WO2021256751A1 - 섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 피부 및 점막 창상 치료용 조성물 - Google Patents

섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 피부 및 점막 창상 치료용 조성물 Download PDF

Info

Publication number
WO2021256751A1
WO2021256751A1 PCT/KR2021/006992 KR2021006992W WO2021256751A1 WO 2021256751 A1 WO2021256751 A1 WO 2021256751A1 KR 2021006992 W KR2021006992 W KR 2021006992W WO 2021256751 A1 WO2021256751 A1 WO 2021256751A1
Authority
WO
WIPO (PCT)
Prior art keywords
skin
wounds
fibroblast
extracellular vesicles
wound
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2021/006992
Other languages
English (en)
French (fr)
Inventor
안병철
정호윤
간가다란프라카시
오은정
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Industry Academic Cooperation Foundation of KNU
Original Assignee
Industry Academic Cooperation Foundation of KNU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Industry Academic Cooperation Foundation of KNU filed Critical Industry Academic Cooperation Foundation of KNU
Publication of WO2021256751A1 publication Critical patent/WO2021256751A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/33—Fibroblasts
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/48—Other medical applications
    • A61B5/4848—Monitoring or testing the effects of treatment, e.g. of medication
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L26/00—Chemical aspects of, or use of materials for, wound dressings or bandages in liquid, gel or powder form
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L26/00—Chemical aspects of, or use of materials for, wound dressings or bandages in liquid, gel or powder form
    • A61L26/0057—Ingredients of undetermined constitution or reaction products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L26/00—Chemical aspects of, or use of materials for, wound dressings or bandages in liquid, gel or powder form
    • A61L26/0061—Use of materials characterised by their function or physical properties
    • A61L26/0066—Medicaments; Biocides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L26/00—Chemical aspects of, or use of materials for, wound dressings or bandages in liquid, gel or powder form
    • A61L26/0061—Use of materials characterised by their function or physical properties
    • A61L26/0085—Porous materials, e.g. foams or sponges
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like

