WO2021222768A2 - Compounds and methods for modulating atxn1 - Google Patents

Compounds and methods for modulating atxn1 Download PDF

Info

Publication number
WO2021222768A2
WO2021222768A2 PCT/US2021/030203 US2021030203W WO2021222768A2 WO 2021222768 A2 WO2021222768 A2 WO 2021222768A2 US 2021030203 W US2021030203 W US 2021030203W WO 2021222768 A2 WO2021222768 A2 WO 2021222768A2
Authority
WO
WIPO (PCT)
Prior art keywords
modified oligonucleotide
modified
oligomeric compound
oligomeric
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2021/030203
Other languages
English (en)
French (fr)
Other versions
WO2021222768A3 (en
Inventor
Keming Zhou
Susan M. Freier
Tracy A. COLE
Holly Kordasiewicz
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Ionis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CA3181546A priority Critical patent/CA3181546A1/en
Priority to IL297435A priority patent/IL297435A/en
Priority to CN202180032525.1A priority patent/CN116096380B/zh
Priority to MX2022013707A priority patent/MX2022013707A/es
Priority to JP2022566328A priority patent/JP7738573B2/ja
Priority to EP21797200.9A priority patent/EP4143321A4/en
Priority to AU2021264010A priority patent/AU2021264010A1/en
Priority to KR1020227041965A priority patent/KR20230005933A/ko
Application filed by Ionis Pharmaceuticals Inc filed Critical Ionis Pharmaceuticals Inc
Priority to BR112022021333A priority patent/BR112022021333A2/pt
Publication of WO2021222768A2 publication Critical patent/WO2021222768A2/en
Publication of WO2021222768A3 publication Critical patent/WO2021222768A3/en
Priority to US17/751,450 priority patent/US11542504B2/en
Priority to US18/047,973 priority patent/US12180479B2/en
Anticipated expiration legal-status Critical
Priority to US18/947,785 priority patent/US20250297254A1/en
Priority to JP2025145172A priority patent/JP2026012176A/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/712Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/30Nerves; Brain; Eyes; Corneal cells; Cerebrospinal fluid; Neuronal stem cells; Neuronal precursor cells; Glial cells; Oligodendrocytes; Schwann cells; Astroglia; Astrocytes; Choroid plexus; Spinal cord tissue
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/02Inorganic compounds
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3521Methyl

Definitions

  • Such compounds, methods, and pharmaceutical compositions for reducing the amount or activity of ATXN1 RNA in a cell or subject, and in certain instances reducing the amount of ATXN1 protein in a cell or subject.
  • Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a neurodegenerative disease.
  • symptoms and hallmarks include gait and limb ataxia, cognitive impairments, difficulty with speaking and swallowing, atrophy of the cerebellum and brainstem in magnetic resonance imaging (MRI), neurochemical abnormalities in the cerebellum and brainstem detected via magnetic resonance spectroscopy (MRS), and death within 10-15 years of symptom onset.
  • Such neurodegenerative diseases include Spinocerebellar ataxia type 1.
  • SCA1 Spinocerebellar ataxia type 1
  • Symptoms and hallmarks of SCA1 include gait and limb ataxia, cognitive impairments, difficulty with speaking and swallowing, atrophy of the cerebellum and brainstem in magnetic resonance imaging (MRI), neurochemical abnormalities in the cerebellum and brainstem detected via magnetic resonance spectroscopy (MRS), and death within 10-15 years of symptom onset (see, e.g., Ju, H., Kokubu, H., and Lim, I, Mol. Neurobiol. 50:866-874, 2014; Ortiz, J. P., Orr, H. T., in Polyglutamine Disorders, Nobrega, C. and Almeida, L., eds., Advances in Exp. Med. And Biol., 1049: 135- 145, 2018).
  • MRI magnetic resonance imaging
  • MRS magnetic resonance spectroscopy
  • compounds, methods and pharmaceutical compositions for reducing the amount or activity of ATXN1 RNA, and in certain embodiments reducing the expression of ATXN1 protein in a cell or subject In certain embodiments, the subject has a neurodegenerative disease. In certain embodiments, the subject has Spinocerebellar ataxia type 1 (SCA1). In certain embodiments, compounds useful for reducing the amount or activity of ATXN1 RNA are oligomeric compounds. In certain embodiments, compounds useful for reducing the amount or activity of ATXN1 RNA are modified oligonucleotides. In certain embodiments, compounds useful for decreasing expression of ATXN1 protein are oligomeric compounds. In certain embodiments, compounds useful for decreasing expression of ATXN1 protein are modified oligonucleotides.
  • the neurodegenerative disease is Spinocerebellar ataxia type 1.
  • the symptom or hallmark includes gait and limb ataxia, cognitive impairments, difficulty with speaking and swallowing, atrophy of the cerebellum and brainstem in magnetic resonance imaging (MRI), neurochemical abnormalities in the cerebellum and brainstem detected via magnetic resonance spectroscopy (MRS), and death within 10-15 years of symptom onset.
  • MRI magnetic resonance imaging
  • MRS magnetic resonance spectroscopy
  • 2’-deoxynucleoside means a nucleoside comprising a 2’-H(H) deoxyfuranosyl sugar moiety.
  • a 2’-deoxynucleoside is a 2 -b-D-dcoxy nucleoside and comprises a 2 -(i-D-dcoxyribosyl sugar moiety, which has the b-D ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA).
  • a 2’-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
  • 2’-MOE means a 2’-OCH 2 CH 2 OCH 3 group in place of the 2’ -OH group of a furanosyl sugar moiety.
  • a “2’-MOE sugar moiety” means a sugar moiety with a 2’-OCH 2 CH 2 OCH 3 group in place of the 2’-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-MOE sugar moiety is in the b-D-ribosyl configuration. “MOE” means O-methoxyethyl.
  • 2’ -MOE nucleoside means a nucleoside comprising a 2’ -MOE sugar moiety.
  • 2’-OMe means a 2’-OCH group in place of the 2’-OH group of a furanosyl sugar moiety.
  • A“2’-0-methyl sugar moiety” or “2’-OMe sugar moiety” means a sugar moiety with a 2’-OCH group in place of the 2’- OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-OMe sugar moiety is in the b-D-ribosyl configuration.
  • 2’-OMe nucleoside means a nucleoside comprising a 2’-OMe sugar moiety.
  • 2’ -substituted nucleoside means a nucleoside comprising a 2’ -substituted sugar moiety.
  • 2’-substituted in reference to a sugar moiety means a sugar moiety comprising at least one 2'-substituent group other than H or OH.
  • 5-methyl cytosine means a cytosine modified with a methyl group attached to the 5 position.
  • a 5-methyl cytosine is a modified nucleobase.
  • administering means providing a pharmaceutical agent to a subject.
  • antisense activity means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.
  • antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
  • antisense compound means an oligomeric compound capable of achieving at least one antisense activity.
  • “ameliorate” in reference to a treatment means improvement in at least one symptom relative to the same symptom in the absence of the treatment.
  • amelioration is the reduction in the severity or frequency of a symptom or the delayed onset or slowing of progression in the severity or frequency of a symptom.
  • the symptom or hallmark is gait and limb ataxia, cognitive impairments, difficulty with speaking and swallowing, atrophy of the cerebellum and brainstem in magnetic resonance imaging (MRI), neurochemical abnormalities in the cerebellum and brainstem detected via magnetic resonance spectroscopy (MRS), and death within 10-15 years of symptom onset.
  • MRI magnetic resonance imaging
  • MRS magnetic resonance spectroscopy
  • bicyclic nucleoside or “BNA” means a nucleoside comprising a bicyclic sugar moiety.
  • bicyclic sugar or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms of the first ring thereby forming a bicyclic structure.
  • the first ring of the bicyclic sugar moiety is a furanosyl moiety.
  • the furanosyl sugar moiety is a ribosyl moiety.
  • the bicyclic sugar moiety does not comprise a furanosyl moiety.
  • cleavable moiety means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.
  • complementary in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more portions thereof and the nucleobases of another nucleic acid or one or more portions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions.
  • complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another.
  • Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl cytosine (mC) and guanine (G).
  • Complementary oligonucleotides and/or target nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated.
  • oligonucleotide or a portion thereof, is complementary to another oligonucleotide or target nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.
  • conjugate group means a group of atoms that is directly or indirectly attached to an oligonucleotide.
  • Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
  • conjugate linker means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
  • conjugate moiety means a group of atoms that is attached to an oligonucleotide via a conjugate linker.
  • oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or intemucleoside linkages that are immediately adjacent to each other.
  • contiguous nucleobases means nucleobases that are immediately adjacent to each other in a sequence.
  • cEt means a 4’ to 2’ bridge in place of the 2’OH-group of a ribosyl sugar moiety, wherein the bridge has the formula of 4'-CH(CH )-0-2', and wherein the methyl group of the bridge is in the S configuration.
  • a “cEt sugar moiety” is a bicyclic sugar moiety with a 4’ to 2’ bridge in place of the 2’OH-group of a ribosyl sugar moiety, wherein the bridge has the formula of 4'-CH(CH )-0-2', and wherein the methyl group of the bridge is in the S configuration.
  • cEt means constrained ethyl.
  • cEt nucleoside means a nucleoside comprising a cEt sugar moiety.
  • chirally enriched population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers.
  • the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.
  • chirally controlled in reference to an intemucleoside linkage means chirality at that linkage is enriched for a particular stereochemical configuration.
  • deoxy region means a region of 5-12 contiguous nucleotides, wherein at least 70% of the nucleosides are 2 -b-D-dcoxy nucleosides.
  • each nucleoside is selected from a 2 -(i-D- deoxynucleoside, a bicyclic nucleoside, and a 2’-susbstituted nucleoside.
  • a deoxy region supports RNase H activity.
  • a deoxy region is the gap or internal region of a gapmer.
  • gapmer means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
  • the internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.”
  • the internal region is a deoxy region.
  • the positions of the internal region or gap refer to the order of the nucleosides of the internal region and are counted starting from the 5’-end of the internal region.
  • each nucleoside of the gap is a 2 -(i-D- deoxynucleoside.
  • the gap comprises one 2’ -substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides of the gap are 2 ‘ -[l-D-dco.xy nucleosides.
  • MOE gapmer indicates a gapmer having a gap comprising 2 ‘ -[l-D-dco.xy nucleosides and wings comprising 2’-MOE nucleosides.
  • the term “mixed wing gapmer” indicates a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may comprise one or more modified intemucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.
  • hotspot region is a range of nucleobases on a target nucleic acid that is amenable to oligomeric compound-mediated reduction of the amount or activity of the target nucleic acid.
  • hybridization means the pairing or annealing of complementary oligonucleotides and or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
  • intemucleoside linkage means the covalent linkage between contiguous nucleosides in an oligonucleotide.
  • modified intemucleoside linkage means any intemucleoside linkage other than a phosphodiester intemucleoside linkage.
  • Phosphorothioate intemucleoside linkage is a modified intemucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester intemucleoside linkage is replaced with a sulfur atom.
  • linker-nucleoside means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.
  • non-bicyclic modified sugar moiety means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
  • mismatch or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotide are aligned.
  • motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages, in an oligonucleotide.
  • nucleobase means an unmodified nucleobase or a modified nucleobase.
  • an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G).
  • a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase.
  • a “5-methyl cytosine” is a modified nucleobase.
  • a universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
  • nucleobase sequence means the order of contiguous nucleobases in a target nucleic acid or oligonucleotide independent of any sugar or intemucleoside linkage modification.
  • nucleoside means a compound or a fragment of a compound comprising a nucleobase and a sugar moiety.
  • the nucleobase and sugar moiety are each, independently, unmodified or modified.
  • modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety.
  • Modified nucleosides include abasic nucleosides, which lack a nucleobase.
  • Linked nucleosides are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).
  • oligomeric compound means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
  • An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired.
  • a “singled-stranded oligomeric compound” is an unpaired oligomeric compound.
  • oligomeric duplex means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.”
  • oligonucleotide means a strand of linked nucleosides connected via intemucleoside linkages, wherein each nucleoside and intemucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides.
  • modified oligonucleotide means an oligonucleotide, wherein at least one nucleoside or intemucleoside linkage is modified.
  • unmodified oligonucleotide means an oligonucleotide that does not comprise any nucleoside modifications or intemucleoside modifications.
  • pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to a subject. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, symps, slurries, suspension and lozenges for the oral ingestion by a subject.
  • a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.
  • pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
  • a pharmaceutical composition means a mixture of substances suitable for administering to a subject.
  • a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution.
  • a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
  • prodrug means a therapeutic agent in a form outside the body that is converted to a different form within a subject or cells thereof.
  • conversion of a prodmg within the subject is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.
  • reducing the amount or activity refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of transcriptional expression or activity.
  • RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
  • RNAi compound means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
  • RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.
  • an RNAi compound modulates the amount, activity, and/or splicing of a target nucleic acid.
  • RNAi compound excludes antisense compounds that act through RNase H.
  • oligonucleotide that at least partially hybridizes to itself.
  • standard in vitro assay or “standard cell assay” means the assay described in Example 1 and reasonable variations thereof.
  • standard in vivo assay means the assay described in Example 6 and reasonable variations thereof.
  • stereorandom chiral centra in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration.
  • the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center.
  • the stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration.
  • a stereorandom chiral center is a stereorandom phosphorothioate intemucleoside linkage.
  • subject means a human or non-human animal.
  • sugar moiety means an unmodified sugar moiety or a modified sugar moiety.
  • unmodified sugar moiety means a 2’-OH(H) b-D-ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2’-H(H) b-D-deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”).
  • Unmodified sugar moieties have one hydrogen at each of the G, 3’, and 4’ positions, an oxygen at the 3’ position, and two hydrogens at the 5’ position.
