, 4H).
13C NMR (101 MHz, Chloroform-d) δ 170.21, 165.50, 146.74, 145.99, 145.90, 143.75, 128.68, 128.01, 122.72, 117.74, 117.44, 116.84, 64.68, 64.28, 51.18.
[제조예 19: 화합물 19의 합성]
Figure PCTKR2021016597-appb-img-000027
19-1: 에틸-3,5-디클로로벤조에이트, ethyl-3,5-dichlorobenzoate (화합물 19b)의 제조
아르곤 분위기 하에 무수 에탄올 (11.0 mL) 용매에 녹아 있는 3,5-디클로로벤조산 (화합물 19a) (1.05 g, 5.50 mmol)에 농축된 황산 (0.29 mL)을 0℃에서 천천히 넣어주었다. 반응 혼합물을 80℃에서 환류하며 15시간 동안 교반하였다. 반응이 끝나면 온도를 상온으로 낮춰 주고 용매를 감압 증발하여 모두 제거한 후 혼합물을 아세트산에틸 (80.0 mL) 용매에 녹이고 포화 탄산수소나트륨 수용액 (15.0 mL)으로 2번, 물 (20.0 mL)로 2번, 포화 염화나트륨 용액 (20.0 mL)으로 1번 닦아주고 무수 황산마그네슘으로 건조하고 감압증류한 후 충분히 건조하여 고체 상태의 에틸-3,5-디클로로벤조에이트 (화합물 19b) (1.15 g, 95.2 %)를 얻었다.
Rf = 0.75 (아세트산에틸/헥세인 = 1/5)
19-2: 3,5-디클로로벤조하이드라지드, 3,5-Dichlorobenzohydrazide (화합물 19c)의 제조
아르곤 분위기 하에 무수 에탄올 (12.0 mL) 용매에 녹아 있는 에틸-3,5-디클로로벤조에이트 (화합물 19b) (1.15 g, 5.24 mmol)에 하이드라진 하이드레이트 (0.38 mL, 7.85 mmol)를 상온에서 넣어주었다. 반응 혼합물을 80℃에서 환류하며 15시간 동안 교반하였다. 반응이 끝나면 온도를 상온으로 낮춰 주고 용매를 감압 증발하여 모두 제거하였다. 그 혼합물에 얼음물을 첨가한 후 여과장치를 이용하여 고체를 걸러주고 물과 헥세인으로 여러 번 씻어준 뒤 충분히 건조하여 흰색 고체인 3,5-디클로로벤조하이드라지드 (화합물 19c) (0.98 g, 90.4 %)를 얻었다. 다른 정제과정 없이 다음 반응에 이용하였다.
Rf = 0.21 (아세트산에틸/헥세인 = 1/1)
1H NMR (400 MHz, DMSO-d6): δ 10.00 (1H, br s), 7.83 (2H, d, J = 1.6 Hz), 7.79 (1H, t, J = 1.6 Hz), 4.59 (2H, br s).
19-3: 2-(3,5-디클로로벤조일)하이드라진카보닐 클로라이드, 2-(3,5-dichlorobenzoyl)hydrazinecarbonyl chloride (화합물 19d)의 제조
아르곤 분위기 하에 무수 아세토니트릴 (18.0 mL) 용매에 녹아 있는 3,5-디클로로벤조하이드라지드 (화합물 19c) (0.97 g, 4.73 mmol)에 클로로아세틸클로라이드 (0.45 mL, 5.68 mmol)를 0℃에서 넣어준 뒤 바로 40% 수산화나트륨 수용액 (1.5 eq)을 천천히 넣어주고 2시간 더 교반하였다. 반응이 끝나면 얼음물 (20.0 mL)을 넣어주고 여과장치를 이용하여 고체를 걸러주고 물로 여러 번 씻어준 뒤 충분히 건조하였다. 고체 화합물을 완전히 건조하기 위해서 아세트산에틸 (200.0 mL) 용매에 녹이고 무수 황산마그네슘으로 건조하여 감압증류한 후 2-(3,5-디클로로벤조일)하이드라진카보닐 클로라이드 (화합물 19d) (0.93 g, 70.0 %)를 얻었다. 다른 정제과정 없이 다음반응에 이용하였다.
Rf = 0.54 (아세트산에틸/헥세인 = 1/1)
19-4: 2-(클로로메틸)-5-(3,5-디클로로페닐)-1,3,4,-옥사다이아졸, 2-(chloromethyl)-5-(3,5-dichlorophenyl)-1,3,4-oxadiazole (화합물 19e)의 제조
아르곤 분위기 하에 무수 아세토니트릴 (18.0 mL) 용매에 녹아 있는 2-(3,5-디클로로벤조일)하이드라진카보닐 클로라이드 (화합물 19d) (0.93 g, 3.31 mmol)에 염화포스포릴 (0.62 mL, 6.63 mmol)을 상온에서 넣어준 후 90℃에서 환류하며 4시간 동안 교반하였다. 반응이 끝나면 온도를 상온으로 낮춰 주고 용매를 감압 증류하에서 제거하였다. 그 혼합물에 포화 탄산수소나트륨 수용액 (15.0 mL)을 넣어준 뒤 아세트산에틸 용매 (50.0 mL)로 3번 추출하고 물 (30.0 mL)로 3번, 포화 염화나트륨 용액 (30 mL)으로 1번 씻어주고 무수 황산마그네슘으로 건조하여 감압증류한 후 컬럼크로마토그래피 (아세트산에틸/헥세인 = 1/10)로 분리하여 흰색 고체인 2-(클로로메틸)-5-(3,5-디클로로페닐)-1,3,4,-옥사다이아졸 (화합물 19e) (0.68 g, 77.7 %)을 얻었다.
Rf = 0.48 (아세트산에틸/헥세인 = 1/5)
1H NMR (400 MHz, CDCl3): δ 7.98 (2H, d, J = 2.0 Hz), 7.56 (1H, t, J = 2.0 Hz), 4.79 (2H, s)
13C NMR (100 MHz, CDCl3): δ 164.1, 163.0, 136.4, 132.3, 126.1, 125.6, 33.0.
19-5: ( E )-에틸-3-(4-하이드록시-3,5-디메톡시페닐)아크릴레이트, ( E )-ethyl-3-(4-hydroxy-3,5-dimethoxyphenyl)acrylate (화합물 19g)의 제조
