WO2021251673A1 - 치주질환 또는 탈구성 외상 치아의 예방 또는 치료용 약학 조성물 - Google Patents

치주질환 또는 탈구성 외상 치아의 예방 또는 치료용 약학 조성물 Download PDF

Info

Publication number
WO2021251673A1
WO2021251673A1 PCT/KR2021/006812 KR2021006812W WO2021251673A1 WO 2021251673 A1 WO2021251673 A1 WO 2021251673A1 KR 2021006812 W KR2021006812 W KR 2021006812W WO 2021251673 A1 WO2021251673 A1 WO 2021251673A1
Authority
WO
WIPO (PCT)
Prior art keywords
peptide
periodontal
composition
pharmaceutical composition
amino acid
Prior art date
Application number
PCT/KR2021/006812
Other languages
English (en)
French (fr)
Inventor
박주황
이지현
이동설
Original Assignee
주식회사 하이센스바이오
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 하이센스바이오 filed Critical 주식회사 하이센스바이오
Priority to CN202180041213.7A priority Critical patent/CN115666614A/zh
Priority to AU2021289122A priority patent/AU2021289122A1/en
Priority to BR112022024634A priority patent/BR112022024634A2/pt
Priority to MX2022015506A priority patent/MX2022015506A/es
Priority to CA3185884A priority patent/CA3185884A1/en
Priority to US18/009,236 priority patent/US20230257419A1/en
Priority to EP21822081.2A priority patent/EP4226932A4/en
Priority to JP2022575190A priority patent/JP7562167B2/ja
Publication of WO2021251673A1 publication Critical patent/WO2021251673A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/08—Peptides having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0053—Mouth and digestive tract, i.e. intraoral and peroral administration
    • A61K9/0056—Mouth soluble or dispersible forms; Suckable, eatable, chewable coherent forms; Forms rapidly disintegrating in the mouth; Lozenges; Lollipops; Bite capsules; Baked products; Baits or other oral forms for animals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/02—Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids

