WO2022119418A1 - Gdf-3를 고발현하는 제대혈 줄기세포 분리 및 배양 방법 및 gdf-3의 용도 - Google Patents

Gdf-3를 고발현하는 제대혈 줄기세포 분리 및 배양 방법 및 gdf-3의 용도 Download PDF

Info

Publication number
WO2022119418A1
WO2022119418A1 PCT/KR2021/018355 KR2021018355W WO2022119418A1 WO 2022119418 A1 WO2022119418 A1 WO 2022119418A1 KR 2021018355 W KR2021018355 W KR 2021018355W WO 2022119418 A1 WO2022119418 A1 WO 2022119418A1
Authority
WO
WIPO (PCT)
Prior art keywords
gdf
cord blood
stem cells
blood stem
cells
Prior art date
Application number
PCT/KR2021/018355
Other languages
English (en)
French (fr)
Inventor
이재용
안희진
이예인
이동열
나규흠
Original Assignee
주식회사 프리모리스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 프리모리스 filed Critical 주식회사 프리모리스
Priority to US18/265,142 priority Critical patent/US20230406897A1/en
Priority to EP21901106.1A priority patent/EP4257674A1/en
Priority to JP2023534204A priority patent/JP2024500063A/ja
Priority to CN202180092901.6A priority patent/CN116848232A/zh
Publication of WO2022119418A1 publication Critical patent/WO2022119418A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0665—Blood-borne mesenchymal stem cells, e.g. from umbilical cord blood
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/48—Reproductive organs
    • A61K35/51—Umbilical cord; Umbilical cord blood; Umbilical stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/98—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution of animal origin
    • A61K8/981—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution of animal origin of mammals or bird
    • A61K8/983—Blood, e.g. plasma
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0014—Skin, i.e. galenical aspects of topical compositions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/08—Anti-ageing preparations
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0656—Adult fibroblasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/11—Epidermal growth factor [EGF]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/115—Basic fibroblast growth factor (bFGF, FGF-2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/15—Transforming growth factor beta (TGF-β)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/165—Vascular endothelial growth factor [VEGF]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/90—Polysaccharides
    • C12N2501/91—Heparin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2533/00—Supports or coatings for cell culture, characterised by material
    • C12N2533/50—Proteins
    • C12N2533/52—Fibronectin; Laminin