아르곤 분위기 하에 무수 에탄올 (10.0 mL) 용매에 녹아 있는 (E)-3-(4-하이드록시-3,5-디메톡시페닐)아크릴산 (화합물 19f) (0.45 g, 2.0 mmol)에 농축된 황산 다섯방울을 0℃에서 천천히 넣어주었다. 반응 혼합물을 80℃에서 환류하며 15시간 동안 교반하였다. 반응이 끝나면 온도를 상온으로 낮춰 주고 용매를 감압 증류하여 모두 제거한 후 혼합물에 물 (20.0 mL)을 넣어주고 아세트산에틸 (35.0 mL) 용매로 3번 추출하였다. 유기층은 포화 탄산수소나트륨 수용액 (25.0 mL)으로 1번, 물 (30.0 mL)로 3번, 포화 염화나트륨 용액 (30.0 mL)으로 1번 씻어주고 무수 황산마그네슘으로 건조하여 감압증류한 후 컬럼크로마토그래피 (아세트산에틸/헥세인 = 1/10)로 분리하여 (E)-에틸-3-(4-하이드록시-3,5-디메톡시페닐)아크릴레이트 (화합물 19g) (0.47 g, 92.9 %)를 얻었다.
Rf = 0.52 (아세트산에틸/헥세인 = 2/3)
19-6: ( E )-에틸-3-(4-((5-(3,5-디클로로페닐)-1,3,4-옥사다이아졸-2-일)메톡시)-3,5-디메톡시페닐)아크릴레이트, ( E )-ethyl-3-(4-((5-(3,5-dichlorophenyl)-1,3,4-oxadiazol-2-yl)methoxy)-3,5-dimethoxyphenyl)acrylate (화합물 19h)의 제조
아르곤 분위기 하에 무수 디메틸포름아마이드 (3.0 mL) 용매에 녹아 있는 (E)-에틸-3-(4-하이드록시-3,5-디메톡시페닐)아크릴레이트 (화합물 19g) (0.23 g, 0.91 mmol)에 탄산칼륨을 상온에서 넣어주고 5분 동안 교반하였다. 무수 디메틸포름아마이드 (3.0 mL) 용매에 녹아있는 2-(클로로메틸)-5-(3,5-디클로로페닐)-1,3,4,-옥사다이아졸 (화합물 19e) (0.24 g, 0.91 mmol), 아이오딘화칼륨 (0.02 g, 0.09 mmol)을 위 혼합물 (화합물 19g)에 천천히 넣어주었다. 반응 혼합물을 65℃에서 6시간 동안 교반하였다. 반응이 끝나면 온도를 상온으로 낮춰 주고 여과장치를 이용하여 고체를 걸러주고 아세트산에틸 (25.0 mL), 물 (20.0 mL)로 씻어주었다. 여과된 액체에 물 (20.0 mL)를 첨가하여 아세트산에틸 (50.0 mL) 용매로 2번 추출하였다. 유기층은 물 (25.0 mL)로 3번, 포화 염화나트륨 용액 (25.0 mL)으로 1번 씻어주고 무수 황산마그네슘으로 건조하여 감압증류한 후 컬럼크로마토그래피 (아세트산에틸/헥세인 = 1/4-1/3)로 분리하여 흰색 솜털 고체인 (E)-에틸-3-(4-((5-(3,5-디클로로페닐)-1,3,4-옥사다이아졸-2-일)메톡시)-3,5-디메톡시페닐)아크릴레이트 (화합물 19h) (0.40 g, 91.8 %)를 얻었다.
Rf = 0.45 (아세트산에틸/헥세인 = 1/2)
1H NMR (400 MHz, CDCl3): δ 8.00 (2H, d, J = 2.0 Hz), 7.58 (1H, d, J = 16.0 Hz), 7.55 (1H, t, J = 2.0 Hz), 6.73 (2H, s), 6.35 (1H, d, J = 16.0 Hz), 5.29 (2H, s), 4.27 (2H, q, J = 7.2 Hz), 1.34 (3H, t, J = 7.2 Hz)
13C NMR (100 MHz, CDCl3): δ 166.9, 163.7, 163.6, 153.6, 144.3, 137.0, 136.3, 132.0, 131.7, 126.4, 125.5, 118.5, 105.0, 63.7, 60.8, 56.3, 14.5.
19-7: ( E )-3-(4-((5-(3,5-디클로로페닐)-1,3,4-옥사다이아졸-2-일)메톡시)-3,5-디메톡시페닐)아크릴산, ( E )-3-(4-((5-(3,5-dichlorophenyl)-1,3,4-oxadiazol-2-yl)methoxy)-3,5-dimethoxyphenyl)acrylic acid (화합물 19i)의 제조
아르곤 분위기 하에 무수 에탄올 (7.0 mL) 용매에 녹아 있는 (E)-에틸-3-(4-((5-(3,5-디클로로페닐)-1,3,4-옥사다이아졸-2-일)메톡시)-3,5-디메톡시페닐)아크릴레이트 (화합물 19h) (0.40 g, 0.83 mmol)에 수산화칼륨 (0.12 g, 2.09 mmol)을 상온에서 넣어주고 80℃에서 3시간 동안 환류하며 교반하였다. 반응이 끝나면 온도를 상온으로 낮춰 주고 용매를 감압증류하여 모두 제거한 후 혼합물에 얼음물 (10.0 mL)을 넣어주고 1N 염산으로 산성화하고 여과장치를 이용하여 고체를 걸러주었다. 고체 화합물을 물로 여러 번 씻어주고 충분히 건조하여 노란색 고체인 (E)-3-(4-((5-(3,5-디클로로페닐)-1,3,4-옥사다이아졸-2-일)메톡시)-3,5-디메톡시페닐)아크릴산 (화합물 19i) (0.29 g, 77.5 %)을 얻었다.
1H NMR (400 MHz, DMSO-d6): δ 10.10 (1H, br s), 7.90 (2H, d, J = 2.0 Hz), 7.88 (1H, t, J = 2.0 Hz), 7.53 (1H, d, J = 16.0 Hz), 7.09 (2H, s), 6.58 (1H, d, J = 16.0 Hz), 4.51 (2H, s), 3.86 (6H, s)