  • modified sugar moiety or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
  • sugar surrogate means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group in an oligonucleotide.
  • Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.
  • symptom or hallmark means any physical feature or test result that indicates the existence or extent of a disease or disorder.
  • a symptom is apparent to a subject or to a medical professional examining or testing said subject.
  • a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests.
  • a hallmark is apparent on a brain MRI scan.
  • target nucleic acid and “target RNA” mean a nucleic acid that an antisense compound is designed to affect.
  • target region means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
  • terminal group means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
  • terapéuticaally effective amount means an amount of a pharmaceutical agent that provides a therapeutic benefit to a subject.
  • a therapeutically effective amount improves a symptom or hallmark of a disease.
  • Embodiment 1 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of an ATXN1 nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage.
  • Embodiment 2 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 22-3624 or 3655.
  • Embodiment 3 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, or 17 contiguous nucleobases of any of SEQ ID NOs: 3625-3654 or 3656-3669.
  • Embodiment 4 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to: an equal length portion of nucleobases 5472-5552 of SEQ ID NO: 1; an equal length portion of nucleobases 5906-6005 of SEQ ID NO: 1; an equal length portion of nucleobases 7868-7911 of SEQ ID NO: 1; an equal length portion of nucleobases 8481-8514 of SEQ ID NO: 1; or an equal length portion of nucleobases 446679-446706 of SEQ ID NO: 2.
  • Embodiment 5 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 contiguous nucleobases of a sequence selected from:
  • Embodiment 6 The oligomeric compound of any of embodiments 1-5, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 90%, 95%, or 100% complementary to the nucleobase sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6 when measured across the entire nucleobase sequence of the modified oligonucleotide.
  • Embodiment 7 The oligomeric compound of any of embodiments 1-6, wherein the modified oligonucleotide comprises at least one modified nucleoside.
  • Embodiment 8 The oligomeric compound of embodiment 7, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.
  • Embodiment 9 The oligomeric compound of embodiment 8, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.
  • Embodiment 10 The oligomeric compound of embodiment 9, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety having a 2’ -4’ bridge, wherein the 2’ -4’ bridge is selected from -0-CH 2 -; and -0-CH(CH )-.
  • Embodiment 11 The oligomeric compound of any of embodiments 7-10, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety.
  • Embodiment 12 The oligomeric compound of embodiment 11, wherein the non-bicyclic modified sugar moiety is a 2’-MOE sugar moiety or 2’-OMe modified sugar moiety.
  • Embodiment 13 The oligomeric compound of any of embodiments 7-8, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.
  • Embodiment 14 The oligomeric compound of embodiment 13, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate selected from morpholino and PNA.
  • Embodiment 15 The oligomeric compound of any of embodiments 1-8 or 11-14, wherein the modified oligonucleotide does not comprise a bicyclic sugar moiety.
  • Embodiment 16 The oligomeric compound of any of embodiments 1-15, wherein the modified oligonucleotide is a gapmer.
  • Embodiment 17 The oligomeric compound of any of embodiments 1-16, wherein the modified oligonucleotide has a sugar motif comprising: a 5’ -region consisting of 1-6 linked 5’ -region nucleosides; a central region consisting of 6-10 linked central region nucleosides; and a 3’ -region consisting of 1-6 linked 3’ -region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2’-deoxyfuranosyl sugar moiety.
  • Embodiment 18 The oligomeric compound of embodiment 17, wherein the modified oligonucleotide has a sugar motif comprising: a 5’ -region consisting of 6 linked 5’ -region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3’ -region consisting of 4 linked 3’ -region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides is a 2’-MOE nucleoside, and each of the central region nucleosides is a 2 -(i-D-dcoxy nucleoside.
  • Embodiment 19 Embodiment 19.
  • Embodiment 20 The oligomeric compound of embodiment 17, wherein the modified oligonucleotide has a 5’ -region consisting of 5 linked 5’ -region nucleosides; a central region consisting of 8 linked central region nucleosides; and a 3’ -region consisting of 4 linked 3’ -region nucleosides; wherein each of the 5’ -region nucleosides and each of the 3’ -region nucleosides comprises a is a 2’-MOE nucleoside, and each of the central region nucleosides is a 2 -b-D-dcoxy nucleoside.
  • Embodiment 21 The oligomeric compound of embodiment 17, wherein the modified oligonucleotide has a 5’ -region consisting of 5 linked 5’ -region nucleosides; a central region consisting of 8 linked central region nucleosides; and a 3’ -region consisting of 4 linked 3’ -region nucleosides; wherein each of the 5’ -region nucleosides comprises a 2’-MOE sugar moiety, each of the 3’ -region nucleosides is selected from a 2’-MOE nucleoside and a cEt nucleoside, and each of the central region nucleosides comprises a 2 -b-D-dcoxy nucleoside.
  • Embodiment 22 The oligomeric compound of any of embodiments 1-16, wherein the modified oligonucleotide has a sugar motif comprising: a 5’ -region consisting of 1-6 linked 5’ -region nucleosides; a central region consisting of 6-10 linked central region nucleosides; and a 3’ -region consisting of 1-6 linked 3’ -region nucleosides; wherein each of the 5’ -region nucleosides and each of the 3’ -region nucleosides comprises a modified sugar moiety, and the central region has the following formula:
  • Nx is a 2’-OMe nucleoside and each Nd is a 2’ ⁇ -D-deoxynucleoside; and n is from 6 to 8.
  • Embodiment 23 The oligomeric compound of any of embodiments 1-16, wherein the modified oligonucleotide has a sugar motif comprising: a 5’ -region consisting of 5 linked 5’ -region nucleosides; a central region consisting of 6-10 linked central region nucleosides; and a 3’ -region consisting of 4 linked 3’ -region nucleosides; wherein each of the 5’ -region nucleosides and each of the 3’ -region nucleosides is selected from a 2’-MOE nucleoside and a cEt nucleoside, and the central region has the following formula: (Nd)(Nx)(Nd)n wherein Nx is a 2’-OMe nucleoside and each Nd is a 2 ‘ -[1-D-dcoxy nucleoside: and n is 7.
  • Embodiment 24 The oligomeric compound of any of embodiments 1-23, wherein the modified oligonucleotide comprises at least one modified intemucleoside linkage.
  • Embodiment 25 The oligomeric compound of embodiment 24, wherein each intemucleoside linkage of the modified oligonucleotide is a modified intemucleoside linkage.
  • Embodiment 26 The oligomeric compound of embodiment 24 or 25 wherein the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Embodiment 27 The oligomeric compound of embodiment 24 or 26 wherein the modified oligonucleotide comprises at least one phosphodiester intemucleoside linkage.
  • Embodiment 28 The oligomeric compound of any of embodiments 24, 26, or 27, wherein each intemucleoside linkage is independently selected from a phosphodiester intemucleoside linkage or a phosphorothioate intemucleoside linkage.
  • Embodiment 30 The oligomeric compound of any of embodiments 1-29, wherein the modified oligonucleotide comprises a modified nucleobase.
  • Embodiment 31 The oligomeric compound of embodiment 30, wherein the modified nucleobase is a 5-methyl cytosine.
  • Embodiment 32 The oligomeric compound of any of embodiments 1-31, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20, 14-18, 16-18, 14-20, 15-17, 15-25, 16-20, or 17-20 linked nucleosides.
  • Embodiment 33 The oligomeric compound of any of embodiments 1-2, 4-19, 22 or 24-31, wherein the modified oligonucleotide consists of 18-22 or 18-20 linked nucleosides.
  • Embodiment 34 The oligomeric compound of any of embodiments 1-17 or 20-32, wherein the modified oligonucleotide consists of 17 linked nucleosides.
  • Embodiment 35 The oligomeric compound of any of embodiments 1-2, 4-19, 22 or 24-31, wherein the modified oligonucleotide consists of 20 linked nucleosides.
  • Embodiment 36 The oligomeric compound of any of embodiments 1-35, consisting of the modified oligonucleotide.
  • Embodiment 37 The oligomeric compound of any of embodiments 1-35, comprising a conjugate group comprising a conjugate moiety and a conjugate linker.
  • Embodiment 38 The oligomeric compound of embodiment 37, wherein the conjugate linker consists of a single bond.
  • Embodiment 39 The oligomeric compound of embodiment 37, wherein the conjugate linker is cleavable.
  • Embodiment 40 The oligomeric compound of embodiment 37, wherein the conjugate linker comprises 1-3 linker- nucleosides.
  • Embodiment 41 The oligomeric compound of any of embodiments 37-40, wherein the conjugate group is attached to the modified oligonucleotide at the 5’ -end of the modified oligonucleotide.
  • Embodiment 42 The oligomeric compound of any of embodiments 37-40, wherein the conjugate group is attached to the modified oligonucleotide at the 3’ -end of the modified oligonucleotide.
  • Embodiment 43 The oligomeric compound of any of embodiments 1-35 or 37-42, comprising a terminal group.
  • Embodiment 44 The oligomeric compound of any of embodiments 1-43 wherein the oligomeric compound is a singled-stranded oligomeric compound.
  • Embodiment 45 The oligomeric compound of any of embodiments 1-39 or 41-42, wherein the oligomeric compound does not comprise linker-nucleosides.
  • Embodiment 46 An oligomeric duplex comprising an oligomeric compound of any of embodiments 1-43 or 45.
  • Embodiment 47 An antisense compound comprising or consisting of an oligomeric compound of any of embodiments 1-45 or an oligomeric duplex of embodiment 46.
  • Embodiment 48 A pharmaceutical composition comprising an oligomeric compound of any of embodiments 1-45 or an oligomeric duplex of embodiment 46 and a pharmaceutically acceptable carrier or diluent.
  • Embodiment 49 The pharmaceutical composition of embodiment 48, wherein the pharmaceutically acceptable diluent is artificial cerebral spinal fluid.
  • Embodiment 50 The pharmaceutical composition of embodiment 49, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebral spinal fluid.
  • Embodiment 51 A method comprising administering to a subject a pharmaceutical composition of any of embodiments 48-50.
  • Embodiment 52 A method of treating a disease associated with ATXN1 comprising administering to an individual having or at risk for developing a disease associated with ATXN1 a therapeutically effective amount of a pharmaceutical composition according to any of embodiments 48-50; and thereby treating the disease associated with ATXN 1.
  • Embodiment 53 The method of embodiment 52, wherein the ATXN 1 -associated disease is Spinocerebellar ataxia type 1.
  • Embodiment 54 The method of any of embodiments 51-52, wherein at least one symptom or hallmark of the ATXN1 -associated disease is ameliorated.
  • Embodiment 55 The method of embodiment 54, wherein the symptom or hallmark is gait or limb ataxia, cognitive impairments, difficulty with speaking or swallowing, atrophy of the cerebellum and/or brainstem in magnetic resonance imaging (MRI), neurochemical abnormalities in the cerebellum and/or brainstem detected via magnetic resonance spectroscopy (MRS), or death within 10-15 years of symptom onset.
  • MRI magnetic resonance imaging
  • MRS magnetic resonance spectroscopy
  • Embodiment 56 The method of any of embodiments 51-53, wherein ATXN 1 levels in the individual are reduced.
  • Embodiment 57 A modified oligonucleotide according to the following chemical structure: salt thereof.
  • Embodiment 58 A modified oligonucleotide according to the following chemical structure: salt thereof.
  • Embodiment 59 A modified oligonucleotide according to the following chemical structure: salt thereof.
  • Embodiment 60 A modified oligonucleotide according to the following chemical structure: salt thereof.
  • Embodiment 61 A modified oligonucleotide according to the following chemical structure: salt thereof.
  • Embodiment 63 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 64 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 66 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 67 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 68 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 69 The modified oligonucleotide of embodiment 57-62, which is a sodium salt or a potassium salt.
  • Embodiment 70 A compound comprising a modified oligonucleotide according to the following chemical notation:
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2’-MOE sugar moiety
  • d a 2’- -D deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • Embodiment 71 A compound comprising a modified oligonucleotide according to the following chemical notation:
  • A an adenine nucleobase
  • m C a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2’-MOE sugar moiety
  • d a 2’- -D deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • Embodiment 72 A compound comprising a modified oligonucleotide according to the following chemical notation: Ges m Ceo m Ceo Teo Tes Tds Ads Tds Ads Ads m Cds Tds Tds Tds Tds m Ceo Teo Tes Tes m Ce (SEQ ID NO: 2552), wherein,
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2’-MOE sugar moiety
  • d a 2’- -D deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • Embodiment 73 A compound comprising a modified oligonucleotide according to the following chemical notation: Tes Teo m Ceo Aeo Ges Tds Tds Tds Ads Gds Tds Tds Gds m Cds Ads Geo m Ceo m Ces Aes Te (SEQ ID NO: 3190), wherein,
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2’-MOE sugar moiety
  • d a 2’- -D deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • Embodiment 74 A compound comprising a modified oligonucleotide according to the following chemical notation: mCes m Ceo m Ceo Geo Tes Ads Tds Tds m Cds m Cds Tds m Cds Tds Tds Ads m Ceo m Ceo Aes Tes m Ce (SEQ ID NO: 3590), wherein,
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2’-MOE sugar moiety
  • d a 2’- -D deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2’-MOE sugar moiety
  • d a 2’- -D deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • Embodiment 76 The compound of any of embodiments 73-78, comprising the modified oligonucleotide covalently linked to a conjugate group.
  • Embodiment 77 A chirally enriched population of modified oligonucleotides of any of embodiments 57-68, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having a particular stereochemical configuration.
  • Embodiment 78 The chirally enriched population of embodiment 77, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having the (Sp) or (Rp) configuration.
  • Embodiment 79 The chirally enriched population of embodiment 77, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate intemucleoside linkage.
  • Embodiment 80 The chirally enriched population of embodiment 77, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate intemucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate intemucleoside linkages.