Definitions

  • the present invention relates to a method for isolating and culturing cord blood stem cells that express high GDF-3 and various uses of GDF-3.
  • Animal cell culture includes primary culture and subculture.
  • Primary culture is the process of separating and culturing cells from tissue pieces.
  • Subculture is a method of culturing cells to continuously maintain cells obtained through primary culture.
  • Normal animal cell lines are mortal and thus have a limited number of cell divisions. In the case of culturing normal cells, most of them grow in the state of undifferentiated stem cells or progenitor cells, and the proliferation stops when differentiation starts. On the other hand, in the case of cells derived from tumor tissue, growth and differentiation are mixed, so they grow continuously.
  • Subculture is a method of continuously culturing cells by transferring them to a new culture dish periodically every 2 to 7 days for cell proliferation. In a limited culture dish, nutrients are insufficient and cells stop proliferating due to secreted metabolites. In the subculture method, the cells are removed from the culture dish and cultured in a new culture dish because the cells stop growing and stop as a single layer. In addition, there is a method of three-dimensional culture in a dedicated culture device using a cell disk or micro-carrier.
  • Cells derived from animal tissues can be continuously cultured for primary, secondary, tertiary, and the like. However, most cells do not proliferate any more and the cells die after culturing to a certain extent if this subculture is continued. Most cells exhibit culture senescence as the number of divisions increases, and because the properties of cells change over time, subculture can be performed only a certain number of times.
  • Stem cells are undifferentiated cells with the ability to self-proliferate and differentiate into various tissue cells, and are classified into embryonic stem cells, adult stem cells, and dedifferentiated stem cells.
  • Embryonic stem cells are stem cells isolated from the cell mass in the blastocyst. They have pluripotency capable of differentiating into any cell or tissue in our body, so they can be used for therapeutic purposes. There is a big possibility and there are ethical issues.
  • Retrodifferentiated stem cells are cells that have the same differentiation capacity as embryonic stem cells by introducing a gene that causes retrodifferentiation into adult somatic cells. There are risks involved in using it for substantive therapeutic purposes.
  • Adult stem cells are undifferentiated cells that exist in body tissues and play a role in replacing dead or damaged cells. Unlike embryonic stem cells, they are stably differentiated, so the possibility of tumors is low, and as they do not destroy fertilized eggs, there is no ethical problem.
  • Adult stem cells can be collected from fat, bone marrow, umbilical cord blood, etc.
  • Adipose and bone marrow stem cells are collected from a donor using an invasive method, and the function and efficacy of stem cells differ depending on the age and health status of the donor.
  • Cord blood stem cells use discarded cord blood without using an invasive method, and since cord blood of a similar gestational age (40 weeks) is used, there is little difference in stem cell function and efficacy between donors.
  • Mesenchymal stem cells are undifferentiated adult stem cells that exist between differentiated cells of tissues or organs, and have self-renewal ability to proliferate. In addition, it can be easily proliferated in vitro and can be differentiated into various tissue cells such as adipocytes, osteocytes, chondrocytes, and myocytes, so that it can be used for tissue regeneration using a differentiation function.
  • Mesenchymal stem cells secrete various growth factors and cytokines such as epidermal growth factor and fibroblast growth factor to produce collagen from fibroblasts. It is known to play an important role in skin regeneration.
  • mesenchymal stem cells isolated from the human body can be improved to be suitable for treatment, and various growth factors or proteins secreted from stem cells can be used to apply to various diseases such as immunomodulation and anti-inflammatory.
  • Various growth factors or proteins secreted from stem cells can be used industrially, such as pharmaceuticals or cosmetics.
  • the technology to contain a high concentration of growth factors in a stem cell culture medium or stem cell-derived composition is still insufficient, and a new method for preparing a culture medium or composition for promoting the synthesis of extracellular matrix containing a high concentration of growth factors is required. .
  • the extracellular matrix is a cell structure formed by various substances secreted by the cell out of the cell, and fills the space between cells and connects cells and tissues.
  • the extracellular matrix not only provides structural support for cells and connections between cells, but also plays an important role in cell-to-cell communication, including signal transduction, and in embryonic development and cell differentiation.
  • the extracellular matrix consists of water, protein, and polysaccharides, and each tissue forms and retains the extracellular matrix of its own shape and phase from the beginning of its creation.
  • the junction between the extracellular matrix and the cell is achieved through extracellular matrix receptors such as integrins, discoidin domain receptors, and syndecans, and this junction is achieved through the cytoskeleton. and the extracellular matrix.
  • the extracellular matrix has a very dynamic structure and is continuously reformed, and the physical and biochemical properties of the extracellular matrix enable organs in living organisms to have unique physical properties such as tensile strength and elasticity.
  • the extracellular matrix consists of two large molecules, one is proteoglycan (PG), a polysaccharide complex with proteins, and the other is a fibrous protein that is insoluble in water such as collagen and keratin. .
  • Proteoglycan is the most abundant substance between cells and tissues, exists in the form of a hydrated gel, and plays various roles by using properties such as buffering, hydration, binding and resistance .
  • Collagen the most abundant protein among several types of fibrous proteins, accounts for about 30% of the total protein in multicellular animals. Collagen is responsible for the structure of the extracellular matrix, is involved in elasticity, cell adhesion, cell migration, and tissue development, and is linked with another fibrous protein, elastin. Elastin fibers are involved in the elasticity of tissues that require repeated stretching actions. However, the elongation of elastin fibers is very limited because they are closely connected with collagen fibers. Another fibrous protein is fibronectin (FN), which organizes the extracellular matrix and is responsible for the connection between the cell and the extracellular matrix.
  • FN fibronectin
  • the stem cell marker GDF-3 (Growth Differentiation Factor-3) is a TGF- ⁇ superfamily and activates nodal signaling to activate the transcriptional action of skin regeneration-related proteins such as collagen, fibronectin, and TGF-BI. .
  • the correlation between GDF-3 and stem cells has been mainly studied in embryonic stem cells (ESCs).
  • GDF-3 is known as a stemness marker of ESCs. nothing has been revealed
  • An object of the present invention is to provide a method for producing umbilical cord blood stem cells highly expressing the GDF-3 gene, and various uses of GDF-3.
  • the present invention is a high-efficiency cord blood-derived, characterized in that mononuclear cells isolated from cord blood are secured with a fast-proliferating cord blood stem cell using a newly designed culture medium for stem cell culture in a culture vessel coated with fibronectin.
  • An object of the present invention is to provide a method for isolating stem cells.
  • an object of the present invention is to provide a method for improving the persistence of cell proliferation and secretion of extracellular matrix components through induction of increased expression of GDF-3 in stem cells.
  • it is intended to provide a culture medium composition containing the extracellular matrix component by inducing cell proliferation and secretion of the extracellular matrix component using the high-expressing GDF-3 cord blood stem cells.
  • a first aspect of the present invention provides a method for producing GDF-3, characterized in that GDF-3 is expressed by culturing cord blood stem cells.
  • a second aspect of the present invention provides a method for producing GDF-3 expressing cord blood stem cells, which is characterized by isolating and culturing cord blood stem cells having a fast cell doubling time in order to secure GDF-3 high-expressing cord blood stem cells. to provide.
  • umbilical cord blood mononuclear cells isolated from cord blood are seeded in a medium containing TGF- ⁇ superfamily growth factor and cultured, and mononuclear cells that are attached to a culture dish and proliferate relatively quickly. It provides a GDF-3 high-expressing cord blood stem cell characterized in that it is selectively isolated and cultured.
  • a fourth aspect of the present invention provides a composition for increasing fibroblast growth, characterized in that it contains GDF-3.
  • a fifth aspect of the present invention provides a composition for skin regeneration characterized in that it contains GDF-3.
  • the present inventors conducted various experiments in consideration of the fact that it is easy to construct a Master Cell Bank when it is possible to secure a lot of stem cells themselves, and it is possible to secure a large amount of cells and culture medium containing a high content of active ingredients by using this.
  • Cord blood stem cells isolated and cultured according to the present invention exhibit high GDF-3 expression characteristics.
  • the proliferation of stem cells decreases, so it is difficult to secure a sufficient number of cells. It has the advantage of being able to secure a large amount of stem cells.
  • the proliferation rate of stem cells is high, the concentration of the extracellular matrix component secreted by the cells is also confirmed to be high, so that it is possible to produce a raw material with excellent efficacy/effectiveness when producing a culture solution composition using high-expressing GDF-3 cord blood stem cells.
  • the method for isolating and culturing high-expressing GDF-3 stem cells is characterized in that a newly designed medium for culturing stem cells is used. At this time, the newly designed culture medium for stem cells was added with various growth factors including the TGF- ⁇ superfamily.
  • Cord blood stem cells isolated and cultured according to the present invention can secure cord blood stem cells having a cell doubling time of less than 24 hours.
  • GDF-3 can increase the growth of fibroblasts (FIG. 8).
  • fibroblasts that increase growth by GDF-3 There are Human Dermal Fibroblasts.
  • GDF-3 can thereby increase the expression of each gene(s) of GDF-3, collagen and/or fibronectin in fibroblasts ( FIG. 8 ).
  • a method for producing GDF-3 expressing cord blood stem cells is characterized by isolating and culturing cord blood stem cells with a fast cell doubling time to secure GDF-3 high-expressing cord blood stem cells.
  • the present invention can construct a cell bank for cord blood stem cells with high GDF-3 expression.
  • umbilical cord blood mononuclear cells isolated from cord blood are seeded and cultured in a medium containing TGF- ⁇ superfamily growth factor, and mononuclear cells that are attached to a culture dish and proliferate relatively quickly are selectively isolated.
  • Cultured, high-expressing GDF-3 cord blood stem cells can be constructed as a cell bank.
  • the method for producing a high-expressing GDF-3 cord blood stem cell is characterized by isolating and culturing cord blood stem cells having a fast cell doubling time in a medium (Example 1).
  • the method for producing GDF-3 expressing umbilical cord blood stem cells is
  • a first step of culturing by seeding the umbilical cord blood mononuclear cells isolated from the cord blood in a medium containing TGF- ⁇ superfamily growth factor;
  • cells that do not adhere to the culture dish may be removed and only adherent mononuclear cells may be cultured.
  • the GDF-3 expressing cord blood stem cells prepared according to the present invention can be differentiated into adipocytes, cartilage (Chondrocyte) and/or osteocytes (Osteocyte). Therefore, the high-expressing GDF-3 cord blood stem cells can be used as a cell therapy.
  • the GDF-3 expressing cord blood stem cells prepared according to the present invention can be used to prepare a GDF-3 containing culture solution by culturing them.
  • the present invention can produce a culture solution containing GDF-3 by separating and culturing umbilical cord blood-derived stem cells that highly express GDF-3.
  • the method for producing GDF-3 expressing cord blood stem cells according to an embodiment of the present invention is characterized in that the cord blood stem cells are separated and cultured in a medium containing TGF- ⁇ superfamily growth factor. In this case, it is possible to secure GDF-3 high-expressing cord blood stem cells with excellent growth ability during subculture.
  • cord blood stem cells are isolated and cultured in a medium containing various growth factors including the TGF- ⁇ superfamily, and subcultured to secure a large amount of cord blood stem cells It can be done (FIG. 3).
  • GDF-3 expressing cord blood stem cells according to an aspect of the present invention are subcultured to have excellent extracellular matrix component secretion ability It is possible to secure a large amount of cord blood stem cells (FIG. 4).
  • GDF-3 a stem cell marker
  • TGF- ⁇ Superfamily TGF- ⁇ Superfamily.
  • TGF- ⁇ is a pleiotropic factor, and has the characteristic of a multifunctional growth factor.
  • TGF- ⁇ signaling plays a critical role in various biological processes and performs various functions such as cell growth inhibition, apoptosis, differentiation and epithelial-mesenchymal transition (EMT).
  • EMT epithelial-mesenchymal transition
  • the TGF- ⁇ signaling pathway is tightly regulated and plays a crucial role in development and organogenesis, as well as maintenance of cellular homeostasis.
  • disturbance of TGF- ⁇ signaling leads to life-threatening diseases such as cancer, fibrosis and congenital malformations.
  • TGF- ⁇ exhibits cancer-suppressing activity in the early stage of the cancer process, but promotes cancer growth in the late stage of the cancer process.
  • TGF- ⁇ 1 is expressed in large amounts in most cancer tissues, and it is known that cancer patients with high TGF- ⁇ 1 expression are often malignant and have a poor prognosis.
  • TGF- ⁇ secreted from cells initiates signaling by binding to a heterogeneous complex of two types of receptors composed of type I and type II receptors.
  • the type I receptor recognizes it and binds to the type II receptor.
  • the type II receptor phosphorylates the GS site of the type I receptor, the type I receptor kinase is activated.
  • Phosphorylated TGF- ⁇ type I receptor induces activation of Smad2 and Smad3 by phosphorylation of C-terminal serine residues of TGF- ⁇ signaling mediators called Smad2 and Smad3.
  • Smad2 and Smad3 form a complex with Smad4 and migrate to the nucleus to participate in the expression of target genes.
  • TGF- ⁇ tumor suppressive role of TGF- ⁇ has been demonstrated in various studies. Conversely, TGF- ⁇ promotes tumor growth, invasion, and metastasis at advanced stages of cancer. The detailed molecular mechanism for the change in the role of TGF- ⁇ in these opposing cancer progression processes has not yet been clearly elucidated.
  • TGF- ⁇ is known to play an important executive role in determining immune homeostasis and tolerance by inhibiting the function and expansion of many components of the immune system. TGF- ⁇ regulates immune tolerance and inflammatory response. TGF- ⁇ signaling directly inhibits the cytotoxic program of CD8+ T cells.
  • TGF- ⁇ 1 produced in cancer cells induces excessive changes in the signaling pathway of cancer cells. These changes adversely affect cancer cells and tumor-stromal interactions. If cross-talk between cells does not occur normally, it creates a permissive stroma (permissive stroma) and creates an environment in which tumor cells can easily spread. TGF- ⁇ secreted from cancer cells induces cancer cells into cells with traits similar to those of EMT and cancer stem cells (CSCs).