13C NMR (100 MHz, DMSO-d6): δ 167.9, 167.0, 162.5, 152.4, 143.4, 137.3, 135.6, 134.4, 131.3, 130.6, 126.4, 6.9, 163.7, 163.6, 153.6, 144.3, 137.0, 136.3, 132.0, 131.7, 126.3, 119.6, 105.7, 70.8, 56.2.
19-8: ( E )-3-클로로-1-(3-(4-((5-(3,5-디클로로페닐)-1,3,4-옥사다이아졸-2-일)메톡시)-3,5-디메톡시페닐)아크릴로일)-5,6-디하이드로피리딘-2(1에이치)-온, ( E )-3-chloro-1-(3-(4-((5-(3,5-dichlorophenyl)-1,3,4-oxadiazol-2-yl)methoxy)-3,5-dimethoxyphenyl)acryloyl)-5,6-dihydropyridin-2(1H)-one (화합물 19)의 합성
아르곤 분위기 하에 25 mL 둥근바닥플라스크에 3-클로로-5,6-디하이드로피리딘-2(1에이치)-온 (화합물 19k) (25 mg, 0.19 mmol)을 넣고 테트라하이드로퓨란 (1.0 mL)을 채운 후 -78℃로 온도를 내리고 LDA (0.10 mL, 0.19 mmol, 2.0 M 용액)를 적가하여 첨가하고 45분 동안 교반하였다. (E)-3-(4-((5-(3,5-디클로로페닐)-1,3,4-옥사다이아졸-2-일)메톡시)-3,5-디메톡시페닐)아크릴 클로라이드 (화합물 19j) (76 mg, 0.16 mmol)를 테트라하이드로퓨란 (1.0 mL)에 녹여 -78℃에서 천천히 넣어주고 1시간 동안 교반하였다. 반응이 끝나면 1N 염산으로 남아있는 LDA를 분해한 후 아세트산에틸로 2번 추출하고, 아세트산에틸층은 포화 염화나트륨 용액으로 한번 씻어주고 무수 황산나트륨으로 건조하여 감압증류한 후 컬럼크로마토그래피 (아세트산에틸/헥세인 = 1/4 to 1/3)로 분리하여 연갈색 고체인 (E)-3-클로로-1-(3-(4-((5-(3,5-디클로로페닐)-1,3,4-옥사다이아졸-2-일)메톡시)-3,5 디메톡시페닐)아크릴로일)-5,6-디하이드로피리딘-2(1에이치)-온 (화합물 19) (8.90 mg, 9.90 %)을 얻었다.
1H NMR (400 MHz, Chloroform-d) δ 8.00 (d, J = 1.9 Hz, 2H), 7.69 (d, J = 15.6 Hz, 1H), 7.55 (t, J = 1.9 Hz, 1H), 7.44 (d, J =15.5 Hz, 1H), 7.10 (t, J = 4.6 Hz, 1H), 6.68 (s, 2H), 5.28 (s, 2H), 4.10 (t, J = 6.5 Hz, 2H), 3.81 (s, 6H), 2.58 (td, J = 6.4, 4.5 Hz, 2H).
[실험예 1: 일산화질소(NO) 생성억제]
본 발명에 따른 피페론구민계 화합물의 일산화질소(NO) 생성 억제능을 평가하였다.
본 실험예에서는, 일산화질소(NO)의 대사물인 아질산염(nitrite)의 양을 측정하는 그리스 시약(Sigma-Aldrich)을 이용하여 NO 생성 억제능을 평가하였다. 구체적으로, 96웰 플레이트에 Raw264.7 세포를 분주하고, 화합물 1 ~ 19의 각 화합물(1 μg/mL) 선 처리 2시간 후에 지질다당체(LPS, 1 μg/mL)를 처리하여 24시간 배양하였다. 반응이 종료된 배양액과 동량의 그리스 시약을 섞고 10분간 반응시킨 후 30분 내 분광광도계로 540 nm에서 흡광도를 측정하였다. 표준곡선을 구하기 위해 소디움 나이트레이트 (Promega)를 100 μM 농도부터 단계적으로 희석하여 사용하였다.
하기 도 1에서 나타난 바와 같이, 본 발명에 따른 피페론구민계 화합물 중 화합물 1, 3-6, 8-19의 경우 일산화질소 생성 세포주인 Raw264.7에서 유의적인 (p < 0.01-0.001) 일산화질소 생성 억제활성을 나타냈으며, 특히 화합물 3, 9-15, 18-19의 경우 현저히 우수한 NO 생성 억제 활성을 나타냈다.
[실험예 2: 항산화 효능_하이드록시 라디칼 소거]
본 발명에 따른 피페론구민계 화합물의 항산화 효능을 확인하기 위해서, 하기와 같은 하이드록시 라디칼 소거능을 평가하였다.
본 실험예에서는, 반응활성종(ROS)에 의한 손상으로부터 단백질이나 효소를 보호하는 항산화 물질의 효과를 금속이온 촉매반응을 통해 확인하는 우혈청 알부민(BSA, Sigma-Aldrich) 분해법을 사용하였다. 구체적으로, 목적 단백질인 BSA를 8 μg/mL 농도가 되도록 하고, 1차 반응으로서 Cu2+ (100 μM)와 H2O2 (2.5 mM)를 첨가하여 수산화라디칼을 생성하고 BSA와 화합물 1 ~ 19의 각 화합물(1 μg/mL)을 함께 혼합한 후 2차 반응을 수행하였다. 반응이 종료된 각 그룹을 10% 소디움 도데실설페이트(SDS)-폴리아크릴아마이드 겔에 전기영동하여 각 화합물에 의한 BSA 단백질분해 저해 수준을 확인한 후 그 결과를 하기 도 2에 나타내었다. 이때 양성대조군으로서 항산화 효과가 우수한 아스코르브산 (150 μM)를 사용하였다.
1차 반응 후 생성된 활성산소종(하이드록시 라디칼)에 의한 단백질 분해수준을 관찰한 결과, 활성산소종만 존재하는 군, 용매처리군과 피페론구민계 화합물 1, 3-4, 6-9, 11 처리군에서 단백질이 완전한 수준으로 파괴되어 활성산소종에 의한 단백질 보호능이 확인되지 않았다. 이에 비해, 본 발명에 따른 피페론구민계 화합물 2, 5, 10, 12-19의 경우, 항산화제인 아스코르브산과 동등 이상의 하이드록시 라디칼 소거능과 이로 인한 단백질 보호능이 관찰되었다(하기 도 2 참조).
[실험예 3: 염증성 사이토카인 억제 효능 평가]