Definitions

  • the present invention relates to a pharmaceutical composition for the prevention or treatment of periodontal disease or disorganized traumatic teeth, and a composition for periodontal tissue regeneration.
  • Periodontium refers to the tissues surrounding the teeth.
  • Periodontal tissue consists of the alveolar bone supporting the teeth within the jawbone (jawbone), the periodontal ligament connecting the alveolar bone and the teeth within the jawbone, the cementum containing the fibers of the periodontal ligament, and the gingiva (gum), which is the soft tissue covering the alveolar bone.
  • Gingival fibroblasts and periodontal ligament fibroblasts are major cellular components of the gingival soft tissue connective tissue, and play a role in forming and maintaining the extracellular matrix.
  • gingival fibroblasts are mainly involved in maintaining the gingival connective tissue, whereas periodontal ligament fibroblasts are involved in the repair and regeneration of adjacent alveolar bone and cementum in vivo as well as forming periodontal ligaments with their unique function. is known
  • the periodontal ligament is a fibrous connective tissue that connects the cementum of the tooth root (periodontal part) and the alveolar bone. Both ends of the periodontal ligament are embedded in the cementum and alveolar bone of the root part, and the periodontal ligament fiber bundle embedded in the alveolar bone or cementum is called Sharpey's fiber.
  • the function of the periodontal ligament is not only to maintain the teeth and to maintain the structural characteristics of hard tissues, but also to resist the impact of occlusal pressure and to protect soft tissues such as blood vessels and nerves from damage. Another important function is to supply nutrients and function as sensory receptors.
  • the nerve control of the periodontal ligament transmits proprioceptive sensations, tactile sensations, and pain sensations through the trigeminal nerve pathway, and detects and regulates external pressure applied to individual teeth. It plays an important role in the neuromuscular mechanisms regulating the masticatory musculature. These periodontal ligaments contain many fibroblasts, and these cells not only form periodontal ligaments with their unique functions, but are also involved in the formation and resorption of cementum and alveolar bone to induce physiological tooth movement and allow periodontal tissues to adapt to occlusal pressure. It has the ability to restore damage.
  • Periodontal disease is classified into gingivitis limited to the gums and periodontitis in which inflammation spreads to the alveolar bone surrounding the tooth root. When periodontal disease occurs, it clinically causes tooth loss due to gingival bleeding and swelling, formation of periodontal pockets and destruction of alveolar bone.
  • the causes of such periodontal disease include local and systemic factors. Two known local causative factors are dental plaque, calculus and other local causes and trauma from occlusion.
  • plaque mechanically accumulates in the periodontal pocket, it becomes a habitat for surrounding bacteria, and this habitat gradually transitions from aerobic, aerobic, and gram-positive bacteria to anaerobic, gram-negative bacteria, and proliferates to the depths of the periodontal pocket, such anaerobes Gram-negative bacteria proliferate and migrate to the depths of the periodontal pocket.
  • the toxin and all products of the proliferated anaerobic Gram-negative bacteria cause inflammation along with destruction of periodontal tissue by various actions from the stimulated immune system either directly destroying tissues or stimulating the immune system.
  • the function of polymorphonuclear leukocytes and immune response act as systemic factors.
  • the basic treatment of periodontal disease is a calculus removal (scaling) procedure that removes plaque and tartar that causes periodontal disease, and similarly, a procedure that removes plaque and calculus. There is root planing. When inflammation is severe due to periodontal disease, alveolar bone damage is accompanied. For the type of bone to be transplanted, the patient's own bone (autologous bone) or xenogeneic or synthetic bone can be used.
  • periodontal disease it is considered that not only the causative bacteria of periodontal disease should be removed, but also the process of regenerating periodontal tissue should be performed together.
  • Korean Patent No. 1179476 discloses that the promyelocytic leukemia zinc finger (PLZF) gene, Fk506 binding protein 5 (FKBP5) gene, serum amyloid A1 (SAA1) gene, fatty acid binding protein 4 (FABP4) gene, family A (FAM107A) gene with sequence similarity, corin (CORIN) gene, ras-associated C3 butolinum toxin substrate 3 (RAC3) gene or prolactin-derived protein ( PIP) genes and FNDC1, PTGS2, RSAD2, NPTX1, VCAM1, MX1, IFIT1, CLDN1 or WISP2 genes that are low expressed during mineralization of human periodontal ligament (hPDL) cells are disclosed.
  • Korean Patent Registration No. 101788916 discloses a pharmaceutical composition for treating periodontal disease comprising an enamel cell culture solution.
  • Dental trauma can be broadly divided into fracture trauma and deconstructive trauma.
  • Dislocation trauma refers to damage to the periodontal ligament and can be subdivided into concussion/subluxation, orbital dislocation, lateral dislocation, complete dislocation, and intrusion. The success of replanting such a completely dislocated tooth depends on the regeneration of the periodontal ligament attached to the completely dislocated tooth or the periodontal ligament remaining in the alveolar fovea from which the tooth is missing.
  • periodontal ligament regeneration does not occur, the cementum and dentin of the tooth root are resorbed, and osseointegration (Ankylosis) occurs in which this area is replaced by alveolar bone. Therefore, the ultimate goal of periodontal treatment is to prevent the progression of periodontal disease and regenerate the destroyed periodontal tissues including gingiva, periodontal ligament, alveolar bone, and cementum to restore it to its original state. No method has been reported.
  • periodontal tissue gingiodontal ligament, cementum, alveolar bone
  • the present invention was completed by confirming a new use of a peptide capable of not only treating damaged periodontal ligaments of teeth but also regenerating damaged cementum and alveolar bone.
  • An object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of periodontal disease or disorganized traumatic teeth.
  • Another object of the present invention is to provide a composition for periodontal tissue regeneration.
  • Another object of the present invention is to provide a composition for promoting gene expression of any one or more of BSP, DMP1, CAP, COL3, and periostin.
  • the present invention relates to a method for treating periodontal disease or destructive traumatic teeth in a subject, comprising administering to the subject in need of treatment for periodontal disease or deconstructive traumatic tooth, an effective amount of a peptide or a pharmaceutically acceptable salt thereof Another purpose is to provide
  • Another object of the present invention is to provide a use of the peptide or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for the prevention or treatment of periodontal disease or deconstructive traumatic teeth.
  • compositions for the prevention or treatment of periodontal disease or deconstructive trauma teeth comprising a peptide comprising the amino acid sequence of the following general formula 1 or a pharmaceutically acceptable salt thereof provides:
  • X5 to X7 are each independently arginine (R) or lysine (K);
  • X8 is asparagine (N) or serine (S).
  • mutant peptides having a sequence different from the amino acid sequence constituting it and one or more amino acid residues are also included in the scope of the peptides provided in the present invention. do.
  • the present inventors have completed the present invention by confirming that the peptide can treat periodontal disease or deconstructive traumatic teeth by promoting the regeneration of periodontal ligaments or differentiation into osteoblasts and cretaceous cells, and regeneration of alveolar bone and cementum.
  • the peptide increased the expression of BSP, DMP1, and CAP, which are osteoblast and chorionic cell differentiation marker genes, and increased the expression of periostin and COL3, which are periodontal ligament differentiation marker genes, in human periodontal ligament cells.
  • the peptide increases the expression of BSP and DMP1, which are marker genes for osteoblasts and cetaceans, in human mesenchymal stem cells.
  • the peptide regenerated alveolar bone, cementum, and periodontal ligament.
  • the peptide of the present invention has the effect of regenerating alveolar bone and forming new cementum-like tissue and new periodontal ligament-like tissue, and the new periodontal ligament formed by the peptide of the present invention is embedded in the newly formed alveolar bone and cementum. was confirmed.
  • the peptide may be one in which a conservative substitution has occurred in one or more amino acids.
  • Constant substitution means substituting an amino acid for another amino acid having similar structural and/or chemical properties.
  • the peptides may have, for example, one or more conservative substitutions while still retaining the same or similar biological activity.
  • Such amino acid substitutions may generally occur based on similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues.
  • positively charged (basic) amino acids include arginine, lysine, and histidine
  • negatively charged (acidic) amino acids include glutamic acid and aspartic acid
  • Aromatic amino acids include phenylalanine, tryptophan and tyrosine
  • hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine and tryptophan.
  • amino acids can be classified into amino acids with electrically charged side chains and amino acids with uncharged side chains, and amino acids with charged side chains are aspartic acid, glutamic acid, lysine, Amino acids with uncharged side chains, including arginine and histidine, can be further classified as nonpolar amino acids or polar amino acids, and nonpolar amino acids are glycine, alanine, valine, leucine, and isoleucine. Methionine, proline, and polar amino acids can be classified as containing serine, threonine, cysteine, asparagine, and glutamine. Conservative substitutions with amino acids having similar properties as described above can be expected to exhibit the same or similar activity.
  • the effect of the peptide provided in the present invention can be shown as it is, so it falls within the scope of the peptide provided in the present invention. Included. As an example, it may be in a form in which 1 to 300 amino acids are added to the N-terminus or C-terminus of the peptide, and as another example, 1 to 100 amino acids are added to the N-terminus or C-terminus of the peptide. It may be in an added form, and as another example, it may be in a form in which 1 to 24 amino acids are added to the N-terminus or C-terminus of the peptide.
  • the peptide may include the amino acid sequence of any one of SEQ ID NOs: 1 to 16.
  • the peptide may consist essentially of any one of the amino acid sequences of SEQ ID NOs: 1 to 16, or the peptide may consist of any one of the amino acid sequences of SEQ ID NOs: 1 to 16.
  • the peptide of the present invention has an amino acid sequence of SEQ ID NOs: 1 to 16 and 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99 It may include an amino acid sequence having % or more homology or identity, but is not limited thereto.
  • “Homology” or “identity” refers to the degree to which two given amino acid sequences or base sequences are related to each other and can be expressed as a percentage.
  • the terms “homology” and “identity” can often be used interchangeably.
  • Whether any two peptide sequences have homology, similarity or identity can be determined, for example, by Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: using default parameters as in 2444, using a known computer algorithm such as the “FASTA” program. or, as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), The Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) can be used to determine.
  • Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: using default parameters as in 2444, using a known computer algorithm such as the “FASTA” program. or, as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice e
  • GAP program is defined as the total number of symbols in the shorter of two sequences divided by the number of similarly aligned symbols (ie, amino acids).
  • Default parameters for the GAP program are: (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp.
  • the peptide may be used in the form of a single peptide, or in the form of a polypeptide in which the peptide is repeated two or more times and linked.
  • the pharmaceutical composition may include a polypeptide in which the peptide is linked repeatedly.
  • a peptide comprising the amino acid sequence of Formula 1 applied to the present invention can be prepared by a combination of various methods for preparing various peptides.
  • the peptide of the present invention can be synthesized by a method well known in the art, for example, an automatic peptide synthesizer, or it can be produced by a genetic engineering technique.
  • the peptides of the present invention can be prepared by standard synthetic methods, recombinant expression systems, or any other method in the art. Accordingly, the peptides according to the present invention can be synthesized by a number of methods including, but not limited to, for example, methods including:
  • the preparation of the peptide may include modification using L- or D-form amino acids, and/or non-natural amino acids; and/or by modifying the native sequence, e.g., modification of side chain functional groups, intramolecular covalent bonds, such as inter-side chain ring formation, methylation, acylation, ubiquitination, phosphorylation, aminohexylation, biotinylation, etc. includes all that Also, the above modifications include all substitutions with non-naturally occurring compounds.
  • Substituted or added amino acids used in the above modification may use atypical or non-naturally occurring amino acids as well as the 20 amino acids commonly found in human proteins.
  • Commercial sources of atypical amino acids may include, but are not limited to, Sigma-Aldrich, ChemPep and Genzyme pharmaceuticals.
  • Peptides containing these amino acids and canonical peptide sequences may be synthesized and purchased from commercial peptide synthesis companies, for example, American peptide company or Bachem in the United States, or Anygen in Korea, but is not limited thereto.
  • Amino acid derivatives can also be obtained in the same manner, and to name just a few examples, 4-imidazoacetic acid and the like can be used.
  • the peptide according to the present invention may have an unmodified N-terminus and/or C-terminus, but its N-terminus and/or C-terminus, etc.
  • This chemically modified form, protected by an organic group, or modified by adding amino acids to the end of the peptide is also included in the scope of the peptide according to the present invention.
  • the terminus of the peptide according to the present invention has a free carboxyl group, but is not particularly limited thereto.
  • the N-terminus is acetylated and/or the C-terminus is amidated to remove these charges.
  • it is not particularly limited thereto.
  • the peptide may include a peptide in which structural stability to heat, pH, etc. of the peptide is increased by mutation or modification in the amino acid sequence, or the prevention or treatment effect of periodontal disease or deconstructive trauma teeth is increased, or periodontal ligament tissue regeneration ability is increased. .
  • the peptide includes both the peptide itself, a salt thereof (eg, a pharmaceutically acceptable salt of the peptide), or a solvate thereof.
  • the type of the salt is not particularly limited. However, it is preferable that the form is safe and effective for an individual, such as a mammal, but is not particularly limited thereto.
  • the peptide may be in any pharmaceutically acceptable form.
  • “Pharmaceutically acceptable” means a sufficient amount to exhibit a therapeutic effect and does not cause side effects, and includes the type of disease, the patient's age, weight, health, sex, the patient's sensitivity to the drug, the route of administration, It can be easily determined by a person skilled in the art according to factors well known in the medical field, such as the administration method, the number of administration, the treatment period, the combination or the drugs used simultaneously.
  • the peptide may be in the form of a pharmaceutically acceptable salt thereof.
  • the salts include conventional acid addition salts used in the pharmaceutical field, for example periodontal disease, for example salts derived from inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, sulfamic acid, phosphoric acid or nitric acid and acetic acid, propionic acid, succinic acid , glycolic acid, stearic acid, citric acid, maleic acid, malonic acid, methanesulfonic acid, tartaric acid, malic acid, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid, 2-acetoxybenzoic acid, fumaric acid, toluenesulfonic acid, oxalic acid or trifluoroacetic acid salts derived from organic acids.
  • the salt may be a base addition salt such as ammonium, dimethylamine, monomethylamine, monoethylamine, or diethylamine.
  • the salts also include conventional metal salt forms, for example salts derived from metals such as lithium, sodium, potassium, magnesium, or calcium.
  • the acid addition salt, base addition salt or metal salt may be prepared according to a conventional method.
  • Pharmaceutically acceptable salts and general methodologies for their preparation are well known in the art. For example, in P. Stahl, et al. Handbook of Pharmaceutical Salts: Properties, Selection and Use, 2nd Revised Edition (Wiley-VCH, 2011)]; [S.M. Berge, et al., "Pharmaceutical Salts," Journal of Pharmaceutical Sciences, Vol. 66, No. 1, January 1977].
  • triphosphonium salts include benzotriazol-1-yloxytris (pyrrolagino) phosphonium hexafluorophosphate (PyBOP), bromotris (pyrrolazino) phosphonium hexafluorophosphate (PyBroP), 7 -Azabenzotriazol-1-yloxytris(pyrrolazino)phosphonium hexafluorophosphate (PyAOP), examples of tetramethyluronium salts are 2-(1H-benzotriazol-1-yl)- 1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU), 2-(7-azabenzotriazol-1-yl)-1,1,3,3-
  • racemization inhibitors eg, N-hydroxy-5-norbornene-2,3-dicarboxylic acid imide (HONB), 1-hydroxybenzotriazole (HOBt), 1-hydroxy- 7-azabenzotriazole (HOAt), 3,4-dihydro-3-hydroxy-4-oxo-1,2,3-benzotriazine (HOOBt), ethyl 2-cyano-2- (hydroxyl mino)acetate (Oxyma), etc.
  • the solvent used for the condensation may be appropriately selected from those known to be useful for the peptide condensation reaction.
  • acid amides such as anhydrous or water-containing N,N-dimethylformamide, N,N-dimethylacetamide, N-methylpyrrolidone, etc.; halogenated hydrocarbons such as methylene chloride, chloroform, etc.; Alcohols such as fluoroethanol and phenol, sulfoxides such as dimethylsulfoxide, tertiary amines such as pyridine, ethers such as dioxane and tetrahydrofuran, nitriles such as acetonitrile and propionitrile, methyl acetate, ethyl Esters such as acetates and the like, suitable mixtures thereof, and the like can be used.
  • Alcohols such as fluoroethanol and phenol, sulfoxides such as dimethylsulfoxide, tertiary amines such as pyridine, ethers such as dioxane and tetrahydrofuran, nitriles such as acet
  • the reaction temperature is appropriately selected from a range known to be usable for a peptide binding reaction, and is usually selected from the range of about -20°C to 90°C.
  • Activated amino acid derivatives are usually used in 1.5 to 6-fold excess.
  • solid-phase synthesis when the test using the ninhydrin reaction indicates that the condensation is insufficient, sufficient condensation can be carried out by repeating the condensation reaction without removing the protecting group. If the condensation is still insufficient after repeating the reaction, the unreacted amino acid may be acetylated with an acid anhydride, acetylimidazole, or the like, so that the influence on the subsequent reaction can be avoided.
  • protecting groups for the amino group of the starting amino acid are benzyloxycarbonyl (Z), tert-butoxycarbonyl (Boc), tert-pentyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl , 2-chlorobenzyloxycarbonyl (Cl-Z), 2-bromobenzyloxycarbonyl (Br-Z), adamantyloxycarbonyl, trifluoroacetyl, phthaloyl, formyl, 2-nitro phenylsulfenyl, diphenylphosphinothioyl, 9-fluorenylmethyloxycarbonyl (Fmoc), trityl, and the like.
  • Examples of a carboxyl-protecting group for the starting amino acid include, in addition to the above-mentioned C 1-6 alkyl group, C 3-10 cycloalkyl group, C 7-14 aralkyl group, aryl, 2-adamantyl, 4-nitrobenzyl, 4 -methoxybenzyl, 4-chlorobenzyl, phenacyl and benzyloxycarbonylhydrazide, tert-butoxycarbonylhydrazide, tritylhydrazide and the like.
  • the hydroxyl group of serine or threonine may be protected, for example, by esterification or etherification.
  • groups suitable for esterification include lower (C 2-4 ) alkanoyl groups such as acetyl groups, aroyl groups such as benzoyl groups, and groups derived from organic acids and the like.
  • groups suitable for etherification include benzyl, tetrahydropyranyl, tert-butyl (But t ), trityl (Trt), and the like.
  • Examples of the protecting group for the phenolic hydroxyl group of tyrosine include Bzl, 2,6-dichlorobenzyl, 2-nitrobenzyl, Br-Z, tert-butyl and the like.
  • Examples of the protecting group of histidine for imidazole include p-toluenesulfonyl (Tos), 4-methoxy-2,3,6-trimethylbenzenesulfonyl (Mtr), dinitrophenyl (DNP), benzyloxymethyl (Bom), tert-butoxymethyl (Bum), Boc, Trt, Fmoc, and the like.
  • Examples of protecting groups for the guanidino group of arginine include Tos, Z, 4-methoxy-2,3,6-trimethylbenzenesulfonyl (Mtr), p-methoxybenzenesulfonyl (MBS), 2,2, 5,7,8-pentamethylchroman-6-sulfonyl (Pmc), mesitylene-2-sulfonyl (Mts), 2,2,4,6,7-pentamethyldihydrobenzofuran-5-sulfonyl phonyl (Pbf), Boc, Z, NO 2 and the like.
  • Mtr 4-methoxy-2,3,6-trimethylbenzenesulfonyl
  • MSS p-methoxybenzenesulfonyl
  • Pmc 2,2, 5,7,8-pentamethylchroman-6-sulfonyl
  • Mts mesitylene-2-sulfonyl
  • Pbf 2,2,4,6,7-p
  • Examples of the protecting group for the side chain amino group of lysine include Z, Cl-Z, trifluoroacetyl, Boc, Fmoc, Trt, Mtr, 4,4-dimethyl-2,6-dioxocyclohexylidenyl (Dde), etc. includes
  • Examples of the protecting group for indolyl of tryptophan include formyl (For), Z, Boc, Mts, Mtr, and the like.
  • protecting groups for asparagine and glutamine include Trt, xantyl (Xan), 4,4'-dimethoxybenzhydryl (Mbh), 2,4,6-trimethoxybenzyl (Tmob), and the like.
  • activated carboxyl groups in the starting material include the corresponding acid anhydrides, azides, active esters [esters with alcohols (eg pentachlorophenol, 2,4,5-trichlorophenol, 2,4-dinitrophenol) , cyanomethyl alcohol, paranitrophenol, HONB, N-hydroxysucciimide, 1-hydroxybenzotriazole (HOBt), 1-hydroxy-7-azabenzotriazole (HOAt))] include Examples of activated amino groups in the starting material include the corresponding phosphorus amides.
  • Examples of methods for removing (eliminating) protecting groups include catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd-black or Pd-carbon; Anhydrous hydrogen fluoride, methanesulfonic acid, trifluoromethanesulfonic acid, trifluoroacetic acid (TFA), trimethylsilyl bromide (TMSBr), trimethylsilyl trifluoromethanesulfonate, tetrafluoroboric acid, tris(tris) acid treatment with a solution of fluoro)boric acid, boron tribromide, or a mixture thereof; base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine or the like; and reduction with sodium in liquid ammonia and the like.
  • a catalyst such as Pd-black or Pd-carbon
  • Anhydrous hydrogen fluoride methanesulfonic acid, trifluoromethanesulfonic acid, trifluoro
  • the removal reaction by acid treatment described above is generally carried out at a temperature of -20°C to 40°C; Acid treatments include anisole, phenol, thioanisole, methacresol and paracresol; This is done efficiently by adding a cation scavenger such as dimethylsulfide, 1,4-butanedithiol, 1,2-ethanedithiol, triisopropylsilane, and the like.
  • a cation scavenger such as dimethylsulfide, 1,4-butanedithiol, 1,2-ethanedithiol, triisopropylsilane, and the like.
  • the 2,4-dinitrophenyl group used as the protecting group of imidazole of histidine is removed by thiophenol treatment;
  • the formyl group used as the protecting group of the indole of tryptophan is not only by acid treatment in the presence of 1,2-ethanedithiol, 1,4-butanedithiol, etc., but also by alkali treatment with diluted sodium hydroxide, diluted ammonia, etc. It is removed by deprotection.
  • Protection of a functional group that should not be involved in the reaction between the starting material and the protecting group, removal of the protecting group, activation of the functional group involved in the reaction, and the like may be appropriately selected from known protecting groups and known means.
  • an amide of a peptide it is formed by solid-phase synthesis using a resin for amide synthesis, or the ⁇ -carboxyl group of a carboxy terminal amino acid is amidated, and the peptide chain is extended to the desired chain length toward the amino group. Then, a peptide in which the protecting group for the N-terminal ⁇ -amino group of only the peptide chain has been removed and the peptide with only the protecting group for the C-terminal carboxyl group removed from the peptide chain are prepared, and these two peptides are mixed as described above condensed in a solvent. For the details of the condensation reaction, the same applies as above.
  • the protected peptide obtained by condensation is purified, all protecting groups can be removed by the method described above to obtain the desired crude peptide.
  • the desired amide of the peptide can be prepared by purifying this crude peptide using various publicly known means of purification of the main fraction and freeze-drying.
  • the peptide may be in the form of a solvate thereof.
  • “Solvate” means that the peptide or a salt thereof forms a complex with a solvent molecule.
  • Periodontal disease refers to inflammatory diseases that occur in the tissues around the teeth that maintain teeth, such as the gingiva, periodontal ligaments, and alveolar bone. It refers to a disease in which bacteria infect the gap between the gingiva (gum) and the teeth and damage the periodontal ligament and adjacent tissues. As the inflammation progresses and more tissue is damaged, a periodontal pocket is formed, and the more severe periodontitis, the deeper the periodontal pocket.
  • the periodontal disease may be a periodontal tissue inflammatory disease.
  • the periodontal disease may be gingivitis or periodontitis.
  • the pharmaceutical composition may further include a drug for treating periodontal disease.
  • the periodontal disease treatment drug may be separated from the peptide, or may be in a form in which a complex is formed with the peptide by binding to the N-terminus or C-terminus of the peptide.
  • Deconstructive trauma includes traumatic force applied to a tooth or periodontal tissue, in which the tooth and periodontal tissue are destroyed according to the difference in direction and size, and the periodontal ligament is damaged. , including those subdivided into lateral dislocation, complete dislocation, and intrusion. Therefore, fundamental treatment of deconstructive trauma also requires regeneration of the damaged periodontal ligament. In particular, the success of replanting a completely dislocated tooth depends on the regeneration of the periodontal ligament attached to the completely dislocated tooth or the periodontal ligament remaining in the alveolar fossa from which the tooth is missing. If periodontal ligament regeneration does not occur, the cementum and dentin of the tooth root are resorbed, and osseointegration (Ankylosis) occurs in which this area is replaced by alveolar bone.
  • Tooth replantation is a method of intentionally extracting a tooth and then performing appropriate root canal treatment or re-implanting it in the extraction fossa before it is performed. Intentional replantation can be performed in situations where root canal treatment has failed, anatomical limitations, accessibility difficulties, dislocated teeth due to an accident, or intentionally rapid orthodontic eruption is required.
  • Prevention refers to any action that suppresses or delays the onset of periodontal disease or disorganized traumatic teeth by administration of the composition.
  • Treatment refers to any action in which the symptoms of periodontal disease or disorganized traumatic teeth are improved or beneficial by administration of the composition.
  • the pharmaceutical composition may be prepared in the form of a pharmaceutical composition for the treatment of periodontal disease further comprising an appropriate carrier (natural or non-natural carrier), excipient or diluent commonly used in the preparation of a pharmaceutical composition to the peptide.
  • the pharmaceutical composition may be formulated and used in the form of a sterile injectable solution that can be administered to the area induced by periodontal disease according to a conventional method, respectively.