  • CSCs cancer stem cells
  • Cells undergoing EMT have increased migratoryability and are more prone to metastasis. These cells change to a spindle-shape and change their cytoskeleton to facilitate movement to other organs and thus facilitate metastasis. .
  • E-cadherin a protein required for epithelial cell adhesion, and increase in the expression of mesenchymal markers such as N-cadherin, vimentin, and fibronectin appear during EMT.
  • TGF- ⁇ is a true mediator of EMT that activates a variety of transcriptional regulators including SNAI1/2, Twist and ZEB1/2.
  • Tumor cells that undergo EMT acquire cancer stem cell (CSC) properties.
  • TGF- ⁇ which is a pleiotropic factor and a multifunctional growth factor, plays opposing roles in cancer progression, and the detailed molecular mechanism for the conversion of these roles is still unknown. has not been clearly identified Therefore, since GDF-3, a kind of TGF- ⁇ superfamily, is also highly likely to cause the same side effects, after mass production of GDF-3 in vitro using the cord blood stem cells isolated and cultured according to the present invention, the desired administration time, It is preferable to apply it in the body by adjusting the site of administration and/or the dosage.
  • medium refers to a composition containing essential components necessary for cell growth and proliferation in vitro, and includes all of the stem cell culture medium commonly used in the art, for example, DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI 1640, DMEM/F-10 (Dulbecco's Modified Eagle's Medium: Nutrient Mixture F-10), DMEM/F-12 Commercially prepared media, such as (Dulbecco's Modified Eagle's Medium: Nutrient Mixture F-12), ⁇ -MEM ( ⁇ -Minimal essential Medium), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Isocove's Modified Dulbecco's Medium), KnockOut DMEM, etc.
  • an artificially synthesized medium may be used, but is not limited thereto.
  • the medium generally includes a carbon source, a nitrogen
  • GDF-3 increases the expression of gene(s) of at least one protein selected from the group consisting of GDF-3, collagen and fibronectin in fibroblasts and/or increases cell proliferation and/or Since it can promote the synthesis of active substances involved in promoting regeneration, it can be used as an active ingredient in a composition for increasing fibroblast growth ( FIGS. 6 to 8 ).
  • fibroblasts include There are Human Dermal Fibroblasts (HDFs).
  • GDF-3 may be used as an active ingredient in a composition for skin regeneration.
  • composition for skin regeneration examples include a cosmetic composition for skin regeneration or wrinkle improvement; transdermal dosage form pharmaceutical compositions; and a pharmaceutical composition for skin regeneration or treatment of wrinkles.
  • the pharmaceutical composition of the present invention may include a pharmaceutically acceptable salt of the active ingredient.
  • Skin regeneration refers to the restoration of skin tissue against damage caused by external and internal causes of the skin.
  • the damage caused by the external cause may include ultraviolet rays, external pollutants, wounds, trauma, and the like, and the damage caused by the internal cause may include stress.
  • Skin wrinkle refers to fine lines caused by deterioration of the skin, and may be caused by a genetic cause, a decrease in collagen and elastin present in the dermis of the skin, an external environment, and the like.
  • Skin wrinkle improvement refers to suppressing or inhibiting the formation of wrinkles on the skin, or alleviating the wrinkles already formed.
  • the skin regeneration and wrinkle improvement may include enhancing skin elasticity.
  • “Wrinkle treatment” means at least partially/temporarily stopping the formation of wrinkles on the skin.
  • “Skin elasticity” is represented by elastic fibers composed of elastin that exist in the dermis layer. These elastic fibers have a very low elastic modulus like rubber, so they are easily deformed by a small force, and the force may have been removed. It easily returns to its original shape.
  • elastic fibers have a form in which microfibrils are embedded in an amorphous matrix called elastin, and elastin is found only in elastic fibers called desmosine and isodesmosine derived from lysine. It is a protein made up of one amino acid. These desmosin and isodesmosin form cross-links in long peptide chains, and this structure makes elastin have rubber-like properties.
  • Endo skin elasticity means that elastic fibers composed of elastin exist together with collagen fibers called collagen, and skin elasticity is maintained or increased in a state in which elastin and collagen are sufficiently present.
  • the active ingredient when used as a cosmetic composition, it may be prepared in the form of a general emulsified formulation and a solubilized formulation.
  • lotions such as softening lotions or nourishing lotions, emulsions such as facial lotions and body lotions, creams such as nourishing creams, moisture creams, and eye creams, essences, sprays, gels, packs, sunscreens, makeup bases, liquid types, powders , a cleansing cream, a cleansing lotion, a makeup remover such as a cleansing oil, a cleansing agent such as a cleansing foam, soap, body wash, and the like.
  • the cosmetic composition comprises a fatty substance, an organic solvent, a solubilizer, a thickening agent and a gelling agent, an emollient, an antioxidant, a suspending agent, a stabilizer, a foaming agent, a fragrance, a surfactant, water, Ionic or nonionic emulsifiers, fillers, sequestering and chelating agents, preservatives, vitamins, blocking agents, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic actives, lipid vesicles or any conventionally used in cosmetics It may contain adjuvants commonly used in the field of cosmetology such as other ingredients of
  • the active ingredient When the active ingredient is used as an external preparation for skin, additionally, a fatty substance, an organic solvent, a solubilizer, a thickening agent and a gelling agent, an emollient, an antioxidant, a suspending agent, a stabilizer, a foaming agent, a fragrance, a surfactant, water , ionic or nonionic emulsifiers, fillers, sequestering and chelating agents, preservatives, vitamins, blocking agents, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic actives, lipid vesicles or commonly used externally for skin applications It may contain adjuvants commonly used in the field of dermatology, such as any other ingredients that are used. In addition, the above ingredients may be introduced in an amount generally used in the field of dermatology.
  • the active ingredient when provided in the form of an external application for skin, it may have a formulation such as, but not limited to, an ointment, a patch, a gel, a cream, or a spray.
  • a formulation such as, but not limited to, an ointment, a patch, a gel, a cream, or a spray.
  • the pharmaceutically acceptable salt of the active ingredient may be an acid addition salt formed using an organic acid or an inorganic acid, and the organic acid is, for example, formic acid, acetic acid, propionic acid, lactic acid, butyric acid, isobutyric acid, trifluoroacetic acid, malic acid , maleic acid, malonic acid, fumaric acid, succinic acid, succinic acid monoamide, glutamic acid, tartaric acid, oxalic acid, citric acid, glycolic acid, glucuronic acid, ascorbic acid, benzoic acid, phthalic acid, salicylic acid, anthranilic acid, dichloroacetic acid, aminooxyacetic acid, benzene and salts of sulfonic acid, p-toluenesulfonic acid and methanesulfonic acid, and inorganic acids include, for example, salts of hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, carbonic
  • the above-mentioned acid addition salt is prepared by a) directly mixing the active ingredient and an acid, b) dissolving one of them in a solvent or an aqueous solvent and mixing, or c) adding the active ingredient to an acid in a solvent or a submerged solvent. It is prepared by the general salt preparation method of positioning and mixing them.
  • additional salts available include gaba salt, gabapentin salt, pregabalin salt, nicotinate, adipate salt, hemimalonate, cysteine salt, acetylcysteine salt, methionine salt, arginine salt, lysine salt, ornithine salt, Aspartate, etc.
  • the active ingredient of the present invention when used as a pharmaceutical, it may contain one or more kinds of additional active ingredients exhibiting the same or similar function.
  • it may include known skin regenerating or wrinkle-improving ingredients.
  • an additional skin regeneration or wrinkle-improving component when included, the skin-regenerating or wrinkle-improving effect of the culture medium of the present invention may be further enhanced.
  • skin safety according to combined use, ease of formulation, and stability of active ingredients can be considered.
  • Additional components may be included in an amount of 0.0001 wt% to 10 wt% based on the total weight of the composition, and the content range may be adjusted according to requirements such as skin safety and ease of formulation of the active ingredient.
  • composition of the present invention may further include a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers may contain various ingredients such as buffers, sterile water for injection, plain saline or phosphate buffered saline, sucrose, histidine, salts and polysorbates, and the like.
  • the pharmaceutical composition of the present invention may be administered orally or parenterally (eg, transdermally), and may be administered in the form of an over-the-counter drug formulation, for example, oral and parenteral various formulations during clinical administration. It can be prepared using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in the pharmaceutical composition of the present invention, for example, starch, calcium carbonate, water Cross (Sucrose) or lactose (Lactose), it can be prepared by mixing gelatin and the like.
  • excipient for example, starch, calcium carbonate, water Cross (Sucrose) or lactose (Lactose)
  • lubricants such as magnesium stearate talc are also used.
  • Liquid formulations for oral use include suspensions, solutions, emulsions, syrups, etc.
  • various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories.
  • Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • injectable esters such as ethyl oleate.
  • As the base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like can be used.
  • the high-expressing GDF-3 cord blood stem cells prepared according to the present invention can be utilized as one main raw material in the next-generation biopharmaceutical field.
  • the extracellular matrix secretion ability is increased by GDF-3, as the efficacy of the cell culture medium containing it increases, it may be useful in developing a composition applicable to the manufacture of cosmetics and pharmaceuticals using the culture medium.
  • Example 1 is a graph analyzing whether umbilical cord blood stem cells isolated and cultured in Example 1 express native surface proteins.
  • CTR normal DMEM medium
  • PMS novel stem cell culture medium
  • FIG 3 is a graph comparing the degree of cell proliferation during late passage (after P7) between normal DMEM medium (CTR) and new stem cell culture medium (PMS).
  • CTR normal DMEM medium
  • PMS new stem cell culture medium
  • FIG. 4 is a graph comparing the secretion amount of the extracellular matrix material and fibronectin secreted by the cells when culturing umbilical cord blood stem cells using a normal DMEM medium (CTR) and a novel stem cell culture medium (PMS).
  • CTR normal DMEM medium
  • PMS novel stem cell culture medium
  • FIG. 5 shows the characteristics of GDF-3 gene expression expressed in cells from the initial (P3) to the late (P7) subculture when culturing cord blood stem cells in normal DMEM medium (CTR) and novel stem cell culture medium (PMS). It is one graph.
  • FIG. 6 shows the high expression of the GDF-3 gene after treatment with the GDF-3 protein in normal dermal fibroblast culture.
  • HDF human epithelial cells
  • FIG. 8 confirms that normal skin cells induced with high GDF-3 expression showed higher gene expression of extracellular matrix components, collagen and fibronectin, compared to control skin cells.
  • Cord blood collected from the mother was mixed with Hetasep TM to remove red blood cells, treated with Ficoll-plaque, centrifuged, and then umbilical cord blood mononuclear cells were separated and washed with PBS.
  • Cord blood mononuclear cells were seeded in a culture dish coated with fibronectin (50ug/ml) (24hrs at 4°C).
  • fibronectin 50ug/ml
  • a novel self-developed medium developed by additionally adding FGF-2, EGF, TGF- ⁇ superfamily growth factors, Ascorbic Acid, and Heparin to DMEM/F12 was used.
  • a flow cytometry experiment was performed to determine whether the isolated cells were cord blood stem cells after isolation of cord blood stem cells.
  • cells of passage 3 or 4 were obtained, stained with fluorescein isothiocyanate (FITC) or phycoerythrin (PE)-conjugated antibody, and analyzed by FACS (CytoFLEX, BECKMAM COULTER, CA).
  • FITC fluorescein isothiocyanate
  • PE phycoerythrin
  • CD44 (mesenchymal stem cell marker), CD73 (mesenchymal stem cell marker), and CD105 (mesenchymal stem cell marker) were used as positive marker antigens to analyze the characteristics of cord blood stem cells isolated from CD11b (hematopoietic stem cell marker), CD19 (immune cell marker), CD34 (hematopoietic stem cell marker), CD45 (non-hematopoietic stem cell marker), and HLA-DR (immune rejection-related marker) were used.
  • CD11b hematopoietic stem cell marker
  • CD19 immunoglobulfenchymal stem cell marker
  • CD34 hematopoietic stem cell marker
  • CD45 non-hematopoietic stem cell marker
  • HLA-DR immunoreduction-related marker
  • CD antigen class Proportion of positively stained cells (%) Cord blood stem cell positive antigen CD44 93.50% CD73 94.05% CD105 99.33%
  • Cord blood stem cell negative antigen CD11b 0.59% CD19 2.73%
  • CD34 0.35%
  • CD45 0.31% HLA-DR 0.33%
  • Example 1 1.1 Cord blood mononuclear cell isolation and 1.2 Cord blood stem cell isolation medium Stem cells were separated and cultured from umbilical cord blood in the same manner as in Example 1, except that DMEM was used as a control.
  • Example 1 Each of the umbilical cord blood stem cells isolated in Example 1 and Comparative Example 1 was a DMEM/F12 medium-based novel stem containing 10% fetal bovine serum and Fibroblast growth factor 2 (FGF2). Cell culture medium was added and cultured in a 37°C 5% CO 2 incubator. From this, cell proliferation rates were compared ( FIGS. 2 and 3 ).
  • FGF2 Fibroblast growth factor 2
  • the cord blood stem cells (PMS) isolated and cultured in Example 1 had a faster proliferation rate than the cord blood stem cells (CTR) isolated and cultured in Comparative Example 1.
  • cord blood stem cells isolated in Example 1 and Comparative Example 1 seeding the cord blood stem cells for each passage at 4 to 10x10 3 cells/cm 2 , washed with PBS 24 hours later, and exchanged the medium with Serum Free Media 2 ⁇ After culturing for 7 days, umbilical cord blood stem cell culture medium was prepared.
  • the expression level of fibronectin was analyzed in the umbilical cord blood stem cell culture medium for each passage using the ELISA Kit (FIG. 4).
  • the cord blood stem cells isolated in Example 1 not only increased cell proliferation but also increased the amount of ECM component secretion compared to the cord blood stem cells isolated in Comparative Example 1.
  • Example 1 and Comparative Example 1 For the cord blood stem cells isolated in Example 1 and Comparative Example 1, the cord blood stem cells for each passage were washed with PBS, and the cells were suspended with Trypsin EDTA. The suspended cells were centrifuged to remove the supernatant. The cell pellet was re-suspended in PBS and then centrifuged to remove the supernatant.
  • the synthesized umbilical cord blood stem cell cDNA was subjected to real-time PCR using the primers in Table 2 to confirm the expression level of GDF-3 for each passage.
  • GAPDH a kind of house keeping gene, was used as a loading control ( FIG. 5 ).
  • the reason for the rapid proliferation is the high expression of GDF-3.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Wood Science & Technology (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Dermatology (AREA)
  • Epidemiology (AREA)
  • Hematology (AREA)
  • Rheumatology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Birds (AREA)
  • Reproductive Health (AREA)
  • Virology (AREA)
  • Pain & Pain Management (AREA)
  • Gerontology & Geriatric Medicine (AREA)