  • Embodiment 81 The chirally enriched population of embodiment 77 wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate intemucleoside linkages in the Sp, Sp, and Rp configurations, in the 5’ to 3’ direction.
  • Embodiment 82 A population of modified oligonucleotides of any of embodiments 57-68, wherein all of the phosphorothioate intemucleoside linkages of the modified oligonucleotide are stereorandom.
  • Embodiment 83 A pharmaceutical composition comprising the population of modified oligonucleotides of any of embodiments 77-82 and a pharmaceutically acceptable diluent or carrier.
  • Embodiment 84 A pharmaceutical composition of any of embodiments 62-75, and a pharmaceutically acceptable diluent or carrier.
  • Embodiment 85 The pharmaceutical composition of embodiment 84, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid or phosphate-buffered saline.
  • Embodiment 86 The pharmaceutical composition of embodiment 85, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebrospinal fluid or phosphate-buffered saline.
  • Embodiment 87 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of an ATXN1 nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage.
  • Embodiment 88 The oligomeric compound of embodiment 87, wherein the ATXN1 nucleic acid has the nucleobase sequence of any of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6.
  • Embodiment 89 The oligomeric compound of embodiment 87 or embodiment 88, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases: an equal length portion of nucleobases 5472-5552 of SEQ ID NO: 1; an equal length portion of nucleobases 5906-6005 of SEQ ID NO: 1; an equal length portion of nucleobases 7868-7911 of SEQ ID NO: 1; an equal length portion of nucleobases 8481-8514 of SEQ ID NO: 1; or an equal length portion of nucleobases 446679-446706 of SEQ ID NO: 2.
  • Embodiment 90 The oligomeric compound of any of embodiments 87-89, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases: an equal length portion of nucleobases 5489-5508 of SEQ ID NO: 1; an equal length portion of nucleobases 5491-5507 of SEQ ID NO: 1; an equal length portion of nucleobases 5912-5931 of SEQ ID NO: 1; an equal length portion of nucleobases 7892-7911 of SEQ ID NO: 1; an equal length portion of nucleobases 8481-8500 of SEQ ID NO: 1; or an equal length portion of nucleobases 446680-446699 of SEQ ID NO: 2.
  • Embodiment 91 The oligomeric compound of any of embodiments 87-90, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the ATXN1 nucleic acid.
  • Embodiment 92 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 12, 13, 14,
  • Embodiment 93 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 12, 13, 14,
  • Embodiment 94 The oligomeric compound of embodiment 92 or 93, wherein the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NO: 22-3669.
  • Embodiment 95 The oligomeric compound of embodiment 94, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any of SEQ ID NO: 22-3669.
  • Embodiment 96 The oligomeric compound of any of embodiments 92-95, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 contiguous nucleobases of a sequence selected from:
  • Embodiment 97 The oligomeric compound of any of embodiments 92-95, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, or 17 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NO: 3638.
  • Embodiment 98 The oligomeric compound of any of embodiments 92-95, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NO: 126, 1045, 2552, 3190, or 3590.
  • Embodiment 99 The oligomeric compound of embodiment 97 or 98, wherein the modified oligonucleotide consists of 17 to 30 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence of any of 126, 1045, 2552, 3190, 3590, or 3638.
  • Embodiment 100 The oligomeric compound of embodiment 99, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any one of 126, 1045, 2552, 3190, 3590, or 3638.
  • Embodiment 101 The oligomeric compound of any of embodiments 92-100, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the ATXN1 nucleic acid, wherein the ATXN1 nucleic acid has the nucleobase sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6.
  • Embodiment 102 The oligomeric compound of any of embodiments 87-101, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar moiety.
  • Embodiment 103 The oligomeric compound of embodiment 102, wherein the modified sugar moiety comprises a bicyclic sugar moiety.
  • Embodiment 104 The oligomeric compound of embodiment 103, wherein the bicyclic sugar moiety comprises a 2’- 4’ bridge selected from -0-CH 2 -; and -0-CH(CH 3 )-.
  • Embodiment 105 The oligomeric compound of any of embodiments 102-104, wherein the modified nucleoside comprises a non-bicyclic modified sugar moiety.
  • Embodiment 106 The oligomeric compound of embodiment 105, wherein the non-bicyclic modified sugar moiety is a 2’-MOE sugar moiety or 2’-OMe modified sugar moiety.
  • Embodiment 107 The oligomeric compound of any of embodiments 102-106, wherein at least one nucleoside of the modified oligonucleotide comprises a sugar surrogate.
  • Embodiment 108 The oligomeric compound of embodiment 107, wherein the sugar surrogate is selected from morpholino and PNA.
  • Embodiment 109 The oligomeric compound of any of embodiments 87-102 or 105-108, wherein the modified oligonucleotide does not comprise abicyclic sugar moiety.
  • Embodiment 110 The oligomeric compound of any of embodiments 87-109, wherein the modified oligonucleotide comprises at least one modified intemucleoside linkage.
  • Embodiment 111 The oligomeric compound of embodiment 110, wherein at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Embodiment 112 The oligomeric compound of embodiment 110 or 111, wherein each intemucleoside linkage is a modified intemucleoside linkage.
  • Embodiment 113 The oligomeric compound of embodiment 112, wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Embodiment 114 The oligomeric compound of any of embodiments 110-111, wherein at least one intemucleoside linkage of the modified oligonucleotide is a phosphodiester intemucleoside linkage.
  • Embodiment 115 The oligomeric compound of any of embodiments 87-109, wherein each intemucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester or a phosphorothioate intemucleoside linkage.
  • Embodiment 116 The oligomeric compound of any of embodiments 87-115, wherein at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 intemucleoside linkages of the modified oligonucleotide are phosphorothioate intemucleoside linkages.
  • Embodiment 118 The oligomeric compound of any of embodiments 87-117, wherein the modified oligonucleotide comprises a modified nucleobase.
  • Embodiment 119 The oligomeric compound of embodiment 118, wherein the modified nucleobase is a 5-methyl cytosine.
  • Embodiment 120 The oligomeric compound of any of embodiments 1-33, wherein the modified oligonucleotide comprises a deoxy region consisting of 5-12 contiguous 2’-deoxynucleosides.
  • Embodiment 121 The oligomeric compound of embodiment 120, wherein each nucleoside of the deoxy region is a 2 ’ -b-D -deoxy nucleoside .
  • Embodiment 122 The oligomeric compound of embodiment 120 or 121 wherein the deoxy region consists of 6, 7,
  • Embodiment 123 The oligomeric compound of any of embodiments 120-122, wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety.
  • Embodiment 124 The oligomeric compound of any of embodiments 120-122, wherein the deoxy region is flanked on the 5’-side by a 5’-region consisting of 1-6 linked 5’-region nucleosides and on the 3’-side by a 3’extemal region consisting of 1-6 linked 3’ -region nucleosides; wherein the 3’-most nucleoside of the 5’-region comprises a modified sugar moiety; and the 5’-most nucleoside of the 3’-region comprises a modified sugar moiety.
  • Embodiment 125 The oligomeric compound of embodiment 124, wherein each nucleoside of the 3’-region comprises a modified sugar moiety.
  • Embodiment 126 The oligomeric compound of embodiment 124 or 125, wherein each nucleoside of the 5’-region comprises a modified sugar moiety.
  • Embodiment 127 The oligomeric compound of embodiment 120-126, wherein the modified oligonucleotide has a 5’-region consisting of 1-6 linked nucleosides; a deoxy region consisting of 6-10 linked nucleosides; and a 3’-region consisting of 1-6 linked nucleosides; wherein each of the 5’ -region nucleosides and each of the 3’ -region nucleosides comprises a modified sugar moiety.
  • Embodiment 128 The oligomeric compound of embodiment 127, wherein the modified oligonucleotide has a 5’ -region consisting of 6 linked nucleosides; a deoxy region consisting of 10 linked nucleosides; and a 3’-region consisting of 4 linked nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides is a 2’-MOE nucleoside, and each of the deoxy region nucleosides is a 2 ‘ -[l-D-dcoxy nucleoside.
  • Embodiment 129 The oligomeric compound of embodiment 127, wherein the modified oligonucleotide has a 5’ -region consisting of 5 linked nucleosides; a central region consisting of 10 linked nucleosides; and a 3’-region consisting of 5 linked nucleosides; wherein each of the 5’ -region nucleosides and each of the 3’ -region nucleosides is a 2’-MOE nucleoside, and each of the deoxy region nucleosides is a 2 ‘ -[l-D-dcoxy nucleoside.
  • Embodiment 130 The oligomeric compound of embodiment 127, wherein the modified oligonucleotide has a 5’ -region consisting of 5 linked nucleosides; a deoxy region consisting of 8 linked nucleosides; and a 3’-region consisting of 4 linked nucleosides; wherein each of the 5’ -region nucleosides and each of the 3’ -region nucleosides is a 2’-MOE nucleoside, and each of the deoxy region nucleosides is a 2 ‘ -[l-D-dcoxy nucleoside.
  • Embodiment 131 The oligomeric compound of embodiment 127, wherein the modified oligonucleotide has a 5’ -region consisting of 5 linked nucleosides; a deoxy region consisting of 8 linked nucleosides; and a 3’-region consisting of 4 linked nucleosides; wherein each of the 5’-region nucleosides is a 2’-MOE nucleoside, each of the 3’-region nucleosides is selected from a 2’-MOE nucleoside and a cEt nucleoside, and each of the deoxy region nucleosides is a 2 ‘ -b-D- deoxy nucleoside.
  • Embodiment 132 The oligomeric compound of any of embodiments 87-119, wherein the modified oligonucleotide has a 5’ region consisting of 3-7 linked nucleosides; a deoxy region consisting of 6-8 linked nucleosides; and a 3’ region consisting of 3-6 linked nucleosides; wherein each of the 3’ region nucleosides is selected from a 2’-MOE nucleoside and a cEt nucleoside, and the 5’ region has the following formula:
  • Nk Nkn(Nd)(Nx) wherein each Nk is a bicyclic nucleoside, Nx is a 2’-OMe nucleoside and Nd is a 2 ' -(i-D- deoxynucleoside; and n is from 1-5.
  • Embodiment 133 The oligomeric compound of any of embodiments 87-119, wherein the modified oligonucleotide has a 5’ region consisting of 7 linked nucleosides; a deoxy region consisting of 6 linked nucleosides; and a 3 ’ region consisting of 4 linked nucleosides; wherein each of the 3’ region nucleosides is selected from a 2’-MOE nucleoside and a cEt nucleoside, and the 5’ region has the following formula:
  • Nk Nkn(Nd)(Nx) wherein each Nk is a bicyclic nucleoside, Nx is a 2’-OMe nucleoside and Nd is a 2 ' -(i-D- deoxynucleoside; and n is from 5.
  • Embodiment 134 The oligomeric compound of any of embodiments 87-133, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20, 14-18, 16-18, 14-20, 15-17, 15-25, 16-20, or 17-20 linked nucleosides.
  • Embodiment 135. The oligomeric compound of any of embodiments 87-132, wherein the modified oligonucleotide consists of 18-22 or 18-20 linked nucleosides.
  • Embodiment 136 The oligomeric compound of any of embodiments 87-133, wherein the modified oligonucleotide consists of 17 linked nucleosides.
  • Embodiment 137 The oligomeric compound of any of embodiments 87-132, wherein the modified oligonucleotide consists of 20 linked nucleosides.
  • Embodiment 138 A compound comprising a modified oligonucleotide according to the following chemical notation:
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2’-MOE sugar moiety
  • d a 2’- -D deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • Embodiment 139 A compound comprising a modified oligonucleotide according to the following chemical notation:
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2’-MOE sugar moiety
  • d a 2’- -D deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • Embodiment 140 A compound comprising a modified oligonucleotide according to the following chemical notation:
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2’-MOE sugar moiety
  • d a 2’- -D deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • Embodiment 141 A compound comprising a modified oligonucleotide according to the following chemical notation:
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2’-MOE sugar moiety
  • d a 2’- -D deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2’-MOE sugar moiety
  • d a 2’- -D deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • Embodiment 143 A compound comprising a modified oligonucleotide according to the following chemical notation:
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2’-MOE sugar moiety
  • d a 2’- -D deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • Embodiment 144 The oligomeric compound of any of embodiments 87-143, consisting of the modified oligonucleotide.
  • Embodiment 145 The oligomeric compound of any of embodiments 87-144, comprising a conjugate group comprising a conjugate moiety and a conjugate linker.
  • Embodiment 146 The oligomeric compound of embodiment 145, wherein the conjugate linker consists of a single bond.
  • Embodiment 147 The oligomeric compound of embodiment 145, wherein the conjugate linker is cleavable.
  • Embodiment 148 The oligomeric compound of embodiment 145, wherein the conjugate linker comprises 1-3 linker nucleosides.
  • Embodiment 149 The oligomeric compound of any of embodiments 145-148, wherein the conjugate linker does not comprise any linker nucleosides.
  • Embodiment 150 The oligomeric compound of any of embodiments 145-148, wherein the conjugate group is attached to the modified oligonucleotide at the 5’ -end of the modified oligonucleotide.
  • Embodiment 151 The oligomeric compound of any of embodiments 145-148, wherein the conjugate group is attached to the modified oligonucleotide at the 3’ -end of the modified oligonucleotide.
  • Embodiment 152 The oligomeric compound of any of embodiments 87-143 or 146-148, comprising a terminal group.
  • Embodiment 153 The oligomeric compound of embodiment 152, wherein the terminal group is an abasic sugar moiety.
  • Embodiment 154 The oligomeric compound of any of embodiments 87-153 wherein the oligomeric compound is a singled-stranded oligomeric compound.
  • Embodiment 155 A modified oligonucleotide according to the following chemical structure: NO: 126), or a salt thereof.