  • carriers, excipients and diluents that may be included in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate, mineral oil, collagen and the like.
  • aqueous solutions such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants.
  • sterilized aqueous solutions non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, suppositories, ointments (for example, dental pulp material, etc.) may be included.
  • Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • witepsol macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like can be used.
  • the content of the peptide or a pharmaceutically acceptable salt thereof included in the pharmaceutical composition is not particularly limited thereto, but may be included in an amount of 0.0001 to 50% by weight, or 0.01 to 20% by weight, based on the total weight of the final composition.
  • the pharmaceutical composition may be administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat or prevent a disease at a reasonable benefit/risk ratio applicable to medical treatment or prevention.
  • the effective dose level is the severity of the disease, the activity of the drug, the patient's age, weight, health, sex, the patient's sensitivity to the drug, the time of administration of the composition of the present invention used, the route of administration and the rate of excretion, the treatment period, It can be determined according to factors including drugs used in combination or concurrent with the composition of the present invention used and other factors well known in the medical field.
  • the pharmaceutical composition of the present invention may be administered alone or in combination with a known pharmaceutical composition for treating periodontal disease. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects.
  • the dosage of the pharmaceutical composition can be determined by those skilled in the art in consideration of the purpose of use, the degree of addiction of the disease, the age, weight, sex, history, or the type of material used as an active ingredient, etc. of the patient.
  • the pharmaceutical composition of the present invention may be administered in an amount of from about 0.1 ng to about 100 mg/kg, preferably from 1 ng to about 10 mg/kg, per adult, and the administration frequency of the composition of the present invention is particularly limited thereto. Although not limited, it may be administered once a day or administered several times in divided doses. The above dosage does not limit the scope of the present invention in any way.
  • composition for periodontal tissue regeneration comprising a peptide comprising the amino acid sequence of the following general formula 1:
  • X5 to X7 are each independently arginine (R) or lysine (K);
  • X8 is asparagine (N) or serine (S).
  • the peptide may include the amino acid sequence of any one of SEQ ID NOs: 1 to 16.
  • the peptide may consist essentially of any one of the amino acid sequences of SEQ ID NOs: 1 to 16, or the peptide may consist of any one of the amino acid sequences of SEQ ID NOs: 1 to 16.
  • Periodontal ligament PDL
  • cementum cementum
  • Periodontal ligament also called periodontal fascia
  • the periodontal ligament refers to a connective tissue fibrous membrane that connects the cementum of the tooth root with the alveolar bone wall in mammals.
  • the periodontal ligament is composed of a main fiber, which is a collagen fiber extending parallel or obliquely to the long axis of the tooth, and a bundle of Sharpey fibers, both ends of which are continuously buried in hard tissue, through the periodontal ligament, the tooth elastically supports the jawbone. (Alveolar bone) is fixed.
  • the periodontal ligament not only buffers the pressure generated when food is chewed, but is also rich in blood vessels and nerves, and is known to be involved in nutrition and sensation.
  • Periodontal ligament contains various cells such as fibroblasts, undifferentiated mesenchymal cells, and epithelial cells. Among them, periodontal ligament fibroblasts can be differentiated into osteoblasts or crypt cells by appropriate stimulation. The differentiation mechanism and differentiation-promoting protein of the are not known. BSP (bone sialoprotein), OC (osteocalcin), CAP (cementum attachment protein), etc. are known as markers for the differentiation of cretaceous cells. In particular, CAP is known to play an important role in the attachment of periodontal ligament fibers to the cementum.
  • BSP bone sialoprotein
  • OC osteocalcin
  • CAP cementum attachment protein
  • cementum is the calcified tissue covering the tooth root (root) of mammals.
  • the cementum fixes the teeth to the alveolar bone by fixing the periodontal ligaments. Therefore, when bacteria infect the gums, the cementum surrounding the teeth is degenerated, and the periodontal ligament fibers that connect the teeth and the alveolar bone cannot adhere to the degenerated cementum, causing the teeth to shake. For the treatment of this degenerated cementum, the formation of new cementum is required.
  • Alveolar bone is a part of the maxilla and mandible that surrounds the tooth root and supports the teeth. By fixing the periodontal ligament together with the root cementum, the alveolar bone plays an important role in occlusal pressure such as mastication, as well as the dispersion and absorption of pressure on the teeth that occur during pronunciation and swallowing.
  • Periodontal ligament fibroblasts together with gingival fibroblasts are the main cellular components of soft tissue connective tissue of periodontal tissue. Periodontal ligament fibroblasts not only form periodontal ligaments with their unique function, but are also involved in the repair and regeneration of adjacent alveolar bone and cementum in vivo. It is distinct from gingival fibroblasts, which are involved in Periodontal ligament fibroblasts can be differentiated into osteoblasts or chorionic cells by an appropriate stimulus, but the mechanism of differentiation of periodontal ligament fibroblasts into chetocytes is not clearly known. BSP (bone sialoprotein), OC (osteocalcin), etc.
  • BSP bone sialoprotein
  • OC osteocalcin
  • CAP cementum attachment protein
  • a periostin gene is known as a gene that plays an important role in the attachment of periodontal ligament fibers to the cementum.
  • a periostin gene is known as a periodontal ligament marker. According to several recent studies, it has been reported that periostin plays an important role in the regeneration of periodontal ligaments and alveolar bone after periodontal surgery by promoting collagen fiber production and migration of fibroblasts and osteoblasts as an important regulator of periodontal tissue formation.
  • Regeneration may refer to any action in which lost or damaged cells or tissues are repaired or replenished. The regeneration may be due to cell differentiation.
  • the peptide has an effect of promoting the differentiation of periodontal ligament fibroblasts into cetaryocytes.
  • composition for periodontal tissue regeneration may promote regeneration of any one or more of gingiva, periodontal ligament, cementum, and alveolar bone.
  • composition for periodontal tissue regeneration may be a pharmaceutical composition.
  • the pharmaceutical composition is as described above.
  • the composition for periodontal tissue regeneration may be a quasi-drug composition.
  • the quasi-drug composition may be a quasi-drug composition for preventing or improving periodontal disease or deconstructive traumatic teeth.
  • improvement is meant any action that at least reduces the severity of a parameter, eg, a symptom, associated with the condition being treated.
  • the improvement is to promote the regeneration of periodontal tissue by administering a pharmaceutical composition comprising the peptide as an active ingredient to an individual in need of treatment of periodontal disease, thereby improving or beneficial symptoms of periodontal disease or deconstructive traumatic teeth.
  • a pharmaceutical composition comprising the peptide as an active ingredient to an individual in need of treatment of periodontal disease, thereby improving or beneficial symptoms of periodontal disease or deconstructive traumatic teeth.
  • quasi-drugs refers to products with a milder action than pharmaceuticals among items used for the purpose of diagnosing, treating, improving, alleviating, treating or preventing diseases of humans or animals.
  • quasi-drugs are Textile and rubber products used for the treatment or prevention of diseases of humans and animals, those that do not have a slight or direct action on the human body, and are not instruments or machines, and things similar to those used for the purpose of preventing infectious diseases This includes disinfectants and pesticides.
  • the type or formulation of the quasi-drug composition containing the peptide is not particularly limited, but as an example, it may be an oral disinfectant cleaner, oral cleaning product, toothpaste, dental floss, oral ointment, and the like.
  • the composition for periodontal tissue regeneration may be a health functional food composition.
  • the health functional food composition may be a health functional food composition for preventing or improving periodontal disease or deconstructive trauma teeth.
  • Food means meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, vitamin complexes, health There are functional foods and health foods, and includes all foods in the ordinary sense.
  • the functional food is the same term as food for special health use (FoSHU), and in addition to nutritional supply, it is processed to efficiently exhibit bioregulatory functions and has high medical effects.
  • function (sex) means to obtain a useful effect for health purposes such as regulating nutrients or physiological action with respect to the structure and function of the human body.
  • the food of the present invention can be prepared by a method commonly used in the art, and at the time of manufacture, it can be prepared by adding raw materials and components commonly added in the art.
  • the formulation of the food may be prepared without limitation as long as it is a formulation recognized as a food.
  • the composition for food of the present invention can be prepared in various forms, and unlike general drugs, it has the advantage that there are no side effects that may occur during long-term use of drugs by using food as a raw material, and excellent portability, the present invention Foods can be ingested as an adjuvant to enhance the effect of preventing or improving periodontal disease or deconstructive trauma teeth.
  • the health food means food having an active health maintenance or promotion effect compared to general food
  • health supplement food means food for the purpose of health supplementation.
  • the terms health functional food, health food, and dietary supplement may be used interchangeably.
  • the health functional food is a food prepared by adding the peptide of the present invention to food materials such as beverages, teas, spices, gums, and confectionery, or by encapsulating, powdering, suspension, etc. It means to bring an effect, but unlike general drugs, it has the advantage that there are no side effects that may occur when taking the drug for a long time using food as a raw material.
  • the food composition can be consumed on a daily basis, a high effect can be expected for the prevention or improvement of periodontal disease or deconstructive trauma teeth, and thus can be very usefully used.
  • the food composition may further include a physiologically acceptable carrier, the type of carrier is not particularly limited and any carrier commonly used in the art may be used.
  • the food composition may include additional ingredients that are commonly used in food compositions to improve odor, taste, vision, and the like.
  • vitamins A, C, D, E, B1, B2, B6, B12, niacin, biotin, folate, pantothenic acid, and the like may be included.
  • it may include minerals such as zinc (Zn), iron (Fe), calcium (Ca), chromium (Cr), magnesium (Mg), manganese (Mn), copper (Cu).
  • it may include amino acids such as lysine, tryptophan, cysteine, and valine.
  • the food composition includes a preservative (potassium sorbate, sodium benzoate, salicylic acid, sodium dehydroacetate, etc.), a disinfectant (bleaching powder and high bleaching powder, sodium hypochlorite, etc.), an antioxidant (butylhydroxyanisole (BHA), butyl hydro Loxytoluene (BHT), etc.), coloring agents (tar pigments, etc.), coloring agents (sodium nitrite, sodium nitrite, etc.), bleach (sodium sulfite), seasonings (MSG sodium glutamate, etc.), sweeteners (dulcin, cyclamate, saccharin, etc.) , sodium, etc.), flavorings (vanillin, lactones, etc.), swelling agents (alum, D-potassium hydrogen tartrate, etc.), strengthening agents, emulsifiers, thickeners (foaming agents), film agents, gum base agents, foam inhibitors, solvents, improving agents, etc. It may contain food additives.
  • the peptide may be added as it is or used together with other foods or food ingredients, and may be appropriately used according to a conventional method.
  • the mixed amount of the active ingredient may be suitably determined according to the purpose of its use (prevention, health or therapeutic treatment).
  • the food composition of the present invention may be added in an amount of 50 parts by weight or less, 20 parts by weight or less, 10 parts by weight or less, 5 parts by weight or less, 1 part by weight or less, 0.1 parts by weight or less.
  • the active ingredient may be used in an amount above the above range.
  • the food composition it may be used as a health drink composition, and in this case, it may contain various flavoring agents or natural carbohydrates as an additional component like a conventional drink.
  • the above-mentioned natural carbohydrates include monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; polysaccharides such as dextrin and cyclodextrin; It may be a sugar alcohol such as xylitol, sorbitol, or erythritol.
  • Sweeteners include natural sweeteners such as taumatine, stevia extract; A synthetic sweetener such as saccharin or aspartame may be used.
  • the ratio of the natural carbohydrate may be generally about 0.01 to 0.04 g, specifically about 0.02 to 0.03 g per 100 mL of the health beverage composition of the present invention.
  • the health beverage composition includes various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, pectic acid salts, alginic acid, alginic acid salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, It may contain alcohol, a carbonation agent, or the like. In addition, it may contain the pulp for the production of natural fruit juice, fruit juice beverage, or vegetable beverage. These components may be used independently or in combination. Although the ratio of these additives is not very important, it is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the health beverage composition of the present invention.
  • the food composition may include various weight % if it can exhibit the effect of preventing or improving periodontal disease or deconstructive trauma, specifically, 0.00001 to 100% by weight or 0.01 to 100% by weight of the peptide of the present invention relative to the total weight of the food composition It may include 80% by weight, but is not limited thereto.
  • BSP Bosset sialoprotein
  • DMP1 Density protein 1
  • CAP cementum attachment protein
  • It provides a composition for promoting gene expression of one or more of COL3 (collagen type III) and periostin:
  • X5 to X7 are each independently arginine (R) or lysine (K);
  • X8 is asparagine (N) or serine (S).
  • the peptide may include the amino acid sequence of any one of SEQ ID NOs: 1 to 16.
  • the peptide may consist essentially of any one of the amino acid sequences of SEQ ID NOs: 1 to 16, or the peptide may consist of any one of the amino acid sequences of SEQ ID NOs: 1 to 16.
  • the peptide increased the expression of BSP, DMP1, and CAP, which are osteoblast and chorionic cell differentiation marker genes, and increased the expression of periostin and COL3, which are periodontal ligament differentiation marker genes, in human periodontal ligament cells.
  • the peptide increases the expression of BSP and DMP1, which are marker genes for osteoblasts and cetaceans, in human mesenchymal stem cells.
  • Another aspect for solving the technical problem of the present invention includes administering an effective amount of the peptide or a pharmaceutically acceptable salt thereof to an individual in need of treatment for periodontal disease or deconstructive traumatic teeth, in an individual Provided is a method for treating periodontal disease or a dislocated traumatic tooth.
  • “Individual” means a subject in need of treatment for a disease, and more specifically, refers to mammals such as human or non-human primates, mice, rats, dogs, cats, horses and cattle. .
  • Effective amount refers to an amount or dose of said peptide or a pharmaceutically acceptable salt thereof that, when administered to a patient in single or multiple doses, provides the desired effect in a patient under diagnosis or treatment.
  • An effective amount can be readily determined by the attending physician of ordinary skill in the art by using known techniques or by observing the results obtained under similar circumstances.
  • an effective amount for a patient the mammalian species; his size, age and general health; the specific disease or disorder involved; degree or severity of involvement of the disease or disorder; individual patient response; the particular compound being administered; mode of administration; the bioavailability characteristics of the agent being administered; selected dosing regimen; use of concomitant medications; and other relevant circumstances are considered by the attending physician.
  • administering means introducing a given substance into a patient by any suitable method.
  • the route of administration may be any general route capable of reaching the in vivo target of the patient.
  • the administration may be, for example, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, intranasal administration, or rectal administration, but is not limited thereto.
  • Treatment of the periodontal disease or deconstructive trauma tooth may be by regeneration of periodontal tissue, but is not limited thereto.
  • an effective amount of the peptide or a pharmaceutically acceptable salt thereof may be administered simultaneously, separately, or sequentially with an effective amount of one or more other active ingredients.
  • the one or more other active ingredients may be, but are not limited to, one or more other agents for treating periodontal disease or dislocated traumatic teeth.
  • Another aspect of the present invention for solving the above technical problem provides the use of the peptide or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for the prophylaxis or treatment of periodontal disease or deconstructive trauma teeth.
  • the pharmaceutical composition for the prevention or treatment of periodontal disease or destructive trauma teeth promotes the regeneration of periodontal tissues including periodontal ligament, alveolar bone and cementum and the attachment of periodontal ligaments, such as periodontal disease and destructive trauma teeth It can be used to restore damaged connective tissue. Therefore, the peptide can be used in various ways as pharmaceutical compositions, quasi-drugs compositions, health functional food compositions, and the like.
  • Example 1 shows that the peptides of Group 1 and Group 2 prepared in Example 1 are bone sialoprotein (BSP), DMP1 (Dentin Matrix protein 1) and CAP (Dentin Matrix protein 1), which are osteoblast and chorionic cell differentiation marker genes in human periodontal ligament cells (hPDL). It is a graph showing the effect on the expression of cementum attachment protein).
  • BSP bone sialoprotein
  • DMP1 Densin Matrix protein 1
  • CAP Densin Matrix protein 1
  • hPDL human periodontal ligament cells
  • Figure 2 shows the effect of the group 1 and group 2 peptides prepared in Example 1 on the expression of osteoblast differentiation marker genes BSP (Bone sialoprotein) and DMP1 (Dentin Matrix protein 1) in human mesenchymal stem cells (hBMSCs); is the result showing
  • FIG. 3 is a result showing the effect of the peptides of Group 1 and Group 2 prepared in Example 1 on the expression of type 3 collagen fiber gene (COL3) and periostin gene, which are periodontal ligament marker genes, in human periodontal ligament cells.
  • COL3 type 3 collagen fiber gene
  • periostin gene which are periodontal ligament marker genes, in human periodontal ligament cells.
  • A represents a positive control (PC);
  • B represents a negative control group (NC) that was not treated after periodontal tissue injury;
  • C represents a negative control group (NC+Plug) in which only a collagen sponge was implanted after periodontal tissue damage;
  • D represents the experimental group treated with the peptide of group 2 (SEQ ID NO: 16);
  • AB means alveolar bone; De stands for dentin.
  • A-D represent the negative control group (NC) without any treatment;
  • E-H represents a negative control group (NC+Plug) in which only a collagen sponge was implanted;
  • I-L represents the experimental group treated with the peptide of group 2 (SEQ ID NO: 16).
  • AB means alveolar bone;
  • De means dentin;
  • CE stands for Cretaceous;
  • CT means connective tissue;
  • NPD means newly formed periodontal ligament-like tissue; NCE stands for newly formed cementum-like tissue.
  • C, G, K, O 100 ⁇ m.
  • A-B represent the negative control group (NC) without any treatment
  • C-D represent a negative control group (NC+Plug) in which only a collagen sponge was implanted
  • E-F represents the experimental group treated with the peptide of group 2 (SEQ ID NO: 16).
  • AB alveolar bone
  • De dentin
  • CE Cretaceous
  • CT connective tissue
  • NPD newly formed periodontal ligament-like tissue
  • NCE stands for newly formed cementum-like tissue. Size bars, A, C, E, G 100 ⁇ m. B, D, F, H, 50 ⁇ m.
  • KYKQRKKSYK 10 KYKQRKRSYK 11 KYKQRRKSYK 12 KYKQRRRSYK 13 KYKQKKKSYK 14 KYKQKRKSYK 15 KYKQKKRSYK 16 KYKQKRRSYK
  • hBMSCs cells were cultured at 37° C. in humidified air containing 5% CO 2 and used in the experiment.
  • Human-derived mesenchymal stem cells (hBMSCs) were purchased from Lonza (LONZA, Switzerland) and used.
  • hBMSCs were cultured in an alpha-MEM (Invitrogen) medium supplemented with 10% heat-inactivated bovine serum.
  • hPDL cells Human periodontal ligament cells
  • RNA of human periodontal ligament cells was isolated using TRIzol reagent.
  • cDNA was synthesized using 2 ⁇ g of total RNA, 1 ul of reverse transcriptase, and 0.5 ⁇ g of oligo (dT).
  • the synthesized cDNA of human periodontal ligament cells was used for real-time polymerase chain reaction using the primers of Table 2 below.
  • Real-time polymerase chain reaction was performed in an ABI PRISM 7500 sequence detection system (Applied Biosystems) using SYBR GREEN PCR Master Mix (Takara, Japan).
  • Real-time polymerase chain reaction was performed at 94°C, 1 min; 95 °C, 15 sec - 60 °C, 34 sec was carried out under the condition of repeating 40 cycles (cycles). Results were analyzed using a CT (comparative cycle threshold) method.
  • the experimental group prepared a collagen sponge (peptide dissolved in physiological saline at a concentration of 1 ⁇ g/ ⁇ l) containing 50 ⁇ g of the peptide prepared in Example 1 (SEQ ID NO: 16 of group 2) at the defect site, and then EP After adding 50 ⁇ l (50 ⁇ g) of the peptide solution to the tube, a collagen sponge was soaked for 5 minutes) and transplanted, and a negative control (NC) and collagen sponge (collagen sponge with 50 saline solution) (prepared by soaking in ⁇ l for 5 minutes) was placed on the inner bone wall of the bone defect, and the transplanted negative control (NC+Plug) was sacrificed 3 months later for histological evaluation.
  • NC negative control
  • NC+Plug transplanted negative control
  • the beagle dogs were sacrificed by administering an excess (90-120 mg/kg) of pentobarbital.
  • the tooth part of the beagle dog was extracted, fixed with 10% formalin, and then calcium was removed by adding 5% formic acid, molded, and embedded in paraffin, and then a tissue section with a thickness of 5 ⁇ m was obtained.
  • tissue sections were stained with hematoxylin and eosin or collagen stained (Masson's Trichrome Staining) to confirm periodontal ligament regeneration, followed by an optical microscope equipped with a digital camera (LEICA ICC50 camera, Germany) (LEICA DM750, Germany) ) was used for analysis.
  • Bone sialoprotein (BSP) and Dentin matrix protein 1 (DMP1) genes are used as markers for differentiation of osteoblasts and cretaceous cells, and are known as important genes for calcification of bone and cementum.
  • CAP cementum attachment protein
  • the CAP cementum attachment protein gene is expressed in differentiated cretaceous cells and is known as a gene involved in cementum attachment of the periodontal ligament fiber bundle.
  • Example 1 is a graph showing the effect of the peptides of Group 1 and Group 2 prepared in Example 1 on the expression of osteoblasts and crypt cell differentiation marker genes BSP, DMP1 and CAP in human periodontal ligament cells (hPDL).
  • Table 3 shows the results of confirming the effect of the group 1 and group 2 peptide groups on BSP mRNA expression by real-time PCR, and shows the relative mRNA expression level compared to the control group.
  • Table 4 shows the results of confirming the effect of the group 1 and group 2 peptide groups on CAP mRNA expression by real-time PCR, and shows the relative mRNA expression level compared to the control group.
  • the results shown in Tables 3 and 4 are the average value and standard deviation (SD) obtained by repeating the experiment three times.
  • BSP gene expression SEQ ID NO: average SD group 1 One 2.092 0.152 2 2.361 0.098 3 2.572 0.209 4 2.702 0.301 5 2.67 0.088 6 2.705 0.137 7 2.215 0.072 8 2.021 0.301 group 2 9 2.211 0.413 10 2.811 0.302 11 2.362 0.182 12 2.211 0.287 13 2.525 0.25 14 2.836 0.099 15 2.620 0.401 16 2.606 0.371
  • Figure 2 is a result showing the effect of the peptides of Group 1 and Group 2 prepared in Example 1 on the expression of osteoblasts and creatocytes differentiation marker genes in human mesenchymal stem cells.
  • Periostin is a protein first discovered in the periodontal ligament and bone periostium. It is expressed in the periodontal ligament and mesenchymal of the tooth in development, and is known to be involved in cell adhesion. According to several recent studies, periostin is an important regulator of periodontal tissue formation, promotes collagen fiber production and migration of fibroblasts and osteoblasts, and plays a pivotal role in the regeneration of periodontal ligaments and alveolar bone after periodontal surgery to treat periodontal disease. known to play a role. Therefore, the effect of the peptide of Example 1 on the expression of periostin, a periodontal ligament differentiation marker gene, and the type 3 collagen fiber gene (COL3) was confirmed.
  • FIG. 3 is a result showing the effect of the peptides of Group 1 and Group 2 prepared in Example 1 on the expression of the type 3 collagen fiber gene (COL3) and periostin gene, which are periodontal ligament marker genes, in human periodontal ligament cells.
  • COL3 type 3 collagen fiber gene
  • periostin gene which are periodontal ligament marker genes, in human periodontal ligament cells.
  • Table 5 shows the results of confirming the effect of the peptide groups of Group 1 and Group 2 on periostin mRNA expression by real-time PCR, and shows the relative mRNA expression level compared to the control group.
  • the results shown in Table 5 are the average value and standard deviation (SD) obtained by repeating the experiment three times.
  • PERIOSTIN gene expression SEQ ID NO: average SD group 1 One 2.092 0.152 2 2.361 0.098 3 2.572 0.209 4 2.702 0.301 5 2.67 0.088 6 2.705 0.137 7 2.329 0.072 8 2.021 0.301 group 2 9 2.211 0.413 10 2.811 0.302 11 2.362 0.182 12 2.211 0.287 13 2.525 0.25 14 2.836 0.099 15 2.620 0.401 16 2.403 0.371
  • the experimental group transplanted a collagen sponge containing 50 ⁇ g of the peptide of Example 1 (SEQ ID NO: 16) to the defect site, and only a negative control (Negative Control: NC) and collagen sponge without any treatment after the defect had bone defects.
  • NC+Plug transplanted by placing it on the internal bone wall of the minor was sacrificed 3 months later and histological evaluation was performed.
  • FIG. 4 is a photograph of tissue stained with hematoxylin/eosin after 3 months of treatment with the peptide of Example 1 (SEQ ID NO: 16) at the periodontal tissue damage site, and the results confirming the effect of the peptide on alveolar bone regeneration.
  • the peptide of the present invention has the effect of regenerating alveolar bone and forming new cementum-like tissue and new periodontal ligament-like tissue, and the new periodontal ligament formed by the peptide of the present invention is embedded in the newly formed alveolar bone and cementum. was confirmed. Therefore, it was found that the peptide of the present invention can be used for periodontal tissue regeneration, for preventing or treating periodontal disease, and for preventing or treating deconstructed traumatic teeth.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Nutrition Science (AREA)
  • Physiology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
  • Medicinal Preparation (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Cosmetics (AREA)