Definitions

  • the present invention is a technology for providing a composition containing fibroblast-derived extracellular vesicles as an active ingredient as a therapeutic agent for skin and mucosal wounds.
  • the skin acts as a barrier to protect the body and is the body's first line of defense against disease, and the epidermis provides a barrier against microbial invasion. Therefore, the primary objective in the treatment of wounds, burns, abrasions and other damage to the skin is rapid closure and wound healing to prevent infection.
  • the mucous membrane acts as a protective barrier for organs, similar to skin tissue in the nasal cavity, etc., and damage to the mucous membrane also requires rapid healing.
  • wound healing is generally a complex process involving three stages: inflammation, proliferation, and remodeling.
  • the first step involves clotting to achieve haemostasis, followed by replenishment of neutrophils to destroy bacteria and necrotic tissue, followed by replenishment of macrophages.
  • angiogenesis occurs, during which endothelial cells migrate to the wound site, while at the same time fibroblasts migrate to the wound site, helping to produce granulation tissue.
  • the formation of granulation tissue allows reepithelialisation to occur.
  • the levels of collagen production and destruction are equalized, and the healed wound is slowly altered to achieve maximum strength. Wound healing can become chronic when any one of these processes does not function properly in a timely manner, as it is delayed or impaired.
  • EVs extracellular vesicles
  • the extracellular endoplasmic reticulum enables the exchange of substances (protein, lipid, genetic material) between cells and functions as a physiological/pathological signal transduction medium.
  • Exosomes are 50-150 nm in size and are intraluminal vesicles generated by the endosomal membrane entering in the process of maturation of multi-vesicular endosomes. It is secreted upon binding.
  • Microvesicles are 50-1000 nm in size, and are vesicles from which the plasma membrane protrudes and separates and is secreted out of the cell.
  • Each cell produces an extracellular ER differently according to the physiological state and secretes an extracellular ER with specific lipid, protein, and nucleic acid composition, and the specific composition of the ER determines the function and fate of the extracellular ER.
  • These extracellular vesicles are secreted out of the cell and then move to the target cell to deliver the contents, thereby inducing a response and facilitating a change in the physiological/pathological state.
  • Extracellular ER-mediated information exchange between cells activates surface receptors on the plasma membrane and occurs through signal transduction followed by uptake of extracellular ER or binding to target cells. These processes are complex and influenced by the origin of the extracellular ER, the type and origin of the target cell.
  • CVD Cardiovascular disease
  • the present invention relates to a composition containing fibroblast-derived extracellular vesicles as an active ingredient, and to provide a therapeutic agent for skin and mucosal wounds that can be applied topically to acute and chronic wounds to provide a rapid therapeutic effect.
  • the present invention provides a pharmaceutical composition for the treatment of skin and mucosal wounds containing fibroblast-derived extracellular vesicles as an active ingredient.
  • the present invention provides an external composition for skin and mucous membrane regeneration or damage recovery containing fibroblast-derived extracellular vesicles as an active ingredient.
  • the present invention comprises the steps of administering an extracellular vesicle inducer to the skin and mucosal wounds; And it provides a method for improving or treating skin wounds, comprising the step of the inducer promoting the secretion of fibroblast-derived extracellular vesicles in the skin and mucosal wounds.
  • the present invention comprises the steps of treating candidate substances to fibroblasts isolated from individuals other than humans; confirming the level of extracellular vesicles secreted from the fibroblasts treated with the candidate substance; And it provides a wound treatment screening method comprising the step of selecting a candidate substance that increases the secretion of the extracellular vesicles from the fibroblasts compared to the control sample.
  • the fibroblast-derived extracellular vesicles are effectively internalized in endothelial cells and fibroblasts, thereby increasing cell migration to the wound site and inducing collagen deposition and maturation to effectively promote wound healing in the skin wound area,
  • the composition containing the fibroblast-derived extracellular vesicles as an active ingredient not only provides skin, but also mucosal wounds with similar biological properties. It may be provided as a therapeutic agent.
  • FIG. 1 is a result of confirming the characteristics of L929-EV
  • FIG. 1A is an immunofluorescence analysis result of ⁇ SMA in fibroblasts (scale bar: 20 ⁇ m)
  • FIG. 1B is a process for isolating the endoplasmic reticulum from fibroblasts (L929)
  • 1C is a result of confirming the morphology of L929-EV through a transmission electron microscope (scale bar: 500 and 200 nm)
  • FIG. 1D is L929 cells and L929- using anti-CD63 and anti-GM130 antibodies. This is the result of Western blot analysis of EVs.
  • L929-EVsDiD DiD-labeled L929-EVs
  • FIG. 3 is a result of confirming the effect of improving the proliferation and migration of fibroblasts through L929-EV treatment.
  • Figure 3B is a phase contrast microscopic analysis result confirming the wound closure level 0, 18 and 36 hours after 0, 20 or 40 ⁇ g / ml L929-EVs (50 ⁇ m) treatment
  • Figure 3C is ZEN 2.3
  • 4A to 4C are results confirming that L929-EV treatment increases the expression of genes related to scar-free wound treatment in fibroblasts, and histograms, respectively, show 20 and 40 ⁇ g/ml L929-EV 24 hours after treatment.
  • the mean and standard deviation of each experiment are indicated. *p ⁇ 0.05; **p ⁇ 0.01. Student-t-test was used.
  • L929-EVsDiD DiD-labeled L929-EVs
  • Figure 6 is the result of confirming the effect of L929-EV treatment to promote the migration and tube formation of endothelial cells
  • 6B is a phase-contrast microscopic image of endothelial cells cultured on a matrigel-coated plate using a medium containing 0, 15 or 30 ⁇ g/ml L929-EVs (scale bar: 200 pixels; * indicates the number of closed structures in the field), and the mean and standard deviation of each experiment are indicated. *p ⁇ 0.01; **p ⁇ 0.001. Student-t-test was used.
  • FIG. 7 is a schematic diagram of an experimental process confirming the wound establishment and wound healing effect using a mouse
  • FIG. 7A is a schematic diagram of an in vivo treatment experiment
  • FIG. 7B is a process of creating a wound and attaching a silicone ring to the skin such as a mouse is shown
  • FIG. 7C is a schematic diagram showing the step-by-step experimental process in the in vivo treatment experiment.
  • FIG. 8 is a result of confirming the wound healing effect of fibrin glue and L929-EV treatment in mice. It is the confirmed representative image result, and FIG. 8B is the result of confirming the percentage of exposed wounds of the control group, FG and FG+L929-EV-treated mice, and the mean and standard deviation of each experiment are displayed. *p ⁇ 0.05; **p ⁇ 0.01; ***p ⁇ 0.001. Student-t-test was used.
  • FIG. 9 is a result of confirming the effect of the skin structure, collagen deposition and maturation of the wound by fibrin glue and L929-EV treatment.
  • the results of H&E staining of the wounds are shown, and
  • FIG. 9B shows the results of Masson's trichome staining of the wounds of the control group, FG and FG+L929-EV treated groups on days 4, 8 and 14.
  • Figure 10 is a result of confirming the effect of increasing the VEGF level by fibrin glue and L929-EV treatment, the control group, FG and FG + L929-EV treated western blot analysis with anti-VEGF on days 4, 8 and 14 in the wound area.
  • ⁇ -actin was used as a loading control.
  • FIG. 11 is a result confirming the effect of fibrin glue and L929-EV treatment to promote angiogenesis and hair at the wound site. It is the result of performing CD31 (IHC) staining on day 4, and FIG. 11B is the result of performing ⁇ -catechin (IHC) staining on days 4, 8, and 14 in the control, FG and FG+L929-EV-treated wounds.
  • MSC mesenchymal stem cell
  • Fibroblasts are one of the main cells for skin wound healing. While mesenchymal stem cells do not exist in the actual skin, fibroblasts are predominant, so fibroblasts are derived from wounded skin rather than conventional mesenchymal stem cell-derived extracellular vesicles. Extracellular vesicles can exhibit high yields. Accordingly, the inventors of the present invention intend to provide fibroblast-derived extracellular vesicles as an alternative to new skin wound treatment agents that can replace conventional mesenchymal stem cell-derived extracellular vesicles.
  • the present invention can provide a pharmaceutical composition for treating skin and mucosal wounds containing fibroblast-derived extracellular vesicles as an active ingredient.
  • the wound may be one selected from the group consisting of burns, lacerations, epidermal wounds, ulcers, trauma, post-surgical, childbirth, chronic wounds, and damage caused by dermatitis. not limited
  • the pharmaceutical composition may further include a scaffold (scaffold).
  • the scaffold may be one or a combination of two or more selected from the group consisting of fibrin glue, chitosan, alginic acid, elastin, hyaluronic acid, collagen, proteoglycan and hydrogel, and more preferably fibrin glue. However, it is not limited thereto.
  • the fibroblast-derived extracellular vesicles may increase the movement of cells to the skin and mucous membrane wounds, and induce collagen deposition and maturation to restore the skin and mucosal wounds.
  • the pharmaceutical composition for the treatment of skin wounds containing the fibroblast-derived extracellular vesicles as an active ingredient is prepared by injection, granule, powder, tablet, pill, capsule, suppository, gel, Any one formulation selected from the group consisting of suspensions, emulsions, drops or solutions may be used.
  • the pharmaceutical composition is a suitable carrier, excipient, disintegrant, sweetener, coating agent, swelling agent, lubricant, flavoring agent, antioxidant, buffer, bacteriostatic agent, diluent commonly used in the preparation of pharmaceutical compositions.
  • carriers, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline Cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil can be used, and solid preparations for oral administration include tablets, pills, powders, granules, and capsules.
  • the solid preparation may be prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, and the like in the composition.
  • excipients for example, starch, calcium carbonate, sucrose or lactose, gelatin, and the like
  • lubricants such as magnesium stearate and talc can also be used.
  • Liquid preparations for oral use include suspensions, solutions, emulsions, syrups, and the like, and various excipients such as wetting agents, sweeteners, fragrances, preservatives, etc. may be included in addition to commonly used simple diluents such as water and liquid paraffin.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, suppositories, and the like.
  • Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • As a base material for the suppository witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like can be used.
  • the pharmaceutical composition is administered in a conventional manner via intravenous, intraarterial, intraperitoneal, intramuscular, intrasternal, transdermal, intranasal, inhalational, topical, rectal, oral, intraocular or intradermal routes. can be administered to the subject.
  • the preferred dosage of the fibroblast-derived extracellular vesicles may vary depending on the condition and weight of the subject, the type and extent of the disease, the drug form, the route and duration of administration, and may be appropriately selected by those skilled in the art.
  • the daily dose may be 0.01 to 200 mg/kg, specifically 0.1 to 200 mg/kg, and more specifically 0.1 to 100 mg/kg.
  • Administration may be administered once a day or may be administered in several divided doses, thereby not limiting the scope of the present invention.
  • the 'subject' may be a mammal including a human, but is not limited to these examples.
  • the present invention can provide an external composition for regeneration or damage recovery of skin and mucous membranes containing fibroblast-derived extracellular vesicles as an active ingredient.
  • composition for topical application may be for topical application to the skin, but is not limited thereto.
  • the external preparation may be selected from the group consisting of an ointment, a cream, a lotion, a liquid, a dressing, a patch, a blister, a tape, an aerosol, an external acid, and a spray.