  • Embodiment 156 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 157 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 158 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 159 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 160 A modified oligonucleotide according to the following chemical structure: or a salt thereof.
  • Embodiment 161 The modified oligonucleotide of any of embodiments 155-160, which is the sodium salt or the potassium salt.
  • Embodiment 162 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 163 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 164 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 165 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 166 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 167 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 168 A chirally enriched population of oligomeric compounds of any of embodiments 87-154 or modified oligonucleotide of embodiments 155-167, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having a particular stereochemical configuration.
  • Embodiment 169 The chirally enriched population of embodiment 168, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having the (Sp) or (Rp) configuration.
  • Embodiment 170 The chirally enriched population of embodiment 169, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate intemucleoside linkage.
  • Embodiment 171 The chirally enriched population of embodiment 170, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate intemucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate intemucleoside linkages.
  • Embodiment 172 The chirally enriched population of embodiment 171, wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate intemucleoside linkages in the Sp, Sp, and Rp configurations, in the 5’ to 3’ direction.
  • Embodiment 173. A population of oligomeric compounds comprising modified oligonucleotides of any of embodiments 87-154, or a population of modified oligonucleotides of embodiments 155-167, wherein all of the phosphorothioate intemucleoside linkages of the modified oligonucleotide are stereorandom.
  • Embodiment 174 An oligomeric duplex, comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound of any of embodiments 87-154.
  • Embodiment 175. The oligomeric duplex of embodiment 174, wherein the second oligomeric compound comprises a second modified oligonucleotide consisting of 12 to 30 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
  • Embodiment 176 The oligomeric duplex of embodiment 174 or 175, wherein the modified oligonucleotide of the first oligomeric compound comprises a 5’ -stabilized phosphate group.
  • Embodiment 177 The oligomeric duplex of embodiment 176, wherein the stabilized phosphate group comprises a cyclopropyl phosphonate or a vinyl phosphonate.
  • Embodiment 178 The oligomeric duplex of any of embodiments 174-177, wherein the modified oligonucleotide of the first oligomeric compound comprises a glycol nucleic acid (GNA) sugar surrogate.
  • GAA glycol nucleic acid
  • Embodiment 179 The oligomeric duplex of any of embodiments 174-178, wherein the modified oligonucleotide of the first oligomeric compound comprises a 2’-NMA sugar moiety.
  • Embodiment 180 The oligomeric duplex of any of embodiments 174-179, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety.
  • Embodiment 181 The oligomeric duplex of embodiment 180, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety.
  • Embodiment 182 The oligomeric duplex of embodiment 181, wherein the bicyclic sugar moiety of the second modified oligonucleotide comprises a 2’-4’ bridge selected from -0-CH 2 -; and -0-CH(CH )-.
  • Embodiment 183 The oligomeric duplex of embodiment 182, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety.
  • Embodiment 184 The oligomeric duplex of embodiment 183, wherein the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2’-MOE sugar moiety, a 2’-F sugar moiety, or 2’-OMe sugar moiety.
  • Embodiment 185 The oligomeric duplex of any of embodiments 174-184, wherein at least one nucleoside of the second modified oligonucleotide comprises a sugar surrogate.
  • Embodiment 186 The oligomeric duplex of any of embodiments 174-185, wherein at least one intemucleoside linkage of the second modified oligonucleotide is a modified intemucleoside linkage.
  • Embodiment 187 The oligomeric duplex of embodiment 186, wherein at least one modified intemucleoside linkage of the second modified oligonucleotide is a phosphorothioate intemucleoside linkage.
  • Embodiment 188 The oligomeric duplex of any of embodiments 174-187, wherein at least one intemucleoside linkage of the second modified oligonucleotide is a phosphodiester intemucleoside linkage.
  • Embodiment 189 The oligomeric duplex of any of embodiments 174-188, wherein each intemucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester or a phosphorothioate intemucleoside linkage.
  • Embodiment 190 The oligomeric duplex of any of embodiments 174-189, wherein each intemucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester intemucleoside linkage, a phosphorothioate intemucleoside linkage, or a mesyl phosphoramidate intemucleoside linkage.
  • Embodiment 191 The oligomeric duplex of any of embodiments 174-190, wherein the second modified oligonucleotide comprises at least one modified nucleobase.
  • Embodiment 192 The oligomeric duplex of embodiment 191, wherein the modified nucleobase of the second modified oligonucleotide is 5-methylcytosine.
  • Embodiment 193 The oligomeric duplex of any of embodiments 174-192, wherein the second modified oligonucleotide comprises a conjugate group.
  • Embodiment 194 The oligomeric duplex of embodiment 193, wherein the conjugate group comprises a conjugate linker and a conjugate moiety.
  • Embodiment 195 The oligomeric duplex of embodiment 193 or 194, wherein the conjugate group is attached to the second modified oligonucleotide at the 5’ -end of the second modified oligonucleotide.
  • Embodiment 196 The oligomeric duplex of embodiment 193 or 194, wherein the conjugate group is attached to the second modified oligonucleotide at the 3’ -end of the modified oligonucleotide.
  • Embodiment 197 The oligomeric duplex of any of embodiments 193-196, wherein the second modified oligonucleotide comprises a terminal group.
  • Embodiment 198 The oligomeric duplex of embodiment 197, wherein the terminal group is an abasic sugar moiety.
  • Embodiment 199 The oligomeric duplex of any of embodiments 174-198, wherein the second modified oligonucleotide consists of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18,16 to 20,
  • Embodiment 200 An antisense agent comprising an antisense compound, wherein the antisense compound is the oligomeric compound of any of embodiments 87-154 or the modified oligonucleotide of any of embodiments 155-167.
  • Embodiment 201 The antisense agent of embodiment 200, wherein the antisense agent is the oligomeric duplex of any of embodiments 174-199.
  • Embodiment 202 The antisense agent of embodiment 200 or 201, wherein the antisense agent is an RNase H agent capable of reducing the amount of ATXN1 nucleic acid through the activation of RNase H.
  • Embodiment 203 The antisense agent of any of embodiments 200-202, wherein the conjugate group comprises a cell-targeting moiety.
  • Embodiment 204 A pharmaceutical composition comprising an oligomeric compound of any of embodiments 87- 154, the modified oligonucleotide of any of embodiments 155-167, the population of any of embodiments 168- 173, an oligomeric duplex of any of embodiments 174-199, or an antisense agent of any of embodiments 200- 203, and a pharmaceutically acceptable carrier or diluent.
  • Embodiment 205 The pharmaceutical composition of embodiment 204, wherein the pharmaceutically acceptable diluent is water, phosphate-buffered saline, or artificial cerebral spinal fluid.
  • Embodiment 206. The pharmaceutical composition of embodiment 205, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebral spinal fluid.
  • Embodiment 207 A method comprising administering to a subject the oligomeric compound of any of embodiments 87-154, the modified oligonucleotide of any of embodiments 155-167, the population of any of embodiments 168-173, the oligomeric duplex of any of embodiments 174-199, the antisense agent of any of embodiments 200-203, or the pharmaceutical composition of any of embodiments 204-206.
  • Embodiment 208 A method of treating a disease associated with ATXN1 comprising administering to a subject having a disease associated with ATXN1 a therapeutically effective amount of the oligomeric compound of any of embodiments 87-154, the modified oligonucleotide of any of embodiments 155-167, the population of any of embodiments 168-173, the oligomeric duplex of any of embodiments 174-199, the antisense agent of any of embodiments 200-203, or the pharmaceutical composition of any of embodiments 204-206; thereby treating the disease associated with ATXN1.
  • Embodiment 209 The method of embodiment 208, wherein the ATXN1 -associated disease is Spinocerebellar ataxia type 1.
  • Embodiment 210 The method of any of embodiments 208-209, wherein at least one symptom or hallmark of the ATXN1 -associated disease is ameliorated.
  • Embodiment 211 The method of embodiment 210, wherein the symptom or hallmark is gait or limb ataxia, cognitive impairments, difficulty with speaking or swallowing, atrophy of the cerebellum and/or brainstem in magnetic resonance imaging (MRI), neurochemical abnormalities in the cerebellum and/or brainstem detected via magnetic resonance spectroscopy (MRS), or death within 10-15 years of symptom onset.
  • MRI magnetic resonance imaging
  • MRS magnetic resonance spectroscopy
  • Embodiment 212 The method of any of embodiments 208-211, wherein ATXN1 levels in the subject are reduced.
  • Embodiment 213 A method of reducing expression of ATXN1 in a cell comprising contacting the cell with the oligomeric compound of any of embodiments 87-154, the modified oligonucleotide of any of embodiments 155-167, the population of any of embodiments 168-173, the oligomeric duplex of any of embodiments 174- 199, the antisense agent of any of embodiments 200-203, or the pharmaceutical composition of any of embodiments 204-206.
  • Embodiment 214 The method of embodiment 213, wherein the cell is a CNS cell.
  • Embodiment 215. Use of the oligomeric compound of any of embodiments 87-154, the modified oligonucleotide of any of embodiments 155-167, the population of any of embodiments 168-173, the oligomeric duplex of any of embodiments 174-199, the antisense agent of any of embodiments 200-203, or the pharmaceutical composition of any of embodiments 204-206 for treating a disease associated with ATXN1.
  • Embodiment 216 Use of the oligomeric compound of any of embodiments 87-154, the modified oligonucleotide of any of embodiments 155-167, the population of any of embodiments 168-173, the oligomeric duplex of any of embodiments 174-199, the antisense agent of any of embodiments 200-203, or the pharmaceutical composition of any of embodiments 204-206 in the manufacture of a medicament for treating a disease associated with ATXN1.
  • Embodiment 217 The use of embodiment 215 or 216, wherein the disease associated with ATXN1 is Spinocerebellar ataxia type 1.
  • oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides.
  • Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides.
  • Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified intemucleoside linkage.
  • Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase.
  • modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
  • modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure.
  • Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2’, 4’, and/or 5’ positions.
  • one or more non-bridging substituent of non- bicyclic modified sugar moieties is branched.
  • 2’ -substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2’-F, 2'-OCH (“OMe” or “O-methyl”), and 2'-0(CH 2 ) 2 0CH 3 (“MOE” or “O-methoxy ethyl”).
  • 2’ -substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O-Ci-Cio alkoxy, O-Ci-Cio substituted alkoxy, O-Ci-Cio alkyl, O-Ci-Cio substituted alkyl, S- alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, 0(CH 2 ) 2 SCH 3 , 0(CH 2 ) 2 0N(R m )(R
  • 2'-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (N0 2 ), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
  • substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (N0 2 ), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
  • 4’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g.
  • non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties and the modified sugar moieties and modified nucleosides described inMigawa et ak, WO 2008/101157 and Rajeev et al., US2013/0203836.
  • NMA non-bridging T -substituent group
  • a 2’ -substituted nucleoside comprises a sugar moiety comprising a non-bridging T- substituent group selected from: F, OCH 3 , and OCH2CH2OCFF.
  • modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration.
  • a 2’-deoxyfuranosyl sugar moiety may be in seven isomeric configurations other than the naturally occurring b-D-deoxyribosyl configuration.
  • modified sugar moieties are described in, e.g., WO 2019/157531, incorporated by reference herein.
  • a 2’-modified sugar moiety has an additional stereocenter at the 2’-position relative to a 2’-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations.
  • 2’ -modified sugar moieties described herein are in the b-D-ribosyl isomeric configuration unless otherwise specified.
  • Certain modifed sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety.
  • the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms.
  • Examples of such 4’ to 2’ bridging sugar substituents include but are not limited to: 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'-(CH 2 ) 3 -2', 4'-CH 2 -0-2' (“LNA”), 4'-CH 2 -S-2', 4'-(CH 2 ) 2 -0-2' (“ENA”), 4'- CH(CH 3 )-0-2' (referred to as “constrained ethyl” or “cEt”), 4’-CH 2 -0-CH 2 -2’, 4’-CH 2 -N(R)-2’, 4'-CH(CH 2 0CH 3 )-0-2' (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S.
  • each R, R a , and R b is, independently, H, a protecting group, or C1-C12 alkyl (see, e.g. Imanishi et al., U.S. 7,427,672).
  • bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration.
  • an LNA nucleoside (described herein) may be in the a-L configuration or in the b-D configuration.
  • general descriptions of bicyclic nucleosides include both isomeric configurations.
  • LNA or cEt are identified in exemplified embodiments herein, they are in the b-D configuration, unless otherwise specified.
  • modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5’ -substituted and 4’-2’ bridged sugars).
  • modified sugar moieties are sugar surrogates.
  • the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom.
  • such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein.
  • certain sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2'-position (see, e.g., Bhat et al., U.S. 7,875,733 and Bhat et al., U.S. 7,939,677) and/or the 5’ position.
  • sugar surrogates comprise rings having other than 5 atoms.
  • a sugar surrogate comprises a six-membered tetrahydropyran (“THP”).
  • THP tetrahydropyran
  • Such tetrahydropyrans may be further modified or substituted.
  • Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:
  • F-HNA see e.g. Swayze et al., U.S. 8,088,904; Swayze et al, U.S. 8,440,803; Swayze et al., U.S. 8,796,437; and Swayze et al., U.S. 9,005,906; F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula: wherein, independently, for each of the modified THP nucleosides:
  • Bx is a nucleobase moiety
  • T and T are each, independently, an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T and T 4 is an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T 3 and T is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group; qi, q2, q 3 , q 4 , qs.
  • modified THP nucleosides are provided wherein qi. q 2 , q 3 , q 4 , qs, q 6 and q 7 are each H. In certain embodiments, at least one of qi, q2, q 3 , q 4 , qs, q 6 and q 7 is other than H. In certain embodiments, at least one of qi, q2, q 3 , q 4 , qs, q 6 and q 7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of Ri and R2 is F. In certain embodiments, Ri is F and R2 is H, in certain embodiments, Ri is methoxy and R2 is H, and in certain embodiments, Ri is methoxyethoxy and R 2 is H.
  • sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
  • nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. 5,698,685; Summertonet al., U.S. 5,166,315; Summerton et al., U.S. 5,185,444; and Summerton et al., U.S. 5,034,506).
  • morpholino means a sugar surrogate having the following structure:
  • morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
  • sugar surrogates are referred to herein as “modifed morpholinos.”
  • sugar surrogates comprise acyclic moieites.
  • nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g. , Kumar et al, Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.
  • modified oligonucleotides comprise one or more nucleosides comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.
  • modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines.
  • modified nucleobases are selected from: 2-aminopropyladenine, 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-CoC-CH 3 ) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5- ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-triiluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7
  • nucleobases include tricyclic pyrimidines, such as l,3-diazaphenoxazine-2-one, 1,3- diazaphenothiazine-2-one and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2-one (G-clamp).
  • Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
  • Further nucleobases include those disclosed in Merigan et al., U.S.
  • nucleosides of modified oligonucleotides may be linked together using any intemucleoside linkage.
  • the two main classes of intemucleoside linking groups are defined by the presence or absence of a phosphoms atom.
  • Modified intemucleoside linkages compared to naturally occurring phosphodiester intemucleoside linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide.
  • intemucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non- phosphorous-containing intemucleoside linkages are well known to those skilled in the art.
  • Representative intemucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates.
  • Modified oligonucleotides comprising intemucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom intemucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations.
  • populations of modified oligonucleotides comprise phosphorothioate intemucleoside linkages wherein all of the phosphorothioate intemucleoside linkages are stereorandom.
  • modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration.
  • populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate intemucleoside linkage in a particular, independently selected stereochemical configuration.
  • the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population.
  • the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population.
  • modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al, JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the fSpj configuration.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (RpJ configuration.
  • modified oligonucleotides comprising (Rp and/or iSpj phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
  • chiral intemucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
  • Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research, Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65).
  • Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CH 2 component parts.
  • a neutral intemucleoside linkage is any of those described in WO 2021/030778, incorporated by reference herein.
  • modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified intemucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or intemucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and intemucleoside linkages are each independent of one another.
  • a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or intemucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
  • oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or portion thereof in a defined pattern or sugar motif.
  • sugar motifs include but are not limited to any of the sugar modifications discussed herein.
  • modified oligonucleotides have a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.”
  • the three regions of a gapmer motif (the 5’-wing, the gap, and the 3’ -wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap.
  • the sugar moieties of the nucleosides of each wing that are closest to the gap differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction).
  • the sugar moieties within the gap are the same as one another.
  • the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap.
  • the sugar motifs of the two wings are the same as one another (symmetric gapmer).
  • the sugar motif of the 5'-wing differs from the sugar motif of the 3'-wing (asymmetric gapmer).
  • the wings of a gapmer comprise 1-6 nucleosides.
  • each nucleoside of each wing of a gapmer comprises a modified sugar moiety.
  • at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety.
  • at least two nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • at least three nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • at least four nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • at least five nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • the gap of a gapmer comprises 7-12 nucleosides.
  • each nucleoside of the gap of a gapmer comprises a 2’-deoxyribosyl sugar moiety.
  • each nucleoside of the gap of a gapmer comprises a 2 ‘ -[l-D-dcoxyribosyl sugar moiety.
  • at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety.
  • at least one nucleoside of the gap of a gapmer comprises a 2’-OMe sugar moiety.
  • the gapmer is a deoxy gapmer.
  • the nucleosides on the gap side of each wing/gap junction comprise 2’-deoxyribosyl sugar moieties and the nucleosides on the wing sides of each wing/gap junction comprise modified sugar moieties.
  • each nucleoside of the gap comprises a 2’-deoxyribosyl sugar moiety.
  • each nucleoside of each wing of a gapmer comprises a modified sugar moiety.
  • one nucleoside of the gap comprises a modified sugar moiety and each remaining nucleoside of the gap comprises a 2’-deoxyribosyl sugar moiety.
  • modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif.
  • each nucleoside of the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety.
  • each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety.
  • modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif, wherein each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif.
  • a fully modified oligonucleotide is a uniformly modified oligonucleotide.
  • each nucleoside of a uniformly modified oligonucleotide comprises the same 2’ -modification.
  • the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5’-wing] - [# of nucleosides in the gap] - [# of nucleosides in the 3’-wing]
  • a 5- 10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap.
  • that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprises a 2 ' -(i-D-dcoxyribosyl sugar moiety.
  • a 5-10-5 MOE gapmer consists of 5 linked 2’ -MOE nucleosides in the 5’ -wing, 10 linked a 2 ‘ -b-D-dco.xy nucleosides in the gap, and 5 linked 2’ -MOE nucleosides in the 3’-wing.
  • a 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5’-wing, 10 linked 2 ' -(i-D- deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3’-wing.
  • a 5-8-5 gapmer consists of 5 linked nucleosides comprising a modified sugar moiety in the 5’-wing, 8 linked a 2 ' -b-D-dcoxy nucleosides in the gap, and 5 linked nucleosides comprising a modified sugar moiety in the 3 ’-wing.
  • a 5-8-5 or 5-8-4 mixed wing gapmer has at least two different modified sugar moieties in the 5’- and/or the 3 ’-wing.
  • modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 6-10-4 MOE gapmers. In certain embodiments, modified oligonucleotides are 5-8-4 MOE gapmers. In certain embodiments, modified oligonucleotides are X-Y-Z MOE gapmers, wherein X and Z are independently selected from 1, 2, 3, 4, 5, 6, or 7 linked 2’-MOE nucleosides and Y is selected from 7, 8, 9, 10, or 11. linked deoxynucleosides.
  • modified oligonucleotides have a sugar motif selected from the following (5’ to 3’): eeeeedddddddddkkee or eeeeedyddddddkkee, wherein ‘d’ represents a 2’-deoxyribosyl sugar moiety, ‘e’ represents a 2’- MOE sugar moiety, ‘k’ represents a cEt sugar moiety, and ‘y’ represents a 2’-OMe sugar moiety.
  • oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or portion thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified.
  • each purine or each pyrimidine is modified.
  • each adenine is modified.
  • each guanine is modified.
  • each thymine is modified.
  • each uracil is modified.
  • each cytosine is modified.
  • some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methyl cytosines.
  • all of the cytosine nucleobases are 5-methyl cytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.
  • modified oligonucleotides comprise a block of modified nucleobases.
  • the block is at the 3 ’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3’-end of the oligonucleotide. In certain embodiments, the block is at the 5’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5 ’-end of the oligonucleotide.
  • oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase.
  • one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif.
  • the sugar moiety of said nucleoside is a 2’- deoxyribosyl sugar moiety.
  • the modified nucleobase is selected from: a 2-thiopyrimidine and a 5 -propynepy rimidine . 3.
  • oligonucleotides comprise modified and/or unmodified intemucleoside linkages arranged along the oligonucleotide or portion thereof in a defined pattern or motif.
  • each intemucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate intemucleoside linkage and phosphodiester intemucleoside linkage.
  • each phosphorothioate intemucleoside linkage is independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate.
  • the sugar motif of a modified oligonucleotide is a gapmer and the intemucleoside linkages within the gap are all modified.
  • the intemucleoside linkages in the wings are unmodified phosphodiester intemucleoside linkages.
  • the terminal intemucleoside linkages are modified.
  • the sugar motif of a modified oligonucleotide is a gapmer, and the intemucleoside linkage motif comprises at least one phosphodiester intemucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal intemucleoside linkage, and the remaining intemucleoside linkages are phosphorothioate intemucleoside linkages.
  • all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one .S'p. ,S'p. Rp motif.
  • all of the intemucleoside linkages are either phosphodiester intemucleoside linkages or phosphorothioate intemucleoside linkages, and the chiral motif is (5’ to 3’): .S'p-o-o-o-S'p-.S'p-.S'p-//p-.S'p-.S'p-//p-.S'p-.S'p-.S'p-S'p-.S'p-.S'p-.S'p-.S'p-.S'p or .S'p-o-o-o-.S'p- .S'p -.S'p -R p -.S'p -.S'p -.S'p -.S'p -.S'p -.S'p -.S'p -.S'p -.S'p -.S'p -.S'p -.S'p -.S'
  • each .S'p ' represents a (.S’p) phosphorothioate intemucleoside linkage
  • each 7/p ' is a i/p intemucleoside linkage
  • each ‘o’ represents a phosphodiester intemucleoside linkage.
  • populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such intemucleoside linkage motifs.
  • modified oligonucleotides have an intemucleoside linkage motif of sooossssssssooss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • modified oligonucleotides have an intemucleoside linkage motif of (5’ to 3’): sooooosssssssssssos, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • modified oligonucleotides have an intemucleoside linkage motif of (5’ to 3’): sssossssssssssss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • modified oligonucleotides have an intemucleoside linkage motif of (5’ to 3’): sssossssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • oligonucleotide it is possible to increase or decrease the length of an oligonucleotide without eliminating activity.
  • Woolf et al. Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992
  • a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target nucleic acid in an oocyte injection model.
  • Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target nucleic acid, albeit to a lesser extent than the oligonucleotides that contained no mismatches.
  • target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.
  • oligonucleotides can have any of a variety of ranges of lengths.
  • oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range.
  • X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X ⁇ Y.
  • oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to
  • modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each intemucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications.
  • the intemucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the intemucleoside linkages of the gap region of the sugar motif.
  • sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.
  • Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for b-D ribosyl sugar moieties, and all of the phosphorothioate intemucleoside linkages are stereorandom.
  • the modified oligonucleotides of a chirally enriched population are enriched for both b-D ribosyl sugar moieties and at least one, particular phosphorothioate intemucleoside linkage in a particular stereochemical configuration.
  • oligonucleotides are further described by their nucleobase sequence.
  • oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
  • a portion of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
  • the nucleobase sequence of a portion or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.
  • oligomeric compounds which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups.
  • Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups.
  • conjugate groups or terminal groups are attached at the 3’ and/or 5’ -end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3’ -end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3’ -end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5’ -end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5’ -end of oligonucleotides.
  • terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
  • oligonucleotides are covalently attached to one or more conjugate groups.
  • conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.
  • conjugate groups impart a new properly on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.
  • conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al, Proc. Natl. Acad. Sci.
  • Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino- carbonyl-oxycholesterol moiety (Crooke et al., ./. Pharmacol. Exp.
  • Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, lipophilic groups, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
  • a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (,S')-(+)-pranoprofcn.
  • active drug substance for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (,S')-(+)-pranoprofcn.
  • carprofen dansylsarcosine, 2,3,5- triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
  • Conjugate moieties are attached to oligonucleotides through conjugate linkers.
  • the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond).
  • the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.
  • a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.
  • conjugate linkers are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein.
  • a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups.
  • bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
  • conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1-carboxy late (SMCC) and 6-aminohexanoic acid (AHEX or AHA).
  • ADO 8-amino-3,6-dioxaoctanoic acid
  • SMCC succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1-carboxy late
  • AHEX or AHA 6-aminohexanoic acid
  • conjugate linkers include but are not limited to substituted or unsubstituted Ci-Cio alkyl, substituted or unsubstituted C 2 -Ci 0 alkenyl or substituted or unsubstituted C 2 -Ci 0 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
  • conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker- nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker- nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine.
  • a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N- benzoylcytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N- isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.
  • linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid.
  • an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide.
  • the total number of contiguous linked nucleosides in such an oligomeric compound is more than 30.
  • an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30.
  • conjugate linkers comprise no more than 10 linker-nucleosides.
  • conjugate linkers comprise no more than 5 linker- nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.
  • a conjugate group it is desirable for a conjugate group to be cleaved from the oligonucleotide.
  • oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide.
  • certain conjugate linkers may comprise one or more cleavable moieties.
  • a cleavable moiety is a cleavable bond.
  • a cleavable moiety is a group of atoms comprising at least one cleavable bond.
  • a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds.
  • a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome.
  • a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
  • a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide.
  • a cleavable bond is one or both of the esters of a phosphodiester.
  • a cleavable moiety comprises a phosphate or phosphodiester.
  • the cleavable moiety is a phosphate or phosphodiester linkage between an oligonucleotide and a conjugate moiety or conjugate group.
  • a cleavable moiety comprises or consists of one or more linker-nucleosides.
  • the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds.
  • such cleavable bonds are unmodified phosphodiester bonds.
  • a cleavable moiety is 2'-deoxynucleoside that is attached to either the 3' or 5'-terminal nucleoside of an oligonucleotide by a phosphodiester intemucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage.
  • the cleavable moiety is 2'-deoxyadenosine.
  • a conjugate group comprises a cell-targeting moiety. In certain embodiments, a conjugate group has the general formula:
  • n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.
  • n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is O andk is l. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.
  • conjugate groups comprise cell-targeting moieties that have at least one tethered ligand.
  • cell-targeting moieties comprise two tethered ligands covalently attached to a branching group.
  • cell-targeting moieties comprise three tethered ligands covalently attached to a branching group.
  • oligomeric compounds comprise one or more terminal groups.
  • oligomeric compounds comprise a stabilized 5’-phosphate.
  • Stabilized 5’-phosphates include, but are not limited to 5’-phosphonates, including, but not limited to 5’-vinylphosphonates.
  • terminal groups comprise one or more abasic nucleosides and/or inverted nucleosides.
  • terminal groups comprise one or more 2’ -linked nucleosides. In certain such embodiments, the 2’ -linked nucleoside is an abasic nucleoside.
  • oligomeric compounds described herein comprise an oligonucleotide, having a nucleobase sequence complementary to that of a target nucleic acid.