Abstract

본원발명은 특정 아미노산 서열의 펩타이드를 포함하는 치주질환 또는 탈구성 외상 치아의 예방 또는 치료용 약학 조성물, 및 치주조직 재생용 조성물을 제공한다.

Description

치주질환 또는 탈구성 외상 치아의 예방 또는 치료용 약학 조성물
본 발명은 치주질환 또는 탈구성 외상 치아의 예방 또는 치료용 약학 조성물, 및 치주조직 재생용 조성물에 관한 것이다.
치주조직(periodontium)이란 치아를 둘러싸고 있는 조직들을 총칭한다. 치주조직은 치아를 악골(턱뼈) 내에 지지하는 치조골, 치조골과 치아를 악골 내에 연결하는 치주인대, 치주인대의 섬유를 함유하는 백악질, 치조골을 덮고 있는 연조직인 치은(잇몸) 등으로 구성되어 있다. 치은 섬유모세포(gingival fibroblast)와 치주인대 섬유모세포 (periodontal ligament fibroblast)는 치은 연조직성 결합조직의 주요 세포 구성 성분이며, 세포 외 기질(extracellular matrix)을 형성하고 이를 유지하는 역할을 한다. 이 중 치은 섬유모세포는 주로 치은 결합조직을 유지하는 데 관여하는 반면, 치주인대 섬유모세포는 그 특유 기능으로 치주인대를 형성할 뿐만 아니라 생체 내에서의 인접 치조골 및 백악질의 수복과 재생에 관여하는 것으로 알려져 있다.
치주인대는 치아뿌리(치근부)의 백악질과 치조골 사이를 연결시켜주는 섬유성 결합조직을 말한다. 치주인대의 양끝은 치근부의 백악질과 치조골에 매입되어 있으며 이렇게 치조골이나 백악질 내로 매입되어 있는 치주인대 섬유다발을 샤피섬유(Sharpey's fiber)라 한다. 치주인대의 기능은 치아를 유지시켜주고 경조직의 구조적 특성을 유지시키는데 중요한 기능을 할 뿐만 아니라 교합압의 충격에 저항하며 손상으로부터 혈관과 신경 같은 연조직을 보호한다. 또 다른 중요한 기능은 영양공급과 감각 수용기로서의 기능으로, 치주인대의 신경지배는 삼차신경경로를 통해 고유수용 감각과 촉각 및 통각을 전달하고, 개개의 치아들에 가해지는 외부 압력을 감지하여 조절하고 저작근육계를 조절하는 신경근육 기전에 중요한 역할을 한다. 이러한 치주인대는 많은 섬유모세포를 함유하고 있으며, 이들 세포들은 그 특유 기능으로 치주인대를 형성할 뿐만 아니라 백악질과 치조골의 형성과 흡수에 관여하여 생리적인 치아이동을 유발하고 치주조직이 교합압에 적응되도록 하며 손상을 회복시키는 기능을 갖고 있다.
치주질환은 잇몸에 국한되는 치은염과 치아뿌리를 둘러싸고 있는 치조골에도 염증이 확산된 치주염으로 분류되며, 치아 자체가 손상되는 질환이 아니라 치아를 지지하고 있는 치주조직에 염증이 발생하는 질환이다. 치주질환이 발생하면 임상적으로 치은 출혈과 종창, 치주낭의 형성 및 치조골의 파괴 등으로 치아의 상실을 가져오게 되며, 이러한 치주질환의 원인으로서는 국소적 요인과 전신적 요인이 있다. 국소 원인인자로 알려진 두가지는 치태(dental plaque), 치석 및 기타 국소 원인들과 교합성 외상(trauma from occlusion)이라 할 수 있다. 발병 기전으로 치태가 치주낭 내에 기계적으로 축적되면 주변에 존재하는 세균들의 서식처가 되며 이러한 서식은 점차 호기성, 통기성, 그람 양성 세균에서 혐기성 그람음성 세균으로 점차 이행되며, 치주낭의 심부로 증식되고, 이러한 혐기성 그람음성 세균은 증식하여 치주낭의 심부로 이행하게 된다. 이때 증식된 혐기성 그람음성 세균의 독소 및 모든 산물은 직접 조직을 파괴하거나 면역계를 자극하여 자극된 면역계에서부터 여러 가지 작용에 의하여 치주조직파괴와 더불어 염증을 유발하게 된다. 이에 대한 방어기전으로서 다형핵 백혈구의 기능과 면역반응이 전신적인 요인으로서 작용하게 된다. 그러나, 근원적인 인자인 혐기성 그람음성 세균에 대한 항균작용 및 정균작용과 이들 세균의 독성산물을 제거하고 파괴, 소실된 치주조직을 원상 회복시키는 것이 치주질환의 예방 및 치료에 중요한 관건이 되는 것으로 알려져 있다.
기본적인 치주질환의 치료는 치주질환의 원인이 되는 치태와 치석을 제거하는 치석제거 (스케일링) 술식과 이와 유사하게 치태와 치석을 제거하는 술식으로 치아 뿌리 표면 백악질에 박혀 있는 염증을 일으키는 요인을 제거하는 치근활택술이 있다. 치주질환으로 인해 염증이 심해지면 치조골 손상을 동반하게 되며, 치조골이 심하게 흡수된 경우에 재생형 치주수술을 통한 골이식을 수행할 수 있다. 이식하는 골의 종류는 환자자신의 골(자가골)을 사용하거나 이종골이나 합성골을 사용할 수 있다.
따라서 치주질환을 치료하기 위하여는 치주질환의 원인균을 제거해야 할 뿐만 아니라 치주조직을 재생하는 과정이 함께 수행되어야 할 것으로 사료된다.
현재 파괴된 치주조직을 재생하기 위한 치료방법으로 골 이식술, 조직유도재생술, 그리고 다양한 성장인자를 이용한 치료법 등이 시행되고 있으며, 또한 치주인대세포의 재생과 신생 백악질의 형성에 초점이 맞춰져 있는 치아 재식술 방법도 시행되고 있다.
이와 관련하여 치주조직을 효과적으로 재생하는 방법을 개발하기 위한 연구가 활발히 진행되고 있다. 예를 들어, 대한민국 등록특허 제1179476호에는 인간 치주인대 (hPDL) 세포의 광물화 과정에서 높게 발현되는 전골수구성 백혈병 아연 손가락(PLZF) 유전자, Fk506 결합 단백질 5(FKBP5) 유전자, 혈청 아밀로이드 A1(SAA1) 유전자, 지방산 결합 단백질 4(FABP4) 유전자, 서열 유사성을 갖는 계열 A(FAM107A) 유전자, 코린(CORIN) 유전자, ras-관련 C3 부톨리눔 독소 기질 3(RAC3) 유전자 또는 프로락틴-유도된 단백질(PIP) 유전자 및 인간 치주인대 (hPDL) 세포의 광물화 과정에서 낮게 발현되는 FNDC1, PTGS2, RSAD2, NPTX1, VCAM1, MX1, IFIT1, CLDN1 또는 WISP2 유전자가 개시되어 있다. 또한 대한민국 등록특허 101788916호에는 법랑모세포 배양액을 포함하는 치주질환 치료용 약학 조성물에 관해 개시되어 있다.
한편, 치아 혹은 치주조직에 외상력이 가해지면, 그 방향과 크기의 차이 등에 따라 여러 가지 파괴가 치아와 치주조직에 발생한다. 치아의 외상은 크게 파절성 외상과 탈구성 외상으로 나눌 수 있다. 탈구성 외상은 치주인대의 손상을 가리키며 진탕·아탈구, 정출성 탈구, 측방성 탈구, 완전 탈구, 함입으로 세분화할 수 있으며, 모든 연령층에서 가능하나 8~12세의 어린이에서 많이 일어날 수 있다. 이러한 완전 탈구 치아의 재식 성공여부는 완전 탈구된 치아에 부착되어 있는 치주인대 또는 치아가 빠진 치조와에 남아있는 치주인대의 재생에 달려있다. 치주인대의 재생이 일어나지 않으면, 치아 뿌리의 백악질과 상아질의 흡수가 일어나며, 이 부위가 치조골로 대체되는 골유착(Ankylosis)이 발생하게 된다. 따라서 치주치료의 궁극적인 목적은 치주질환의 진행을 막고 치은, 치주인대, 치조골, 그리고 백악질을 포함하는 파괴된 치주조직을 재생시켜 원래대로 회복하는 것이지만, 아직까지는 치주인대를 직접적으로 재생하거나 분화시킬 수 있는 방법은 보고되어 있지 않다.
이러한 배경하에서, 본 발명자들은 치주질환으로 인해 손상된 치주조직(치주인대, 백악질, 치조골)을 재생시킬 수 있는 방법을 개발하고자 예의 연구 노력한 결과, 치주인대 세포의 분화를 유도하여 치주질환 또는 탈구성 외상 치아의 손상된 치주인대를 치료할 수 있을 뿐만 아니라 손상된 백악질 및 치조골을 재생할 수 있는 펩타이드의 새로운 용도를 확인하고 본 발명을 완성하였다.
본 발명은 치주질환 또는 탈구성 외상 치아의 예방 또는 치료용 약학 조성물을 제공하는 것을 목적으로 한다.
본 발명은 치주조직 재생용 조성물을 제공하는 것을 다른 목적으로 한다.
본 발명은 BSP, DMP1, CAP, COL3 및 페리오스틴 중 어느 하나 이상의 유전자 발현 촉진용 조성물을 제공하는 것을 또다른 목적으로 한다.
본 발명은 치주질환 또는 탈구성 외상 치아의 치료를 필요로 하는 개체에게 유효량의 펩타이드 또는 그의 약학적으로 허용가능한 염을 투여하는 단계를 포함하는, 개체에서 치주질환 또는 탈구성 외상 치아를 치료하는 방법을 제공하는 것을 또다른 목적으로 한다.
본 발명은 치주질환 또는 탈구성 외상 치아의 예방 또는 치료용 약제를 제조하는데 있어서, 상기 펩타이드 또는 그의 약학적으로 허용가능한 염의 용도를 제공하는 것을 또다른 목적으로 한다.
본 발명의 목적은 이상에서 언급한 것으로 제한되지 않으며, 언급되지 않은 또 다른 목적들은 아래의 기재로부터 본 발명이 속하는 기술 분야의 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
상기 기술적 과제를 해결하기 위한 본 발명의 일 양상은 하기 일반식 1의 아미노산 서열을 포함하는 펩타이드 또는 그의 약학적으로 허용가능한 염을 포함하는, 치주질환 또는 탈구성 외상 치아의 예방 또는 치료용 약학 조성물을 제공한다:
K-Y-K-Q-X5-X6-X7-X8-Y-K (일반식 1)
상기 일반식 1에서,
X5 내지 X7는 각각 독립적으로 아르기닌 (R) 또는 리신 (K)이고;
X8은 아스파라긴 (N) 또는 세린 (S)이다.
상기 펩타이드는, 치주질환 또는 탈구성 외상 치아의 예방 또는 치료 효과를 나타낼 수 있는 한, 이를 구성하는 아미노산 서열과 하나 이상의 아미노산 잔기가 상이한 서열을 가지는 변이체 펩타이드도 본 발명에서 제공하는 펩타이드의 범주에 포함된다.
본 명세서 전반에서, 펩타이드를 구성하는 천연적으로 존재하는 아미노산에 대한 통상의 1문자 및 3문자 코드가 사용된다. 또한 본 명세서에서 약어로 언급된 아미노산은 IUPAC-IUB 명명법에 따라 기재되었다.
알라닌 Ala, A 아르기닌 Arg, R
아스파라긴 Asn, N 아스파르트산 Asp, D
시스테인 Cys, C 글루탐산 Glu, E
글루타민 Gln, Q 글리신 Gly, G
히스티딘 His, H 이소류신 Ile, I
류신 Leu, L 리신 Lys, K
메티오닌 Met, M 페닐알라닌 Phe, F
프롤린 Pro, P 세린 Ser, S
트레오닌 Thr, T 트립토판 Trp, W
티로신 Tyr, Y 발린 Val, V
본 발명자들은 상기 펩타이드가 치주인대의 재생 또는 뼈모세포 및 백악모세포로의 분화, 치조골 및 백악질의 재생을 촉진시킴으로써 치주질환 또는 탈구성 외상 치아를 치료할 수 있음을 확인하여 본 발명을 완성하였다.
상기 펩타이드는 인간 치주인대세포에서 뼈모세포 및 백악모세포 분화마커 유전자인 BSP, DMP1, CAP의 발현을 증가시키고, 치주인대 분화마커 유전자인 페리오스틴과 COL3의 발현을 증가시킴을 확인하였다. 또한, 상기 펩타이드는 인간 중간엽줄기세포에서 뼈모세포 및 백악모세포 분화마커 유전자인 BSP 및 DMP1의 발현을 증가시킴을 확인하였다.
뿐만 아니라, 치주조직 손상 동물 모델 실험 결과, 상기 펩타이드가 치조골, 백악질 및 치주인대를 재생하였음을 확인하였다. 구체적으로, 본 발명의 펩타이드는 치조골을 재생하고, 신생 백악질 유사조직 및 신생 치주인대 유사조직을 형성하는 효과가 있으며, 본 발명의 펩타이드에 의해 형성된 신생 치주인대는 새로 형성된 치조골과 백악질에 함입되어 있음을 확인하였다.
일 구체예에서, 상기 펩타이드는 1개 이상의 아미노산에서 보존적 치환이 일어난 것일 수 있다.
“보존적 치환(conservative substitution)”은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 상기 펩타이드는 동일 또는 유사한 생물학적 활성을 여전히 보유하면서, 예를 들어 하나 이상의 보존적 치환을 가질 수 있다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다. 예를 들면, 양으로 하전 된 (염기성) 아미노산은 아르기닌, 리신, 및 히스티딘을 포함하고; 음으로 하전 된 (산성) 아미노산은 글루탐산 및 아스파르트산을 포함하고; 방향족 아미노산은 페닐알라닌, 트립토판 및 티로신을 포함하고, 소수성 아미노산은 알라닌, 발린, 이소류신, 류신, 메티오닌, 페닐알라닌, 티로신 및 트립토판을 포함한다. 또한, 아미노산은 전하를 띠는(electrically charged) 곁사슬을 갖는 아미노산과 전하를 띠지 않는(uncharged) 곁사슬을 갖는 아미노산으로 분류할 수 있으며, 전하를 띠는 곁사슬을 갖는 아미노산은 아스파르트산, 글루탐산, 리신, 아르기닌, 히스티딘을 포함하고, 전하를 띠지 않는 곁사슬을 갖는 아미노산은 다시 비극성(nonpolar) 아미노산 또는 극성 아미노산(polar)으로 분류할 수 있으며, 비극성 아미노산은 글리신, 알라닌, 발린, 류신, 이소류신. 메티오닌, 프롤린, 극성 아미노산은 세린, 트레오닌, 시스테인, 아스파라긴, 글루타민을 포함하는 것으로 분류할 수 있다. 상기와 같은 유사한 성질을 갖는 아미노산으로의 보존적 치환은 동일 또는 유사한 활성을 나타낼 것으로 기대할 수 있다.
이처럼, 본원발명의 펩타이드를 구성하는 산성 아미노산, 염기성 아미노산 또는 방향족 아미노산은 각각 이와 다른 산성 아미노산, 염기성 아미노산, 중성 아미노산 또는 방향족 아미노산으로 치환되어도, 본 발명에서 제공하는 펩타이드의 효과를 그대로 나타낼 수 있으므로, 본 발명의 펩타이드를 구성하는 아미노산 서열과 하나 이상의 아미노산 잔기가 상이한 서열을 가지는 변이체 펩타이드도 본 발명에서 제공하는 펩타이드의 범주에 포함됨은 자명하다.
또한, 본 발명의 펩타이드는 그의 N-말단 또는 C-말단에 임의의 아미노산이 부가된 형태를 갖더라도, 본 발명에서 제공하는 펩타이드의 효과를 그대로 나타낼 수 있으므로, 본 발명에서 제공하는 펩타이드의 범주에 포함된다. 일 예로서, 상기 펩타이드의 N-말단 또는 C-말단에 1 내지 300개의 아미노산이 부가된 형태가 될 수 있고, 다른 예로서, 상기 펩타이드의 N-말단 또는 C-말단에 1 내지 100개의 아미노산이 부가된 형태가 될 수 있으며, 또 다른 예로서, 상기 펩타이드의 N-말단 또는 C-말단에 1 내지 24개의 아미노산이 부가된 형태가 될 수 있다.
일 구체예에서, 상기 펩타이드는 서열번호 1 내지 16 중 어느 하나의 아미노산 서열을 포함하는 것일 수 있다.
다른 구체예에서, 상기 펩타이드는 서열번호 1 내지 16 중 어느 하나의 아미노산 서열로 필수적으로 구성된 것이거나, 상기 펩타이드는 서열번호 1 내지 16 중 어느 하나의 아미노산 서열로 구성된 것일 수 있다.
본원에서 '특정 서열번호로 구성되는 펩타이드'라고 기재되어 있다 하더라도, 해당 서열번호의 아미노산 서열로 이루어진 펩타이드와 동일 혹은 상응하는 활성을 가지는 경우라면 해당 서열번호의 아미노산 서열 앞뒤의 무의미한 서열 추가 또는 자연적으로 발생할 수 있는 돌연변이, 혹은 이의 침묵 돌연변이(silent mutation)를 제외하는 것이 아니며, 이러한 서열 추가 혹은 돌연변이를 가지는 경우에도 본 발명의 범위 내에 속하는 것이 자명하다. 즉, 일부 서열의 차이가 있더라도 일정 수준 이상의 상동성을 나타내며 동일 또는 유사한 활성을 나타낸다면 본 발명의 범위에 속할 수 있다. 구체적으로, 본 발명의 펩타이드는 서열번호 1 내지 16의 아미노산 서열과 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성 또는 동일성을 가지는 아미노산 서열을 포함할 수 있으나, 이에 제한되지 않는다.
“상동성(homology)” 또는 “동일성(identity)”은 두 개의 주어진 아미노산 서열 또는 염기 서열과 서로 관련된 정도를 의미하며 백분율로 표시될 수 있다. 용어, “상동성” 및 “동일성”은 종종 상호교환적으로 사용될 수 있다.
임의의 두 펩타이드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 예를 들어, Pearson et al (1988)[Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다. (GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA(Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
펩타이드의 상동성, 유사성 또는 동일성은 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482에 공지된 대로, 예를 들면, Needleman et al.(1970), J Mol Biol.48: 443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 아미노산)의 수를 나눈 값으로 정의한다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 일진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL (NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다. 따라서, 본 발명에서 사용된 것으로서, 용어 "상동성" 또는 "동일성"은 서열들 간의 관련성(relevance)를 나타낸다.
일 구체예에서, 상기 펩타이드는 펩타이드 단독의 형태로 사용될 수도 있고, 상기 펩타이드가 2회 이상 반복되어 연결된 폴리펩타이드의 형태로 사용될 수도 있다.
따라서, 상기 약학 조성물은 상기 펩타이드가 반복되어 연결된 폴리펩타이드를 포함하는 것일 수 있다.
일 구체예에서, 다양한 펩타이드 제조를 위한 여러 방법들의 조합으로 본 발명에 적용되는 일반식 1의 아미노산 서열을 포함하는 펩타이드를 제조할 수 있다.
본 발명의 펩타이드는 그 길이에 따라 이 분야에서 잘 알려진 방법, 예를 들어 자동 펩타이드 합성기에 의해 합성할 수 있으며, 유전자 조작 기술에 의하여 생산할 수도 있다. 구체적으로, 본 발명의 펩타이드는 표준 합성 방법, 재조합 발현 시스템, 또는 임의의 다른 당해 분야의 방법에 의해 제조될 수 있다. 따라서, 본 발명에 따른 펩타이드는, 예를 들어 하기를 포함하는 방법을 포함하는 다수의 방법으로 합성될 수 있으나, 이에 제한되는 것은 아니다:
(a) 펩타이드를 고체상 또는 액체상 방법의 수단으로 단계적으로 또는 단편 조립에 의해 합성하고, 최종 펩타이드 생성물을 분리 및 정제하는 방법; 또는
(b) 펩타이드를 인코딩하는 핵산 작제물을 숙주세포 내에서 발현시키고, 발현 생성물을 숙주 세포 배양물로부터 회수하는 방법; 또는
(c) 펩타이드를 인코딩하는 핵산 작제물의 무세포 시험관 내 발현을 수행하고, 발현 생성물을 회수하는 방법; 또는
(a), (b) 및 (c)의 임의의 조합으로 펩타이드의 단편을 수득하고, 이어서 단편을 연결시켜 펩타이드를 수득하고, 당해 펩타이드를 회수하는 방법.