염증성 사이토카인의 발현 억제를 다음과 같은 방법으로 확인하였다.
3-1: 염증성 사이토카인의 발현 억제 확인
사이토카인에 의한 과도한 신호는 다양한 질병을 유발하는 원인을 제공하는 것으로 알려져 있다. 따라서, 본 발명에 따른 화합물의 염증성 사이토카인 발현 억제를 하기와 같이 확인하였다.
먼저, 실험에 사용하기 위한 마우스 대식세포주 Raw264.7는 각각 10% 우 태아 혈청을 포함한 Dulbecco's Modified Eagle Medium(DMEM) 혹은 RPMI1640 배지를 사용하여 37℃, 5% CO2로 조정된 CO2 배양기에서 배양하였다. 세포가 90% 증식이 되었을 때 후술되는 실험에 사용하였으며, 세포주는 20 passage가 넘지 않도록 조절하였다. 상기와 같이 배양된 세포는 0.25% trypsin-EDTA로 부유시킨 후 혈구계산기로 세포 수를 산정하였으며, 유전자 발현 시험은 6-웰플레이트에 1.5×106 cells/well이 되도록 분주하여 2시간 동안 미리 배양한 후, 화합물 1~19을 LPS와 함께 처리하고 20시간 반응시켰다. 반응 후, 트리졸시약(Invitrogen)를 이용하여 배양된 Raw264.7 세포로부터 총 RNA를 추출하였다. 구체적으로, 트리졸시약 1 mL를 첨가하여 세포를 용해시키고 실온에서 5분 동안 방치한 후 클로로포름 200 μL를 첨가하여 13,500 rpm에서 15분 동안 원심분리 하였다. 투명한 상층액 500 μL을 취하여 새로운 튜브로 옮기고 동량의 이소프로필 알코올을 첨가한 후 13,500 rpm에서 10분 동안 원심분리 하여 RNA를 침강시켰다. 상기 RNA 침전물을 디에틸 피로카르보네이트(DEPC Sigma-Aldrich) 처리한 증류수로 희석된 70 % 에탄올 0.75 mL로 세척한 후 공기 중에서 건조시켜 역전사 샘플로 사용하였다. 1차 가닥 cDNA 합성은 추출된 총 RNA 1 μg을 사용하여 수행되었고, Improm-II reverse transcription system(Promega)과 oligo dT 프라이머를 사용하여 역전사 반응을 수행하였다. 또한 qPCR 분석은 Rotor-Gene 6000(Qiagen, CA, USA)을 사용하였으며, 표 1의 프라이머를 이용하여 유전자의 발현을 정량적으로 측정하였고 β-actin에 정상화시킨 상대 수치를 비교분석 하였다.
유전자 프라이머 염기서열 서열번호
β-actin forward 5´-TACAGCTTCACCACCACAGC 서열번호 1
reverse 5´-AAGGAAGGCTGGAAAAGAGC 서열번호 2
IL-1β forward 5'- AGCTGTGGCAGCTACCTGTG 서열번호 3
reverse 5'- GCTCTGCTTGTGAGGTGCTG 서열번호 4
IL-2 forward 5'-cacttcaagctccacttcaa 서열번호 5
reverse 5'-agtcaaatccagaacatgcc 서열번호 6
IL-4 forward 5'-cctccaagaacacaactgag 서열번호 7
reverse 5'-tccttcacaggacaggaatt 서열번호 8
IL-6 forward 5'-ttccatccagttgccttctt 서열번호 9
reverse 5'-gttgggagtggtatcctctg 서열번호 10
IL-10 forward 5'-acaataactgcacccacttc 서열번호 11
reverse 5'-ccactgccttgctcttattt 서열번호 12
IL-17a forward 5'-ctccagaatgtgaaggtcaa 서열번호 13
reverse 5'-aacagaattcatgtggtggt 서열번호 14
IFNγ forward 5'-TGAAAATCCTGCAGAGCCAG 서열번호 15
reverse 5'-TGGACCTGTGGGTTGTTGAC 서열번호 16
TNFα forward 5'-gattatggctcagggtccaa 서열번호 17
reverse 5'-gagacagaggcaacctgacc 서열번호 18
하기 도 3 내지 5에 나타난 바와 같이, 본 발명에 따른 피페론구민계 화합물 1, 3-6, 9-15, 17-19의 경우 사이토카인 IL-1β 유전자 발현 억제 활성을 나타냈으며, 화합물 1, 3-6, 9-19의 경우 IL-6 유전자 발현 억제 활성을 나타냈다. 또한 화합물 1, 3, 5-6, 9-16, 19의 경우 TNF-α 유전자 발현을 억제하여 효과적인 항염증 활성이 입증되었다.
3-2: T세포 의존형 사이토카인 유전자 발현 억제 확인
본 실험예에서는 Balb/c 마우스 비장세포를 분리하여 생체 외(Ex-vivo) 조건에서 T세포 의존형 사이토카인, 예컨대 Th1 사이토카인(IL-2, IFNγ), Th2 사이토카인(IL-4, IL-10) 및 Th17 사이토카인(IL-17a) 유전자 발현 분석을 통해 피페론구민계 화합물 1~19의 면역세포 활성억제능을 확인하였다. T세포 의존성 자극을 유도하고자, CD3 단일클론항체를 Balb/c 마우스 비장세포에 처리하여 T세포수용체 복합체를 자극하고 T세포를 활성화시켰으며, 이와 동일한 조건 하에서 피페론구민계 화합물 1~19의 T 세포 활성 억제능을 상기 실험예 3-1과 동일한 방법으로 분석하고 그 결과를 하기 도 6 내지 10에 각각 나타내었다.
도 6 내지 7은 T세포 의존성 사이토카인 중 Th1 사이토카인 유래 IL-2 및 IFNγ 유전자 발현 억제 그래프이다. 도 6에 나타난 바와 같이, 본 발명의 피페론구민계 화합물 1-11, 13-16이 IL-2 유전자 발현 억제 활성을 나타냈으며, 특히 화합물 1, 3 및 9의 경우 비교물질인 사이클로스포린(CsA, 면역 억제제)과 동등 이상 유의한 수준의 IL-2 유전자 발현 억제 활성이 관찰되었다.