Abstract

본 발명은 GDF-3를 고발현하는 제대혈 줄기세포 분리 및 배양 방법에 관한 것이다. 본 발명에 따라 분리배양된 제대혈 줄기세포의 경우 GDF-3를 고발현하는 특성을 보인다. 통상적으로 계대가 진행됨에 따라 줄기세포의 증식이 감소하여 충분한 양의 세포수 확보가 어려우나, GDF-3 고발현되는 줄기세포의 경우 계대가 진행되더라도 세포의 증식능이 대조군에 비해 높게 유지되어 건강한 상태의 줄기세포를 대량으로 확보할 수 있는 장점이 있다. 또한, 줄기세포의 증식률이 높음에 따라 세포가 분비하는 세포외기질 성분 농도 또한 높은 것으로 확인되어 GDF-3 고발현 제대혈 줄기세포를 활용한 세포 및 배양액 조성물 생산 시 효능/효과가 뛰어난 원료를 생산할 수 있다.

Description

GDF-3를 고발현하는 제대혈 줄기세포 분리 및 배양 방법 및 GDF-3의 용도
본 발명은 GDF-3를 높게 발현하는 제대혈 줄기세포 분리 및 배양 방법 및 GDF-3의 다양한 용도에 관한 것이다.
동물세포 배양은 초대배양과 계대배양(subculture)이 있다. 초대배양이란 조직편(片)에서 세포를 분리하여 배양하는 과정이다. 계대배양이란 초대배양을 통해 얻은 세포를 지속적으로 유지하기 위해 배양하는 방법이다.
정상적인 동물세포 계통(cell line)들은 사멸성(mortal)이어서 세포분열 횟수가 한정되어 있다. 정상세포를 배양하는 경우에는 대부분 미분화 줄기세포(undifferentiated stem cell)나 전구 세포의 상태로 생장하다가 분화가 시작되면서 증식이 정지한다. 반면에 종양조직에서 유래된 세포의 경우에는 생장과 분화가 섞여 있으므로 지속으로 생장한다.
계대배양(繼代培養)은 세포 증식을 위해 2~7일마다 주기적으로 새로운 배양접시에 옮겨 세포의 대(代)를 계속 이어서 배양하는 방법이다. 제한된 배양접시 내에선 영양분이 부족하고 분비하는 대사산물에 의해 세포가 증식을 멈추게 되므로 이를 막고 세포가 증식할 수 있게끔 새로운 공간을 제공하는 것이다. 계대배양 방법은, 가장 기본적으로 세포가 단층으로 자라고 멈추기 때문에 배양접시에서 세포를 떼어내어 새로운 배양접시에서 배양한다. 그 밖에 cell disk 나 micro-carrier를 활용하여 전용 배양기기 안에서 삼차원 배양하는 방법이 있다.
동물 조직에서 유래된 세포는 1차, 2차, 3차 등 계속하여 배양 가능하다. 그러나, 대부분의 세포들은 이러한 계대배양을 계속할 경우 어느 정도 배양하다 보면 더 이상 증식되지 않고 세포들이 죽게 된다. 대부분의 세포는 분열횟수가 증가함에 따라 세포노화(culture senescence)현상이 나타나고 세포의 성질이 시간에 따라 변화하기 때문에 일정 횟수만큼만 계대배양을 할 수 있다.
줄기세포는 자가 증식능과 다양한 조직세포로 분화할 수 있는 능력을 가진 미분화 세포로서 배아줄기세포, 성체줄기세포, 역분화 줄기세포로 구분된다. 배아줄기세포(embryonic stem cell)는 배반포 내 세포 덩어리로부터 분리한 줄기세포로서 우리 몸의 모든 세포나 조직으로 분화가 가능한 전분화능(Pluripotency)을 가지고 있어 치료 목적으로 사용될 수 있으나, 이식 시 종양이 형성될 가능성이 큰 것과 윤리적인 문제가 있다. 역분화 줄기세포는 성인의 체세포에 역분화를 일으키는 유전자를 도입하여 배아줄기세포와 같은 분화능을 가지는 세포로서 배아줄기세포의 윤리적인 문제를 해결하였으나 역분화 효율이 낮으며 유전자 도입에 바이러스가 사용되어 실체 치료 목적으로 사용하기에 위험이 뒤따른다. 성체줄기세포는 신체 조직에 존재하는 미분화된 세포로서 죽거나 손상된 세포를 대체하는 역할을 한다. 배아줄기세포와 달리 안정적으로 분화되어 종양 발생 가능성이 낮으며 수정란을 파괴하지 않아 윤리적인 문제가 되지 않는다.
성체 줄기세포는 지방, 골수, 제대혈 등에서 채취할 수 있으며 지방 및 골수 줄기세포는 공여자로부터 침습법을 사용하여 채취하며 공여자의 연령 및 건강 상태에 따라 줄기세포의 기능과 효능에 차이가 발생한다. 제대혈 줄기세포는 침습법을 사용하지 않고 폐기되는 제대혈을 활용하며 비슷한 임신 주령(40주)의 제대혈을 사용하기 때문에 공여자 간의 줄기세포 기능과 효능의 차이가 거의 없다.
성체 줄기세포의 재생 및 항염 기능을 활용한 많은 세포치료제가 개발 중이며, 이러한 성체 줄기세포의 재생 및 항염 기능의 기전은 성체 줄기세포가 만들어 내는 물질에 의한 것으로 콜라겐(Collagen), TGF-β1 그리고 miRNA 와 같은 단백질 및 유전체가 있다. 줄기세포 세포치료제의 경우 세포의 생착 여부와 완전히 해소하지 못한 종양 발생에 대한 문제로 이를 해결하기 위해 줄기세포 배양액 및 세포외소포체 연구가 활발히 이루어지고 있다.
중간엽 줄기세포(mesenchymal stem cells)는 조직이나 기관의 분화된 세포들 사이에 존재하는 미분화된 성체 줄기세포로서, 스스로 증식하는 자가 재생능력(self-renewal)을 가지고 있다. 또한, 체외에서 쉽게 증식이 가능하고 지방세포, 골세포, 연골세포, 근세포 등 여러 가지 다양한 조직 세포로 분화 가능하여 분화 기능을 이용한 조직 재생에 사용될 수 있다.
중간엽 줄기세포(Mesenchymal stem cell)는 표피세포성장인자(Epithelial growth factor), 섬유아세포성장인자(Fibroblast growth factor)와 같은 다양한 성장인자(growth factor)와 사이토카인을 분비하여 섬유아세포로부터 콜라겐의 생성을 촉진시켜 피부의 재생에 중요한 역할을 한다고 알려져 있다.
또한, 인체로부터 분리된 중간엽 줄기세포를 치료에 적합하도록 개선할 수 있으며, 줄기세포로부터 분비되는 다양한 성장인자 또는 단백질을 이용하여 면역조절, 항염증 등 다양한 질환에 적용할 수 있다.
줄기세포로부터 분비되는 다양한 성장인자 또는 단백질은 의약 또는 화장품 등 산업적으로 활용할 수 있다. 줄기세포 배양액 또는 줄기세포 유래 조성물 내 성장인자를 고농도로 함유하도록 하는 기술은 아직 미비한 실정이며, 고농도의 성장인자를 포함하는 세포외기질 합성 촉진을 위한 배양액 또는 조성물을 제조하기 위한 새로운 방법이 요구된다.
세포외기질(extracellular matrix)은 세포가 세포 밖으로 분비한 여러 가지 물질들이 형성하는 세포의 구조물이고, 세포 사이의 공간을 충진(filling)하고 세포와 조직을 연결한다. 세포외기질은 세포의 구조적 지지와 세포 간의 연결을 마련할 뿐만 아니라, 신호전달을 비롯한 세포와 세포 사이의 소통을 위한 역할과 배아의 발생과 세포의 분화에서도 중요한 기능을 한다. 기본적으로 세포외기질은 물과 단백질, 다당류 등으로 이루어져 있으며, 각각의 조직은 생성이 시작될 때부터 나름에 맞는 형태와 위상의 세포외기질을 형성시켜 보유하고 있다. 세포외기질과 세포와의 접합은 인테그린(integrins), 디스코이딘 복합 수용체(discoidin domain receptor), 신데칸(syndecans)과 같은 세포외기질 수용체(Extracellular matrix receptor)를 통해 이루어지며, 이러한 접합은 세포 골격과 세포외기질을 연결시켜 준다. 또한 세포외기질은 매우 다이나믹한 구조를 가지고 있어 지속적으로 재형성되며, 세포외기질의 물리적, 생화학적 특성은 생물체 내 기관들이 인장력이나 탄력 등 고유한 물리적 특성을 가질 수 있게 한다. 세포외기질은 두 개의 큰 분자로 이루어져 있는데, 하나는 단백질과 복합된 다당류인 프로테오글라이칸(proteoglycan, PG)이며, 또 하나는 콜라겐, 케라틴과 같은 물에 녹지 않는 섬유상 단백질(fibrous protein)이다.
프로테오글라이칸은 세포와 조직 사이에 가장 많이 존재하는 물질로 수소화 겔(hydrated gel) 형태로 존재하며, 완충작용, 수화작용, 결합 및 저항작용 등의 성질을 이용하여, 여러가지 역할을 담당하고 있다.
섬유상 단백질의 여러 종류 중에 가장 풍부한 단백질인 콜라겐은 다세포 동물의 총 단백질의 약 30%를 차지하고 있다. 콜라겐은 세포외기질의 구조를 담당하고 탄성력과 세포 부착기작 및 세포이동과 조직의 발달에 관여하며, 또 다른 섬유상 단백질인 엘라스틴(elastin)과 연계되어 있다. 엘라스틴 섬유는 반복적인 신장 작용을 요구하는 조직의 신축성에 관여한다. 하지만 엘라스틴 섬유의 신장은 콜라겐 섬유와 긴밀히 연결되어 있기 때문에 매우 제한적이다. 또 다른 섬유상 단백질로는 피브로넥틴(fibronectin, FN)이 있는데, 이는 세포외기질 사이를 조직화하고 세포와 세포외기질의 연결을 담당한다.
한편, 줄기세포 마커(Stem cell marker) GDF-3(Growth Differentiation Factor-3)는 TGF-β Superfamily로써 Nodal Signaling을 활성화하여 Collagen, Fibronectin, TGF-BI와 같은 피부 재생 관련 단백질의 전사 작용을 활성화시킨다. GDF-3와 줄기세포의 상관관계는 주로 배아줄기세포(embryonic stem cells, ESC)에서 연구되었으며 GDF-3가 ESC의 stemness 마커로 알려져 있으나, 그 밖의 성체줄기세포에서의 GDF-3의 기능에 대해서는 밝혀진 바가 없다.
본 발명은 GDF-3 유전자를 높게 발현하는 제대혈 줄기세포의 제조방법, 및 GDF-3의 다양한 용도를 제공하고자 한다.
구체적으로, 본 발명은 제대혈로부터 분리한 단핵세포를 파이브로넥틴이 도말된 배양 용기 내에서 새롭게 설계된 줄기세포 배양용 배지를 활용하여 증식이 빠른 제대혈 줄기세포를 확보하는 것을 특징으로 하는 제대혈 유래 고효능 줄기세포 분리방법을 제공하고자 한다. 또한, 본 발명은 줄기세포 내 GDF-3 발현 증가 유도를 통해 세포 증식의 지속성과 세포외기질 성분의 분비를 향상시키는 방법을 제공하고자 한다. 또한 이를 기반으로 GDF-3 고발현 제대혈 줄기세포를 이용한 세포증식 및 세포외기질 성분 분비를 유도하여 세포외기질 성분이 함유되어 있는 배양액 조성물을 제공하고자 한다.
본 발명의 제1양태는 제대혈 줄기세포를 배양하여 GDF-3을 발현시키는 것이 특징인 GDF-3 제조방법을 제공한다.
본 발명의 제2양태는 GDF-3 고발현 제대혈 줄기세포를 확보하기 위해, 생장 속도(cell doubling time)가 빠른 제대혈 줄기세포를 분리배양하는 것이 특징인 GDF-3 발현 제대혈 줄기세포의 제조방법을 제공한다.
본 발명의 제3양태는 제대혈로부터 분리한 제대혈 단핵세포들을 TGF-β 수퍼패밀리 성장인자(superfamily growth factor) 함유 배지에 시딩(Seeding)하여 배양하고, 배양접시에 부착되어 상대적으로 빠르게 증식하는 단핵세포를 선택적으로 분리하여 배양한 것이 특징인 GDF-3 고발현 제대혈 줄기세포를 제공한다.
본 발명의 제4양태는 GDF-3를 함유하는 것이 특징인 섬유아세포 생장 증가용 조성물을 제공한다.
본 발명의 제5양태는 GDF-3를 함유하는 것이 특징인 피부 재생용 조성물을 제공한다.
이하, 본 발명을 자세히 설명한다.
본 발명자들은 줄기세포 자체를 많이 확보할 수 있어야 마스터 세포 은행(Master Cell Bank) 구축에 용이하며 이를 활용하여 유효성분이 고함량으로 함유된 세포 및 배양액의 대량 확보가 가능하다는 점을 고려하여 다양한 실험을 수행한 결과, (i) GDF-3 고발현은 세포의 증식과 재생 촉진에 관여하는 유효 물질의 합성을 촉진하는 것; (ii) 분리배양된 제대혈 줄기세포의 GDF-3 발현량과 분리배양 된 제대혈 줄기세포의 증식 속도는 상관관계가 있다는 것; (iii) 제대혈 줄기세포에서 GDF-3의 유전자 발현이 유의하게 높게 나타나는 것; (iv) 사람상피세포(HDF)에 GDF-3 처리시 세포의 모양이 좀 더 길쭉하고 짧은 형태를 보이면서 증식에 유리한 모양을 가지고 있으며 지속적으로 세포가 증가하는 것(실시예 5 및 도 7); (v) 사람상피세포(HDF)에 GDF-3 처리시 피부 재생에 관여하는 콜라겐(Collagen)과 피브로넥틴(Fibronectin)과 같은 피부구성물질의 유전자 발현 또한 증가하는 것 (실시예 6 및 도 8)을 발견하였으며, 본 발명은 이에 기초한 것이다.
본 발명에 따라 분리배양된 제대혈 줄기세포의 경우 GDF-3를 고발현하는 특성을 보인다. 통상적으로 계대가 진행됨에 따라 줄기세포의 증식이 감소하여 충분한 양의 세포 수 확보가 어려우나, GDF-3 고발현 되는 줄기세포의 경우 계대가 진행되더라도 세포의 증식능이 대조군에 비해 높게 유지되어 건강한 상태의 줄기세포를 대량으로 확보할 수 있는 장점이 있다. 또한, 줄기세포의 증식률이 높음에 따라 세포가 분비하는 세포외기질 성분 농도 또한 높은 것으로 확인되어 GDF-3 고발현 제대혈 줄기세포를 활용한 배양액 조성물 생산 시 효능/효과가 뛰어난 원료를 생산할 수 있다.
본 발명의 일양태에 따른 GDF-3 고발현 줄기세포 분리 및 배양방법은 새롭게 설계된 줄기세포 배양용 배지를 활용한 것이 특징이다. 이때 새롭게 설계된 줄기세포 배양용 배지는 TGF-β superfamily를 포함하는 다양한 성장인자가 첨가되었다.
본 발명을 통해 분리 및 배양하는 제대혈 줄기세포는 24시간 미만의 생장 속도(cell doubling time)를 가진 제대혈 줄기세포를 확보할 수 있게 한다.
본 발명에서 확인된 바와 같이, GDF-3는 섬유아세포의 생장을 증가시킬 수 있다(도 8). GDF-3에 의해 생장을 증가시키는 섬유아세포의 비제한적인 예로 사람상피세포(Human Dermal Fibroblast)가 있다.
본 발명에서 확인된 바와 같이, GDF-3는 이에 의해 섬유아세포에서 GDF-3, 콜라겐 및/또는 피브로넥틴의 각 유전자(들)의 발현을 증가시킬 수 있다(도 8).
한편, 분리배양된 제대혈 줄기세포의 GDF-3 발현량과 분리배양된 제대혈 줄기세포의 증식 속도는 상관관계가 있다는 발견에 기초하여, 본 발명의 일양태에 따른 GDF-3 발현 제대혈 줄기세포의 제조방법은 GDF-3 고발현 제대혈 줄기세포를 확보하기 위해, 생장 속도(cell doubling time)가 빠른 제대혈 줄기세포를 분리배양하는 것이 특징이다.