또한, 상기 펩타이드의 제조는 L-형 혹은 D-형 아미노산, 및/또는 비-천연형 아미노산을 이용한 변형; 및/또는 천연형 서열을 개질, 예를 들어 측쇄 작용기의 변형, 분자 내 공유결합, 예컨대, 측쇄 간 고리 형성, 메틸화, 아실화, 유비퀴틴화, 인산화, 아미노헥산화, 바이오틴화 등과 같이 개질함으로써 변형하는 것을 모두 포함한다. 또한, 상기 변형은 비 천연형 화합물로의 치환을 모두 포함한다.
상기 변형에 이용되는 치환되거나 추가되는 아미노산은 인간 단백질에서 통상적으로 관찰되는 20개의 아미노산뿐만 아니라 비정형 또는 비-자연적 발생 아미노산을 사용할 수 있다. 비정형 아미노산의 상업적 출처에는 Sigma-Aldrich, ChemPep과 Genzyme pharmaceuticals가 포함될 수 있으나, 이에 제한되지 않는다. 이러한 아미노산이 포함된 펩타이드와 정형적인 펩타이드 서열은 상업화된 펩타이드 합성 회사, 예를 들어 미국의 American peptide company나 Bachem, 또는 한국의 Anygen을 통해 합성 및 구매 가능할 수 있으나, 이에 제한되지 않는다.
아미노산 유도체도 마찬가지 방식으로 입수할 수 있는데, 그 예를 일부만 들자면 4-이미다조아세트산 (4-imidazoacetic acid) 등을 사용할 수 있다.
또한, 본 발명에 따른 펩타이드는 N-말단 및/또는 C-말단이 변형되지 않은 것일 수 있으나, 생체 내의 단백질 절단 효소들로부터 보호하고 안정성을 증가시키기 위하여 이의 N-말단 및/또는 C-말단 등이 화학적으로 수식되거나 유기단으로 보호되거나, 또는 펩타이드 말단 등에 아미노산이 추가되어 변형된 형태 역시 본 발명에 따른 펩타이드의 범주에 포함된다. C-말단이 변형되지 않은 경우, 본 발명에 따른 펩타이드의 말단은 자유 카르복실기를 가지나, 특별히 이에 제한되는 것은 아니다.
특히, 화학적으로 합성한 펩타이드의 경우, N- 및 C-말단이 전하를 띠고 있기 때문에, 이러한 전하를 제거하기 위하여 N-말단을 아세틸화 (acetylation) 및/또는 C-말단을 아미드화 (amidation)할 수 있으나, 특별히 이에 제한되지는 않는다.
상기 펩타이드는 아미노산 서열 상의 변이 또는 수식에 의해서 펩타이드의 열, pH 등에 대한 구조적 안정성이 증가하거나 치주질환 또는 탈구성 외상 치아의 예방 또는 치료 효과가 증가하거나 치주인대조직 재생능이 증가한 펩타이드를 포함할 수 있다.
상기 펩타이드는 펩타이드 그 자체, 그의 염(예컨대, 상기 펩타이드의 약학적으로 허용가능한 염), 또는 그의 용매화물의 형태를 모두 포함한다.
상기 염의 종류는 특별히 제한되지는 않는다. 다만, 개체, 예컨대 포유류에게 안전하고 효과적인 형태인 것이 바람직하나, 특별히 이에 제한되는 것은 아니다.
또한, 상기 펩타이드는 약학적으로 허용되는 임의의 형태일 수 있다.
"약학적으로 허용가능한"이란 치료효과를 나타낼 수 있을 정도의 충분한 양과 부작용을 일으키지 않는 것을 의미하며, 질환의 종류, 환자의 연령, 체중, 건강, 성별, 환자의 약물에 대한 민감도, 투여 경로, 투여 방법, 투여 횟수, 치료 기간, 배합 또는 동시 사용되는 약물 등 의학 분야에 잘 알려진 요소에 따라 당업자에 의해 용이하게 결정될 수 있다.
일 구체예에서, 상기 펩타이드는 그의 약학적으로 허용가능한 염의 형태일 수 있다. 상기 염은 약학 분야, 예를 들면 치주질환 분야에서 사용되는 통상의 산 부가염, 예를 들면 염산, 브롬산, 황산, 술팜산, 인산 또는 질산과 같은 무기산으로부터 유도된 염 및 아세트산, 프로피온산, 숙신산, 글리콜산, 스테아르산, 시트르산, 말레산, 말론산, 메탄술폰산, 타르타르산, 말산, 페닐아세트산, 글루탐산, 벤조산, 살리실산, 2-아세톡시벤조산, 푸마르산, 톨루엔술폰산, 옥살산 또는 트리플루오로아세트산과 같은 유기산으로부터 유도된 염을 포함한다. 또한, 상기 염은, 암모늄, 디메틸아민, 모노메틸아민, 모노에틸아민, 디에틸아민과 같은 염기 부가 염일 수 있다. 또한, 상기 염은 통상의 금속 염 형태, 예를 들면 리튬, 소듐, 칼륨, 마그네슘, 또는 칼슘과 같은 금속으로부터 유도된 염을 포함한다. 상기 산 부가염, 염기 부가염 또는 금속염은 통상의 방법에 따라 제조될 수 있다. 약학적으로 허용가능한 염 및 그를 제조하는 일반 방법론은 관련 기술 분야에 널리 공지되어 있다. 예를 들어, 문헌 [P. Stahl, et al. Handbook of Pharmaceutical Salts: Properties, Selection and Use, 2nd Revised Edition (Wiley-VCH, 2011)]; [S.M. Berge, et al., "Pharmaceutical Salts," Journal of Pharmaceutical Sciences, Vol. 66, No. 1, January 1977]을 참조할 수 있다.
보호된 아미노산 또는 펩타이드의 축합을 위하여, 펩타이드 합성에 유용한 각종 활성화 시약, 특히 바람직하게는 트리스포스포늄염, 테트라메틸우로늄염, 카보다이이미드 등이 사용될 수 있다. 트리스포스포늄염의 예는 벤조트라이아졸-1-일옥시트리스(피롤라지노)포스포늄헥사플루오로포스페이트(PyBOP), 브로모트리스(피롤라지노)포스포늄헥사플루오로포스페이트(PyBroP), 7-아자벤조트라이아졸-1-일옥시트리스(피롤라지노)포스포늄헥사플루오로포스페이트(PyAOP)를 포함하고, 테트라메틸우로늄염의 예는 2-(1H-벤조트라이아졸-1-일)-1,1,3,3-테트라메틸우로늄헥사플루오로포스페이트(HBTU), 2-(7-아자벤조트라이아졸-1-일)-1,1,3,3-테트라메틸우로늄헥사플루오로포스페이트(HATU), 2-(1H-벤조트라이아졸-1-일)-1,1,3,3-테트라메틸우로늄테트라플루오로보레이트(TBTU), 2-(5-노보난-2,3-다이카복시이미드)-1,1,3,3-테트라메틸우로늄테트라플루오로보레이트(TNTU), O-(N-석시미딜)-1,1,3,3-테트라메틸우로늄테트라플루오로보레이트(TSTU)를 포함하고, 카보다이이미드의 예는 N,N'-다이사이클로헥실카보다이이미드(DCC), N,N'-다이아이소프로필카보다이이미드(DIPCDI), N-에틸-N'-(3-다이메틸아미노프로필)카보다이이미드 염산염(EDCI·HCl) 등을 포함한다. 이들을 이용하는 축합을 위하여, 라세미화 저해제[예컨대, N-하이드록시-5-노보넨-2,3-다이카복실산 이미드(HONB), 1-하이드록시벤조트라이아졸(HOBt), 1-하이드록시-7-아자벤조트라이아졸(HOAt), 3,4-다이하이드로-3-하이드록시-4-옥소-1,2,3-벤조트라이아진(HOOBt), 에틸 2-사이아노-2-(하이드록시이미노)아세테이트(Oxyma) 등]의 첨가가 바람직하다. 축합에 사용되는 용매는 펩타이드 축합 반응에 유용한 것으로 공지된 것들로부터 적절하게 선택될 수 있다. 예를 들어, 무수 또는 물-함유 N,N-다이메틸폼아마이드, N,N-다이메틸아세트아마이드, N-메틸피롤리돈 등과 같은 산 아마이드, 염화메틸렌, 클로로폼 등과 같은 할로겐화된 탄화수소, 트라이플루오로에탄올, 페놀 등과 같은 알코올, 다이메틸설폭사이드 등과 같은 설폭사이드, 피리딘 등과 같은 3급 아민, 다이옥산, 테트라하이드로퓨란 등과 같은 에터, 아세토나이트릴, 프로피오나이트릴 등과 같은 나이트릴, 메틸 아세테이트, 에틸 아세테이트 등과 같은 에스터, 이들의 적절한 혼합물 등이 사용될 수 있다. 반응 온도는 펩타이드 결합 반응에 사용 가능한 것으로 공지된 범위로부터 적절하게 선택되고, 통상 약 -20℃ 내지 90℃의 범위로부터 선택된다. 활성화된 아미노산 유도체는 통상 1.5 내지 6배 과잉으로 사용된다. 고상 합성에서, 닌하이드린 반응을 이용하는 시험이 축합이 불충분한 것을 나타낼 경우, 충분한 축합은 보호기의 제거 없이 축합 반응을 반복함으로써 수행될 수 있다. 반응을 반복한 후에도 축합이 여전히 불충분할 경우, 미반응 아미노산은 산 무수물, 아세틸이미다졸 등으로 아세틸화될 수 있으므로 후속 반응에 대한 영향이 회피될 수 있게 된다.
출발 아미노산의 아미노기에 대한 보호기의 예는 벤질옥시카보닐(Z), tert-부톡시카보닐(Boc), tert-펜틸옥시카보닐, 아이소보닐옥시카보닐, 4-메톡시벤질옥시카보닐, 2-클로로벤질옥시카보닐(Cl-Z), 2-브로모벤질옥시카보닐(Br-Z), 아다만틸옥시카보닐, 트라이플루오로아세틸, 프탈로일, 폼일, 2-나이트로페닐설페닐, 다이페닐포스피노티오일, 9-플루오레닐메틸옥시카보닐(Fmoc), 트라이틸 등을 포함한다.
출발 아미노산에 대한 카복실-보호기의 예는, 위에서 언급된 C1-6 알킬기, C3-10 사이클로알킬기, C7-14 아르알킬기 이외에, 아릴, 2-아다만틸, 4-나이트로벤질, 4-메톡시벤질, 4-클로로벤질, 페나실 및 벤질옥시카보닐하이드라자이드, tert-부톡시카보닐하이드라자이드, 트라이틸하이드라자이드 등을 포함한다.
세린 또는 트레오닌의 하이드록실기는, 예를 들어, 에스터화 또는 에터화에 의해 보호될 수 있다. 에스터화에 적합한 기의 예는, 아세틸기 등과 같은 저급(C2-4) 알카노일기, 벤조일기 등과 같은 아로일기, 및 유기산 등으로부터 유래된 기를 포함한다. 또한, 에터화에 적합한 기의 예는 벤질, 테트라하이드로피란일, tert-부틸(But), 트라이틸(Trt) 등을 포함한다.
티로신의 페놀성 하이드록실기에 대한 보호기의 예는 Bzl, 2,6-다이클로로벤질, 2-나이트로벤질, Br-Z, tert-부틸 등을 포함한다.
히스티딘의 이미다졸에 대한 보호기의 예는 p-톨루엔설포닐(Tos), 4-메톡시-2,3,6-트라이메틸벤젠설포닐(Mtr), 다이나이트로페닐(DNP), 벤질옥시메틸 (Bom), tert-부톡시메틸 (Bum), Boc, Trt, Fmoc 등을 포함한다.
아르기닌의 구아니디노기에 대한 보호기의 예는 Tos, Z, 4-메톡시-2,3,6-트라이메틸벤젠설포닐(Mtr), p-메톡시벤젠설포닐(MBS), 2,2,5,7,8-펜타메틸크로만-6-설포닐(Pmc), 메시틸렌-2-설포닐(Mts), 2,2,4,6,7-펜타메틸다이하이드로벤조퓨란-5-설포닐(Pbf), Boc, Z, NO2 등을 포함한다.
라이신의 곁사슬 아미노기에 대한 보호기의 예는 Z, Cl-Z, 트라이플루오로아세틸, Boc, Fmoc, Trt, Mtr, 4,4-다이메틸-2,6-다이옥소사이클로헥실리덴일(Dde) 등을 포함한다.
트립토판의 인돌릴에 대한 보호기의 예는 폼일(For), Z, Boc, Mts, Mtr 등을 포함한다.
아스파라긴 및 글루타민에 대한 보호기의 예는 Trt, 잔틸(Xan), 4,4'-다이메톡시벤즈하이드릴(Mbh), 2,4,6-트라이메톡시벤질(Tmob) 등을 포함한다.
출발 물질 중의 활성화된 카복실기의 예는 대응하는 산 무수물, 아자이드, 활성 에스터[알코올과의 에스터(예컨대, 펜타클로로페놀, 2,4,5-트라이클로로페놀, 2,4-다이나이트로페놀, 사이아노메틸알코올, 파라나이트로페놀, HONB, N-하이드록시석시미드, 1-하이드록시벤조트라이아졸(HOBt), 1-하이드록시-7-아자벤조트라이아졸(HOAt))] 등을 포함한다. 출발 재료 내 활성화된 아미노기의 예는 대응하는 인 아마이드를 포함한다.
보호기를 제거(removing)(제거(eliminating))하는 방법의 예는, Pd-블랙 또는 Pd-탄소와 같은 촉매의 존재 하에서의 수소 스트림 중의 촉매 환원; 무수 플루오린화수소, 메탄설폰산, 트라이플루오로메탄설폰산, 트라이플루오로아세트산(TFA), 트라이메틸실릴 브로마이드(TMSBr), 트라이메틸실릴 트라이플루오로메탄설포네이트, 테트라플루오로붕산, 트리스(트라이플루오로)붕산, 삼브로민화붕소, 또는 이의 혼합물 용액을 이용한 산 처리; 다이아이소프로필에틸아민, 트라이에틸아민, 피페리딘, 피페라진 등을 이용한 염기 처리; 및 액체 암모니아 중에서 나트륨에 의한 환원 등을 포함한다. 위에서 기재된 산 처리에 의한 제거 반응은 일반적으로 -20℃ 내지 40℃의 온도에서 수행되고; 산 처리는 아니솔, 페놀, 티오아니솔, 메타크레졸 및 파라크레졸; 다이메틸설파이드, 1,4-부탄다이티올, 1,2-에탄다이티올, 트라이아이소프로필실란 등과 같은 양이온 포촉제(cation scavenger)를 첨가함으로써 효율적으로 수행된다. 또한, 히스티딘의 이미다졸의 보호기로서 사용되는 2,4-다이나이트로페닐기는 티오페놀 처리에 의해 제거되고; 트립토판의 인돌의 보호기로서 사용되는 폼일기는 1,2-에탄다이티올, 1,4-부탄다이티올 등의 존재 중에서 산처리에 의한 것뿐만 아니라, 희석 수산화나트륨, 희석 암모니아 등에 의한 알칼리 처리에 의한 탈보호에 의해 제거된다.
출발 물질과 보호기의 반응에 관여되지 않아야 하는 작용기의 보호, 보호기의 제거, 반응에 관여하는 작용기의 활성화 등은 공지된 보호기 및 공지된 수단으로부터 적절하게 선택될 수 있다.
펩타이드의 아마이드를 제조하는 방법에서, 이것은 아마이드 합성을 위하여 수지를 이용하는 고상 합성에 의해 형성되거나, 또는 카복시 말단 아미노산의 α-카복실기가 아마이드화되고, 펩타이드 사슬이 아미노기 측을 향하여 목적하는 사슬 길이로 연장되고, 그 후, 펩타이드 사슬만의 N-말단 α-아미노기에 대한 보호기가 제거된 펩타이드 및 C-말단 카복실기에 대한 보호기만이 펩타이드 사슬에서 제거된 펩타이드가 제조되고, 이들 두 펩타이드는 위에서 기재된 혼합된 용매 중에서 축합된다. 축합 반응에 대한 상세에 대해서, 위에서의 것과 같은 것이 적용된다. 축합에 의해 얻어진 보호된 펩타이드가 정제된 후에, 모든 보호기가 위에서 기재된 방법에 의해 제거되어 목적하는 조질의 펩타이드를 수득할 수 있다. 이 조질의 펩타이드를 주된 분획의 정제 및 동결-건조의 각종 공개적으로 공지된 수단을 이용해서 정제함으로써, 펩타이드의 목적하는 아마이드가 제조될 수 있다.
일 구체예에서, 상기 펩타이드는 그의 용매화물의 형태일 수 있다. “용매화물”은 상기 펩타이드 또는 그의 염이 용매 분자와 복합체를 형성한 것을 의미한다.
“치주질환”은 치아를 유지하는 치아 주위 조직인 치은, 치주인대, 치조골에서 일어나는 염증 질환을 일컫는 것이다. 치은(잇몸)과 치아 사이의 틈에 박테리아가 감염되어 치주인대와 인접조직을 손상시키는 질환을 의미하는데, 병증의 정도에 따라 치은염과 치주염으로 구분된다. 염증이 진행되어 더 많은 조직이 손상되면서 치주낭(periodontal pocket)이 형성되고, 치주염이 심할수록 치주낭의 깊이가 깊어지게 되는데, 치주낭이 깊어지면서 치주인대에 염증이 생기게 되고 최종적으로는 골소실이 유발된다고 알려져 있다. 이러한 치주질환의 근본적 치료는 손상된 치주인대 결합조직, 백악질 및 치조골을 복원하는 것이므로, 이를 위하여는 치조골을 지지하는 치주인대를 재생시켜야 할 뿐만 아니라, 치주인대가 부착할 수 있는 치조골과 백악질의 재생이 필요하다.
상기 약학 조성물에서, 상기 치주질환은 치주조직 염증성 질환일 수 있다.
상기 약학 조성물에서, 상기 치주질환은 치은염 또는 치주염일 수 있다.
일 구체예에서, 상기 약학 조성물은 치주질환 치료용 약물을 더 포함할 수 있다.
상기 치주질환 치료용 약물은 상기 펩타이드와 분리되어 있는 것일 수도 있고, 상기 펩타이드의 N-말단 또는 C-말단에 결합되어 펩타이드와 복합체를 형성한 형태일 수도 있다.
“탈구성 외상”은 치아 혹은 치주조직에 외상력이 가해져서, 그 방향과 크기의 차이 등에 따라 치아와 치주조직이 파괴되어, 치주인대가 손상된 외상을 포함하며, 진탕·아탈구, 정출성 탈구, 측방성 탈구, 완전 탈구, 함입으로 세분화된 것을 포함한다. 따라서, 탈구성 외상의 근본적 치료 또한 손상된 치주인대의 재생을 필요로 한다. 특히 완전 탈구 치아의 재식 성공여부는 완전 탈구된 치아에 부착되어 있는 치주인대 또는 치아가 빠진 치조와에 남아있는 치주인대의 재생에 달려있다. 치주인대의 재생이 일어나지 않으면, 치아 뿌리의 백악질과 상아질의 흡수가 일어나며, 이 부위가 치조골로 대체되는 골유착(Ankylosis)이 발생하게 된다.
“치아 재식술(tooth replantation)”은 치아를 의도적으로 발치한 후 적절한 근관치료를 시행하였거나 시행하기 전에 발치와에 재식립하는 방법이다. 의도적 재식술은 근관치료가 실패하였거나, 해부학적인 한계가 있거나, 접근성의 어려움이 있거나, 사고로 인해 치아가 탈구되었거나, 의도적으로 빠른 교정 맹출을 해야 하는 상황에서 시행할 수 있다.
“예방”은 상기 조성물의 투여로 치주질환 또는 탈구성 외상 치아의 발병을 억제 또는 지연시키는 모든 행위를 의미한다.
“치료”는 상기 조성물의 투여로 치주질환 또는 탈구성 외상 치아의 증세가 호전되거나 이롭게 되는 모든 행위를 의미한다.
상기 약학 조성물은, 상기 펩타이드에 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체 (자연적 또는 비자연적 담체), 부형제 또는 희석제를 추가로 포함하는 치주질환 치료용 약학 조성물의 형태로 제조될 수 있다. 상기 약학 조성물은, 각각 통상의 방법에 따라 치주질환이 유발된 부위에 투여할 수 있는 멸균 주사용액의 형태로 제형화하여 사용될 수 있다.
본 발명에서, 상기 약학 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트, 광물유, 콜라겐 등을 들 수 있다. 제제화 할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다. 특히, 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제, 연고제(예를 들어, 치수이장재 등) 등이 포함될 수 있다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
상기 약학 조성물에 포함된 상기 펩타이드 또는 그의 약학적으로 허용가능한 염의 함량은 특별히 이에 제한되지 않으나, 최종 조성물 총 중량을 기준으로 0.0001 내지 50 중량%, 또는 0.01 내지 20 중량%의 함량으로 포함될 수 있다.
상기 본 약학 조성물은 약제학적으로 유효한 양으로 투여될 수 있는데, 본 발명의 용어 "약제학적으로 유효한 양"이란 의학적 치료 또는 예방에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료 또는 예방하기에 충분한 양을 의미하며, 유효 용량 수준은 질환의 중증도, 약물의 활성, 환자의 연령, 체중, 건강, 성별, 환자의 약물에 대한 민감도, 사용된 본 발명 조성물의 투여 시간, 투여 경로 및 배출 비율 치료기간, 사용된 본 발명의 조성물과 배합 또는 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 약학 조성물은 단독으로 투여하거나 공지된 치주질환 치료용 약학 조성물과 병용하여 투여될 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하다.