  • the present invention comprises the steps of administering an extracellular vesicle inducer to the skin and mucosal wounds; And the inducer may provide a method for improving or treating skin and mucosal wounds, comprising the step of promoting the secretion of fibroblast-derived extracellular vesicles at the site of skin and mucosal wounds.
  • the extracellular vesicle inducer is TGF- ⁇ , CD40, an IL-4 receptor activator, hexadecylglycerol, a lysosomal inhibitor chloroquine, a group consisting of Bafilomycin A and a SIRT1 inhibitor.
  • TGF- ⁇ TGF- ⁇
  • CD40 CD40
  • an IL-4 receptor activator hexadecylglycerol
  • a lysosomal inhibitor chloroquine a group consisting of Bafilomycin A and a SIRT1 inhibitor.
  • the present invention comprises the steps of treating candidate substances to fibroblasts isolated from individuals other than humans; confirming the level of extracellular vesicles secreted from the fibroblasts treated with the candidate substance; And it can provide a wound treatment screening method comprising the step of selecting a candidate substance that increases the secretion of the extracellular vesicles from the fibroblasts compared to the control sample.
  • the mouse fibroblast line L929 (L cell, L-929, derivative of Strain L) was prepared by Dr. It was provided by Yong Hyun Jeon (Daegu-Gyeongbuk Medical Innovation Foundation, Daegu, Republic of Korea), and the mouse endothelial cell line SVEC4-10EHR1 was purchased from the American Type Culture Collection (Manassas, VA, USA).
  • L929 and SVEC4 cells were treated with DMEM-high glucose (HyClone, Logan, UT, USA) containing 10% fetal bovine serum (FBS; HyClone) and 1% penicillin-streptomycin (Gibco, Carlsbad, CA, USA). ) was used and cultured at 37° C. and 5% CO 2 conditions.
  • DMEM-high glucose HyClone, Logan, UT, USA
  • FBS fetal bovine serum
  • penicillin-streptomycin Gibco, Carlsbad, CA, USA
  • L929 cells (5 ⁇ 10 3 ) were seeded on 4-well chamber slides and maintained overnight in a CO 2 incubator. Cells were blocked with 3% BSA for 45 min. Probe the cells with anti- ⁇ -SMA antibody overnight at 4°C and wash the cells twice with PBS for 10 min before coat anti-rabbit fluorescein isothiocyanate (FITC; Abcam, Cambridge, United Kingdom) secondary antibody was stained with Chamber slides were mounted and sealed using VECTASHIELD Antifade mounting medium (Vector Laboratories, CA, USA).
  • FITC fluorescein isothiocyanate
  • the immunofluorescence-stained sections were imaged with a high-sensitivity super-resolution confocal laser microscope (LSM 800 with AiryScan, Zeiss, Oberkochen, Germany).
  • the extracellular vesicles isolated from the culture medium of L929 cells and EV-deficient fetal bovine serum were used as the culture medium.
  • the cultured medium was centrifuged at 1500 ⁇ g for 10 minutes to precipitate a major part of the cells, and cell debris was removed at 4000 ⁇ g for 20 minutes.
  • the supernatant was filtered through a bottle top vacuum 0.45 ⁇ m filter.
  • the extracellular vesicles contained in the supernatant obtained by the above process were ultracentrifuged at 100,000 ⁇ g for 1 hour. The supernatant was discarded, and the extracellular vesicle pellet was mixed with phosphate-buffered saline (PBS) and ultracentrifuged at 100,000 ⁇ g for 1 hour. The extracellular vesicle pellets were used immediately or stored at -80°C until use.
  • PBS phosphate-buffered saline
  • the L929-EV pellet was suspended in 100 ⁇ L of 2% paraformaldehyde.
  • the grid was washed with a drop of PBS (100 ⁇ L) using sterile forceps. For fixation, the grid was transferred to 50 ⁇ L of 1% glutaraldehyde and incubated at 25 to 30° C. for 5 minutes. The grid was then washed with sterile water for 2 minutes.
  • L929-EV in the grid was stained with 2% uranyl acetate, washed with distilled water for 2 minutes, and the above process was repeated 7 times or more.
  • the samples were completely dried for 24 hours, and the grid was observed under an HT 7700 transmission electron microscope (Hitachi, Tokyo, Japan) to check the L929-EV.
  • the same amount of total protein was separated on an SDS-PAGE gel and transferred to a polyvinylidene difluoride membrane (GE healthcare, IL, USA).
  • the membrane was incubated with primary antibodies (Abcam: Anti-rabbit-CD63 and Anti-rabbit-GM130; GenTex: Anti-rabbit-VEGF) and then incubated with a secondary antibody conjugated with horseradish peroxidase.
  • L929-EV was incubated with a lipophilic dye DiD (1,1'-Dioctadecyl-3,3,3',3' Tetramethylindodicarbocyanine, 4-Chlorobenzenesulfonate Salt, Thermo Fisher Scientific) at 37° C. for 20 minutes in a shaker incubator.
  • DiD 1,1'-Dioctadecyl-3,3,3',3' Tetramethylindodicarbocyanine, 4-Chlorobenzenesulfonate Salt, Thermo Fisher Scientific
  • L929-EVsDiD DiD-labeled L929-EVs
  • L929-EVsDiD and L929-EV indicated above were added to the cells, incubated for 4 hours, and the slides were treated with 4′,6-diamidino-2-phenylindole (DAPI; Vectashield, CA, USA) and an inclusion agent (antifade). .
  • DAPI 4′,6-diamidino-2-phenylindole
  • an inclusion agent antifade
  • L929 cells were inoculated in 100 ⁇ l of complete medium in 96-well plate at 5 ⁇ 10 3 cells/well, and cultured in a CO 2 incubator overnight. It was treated at a concentration of 50 ⁇ g/ml for 24 hours.
  • L929 cells (5 ⁇ 10 5 ) were grown in 35 mm plates in 5% CO 2 until they reached 90-95% confluence.
  • a sterile 10 ⁇ l pipette tip was used to make a scratch wound, and after removing the medium, serum-free medium was added.
  • L929 cells were treated with L929-EVs (20 and 40 ⁇ g/ml) and wound healing was photographed under a microscope (AXIO, Zeiss, Baden-Wurttemberg, Germany). Images were taken every 0, 18 and 36 hours, and the open wound gap was measured 5 times in a visible microscopic field using a ZEN lite 2.3 (Carl Zeiss, Baden-Wurttemberg, Germany).
  • fibroblasts were collected and mRNA expression levels of wound healing-related genes were confirmed using qRT-PCR.
  • qRT-PCR was performed with SsoAdvancedTM Universal SYBR® Green Supermix (Bio-Rad, USA) reagent in a PCR system (Bio-Rad) according to the manufacturer's instructions.
  • a 24-well culture plate was coated with Matrigel Growth Factor Reduced (GFR) Basement Membrane Matrix (Corning, MA, USA) and incubated at 37° C. for 1 hour. Thereafter, 2 ⁇ 10 4 SVEC4 cells/well were added to the Matrigel-coated plate. Immediately, L929-EVs (15 and 30 ⁇ g/ml) were added to the designated wells, PBS was added as a control, and 3 hours later, the cells were visualized and images were obtained by microscopy (AXIO, Zeiss, Carl Zeiss).
  • L929-EV The in vivo wound healing effect of L929-EV was confirmed using 6-week-old, female C57BL/6 mice. Mice were anesthetized by hair removal and treatment with 2.5% isoflurane (Merial, Lyon, France) during skin incision.
  • mice were anesthetized, the hairs of the mice were removed with an electric razor, and sterilized using povidone-iodine and 70% alcohol.
  • An 8 mm skin wound was prepared using a biopsy punch, and a silicone ring with an inner diameter of 8 mm and an outer diameter of 12 mm was attached to prevent contraction (Dermabond®, Ethicon, USA).
  • mice in all groups were covered with TegadermTM transparent film (3 M, London, UK) and lightly fixed with a 2-inch elastic support bandage.
  • Wound epithelialization (%) (W i -U i )/W 0 ⁇ 100
  • Skin tissues were collected on days 4, 8 and 14, and tissue extracts were prepared with RIPA solution and protease inhibitor cocktail. Tissue samples were fixed with 10% formalin buffer, and blocks embedded in paraffin were cut into 5 micron sections. Sections were stained with standard hematoxylin & eosin (H & E) or Masson's trichrome.
  • Immunofluorescence analysis was performed to confirm the expression of fibroblast biomarkers such as vimentin and ⁇ -SMA in L929 cells as shown in FIG. 1A.
  • L929 extracellular vesicles were separated from the medium collected from L929 cell culture, and the morphology of the isolated L929-EV was analyzed by transmission electron microscopy (TEM).
  • TEM transmission electron microscopy
  • L929-EV could interact and be internalized into L929 cells.
  • L929-EV and L929-EVsDiD and L929 cells were incubated for 4 hours and confirmed by imaging under a fluorescence microscope.
  • L929-EV is internalized after interaction with the cell surface of L929 cells as shown in FIG. 2 .
  • Fibroblast migration and proliferation are basic processes for wound healing, and the effect of L929-EVs (10-50 ⁇ g/ml) on L929 cell proliferation was confirmed.
  • L929-EV-treated L929 cell migration at 18 hours as shown in FIG. 3B was compared with the control. It was confirmed that there was a significant increase in dose-dependently, and it was confirmed that the migration of L929-EV-treated L929 cells was significantly increased in a dose-dependent manner as compared to the control group as shown in FIGS. 3B and 3C at 36 hours.
  • L929-EV The effect of L929-EV on the expression of ECM-related genes in fibroblasts was confirmed.
  • the mRNA expression of MMP1, MMP3 and Col3A1 was increased after treatment with L929-EVs (20 and 40 ⁇ g/ml) as shown in FIGS. 4A to 4C .
  • L929-EV 20 ⁇ g/ml MMP1 and MMP3 mRNA levels were significantly increased, but Col3A1 levels did not change.
  • L929-EV 40 ⁇ g/ml it was confirmed that all of the mRNA levels were increased.
  • L929-EV treatment induces an increase in genes related to scarless wound healing in fibroblasts.
  • L929-EV was internalized into endothelial cells after interacting with the cell membrane.
  • tubularity analysis was performed on SVEC4 cells after treatment with L929-EV (15 and 30 ⁇ g/ml) and PBS.
  • L929-EVs internalized into endothelial cells induce endothelial cell migration and increased tubular formation.
  • FIGS. 7A and 7B In order to confirm the effect of fibrin glue and L929-EV on skin wound healing, a wound was created in the entire layer of the skin, such as in mice, as shown in FIGS. 7A and 7B, and photo analysis was performed after treatment with FG or FG+L929-EV. The level of wound healing was confirmed by performing western blot and histological analysis as shown in FIGS. 7A and 7C.
  • FIGS. 8A and 8B closure of the wounds of FG-treated animals was significantly accelerated (p ⁇ 0.05) compared to the control group after 4 days of wounding, and compared to the control group, FG+L929-EV-treated mice A high level (p ⁇ 0.01) wound closure effect was also confirmed in the group.
  • the wound skin structure, collagen deposition and maturation effects were confirmed according to fibrin glue and L929-EV treatment.
  • control group showed a structural pattern similar to that of the 4th day of the FG and FG+L929-EVs treated group, and more common skin appendages (head, sebaceous glands, sweat glands) were confirmed in the FG+L929-EV group on the 8th day. However, it was not confirmed in FG and control group.
  • Collagen deposition and maturation have improved tissue flexibility and strength, and can lead to skin healing. Accordingly, as a result of performing Masson's trichrome staining on the 8th day, as shown in FIG. 9B, an increase in collagen at the wound site was confirmed in the FG+L929-EV-treated group compared to FC and the control group, and a relatively low collagen content in the FG-treated group was observed. was confirmed, and collagen was not identified in the control group.
  • the VEGF level of the FG+L929-EV-treated group was significantly higher than that of the other experimental groups on the 8th day, and the VEGF level on the 14th day was approximately in the FG+L929-EV-treated group compared to the control group. It could be confirmed that the increase was more than two-fold, and it was confirmed that it was significantly increased than in the FG group.
  • IHC staining for CD31 was performed to confirm the number of newly formed and mature vessels.
  • FIG. 11A new blood vessels were clearly identified in the FG+L9292-EV treatment group than in the other two groups on the 8th day, and on the 14th day, significantly higher blood vessel density in the FG+L929-EV group compared to the other two groups. indicated.
  • Vascular density exactly matched VEGF expression in the skin.
  • ⁇ -catechin was highly expressed in the FG+L929-EV treated group on the 8th day, whereas ⁇ -catechin was not expressed in the dermis of FG and the control group. Also, on the 14th day, ⁇ -catechin was expressed very highly in the FG+L929-EV group, and then expression was confirmed in the FG group, whereas ⁇ -catechin expression did not appear in the dermis of the control group.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Materials Engineering (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Dermatology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Pathology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Medical Informatics (AREA)
  • Molecular Biology (AREA)
  • Surgery (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 피부 및 점막 창상 치료용 조성물에 관한 것으로, 상기 섬유아세포 유래 세포외 소포체는 내피세포 및 섬유아세포에 효과적으로 내재화됨으로서, 상처 부위로 세포 이동을 증가시키고, 콜라겐 침착 및 성숙을 유도하여 피부 창상 부위의 상처 회복을 효과적으로 촉진시켰으며, 상처 부위에서 흉터 생성을 억제하는 유전자들의 발현을 증가시켜 효과적으로 흉터를 감소시키는 것으로 확인됨에 따라, 상기 섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 조성물은 피부 및 점막 창상 치료제로 제공될 수 있다.