분리배양 된 제대혈 줄기세포의 증식 속도가 클 수록 분리배양 된 제대혈 줄기세포의 GDF-3 발현량이 높다.
따라서, 본 발명은 GDF-3 고발현 제대혈 줄기세포에 대한 세포은행(cell bank) 구축할 수 있다. 예컨대, 제대혈로부터 분리한 제대혈 단핵세포들을 TGF-β 수퍼패밀리 성장인자(superfamily growth factor) 함유 배지에 시딩(Seeding)하여 배양하고, 배양접시에 부착되어 상대적으로 빠르게 증식하는 단핵세포를 선택적으로 분리하여 배양한, GDF-3 고발현 제대혈 줄기세포를 세포은행으로 구축할 수 있다.
또한, 본 발명의 일양태에 따른 GDF-3 고발현 제대혈 줄기세포의 제조방법은 배지에서 생장 속도(cell doubling time)가 빠른 제대혈 줄기세포를 분리배양하는 것이 특징이다(실시예 1).
일구체예에 따라 GDF-3 발현 제대혈 줄기세포의 제조방법은
제대혈로부터 분리한 제대혈 단핵세포들을 TGF-β 수퍼패밀리 성장인자(superfamily growth factor) 함유 배지에 시딩(Seeding)하여 배양하는 제1단계; 및
배양접시에 부착되어 상대적으로 빠르게 증식하는 단핵세포를 선택적으로 분리하여 배양하는 제2단계
를 포함한다.
제2단계는 배양접시에 부착되지 못한 세포는 제거하고 부착된 단핵세포만을 배양할 수 있다.
본 발명에 따라 제조된 GDF-3 발현 제대혈 줄기세포는 지방(Adipocyte), 연골(Chondrocyte) 및/또는 골세포(Osteocyte)로 분화 가능하다. 따라서, GDF-3 고발현 제대혈 줄기세포는 세포치료제로 사용될 수 있다.
줄기세포 배양 시 생산되는 성장인자의 종류, 이의 조합 및 그 함량은 줄기세포 유래에 따라 이의 배양방법에 따라 다르다. 따라서, 본 발명에 따라 제조된 GDF-3 발현 제대혈 줄기세포는 이를 배양하여 GDF-3 함유 배양액을 제조하는데 사용될 수 있다. 특히, 본 발명은 GDF-3을 고발현하는 제대혈 유래 줄기세포를 분리배양하여 GDF-3 함유 배양액을 생산할 수 있다.
놀랍게도, 본 발명에 따라 제조된 GDF-3 발현 제대혈 줄기세포는 계대가 진행될수록 GDF-3의 발현량이 점차 증가하는 것을 발견하였다(도 5). 따라서, GDF-3 고발현 제대혈 줄기세포를 확보하기 위해, 계대 5 ~ 계대 7인 혹은 그 이상 계대의 GDF-3 발현 제대혈 줄기세포를 사용할 수 있다(도 3).
본 발명의 일양태에 따른 GDF-3 발현 제대혈 줄기세포의 제조방법은 TGF-β 수퍼패밀리 성장인자(superfamily growth factor) 함유 배지에서 제대혈 줄기세포를 분리배양하는 것이 특징이다. 이경우, 계대배양 시 생장능이 우수한 GDF-3 고발현 제대혈 줄기세포를 확보할 수 있다.
따라서, 본 발명의 일양태에 따른 GDF-3 발현 제대혈 줄기세포의 제조방법은 TGF-β superfamily를 포함한 다양한 성장인자 함유 배지에서 제대혈 줄기세포를 분리배양하고, 이를 계대배양하여 제대혈 줄기세포를 대량 확보할 수 있다(도 3).
본 발명의 일양태에 따른 GDF-3 발현 제대혈 줄기세포를 계대배양하여 세포외기질 성분 분비능이 우수한 제대혈 줄기세포를 대량확보 할 수 있다(도 4).
전술한 바와 같이, 줄기세포 마커(Stem cell marker)인 GDF-3는 TGF-β Superfamily이다. TGF-β는 다면 발현성인자 (pleiotropic factor)이며, 다중기능 성장인자 (Multifunctional growth factor)라는 특성을 가진다.
TGF-β(Transforming growth factor-β) 신호 전달은 다양한 생물학적 과정에서 결정적인 역할을 하며 세포 성장 억제, 세포 사멸, 분화 및 상피-간충직 전이 (epithelial-mesenchymal transition; EMT)와 같은 다양한 기능을 수행한다. TGF-β 신호전달계는 엄격하게 조절되며 세포 항상성의 유지와 더불어 발생 및 기관 형성에 결정적인 역할을 한다. 따라서 TGF-β 신호 전달의 교란은 암, 섬유증 및 선천성 기형과 같은 생명을 위협하는 질환을 유발한다.
TGF-β는 암화과정의 초기단계에서는 암 억제활성을 나타내나, 암화과정의 후기에는 암성장을 촉진시키는 것으로 알려져 있다. TGF-β1은 대부분의 암 조직에서 다량으로 발현되며, TGF-β1의 발현이 높은 암환자의 경우 악성인 경우가 많고 예후 또한 좋지 않은 것으로 알려져 있다.　
세포에서 분비된 TGF-β는 타입 I 및 타입 II 수용체로 구성된 두가지 타입의 수용체의 이종 복합체에 결합하여 신호전달을 개시한다. TGF-β는 II 형 수용체에 결합하게 되면 I 형 수용체는 이를 인식하여 II형 수용체에 결합을 하게 되는데 이때 II형 수용체가 I형 수용체의 GS부위를 인산화시키게 되면 I 형 수용체 kinase가 활성화되게 된다. 인산화된 TGF-β I 형 수용체는 Smad2 및 Smad3라는 TGF-β 신호전달 매개체의 C-말단 세린 잔기를 인산화시킴으로써 Smad2 및 Smad3의 활성화를 유발한다. 활성화된 Smad2 및 Smad3은 Smad4와 복합체를 형성하여 핵으로 이동하여 표적 유전자의 발현에 관여한다.
TGF-β의 종양 억제 역할은 다양한 연구에서 입증되었다. 반대로, TGF-β는 암의 진행 단계에서 종양 성장, 침윤 및 전이를 촉진한다. 이러한 상반되는 암진행과정에서의 TGF-β의 역할의 변화에 대한 상세한 분자 기전은 아직도 명확하게 규명이 되어있지 않다.
TGF-β는 면역계의 많은 구성 요소의 기능과 확장을 저해함으로 면역 항상성 (homeostasis)과 관용 (tolerance)을 결정 짓는 중요한 집행자 역할을 하는 것으로 알려져 있다. TGF-β가 면역 내성과 염증 반응을 조절한다. TGF-β 신호는 CD8+ T 세포의 세포 독성 프로그램을 직접적으로 억제한다.
종양 미세 환경에서는 암세포에서 생산된 과량의 TGF-β1은 암 세포의 신호전달계에 과도한 변화를 유발시킨다. 이러한 변화는 암 세포와 종양-간질 상호 작용에 악 영향을 미치게 된다. 세포와 세포 사이의 cross-talk이 정상적으로 이뤄지지 않으면 permissive stroma (허용적인 간질)을 만들어 종양세포가 잘 퍼져갈 수 있는 환경을 만든다. 암세포에서 분비된 TGF-β는 EMT와 암 줄기 세포 (CSC)와 유사한 형질을 가진 세포로 암세포를 유도한다.
EMT를 겪는 세포는 이동능력 (migratoryability)이 증가되어 전이를 일으키기 쉽게 되는데, 이들 세포는 방추형 모양 (spindle-shape)으로 변하고, 세포골격에 변화를 일으켜 다른 장기로 이동이 쉽게 되어 전이가 용이하게 된다.
상피 세포에서는 상피 세포 부착에 필요한 단백질인 E-cadherin의 소실 및 N-cadherin, vimentin 및 fibronectin과 같은 간엽 표지자의 발현 증가가 EMT과정에서 나타난다. TGF-β는 SNAI1/2, Twist 및 ZEB1/2를 비롯한 다양한 전사 조절인자를 활성화시키는 EMT의 진정한 매개체이다. EMT를 겪는 종양 세포는 암줄기세포 (CSC) 성질을 획득하게 된다.
이와 같이, 다면 발현성인자 (pleiotropic factor)이며, 다중기능 성장인자 (Multifunctional growth factor)라는 특성을 가진 TGF-β는 암진행과정에서 상반되는 역할을 하며 이러한 역할의 전환에 대한 상세한 분자 기전은 아직도 명확하게 규명이 되어있지 않다. 따라서, TGF-β Superfamily의 일종인 GDF-3 역시 동일한 부작용을 야기할 가능성이 크므로, 본 발명에 따라 분리배양된 제대혈 줄기세포를 사용하여 체외에서 GDF-3를 대량 생산 후, 원하는 투여시기, 투여부위 및/또는 투여량을 조절하여 체내 적용하는 것이 바람직하다.
본 명세서에서 "배지"는 생체외 (in vitro)에서 세포의 성장과 증식에 필요한 필수성분을 포함하는 조성물을 의미하는 것으로, 당해 분야에 통상적으로 사용되는 줄기세포 배양용 배지를 모두 포함하며, 예를 들어 DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI 1640, DMEM/F-10 (Dulbecco's Modified Eagle's Medium: Nutrient Mixture F-10), DMEM/F-12 (Dulbecco's Modified Eagle's Medium: Nutrient Mixture F-12), α-MEM(α-Minimal essential Medium), G-MEM(Glasgow's Minimal Essential Medium), IMDM(Isocove's Modified Dulbecco's Medium), KnockOut DMEM 등 상업적으로 제조된 배지 또는 인위적으로 합성한 배지를 이용할 수 있고, 이에 한정되지 않다. 본 명세서에서 배지는 일반적으로 탄소원, 질소원 및 미량원소 성분을 포함하며, 아미노산, 항생제 등을 더 포함할 수 있다.
또한, 본 발명에서 확인된 바와 같이, GDF-3는 섬유아세포에서 GDF-3, 콜라겐 및 피브로넥틴으로 구성된 군에서 적어도 하나 선택된 단백질의 유전자(들)의 발현을 증가 및/또는 세포의 증식 및/또는 재생 촉진에 관여하는 유효 물질의 합성을 촉진시킬 수 있으므로, 섬유아세포 생장 증가용 조성물의 유효성분으로 사용될 수 있다(도 6 ~ 8). 섬유아세포의 비제한적인 예로는 사람상피세포(Human Dermal Fibroblast, HDF)이 있다.
따라서, 본 발명에서 GDF-3는 피부 재생용 조성물의 유효성분으로 사용될 수 있다.
피부 재생용 조성물의 예로는 피부 재생 또는 주름 개선용 화장 조성물; 경피 투여형 약학 조성물; 및 피부 재생 또는 주름 치료용 약학 조성물이 있다. 본 발명의 약학 조성물은 상기 유효성분의 약제학적으로 허용 가능한 염을 포함할 수 있다.
“피부 재생”은 피부 외부 및 내부 원인에 의한 손상에 대하여 피부 조직이 회복되는 것을 의미한다. 상기 외부 원인에 의한 손상은 자외선, 외부 오염 물질, 창상, 외상 등을 들 수 있으며, 상기 내부 원인에 의한 손상은 스트레스 등을 들 수 있다.
"피부 주름"은 피부가 쇠하여 생긴 잔줄을 의미하는데, 유전자에 의한 원인, 피부 진피에 존재하는 콜라겐과 엘라스틴의 감소, 외부환경 등에 의해 유발될 수 있다.
"피부 주름 개선"이란 피부에 주름이 생성되는 것을 억제 또는 저해하거나, 이미 생성된 주름을 완화시키는 것을 말한다. 본 발명의 목적상, 상기 피부 재생 및 주름 개선은 피부 탄력 증진을 포함하는 것일 수 있다.
“주름 치료”는 피부에 주름이 생성되는 것을 적어도 부분적/일시적으로 정지시키는 것을 의미한다.
"피부 탄력"은 진피층에 존재하는 엘라스틴(elastin)으로 구성된 탄력섬유에 의해 나타나는데, 이러한 탄력섬유는 고무와 같이 매우 낮은 탄성계수를 가지고 있어서, 작은 힘에 의해서도 쉽게 변형되고, 또 그 힘이 제거되었을 때는 쉽게 원형으로 되돌아온다. 또한, 탄력섬유는 엘라스틴이라는 무정형의 기질에 미원섬유(microfibrils)들이 박혀 있는 형태를 띠고 있으며, 엘라스틴은 라이신에서 유래한 데스모신(desmosine)과 아이소데스모신(isodesmosine)이라는 탄력섬유에서만 발견되는 아주 톡특한 아미노산으로 구성된 단백질이다. 이러한 데스모신과 아이소데스모신 등은 긴 펩타이드 사슬안에서 가교(cross-links)를 형성하고 있는데, 이러한 구조가 엘라스틴으로 하여금 고무와 같은 성질을 갖게 한다.
"피부 탄력 증진"은 엘라스틴으로 구성된 탄력섬유가 콜라겐(collagen)이라고 하는 교원섬유와 함께 존재하는데, 엘라스틴과 콜라겐이 충분히 존재하는 상태에서 피부 탄력이 유지 또는 증가되는 것을 말한다.
상기 유효성분을 화장료 조성물로 사용하는 경우, 일반적인 유화 제형 및 가용화 제형의 형태로 제조할 수 있다. 예컨대, 유연 화장수 또는 영양 화장수 등과 같은 화장수, 훼이셜 로션, 바디로션 등과 같은 유액, 영양 크림, 수분 크림, 아이 크림 등과 같은 크림, 에센스, 스프레이, 젤, 팩, 선 스크린, 메이크업 베이스, 액체 타입, 파우더, 클렌징 크림, 클렌징 로션, 클렌징 오일과 같은 메이크업 제거제, 클렌징 폼, 비누, 바디 워쉬 등과 같은 세정제 등의 제형을 가질 수 있다.
또한, 상기 화장료 조성물은 상기 유효성분에 추가로 지방 물질, 유기 용매, 용해제, 농축제 및 겔화제, 연화제, 항산화제, 현탁화제, 안정화제, 발포제(foaming agent), 방향제, 계면활성제, 물, 이온형 또는 비이온형 유화제, 충전제, 금속이온봉쇄제 및 킬레이트화제, 보존제, 비타민, 차단제, 습윤화제, 필수 오일, 염료, 안료, 친수성 또는 친유성 활성제, 지질 소낭 또는 화장품에 통상적으로 사용되는 임의의 다른 성분과 같은 화장품학 분야에서 통상적으로 사용되는 보조제를 함유할 수 있다.
상기 유효성분을 피부외용제로 사용하는 경우, 추가로 지방 물질, 유기 용매, 용해제, 농축제 및 겔화제, 연화제, 항산화제, 현탁화제, 안정화제, 발포제(foaming agent), 방향제, 계면활성제, 물, 이온형 또는 비이온형 유화제, 충전제, 금속이온봉쇄제 및 킬레이트화제, 보존제, 비타민, 차단제, 습윤화제, 필수 오일, 염료, 안료, 친수성 또는 친유성 활성제, 지질 소낭 또는 피부용 외용제에 통상적으로 사용되는 임의의 다른 성분과 같은 피부 과학 분야에서 통상적으로 사용되는 보조제를 함유할 수 있다. 또한 상기 성분들은 피부 과학 분야에서 일반적으로 사용되는 양으로 도입될 수 있다.
또한, 상기 유효성분이 피부 외용제 제형으로 제공될 경우, 이에 제한되는 것은 아니나, 연고, 패취, 겔, 크림 또는 분무제와 같은 제형을 가질 수 있다.