또한 도 7에 나타난 바와 같이, 본 발명의 피페론구민계 화합물 1-6, 8-19의 경우 Th1 유래 IFNγ에 대한 발현 억제능을 나타냈으며, 특히 화합물 1, 3-5, 9, 12, 및 14의 경우 매우 높은 억제능을 나타냈다.
도 8 내지 9은 T세포 의존성 사이토카인 중 Th2 유래 사이토카인인 IL-4과 IL-10 유전자 발현 억제 그래프이다. 도 8에 나타난 바와 같이, 본 발명의 피페론구민계 화합물 1-6, 8-18의 경우 IL-4 유전자 발현 억제 활성을 나타냈으며, 특히 화합물 1, 3, 9 및 11의 경우 비교물질인 사이클로스포린(CsA, 면역 억제제)과 동등 이상의 IL-4 유전자 발현 억제 활성이 입증되었다.
또한 도 9에 나타난 바와 같이, 본 발명의 피페론구민계 화합물 1-6, 8-19의 경우 IL-10의 발현을 유의적으로 억제하였다.
아울러 도 10은 T세포 의존성 사이토카인 중 Th17 유래 사이토카인인 IL-17a 유전자 발현 억제 그래프이다. 도 10에 나타난 바와 같이, 본 발명의 피페론구민계 화합물 1-10, 12-19는 IL-17a 유전자 발현 억제 활성을 나타냈으며, 특히 화합물 1, 3-5, 9 및 14-15에서 보다 우수한 활성이 관찰되었다. 특히 본 발명의 피페론구민계 화합물 1은 비교군인 사이클로스포린(CSA, 면역 억제제)에 비해 우수한 IL-17a 발현 억제 활성을 나타냈을 뿐만 아니라, IL-2 및 IL-4와 달리 화합물 3 및 9 대비 각각 적어도 6배 및 3배 이상의 높은 유전자 발현 억제 활성을 나타냈다.
전술한 결과를 통해, 본 발명의 피페론구민계 화합물, 특히 화합물 1, 3 및 9는 IL-2, IL-4 및 IFNγ를 효과적으로 억제하는 신규한 화합물로 판단된다. 특히, 화합물 7을 제외한 본 발명의 모든 피페론구민계 화합물이, Th2(보조 T-2 세포)에 의해 과발현되는 IL-10 제어 활성이 있으며, 또한 사이토카인 IL-23의 축을 돕는 IL-17a의 효과적인 억제를 통해 면역조절제로서의 가능성을 충분히 확인할 수 있었다.
[실험예 4: 면역세포 신호전달 억제 활성 평가]
면역조절과 관련된 유전자의 세포내 신호전달 및 과활성 억제능을 확인하기 위해 하기와 같이 리포터유전자 발현 분석시스템을 이용하여 분석하였다.
본 실험예에서는 InVivoGen사로부터 THP1-Lucia NF-κB, HEK-Lucia RIG-1, HEK-Blue-IL-4/IL-13 및 HEK-Blue IL-10 세포주를 구입하여 면역세포 신호전달에 대한 억제활성을 평가하였으며, 분석은 제조사의 분석법에 따라 수행하였다. 구체적으로, 상기 4종류의 세포주에 각 시험물질인 피페론구민계 화합물 1 내지 19를 처리한 후 프로모터의 자극물질(LPS, 3p-hpRNA, 인터루킨-4 및 인터루킨-10)로 각각 처리하였으며, 지침에 따른 반응유도 후 활성 억제능을 분석하였다. 그 결과를 하기 도 11 내지 14에 각각 나타내었다.
도 11은 NF-κB 활성을 위해 지질다당체(LPS)로 자극한 세포에 피페론구민계 화합물을 처리한 후, 각 화합물의 NF-κB 신호전달 경로 조절여부를 분석한 그래프이다. 하기 도 11에 나타난 바와 같이, 본 발명의 피페론구민계 화합물 1, 3-6, 9-17, 및 19의 경우 NF-κB 활성 저해 효과가 관찰되었으며, 특히 화합물 1, 3 및 9는 매우 높은 NF-κB 활성 저해능을 확인하였다.
또한 도 12는 HEK RIG1 시스템을 통해 피페론구민계 화합물의 RIG1 활성 저해 여부를 분석한 그래프이다.
하기 도 12에 나타난 바와 같이, 본 발명의 피페론구민계 화합물 1-5, 8-15, 및 19의 경우 RIG1 활성 저해 효과를 나타냈으며, 특히 화합물 1, 3, 9 및 10은 매우 높은 RIG1 활성 저해능이 확인되었다.
또한 도 13은 HEK Blue IL-10 시스템을 통해 피페론구민계 화합물의 STAT3 신호경로 조절 여부를 분석한 그래프이다.
STAT3는 세포질에서 사이토카인 자극 후 핵 내부로 신호를 전달하는 중요한 전사인자이다. 도 13에 나타난 바와 같이, 본 발명의 피페론구민계 화합물 1, 3-6, 8-16, 및 19의 경우 STAT3 활성 저해 효과를 나타냈으며, 특히 화합물 1, 3, 9-10, 12-13, 및 16은 매우 높은 STAT3 활성 저해능을 확인하였다.
또한 도 14는 HEK Blue IL4/IL-13 시스템을 통해 피페론구민계 화합물의 STAT6 신호경로 조절 여부를 분석한 그래프이다. STAT6는 외부로부터 들어오는 신호에 의해 다양한 사이토카인, 호르몬 및 성장인자 발현 조절역할을 하는 전사인자이다. 또한 IL-4/IL-13 및 STAT6는 Th2의 중요한 조절자이다. 하기 도 14에 나타난 바와 같이, 본 발명의 피페론구민계 화합물 1, 3-5, 9-10, 12-13, 및 16의 경우 STAT6 활성 저해 효과를 나타냈으며, 특히 화합물 1, 3, 12-13, 및 16은 매우 높은 STAT6 활성 저해능이 확인되었다.
전술한 결과들을 통해, 본 발명의 신규 피페론구민계 화합물은 NF-κB, RIG1, STAT3, STAT6 등의 면역세포 신호전달에 대한 억제 활성이 우수하다는 것을 알 수 있으며, 이에 따라 상기 피페론구민계 화합물은 면역조절제로서 유용하게 적용될 수 있다는 것을 확인할 수 있었다.