  • an oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex.
  • Such oligomeric duplexes comprise a first oligomeric compound having a portion complementary to a target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound.
  • the first oligomeric compound of an oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group.
  • Either or both oligomeric compounds of an oligomeric duplex may comprise a conjugate group.
  • the oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides.
  • oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds.
  • antisense compounds have antisense activity when they reduce the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid.
  • Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
  • hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid.
  • certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid.
  • RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex.
  • the DNA in such an RNA:DNA duplex need not be unmodified DNA.
  • described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity.
  • one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.
  • an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid.
  • RISC RNA-induced silencing complex
  • certain antisense compounds result in cleavage of the target nucleic acid by Argonaute.
  • Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).
  • hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.
  • Antisense activities may be observed directly or indirectly.
  • observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or subject.
  • oligomeric compounds comprise or consist of an oligonucleotide comprising a portion that is complementary to a target nucleic acid.
  • the target nucleic acid is an endogenous RNA molecule.
  • the target nucleic acid encodes a protein.
  • the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions.
  • the target nucleic acid is a mature mRNA.
  • the target nucleic acid is a pre- mRNA.
  • the target region is entirely within an intron.
  • the target region spans an intron/exon junction.
  • the target region is at least 50% within an intron.
  • Gautschi et al J. Natl. Cancer Inst. 93:463-471, March 2001
  • this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res.
  • oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a portion that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the portion of full complementarity is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleobases in length.
  • oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid.
  • antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount.
  • selectivity of the oligonucleotide is improved.
  • the mismatch is specifically positioned within an oligonucleotide having a gapmer motif.
  • the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 from the 5’-end of the gap region.
  • the mismatch is at position 1, 2, 3, 4, 5, or 6 from the 5’-end of the 5’ wing region or the 3 ’ wing region.
  • oligomeric compounds comprise or consist of an oligonucleotide that is complementary to a target nucleic acid, wherein the target nucleic acid is an ATXN1 nucleic acid.
  • ATXN1 nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No.
  • SEQ ID NO: 2 the complement of GENBANK Accession No. NC 000006.12 truncated from nucleotides 16296001to 16764000
  • SEQ ID NO: 3 GenBANK Accession No. NM 001128164.1
  • SEQ ID NO: 4 GenBANK Accession No. BC011026.1
  • SEQ ID NO: 5 GenBANK Accession No. BC029401.1
  • contacting a cell with an oligomeric compound complementary to any of SEQ ID NO: 1-6 reduces the amount of ATXN1 RNA in a cell. In certain embodiments, contacting a cell with an oligomeric compound complementary to any of SEQ ID NO: 1-6 reduces the amount of ATXN1 in a cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in a subject. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide.
  • contacting a cell in a subject with an oligomeric compound complementary to any of SEQ ID NO: 1-6 ameliorates one or more symptom or hallmark of a neurodegenerative disease.
  • the neurodegenerative disease is SCA1.
  • the symptom or hallmark is selected from gait and limb ataxia, cognitive impairments, difficulty with speaking and swallowing, atrophy of the cerebellum and brainstem in magnetic resonance imaging (MRI), neurochemical abnormalities in the cerebellum and brainstem detected via magnetic resonance spectroscopy (MRS), and death within 10-15 years of symptom onset.
  • an oligomeric compound complementary to any of SEQ ID NO: 1-6 is capable of reducing the detectable amount of ATXN1 RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard cell assay.
  • an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6 is capable of decreasing the amount of ATXN1 in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard cell assay.
  • an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6 is capable of reducing the detectable amount of ATXN1 RNA in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
  • an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6 is capable of decreasing the detectable amount of ATXN 1 in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
  • oligomeric compounds comprise or consist of an oligonucleotide comprising a portion that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue.
  • the pharmacologically relevant tissues are the cells and tissues that comprise the central nervous system. Such tissues include the cortex, cerebellum, and brainstem.
  • compositions comprising one or more oligomeric compounds.
  • the one or more oligomeric compounds each consists of a modified oligonucleotide.
  • the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier.
  • a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound.
  • the sterile saline is pharmaceutical grade saline.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water.
  • the sterile water is pharmaceutical grade water.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate- buffered saline (PBS).
  • PBS phosphate- buffered saline
  • the sterile PBS is pharmaceutical grade PBS.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid.
  • the artificial cerebrospinal fluid is pharmaceutical grade.
  • a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.
  • compositions comprise one or more oligomeric compound and one or more excipients.
  • excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone .
  • oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters.
  • pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide upon administration to a subject, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
  • the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
  • Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
  • prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.
  • Lipid moieties have been used in nucleic acid therapies in a variety of methods.
  • the nucleic acid such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids.
  • DNA complexes with mono- or poly -cationic lipids are formed without the presence of a neutral lipid.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
  • compositions comprise a delivery system.
  • delivery systems include, but are not limited to, liposomes and emulsions.
  • Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds.
  • certain organic solvents such as dimethylsulfoxide are used.
  • compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents comprising an oligomeric compound provided herein to specific tissues or cell types.
  • pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
  • pharmaceutical compositions comprise a co-solvent system.
  • co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
  • co-solvent systems are used for hydrophobic compounds.
  • VPD co-solvent system is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80TM and 65% w/v polyethylene glycol 300.
  • the proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics.
  • co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80TM; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
  • compositions are prepared for oral administration.
  • pharmaceutical compositions are prepared for buccal administration.
  • a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.).
  • a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
  • other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
  • injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like.
  • compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers.
  • Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
  • Compound No. 994509 is characterized as a 5-10-5 MOE gapmer having a sequence of (from 5’ to 3’) GCACGGTATTAGTGTCTTCA (SEQ ID NO: 126), wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 6-15 are 2 -b-D-dcoxy nucleosides wherein the intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 16 to 17, and 17 to 18 are phosphodiester intemucleoside linkages and the intemucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages, and wherein each cytosine is a 5-methyl cytosine
  • Compound No. 994509 is represented by the following chemical notation (5’ to 3’): Ges m Ceo Aeo m Ceo Ges Gds Tds Ads Tds Tds Ads Gds Tds Gds Tds m Ceo Teo Tes m Ces Ae (SEQ ID NO: 126), wherein,
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2’-MOE sugar moiety
  • d a 2’- -D deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • Compound No. 994509 is represented by the following chemical structure:
  • the sodium salt of Compound No. 994509 is represented by the following chemical structure:
  • Compound No. 1040500 is characterized as a 5-10-5 MOE gapmer having a sequence of (from 5’ to 3’) GCTTCTCAAATCAGGTGTAC (SEQ ID NO: 1045), wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 6-15 are 2 ‘ -[l-D-dcoxy nucleosides.
  • intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 16 to 17, and 17 to 18 are phosphodiester intemucleoside linkages and the intemucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • Compound No. 1040500 is represented by the following chemical notation (5’ to 3’): Ges m Ceo Teo Teo m Ces Tds m Cds Ads Ads Tds m Cds Ads Gds Gds Teo Geo Tes Aes mCe (SEQ ID NO: 1045), wherein,
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • Compound No. 1040500 is represented by the following chemical structure:
  • the sodium salt of Compound No. 1040500 is represented by the following chemical structure:
  • Compound No. 1041927 is characterized as a 5-10-5 MOE gapmer having a sequence of (from 5’ to 3’) GCCTTTATAACTTTTCTTTC (SEQ ID NO: 2552), wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 6-15 are 2 ‘ -[l-D-dcoxy nucleosides.
  • intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 16 to 17, and 17 to 18 are phosphodiester intemucleoside linkages and the intemucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • Compound No. 1041927 is represented by the following chemical notation (5 ’ to 3 ’ ) : Ges m Ceo m Ceo Teo Tes Tds Ads Tds Ads Ads m Cds Tds Tds Tds Tds m Ceo Teo Tes Tes m Ce (SEQ ID NO: 2552), wherein,
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2’ -MOE sugar moiety
  • d a 2’- -D deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • Compound No. 1041927 is represented by the following chemical structure:
  • the sodium salt of Compound No. 1041927 is represented by the following chemical structure:
  • Compound No. 1055001 is characterized as a 5-10-5 MOE gapmer having a sequence of (from 5’ to 3’) TTCAGTTTAGTTGCAGCCAT (SEQ ID NO: 3190), wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 6-15 are 2 ‘ -[l-D-dcoxy nucleosides.
  • intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 16 to 17, and 17 to 18 are phosphodiester intemucleoside linkages and the intemucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • Compound No. 1055001 is represented by the following chemical notation (5’ to 3’): Tes Teo m Ceo Aeo Ges Tds Tds Tds Ads Gds Tds Tds Gds m Cds Ads Geo m Ceo m Ces Aes Te (SEQ ID NO: 3190), wherein,
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2’ -MOE sugar moiety
  • d a 2’- -D deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • Compound No. 1055001 is represented by the following chemical structure:
  • the sodium salt of Compound No. 1055001 is represented by the following chemical structure:
  • Compound No. 1371311 is characterized as a 5-10-5 MOE gapmer having a sequence of (from 5’ to 3’) CCCGTATTCCTCTTACCATC (SEQ ID NO: 3590), wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 6-15 are 2 -b-D-dcoxv nucleosides wherein the intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 16 to 17, and 17 to 18 are phosphodiester intemucleoside linkages and the intemucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages, and wherein each cytosine is a 5-methyl cyto
  • Compound No. 1371311 is represented by the following chemical notation (5 ’ to 3 ’ ) : m Ces m Ceo m Ceo Geo Tes Ads Tds Tds m Cds m Cds Tds m Cds Tds Tds Ads m Ceo m Ceo Aes Tes m Ce (SEQ ID NO: 3590), wherein,
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2’ -MOE sugar moiety
  • d a 2’- -D deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • Compound No. 1371311 is represented by the following chemical structure:
  • the sodium salt of Compound No. 1371311 is represented by the following chemical structure:
  • Compound No. 1385293 is characterized as a 5-8-4 MOE gapmer having a sequence of (from 5’ to 3’) TCAGTTTAGTTGCAGCC (SEQ ID NO: 3638), wherein each of nucleosides 1-5 and 14-17 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 6-13 are 2 ‘ -[l-D-dcoxy nucleosides.
  • intemucleoside linkages between nucleosides 4 to 5 and 14 to 15 are phosphodiester intemucleoside linkages and the intemucleoside linkages between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 15 to 16, and 16 to 17 are phosphorothioate intemucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
  • Compound No. 1385293 is represented by the following chemical notation (5’ to 3’): Tes m Ces Aes Geo Tes Tds Tds Ads Gds Tds Tds Gds m Cds Aeo Ges m Ces m Ce (SEQ ID NO: 3638), wherein,
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2’ -MOE sugar moiety
  • d a 2’- -D deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • Compound No. 1385293 is represented by the following chemical structure:
  • the sodium salt of Compound No. 1385293 is represented by the following chemical structure:
  • nucleobases in the ranges specified below comprise a hotspot region of ATXN 1 nucleic acid.
  • modified oligonucleotides that are complementary within a hotspot region of ATXN1 nucleic acid achieve an average of more than 75% reduction of ATXN1 RNA in vitro in the standard cell assay.
  • modified oligonucleotides that are complementary within a hotspot region of ATXN1 nucleic acid achieve an average of 24% or greater reduction of ATXN1 RNA in vivo in the standard in vivo assay.
  • modified oligonucleotides that are complementary within a hotspot region of ATXN 1 nucleic acid achieve an average of 45% or greater reduction of ATXN1 RNA in vivo in the standard in vivo assay.
  • nucleobases 5472-5552 of SEQ ID NO: 1 or 459725-459805 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary within nucleobases 5472-5552 of SEQ ID NO: 1 or 459725-459805 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 17 nucleobases in length.
  • modified oligonucleotides are gapmers.
  • modified oligonucleotides are mixed wing gapmers.
  • the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10- 4 MOE gapmers. In certain embodiments, the gapmers are 5-8-4 MOE gapmers or 5-8-4 mixed MOE/cEt gapmers. In certain embodiments, the mixed wing gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddkkee; wherein ‘d’ represents a 2 ' -(i-D-dcoxvribosvl sugar moiety, ‘k’ represents a cEt sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’ -substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’) ⁇
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeedyddddddddeeeee or eeeeedyddddddkkee; wherein ‘d’ represents a 2 ' -(i-D-dcoxyribosyl sugar moiety, ‘k’ represents a cEt sugar moiety, ‘e’ represents a 2’-MOE sugar moiety, and “y” represents a 2’-OMe sugar moiety.
  • the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in order from 5 ’ to 3 ’ :
  • modified nucleotides have an intemucleoside linkage motif of sooosssssssssssooss, sssossssssssssssssssss, sssosssssssssssss, or sooooosssssssssssoss wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID Nos: 196, 274, 352, 430, 508, 2578, 2655, 2732, 2809, 2886, 2963, 3121, 3122, 3190, 3191, 3192, 3262, 3330, 3331, 3332, 3401, 3402, 3575, 3577, 3620, 3624, 3638-3640, 3653-3655, 3662, 3665, and 3669 are complementary within nucleobases 5472-5552 of SEQ ID NO: 1 or 459725-459805 of SEQ ID NO: 2
  • nucleobase sequence of Compound Nos.: 994446-994450, 1040296-1040301, 1055001-1055011, 1342062, 1342063, 1342067, 1342068, 1365271, 1365272, 1365274, 1365294, 1365299, 1365300, 1371818, 1371821, 1371827, 1371829, 1371837,1371843, 1371866, 1371869, 1371871, 1371876, 1385293, 1394156-1394160, 1394162, 1394164, 1394166-1394168, 1394533, 1394544, 1394546, 1394549, and 1394553 are complementary within nucleobases 5472- 5552 of SEQ ID NO: 1 or 459725-459805 of SEQ ID NO: 2.