상기 유효성분의 약제학적으로 허용 가능한 염은 유기산 또는 무기산을 이용하여 형성된 산 부가염일 수 있으며, 상기 유기산은, 예를 들면 포름산, 아세트산, 프로피온산, 락트산, 부티르산, 이소부티르산, 트리플루오로아세트산, 말산, 말레산, 말론산, 푸마르산, 숙신산, 숙신산 모노아미드, 글루탐산, 타르타르산, 옥살산, 시트르산, 글리콜산, 글루쿠론산, 아스코르브산, 벤조산, 프탈산, 살리실산, 안트라닐산, 디클로로아세트산, 아미노옥시 아세트산, 벤젠술폰산, p-톨루엔술폰산 및 메탄술폰산계 염을 포함하며 무기산은 예를 들면 염산, 브롬산, 황산, 인산, 질산, 탄산 및 붕산계 염을 포함한다.　바람직하게는 염산염 또는 아세트산염 형태일 수 있으며, 보다 바람직하게는 염산염 형태일 수 있다.
상기 언급된 산 부가염은 a) 상기 유효성분 및 산을 직접 혼합하거나, b) 이들 중 한 가지를 용매 또는 함수 용매 중에 용해시키고 혼합시키거나, 또는 c) 유효성분을 용매 또는 수하 용매 중의 산에 위치시키고 이들을 혼합하는 일반적인 염 제조방법으로 제조된다.
위와는 별도로 추가적으로 염이 가능한 형태는 가바염, 가바펜틴염, 프레가발린염, 니코틴산염, 아디페이트염, 헤미말론산염, 시스테인염, 아세틸시스테인염, 메티오닌염, 아르기닌염, 라이신염, 오르니틴염, 아스파르트산염 등이 있다.
또한, 본 발명의 상기 유효성분을 의약품으로 사용하는 경우, 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1종 이상 함유할 수 있다. 예컨대, 공지의 피부 재생 또는 주름 개선 성분을 포함할 수 있을 것이다. 추가적인 피부 재생 또는 주름 개선 성분을 포함하게 되면 본 발명의 배양액의 피부 재생 또는 주름 개선 효과는 더욱 증진될 수 있을 것이다. 상기 성분 추가 시에는 복합 사용에 따른 피부 안전성, 제형화의 용이성, 유효성분들의 안정성을 고려할 수 있다. 추가의 성분은 전체 조성물 중량에 대하여 0.0001 중량% 내지 10 중량%로 포함될 수 있으며, 상기 함량 범위는 피부 안전성, 상기 유효성분의 제형화 시의 용이성 등의 요건에 따라 조절될 수 있을 것이다.
또한, 본 발명의 약학 조성물은 약학적으로 허용 가능한 담체를 더 포함할 수 있다.
약학적으로 허용되는 담체는 완충액, 주사용 멸균수, 일반 식염수 또는 인산염 완충 식염수, 슈크로스, 히스티딘, 염 및 폴리솔베이트 등과 같은 여러 성분을 함유할 수 있다.
본 발명의 약학 조성물은 경구 또는 비경구(예, 경피)로 투여할 수 있으며, 일반 의약품 제제의 형태, 예를 들어, 임상 투여 시 경구 및 비경구의 여러 가지 제형으로 투여될 수 있는데, 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다.
경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 본 발명의 약학 조성물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(Calcium carbonate), 수크로스(Sucrose) 또는 락토오스(Lactose), 젤라틴 등을 섞어 조제될 수 있다.
단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다.
비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁용제로는 프로필렌 글리콜(Propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명에서는 GDF-3가 높게 발현되는 성체줄기세포를 제대혈로부터 분리하여 GDF-3의 제대혈 줄기세포 내 역할을 분석한 결과 제대혈 줄기세포가 GDF-3를 높게 발현 시 세포 증식능과 세포외기질 분비능이 증가되어 있음을 밝혀내었으며, 이러한 GDF-3가 줄기세포뿐만 아니라 일반 체세포에서도 세포증식과 세포외기질 분비능에도 영향을 주는 것을 확인하였다.
이러한 특성을 통해 성체줄기세포의 계대 가능 회수가 증가함에 따라 더 많은 줄기세포를 확보할 수 있어 줄기세포 자체와 줄기세포가 분비하는 유효 물질을 대량으로 확보할 수 있다. 이는 GDF-3 고발현 제대혈 줄기세포와 세포 분비 물질을 활용한 다양한 조성물 개발에 유용하게 작용할 수 있다.
따라서, 본 발명에 따라 제조된 GDF-3 고발현 제대혈 줄기세포는 차세대 바이오의약품 영역에서 하나의 주원료로 활용할 수 있다.
또한, GDF-3에 의해 세포외기질 분비능이 증가한 경우 이를 포함하는 세포배양액의 효능이 높아짐에 따를 배양액을 활용한 화장품 및 의약품 제조에 적용 가능한 조성물 개발에 유용하게 작용할 수 있다.
도 1은 실시예 1에서 분리 배양한 제대혈 줄기세포가 고유 표면 단백질을 발현하는지 여부를 분석한 그래프이다.
도 2는 일반 DMEM 배지(CTR)와 신규 줄기세포 배양용 배지(PMS)에서 제대혈 줄기세포 분리 후 계대 별 세포 모양과 증식 속도를 비교한 것이다.
도 3은 일반 DMEM 배지(CTR)와 신규 줄기세포 배양용 배지(PMS) 간 후기 계대(P7 이후) 시 세포의 증식 정도를 비교한 그래프이다.
도 4는 일반 DMEM 배지(CTR)과 신규 줄기세포 배양용 배지(PMS)를 활용하여 제대혈 줄기세포 배양 시 세포가 분비하는 세포외기질 물질, 파이브로넥틴의 분비량을 비교한 그래프이다.
도 5는 일반 DMEM 배지(CTR)과 신규 줄기세포 배양용 배지(PMS)에서 제대혈 줄기세포를 배양 시 계대 배양 초기(P3) 부터 후기(P7)까지 세포에서 발현하는 GDF-3 유전자 발현 특성을 분석한 그래프이다.
도 6은 일반 피부세포(dermal fibroblast) 배양 시 GDF-3 단백질 처리 후 GDF-3 유전자 고발현을 확인한 것이다.
도 7은 사람상피세포(HDF) 생장에 미치는 GDF-3의 영향을 도시한 그래프이다. GDF-3가 고발현되는 피부세포의 경우 세포의 증식이 빠르고 지속적으로 진행됨을 확인한 것이다.
도 8은 GDF-3 고발현이 유도된 일반 피부세포가 대조군 피부세포에 비해 세포외기질 성분인 콜라겐(collagen)과 파이브로넥틴(Fibronectin)의 유전자 발현이 높게 나타나는 것을 확인한 것이다.
이하, 본 발명을 실시예를 통하여 보다 구체적으로 설명한다. 다만, 하기 실시예는 본 발명의 기술적 특징을 명확하게 예시하기 위한 것일 뿐 본 발명의 보호범위를 한정하는 것은 아니다.
실시예 1. 제대혈 줄기세포 분리
1.1. 제대혈 단핵세포 분리
산모로부터 채취한 제대혈을 HetasepTM와 혼합하여 적혈구를 제거한 후 피콜상(Ficoll-plaque)을 처리하여 원심분리 후 제대혈 단핵세포를 분리하여 PBS로 세척하였다. 피브로넥틴(Fibronectin) (50ug/ml)으로 코팅한(24hrs at 4°C) 배양접시에 제대혈 단핵세포를 시딩(Seeding)하였다. 이때 사용되는 배양 배지는 DMEM/F12에 FGF-2, EGF, TGF-β superfamily growth factors, Ascorbic Acid, Heparin을 추가로 첨가하여 개발한 신규 자체 배지를 사용하였다.
1.2. 제대혈 줄기세포 분리
제대혈 단핵세포를 48시간 배양 후, 배양접시에 부착되지 못한 세포는 제거하고 부착된 단핵세포만을 배양하고, 빠르게 증식하는 단핵세포를 선택적으로 분리하여 배양한 후 Stem cell Marker를 분석하였다. 이때 배양배지는 2~3일 간격으로 교체하며 cell doubling time이 24 시간 미만인 제대혈 줄기세포를 분리하였다.
1.3. 제대혈 줄기세포 고유 표면 마커 발현 분석
1.2. 에서 제대혈 줄기세포 분리 후 분리한 세포가 제대혈 줄기세포인지 여부를 확인하기 위해 flow cytometry 실험을 하였다. 세포 표면 항원 phenotyping을 위해 3~4 계대의 세포를 수득하여 fluorescein isothiocyanate(FITC) 또는 phycoerythrin(PE)가 결합된 항체로 염색하고 FACS(CytoFLEX, BECKMAM COULTER, CA)로 분석하였다.
1.2. 에서 분리한 제대혈 줄기세포의 특성을 분석하기 위해 양성 표지 항원으로 CD44(중간엽 줄기세포 마커), CD73(중간엽 줄기세포 마커), CD105(중간엽 줄기세포 마커)를 사용하였으며, 음성 표지 항원으로 CD11b(조혈모 줄기세포 마커), CD19(면역세포 마커), CD34(조혈모 줄기세포 마커), CD45(비조혈모 줄기세포 마커), HLA-DR(면역거부반응 관련 마커)를 사용하였다. 이의 결과로서 제대혈 줄기세포의 CD 항원에 대한 양성 세포 비율은 표 1 및 이를 그래프로 표시한 도 1 과 같다.
CD 항원 종류 양성으로 염색된 세포 비율(%)
제대혈 줄기세포 양성 항원 CD44 93.50%
CD73 94.05%
CD105 99.33%
제대혈 줄기세포 음성 항원 CD11b 0.59%
CD19 2.73%
CD34 0.35%
CD45 0.31%
HLA-DR 0.33%
비교예 1
1.1 제대혈 단핵세포 분리 및 1.2 제대혈 줄기세포 분리 시 배지 대조군으로 DMEM을 사용한 것을 제외하고 실시예 1와 동일한 방법으로 제대혈로부터 줄기세포를 분리 배양하였다.
실시예 2. 제대혈 줄기세포 배양 및 증식능 분석
실시예 1 및 비교예 1에서 각각 분리된 제대혈 줄기세포(Umbilical cord blood stem cell)는 10% 우태아 혈청(Fetal bovine serum) 및 FGF2(Fibroblast growth factor 2)를 함유하는 DMEM/F12 배지 기반 신규 줄기세포 배양용 배지를 첨가하여 37도씨 5% CO2 배양기에서 배양하였다. 이로부터 세포 증식률을 비교하였다(도 2 및 도 3).
도 2에서 비교된 바와 같이, 실시예 1에서 분리배양된 제대혈 줄기세포(PMS)가 비교예 1에서 분리배양된 제대혈 줄기세포(CTR) 보다 증식 속도가 빠르다.
또한, 도 3에서 비교된 바와 같이, 비교예 1에서 분리배양된 제대혈 줄기세포(CTR)는 7계대 이후 세포 생장이 정지되지만, 실시예 1에서 분리배양된 제대혈 줄기세포(PMS)는 8계대 이상도 세포 증식이 유도되었다. 따라서, 본 발명은 보다 많은 줄기세포의 대량 확보가 가능하다.
실시예 3. 제대혈 줄기세포의 세포외기질(ECM) 물질 분비능 비교
실시예 1과 비교예 1에서 분리된 제대혈 줄기세포에 대해, 각 계대별 제대혈 줄기세포를 4~10x103 cells/cm2으로 Seeding 한 다음 24시간 후 PBS 세척 후 Serum Free Media로 배지 교환 후 2~7일간 배양하여 제대혈 줄기세포 배양액을 만들었다.
각 계대별 제대혈 줄기세포 배양액을 ELISA Kit를 활용하여 Fibronectin의 발현량을 분석하였다(도 4).
도 4에 도시한 바와 같이, GDF-3 고발현이 유지되었던 실시예 1에서 분리된 제대혈 줄기세포를 계대배양한 제대혈 줄기세포 배양액 내 Fibronectin의 함유량이 비교예 1에서 분리된 제대혈 줄기세포를 계대배양한 대조군에 비해 높은 것을 확인하였다.
실시예 1에서 분리된 제대혈 줄기세포는, 비교예 1에서 분리된 제대혈 줄기세포 대비 세포 증식뿐만 아니라, ECM 성분 분비량도 증가하였다.
실시예 4. Passage 별 GDF-3 mRNA 발현량 분석
실시예 1과 비교예 1에서 분리된 제대혈 줄기세포에 대해, 각 계대별 제대혈 줄기세포를 PBS 세척하고 Trypsin EDTA로 세포를 부유시킨 후 Trypsin EDTA 처리량 2배의 배양 배지를 넣어 Trypsin EDTA를 비활성화시켰다. 부유시킨 세포를 원심분리하여 상층액을 제거하였다. 세포 펠렛(Pellet)을 PBS로 재 현탁한 후 원심분리하여 상층액을 제거하였다.
PureLink™ RNA Mini Kit(Invitrogen)으로 Total RNA를 분리 후 정량하여 cDNA 합성하였다.
합성된 제대혈 줄기세포 cDNA를 표 2의 Primer로 Real-Time PCR을 진행하여 각 계대별 GDF-3의 발현량을 확인하였다. 이때, 로딩 대조군(loading control)으로 일종의 하우스키핑유전자(house keeping gene)인 GAPDH를 사용하였다(도 5).
GAPDH Forward GACCTGCCGTCTAGAAAAAC
Reverse TTGAAGTCAGAGGAGACCAC
GDF-3 Forward AGACTTATGCTACGTAAAGGA
Reverse CTTTGATGGCAGACAGGTTAA
도 5의 그래프에서 알 수 있는 바와 같이, 증식이 빠른 원인은 GDF-3 고발현 때문이다.
또한, 도 5에 도시한 바와 같이 실시예 1에서 분리된 제대혈 줄기세포(PMS)에서 유의하게 GDF-3의 발현량이 비교예 1에서 분리된 제대혈 줄기세포 대조군(Control)에 비해 높게 나타나는 것을 확인하였다. 특이적으로 계대가 진행될수록 GDF-3의 발현량이 점차 증가하는 것으로 확인되었다.
실시예 5. GDF-3가 처리된 사람상피세포(Human Dermal Fibroblast, HDF)의 특성 분석
사람상피세포(HDF) 배양 동안 GDF-3를 처리한 후 처리하지 않은 대조군과의 세포 특성을 mRNA 분석을 통해 진행하였다. 도 6에 도시된 바와 같이, 실험 결과 GDF-3 처리 실험군에서 유의하게 GDF-3 유전자 발현이 높게 나타나는 것을 확인할 수 있었다.
실시예 6. HDF의 생장에 미치는 GDF-3의 영향
사람상피세포(HDF)를 DMEM 배지에 배양하는 동안 48시간 간격으로 GDF-3를 1 ~100 ng/ml 범위에서 처리한 결과, 도 7에 도시된 바와 같이, GDF-3 처리 실험군에서 미처리군보다 HDF의 생장이 증가되는 것을 확인하였다. GDF-3 처리군에서 세포의 모양이 좀 더 길쭉하고 짧은 형태를 보이면서 증식에 유리한 모양을 가지고 있으며 96시간 이상의 장기간 배양 시에도 세포 증식의 정체 및 감소 없이 지속적으로 세포가 증가하는 것을 확인하였다. 이는 GDF-3가 세포의 지속적인 생장에 영향을 미침을 의미한다(도 7).
실시예 7. GDF-3 고발현 HDF의 세포외기질 유전자 발현량 확인
GDF-3 처리로 인해 피부 재생에 관여하는 Collagen과 Fibronectin과 같은 피부구성물질의 유전자 발현 또한 증가하는 것을 Real-Time PCR 기법으로 확인하였다(도 8).
도 8에 나타난 바와 같이, HDF에서 GDF-3 고발현이 유지되면 ECM 성분의 유전자 발현량이 증가되는 것을 확인하였다.