Claims (9)

  1. 하기 화학식 1로 표시되는 화합물, 이의 약학적으로 허용 가능한 염, 또는 용매화물:
    [화학식 1]
    Figure PCTKR2021016597-appb-img-000028
    상기 화학식 1에서,
    R2 내지 R4는 서로 동일하거나 또는 상이하며, 각각 독립적으로 수소, 중수소, 할로겐, 니트로기, 히드록시기, 아미노기, C1~C40의 알킬기, C2~C40의 알케닐기, C2~C40의 알키닐기, C3~C40의 시클로알킬기, 핵원자수 3 내지 40개의 헤테로시클로알킬기, C1~C20의 알콕시기, C1~C20의 케톤기, C1~C20의 에스터기, C6~C20의 아릴기, 핵원자수 5 내지 20의 헤테로아릴기, 및 C6~C20의 아릴옥시기로 이루어진 군에서 선택되거나, 또는 이들이 인접한 기와 결합하여 C6-C20의 아릴 또는 핵원자수 5 내지 20의 헤테로아릴 고리를 형성할 수 있으며, 다만 R2 내지 R4가 동일한 경우는 제외되며,
    R1은 하기 구조식에서 선택되는 치환기이며,
    Figure PCTKR2021016597-appb-img-000029
    상기 식에서,
    X는 F, Cl, Br 및 I로 이루어진 군에서 선택되는 할로겐 원소이며,
    Y는 C1~C10의 알킬기이며,
    상기 R2~R4의 알킬기, 케톤기, 에스터기, 아릴기, 헤테로아릴기는 각각 독립적으로 중수소, 할로겐, 시아노기, 니트로기, C1~C40의 알킬기, C2~C40의 알케닐기, C2~C40의 알키닐기, C6~C40의 아릴기, 핵원자수 5 내지 40의 헤테로아릴기, C6~C40의 아릴옥시기, C1~C40의 알킬옥시기, C6~C40의 아릴아민기, C3~C40의 시클로알킬기, 핵원자수 3 내지 40의 헤테로시클로알킬기, C1~C40의 알킬실릴기, C1~C40의 알킬보론기, C6~C40의 아릴보론기, C6~C40의 아릴포스핀기, C6~C40의 아릴포스핀옥사이드기 및 C6~C40의 아릴실릴기로 이루어진 군에서 선택된 1종 이상의 치환기로 치환될 수 있으며, 이때 상기 치환기가 복수인 경우, 이들은 서로 동일하거나 상이할 수 있다.
  2. 제1항에 있어서,
    R1은 하기 구조식에서 선택되는 치환기를 갖는 화합물, 이의 약학적으로 허용 가능한 염, 또는 용매화물:
    Figure PCTKR2021016597-appb-img-000030
  3. 제1항에 있어서,
    상기 화학식 1로 표시되는 화합물은 하기 화학식 2 내지 화학식 5 중 어느 하나로 표시되는 화합물, 이의 약학적으로 허용 가능한 염, 또는 용매화물:
    [화학식 2]
    Figure PCTKR2021016597-appb-img-000031
    [화학식 3]
    Figure PCTKR2021016597-appb-img-000032
    [화학식 4]
    Figure PCTKR2021016597-appb-img-000033
    [화학식 5]
    Figure PCTKR2021016597-appb-img-000034
    상기 화학식 2 내지 5에서,
    R1은 제1항에서 정의된 바와 같으며,
    R5 내지 R7는 서로 동일하거나 또는 상이하며, 각각 독립적으로 수소, 히드록시기, C1~C6의 알킬기, C1~C6의 알콕시기, C1~C6의 케톤기, 및 C1~C6의 에스터기로 이루어진 군에서 선택되며,
    환 A는 탄소수 20 이하의 사이클로알킬환, 헤테로사이클로알킬환, 아릴환 및 헤테로아릴환으로 이루어진 군에서 선택되며,
    상기 환 A는 중수소, 할로겐, 시아노기, 니트로기, C1~C40의 알킬기, C6~C40의 아릴기, 및 핵원자수 5 내지 40의 헤테로아릴기로 이루어진 군에서 선택된 1종 이상의 치환기로 치환될 수 있다.
  4. 제1항에 있어서,
    상기 화학식 1로 표시되는 화합물은 하기 화학식으로 표시되는 화합물 군에서 선택되는 화합물, 이의 약학적으로 허용 가능한 염, 또는 용매화물.
    Figure PCTKR2021016597-appb-img-000035
    Figure PCTKR2021016597-appb-img-000036
  5. 제1항 내지 제4항 중 어느 한 항에 기재된 화합물, 이의 약학적으로 허용 가능한 염, 또는 용매화물을 유효성분으로 포함하는 면역조절제.
  6. 제5항에 있어서,
    상기 면역조절제는 면역 반응을 억제하는 것인, 면역조절제.
  7. 제1항 내지 제4항 중 어느 한 항에 기재된 화합물, 이의 약학적으로 허용 가능한 염, 또는 용매화물을 유효성분으로 포함하는 면역조절용 건강기능식품.
  8. 제1항 내지 제4항 중 어느 한 항에 기재된 화합물, 이의 약학적으로 허용 가능한 염, 또는 용매화물을 개체에 투여하는 단계를 포함하는 면역조절 방법.
  9. 면역조절을 위한 약제의 제조에 사용하기 위한 제1항 내지 제4항 중 어느 한 항에 기재된 화합물, 이의 약학적으로 허용 가능한 염, 또는 용매화물의 용도.
PCT/KR2021/016597 2020-12-29 2021-11-15 피페론구민계 화합물 및 이를 포함하는 면역조절제 WO2022145707A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20200185404 2020-12-29
KR10-2020-0185404 2020-12-29
KR10-2021-0128774 2021-09-29
KR1020210128774A KR20220095094A (ko) 2020-12-29 2021-09-29 피페론구민계 화합물 및 이를 포함하는 면역조절제