상기 약학 조성물의 투여량은 사용목적, 질환의 중독도, 환자의 연령, 체중, 성별, 기왕력, 또는 유효성분으로서 사용되는 물질의 종류 등을 고려하여 당업자가 결정할 수 있다. 예를 들어, 본 발명의 약학 조성물은 성인 1인당 약 0.1 ng 내지 약 100 mg/kg, 바람직하게는 1 ng 내지 약 10 mg/kg로 투여할 수 있고, 본 발명의 조성물의 투여빈도는 특별히 이에 제한되지 않으나, 1일 1회 투여하거나 또는 용량을 분할하여 수회 투여할 수 있다. 상기 투여량은 어떠한 면으로 든 본 발명의 범위를 한정하는 것은 아니다.
상기 기술적 과제를 해결하기 위한 본 발명의 다른 양상은 하기 일반식 1의 아미노산 서열을 포함하는 펩타이드를 포함하는 치주조직 재생용 조성물을 제공한다:
K-Y-K-Q-X5-X6-X7-X8-Y-K (일반식 1)
상기 일반식 1에서,
X5 내지 X7는 각각 독립적으로 아르기닌 (R) 또는 리신 (K)이고;
X8은 아스파라긴 (N) 또는 세린 (S)이다.
일 구체예에서, 상기 펩타이드는 서열번호 1 내지 16 중 어느 하나의 아미노산 서열을 포함하는 것일 수 있다.
다른 구체예에서, 상기 펩타이드는 서열번호 1 내지 16 중 어느 하나의 아미노산 서열로 필수적으로 구성된 것이거나, 상기 펩타이드는 서열번호 1 내지 16 중 어느 하나의 아미노산 서열로 구성된 것일 수 있다.
상기 펩타이드에 관한 설명은 상술한 바와 같다.
“치주조직(periodontium)”은 상피조직, 연조직성 결합조직(connective tissue) 및 석회화 된 결합조직으로 이루어진 복합기관으로, 구조적으로 잇몸(gingiva, 치은), 치주인대(PDL: periodontal ligament), 백악질(cementum) 및 치조골(alveolar bone)로 구성되어 있다.
"치주인대(periodontal ligament, PDL)"란, 치근막이라고도 호칭되며, 포유류에서 치근의 백악질과 치조골벽을 결합하는 결합조직성 섬유막을 의미한다. 상기 치주인대는 치아의 장축에 대해 평행 또는 비스듬히 뻗는 교원섬유인 주섬유와 이것에 연속하여 양끝이 경조직에 묻혀있는 샤피(Sharpey) 섬유의 다발로 구성되며, 치주인대를 통하여 치아가 탄성적으로 턱뼈(치조골)에 고착된다. 상기 치주인대는 음식물을 씹을 때 생기는 압력을 완충할 뿐만 아니라 혈관이나 신경이 풍부하며 영양공급이나 감각에도 관여하는 것으로 알려져 있다. 치주 인대에는 섬유모세포, 미분화 중간엽세포, 상피세포 등 다양한 세포가 포함되어 있으며, 이중 치주인대 섬유모세포는 적절한 자극에 의해 뼈모세포 또는 백악모세포로 분화할 수 있으나, 치주인대 섬유모세포의 백악모세포로의 분화 기작 및 분화 촉진 단백질에 대해서는 알려져 있지 않다. 백악모세포 분화 마커로는 BSP(bone sialoprotein), OC(osteocalcin), CAP(cementum attachment protein)등이 알려져 있으며, 특히 CAP는 백악질에 치주인대 섬유가 부착하는데 중요한 역할을 하는 것으로 알려져 있다.
"백악질(cementum)"이란, 포유동물의 치아 뿌리(치근)를 덮고 있는 석회화 된 조직이다. 백악질은 치주인대를 고정시킴으로써 치아를 치조골에 고정시킨다. 따라서 세균이 잇몸에 감염되면 치아를 둘러싼 백악질의 변성이 일어나고, 변성된 백악질에는 치아와 치조골을 연결해주는 치주인대 섬유 다발이 달라붙지 못해서 치아가 흔들리게 된다. 이러한 변성된 백악질의 치료를 위해서는 새로운 백악질의 형성이 필요하다.
“치조골(alveolar bone)”은 치아뿌리(치근)을 둘러싸고 치아를 지지하는 역할을 하는 상악 및 하악골의 일부로서 치아의 형성이나 맹출에 따라 발달하고, 치아가 상실되면 서서히 흡수된다. 이러한 치조골은 치근백악질과 함께 치주인대를 고정시킴으로써 저작 등 교합압, 발음, 연하시 일어나는 치아에 대한 압력의 분산, 흡수에 중요한 역할을 한다.
“치주인대 섬유모세포(periodontal ligament fibroblast)”는 치은 섬유모세포(gingival fibroblast)와 함께 치주조직의 연조직성 결합조직의 주요 세포 구성이다. 치주인대 섬유모세포는 그 특유 기능으로 치주인대를 형성할 뿐만 아니라 생체 내에서의 인접 치조골 및 백악질의 수복과 재생에 관여하나, 이를 촉진할 수 있는 물질에 대해서는 알려진 바가 없으며, 치은 결합조직을 유지하는 데 관여하는 치은 섬유모세포와는 구분된다. 치주인대 섬유모세포는 적절한 자극에 의해 뼈모세포 또는 백악모세포로 분화할 수 있으나, 치주인대 섬유모세포의 백악모세포로의 분화 기작은 명확히 알려져 있지 않다. 뼈모세포와 백악모세포 분화 마커로는 BSP(bone sialoprotein), OC(osteocalcin)등이 알려져 있으며, CAP(cementum attachment protein)는 백악질에 치주인대 섬유가 부착하는데 중요한 역할을 하는 유전자로 알려져 있다. 또한 치주인대 마커로는 페리오스틴 (Periostin) 유전자가 알려져 있다. 최근 여러 연구에 따르면 페리오스틴은 치주조직 형성의 중요한 조절 인자로 콜라겐 섬유질 생성 및 섬유모세포 및 뼈모세포의 이동을 촉진함으로써, 치주 수술 후 치주인대 및 치조골의 재생에 중요한 역할을 한다는 것이 보고되고 있다.
“재생”은 상실 또는 손상된 세포 또는 조직이 복구 또는 보충되는 모든 작용을 의미할 수 있다. 상기 재생은 세포의 분화에 의한 것일 수 있다.
상기 펩타이드는 치주인대 섬유모세포의 백악모세포로의 분화를 촉진하는 효과가 있음을 확인하였다.
상기 치주조직 재생용 조성물은 치은, 치주인대, 백악질, 및 치조골 중 어느 하나 이상의 재생을 촉진하는 것일 수 있다.
상기 치주조직 재생용 조성물은 약학 조성물일 수 있다.
상기 약학 조성물에 대하여는 상술한 바와 같다.
상기 치주조직 재생용 조성물은 의약외품 조성물일 수 있다. 상기 의약외품 조성물은 치주질환 또는 탈구성 외상 치아의 예방 또는 개선용 의약외품 조성물일 수 있다.
"개선"이란, 치료되는 상태와 관련된 파라미터, 예를 들면 증상의 정도를 적어도 감소시키는 모든 행위를 의미한다.
상기 개선은 상기 펩타이드를 유효성분으로 포함하는 약학 조성물을 치주질환의 치료가 요구되는 개체에 투여하여 치주조직의 재생을 촉진함으로써, 치주질환 또는 탈구성 외상 치아의 증상이 호전되거나 또는 이롭게 되도록 하는 모든 행위를 의미하는 것으로 해석될 수 있다.
"의약외품"이란, 사람이나 동물의 질병을 진단, 치료, 개선, 경감, 처치 또는 예방할 목적으로 사용되는 물품들 중 의약품보다 작용이 경미한 물품들을 의미하는 것으로, 예를 들어 약사법에 따르면 의약외품이란 의약품의 용도로 사용되는 물품을 제외한 것으로, 사람·동물의 질병 치료나 예방에 쓰이는 섬유·고무 제품, 인체에 대한 작용이 경미하거나 직접 작용하지 않으며, 기구 또는 기계가 아닌 것과 이와 유사한 것, 감염병을 막기 위한 살균·살충제 등이 이에 포함된다.
상기 펩타이드를 포함하는 의약외품 조성물의 종류나 제형은 특별히 제한되지 않으나, 일 예로서, 구강용 소독 청결제, 구강청정용품, 치약, 치실, 구강용 연고제 등일 수 있다.
상기 치주조직 재생용 조성물은 건강기능식품 조성물일 수 있다. 상기 건강기능식품 조성물은 치주질환 또는 탈구성 외상 치아의 예방 또는 개선용 건강기능식품 조성물일 수 있다.
"식품"은 육류, 소시지, 빵, 초콜릿, 캔디류, 스낵류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알코올음료, 비타민 복합제, 건강 기능 식품 및 건강 식품 등이 있으며, 통상적인 의미에서의 식품을 모두 포함한다.
상기 건강 기능(성) 식품(functional food)이란, 특정보건용 식품(food for special health use, FoSHU)과 동일한 용어로, 영양 공급 외에도 생체조절기능이 효율적으로 나타나도록 가공된 의학, 의료효과가 높은 식품을 의미한다. 여기서 "기능(성)"이라 함은 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건용도에 유용한 효과를 얻는 것을 의미한다.
본 발명의 식품은 당 업계에서 통상적으로 사용되는 방법에 의하여 제조 가능하며, 상기 제조시에는 당 업계에서 통상적으로 첨가하는 원료 및 성분을 첨가하여 제조할 수 있다. 또한 상기 식품의 제형 또한 식품으로 인정되는 제형이면 제한 없이 제조될 수 있다. 본 발명의 식품용 조성물은 다양한 형태의 제형으로 제조될 수 있으며, 일반 약품과는 달리 식품을 원료로 하여 약품의 장기복용 시 발생할 수 있는 부작용 등이 없는 장점이 있고, 휴대성이 뛰어나, 본 발명의 식품은 치주질환 또는 탈구성 외상 치아의 예방 또는 개선의 효과를 증진시키기 위한 보조제로 섭취가 가능하다.
상기 건강 식품(health food)은 일반식품에 비해 적극적인 건강유지나 증진 효과를 가지는 식품을 의미하고, 건강보조식품(health supplement food)은 건강보조 목적의 식품을 의미한다. 경우에 따라, 건강 기능 식품, 건강 식품, 건강보조식품의 용어는 혼용될 수 있다.
구체적으로, 상기 건강 기능 식품은 본 발명의 펩타이드를 음료, 차류, 향신료, 껌류, 과자류 등의 식품 소재에 첨가하거나, 캡슐화, 분말화, 현탁액 등으로 제조한 식품으로, 이를 섭취할 경우 건강상 특정한 효과를 가져오는 것을 의미하나, 일반 약품과는 달리 식품을 원료로 하여 약품의 장기 복용 시 발생할 수 있는 부작용이 없는 장점이 있다.
상기 식품 조성물은, 일상적으로 섭취하는 것이 가능하기 때문에 치주질환 또는 탈구성 외상 치아의 예방 또는 개선에 대하여 높은 효과를 기대할 수 있으므로, 매우 유용하게 사용될 수 있다.
상기 식품 조성물은 생리학적으로 허용 가능한 담체를 추가로 포함할 수 있는데, 담체의 종류는 특별히 제한되지 않으며 당해 기술 분야에서 통상적으로 사용되는 담체라면 어느 것이든 사용할 수 있다.
또한, 상기 식품 조성물은 식품 조성물에 통상 사용되어 냄새, 맛, 시각 등을 향상시킬 수 있는 추가 성분을 포함할 수 있다. 예들 들어, 비타민 A, C, D, E, B1, B2, B6, B12, 니아신(niacin), 비오틴(biotin), 폴레이트(folate), 판토텐산(panthotenic acid) 등을 포함할 수 있다. 또한, 아연(Zn), 철(Fe), 칼슘(Ca), 크롬(Cr), 마그네슘(Mg), 망간(Mn), 구리(Cu) 등의 미네랄을 포함할 수 있다. 또한, 라이신, 트립토판, 시스테인, 발린 등의 아미노산을 포함할 수 있다.
또한, 상기 식품 조성물은 방부제(소르빈산 칼륨, 벤조산나트륨, 살리실산, 데히드로초산나트륨 등), 살균제(표백분과 고도 표백분, 차아염소산나트륨 등), 산화방지제(부틸히드록시아니졸(BHA), 부틸히드록시톨류엔(BHT) 등), 착색제(타르색소 등), 발색제(아질산 나트륨, 아초산 나트륨 등), 표백제(아황산나트륨), 조미료(MSG 글루타민산나트륨 등), 감미료(둘신, 사이클레메이트, 사카린, 나트륨 등), 향료(바닐린, 락톤류 등), 팽창제(명반, D-주석산수소칼륨 등), 강화제, 유화제, 증점제(호료), 피막제, 검기초제, 거품억제제, 용제, 개량제 등의 식품 첨가물(food additives)을 포함할 수 있다. 상기 첨가물은 식품의 종류에 따라 선별되고 적절한 양으로 사용될 수 있다.
상기 펩타이드는 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효성분의 혼합양은 그의 사용 목적(예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품 또는 음료의 제조시에 본 발명의 식품 조성물은 50 중량부 이하, 20 중량부 이하, 10 중량부 이하, 5 중량부 이하, 1 중량부 이하, 0.1 중량부 이하의 양으로 첨가될 수 있다. 그러나 건강 및 위생을 목적으로 장기간 섭취할 경우에는 상기 범위 이하의 함량을 포함할 수 있으며, 안전성 면에서 아무런 문제가 없기 때문에 유효성분은 상기 범위 이상의 양으로도 사용될 수 있다.
상기 식품 조성물의 일 예로 건강음료 조성물로 사용될 수 있으며, 이 경우 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로 함유할 수 있다. 상술한 천연 탄수화물은 포도당, 과당과 같은 모노사카라이드; 말토스, 슈크로스와 같은 디사카라이드; 덱스트린, 사이클로덱스트린과 같은 폴리사카라이드; 자일리톨, 소르비톨, 에리트리톨 등의 당알콜일 수 있다. 감미제는 타우마틴, 스테비아 추출물과 같은 천연 감미제; 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 건강음료 조성물 100 mL 당 일반적으로 약 0.01 내지 0.04 g, 구체적으로 약 0.02 내지 0.03 g이 될 수 있다.
상기 외에 건강음료 조성물은 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산, 펙트산의 염, 알긴산, 알긴산의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올 또는 탄산화제 등을 함유할 수 있다. 그 밖에 천연 과일주스, 과일주스 음료, 또는 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 혼합하여 사용할 수 있다. 이러한 첨가제의 비율은 크게 중요하진 않지만 본 발명의 건강음료 조성물 100 중량부당 0.01 내지 0.1 중량부의 범위에서 선택되는 것이 일반적이다.
상기 식품 조성물은 치주질환 또는 탈구성 외상 치아의 예방 또는 개선 효과를 나타낼 수 있다면 다양한 중량%로 포함할 수 있고, 구체적으로 본 발명의 펩타이드를 식품 조성물의 총 중량 대비 0.00001 내지 100 중량% 또는 0.01 내지 80 중량%로 포함할 수 있으나, 이에 제한되지 않는다.
상기 기술적 과제를 해결하기 위한 본 발명의 또다른 양상은 하기 일반식 1의 아미노산 서열을 포함하는 펩타이드를 포함하는, BSP (Bone sialoprotein), DMP1 (Dentin matrix protein 1), CAP (Cementum attachment protein), COL3 (collagen type III) 및 페리오스틴 (Periostin) 중 어느 하나 이상의 유전자 발현 촉진용 조성물을 제공한다:
K-Y-K-Q-X5-X6-X7-X8-Y-K (일반식 1)
상기 일반식 1에서,
X5 내지 X7는 각각 독립적으로 아르기닌 (R) 또는 리신 (K)이고;
X8은 아스파라긴 (N) 또는 세린 (S)이다.
일 구체예에서, 상기 펩타이드는 서열번호 1 내지 16 중 어느 하나의 아미노산 서열을 포함하는 것일 수 있다.
다른 구체예에서, 상기 펩타이드는 서열번호 1 내지 16 중 어느 하나의 아미노산 서열로 필수적으로 구성된 것이거나, 상기 펩타이드는 서열번호 1 내지 16 중 어느 하나의 아미노산 서열로 구성된 것일 수 있다.
상기 펩타이드에 관한 설명은 상술한 바와 같다.
상기 펩타이드는 인간 치주인대세포에서 뼈모세포 및 백악모세포 분화마커 유전자인 BSP, DMP1, CAP의 발현을 증가시키고, 치주인대 분화마커 유전자인 페리오스틴과 COL3의 발현을 증가시킴을 확인하였다. 또한, 상기 펩타이드는 인간 중간엽줄기세포에서 뼈모세포 및 백악모세포 분화마커 유전자인 BSP 및 DMP1의 발현을 증가시킴을 확인하였다.
본 발명의 기술적 과제를 해결하기 위한 또다른 양상은 치주질환 또는 탈구성 외상 치아의 치료를 필요로 하는 개체에게 유효량의 상기 펩타이드 또는 그의 약학적으로 허용가능한 염을 투여하는 단계를 포함하는, 개체에서 치주질환 또는 탈구성 외상 치아를 치료하는 방법을 제공한다.
“개체”란 질환의 치료를 필요로 하는 대상을 의미하고, 보다 구체적으로 인간 또는 비-인간인 영장류, 생쥐(mouse), 쥐(rat), 개, 고양이, 말 및 소 등의 포유류를 의미한다.
"유효량"은 환자에게 단일 또는 다회 용량으로 투여되었을 때, 진단 또는 치료 하에 환자에서 원하는 효과를 제공하는, 상기 펩타이드 또는 그의 약학적으로 허용가능한 염의 양 또는 용량을 지칭한다. 유효량은 공지 기술을 사용함으로써 또는 유사 환경 하에서 수득한 결과를 관찰함으로써 관련 기술분야의 통상의 기술자로서 주치의 진단의에 의해 쉽게 결정될 수 있다. 환자에 대한 유효량을 결정할 때, 포유동물종; 그의 크기, 연령 및 일반적인 건강 상태; 연루된 구체적인 질환 또는 장애; 질환 또는 장애의 연루 정도 또는 중증도; 개별 환자의 반응; 투여되는 특정 화합물; 투여 모드; 투여되는 제제의 생체이용성 특징; 선택된 투약 요법; 동시 약물처치 사용; 및 다른 관련된 환경을 포함하나, 이에 제한되지 않는 다수의 인자가 주치의 진단의에 의해 고려된다.
“투여”는 어떠한 적절한 방법으로 환자에게 소정의 물질을 도입하는 것을 의미한다. 투여 경로는 환자의 생체 내 표적에 도달할 수 있는 어떠한 일반적인 경로일 수 있다. 상기 투여는, 예를 들어, 복강 내 투여, 정맥 내 투여, 근육 내 투여, 피하 투여, 피내 투여, 경구 투여, 국소 투여, 비내 투여, 직장 내 투여일 수 있으나, 이에 제한되지 않는다.
상기 치주질환 또는 탈구성 외상 치아의 치료는 치주조직의 재생에 의한 것일 수 있으나, 이에 제한되지 않는다.
상기 방법에서, 유효량의 상기 펩타이드 또는 그의 약학적으로 허용가능한 염은 유효량의 하나 이상의 다른 활성 성분과 동시에, 개별적으로, 또는 순차적으로 투여할 수 있다. 상기 하나 이상의 다른 활성 성분은 치주질환 또는 탈구성 외상 치아를 치료하기 위한 하나 이상의 다른 제제일 수 있으나, 이에 제한되지 않는다.
상기 기술적 과제를 해결하기 위한 본 발명의 또다른 양상은 치주질환 또는 탈구성 외상 치아의 예방 또는 치료용 약제를 제조하는데 있어서, 상기 펩타이드 또는 그의 약학적으로 허용가능한 염의 용도를 제공한다.
본원에서 개시된 모든 수치는 “약”의 의미를 포함할 수 있다. "약"은 ±0.5, ±0.4, ±0.3, ±0.2, ±0.1 등을 모두 포함하는 범위로, 약 이란 용어 뒤에 나오는 수치와 동등하거나 유사한 범위의 수치를 모두 포함하나, 이에 제한되지 않는다.
본원에서 개시되는 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본원에서 개시된 다양한 요소들의 모든 조합이 본 발명의 범주에 속한다. 또한, 하기 기술되는 구체적인 서술에 의하여 본 발명의 범주가 제한된다고 할 수 없다.
본 발명에 따른 치주질환 또는 탈구성 외상 치아의 예방 또는 치료용 약학 조성물은 치주인대, 치조골 및 백악질을 포함하는 치주조직의 재생과 치주인대의 부착을 촉진하므로, 치주질환 및 탈구성 외상 치아와 같은 손상된 결합조직의 복원용으로 사용될 수 있다. 따라서, 상기 펩타이드는 약학 조성물, 의약외품 조성물, 건강기능식품 조성물 등으로 다양하게 이용될 수 있다.