Claims (23)

  1. 제대혈 줄기세포를 배양하여 GDF-3을 발현시키는 것이 특징인 GDF-3 제조방법.
  2. 제1항에 있어서, 제대혈 줄기세포의 세포 증식 속도는 24 시간 이하로 생장 속도(cell doubling time)가 빠른 제대혈 줄기세포를 분리배양한 것이 특징인 GDF-3 제조방법.
  3. 제1항에 있어서, 제대혈 줄기세포는 DMEM/F12에 FGF-2, EGF, TGF-β 수퍼패밀리 성장인자(superfamily growth factor), 아스코르브산(Ascorbic Acid), 및 헤파린(Heparin)을 추가로 첨가한 배지에서 원하는 생장 속도(cell doubling time)를 가진 제대혈 줄기세포를 분리배양한 것인 GDF-3 제조방법.
  4. 제1항에 있어서, GDF-3는 섬유아세포의 생장을 증가시키는 것이 특징인 GDF-3 제조방법.
  5. 제4항에 있어서, GDF-3에 의해 생장을 증가시키는 섬유아세포는 사람상피세포(Human Dermal Fibroblast) 인 것이 특징인 GDF-3 제조방법.
  6. 제1항에 있어서, GDF-3는 이에 의해 섬유아세포에서 GDF-3, 콜라겐 및 피브로넥틴으로 구성된 군에서 적어도 하나 선택된 단백질의 유전자(들)의 발현을 증가시키는 것이 특징인 GDF-3 제조방법.
  7. 제1항에 있어서, GDF-3는 세포의 증식 및/또는 재생 촉진에 관여하는 유효 물질의 합성을 촉진하는 것이 특징인 GDF-3 제조방법.
  8. GDF-3 고발현 제대혈 줄기세포를 확보하기 위해, 생장 속도(cell doubling time)가 빠른 제대혈 줄기세포를 분리배양 하는 것이 특징인 GDF-3 발현 제대혈 줄기세포의 제조방법.
  9. 제8항에 있어서, 분리배양된 제대혈 줄기세포의 증식 속도가 클 수록 분리배양된 제대혈 줄기세포의 GDF-3 발현량이 높은 것이 특징인 GDF-3 발현 제대혈 줄기세포의 제조방법.
  10. 제8항에 있어서, GDF-3 고발현 제대혈 줄기세포에 대한 세포은행(cell bank) 구축하기 위해 사용되는 것이 특징인 GDF-3 고발현 제대혈 줄기세포의 제조방법.
  11. 제8항에 있어서,
    제대혈로부터 분리한 제대혈 단핵세포들을 TGF-β 수퍼패밀리 성장인자(superfamily growth factor) 함유 배지에 시딩(Seeding)하여 배양하는 제1단계; 및
    배양접시에 부착되어 상대적으로 빠르게 증식하는 단핵세포를 선택적으로 분리하여 배양하는 제2단계
    를 포함하는 것이 특징인 GDF-3 발현 제대혈 줄기세포의 제조방법.
  12. 제8항에 있어서, GDF-3 발현 제대혈 줄기세포는 이를 배양하여 GDF-3 함유 배양액을 제조하는데 사용되는 것이 특징인 GDF-3 발현 제대혈 줄기세포의 제조방법.
  13. 제8항에 있어서, GDF-3 발현 제대혈 줄기세포는 계대가 진행될수록 GDF-3의 발현량이 점차 증가하는 것이 특징인 GDF-3 고발현 제대혈 줄기세포의 제조방법.
  14. 제8항에 있어서, GDF-3 고발현 제대혈 줄기세포를 확보하기 위해, GDF-3 발현 제대혈 줄기세포는 계대 5 또는 그 이상의 계대인 것이 특징인 GDF-3 발현 제대혈 줄기세포의 제조방법.
  15. 제8항에 있어서, 제대혈 줄기세포를 대량확보하기 위해, GDF-3 발현 제대혈 줄기세포를 계대배양하는 것이 특징인 GDF-3 제대혈 줄기세포의 제조방법.
  16. 제8항에 있어서, 세포외기질 성분 분비능이 우수한 제대혈 줄기세포를 대량확보하기 위해, GDF-3 발현 제대혈 줄기세포를 계대배양하는 것이 특징인 GDF-3 제대혈 줄기세포의 제조방법.
  17. 제대혈로부터 분리한 제대혈 단핵세포들을 TGF-β 수퍼패밀리 성장인자(superfamily growth factor) 함유 배지에 시딩(Seeding)하여 배양하고, 배양접시에 부착되어 상대적으로 빠르게 증식하는 단핵세포를 선택적으로 분리하여 배양한 것이 특징인 GDF-3 발현 제대혈 줄기세포.
  18. GDF-3를 함유하는 것이 특징인 섬유아세포 생장 증가용 조성물.
  19. 제18항에 있어서, 섬유아세포는 사람상피세포(Human Dermal Fibroblast, HDF) 인 것이 특징인 섬유아세포 생장 증가용 조성물.
  20. 제18항에 있어서, GDF-3는 섬유아세포에서 GDF-3, 콜라겐 및 피브로넥틴으로 구성된 군에서 적어도 하나 선택된 단백질의 유전자(들)의 발현을 증가시키는 것이 특징인 섬유아세포 생장 증가용 조성물.
  21. 제18항에 있어서, GDF-3는 세포의 증식 및/또는 재생 촉진에 관여하는 유효 물질의 합성을 촉진하는 것이 특징인 섬유아세포 생장 증가용 조성물.
  22. GDF-3를 함유하는 것이 특징인 피부 재생용 조성물.
  23. 제22항에 있어서, 화장료 조성물 또는 약학 조성물인 것이 특징인 피부 재생용 조성물.
PCT/KR2021/018355 2020-12-04 2021-12-06 Gdf-3를 고발현하는 제대혈 줄기세포 분리 및 배양 방법 및 gdf-3의 용도 WO2022119418A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US18/265,142 US20230406897A1 (en) 2020-12-04 2021-12-06 Method for isolating and culturing cord blood stem cells expressing gdf-3 at high level, and use of gdf-3
EP21901106.1A EP4257674A1 (en) 2020-12-04 2021-12-06 Method for isolating and culturing cord blood stem cells expressing gdf-3 at high level, and use of gdf-3
JP2023534204A JP2024500063A (ja) 2020-12-04 2021-12-06 Ｇｄｆ－３を高発現する臍帯血幹細胞の分離及び培養方法、並びにｇｄｆ－３の用途
CN202180092901.6A CN116848232A (zh) 2020-12-04 2021-12-06 高表达gdf-3的脐带血干细胞分离和培养方法及gdf-3的用途