Description

섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 피부 및 점막 창상 치료용 조성물
본 발명은 섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 조성물을 피부 및 점막 창상 치료제로 제공하는 기술이다.
피부는 신체를 보호하는 방어막 역할로서 질환에 대한 신체의 1차 방어선이며, 표피는 미생물 침입에 대한 장벽을 제공한다. 따라서 상처, 화상, 찰과상 및 피부에 대한 기타 손상의 치료에서 일차적인 목적은 감염을 예방하기 위한 신속한 봉합(Closure) 및 상처 치유이다. 점막은 비강 구강 등에서 피부 조직과 유사하게 장기의 방어막으로 역할을 하며, 점막 손상 역시 신속한 치유가 필요하다.
이때, 상처 치유는 일반적으로, 염증(inflammation), 증식(proliferation) 및 재형성(remodelling)의 3가지 단계를 수반하는 복잡한 과정이다. 첫 번째 단계는 지혈(haemostasis)을 달성하기 위한 응고(clotting), 그리고 세균 및 괴사 조직을 파괴하기 위한 호중구의 보충, 그 이후에 대식세포의 보충을 수반한다. 두 번째 단계 동안, 혈관신생(angiogenesis)이 발생하고, 이때 내피세포가 상처 부위로 이동하고, 이와 동시에 섬유아세포가 상처 부위로 이동하여 육아 조직(granulation tissue)을 생산하는데 도움을 준다. 육아 조직의 형성은 재상피화 (reepithelialisation)가 일어날 수 있도록 한다. 최종 단계 동안, 콜라겐 생산과 파괴의 수준이 균등해지고, 치유된 상처는 최대 강도를 달성하기 위하여 천천히 변경된다. 상처 치유는 상기 과정 중에서 한 가지라도 시기 적절하게 제대로 기능하지 않을 때, 지연되거나 손상되므로 만성적인 상태까지 달할 수 있다.
한편, 모든 세포들은 세포외 소포체(extracellular vesicles, EVs)를 분비하며, 이러한 점은 박테리아로부터 인간과 식물에 이르기까지 진화적으로 보존된 현상이다. 세포외 소포체는 세포 간의 물질(단백질, 지질, 유전물질) 교환을 가능하게 하며, 생리적/병리적으로 신호를 전달하는 매개체로서 기능한다.
세포외 소포체는 크게 엑소좀(exosomes)과 마이크로베시클(microvesicles)로 분류된다. 엑소좀은 크기가 50-150 nm로, 다중 소포 엔도좀(multi-vesicular endosomes)이 성숙하는 과정에서 엔도좀 막이 안쪽으로 들어와 생성된 내강 소낭(intraluminal vesicles)인데, 다중 소포 엔도좀이 세포 표면과 결합할 때 분비된다. 마이크로베시클은 크기가 50-1000 nm로, 원형질막(plasma membrane)이 바깥으로 솟아나와 분리되어 세포 밖으로 분비되는 소낭이다.
각 세포들은 생리적 상태에 따라 세포외 소포체를 다르게 생성하고, 특정한 지질, 단백질, 핵산 조성을 갖는 세포외 소포체를 분비하며, 세포외 소포체의 특정한 조성은 세포외 소포체의 기능과 운명을 결정한다. 이러한 세포외 소포체는 세포 밖으로 분비된 뒤에 표적 세포로 이동하여 내용물을 전달함으로써 반응을 유도하고, 생리적/병리적 상태에 변화를 촉진할 수 있다. 세포외 소포체 매개 세포간 정보 교환은 원형질막에서 표면 수용체를 활성화하고, 신호전달 후 세포외 소포체의 흡수 또는 표적 세포와의 결합을 통하여 일어난다. 이러한 과정은 복잡하고 세포외 소포체의 기원, 표적 세포의 종류와 기원에 따라 영향을 받는다.
실제로 인간제대정맥 내피 세포(human umbilical vein endothelial cells, HUVECs)로부터 유래된 엑소좀과 내피전구세포 (endothelial progenitor cells, EPCs)로부터 유래된 엑소좀이 각각 처리된 경동맥 내피가 손상된 동물모델의 혈관 내피 복구 효과는 HUVEC보다 EPC로부터 분리된 엑소좀의 효과가 4.2배 높은 것으로 보고되었으며, 각각 심장 섬유모세포, 심근세포, 내피세포, 심장전구세포, 지방세포 및 심장 텔로사이트에서 유래된 엑소좀이 심혈관계 질환 (Cardiovascular disease, CVD) 치료에 있어서, 각각 다른 세포 반응을 유도하는 것이 확인되었다.
이러한 결과는 세포마다 전혀 다른 세포외 소포체를 생산하며, 각각 다른 세포로부터 유래된 세포외 소포체는 동일한 표적세포에 대해서도 전혀 다른 영향을 미치는 것을 확인한 것으로, 의학적 용도로서 세포외 소포체를 효과적으로 이용하기 위해서는 세포외 소포체의 기초 기능을 규명하고 임상적으로 활용하기 위한 연구 개발이 필요한 실정이다.
본 발명은 섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 조성물에 관한 것으로, 급성 및 만성 창상에 국소적으로 적용하여 빠른 치료 효과를 제공할 수 있는 피부 및 점막 창상 치료제를 제공하고자 한다.
본 발명은 섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 피부 및 점막 창상 치료용 약학조성물을 제공한다.
본 발명은 섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 피부 및 점막 재생 또는 손상 회복용 외용제 조성물을 제공한다.
본 발명은 피부 및 점막 창상 부위에 세포외 소포체 유도물질을 투여하는 단계; 및 상기 유도물질이 피부 및 점막 창상 부위에서 섬유아세포 유래 세포외 소포체의 분비를 촉진시키는 단계를 포함하는 피부 창상 개선 또는 치료방법을 제공한다.
또한, 본 발명은 인간을 제외한 개체로부터 분리된 섬유아세포에 후보물질을 처리하는 단계; 상기 후보물질이 처리된 섬유아세포로부터 분비된 세포외 소포체 수준을 확인하는 단계; 및 대조구 시료와 비교하여 섬유아세포로부터 세포외 소포체 분비를 증가시킨 후보물질을 선별하는 단계를 포함하는 창상 치료제 스크리닝 방법을 제공한다.
본 발명에 따르면, 섬유아세포 유래 세포외 소포체는 내피세포 및 섬유아세포에 효과적으로 내재화됨으로서, 상처 부위로 세포 이동을 증가시키고, 콜라겐 침착 및 성숙을 유도하여 피부 창상 부위의 상처 회복을 효과적으로 촉진시켰으며, 상처 부위에서 흉터 생성을 억제하는 유전자들의 발현을 증가시켜 효과적으로 흉터를 감소시키는 것으로 확인됨에 따라, 상기 섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 조성물은 피부뿐만 아니라 이와 유사한 생물학적 특성을 가진 점막 창상 치료제로 제공될 수 있다.
도 1은 L929-EV의 특징을 확인한 결과로, 도 1A는 섬유아세포에서 αSMA의 면역형광분석 결과이며 (scale bar: 20 μm), 도 1B는 섬유아세포 (L929)로 부터 소포체를 분리하기 위한 과정을 나타낸 모식도이며, 도 1C는 투과전자현미경을 통하여 L929-EV의 형태를 확인한 결과이며 (scale bar: 500 및 200 nm), 도 1D는 항-CD63 및 항-GM130 항체를 이용한 L929 세포 및 L929-EV의 웨스턴 블롯 분석 결과이다.
도 2는 섬유아세포에서 L929-EV의 내재화를 확인한 결과로, L929 세포를 표시되지 않은 L929-EV 및 DiD-표시된 L929-EVs (L929-EVsDiD)와 각각 인큐베이트한 결과이다 (scale bar: 20 μm).
도 3은 L929-EV 처리를 통하여 섬유아세포의 증식 및 이동 향상 효과를 확인한 결과로, 도 3A는 0-50 μg/ml L929-EV를 24시간 처리 후 CCK8 분석을 수행하여 세포 증식을 확인한 히스토그램 결과이며 (n=6), 도 3B는 0, 20 또는 40 μg/ml L929-EVs (50 μm) 처리 후 0, 18 및 36 시간 후 상처 봉합 수준을 확인한 위상차 현미경 분석 결과이며, 도 3C는 ZEN 2.3 (blue edition) 소프트웨어를 이용하여 상기 도 3C에서 확인된 상처 거리를 측정한 결과로, 각 실험의 평균 및 표준편차를 표시하였다. *p < 0.05; ***p < 0.001. Student-t-test was used.
도 4A 내지 도 4C는 L929-EV 처리가 섬유아세포에서 무흉터 상처 치료와 관련된 유전자의 발현을 증가시키는 것을 확인한 결과로, 각각의 히스토그램은 20 및 40 μg/ml L929-EV을 처리하고 24시간 후 MMP1, MMP3 및 COL3A1 mRNA 발현을 확인한 실시간 PCR 분석 결과로, 각 실험의 평균 및 표준편차를 표시하였다. *p < 0.05; **p < 0.01. Student-t-test was used.
도 5는 내피세포에서 L929-EV의 내재화를 확인한 결과로, 내피 세포 (SVEC4)를 표시도지 않은 L929-EV 및 DiD-표시된 L929-EVs (L929-EVsDiD)와 각각 인큐베이트한 결과이다 (scale bar: 20 μm).
도 6은 L929-EV 처리가 내피세포의 이동 및 관 형성을 촉진시키는 효과를 확인한 결과로, 도 6A는 15 또는 30 μg/ml L929-EVs (100 μm)를 처리 또는 비처리하고 24시간 후 세포 이동을 확인한 위상차 현미경 이미지이며, 막대 그래프는 실험 결과에서 이동한 세포를 나타낸다 (n=5). 도 6B는 0, 15 또는 30 μg/ml L929-EVs이 포함된 배지를 이용하여 마트리겔이 코팅된 플레이트에서 배양된 내피 세포를 확인한 위상차 현미경 이미지로 (scale bar: 200 pixels; * indicates the number of closed structures in the field), 각 실험의 평균 및 표준편차를 표시하였다. *p < 0.01; **p < 0.001. Student-t-test was used.
도 7은 마우스를 이용하여 상처 수립 및 상처 치유 효과를 확인한 실험 과정에 대한 모식도로, 도 7A는 생체 내 처리 실험에 대한 개략도를 나타낸 것이며, 도 7B는 생쥐 등 피부에 상처 생성 및 실리콘 링 부착 과정을 나타낸 것이며, 도 7C는 생체 내 처리 실험에 있어서, 단계별 실험 과정을 나타내는 모식도이다.
도 8은 생쥐에서 피브린 글루 및 L929-EV 처리에 따른 상처 치유 효과를 확인한 결과로, 도 8A는 0, 4, 8 및 14일째 대조군, FG 및 FG+L929-EV 처리군 생쥐의 상처 치유 과정을 확인한 대표 이미지 결과이며, 도 8B는 대조군, FG 및 FG+L929-EV 처리군 생쥐의 노출된 상처의 백분율을 확인한 결과로, 각 실험의 평균 및 표준편차를 표시하였다. *p<0.05; **p<0.01; ***p<0.001. Student-t-test was used.
도 9는 피브린 글루 및 L929-EV 처리에 의한 상처의 피부 구조, 콜라겐 침착 및 성숙의 효과를 확인한 결과로, 도 9A는 4, 8 및 14일째에 대조군, FG 및 FG+L929-EV 처리군의 상처 부위를 H&E 염색한 결과이며, 도 9B는 4, 8 및 14일째에 대조군, FG 및 FG+L929-EV 처리군의 상처 부위의 Masson’s trichome 염색을 수한 결과이다.
도 10은 피브린 글루 및 L929-EV 처리에 의한 VEGF 수준 증가 효과를 확인한 결과로, 대조군, FG 및 FG+L929-EV 처리된 상처 부위에서 4, 8 및 14일째에 항-VEGF로 웨스턴 블롯 분석을 수행한 결과로, β-액틴을 로딩 대조군으로 이용하였다.
도 11은 피브린 글루 및 L929-EV 처리가 상처 부위에서 혈관형성 및 모발을 촉진시키는 효과를 확인한 결과로, 도 11A는 대조군, FG 및 FG+L929-EV 처리군의 상처 부위에서 4, 8 및 14일째에 CD31 (IHC) 염색을 수행한 결과이며, 도 11B는 대조군, FG 및 FG+L929-EV 처리된 상처 부위에서 4, 8 및 14일째에 β-카테킨 (IHC) 염색을 수행한 결과이다.
이하, 본 발명을 보다 상세하게 설명한다.
최근 의학적으로 세포외 소포체의 활용에 대한 관심이 증가하고 있으나, 대부분의 연구는 중간엽 줄기세포(MSC) 유래 세포외 소포체에 집중되어 있다. 섬유아세포는 피부 상처 치유를 위한 주요 세포 중 하나로, 실제 피부에는 중간엽 줄기세포가 존재하지 않는 반면, 섬유아세포가 주를 이루고 있어 종래 중간엽 줄기세포 유래 세포외 소포체 보다 상처난 피부에서 섬유아세포 유래 세포외 소포체는 높은 수득율을 나타낼 수 있다. 이에 따라, 본 발명의 발명자들은 섬유아세포 유래 세포외 소포체를 종래의 중간엽 줄기세포 유래 세포외 소포체를 대신할 수 있는 새로운 피부 창상 치료제의 대안으로 제공하고자 한다.
본 발명은 섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 피부 및 점막 창상 치료용 약학조성물을 제공할 수 있다.
상기 창상은 화상, 열상, 표피 창상, 궤양, 외상, 외과적 수술(post-surgical), 출산, 만성적 상처(chronic wound) 및 피부염(dermatitis)에 의한 손상으로 이루어진 군에서 선택되는 것일 수 있으나, 이에 제한되지 않는다.
상기 약학조성물은 스캐폴드(scaffold)를 추가로 더 포함하는 것일 수 있다.
상기 스캐폴드는 피브린 글루(fibrin glue), 키토산, 알긴산, 엘라스틴, 히알루론산, 콜라겐, 프로테오글리칸 및 하이드로겔로 이루어진 군에서 하나 또는 둘 이상의 조합으로 선택되는 것일 수 있으며, 보다 바람직하게는 피브린 글루일 수 있으나, 이에 제한되지 않는다.
상기 섬유아세포 유래 세포외 소포체는 피부 및 점막 창상부위로 세포의 이동을 증가시키고, 콜라겐 침착 및 성숙을 유도하여 피부 및 점막 창상을 회복시키는 것일 수 있다.
본 발명의 한 구체예에서, 상기 섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 피부 창상 치료용 약학조성물은 통상적인 방법에 따라 주사제, 과립제, 산제, 정제, 환제, 캡슐제, 좌제, 겔, 현탁제, 유제, 점적제 또는 액제로 이루어진 군에서 선택된 어느 하나의 제형을 사용할 수 있다.
본 발명의 다른 구체예에서, 상기 약학조성물은 약학조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제, 붕해제, 감미제, 피복제, 팽창제, 활택제, 향미제, 항산화제, 완충액, 정균제, 희석제, 분산제, 계면활성제, 결합제 및 윤활제로 이루어진 군에서 선택되는 하나 이상의 첨가제를 추가로 포함할 수 있다.