본 발명의 효과는 이상에서 언급한 것으로 제한되지 않으며, 언급되지 않은 또 다른 효과들은 아래의 기재로부터 본 발명이 속하는 기술 분야의 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
도 1은 실시예 1에서 제조한 그룹 1 및 그룹 2의 펩타이드가 인간 치주인대세포(hPDL)에서 뼈모세포 및 백악모세포 분화 마커 유전자인 BSP (Bone sialoprotein), DMP1 (Dentin Matrix protein 1) 와 CAP(Cementum attachment protein)의 발현에 미치는 영향을 나타낸 그래프이다.
도 2는 실시예 1에서 제조한 그룹 1 및 그룹 2의 펩타이드가 인간 중간엽줄기세포(hBMSCs)에서 뼈모세포 분화 마커 유전자인 BSP (Bone sialoprotein)와 DMP1 (Dentin Matrix protein 1)의 발현에 미치는 영향을 나타낸 결과이다.
도 3은 실시예 1에서 제조한 그룹 1 및 그룹 2의 펩타이드가 인간 치주인대세포에서 치주인대 마커 유전자인 제3형 콜라겐 섬유 유전자(COL3)와 페리오스틴 유전자의 발현에 미치는 영향을 나타낸 결과이다.
도 4는 치주조직 손상 부위에 실시예 1의 펩타이드(서열번호 16)를 처리하고 3개월 후 헤마톡실린/에오신으로 염색한 조직 사진으로서, 펩타이드가 치조골 재생에 미치는 영향을 확인한 결과이다. A는 양성대조군(Positive Control: PC)을 나타내고; B는 치주조직 손상 후 아무것도 처리하지 않은 음성대조군(NC)을 나타내며; C는 치주조직 손상 후 콜라겐 스펀지만 식립한 음성대조군(NC+Plug)을 나타내며; D는 그룹 2(서열번호 16번)의 펩타이드를 처리한 실험군을 나타내고; AB는 치조골을 의미하고; De는 상아질을 의미한다.
도 5는 치주조직 손상 부위에 실시예 1의 펩타이드(서열번호 16)를 처리하고 3개월 후 펩타이드가 치주인대 조직 재생에 미치는 영향을 헤마톡실린/에오신으로 염색을 통하여 확인한 결과이다. A-D는 아무것도 처리하지 않은 음성대조군(NC)을 나타내며; E-H는 콜라겐 스펀지만 식립한 음성대조군(NC+Plug)을 나타내며; I-L은 그룹 2(서열번호 16번)의 펩타이드를 처리한 실험군을 나타낸다. AB는 치조골을 의미하고; De는 상아질을 의미하고; CE는 백악질을 의미하고; CT는 결합조직을 의미하고; NPD는 새롭게 형성된 치주인대 유사조직을 의미하며; NCE는 새롭게 형성된 백악질 유사조직을 의미한다. 크기바, A, E, I, M 500 ㎛. B, F, J, N, 200 ㎛. C, G, K, O, 100 ㎛. D, H, L, P, 50 ㎛.
도 6는 치주조직 손상 부위에 실시예 1의 펩타이드(서열번호 16)를 처리하고 3개월 후 펩타이드가 치주인대 조직 재생에 미치는 영향을 콜라겐 염색 (Masson's trichrome stain)방법으로 확인한 결과이다. A-B는 아무것도 처리하지 않은 음성대조군(NC)을 나타내며; C-D는 콜라겐 스펀지만 식립한 음성대조군(NC+Plug)을 나타내며; E-F는 그룹 2(서열번호 16번)의 펩타이드를 처리한 실험군을 나타낸다. AB는 치조골을 의미하고; De는 상아질을 의미하고; CE는 백악질을 의미하고; CT는 결합조직을 의미하고; NPD는 새롭게 형성된 치주인대 유사조직을 의미하며; NCE는 새롭게 형성된 백악질 유사조직을 의미한다. 크기바, A, C, E, G 100 ㎛. B, D, F, H, 50 ㎛.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1: 펩타이드의 합성
하기 표 1에 기재된 아미노산 서열로 구성된 16개의 펩타이드를 각각 합성하였다. 여기에서, 8번 아미노산이 아스파라긴(N)인 펩타이드를 그룹 1로 하고, 8번 아미노산이 세린(S)인 펩타이드를 그룹 2로 하였다.
그룹 서열번호 아미노산 서열(N-C)
그룹 1 1 KYKQRKKNYK
2 KYKQRKRNYK
3 KYKQRRKNYK
4 KYKQRRRNYK
5 KYKQKKKNYK
6 KYKQKRKNYK
7 KYKQKKRNYK
8 KYKQKRRNYK
그룹 2 9 KYKQRKKSYK
10 KYKQRKRSYK
11 KYKQRRKSYK
12 KYKQRRRSYK
13 KYKQKKKSYK
14 KYKQKRKSYK
15 KYKQKKRSYK
16 KYKQKRRSYK
실험 재료 및 방법 1. 세포 배양
hBMSCs세포는 5%의 CO2를 포함하는 습윤된 공기 37℃ 조건에서 배양되어 실험에 사용되었다. 사람유래 중간엽 줄기세포(hBMSCs)는 론자 (LONZA, 스위스)에서 구입하여 사용하였다. hBMSCs는 10% 열 불활성화된 소의 혈청이 첨가된 알파-엠이엠(α-MEM, Invitrogen) 배양액에서 배양하였다.
2. 인간 치주인대세포 분리 및 배양
인간 치주인대세포(hPDL cells)는 서울대학교 치과병원에서 성인 10명(18-22세)의 사랑니에서 치주인대조직으로부터 세포를 분리하였다. 구체적으로, 모든 실험은 임상연구심의위원회(hospital's Institutional Review Board)에서 승인을 받은 후 환자의 동의를 받아 수행하였으며, 사랑니의 치아뿌리에 붙어있는 치주인대 조직을 분리하여 양면도로 잘게 자르고, 60 mm 접시에 넣고, 커버 슬립으로 덮은 후 둘베코의 수정 이글 배지에서 배양하였다.
3. 실시간 PCR 분석
TRIzol 시약을 이용하여 인간 치주인대세포의 전체(total) RNA를 분리하였다. 2 ㎍의 전체 RNA와 역전사효소 1 ul와 0.5 ㎍의 올리고(oligo; dT)를 이용하여 cDNA를 합성하였다. 합성된 인간 치주인대세포의 cDNA를 하기 표 2의 프라이머를 사용한 실시간 중합효소 연쇄반응에 이용하였다. 실시간 중합효소 연쇄반응은 SYBR GREEN PCR Master Mix(Takara, 일본)를 이용하여 ABI PRISM 7500 시퀀스 검출 시스템(sequence detection system)(Applied Biosystems)에서 진행되었다. 실시간 중합효소 연쇄반응은 94℃, 1 분; 95℃, 15 초 - 60℃, 34 초를 40 사이클(cycles) 반복하는 조건으로 진행하였다. 결과의 분석은 CT (comparative cycle threshold) 방법을 이용하였다.
유전자 서열번호 방향 서열(5'-3')
hBSP 17 정방향 GAATGGCCTGTGCTTTCTCAA
18 역방향 TCGGATGAGTCACTACTGCCC
hDMP1 19 정방향 ACAGGCAAATGAAGACCC
20 역방향 TTCACTGGCTTGTATGG
hCAP 21 정방향 GACGAGGACGGCACCAACGG
22 역방향 CGCGGTCATGGCGATGTCGT
hPERIOSTIN 23 정방향 GAGACAAAGTGGCTTCCG
24 역방향 CTGTCACCGTCACATCCT
hCollagen Type III 25 정방향 CGGATGCTTCCAGACATCTCTATC
26 역방향 ACAGGAAGCTGTTGAAGGAGGA
hGAPDH 27 정방향 CCATGGAGAAGGCTGGGG
28 역방향 CAAAGTTCTCATGGATGACC
4. 치주조직 손상 모델에서 펩타이드가 치주조직 재생에 미치는 영향 평가
4 마리의 비글견(12 내지 16kg; 6 내지 8주령)에 겔로란을 흡입시켜서 마취시키고, 졸레틸(Zoletil, 5mg/kg)과 자일라진(xylazine, 0.2~0.5mg/kg)을 정맥주사한 다음, 리도카인을 처리하였다(Lidocaine 2% with 1:80,000 epinephrine). 상기 비글견의 하악골에서 4번 소구치와 2번 대구치를 발치한 다음 3개월 동안 치유되기를 기다렸다.
치유 3개월 후 1번 큰어금니 원심면과 근심면에 3벽성 치주결손을 유도하였다. 그런 다음, 치근 주위로 협설측 및 원심측 골이 남아있는 상태로 4x4x4 mm 크기의 치주 손상을 형성하고, 치근부 치조골을 확실하게 삭제한 후 큐렛을 이용하여 치근면 활택술 시행한 후 1/2 라운드 버를 이용하여 앞니골패임을 형성하였다.
이어, 실험군은 결손 부위에 50 ㎍의 실시예 1에서 제조한 펩타이드(그룹 2의 서열번호 16)를 포함하는 콜라겐 스펀지(펩타이드를 생리식염수에 1 ㎍/㎕ 농도로 용해한 펩타이드 용액을 제조한 다음 EP tube에 펩타이드 용액 50 ㎕ (50 ㎍)를 첨가한 후 콜라겐 스펀지를 5분간 담가 두어 제조하였음)를 이식하였고, 결손 후 아무 처리도 하지 않은 음성 대조군(NC)과 콜라겐 스펀지(콜라겐 스펀지를 생리식염수 50 ㎕에 5분간 담가 두어 제조하였음) 만 골 결손 부 내부 골 벽에 위치시켜 이식한 음성 대조군(NC+Plug)을 3개월 후에 희생하여 조직학적 평가를 시행하였다.
3개월 후, 상기 비글견에 과량(90-120 mg/kg)의 펜토바비탈을 투여하여 희생시켰다. 상기 비글견의 치아 부위를 적출하고, 10% 포르말린으로 고정시킨 후, 5% 포름산을 가하여 칼슘을 제거하며, 성형하고, 파라핀에 포매한 다음, 5㎛ 두께의 조직 절편을 수득하였다.
상기 수득한 조직 절편을 헤마톡실린과 에오신으로 염색하거나 치주인대 재생을 확인하기 위하여 콜라겐 염색(Masson's Trichrome Staining) 한 다음, 디지털 카메라(LEICA ICC50 camera, Germany)가 장착된 광학현미경(LEICA DM750, Germany)을 사용하여 분석하였다.
실험 결과
실험예 1: 펩타이드가 인간 치주인대세포에서 뼈모세포 및 백악모세포 분화마커 유전자 발현에 미치는 영향
BSP (Bone sialoprotein)와 DMP1 (Dentin matrix protein 1) 유전자는 뼈모세포와 백악모세포 분화 마커로 사용되며, 뼈와 백악질의 석회화에 중요한 유전자로 알려져 있다. 또한, CAP (cementum attachment protein) 유전자는 분화된 백악모세포에서 발현되며, 치주인대 섬유다발의 백악질 부착에 관여하는 유전자로 알려져 있다.
도 1은 실시예 1에서 제조한 그룹 1 및 그룹 2의 펩타이드가 인간 치주인대세포(hPDL)에서 뼈모세포 및 백악모세포 분화 마커 유전자 BSP, DMP1 및 CAP의 발현에 미치는 영향을 나타낸 그래프이다.
도 1에 나타낸 바와 같이, 그룹 1과 그룹 2의 펩타이드를 처리한 실험군에서는 대조군에 비해 BSP, DMP1, 및 CAP 유전자 발현이 약 2배 이상 증가된 것을 확인하였다.
표 3은 그룹 1과 그룹 2의 펩타이드 군이 BSP mRNA 발현에 미치는 영향을 실시간 PCR로 확인한 결과이며, 대조군 대비 상대적 mRNA 발현 정도를 나타낸 것이다.
표 4는 그룹 1과 그룹 2의 펩타이드 군이 CAP mRNA 발현에 미치는 영향을 실시간 PCR로 확인한 결과이며, 대조군 대비 상대적 mRNA 발현 정도를 나타낸 것이다. 표 3 및 표 4에 나타낸 결과는 실험을 3회 반복 실시하여 얻은 평균값과 표준 편차(SD)이다.
BSP 유전자 발현
서열번호 평균 SD
그룹 1 1 2.092 0.152
2 2.361 0.098
3 2.572 0.209
4 2.702 0.301
5 2.67 0.088
6 2.705 0.137
7 2.215 0.072
8 2.021 0.301
그룹 2 9 2.211 0.413
10 2.811 0.302
11 2.362 0.182
12 2.211 0.287
13 2.525 0.25
14 2.836 0.099
15 2.620 0.401
16 2.606 0.371
CAP 유전자 발현
서열번호 평균 SD
그룹 1 1 2.092 0.152
2 2.361 0.098
3 2.572 0.209
4 2.702 0.301
5 2.67 0.088
6 2.705 0.137
7 2.451 0.072
8 2.021 0.301
그룹 2 9 2.211 0.413
10 2.811 0.302
11 2.362 0.182
12 2.211 0.287
13 2.525 0.25
14 2.836 0.099
15 2.620 0.401
16 2.467 0.371
실험예 2: 펩타이드가 인간 중간엽줄기세포에서 뼈모세포 및 백악모세포 분화마커 유전자 발현에 미치는 영향
도 2는 실시예 1에서 제조한 그룹 1 및 그룹 2의 펩타이드가 인간 중간엽줄기세포에서 뼈모세포와 백악모세포 분화 마커 유전자의 발현에 미치는 영향을 나타낸 결과이다.
도 2에 나타낸 바와 같이, 펩타이드 그룹 1과 그룹 2를 인간 중간엽줄기세포에 처리하였을 때, 대조군과 비교하여 뼈모세포와 백악모세포 분화 마커 유전자인 BSP와 DMP1의 발현을 약 2배에서 4배까지 증가시키는 것을 확인하였다.
실험예 3: 펩타이드가 인간 치주인대세포에서 치주인대 분화마커 유전자 발현에 미치는 영향
페리오스틴(Periostin)은 치주인대와 뼈의 페리오스티움에서 처음 발견된 단백질로, 발생 중인 치아의 치주인대와 간엽에서 발현하며, 세포의 부착에 관여하는 것으로 알려져 있다. 최근 여러 연구에 따르면 페리오스틴은 치주조직 형성의 중요한 조절자로서, 콜라겐 섬유질 생성 및 섬유모세포와 뼈모세포의 이동을 촉진하고, 치주질환을 치료하기 위한 치주 수술 후 치주인대 및 치조골의 재생에 중추적인 역할을 수행한다고 알려져 있다. 따라서, 실시예 1의 펩타이드가 치주인대 분화 마커 유전자인 페리오스틴과 제3형 콜라겐 섬유 유전자(COL3)의 발현에 미치는 영향을 확인하였다.
도 3은 실시예 1에서 제조한 그룹 1 및 그룹 2의 펩타이드가 인간 치주인대세포에서 치주인대 마커 유전자인 제3형 콜라겐 섬유 유전자(COL3)와 페리오스틴 유전자의 발현에 미치는 영향을 나타낸 결과이다.
도 3에서 볼 수 있듯이, 인간 치주인대세포에 펩타이드 그룹 1 및 그룹 2를 처리하였을 때 제3형 콜라겐 섬유 유전자(COL 3)와 페리오스틴 유전자의 발현이 2배 이상 증가되는 것을 확인하였다.
표 5는 그룹 1과 그룹 2의 펩타이드 군이 페리오스틴 mRNA 발현에 미치는 영향을 실시간 PCR로 확인한 결과이며, 대조군 대비 상대적 mRNA 발현 정도를 나타내었다. 표 5에 나타낸 결과는 실험을 3회 반복 실시하여 얻은 평균값과 표준 편차(SD)이다.
PERIOSTIN 유전자 발현
서열번호 average SD
그룹 1 1 2.092 0.152
2 2.361 0.098
3 2.572 0.209
4 2.702 0.301
5 2.67 0.088
6 2.705 0.137
7 2.329 0.072
8 2.021 0.301
그룹 2 9 2.211 0.413
10 2.811 0.302
11 2.362 0.182
12 2.211 0.287
13 2.525 0.25
14 2.836 0.099
15 2.620 0.401
16 2.403 0.371
실험예 4: 치주조직 손상 동물 모델에서 펩타이드의 치주조직 재생 효과 검증
4 마리의 비글견 하악골에서 4번 소구치와 2번 대구치를 발치한 다음, 3개월 동안 치유되기를 기다린 후, 치유 3개월 후에 1번 큰어금니 원심면과 근심면에 3벽성 치주 결손을 유도하였다. 그런 다음, 치근 주위로 협설측 및 원심측 골이 남아있는 상태로 4X4x4 mm 크기의 치주조직 손상을 형성한 다음 치근부 치조골을 확실하게 삭제하고, 큐렛을 이용하여 치근면 활택술 시행하여 앞니 골패임을 형성하였다. 이어, 실험군은 결손 부위에 50 ㎍의 실시예 1의 펩타이드(서열번호 16)를 포함하는 콜라겐 스펀지를 이식하였고, 결손 후 아무 처리도 하지 않은 음성 대조군(Nagative Control: NC)과 콜라겐 스펀지만 골 결손 부 내부 골 벽에 위치시켜 이식한 대조군(NC+Plug)을 3개월 후에 희생하여 조직학적 평가를 시행하였다.
도 4는 치주조직 손상 부위에 실시예 1의 펩타이드(서열번호 16)를 처리하고 3개월 후 헤마톡실린/에오신으로 염색한 조직 사진으로서, 펩타이드가 치조골 재생에 미치는 영향을 확인한 결과이다.
도 4에 나타낸 바와 같이, 상기 실험군은 음성대조군과 비교하여 손상된 치주조직 대부분에서 치조골이 재생된 것이 확인되었다.
도 5는 치주조직 손상 부위에 실시예 1의 펩타이드(서열번호 16)를 처리하고 3개월 후 펩타이드가 치주인대 조직 재생에 미치는 영향을 헤마톡실린/에오신으로 염색을 통하여 확인한 결과이다.
도 5에 나타낸 바와 같이, 아무것도 처리하지 않은 음성대조군(도 5A-D) 또는 콜라겐 스펀지만 식립한 음성대조군(도 5E-H)은 치근면을 따라 신생치주인대 유사조직(NPD)이 관찰되지 않았으며, 결합조직(CT)이 형성된 것이 관찰되었다. 또한, 치조정 부위의 상아질은 흡수가 일어난 것이 관찰되었다. 그러나, 그룹 2의 펩타이드(서열번호 16)(도 5I-L)를 처리한 실험군은 치근면을 따라 신생 백악질 유사조직이 관찰되었을 뿐만 아니라, 신생 치주인대 유사조직 형성 또한 관찰되었다. 신생 치주인대는 새로 형성된 치조골과 백악질에 함입되어 있었다.
도 6는 치주조직 손상 부위에 실시예 1의 펩타이드(서열번호 16)를 처리하고 3개월 후 펩타이드가 치주인대 조직 재생에 미치는 영향을 콜라겐 염색 (Masson's trichrome stain)방법으로 확인한 결과이다.
도 6에 나타낸 바와 같이, 아무것도 처리하지 않은 음성대조군(도 6A-B) 또는 콜라겐 스펀지만 식립한 음성대조군(도 6C-D)은 치근면을 따라 대부분 결합조직(CT)이 형성된 것이 관찰되었으며, 일부에서는 신생치주인대 유사조직(NPD)이 관찰되었으나, 치주인대 섬유 다발은 불규칙하게 배열되어 있었다. 또한, 음성대조군은 치근을 따라 일부에서 신생 백악질이 형성된 것이 관찰되었다. 그러나, 그룹 2의 펩타이드(서열번호 16)(도 6E-F)를 처리한 실험군은 치근면을 따라 신생 백악질 유사조직이 관찰되었을 뿐만 아니라 신생 치주인대 유사조직 형성 또한 관찰되었다. 신생 치주인대 섬유다발은 새로 형성된 치조골과 백악질에 수직으로 함입되어 있었다.
이와 같이, 본 발명의 펩타이드는 치조골을 재생하고, 신생 백악질 유사조직 및 신생 치주인대 유사조직을 형성하는 효과가 있으며, 본 발명의 펩타이드에 의해 형성된 신생 치주인대는 새로 형성된 치조골과 백악질에 함입되어 있음을 확인하였다. 따라서, 본 발명의 펩타이드는 치주조직 재생용, 치주질환 예방 또는 치료용, 탈구성 외상 치아의 예방 또는 치료용으로 사용할 수 있음을 알 수 있었다.
본 명세서와 도면에는 본 발명의 바람직한 실시예에 대하여 개시하였으며, 비록 특정 용어들이 사용되었으나, 이는 단지 본 발명의 기술 내용을 쉽게 설명하고 발명의 이해를 돕기 위한 일반적인 의미에서 사용된 것이지, 본 발명의 범위를 한정하고자 하는 것은 아니다. 여기에 개시된 실시예 외에도 본 발명의 기술적 사상에 바탕을 둔 다른 변형예들이 실시 가능하다는 것은 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에게 자명한 것이다.