Publications (1)

Publication Number Publication Date
WO2022145707A1 true WO2022145707A1 (ko) 2022-07-07

Family

ID=78617238

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/016597 WO2022145707A1 (ko) 2020-12-29 2021-11-15 피페론구민계 화합물 및 이를 포함하는 면역조절제

Country Status (5)

Country Link
US (1) US11878971B2 (ko)
EP (1) EP4023301A3 (ko)
JP (1) JP2022104792A (ko)
CN (1) CN114685361A (ko)
WO (1) WO2022145707A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116969927B (zh) * 2023-06-07 2024-03-19 中南民族大学 一种从荜茇中提取分离的化合物及该化合物在制备抗炎药物中的应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5753691A (en) * 1994-12-26 1998-05-19 Nisshin Flour Milling Co., Ltd. Agents for inhibiting the production of IL-1β and the release of TNFα
WO2008026125A2 (en) * 2006-09-01 2008-03-06 Piramal Life Sciences Limited Anti cancer use of caffeic acid and derivatives
US20200377510A1 (en) * 2019-05-30 2020-12-03 Auransa Inc. Derivatives of piperlongumine and uses thereof

Family Cites Families (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS61245900A (ja) * 1985-04-22 1986-11-01 Taki Chem Co Ltd メタン醗酵促進剤
JPS61246105A (ja) * 1985-04-23 1986-11-01 Taki Chem Co Ltd 植物生長調節剤
IT1231921B (it) * 1989-06-12 1992-01-15 Sigma Tau Ind Farmaceuti 1-acil-2-pirrolidoni quali attivatori dei processi di apprendimento e della memoria e composizioni farmaceutiche comprendenti tali composti
JP3828603B2 (ja) * 1994-12-26 2006-10-04 株式会社日清製粉グループ本社 ピロリジノン誘導体を含有する医薬組成物
KR100767701B1 (ko) 2004-04-24 2007-10-18 김상희 모노아세틸디아실글리세롤류 화합물을 유효성분으로 함유하는 면역조절제 및 항암제
US7507748B2 (en) * 2004-07-22 2009-03-24 Amgen Inc. Substituted aryl-amine derivatives and methods of use
CN102146054A (zh) * 2010-02-10 2011-08-10 新昌县来益科技开发有限公司 荜茇酰胺衍生物及其药物组合物和在制备抑制肿瘤生长的药物中的用途
US9108923B2 (en) * 2012-07-20 2015-08-18 Howard Hughes Medical Institute Compounds, compositions, and methods for cancer therapy
WO2015048567A1 (en) 2013-09-26 2015-04-02 Sanford-Burnham Medical Research Institute Spirocyclic ebi2 modulators
WO2015051230A1 (en) 2013-10-04 2015-04-09 Drexel University Novel compositions useful for inhibiting hiv-1 infection and methods using same
WO2015188136A1 (en) * 2014-06-06 2015-12-10 Board Of Trustees Of Michigan State University Compounds for inhibition of fungal toxin production
KR101633655B1 (ko) * 2014-09-01 2016-06-27 한림대학교 산학협력단 피페론구민과 그 유도체 및 그 합성방법
WO2019221755A1 (en) * 2018-05-18 2019-11-21 Bioventures, Llc Piperlongumine analogues and uses thereof
CN115403511B (zh) * 2021-08-03 2024-01-26 河南省儿童医院郑州儿童医院 荜茇酰胺类似物、药物组合物及其制备方法和应用