  • modified oligonucleotides complementary within nucleobases 5472-5552 of SEQ ID NO: 1 or 459725-459805 of SEQ ID NO: 2 achieve at least 58% reduction of ATXN 1 RNA in vitro in the standard cell assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 5472-5552 of SEQ ID NO: 1 or 459725-459805 of SEQ ID NO: 2 achieve an average of 90% reduction of ATXN1 RNA in vitro in the standard cell assay.
  • modified oligonucleotides complementary within nucleobases 5472-5552 of SEQ ID NO: 1 or 459725-459805 of SEQ ID NO: 2 achieve an average of 52% reduction of ATXN1 RNA in vivo in the standard in vivo assay.
  • nucleobases 5906-6005 of SEQ ID NO: 1 or 460159-460258 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to nucleobases 5906- 6005 of SEQ ID NO: 1 or 460159-460258 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 17 nucleobases in length.
  • modified oligonucleotides are mixed wing gapmers.
  • the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10- 4 MOE gapmers. In certain embodiments, the gapmers are 5-8-4 MOE gapmers or 5-8-4 mixed MOE/cEt gapmers. In certain embodiments, the mixed wing gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddkkee; wherein ‘d’ represents a 2 ‘ -[l-D-dco. ⁇ yribosyl sugar moiety, ‘k’ represents a cEt sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in order from 5 ’ to 3 ’ :
  • modified nucleotides have an intemucleoside linkage motif of sooosssssssssssooss, sssossssssssssssssssss, sssosssssssssssss, or sooooosssssssssssoss wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID Nos: 42, 120, 198, 276, 509, 587, 2502, 2579, 2656, 2733, 2810, 2887, 2964, 3585, 3588-3590, 3615, 3618, 3622, 3657, 3660, 3661, 3663, 3664, and 3666-3668 are complementaiy within nucleobases 5906-6005 of SEQ ID NO: 1 or 460159-460258 of SEQ ID NO: 2.
  • nucleobase sequence of Compound Nos.: 994458-994463, 1040327-1040333, 1367569, 1367580-1367581, 1367589-1367591, 1371311, 1371820, 1371823, 1371825, 1371842, 1371865, 1371868, 1371870, 1371873, 1371875, 1371877, 1394161, 1394163, 1394165, 1394524, 1394538, 1394541, 1394543, 1394545, 1394548, and 1394550- 1394552 are complementary within nucleobases 5906-6005 of SEQ ID NO: 1 or 460159-460258 of SEQ ID NO: 2.
  • modified oligonucleotides complementary within 5906-6005 of SEQ ID NO: 1 or 460159-460258 of SEQ ID NO: 2 achieve at least 26% reduction of ATXN1 RNA in vitro in the standard cell assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 5906-6005 of SEQ ID NO: 1 or 460159-460258 of SEQ ID NO: 2 achieve an average of 78% reduction of ATXN1 RNA in vitro in the standard cell assay.
  • modified oligonucleotides complementary within nucleobases 5906-6005 of SEQ ID NO: 1 or 460159-460258 of SEQ ID NO: 2 achieve an average of 51% reduction of ATXN1 RNA in vivo in the standard in vivo assay.
  • nucleobases 7868-7911 of SEQ ID NO: 1 or 462121-462164 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to nucleobases 7868- 7911 of SEQ ID NO: 1 or 462121-462164 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10- 4 MOE gapmers.
  • the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in order from 5 ’ to 3 ’ :
  • modified nucleotides have an intemucleoside linkage motif of sooossssssssssooss, sssossssssssssssssssssss, or sooooossssssssssoss wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID Nos: 48, 126, 2044, and 2121 are complementary within nucleobases 7868-7911 of SEQ ID NO: 1 or 462121-462164 of SEQ ID NO: 2.
  • nucleobase sequence of Compound Nos. : 994508, 994509, 1040499, 1040450, 1394513, and 1394529 are complementary within nucleobases 7868-7911 of SEQ ID NO: 1 or 462121-462164 of SEQ ID NO: 2.
  • modified oligonucleotides complementary within 7868-7911 of SEQ ID NO: 1 or 462121-462145 of SEQ ID NO: 2 achieve at least 61% reduction of ATXN1 RNA in vitro in the standard cell assay.
  • modified oligonucleotides complementary within nucleobases 7868-7911 of SEQ ID NO: 1 or 462121-462145 of SEQ ID NO: 2 an average of 79% reduction of ATXN1 RNA in vitro in the standard cell assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 7868-7911 of SEQ ID NO: 1 or 462121-462164 of SEQ ID NO: 2 achieve an average of 53% reduction of ATXN1 RNA in vivo in the standard in vivo assay.
  • nucleobases 8481-8514 of SEQ ID NO: 1 or 462734-462767 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to nucleobases 8481- 8514 of SEQ ID NO: 1 or 462734-462767 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10- 4 MOE gapmers.
  • the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in order from 5 ’ to 3 ’ :
  • modified nucleotides have an intemucleoside linkage motif of sooossssssssssooss, sssossssssssssssssssssss, or sooooossssssssssoss wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID Nos: 128, 206, 284, 1045, 1122, 1199, and 1276 are complementary within nucleobases 8481-8514 of SEQ ID NO: 1 or 462734-462767 of SEQ ID NO: 2.
  • nucleobase sequence of Compound Nos.: 994525-994527, 1040500-1040503, 1394514, and 1394525 are complementary within nucleobases 8481-8514 of SEQ ID NO: 1 or 462734-462767 of SEQ ID NO: 2.
  • modified oligonucleotides complementary within 8481-8514 of SEQ ID NO: 1 or 462734-462767 of SEQ ID NO: 2 achieve at least 54% reduction of ATXN1 RNA in vitro in the standard cell assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 8481-8514 of SEQ ID NO: 1 or 462734-462767 of SEQ ID NO: 2 achieve an average of 79% reduction of ATXN1 RNA in vitro in the standard cell assay.
  • modified oligonucleotides complementary within nucleobases 8481-8514 of SEQ ID NO: 1 or 462734-462767 of SEQ ID NO: 2 achieve an average of 48% reduction of ATXN1 RNA in vivo in the standard in vivo assay.
  • nucleobases 446679-446706 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to nucleobases 446679-446706 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are gapmers.
  • the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10- 4 MOE gapmers. In certain embodiments, 446679-446706 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary within 446679-446706 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 17 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers.
  • the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in order from 5 ’ to 3 ’ :
  • modified nucleotides have an intemucleoside linkage motif of sooossssssssssooss, sssossssssssssssssssssss, or sooooossssssssssoss wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID Nos: 2475, 2552, 2629, 2706, 2783, 3627-3630, and 3644 are complementary within nucleobases 446679-446706 of SEQ ID NO: 2.
  • nucleobase sequence of Compound Nos.: 1041926-1041930, 1364282, 1365258-1365261, 1365282- 1365284, 1365287, and 1394522 are complementary within nucleobases 446679-446706 of SEQ ID NO: 2.
  • modified oligonucleotides complementary within nucleobases 446679-446706 of SEQ ID NO: 2 achieve at least 67% reduction of ATXN1 RNA in vitro in the standard cell assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 446679-446706 of SEQ ID NO: 2. achieve an average of 81% reduction of ATXN1 RNA in vitro in the standard cell assay.
  • the ranges described in the Table below comprise hotspot regions.
  • Each hotspot region begins with the nucleobase of SEQ ID NO: 1 identified in the “Start Site SEQ ID NO: 1” column and ends with the nucleobase of SEQ ID NO: 1 identified in the “Stop Site SEQ ID NO: 1” column.
  • modified oligonucleotides are complementary within any of the hotspot regions 1-53, as defined in the table below. In certain embodiments, modified oligonucleotides are 17 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length.
  • the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6- 10-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-4 MOE gapmers or 5-8-4 mixed MOE/cEt gapmers.
  • the mixed wing gapmers have the sugar motif in order from 5 ’ to 3 ’ : eeeeeddddddddkkee; wherein ‘d’ represents a 2 ‘ -[i-D-dcoxyribosyl sugar moiety, ‘k’ represents a cEt sugar moiety, and ‘e’ represents a T- MOE sugar moiety.
  • gapmers comprise a 2’ -substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the T- substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeedyddddddddeeeee or eeeeedyddddddkkee; wherein ‘d’ represents a 2 -(i-D-dcoxyribosyl sugar moiety, ‘k’ represents a cEt sugar moiety, ‘e’ represents a 2’-MOE sugar moiety, and “y” represents a 2’-OMe sugar moiety.
  • the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in order from 5 ’ to 3 ’ :
  • modified nucleotides have an intemucleoside linkage motif of sooosssssssssssooss, sssossssssssssssssssss, sssosssssssssssss, or sooooosssssssssssoss wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequence of compounds listed in the “Compound No. in range” column in the table below are complementary to SEQ ID NO: 2 within the specified hotspot region.
  • nucleobase sequence of the oligonucleotides listed in the “SEQ ID NO: in range” column in the table below are complementary to the target sequence, SEQ ID NO:
  • modified oligonucleotides complementary to nucleobases within the hotspot region achieve at least “Min.% Red. in vitro” (minimum % reduction, relative to untreated control cells) of ATXN1 RNA in vitro in the standard cell assay, as indicated in the table below. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot region achieve an average of “ Avg.% Red. in vitro ” (average % reduction, relative to untreated control cells) of ATXN1 RNA in vitro in the standard cell assay, as indicated in the table below.
  • modified oligonucleotides complementary to nucleobases within the hotspot region achieve a maximum of “Max. % Red. in vitro ” (maximum % reduction, relative to untreated control cells) of ATXN1 RNA in vitro in the standard cell assay, as indicated in the table below.
  • modified oligonucleotides complementary to nucleobases within the hotspot region achieve an average of “ Avg. % Red. in vivo ” (average % reduction, relative to PBS-treated animals) of ATXN1 RNA in vivo in the standard in vivo assay in cortical tissue, as indicated in the table below.
  • RNA nucleoside comprising a 2’-OH sugar moiety and a thymine base
  • RNA a DNA having a modified sugar (2’ -OH in place of one 2’-H of DNA
  • RNA a modified base
  • thymine methylated uracil
  • nucleic acid sequences provided herein are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
  • an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “AT m CGAUCG,” wherein m C indicates a cytosine base comprising a methyl group at the 5-position.
  • Certain compounds described herein e.g., modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as ( R ) or ( S ), as a or b such as for sugar anomers, or as (D) or (L), such as for amino acids, etc.
  • Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds.
  • Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise.
  • tautomeric forms of the compounds herein are also included unless otherwise indicated.
  • compounds described herein are intended to include corresponding salt forms.
  • the compounds described herein include variations in which one or more atoms are replaced with a nonradioactive isotope or radioactive isotope of the indicated element.
  • compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 3 ⁇ 4 hydrogen atoms.
  • Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2 H or 3 H in place of 3 ⁇ 4, 13 C or 14 C in place of 12 C, 15 N in place of 14 N, 17 0 or 18 0 in place of 16 0, and 33 S, 34 S, 35 S, or 36 S in place of 32 S.
  • non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool.
  • radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.
  • certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphodiester linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” is intended to include all such forms.
  • modified oligonucleotides or oligomeric compounds are in aqueous solution with sodium.
  • modified oligonucleotides or oligomeric compounds are in aqueous solution with potassium.
  • modified oligonucleotides or oligomeric compounds are in PBS.
  • modified oligonucleotides or oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HC1 to achieve a desired pH.
  • a dose may be in the form of a dosage unit.
  • a dose (or dosage unit) of a modified oligonucleotide or an oligomeric compound in milligrams indicates the mass of the free acid form of the modified oligonucleotide or oligomeric compound.
  • the free acid is in equilibrium with anionic and salt forms.
  • the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium-acetate free, anhydrous, free acid.
  • a modified oligonucleotide or an oligomeric compound may be partially or fully de-protonated and in association with Na+ ions.
  • the mass of the protons are nevertheless counted toward the weight of the dose, and the mass of the Na+ ions are not counted toward the weight of the dose.
  • a dose, or dosage unit, of 10 mg of Compound No. 1371311 equals the number of fully protonated molecules that weighs 10 mg. This would be equivalent to 10.59 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 1371311.
  • an oligomeric compound comprises a conjugate group
  • the mass of the conjugate group is included in calculating the dose of such oligomeric compound. If the conjugate group also has an acid, the conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose.
  • Example 1 Effect of 5-10-5 MOE gapmer modified oligonucleotides on human ATXN1 RNA in vitro, single dose
  • Modified oligonucleotides complementary to human ATXN 1 nucleic acid were designed and tested for their single dose effects on ATXN1 mRNA in vitro.
  • the modified oligonucleotides were tested in a series of experiments that had similar culture conditions.
  • the modified oligonucleotides in the tables below are 5-10-5 MOE gapmers with mixed PO/PS intemucleoside linkages.
  • the gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2 -(i-D- deoxynucleosides and the 3’ and 5’ wings each consist of five 2’-MOE modified nucleosides.
  • the motif for the gapmers is (from 5’ to 3’): eeeeedddddddddddeeeee; wherein “d” represents a 2 -(i-D-dcoxvribosyl sugar, and ‘e’ represents a T- MOE modified ribosyl sugar.
  • the intemucleoside linkage motif for the gapmers is (from 5’ to 3’): sooossssssssooss; wherein ‘o’ represents a phosphodiester intemucleoside linkage and ‘s’ represents a phosphorothioate intemucleoside linkage.
  • Each cytosine residue is a 5-methyl cytosine.
  • “Start site” indicates the 5’ -most nucleoside to which the modified oligonucleotide is complementary in the human gene sequence. “Stop site” indicates the 3’ -most nucleoside to which the modified oligonucleotide is complementary in the human gene sequence.