Claims (14)

  1. 하기 일반식 1의 아미노산 서열을 포함하는 펩타이드 또는 그의 약학적으로 허용가능한 염을 포함하는, 치주질환 또는 탈구성 외상 치아의 예방 또는 치료용 약학 조성물:
    K-Y-K-Q-X5-X6-X7-X8-Y-K (일반식 1)
    상기 일반식 1에서,
    X5 내지 X7는 각각 독립적으로 아르기닌 (R) 또는 리신 (K)이고;
    X8은 아스파라긴 (N) 또는 세린 (S)이다.
  2. 제1항에 있어서,
    상기 펩타이드는 서열번호 1 내지 16 중 어느 하나의 아미노산 서열로 구성되는 것인 약학 조성물.
  3. 제1항에 있어서,
    상기 약학 조성물은 상기 펩타이드가 반복되어 연결된 폴리펩타이드를 포함하는 것인 약학 조성물.
  4. 제1항에 있어서,
    상기 치주질환은 치주조직 염증성 질환인 것인 약학 조성물.
  5. 제1항에 있어서,
    상기 치주질환은 치은염 또는 치주염인 것인 약학 조성물.
  6. 제1항에 있어서,
    치주질환 치료용 약물을 더 포함하는 것인 약학 조성물.
  7. 하기 일반식 1의 아미노산 서열을 포함하는 펩타이드를 포함하는 치주조직 재생용 조성물:
    K-Y-K-Q-X5-X6-X7-X8-Y-K (일반식 1)
    상기 일반식 1에서,
    X5 내지 X7는 각각 독립적으로 아르기닌 (R) 또는 리신 (K)이고;
    X8은 아스파라긴 (N) 또는 세린 (S)이다.
  8. 제7항에 있어서,
    상기 펩타이드는 서열번호 1 내지 16 중 어느 하나의 아미노산 서열로 구성되는 것인 치주조직 재생용 조성물.
  9. 제7항에 있어서,
    치은, 치주인대, 백악질, 및 치조골 중 어느 하나 이상의 재생을 촉진하는 것인 치주조직 재생용 조성물.
  10. 제7항에 있어서,
    상기 조성물은 약학 조성물인 것인 치주조직 재생용 조성물.
  11. 제7항에 있어서,
    상기 조성물은 의약외품 조성물인 것인 치주조직 재생용 조성물.
  12. 제7항에 있어서,
    상기 조성물은 건강기능식품 조성물인 것인 치주조직 재생용 조성물.
  13. 하기 일반식 1의 아미노산 서열을 포함하는 펩타이드를 포함하는, BSP (Bone sialoprotein), DMP1 (Dentin matrix protein 1), CAP (Cementum attachment protein), COL3 (collagen type III) 및 페리오스틴 (Periostin) 중 어느 하나 이상의 유전자 발현 촉진용 조성물:
    K-Y-K-Q-X5-X6-X7-X8-Y-K (일반식 1)
    상기 일반식 1에서,
    X5 내지 X7는 각각 독립적으로 아르기닌 (R) 또는 리신 (K)이고;
    X8은 아스파라긴 (N) 또는 세린 (S)이다.
  14. 제13항에 있어서,
    상기 펩타이드는 서열번호 1 내지 16 중 어느 하나의 아미노산 서열로 구성되는 것인 조성물.
PCT/KR2021/006812 2020-06-09 2021-06-01 치주질환 또는 탈구성 외상 치아의 예방 또는 치료용 약학 조성물 WO2021251673A1 (ko)

Priority Applications (8)

Application Number Priority Date Filing Date Title
CN202180041213.7A CN115666614A (zh) 2020-06-09 2021-06-01 用于预防或治疗牙周疾病或外伤性脱位牙的药学组合物
AU2021289122A AU2021289122A1 (en) 2020-06-09 2021-06-01 Pharmaceutical composition for preventing or treating periodontal disease or luxated teeth
BR112022024634A BR112022024634A2 (pt) 2020-06-09 2021-06-01 Composição e composição farmacêutica
MX2022015506A MX2022015506A (es) 2020-06-09 2021-06-01 Composicion farmaceutica para prevenir o tratar una enfermedad periodontal o un diente dislocado de forma traumatica.
CA3185884A CA3185884A1 (en) 2020-06-09 2021-06-01 Pharmaceutical composition for preventing or treating a periodontal disease or dislocated traumatic tooth
US18/009,236 US20230257419A1 (en) 2020-06-09 2021-06-01 Pharmaceutical composition for preventing or treating a periodontal disease or dislocated traumatic tooth
EP21822081.2A EP4226932A4 (en) 2020-06-09 2021-06-01 PHARMACEUTICAL COMPOSITION FOR THE PREVENTION OR TREATMENT OF PERIODONTAL DISEASE OR LUXATED TEETH
JP2022575190A JP7562167B2 (ja) 2020-06-09 2021-06-01 歯周疾患または脱臼性外傷歯の予防もしくは治療用薬学的組成物

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0069444 2020-06-09
KR1020200069444A KR102500280B1 (ko) 2020-06-09 2020-06-09 치주질환 또는 탈구성 외상 치아의 예방 또는 치료용 약학 조성물

Publications (1)

Publication Number Publication Date
WO2021251673A1 true WO2021251673A1 (ko) 2021-12-16

Family

ID=78846290

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/006812 WO2021251673A1 (ko) 2020-06-09 2021-06-01 치주질환 또는 탈구성 외상 치아의 예방 또는 치료용 약학 조성물

Country Status (10)

Country Link
US (1) US20230257419A1 (ko)
EP (1) EP4226932A4 (ko)
JP (1) JP7562167B2 (ko)
KR (1) KR102500280B1 (ko)
CN (1) CN115666614A (ko)
AU (1) AU2021289122A1 (ko)
BR (1) BR112022024634A2 (ko)
CA (1) CA3185884A1 (ko)
MX (1) MX2022015506A (ko)
WO (1) WO2021251673A1 (ko)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240032212A (ko) * 2022-08-31 2024-03-12 주식회사 하이센스바이오 티로시나아제 활성을 촉진하는 펩타이드 및 이의 용도
KR102522134B1 (ko) * 2022-09-15 2023-04-21 주식회사 하이센스바이오 Cpne7 유래 펩타이드를 포함하는 상아질 접착용 조성물 및 치수복조용 조성물
KR102596392B1 (ko) * 2022-12-08 2023-11-01 주식회사 하이센스바이오 신규한 펩타이드

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101179476B1 (ko) 2010-01-19 2012-09-07 경북대학교 산학협력단 인간치주인대 세포의 광물화-관련 유전자 및 치주질환 예방 또는 치료용 조성물
KR20150145470A (ko) * 2014-06-19 2015-12-30 서울대학교산학협력단 Cpne7 단백질을 포함하는 비치계 중간엽 줄기세포의 상아모세포로의 분화방법, 조성물 및 이를 이용한 치수조직 재생 및 상아질 지각과민증 치료용 약학적 조성물
KR101772449B1 (ko) * 2016-12-27 2017-08-30 주식회사 하이센스바이오 신규한 펩타이드
KR101788916B1 (ko) 2015-02-27 2017-10-24 서울대학교산학협력단 법랑모세포 배양액을 포함하는 치주질환 치료용 약학 조성물
KR20190087835A (ko) * 2018-01-17 2019-07-25 서울대학교산학협력단 Cpne7의 치주인대 재생 용도

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180076996A (ko) * 2017-06-19 2018-07-06 주식회사 하이센스바이오 신규한 펩타이드

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101179476B1 (ko) 2010-01-19 2012-09-07 경북대학교 산학협력단 인간치주인대 세포의 광물화-관련 유전자 및 치주질환 예방 또는 치료용 조성물
KR20150145470A (ko) * 2014-06-19 2015-12-30 서울대학교산학협력단 Cpne7 단백질을 포함하는 비치계 중간엽 줄기세포의 상아모세포로의 분화방법, 조성물 및 이를 이용한 치수조직 재생 및 상아질 지각과민증 치료용 약학적 조성물
KR101788916B1 (ko) 2015-02-27 2017-10-24 서울대학교산학협력단 법랑모세포 배양액을 포함하는 치주질환 치료용 약학 조성물
KR101772449B1 (ko) * 2016-12-27 2017-08-30 주식회사 하이센스바이오 신규한 펩타이드
KR20190087835A (ko) * 2018-01-17 2019-07-25 서울대학교산학협력단 Cpne7의 치주인대 재생 용도

Non-Patent Citations (16)

* Cited by examiner, † Cited by third party
Title
"Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation", 1979, pages: 353 - 358
"Guide to Huge Computers", 1994, ACADEMIC PRESS
ATSCHUL, [S.] [F. ET AL.: "J MOLEC BIOL", vol. 215, 1990, pages: 403
CARILLO, SIAM J APPLIED MATH, vol. 48, 1988, pages 1073
CHOUNG HAN-WOOL, LEE DONG-SEOL, PARK YEOUNG-HYUN, LEE YOON SEON, BAI SHENGFENG, YOO SU-HYANG, LEE JONG-HO, YOU HYUNG-KEUN, PARK JO: "The effect of CPNE7 on periodontal regeneration", CONNECTIVE TISSUE RESEARCH, TAYLOR & FRANCIS, US, vol. 60, no. 5, 3 September 2019 (2019-09-03), US , pages 419 - 430, XP055878692, ISSN: 0300-8207, DOI: 10.1080/03008207.2019.1574776 *
DATABASE Protein 15 July 2006 (2006-07-15), ANONYMOUS: "Copine VII [Homo sapiens]", XP055511728, retrieved from NCBI Database accession no. AAH35334.1 *
DEVEREUX, J. ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, 1984, pages 387
GRIBSKOV ET AL., NUCL. ACIDS RES., vol. 14, 1986, pages 6745
NEEDLEMAN ET AL., J MOL BIOL., vol. 48, 1970, pages 443
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
P. STAHL ET AL.: "Handbook of Pharmaceutical Salts: Properties, Selection, and Use", 2011, WILEY-VCH
PEARSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444
RICE ET AL.: "EMBOSS: The European Molecular Biology Open Software Suite", TRENDS GENET., vol. 16, 2000, pages 276 - 277, XP004200114, DOI: 10.1016/S0168-9525(00)02024-2
S.M. BERGE ET AL.: "Pharmaceutical Salts", JOURNAL OF PHARMACEUTICAL SCIENCES, vol. 66, no. 1, January 1977 (1977-01-01), XP002675560, DOI: 10.1002/jps.2600660104
See also references of EP4226932A4
SMITHWATERMAN, ADV. APPL. MATH, vol. 2, 1981, pages 482

Also Published As

Publication number Publication date
CA3185884A1 (en) 2021-12-16
KR102500280B1 (ko) 2023-02-15
BR112022024634A2 (pt) 2022-12-27
EP4226932A4 (en) 2024-06-19
KR20210152677A (ko) 2021-12-16
CN115666614A (zh) 2023-01-31
JP7562167B2 (ja) 2024-10-07
AU2021289122A1 (en) 2023-01-19
MX2022015506A (es) 2023-01-24
JP2023530606A (ja) 2023-07-19
EP4226932A1 (en) 2023-08-16
US20230257419A1 (en) 2023-08-17

Similar Documents

Publication Publication Date Title
WO2021251673A1 (ko) 치주질환 또는 탈구성 외상 치아의 예방 또는 치료용 약학 조성물
WO2019103203A1 (ko) 신규 펩티드 및 이를 포함한 조성물
JP5670190B2 (ja) 機能障害性シナプス伝達に伴う障害の治療用ｇｉｐの使用
WO2013169077A1 (ko) 악액질 예방 또는 치료용 조성물
WO2019216568A1 (ko) 상아질 지각과민증 완화를 위한 치약 조성물
WO2015156649A1 (ko) 섬유증 억제 활성을 가지는 펩티드 및 이를 포함하는 조성물
WO2016105086A1 (ko) 안질환 치료 펩티드 및 이를 포함하는 안질환 치료용 조성물
WO2015093854A1 (ko) 전립선 암 치료용 조성물
WO2018124425A1 (ko) 신규한 펩타이드
WO2019132352A1 (ko) 신규한 펩타이드
WO2016190660A1 (ko) 신규 펩티드 및 이를 포함한 조성물
KR102077983B1 (ko) 피부 주름 개선 및 미백용 조성물
WO2013137569A1 (ko) 테트라펩타이드 및 이를 함유하는 피부노화 방지 및 항염효능의 화장료 조성물
EP1363945B1 (en) Modified derivatives of cck-8
WO2019132353A1 (ko) Cpne4 단백질을 포함하는 상아질-치수질환 또는 치주질환 예방 또는 치료용 약학적 조성물
WO2024122889A1 (ko) 신규한 펩타이드
KR102093093B1 (ko) 피부 노화 개선용 조성물
WO2016098935A1 (ko) Bmp 유래 펩타이드 및 이의 용도
WO2016098936A1 (ko) 골형성 펩타이드 및 이의 용도
WO2019216567A1 (ko) 상아질 지각과민증 완화를 위한 구강 청결용 조성물
WO2023003357A1 (ko) 수퍼옥시드 디스뮤타제 및/또는 바실러스 균주 포자를 포함하는 조성물 및 이의 구강 건강 개선용 용도
RU2811919C1 (ru) Фармацевтическая композиция для предотвращения или лечения пародонтоза или травматического вывиха зуба
US20090281032A1 (en) Modified CCK peptides
WO2023171900A1 (ko) 치아우식증 예방 또는 치료용 조성물
WO2017111388A1 (ko) 페리오스틴 유래 펩타이드를 유효성분으로 포함하는 혈관신생 촉진용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21822081

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 202217068822

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 3185884

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2022575190

Country of ref document: JP

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112022024634

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112022024634

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20221201

WWE Wipo information: entry into national phase

Ref document number: 2022132067

Country of ref document: RU

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021289122

Country of ref document: AU

Date of ref document: 20210601

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2021822081

Country of ref document: EP

Effective date: 20230109