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5753691A (en) * 1994-12-26 1998-05-19 Nisshin Flour Milling Co., Ltd. Agents for inhibiting the production of IL-1β and the release of TNFα
WO2008026125A2 (en) * 2006-09-01 2008-03-06 Piramal Life Sciences Limited Anti cancer use of caffeic acid and derivatives
US20200377510A1 (en) * 2019-05-30 2020-12-03 Auransa Inc. Derivatives of piperlongumine and uses thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LIANG JIE, ZIEGLER JACQUELINE D., JAHRAUS BEATE, ORLIK CHRISTIAN, BLATNIK RENATA, BLANK NORBERT, NIESLER BEATE, WABNITZ GUIDO, RUP: "Piperlongumine Acts as an Immunosuppressant by Exerting Prooxidative Effects in Human T Cells Resulting in Diminished TH17 but Enhanced Treg Differentiation", FRONTIERS IN IMMUNOLOGY, vol. 11, 1 January 2020 (2020-01-01), pages 1172, XP055948982, DOI: 10.3389/fimmu.2020.01172 *
LIU XINGUI, WANG YINGYING, ZHANG XUAN, GAO ZHENGYA, ZHANG SUPING, SHI PEIZHONG, ZHANG XIN, SONG LIN, HENDRICKSON HOWARD, ZHOU DAOH: "Senolytic activity of piperlongumine analogues: Synthesis and biological evaluation", BIOORGANIC, ELSEVIER, AMSTERDAM, NL, vol. 26, no. 14, 1 August 2018 (2018-08-01), AMSTERDAM, NL, pages 3925 - 3938, XP055946477, ISSN: 0968-0896, DOI: 10.1016/j.bmc.2018.06.013 *

Also Published As

Publication number Publication date
JP2022104792A (ja) 2022-07-11
US11878971B2 (en) 2024-01-23
US20220213080A1 (en) 2022-07-07
EP4023301A2 (en) 2022-07-06
CN114685361A (zh) 2022-07-01
EP4023301A3 (en) 2022-09-07

Similar Documents

Publication Publication Date Title
WO2017026718A1 (ko) Ret 키나아제 저해제인 신규 3-(이속사졸-3-일)-피라졸로[3,4-디]피리미딘-4-아민 화합물
WO2020171606A1 (ko) 신규한 헤테로트리시클릭 유도체 화합물 및 이의 용도
WO2022145707A1 (ko) 피페론구민계 화합물 및 이를 포함하는 면역조절제
WO2011159137A2 (ko) 신규한 티오우레아 또는 우레아 유도체, 이의 제조방법 및 이를 유효성분으로 함유하는 ａｉｄｓ 예방 또는 치료용 약학 조성물
WO2016032209A2 (ko) 야누스인산화효소 억제제로서의 치환된 n-(피롤리딘-3-일)-7h-피롤로[2,3-d]피리미딘-4-아민
WO2023195791A1 (ko) 신규한 크로마논 화합물을 유효성분으로 포함하는 다발성골수종의 예방 또는 치료용 조성물
AU2017256488B2 (en) Quinazoline derivative or its salt and pharmaceutical composition comprising the same
WO2017034245A1 (ko) 야누스 키나제 1 선택적 억제제 및 그 의약 용도
WO2018151562A2 (ko) Jnk 저해 활성을 갖는 신규한 벤즈이미다졸 유도체 및 이의 용도
WO2012148140A2 (ko) 혈관 신생 억제 및 항산화 효과를 가지는 이미다졸계 알칼로이드 유도체 및 이의 제조방법
WO2017131425A1 (ko) Jnk 저해 활성을 갖는 신규한 이미다졸 유도체 및 이의 용도
WO2023018237A1 (en) Novel plk1 degradation inducing compound
WO2022177313A1 (ko) 세스퀴테르펜 유도체 또는 이의 약학적으로 허용가능한 염 및 이의 용도
WO2023055020A1 (ko) 피페론구민계 화합물을 유효성분으로 포함하는 혈관질환 예방 또는 치료용 약학적 조성물
WO2022145923A1 (ko) 피페론구민계 화합물을 유효성분으로 포함하는 바이러스 감염증의 예방 또는 치료용 약학적 조성물
WO2021066573A1 (ko) 신규 화합물 및 이의 자가면역질환 치료 용도
WO2020040326A1 (ko) 페닐아세트산 유도체 및 이를 유효성분으로 함유하는 자가면역질환 예방 또는 치료용 조성물
WO2016144087A1 (ko) Ｎ-페닐-ｎ&#39;-페녹시카르보닐-페닐설폰하이드라자이드 유도체 및 그를 포함하는 약제학적 조성물
WO2019231262A1 (ko) 신규 바이페닐 유도체 화합물 및 이의 용도
WO2023013996A1 (ko) 인돌 유도체, 이의 제조방법 및 약학적 용도
WO2023075016A1 (ko) 신규 화합물 및 이를 유효성분으로 포함하는 신경염증성 뇌질환 예방 또는 치료용 조성물
WO2023277656A1 (ko) 벤조피란 유도체 및 이의 용도
WO2023195807A1 (ko) 돌연변이형 ron 저해제 및 항-pd-1 항체를 포함하는 암 치료용 약학 조성물
WO2023132606A1 (ko) 캐스파제 저해제로서의 신규한 이소인돌리논 유도체 화합물
WO2023043197A1 (ko) 신규한 카나비디올 유도체, 이의 제조방법 및 이를 포함하는 인지기능 개선용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21915505

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21915505

Country of ref document: EP

Kind code of ref document: A1