구체적으로 담체, 부형제 및 희석제는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 사용할 수 있으며, 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 조성물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 칼슘카보네이트, 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제할 수 있다. 또한 단순한 부형제 이외에 마그네슘 스티레이트, 탈크 같은 윤활제들도 사용할 수 있다. 경구를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 있으며 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제 등이 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜, 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기재로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명의 일실시예에 따르면 상기 약학 조성물은 정맥내, 동맥내, 복강내, 근육내, 흉골내, 경피, 비측내, 흡입, 국소, 직장, 경구, 안구내 또는 피내 경로를 통해 통상적인 방식으로 대상체로 투여할 수 있다.
상기 섬유아세포 유래 세포외 소포체의 바람직한 투여량은 대상체의 상태 및 체중, 질환의 종류 및 정도, 약물 형태, 투여경로 및 기간에 따라 달라질 수 있으며 당업자에 의해 적절하게 선택될 수 있다. 본 발명의 일실시예에 따르면 이에 제한되는 것은 아니지만 1일 투여량이 0.01 내지 200 mg/kg, 구체적으로는 0.1 내지 200 mg/kg, 보다 구체적으로는 0.1 내지 100 mg/kg 일 수 있다. 투여는 하루에 한 번 투여할 수도 있고 수회로 나누어 투여할 수도 있으며, 이에 의해 본 발명의 범위가 제한되는 것은 아니다.
본 발명에 있어서, 상기 '대상체'는 인간을 포함하는 포유동물일 수 있으나, 이들 예에 한정되는 것은 아니다.
본 발명은 섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 피부 및 점막의 재생 또는 손상 회복용 외용제 조성물을 제공할 수 있다.
상기 외용제 조성물은 피부 국소 도포용일 수 있으나, 이에 제한되지 않는다.
또한, 상기 외용제는 연고제, 크림제, 로션제, 액제, 드레싱제, 패취제, 수포제, 테이프제, 연무제, 외용산제 및 스프레이제로 이루어지 군에서 선택되는 것일 수 있다.
본 발명은 피부 및 점막 창상 부위에 세포외 소포체 유도물질을 투여하는 단계; 및 상기 유도물질이 피부 및 점막 창상 부위에서 섬유아세포 유래 세포외 소포체의 분비를 촉진시키는 단계를 포함하는 피부 및 점막 창상 개선 또는 치료방법을 제공할 수 있다.
상기 세포외 소포체 유도물질은 TGF-β, CD40, IL-4 수용체 활성화제, 헥사데실글리세롤 (Hexadecylglycerol), 리소좀 억제제인 클로로퀸 (chloroquine), 바필로바이신 A (Bafilomycin A) 및 SIRT1 억제제로 이루어진 군에서 선택될 수 있으며, 낮은 전류 자극에 의해서도 유도될 수 있다.
또한, 본 발명은 인간을 제외한 개체로부터 분리된 섬유아세포에 후보물질을 처리하는 단계; 상기 후보물질이 처리된 섬유아세포로부터 분비된 세포외 소포체 수준을 확인하는 단계; 및 대조구 시료와 비교하여 섬유아세포로부터 세포외 소포체 분비를 증가시킨 후보물질을 선별하는 단계를 포함하는 창상 치료제 스크리닝 방법을 제공할 수 있다.
이하, 본 발명의 이해를 돕기 위하여 실시예를 들어 상세하게 설명하기로 한다. 다만 하기의 실시예는 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다. 본 발명의 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.
<실험예>
하기의 실험예들은 본 발명에 따른 각각의 실시예에 공통적으로 적용되는 실험예를 제공하기 위한 것이다.
1. 세포 배양
마우스 섬유아세포 주 L929 (L cell, L-929, derivative of Strain L)를 Dr. Yong Hyun Jeon (Daegu-Gyeongbuk Medical Innovation Foundation, Daegu, Republic of Korea)에게서 제공받았으며, 마우스 내피 세포주 SVEC4-10EHR1을 American Type Culture Collection (Manassas, VA, USA)에서 구입하였다.
L929 및 SVEC4 세포를 10% 태아소혈청 (fetal bovine serum, FBS; HyClone) 및 1% 페니실린-스트렙토마이신 (Gibco, Carlsbad, CA, USA)이 포한된 DMEM-high glucose (HyClone, Logan, UT, USA)를 이용하여 37℃ 및 5% CO2 조건에서 배양하였다.
2. 면역형광분석 (Immunofluorescence)
면역형광분석을 하기와 같이 수행하였다.
L929 세포 (5×103)를 4-웰 챔버 슬라이드에 접종하고 CO2 배양기에서 하룻밤동안 유지시켰다. 세포를 45분간 3% BSA로 차단하였다. 4℃에서 하룻밤동안 세포를 항-α-SMA 항체로 탐침시키고 세포를 PBS로 10분간 두 번 세척한 후 코트 항-래빗 플루오레세인이소티오시안산염(FITC; Abcam, Cambridge, United Kingdom) 이차 항체로 염색하였다. VECTASHIELD Antifade mounting medium (Vector Laboratories, CA, USA)를 이용하여 챔버 슬라이드를 올려놓고 밀봉하였다.
면역형광 염색된 부분을 고감도 초해상 공초점 레이저 현미경 (LSM 800 with AiryScan, Zeiss, Oberkochen, Germany)으로 이미지화 하였다.
3. 세포외 소포체(EV)의 분리 및 정제
L929 세포의 배양 배지로부터 분린된 세포외 소포체와 배양배지로 EV가 결핍된 태아소혈청(원심분리 18시간, 120,000 ×g 및 4℃)을 사용하였다.
배양된 배지를 1500×g에서 10분간 원심분리하여 세포의 주요 부분을 침전시키고 4000×g에서 20분간 세포 잔해물을 제거하였다. 상층액을 bottle top vacuum 0.45 μm 필터를 통과시켜 여과하였다.
상기 과정으로 얻은 상층액에 포함된 세포외 소포체를 100,000×g에서 1시간 동안 초원심분리하였다. 상층액을 버리고 세포외 소포체 펠렛을 인산염완충식염수 (phosphate-buffered saline, PBS)와 혼합하고 100,000×g에서 1시간 동안 초원심분리하였다. 세포외 소포체 펠렛을 즉시 사용하거나 사용전까지 -80℃에서 보관하였다.
모든 원심분리는 4℃에서 수행되었으며, 세포외 소포체의 농도는 Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, MA, USA)로 확인하였다.
4. 투과전자현미경 (Transmission electron microscopy, TEM)
L929-EV 펠렛을 2% 파라포름알데하이드 100 μL에 현탁시켰다.
다음으로 L929-EV 펠렛 10 μL를 포름바 (Formvar) 탄소가 코팅된 TEM 그리드에 20분간 첨가하였다.
멸균된 겸자 (forceps)를 이용하여 그리드를 PBS (100 μL) 방울로 세척하였다. 고정을 위해 그리드를 1% 글루타알데하이드 50 μL로 옮기고 25 내지 30℃에서 5분간 인큐벤이션하였다. 이후 그리드를 멸균수로 2분간 세척하였다.
그리드 내 L929-EV을 2% 아세트산 우라닐를 이용하여 염색하고 증류수로 2분간 세척하고 상기 과정을 7번 이상 반복하였다.
24시간 동안 시료를 완전히 건조시키고, HT 7700 transmission electron microscope (Hitachi, Tokyo, Japan) 하에서 L929-EV을 확인하기 위해 그리드를 관찰하였다.
5. 웨스턴 블롯 (Western blotting)
웨스턴 블롯을 하기와 같이 수행하였다. 세포외 소포체 (EVs) 또는 세포 용해물을 방사성 면역 침전 분석 완충제 (Thermo Fisher Scientific) 프로테아제 억제제 칵테일 (Sigma, MO, USA)로 준비하였다.
동량의 전체 단백질을 SDS-PAGE 겔에 분리하고 PVDF 막(polyvinylidene difluoride membrane; GE healthcare, IL, USA)에 옮겼다. 막을 일차 항체(Abcam: Anti-rabbit-CD63 및 Anti-rabbit-GM130; GenTex: Anti-rabbit-VEGF)와 배양한 후 horseradish peroxidase가 결합된 이차 항체와 배양하였다.
ECL (enhanced chemiluminescence; GE healthcare, IL, USA)을 이용하여 제조사의 설명서에 따라 신호를 검출하였다. 밴드를 Chemi-doc 이미지 소프트웨어로 시각화 하였다. Picasa3 (version 3.9.1.4.1) (Google, CA, USA) 또는 PowerPoint (Microsoft, WA, USA)를 이용하여 블롯 이미지를 준비하였다. 밴드 강도는 GelQuant.NET software (Version 1.8.2) (BiochemLabSolutions.com, CA, USA)로 측정하였다.
6. L929-EV의 DID 표시 및 내재화 분석
L929-EV를 친유성 염료 DiD (1,1'-Dioctadecyl-3,3,3',3' Tetramethylindodicarbocyanine, 4-Chlorobenzenesulfonate Salt, Thermo Fisher Scientific)와 37℃에서 20분간 진탕배양기에서 인큐베이션하였다.
DiD가 표시된 L929-EVs (L929-EVsDiD)를 Exo-Quick solution (System Biosciences)으로 분리하였다. L929 또는 SVEC4 세포 (5×103)를 4-웰 챔버 슬라이드에 접종하고 CO2 배양기에 하룻밤동안 유지시켰다.
상기 표시된 L929-EVsDiD 및 L929-EV을 세포에 첨가하고 4시간 동안 인큐베이션하고, 슬라이드에 4′,6-diamidino-2-phenylindole (DAPI; Vectashield, CA, USA)와 봉입제 (antifade)를 처리하였다.
고감도 초해상도 공초점 레이저 스캔 현미경(LSM 800 with AiryScan, Carl Zeiss, Baden-Wurttemberg, Germany)에서 슬라이드 이미지를 얻었다.
7. 생체 외 세포증식 분석
L929 세포를 96웰 플레이트 내 완전배지 100 μl에 5×103 cells/well로 접종하고, 하룻밤동안 CO2 배양기에서 배양한 후 무혈청 배지 내 L929-EV를 0, 10, 20, 30, 40 및 50 μg/ml 농도로 24시간 동안 처리하였다.
제조사의 설명서(CCK8 assay kit - Dojindo Molecular Technologies, Kyushu, Japan)에 따라, 분광광도계 (spectrophotometer)를 이용하여 광학밀도 (optical density, OD)로 측정하여 세포 증식을 확인하였다.
8. 생체 외 상처치유 이동 분석 (wound-healing migration assay)
L929 세포 (5×105)를 90-95% 합류에 도달할 때까지 5% CO2의 35mm 플레이트에서 성장시켰다.
멸균된 10 μl 파이펫 팁을 이용하여 스크래치 상처를 만들고 배지를 제거한 후 무혈청 배지를 첨가하였다. L929 세포에 L929-EVs (20 및 40 μg/ml)를 처리하고 현미경(AXIO, Zeiss, Baden-Wurttemberg, Germany)으로 상처 회복을 촬영하였다. 이미지는 0, 18 및 36 시간마다 얻었으며, ZEN lite 2.3 (Carl Zeiss, Baden-Wurttemberg, Germany)를 이용하여 visible microscopic field에서 열린 상처 간격을 5회 측정하였다.
9. 정량적 실시간 중합효소 연쇄 반응 (Quantitative real-time polymerase chain reaction; qRT-PCR)
처리 후 섬유아세포를 수집하고 qRT-PCR를 이용하여 상처 치유와 관련된 유전자의 mRNA 발현 수준을 확인하였다.
TRIzol™ Reagent (Thermo Fisher Scientific)를 이용하여 전체 RNA를 추출하고 High-Capacity cDNA conversion kit (Applied Biosystem, USA)를 이용하여 상보적 DNA (complementary DNA)를 역전사시켰다.
qRT-PCR은 제조사의 설명서에 따라, PCR system (Bio-Rad)에서 SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad, USA) 시약으로 수행되었다.
정방향 및 역방향 프라이머 리스트는 표 1과 같으며, PCR system software (Bio-Rad)를 이용하여 상대적 발현 수준을 자동으로 계산하였다.
gene name Sequence (5'-3')
MMP1-F GGCTGAAAGTGACTGGGAAACC
MMP1-R TGCTCTTGGCAAATCTGGCGTG
MMP3-F CTGGACTCCGACACTCTGGA
MMP3-R CAGGAAAGGTTCTGAAGTGAC
COL3A1-F GCCAAATATGTGTCTGTGACTC
COL3A1-R GGGCGAGTAGGAGCAGTTG
GAPDH-L GGCACAGTCAAGGCTGAGAATG
GAPDH-R ATGGTGGTGAAGACGCCAGTA
10. 생체외 세포 이동 분석 (transwell migration assay)
트랜스 웰 막의 상층부에 SVEC4 세포 1 × 104 (200μl)를 첨가하였다. 600 μl의 배지 (3% FBS)를 아래 챔버의 바닥에 첨가하였다. 즉시 L929-EVs (15 및 30 μg/ml)를 삽입체 상층부에 첨가한 후 CO2 배양기에서 24시간 동안 유지시킨 후 세포를 고정시키고 크리스탈 바이올렛으로 염색하여 세포를 시각화하고 현미경(AXIO, Zeiss, Carl Zeiss, Baden-Wurttemberg, Germany)으로 이미지를 얻었다.