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20200168691 2020-12-04
KR10-2020-0168691 2020-12-04

Publications (1)

Publication Number Publication Date
WO2022119418A1 true WO2022119418A1 (ko) 2022-06-09

Family

ID=81853384

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/018355 WO2022119418A1 (ko) 2020-12-04 2021-12-06 Gdf-3를 고발현하는 제대혈 줄기세포 분리 및 배양 방법 및 gdf-3의 용도

Country Status (6)

Country Link
US (1) US20230406897A1 (ko)
EP (1) EP4257674A1 (ko)
JP (1) JP2024500063A (ko)
KR (1) KR20220079490A (ko)
CN (1) CN116848232A (ko)
WO (1) WO2022119418A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116987151A (zh) * 2023-08-02 2023-11-03 陕西中港万海生命科学研究院有限公司 一种脐带间充质干细胞上清液在皮肤修复以及抗衰老护肤品中的制备方法及应用

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000005248A1 (en) * 1998-07-24 2000-02-03 Eli Lilly And Company Human gdf-3 nucleic acids, polypeptides, vectors, host cells, methods and uses thereof
WO2006002387A2 (en) * 2004-06-24 2006-01-05 Acceleron Pharma Inc. Gdf3 propeptides and related methods
KR20100114729A (ko) * 2009-04-16 2010-10-26 (주)차바이오앤디오스텍 제대혈 줄기세포 유래 혈관전구세포 배양액 또는 배양 분비물을 이용한 피부재생용 조성물 및 이의 용도
KR20170093283A (ko) * 2016-02-04 2017-08-16 주식회사 강스템바이오텍 Gdf11을 포함하는 조성물 및 그의 용도

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000005248A1 (en) * 1998-07-24 2000-02-03 Eli Lilly And Company Human gdf-3 nucleic acids, polypeptides, vectors, host cells, methods and uses thereof
WO2006002387A2 (en) * 2004-06-24 2006-01-05 Acceleron Pharma Inc. Gdf3 propeptides and related methods
KR20100114729A (ko) * 2009-04-16 2010-10-26 (주)차바이오앤디오스텍 제대혈 줄기세포 유래 혈관전구세포 배양액 또는 배양 분비물을 이용한 피부재생용 조성물 및 이의 용도
KR20170093283A (ko) * 2016-02-04 2017-08-16 주식회사 강스템바이오텍 Gdf11을 포함하는 조성물 및 그의 용도

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
LEVINE ARIEL J., BRIVANLOU ALI H: "GDF3, a BMP inhibitor, regulates cell fate in stem cells and early embryos", DEVELOPMENT, vol. 133, no. 2, 15 January 2006 (2006-01-15), GB , pages 209 - 216, XP055937453, ISSN: 0950-1991, DOI: 10.1242/dev.02192 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116987151A (zh) * 2023-08-02 2023-11-03 陕西中港万海生命科学研究院有限公司 一种脐带间充质干细胞上清液在皮肤修复以及抗衰老护肤品中的制备方法及应用
CN116987151B (zh) * 2023-08-02 2024-02-20 陕西中港万海生命科学研究院有限公司 一种脐带间充质干细胞上清液在皮肤修复以及抗衰老组合物中的制备方法及应用

Also Published As

Publication number Publication date
US20230406897A1 (en) 2023-12-21
EP4257674A1 (en) 2023-10-11
CN116848232A (zh) 2023-10-03
KR20220079490A (ko) 2022-06-13
JP2024500063A (ja) 2024-01-04

Similar Documents

Publication Publication Date Title
WO2017123022A1 (ko) 고함량의 성장인자를 함유한 줄기세포 유래 엑소좀
WO2019135644A1 (ko) 유도만능 줄기세포 유래 중간엽 줄기세포 및 이로부터 유래된 엑소좀을 포함하는 피부질환의 개선, 예방 또는 치료용 조성물
AU2017202287B2 (en) Composition for differentiation induction of adipocyte containing stem cell-derived exosome, regeneration of adipose tissue, and skin whitening or wrinkle improvement
WO2016072821A1 (ko) 줄기세포 유래 엑소좀을 함유하는 지방세포 분화유도, 지방조직 재생, 피부 미백 또는 주름개선용 조성물
JP5911874B2 (ja) 発毛を促進又は増強するためのエキソソームの使用
WO2013009100A2 (ko) 탯줄 추출물의 제조방법 및 그의 용도
US11590175B2 (en) Compositions containing amniotic components and methods for preparation and use thereof
WO2019135645A1 (ko) 인터페론 감마로 전처리된 유도만능 줄기세포 유래 중간엽 줄기세포 및 이로부터 유래된 엑소좀을 포함하는 피부질환의 개선, 예방 또는 치료용 조성물
WO2014181954A1 (ko) 줄기세포의 재생능 향상을 위한 배지 조성물 및 이를 이용한 줄기세포의 배양방법
WO2015005614A1 (ko) 인간 배아줄기세포에서 유래된 중간엽 줄기세포를 유효성분으로 함유하는 간섬유화 또는 간경화 예방 및 치료용 조성물
WO2018131900A2 (ko) 나노그를 도입한 양수 내 태아 유래 중간엽 줄기세포로부터 획득한 엑소좀 내 포함된 육모 촉진용 조성물의 제조방법
WO2011043524A1 (ko) 인간 유래 성체 줄기세포를 함유하는 항암용 조성물
WO2017135556A1 (ko) Gdf11을 포함하는 조성물 및 그의 용도
WO2017047996A1 (ko) 나노그를 도입한 양수 내 태아 유래 중간엽 줄기세포를 이용한 육모 촉진용 조성물의 제조방법
WO2021201637A1 (ko) 제대혈 줄기세포에 의해 고효능의 엑소좀이 고함량으로 분비된 배양액의 제조 방법 및 이의 용도
WO2022119418A1 (ko) Gdf-3를 고발현하는 제대혈 줄기세포 분리 및 배양 방법 및 gdf-3의 용도
WO2012008733A2 (ko) 1기 태반조직 유래 줄기세포 및 이를 함유하는 세포치료제
WO2022119417A1 (ko) 리포폴리사카라이드와 리포테이코산을 활용한 항염 및 재생 기능이 강화된 고농도 줄기세포 엑소좀 생산 방법
WO2010107287A2 (ko) 양수 내 태아 유래 중간엽줄기세포를 이용한 발모촉진용 조성물
WO2013165120A1 (ko) 신경능선줄기세포의 배양방법 및 그 용도
JP2021528489A (ja) 皮膚科用医薬組成物及びその使用
KR20220063839A (ko) 상처 치유 또는 피부 재생, 및 탈모 예방 또는 모발 성장 촉진용 중간엽 줄기세포 배양액 및 이의 제조방법
WO2019112161A2 (ko) 조류의 에그로부터 분리한 세포인 배반엽 전분화능세포, 신경줄기세포, 배아섬유아세포 컨디션드 배지를 유효성분으로 하는 세포 증식, 피부재생 및 주름 개선용 배지 조성물
WO2021162206A1 (ko) 모낭조직 배양액을 포함하는 탈모의 예방 또는 치료용 조성물
WO2018155913A1 (ko) 저분자 화합물을 이용한 골격근육세포 분화 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21901106

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2023534204

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021901106

Country of ref document: EP

Effective date: 20230704

WWE Wipo information: entry into national phase

Ref document number: 202180092901.6

Country of ref document: CN