11. 생체 외 관형성 분석
24-웰 배양 플레이트를 Matrigel Growth Factor Reduced (GFR) Basement Membrane Matrix (Corning, MA, USA)로 코팅한 후 37℃에서 1시간 동안 인큐베이션하였다. 이후 2 × 104 SVEC4 cells/well를 마트리겔이 코팅된 플레이트에 첨가하였다. 즉시, L929-EVs (15 및 30 μg/ml)를 정해진 웰에 첨가하였으며, PBS를 대조군으로 첨가하고 3시간 후 세포를 시각화하여 현미경(AXIO, Zeiss, Carl Zeiss)으로 이미지를 얻었다.
12. 동물 모델 및 처리
6주령, 암컷 C57BL/6 생쥐를 이용하여 L929-EV의 생채 내 상처 치유효과를 확인하였다. 털을 제거하고, 피부를 절개하는 동안 2.5% 이소플루란 (Merial, Lyon, France)을 처리하여 생쥐를 마취시켰다.
생쥐를 마취시키고 생쥐 등의 털을 전기면도기로 제거하고 포비돈-아이오딘 및 70% 알코올을 이용하여 살균하였다. biopsy punch를 이용하여 8mm 피부 상처를 제작하고, 수축을 방지하기 위해 내경 8 mm 및 외경 12mm 실리콘 링을 부착시켰다 (Dermabond®, Ethicon, USA).
즉시 (0일) 및 대조군은 아무것도 처리되지 않았으며, 피브린 글루군 (FG, n=6)은 FG fibrin glue (FG; Greenplast Q, GC Pharma, Korea) 100μl를 실리콘 링 내부 상처에 처리하였으며, FG + L929-EVs 군은 L929-EVs (100μg in 20μl) 및 FG(100μl)를 실리콘 링 내부 상처에 처리하였다.
마지막으로, 모든 군의 생쥐 상처를 Tegaderm™ transparent film (3 M, London, UK)으로 덮고 2인치 elastic support bandage로 약하게 고정하였다.
4일째 다시 한 번 처리하였으며, 상처는 0, 4, 8 및 14일 마다 확인하였다.
13. 상처 치유 확인
0, 4, 8 및 14일의 총 상처 측정을 위해, 앞서 보고된 방법(Park GY, Yeum JH, Yang DJ, et al. Moisture Wound Healing Characteristics of Alginate Sponge and Hydrogel. 폴리머. 2018; 42: 112-8. )으로 Visitrak Grid films 및 Visitrak Digital wound analysis system (Smith & Nephew, UK)을 수행하였다. 상처 치유 백분율을 하기 식으로 계산하였다.
상처 치유(%) = (W0-Ui)/W0×100
상처 수축(%) = (W0-Wi)/W0×100
상처 상피화(%) = (Wi-Ui)/W0×100
14. 조직학적 분석 및 면역조직화학
4, 8 및 14일 째 피부 조직을 수집하고 RIPA 용액과 단백질분해효소 억제제 칵테일로 조직 추출물을 준비하였다. 조직 시료를 10% 포르말린 버퍼로 고정시키고 파라핀에 포매시킨 블록을 5 micron 절편으로 절단하였다. 절편을 표준 헤마톡실린 & 에오신 (H & E) 또는 Masson's trichrome 염색하였다.
또한, 앞서 보고된 방법(Sawant SS, Chaukar DA, Joshi SS, et al. Prognostic value of tissue polypeptide antigen in oral squamous cell carcinoma. Oral Oncol. 2011; 47: 114-20.)으로 상기 조직 절편에 면역조직화학 (IHC)을 수행하였다. 간략하게, 첫번째로 파라핀 피부 절편의 파라핀을 제거하고 항원 검색을 위해 Na-구연산염 완충액 (pH 6.0)으로 전자파 처리하였다.
내인성 퍼옥시다제 불활성화 후 피부 절편을 10% 면역이전혈청에 인큐베이션하였다. Avidin-Biotin-Peroxidase Complex kit (Dako Corp. CA, USA)에 따라, 피부 절편을 1차 항-β-catenin (Abcam, Cambridge, United Kingdom) 또는 항-CD31 (Abcam) 항체를 1:200로 희석하여 추가로 검출하였다. 모든 슬라이드는 광학현미경(Leica Microsystems, Wetzlar, Germany)에서 분석되었다.
<실시예 1> 마우스 섬유아세포로부터 분리된 세포외 소포체의 특징 확인
면역형광 분석을 수행하여 비멘틴(vimentin) 및 α-SMA와 같은 섬유아세포 바이오마커 발현을 L929 세포에서 도 1A와 같이 확인하였다.
도 1B와 같이 L929 세포외 소포체(EV)를 L929 세포 배양물로부터 수집된 배지에서 분리하였으며, 분리된 L929-EV의 형태를 투과전자현미경(TEM)로 분석하였다.
그 결과, 도 1C를 참고하면 L929-EV의 TEM 이미지와 같이 대부분의 L929-EV가 원형 또는 구형 형상을 나타내었으며, 상기 결과로부터 분리과정에서 L929-EV가 전혀 손상되지 않은 것을 확인할 수 있었다.
EV의 양성 및 음성 바이오마커의 웨스턴 블롯 분석 결과, 도 1D와 같이 테트라 스파닌 막 단백질 CD63은 L929 세포보다 L929-EV에서 매우 풍부한 것으로 확인되었으며, L929-EV에서 GM130 (골지장치 단백질)의 부재를 통하여 L929-EV이 세포 또는 세포 소기관으로 오염되지 않은 것을 확인할 수 있었다.
상기 결과로부터 배양 배지로부터 L929-EV의 분리가 성공적으로 이루어진 것이 확인되었다.
<실시예 2> L929-EV의 섬유아세포로의 내재화
L929-EV이 상호작용하고 L929 세포로 내재화될 수 있는지 여부를 확인하였다. L929-EV 및 L929-EVsDiD와 L929 세포를 4시간 동안 인큐베이션하고 형광 현미경으로 이미지화하여 확인하였다.
그 결과, 도 2와 같이 L929-EV가 L929 세포의 세포 표면과 상호작용한 후 내재화되는 것을 확인할 수 있었다.
<실시예 3> L929-EV 처리에 따른 섬유아세포의 증식 및 이동 향상 효과 확인
섬유아세포 이동 및 증식은 상처 치유를 위한 기본 과정으로, L929-EVs (10-50 μg/ml)가 L929 세포 증식에 미치는 영향을 확인하였다.
그 결과, 도 3A와 같이 대조군과 비교하여 L929-EV 처리된 L929 세포의 증식이 용량의존적으로 현저하게 증가되는 것을 확인할 수 있었다 (p<0.05 :0 μg/ml vs 20 μg/ml; p<0.00: 0 μg/ml vs 30-50 μg/ml).
또한, L929 세포에 L929-EV (20 and 40 μg/ml) 및 PBS 처리 후 상처 치유 이동분석을 수행한 결과, 도 3B와 같이 18시간째에 L929-EV 처리된 L929 세포 이동이 대조군과 비교하여 용량의존적으로 유의하게 증가된 것을 확인할 수 있었으며, 36시간째 역시 도 3B 및 도 3C와 같이 대조군과 비교하여 용량의존적으로 L929-EV가 처리된 L929 세포 이동이 유의하게 증가되는 것을 확인할 수 있었다.
상기 결과로부터 L929-EV의 내재화는 섬유아세포의 증식 및 이동 증가를 유도하는 것이 확인되었다.
<실시예 4> 섬유아세포에서 무흉터 상처 치유와 관련된 유전자의 발현에 대한 L929-EV의 영향 확인
섬유아세포에서 ECM 관련 유전자의 발현에 대한 L929-EV의 영향을 확인하였다. 그 결과, 도 4A 내지 도 4C와 같이 L929-EVs (20 및 40 μg/ml) 처리 후 MMP1, MMP3 및 Col3A1의 mRNA 발현이 증가되었다. L929-EV 20μg/ml이 처리된 세포군에서는 MMP1 및 MMP3 mRNA 수준이 상당히 증가였으나, Col3A1 수준은 변화가 나타나지 았았다. 반면, L929-EV 40 μg/ml가 처리된 세포군에서는 상기 mRNA 수준이 모두 증가하는 것을 확인할 수 있었다.
상기 결과로부터 L929-EV 처리는 섬유아세포에서 무흉터 상처 치유와 관련된 유전자의 증가를 유도하는 것이 확인되었다.
<실시예 5> L929-EV의 내피세포 내재화 확인
L929-EV가 상호작용하여 SVEC4 세포 내로 내재화 될 수 있는 지 여부를 확인하기 위해, L929-EVs 및 L929-EVsDiD를 내피세포와 4시간 동안 함께 배양하고 형광현미경 이미지로 확인하였다.
그 결과, 도 5와 같이 L929-EV는 세포 막과 상호작용한 후 내피세포 내로 내재화 되는 것을 확인할 수 있었다.
<실시예 6> L929-EV 처리에 따른 내피세포의 이동 및 관 형성 효과 확인
L929-EV (15 및 30 μg/ml) 및 PBS 처리 후 내피세포의 세포 이동 분석을 수행하였다. 24시간 후 도 6A와 같이 L929-EV이 처리된 내피세포의 이동이 대조군과 비교하여 용량의존적으로 유의하게 증가된 것을 확인할 수 있었다.
또한, SVEC4 세포에 L929-EV (15 및 30 μg/ml) 및 PBS 처리 후 관형성 분석을 수행하였다.
그 결과, 도 6B와 같이 처리 3시간 후 대조군과 비교하여 L929-EV 처리군에서 용량의존적으로 관 형성이 증가되는 것을 확인할 수 있었다.
상기 결과로부터 내피세포로 내재화된 L929-EVs는 내피세포의 이동 및 관형성 증가를 유도하는 것이 확인되었다.
<실시예 7> 피브린 글루 및 L929-EV 처리에 따른 상처 치유 향상 효과 확인
피부 상처 치유에 대한 피브린 글루 및 L929-EV의 효과를 확인하기 위해, 도 7A 및 도 7B와 같이 생쥐 등 피부의 전층에 상처를 생성하고, FG 또는 FG+L929-EV를 처리한 후 사진 분석을 수행하여 상처 회복 수준을 확하였으며, 도 7A 및 도7C와 같이 웨스턴 블롯 및 조직학적 분석을 수행하였다.
그 결과, 도 8A 및 도 8B와 같이 상처 발생 4일 후 대조군과 비교하여 FG 처리된 동물 상처의 봉합이 현저하게 가속화(p<0.05)되었으며, 대조군과 비교하여 FG+L929-EV가 처리된 생쥐군에서도 높은 수준(p<0.01)의 상처 봉합 효과가 확인되었다. 반면, FG+L929-EV 처리군과 비교하여 피브린 글루(FG)가 처리된 실험군에서는 상처 봉합에 유의한 변화가 나타나지 않았다.
또한, 상처 발생 후 8일째, 대조군과 비교하여 FG 처리된 동물에서는 유의한 상처 봉합 효과가 확인되지 않은 반면, 대조군과 FG 처리군과 비교하여 FG+L929-EV 처리된 생쥐에서는 현저하게 높은 수준의 상처 봉합 효과가 확인되었다.
상처 발생 후 14일째에는 대조군과 비교하여 FG 처리된 동물에서는 유의한 상처 봉합 효과가 확인되지 않았으나, FG+L929-EV 처리된 생쥐는 대조군(p<0.001) 및 FG (p<0.01) 처리군과 비교하여 현저하게 높은 수준의 상처 봉합 효과가 확인되었다.
상기 결과로부터 피브린 글루는 상처 초기에만 회복을 가속화시킨 반면, L929-EV와 피브린 글루의 병합 처리는 모든 실험기간 동안 일정한 상처 치유 가속화를 나타내는 것이 확인되었다.
<실시예 8> 피브린 글루 및 L929-EV 처리에 따른 상처 피부 구조, 콜라겐 침착 및 성숙 효과 확인
피브린 글루 및 L929-EV 처리에 따른 상처 피부 구조, 콜라겐 침착 및 성숙 효과를 확인하였다.
도 9A를 참고하면, 절개된 조직의 H&E 염색 분석을 수행한 결과, 8일째 FG+L929-EV 군에서 FG군과 대조군과 비교하여 조밀하게 채워진 세포가 확인되었으며, 침윤성 염증 세포는 FG+L929-EV 처리군보다 FG 군에서 더 높게 나타났다.
8일 째, 대조군은 FG 및 FG+L929-EVs 처리군의 4일째와 유사한 구조적 패턴을 나타내었으며, 8일 째 FG+L929-EV군에서는 더욱 일반적인 피부 부속기관 (머리, 피지선, 땀샘)이 확인되었으나, FG 및 대조군에서는 확인되지 않았다.
또한, 14일째 대조군에서는 표피를 거의 확인할 수 없었고, FG군에서는 표피가 확인되었으나 상처 명확한 가시세포 및 기저세포 층이 확인되지 않았기 때문에 상처가 완전히 회복되지 못하였다. 반면, FG+L929-EV이 처리된 군에서는 상기 가시세포 및 기저세포 층이 모두 확인되었다.
콜라겐 침착 및 성숙은 조직의 유연성 강도를 개선하였으며, 피부 치유를 유도할 수 있다. 이에 따라, 8일째 Masson’s trichrome 염색을 수행한 결과, 도 9B와 같이 FG+L929-EV 처리 군에서 FC 및 대조군과 비교하여 상처 부위에 콜라겐 증가가 확인되었으며, FG 처리군에서는 상대적으로 낮은 콜라겐 함량이 확인되었으며, 대조군에서는 콜라겐이 확인되지 않았다.
또한, 14일째에는 FG 및 대조군보다 FG+L929-EV 처리군에서 성숙된 콜라겐이 확인되었다.
<실시예 9> 상처에서 피브린 글루 및 L929-EV 처리에 따른 혈관형성 및 모발 촉진 효과 확인
혈관형성은 상처 치유에 중요하기 때문에 4, 8 및 14째 웨스턴 블롯을 수행하여 피부에서 VEGF의 발현을 확인하였다.
그 결과, 도 10과 같이 8일 째에는 FG+L929-EV 처리군의 VEGF 수준이 다른 실험군보다 매우 높게 나타났으며, 14일째의 VEGF 수준은 대조군과 비교하여 FG+L929-EV 처리군에서 약 2배 이상 증가된 것을 확인할 수 있으며, FG군 보다는 상당히 증가된 것을 확인할 수 있었다.
또한, CD31에 대한 IHC 염색을 수행하여 새로 형성되고 성숙된 혈관 수를 확인하였다.
그 결과, 도 11A와 같이 8일째 다른 두 그룹보다 FG+L9292-EV 처리군에서 새로운 혈관이 명확하게 확인되었으며, 14일째에는 다른 두 그룹과 비교하여 FG+L929-EV 군에서 상당히 높은 혈관 밀도를 나타내었다. 혈관 밀도는 피부의 VEGF 발현과 정확하게 일치하였다.
또한, 머리 모낭과 연관된 β-카테킨 발현 확인을 통하여 FG+L929-EV이 모발 성장을 자극할 수 있는 지 확인하였다.
그 결과, 도 11B와 같이 8일째 FG+L929-EV 처리군에서는 β-카테킨이 매우 높게 발현된 반면, FG 및 대조군의 진피에서는 β-카테킨 발현이 나타나지 않았다. 또한, 14일째에는 β-카테킨이 FG+L929-EV 군에서 매우 높게 발현되었으며, 다음으로 FG 군에서 발현이 확인된 반면, 대조군의 진피에서는 β-카테킨 발현이 나타나지 않았다.
상기 결과로부터 FG+L929-EV은 혈관생성 및 모발 성장을 촉진시키는 것을 확인할 수 있었다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.

Claims (8)

  1. 섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 피부 및 점막 창상 치료용 약학조성물.
  2. 청구항 1에 있어서, 상기 창상은 화상, 열상, 표피 창상, 궤양, 외상, 외과적 수술(post-surgical), 출산, 만성적 상처(chronic wound) 및 피부염(dermatitis)에 의한 손상으로 이루어진 군에서 선택되는 것을 특징으로 하는 피부 및 점막 창상 치료용 약학조성물.
  3. 청구항 1에 있어서, 상기 약학조성물은 스캐폴드(scaffold)를 추가로 더 포함하는 것을 특징으로 하는 피부 및 점막 창상 치료용 약학조성물.
  4. 청구항 3에 있어서, 상기 스캐폴드는 피브린 글루(fibrin glue), 키토산, 알긴산, 엘라스틴, 히알루론산, 콜라겐, 프로테오글리칸 및 하이드로겔로 이루어진 군에서 하나 또는 둘 이상의 조합으로 선택되는 것을 특징으로 하는 피부 및 점막 창상 치료용 약학조성물.
  5. 청구항 1에 있어서, 상기 섬유아세포 유래 세포외 소포체는 피부 및 점막 창상 부위로 세포의 이동을 증가시키고, 콜라겐 침착 및 성숙을 유도하는 것을 특징으로 하는 피부 및 점막 창상 치료용 약학조성물.
  6. 섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 피부 및 점막 재생 또는 손상 회복용 외용제 조성물.
  7. 피부 및 점막 창상 부위에 세포외 소포체 유도물질을 투여하는 단계; 및
    상기 유도물질이 피부 및 점막 창상 부위에서 섬유아세포 유래 세포외 소포체의 분비를 촉진시키는 단계를 포함하는 피부 및 점막 창상 개선 또는 치료방법.
  8. 인간을 제외한 개체로부터 분리된 섬유아세포에 후보물질을 처리하는 단계;
    상기 후보물질이 처리된 섬유아세포로부터 분비된 세포외 소포체 수준을 확인하는 단계; 및
    대조구 시료와 비교하여 섬유아세포로부터 세포외 소포체 분비를 증가시킨 후보물질을 선별하는 단계를 포함하는 창상 치료제 스크리닝 방법.
PCT/KR2021/006992 2020-06-18 2021-06-04 섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 피부 및 점막 창상 치료용 조성물 Ceased WO2021256751A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200074094A KR102384368B1 (ko) 2020-06-18 2020-06-18 섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 피부 및 점막 창상 치료용 조성물
KR10-2020-0074094 2020-06-18

Publications (1)

Publication Number Publication Date
WO2021256751A1 true WO2021256751A1 (ko) 2021-12-23

Family

ID=79177146

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/006992 Ceased WO2021256751A1 (ko) 2020-06-18 2021-06-04 섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 피부 및 점막 창상 치료용 조성물

Country Status (2)

Country Link
KR (1) KR102384368B1 (ko)
WO (1) WO2021256751A1 (ko)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4245306A1 (en) * 2022-03-16 2023-09-20 Fibrobiologics, Inc. Therapeutic use of fibroblasts for use in wound healing
CN116807966A (zh) * 2023-07-25 2023-09-29 南方医科大学南方医院 一种负载姜黄来源类细胞外囊泡纳米粒子的气凝胶材料及其制备与应用
EP4410320A1 (en) * 2023-02-06 2024-08-07 FibroBiologics, Inc. Reuse of fibroblasts for skin augmentation

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130068530A (ko) * 2011-12-15 2013-06-26 삼성전자주식회사 세포배양에서 엑소좀의 정량 방법 및 이를 이용한 엑소좀의 수득율을 증가시키는 방법
JP5641388B2 (ja) * 2009-05-01 2014-12-17 独立行政法人理化学研究所 創傷治療剤及びそのスクリーニング方法
KR20170106149A (ko) * 2016-03-11 2017-09-20 가톨릭관동대학교기술지주 주식회사 물리적 자극에 의한 환경유입을 이용한 세포 리프로그래밍 방법
KR20190088895A (ko) * 2018-01-19 2019-07-29 남부대학교산학협력단 프로스타좀 분비 조절용 조성물 및 이의 용도
KR20200037918A (ko) * 2018-10-02 2020-04-10 주식회사 스템온 유도된 엑소좀을 포함하는 피부 재생 및 상처 치유용 조성물
CN110975000A (zh) * 2019-11-25 2020-04-10 北京航空航天大学 一种抗菌改性外泌体烧创伤促愈生物敷料的制备和用途

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3254684B1 (en) 2016-06-08 2019-10-23 Lysatpharma GmbH Human platelet lysate or fraction enriched in human platelet-derived extracellular vesicles, for use in medicine

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5641388B2 (ja) * 2009-05-01 2014-12-17 独立行政法人理化学研究所 創傷治療剤及びそのスクリーニング方法
KR20130068530A (ko) * 2011-12-15 2013-06-26 삼성전자주식회사 세포배양에서 엑소좀의 정량 방법 및 이를 이용한 엑소좀의 수득율을 증가시키는 방법
KR20170106149A (ko) * 2016-03-11 2017-09-20 가톨릭관동대학교기술지주 주식회사 물리적 자극에 의한 환경유입을 이용한 세포 리프로그래밍 방법
KR20190088895A (ko) * 2018-01-19 2019-07-29 남부대학교산학협력단 프로스타좀 분비 조절용 조성물 및 이의 용도
KR20200037918A (ko) * 2018-10-02 2020-04-10 주식회사 스템온 유도된 엑소좀을 포함하는 피부 재생 및 상처 치유용 조성물
CN110975000A (zh) * 2019-11-25 2020-04-10 北京航空航天大学 一种抗菌改性外泌体烧创伤促愈生物敷料的制备和用途

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4245306A1 (en) * 2022-03-16 2023-09-20 Fibrobiologics, Inc. Therapeutic use of fibroblasts for use in wound healing
EP4410320A1 (en) * 2023-02-06 2024-08-07 FibroBiologics, Inc. Reuse of fibroblasts for skin augmentation
CN116807966A (zh) * 2023-07-25 2023-09-29 南方医科大学南方医院 一种负载姜黄来源类细胞外囊泡纳米粒子的气凝胶材料及其制备与应用

Also Published As

Publication number Publication date
KR20210156466A (ko) 2021-12-27
KR102384368B1 (ko) 2022-04-07

Similar Documents

Publication Publication Date Title
WO2017123022A1 (ko) 고함량의 성장인자를 함유한 줄기세포 유래 엑소좀
WO2016167527A1 (ko) 백미 추출물의 지표성분인 시나프산 또는 이를 함유하는 백미 추출물을 함유하는 피부재생용 화장료 조성물 및 상처 치료용 약학 조성물
WO2016072821A1 (ko) 줄기세포 유래 엑소좀을 함유하는 지방세포 분화유도, 지방조직 재생, 피부 미백 또는 주름개선용 조성물
KR102384368B1 (ko) 섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 피부 및 점막 창상 치료용 조성물
WO2021201637A1 (ko) 제대혈 줄기세포에 의해 고효능의 엑소좀이 고함량으로 분비된 배양액의 제조 방법 및 이의 용도
WO2019198995A1 (ko) 엑소좀 기반의 면역세포의 교차분화 방법
WO2021034162A1 (ko) 유사교세포로 분화 유도된 후기 단계의 인간 중간엽 줄기세포를 유효성분으로 함유하는 뇌졸중 치료용 약학적 조성물
WO2022158784A1 (ko) 페놀 유도체가 수식된 탈세포화된 조직 유래 세포외기질 및 이의 용도
WO2023048339A1 (ko) 인간 편도줄기세포 유래 소포체를 유효성분으로 포함하는 조성물
WO2019004792A9 (ko) 인간 유래 심장 줄기세포 미세구의 제조 방법 및 용도
WO2020091463A1 (ko) 분리된 미토콘드리아를 포함하는 건병증 예방 또는 치료용 약학 조성물
WO2020138674A1 (ko) 근육 이완용 조성물
WO2025053666A1 (ko) 중간엽 줄기세포 스페로이드, 이의 제조방법 및 이를 포함하는 조성물
WO2022211493A1 (ko) 갈롤 유도체가 수식된 펙틴 및 그의 용도
WO2022119418A1 (ko) Gdf-3를 고발현하는 제대혈 줄기세포 분리 및 배양 방법 및 gdf-3의 용도
WO2015178728A1 (ko) 플로로탄닌 분획물을 이용한 중간엽 줄기세포로부터 유도만능 줄기세포를 제조하는 방법
WO2018004237A1 (ko) 트롬빈 처리 줄기세포에서 유래된 엑소좀을 포함하는 피부상처 치료용 조성물
WO2024128496A1 (ko) 줄기세포 유래 엑소좀을 포함하는 피부 노화 억제 조성물 및 이의 제조방법
WO2019190290A1 (ko) 피부장벽 기능 이상의 개선용 조성물
WO2022265150A1 (ko) 불멸화 줄기세포의 엑소좀 풍부 배양액 및 보툴리눔 독소를 포함하는 기능성 조성물
WO2023080413A1 (ko) 줄기세포 배양액 및 이로부터 분리된 엑소좀을 유효성분으로 포함하는 안구 질환의 예방 또는 치료용 약학적 조성물
WO2018088733A1 (ko) 신규의 프로테인 트랜스덕션 도메인 및 이의 용도
WO2018021771A1 (ko) TIF1γ의 발현 또는 활성 증강제를 유효성분으로 포함하는 간 섬유화 또는 간경화 예방 또는 치료용 조성물
WO2025048545A1 (ko) 중간엽 줄기세포 스페로이드를 포함하는 피부 상처 또는 흉터 치료용 조성물
WO2024122726A1 (ko) 연골 재생용 펩타이드 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21826177

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21826177

Country of ref document: EP

Kind code of ref document: A1