  • Each modified oligonucleotide listed in the Tables below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NM 000332.3), or SEQ ID NO: 2 (the complement of GENBANK Accession No. NC 000006.12 truncated from nucleotides 16296001 to 16764000). ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular gene sequence.
  • ATXN 1 RNA levels were measured by Human ATXN1 primer probe set RTS37573 (forward sequence CATCCAGAGTGCAGAGATAAGC, designated herein as SEQ ID NO: 11; reverse sequence ACTCTACCAAAACTTCAACGCT, designated herein as SEQ ID NO: 12; probe sequence AGAGGATTGAAG ACAGCC AT AGCCC, designated herein as SEQ ID NO: 13).
  • ATXN1 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent ATXN1 RNA levels relative to untreated control cells (%control). Each table represents results from an individual assay plate.
  • the Compound No. marked with an asterisk (*) indicates that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.
  • Example 2 Effect of 5-10-5 MOE gapmer modified oligonucleotides on human ATXN1 RNA in vitro, single dose
  • Modified oligonucleotides complementary to human ATXN 1 nucleic acid were designed and tested for their single dose effects on ATXN1 mRNA in vitro.
  • the modified oligonucleotides were tested in a series of experiments that had similar culture conditions.
  • the modified oligonucleotides in the tables below are 5-10-5 MOE gapmers with mixed intemucleoside linkages.
  • the gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2 -b-D-dcoxy nucleosides and the 3’ and 5’ wings each consist of five 2’-MOE modified nucleosides.
  • the motif for the gapmers is (from 5’ to 3’): eeeeedddddddddddeeeee; wherein “d” represents a 2 -(i-D-dcoxyribosyl sugar, and ‘e’ represents a 2’-MOE modified ribosyl sugar.
  • the intemucleoside linkage motif for the gapmers is (from 5’ to 3’): sooossssssssooss; wherein ‘o’ represents a phosphodiester intemucleoside linkage and ‘s’ represents a phosphorothioate intemucleoside linkage.
  • Each cytosine residue is a 5-methyl cytosine.
  • “Start site” indicates the 5’ -most nucleoside to which the modified oligonucleotide is complementary in the human gene sequence. “Stop site” indicates the 3’ -most nucleoside to which the modified oligonucleotide is complementary in the human gene sequence.
  • Each modified oligonucleotide listed in the Tables below is 100% complementary to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 (GENBANK Accession No. NM 001128164.1). ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular gene sequence.
  • ATXN 1 RNA levels were measured by Human ATXN1 primer probe set RTS37575 (forward sequence GTATAGGCTGAGGCTACCTGT, designated herein as SEQ ID NO: 14; reverse sequence GATCCAGGCTCTTCATGAGG, designated herein as SEQ ID NO: 15; probe sequence ACAGCAGCTCTGGATGAACATTCACT, designated herein as SEQ ID NO: 16).
  • ATXN1 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent ATXN1 RNA levels relative to untreated control cells (% Control).
  • the Compound No. marked with an asterisk (*) indicates that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.
  • Example 3 Effect of modified oligonucleotides on human ATXN1 RNA in vitro, multiple doses
  • Modified oligonucleotides selected from the examples above were tested at various doses in A-431 cells.
  • Cultured A-431 cells at a density of 10,000 cells per well were treated using free uptake with various concentrations of modified oligonucleotide as specified in the tables below.
  • total RNA was isolated from the cells and ATXN 1 RNA levels were measured by quantitative real-time RTPCR.
  • Human ATXN 1 primer probe set RTS37573 was used to measure RNA levels as described above.
  • ATXN1 levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent reduction of the amount of ATXN1 RNA, relative to untreated control.
  • the half maximal inhibitory concentration (IC50) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in excel.
  • Example 4 Design of modified oligonucleotides complementary to a human ATXN1 nucleic acid
  • the compounds in table 53 are 5-10-5 MOE gapmers with mixed intemucleoside linkages.
  • the gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2 ‘ -[1-D-dcoxy nucleosides.
  • the 5’ wing segment consists of five 2’-MOE nucleosides, and the 3 ’ wing segment consists of five 2’-MOE nucleosides.
  • the sugar motif of the gapmers is (from 5’ to 3’): eeeeedddddddddddeeeee; wherein ‘d’ represents a 2 ‘ -[l-D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers have an intemucleoside linkage motif of (from 5’ to 3’): sooosssssssssooss; wherein “s” represents a phosphorothioate intemucleoside linkage and “o” represents a phosphodiester intemucleoside linkage. All cytosine residues are 5-methylcytosines.
  • the compounds in table 54 are 5-10-5 MOE gapmers with mixed intemucleoside linkages.
  • the gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2 -b-D-dcoxy nucleosides the 5’ wing segment consists of five 2’-MOE nucleosides, and the 3’ wing segment consists of five 2’-MOE nucleosides.
  • the sugar motif of the gapmers is (from 5’ to 3’): eeeeedddddddddddeeeee; wherein ‘d’ represents a 2 -(i-D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers have an intemucleoside linkage motif of (from 5’ to 3’): sssosssssssssosss; wherein “s” represents a phosphorothioate intemucleoside linkage and “o” represents a phosphodiester intemucleoside linkage. All cytosine residues are 5-methylcytosines. Table 54
  • the compounds in table 55 are 6-10-4 MOE gapmers with mixed intemucleoside linkages.
  • the gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2 ‘ -[1-D-dcoxy nucleosides.
  • the 5’ wing segment consists of six 2’-MOE nucleosides, and the 3’ wing segment consists of four 2’-MOE nucleosides.
  • the sugar motif of the gapmers is (from 5’ to 3’): eeeeeeddddddddddeeee; wherein ‘d’ represents a 2 ' -(i-D-dcoxvribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers have an intemucleoside linkage motif of (from 5’ to 3’): sooooossssssssoss; wherein “s” represents a phosphorothioate intemucleoside linkage and “o” represents a phosphodiester intemucleoside linkage. All cytosine residues are 5-methylcytosines. Table 55
  • the compounds in table 56 are 5-8-4 mixed MOE/cEt gapmers with mixed intemucleoside linkages.
  • the gapmers are 17 nucleosides in length, wherein the central gap segment consists of eight 2 ‘ -[1-D-dcoxy nucleosides.
  • the 5’ wing segment consists of five 2’-MOE nucleosides, and the 3 ’ wing segment consists of two cEt nucleosides and two 2’- MOE nucleosides.
  • the sugar motif of the gapmers is (from 5’ to 3’): eeeeedddddddddkkee; wherein ‘d’ represents a 2’- b-D-deoxyribosyl sugar moiety, ‘k’ represents a cEt sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers have an intemucleoside linkage motif of (from 5’ to 3’): sssossssssssoss; wherein “s” represents a phosphorothioate intemucleoside linkage and “o” represents a phosphodiester intemucleoside linkage. All cytosine residues are 5-methylcytosines.
  • the compounds in table 57 are 5-8-4 mixed gapmers with mixed intemucleoside linkages.
  • the mixed gapmers have mixed cEt/MOE wings and a 2’-OMe modified nucleoside at position 2 of the gap.
  • the gapmers are 17 nucleosides in length, wherein the 5’ wing segment consists of five 2’-MOE nucleosides, the 3’ wing segment consists of two cEt nucleosides and two 2’-MOE nucleosides.
  • the gap is eight nucleosides in length, and has a nucleoside comprising a 2 ‘ -[l-D-dco.xyribosyl sugar moiety at positions 1, 3, 4, 5, 6, 7, and 8 of the gap (counting from the 5’ end) and 2’-OMe nucleoside at position 2 of the gap (counting from the 5’ end).
  • the sugar motif of the mixed gapmers is (from 5’ to 3’): eeeeedyddddddkkee; wherein ‘d’ represents a 2 ‘ -[l-D-dco.xyribosyl sugar moiety, ‘y’ represents a 2’-0 ⁇ methyl ribose sugar moiety, ‘k’ represents a cEt sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers have an intemucleoside linkage motif of (from 5’ to 3’): sssosssssssoss; wherein “s” represents a phosphorothioate intemucleoside linkage and “o” represents a phosphodiester intemucleoside linkage. All cytosine residues are 5- methylcytosines. Table 57
  • the compounds in table 58 are 5-8-4 MOE gapmers with mixed intemucleoside linkages.
  • the gapmers are 17 nucleosides in length, wherein the central gap segment consists of eight 2 -b-D-dcox nucleosides the 5’ wing segment consists of five 2’ -MOE nucleosides, and the 3’ wing segment consists of four 2’ -MOE nucleosides.
  • the sugar motif of the gapmers is (from 5’ to 3’): eeeeeddddddddeeee; wherein ‘d’ represents a 2 -(i-D-dcox ribos l sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers have an intemucleoside linkage motif of (from 5’ to 3 ’): sssosssssssoss; wherein “s” represents a phosphorothioate intemucleoside linkage and “o” represents a phosphodiester intemucleoside linkage. All cytosine residues are 5-methylcytosines.
  • the compounds in table 59 are 5-10-5 MOE gapmers with mixed intemucleoside linkages.
  • the gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2 -b-D-dcoxy nucleosides the 5’ wing segment consists of five 2’-MOE nucleosides, and the 3’ wing segment consists of five 2’-MOE nucleosides.
  • the sugar motif of the gapmers is (from 5’ to 3’): eeeeeddddddddddeeeee; wherein ‘d’ represents a 2 -(i-D-dcoxvribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers have an intemucleoside linkage motif of (from 5’ to 3’): sooosssssssssooss; wherein “s” represents a phosphorothioate intemucleoside linkage and “o” represents a phosphodiester intemucleoside linkage. All cytosine residues are 5-methylcytosines. Table 59
  • Example 5 Tolerability of modified oligonucleotides complementary to human ATXN1 in rats, long-term assessment
  • modified oligonucleotides described above were tested in Sprague Dawley rats to assess the long-term tolerability of the oligonucleotides.
  • Sprague Dawley rats each received a single intrathecal (IT) delivered dose of 3mg of oligonucleotide or PBS.
  • ITZ intrathecal
  • PBS percutaneous endocal
  • Adverse events were defined as neurological dysfunction not typical in PBS-treated control animals, including, but not limited to: abnormal limb splay, abnormal gait, tremors, abnormal respiration, paralysis, and spasticity. Animals treated with Compound No. 994509, Compound No. 1040500,
  • Compound No. 1041927, Compound No. 1055001, Compound No. 1371311, or Compound No. 1385293 achieved no adverse events for the duration of the study.
  • Example 6 Activity of modified oligonucleotides complementary to human ATXN1 in transgenic mice
  • a transgenic mouse model was developed in the laboratories of Drs. Harry Orr and Michael Koob at the University of Minnesota.
  • the construct contains human Atxnl exon 8, intron 8 and exon 9 including the entire 3’ UTR (Banfi et al. Nat. Genet. 7: 513-520, 1994) (including nucleosides 435531-464889 of SEQ ID NO:2) flanked by Frt sites for FLP recombinase and the selection marker Hygro flanked by LoxN sites for CRE recombinase.
  • the construct was injected into mouse blastocysts.
  • the human sequence of exon 8, intron 8 and exon 9 replace the mouse Atxnl exon 7, intron 7, and exon 8.
  • the Hygro cassette was removed via recombination to generate chimeric mice expressing human coding sequence exon 8 and exon 9. Human RNA expression is found in brain and spinal cord in this model. There is a one base deletion causing a stop codon at amino acid 190, so protein is not generated.
  • ATXN1 transgenic mice were treated with a single ICV bolus of 300 pg of modified oligonucleotide.
  • a group of 3-4 mice received PBS as a negative control on each treatment day, and the PCR values were normalized to the PBS control group for mice treated on the same day.
  • individual mice treated with a given modified oligonucleotide were treated on different days, and the reported results for each modified oligonucleotide in the table below represent the average across 1-3 independent experiments representing 1-5 treated mice for each modified oligonucleotide.
  • mice Two weeks post treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue for realtime qPCR analysis of RNA expression of ATXN1 using primer probe set RTS37573 (described herein above). Results are presented as percent change of RNA, relative to PBS control, normalized to mouse cyclophilin A. Data indicated as “n.d.” (no data) means that no data are available for that tissue for that compound.
  • Example 7 Activity of modified oligonucleotides complementary to human ATXN1 in transgenic mice, multiple doses Modified oligonucleotides described above were tested in the ATXN1 transgenic mice described herein above.
  • ATXN1 transgenic mice were divided into groups of 3-4 mice each. Each mouse received a single ICV bolus of modified oligonucleotide at the doses described in the tables below and were sacrificed two weeks later. A group of 4 mice received PBS as a negative control for each experiment. Each table represents a separate experiment.
  • mice were sacrificed, and RNA was extracted from cortical brain tissue for real-time PCR analysis of measurement of RNA expression of ATXN1 using primer probe set RTS37573. Results are presented as percent change of RNA, relative to PBS control, normalized to mouse cyclophilin A (measured by primer-probe set m_cyclo24 described herein above). ED50 values were calculated in GraphPad Prism. N/A means that an ED50 value could not be reliably calculated for that experiment.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Epidemiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Ophthalmology & Optometry (AREA)
  • Immunology (AREA)
  • Virology (AREA)
  • Inorganic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Saccharide Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/US2021/030203 2020-05-01 2021-04-30 Compounds and methods for modulating atxn1 Ceased WO2021222768A2 (en)

Priority Applications (13)

Application Number Priority Date Filing Date Title
KR1020227041965A KR20230005933A (ko) 2020-05-01 2021-04-30 Atxn1을 조정하는 화합물 및 방법
IL297435A IL297435A (en) 2020-05-01 2021-04-30 Compounds and methods for modulating atxn1
CN202180032525.1A CN116096380B (zh) 2020-05-01 2021-04-30 调节atxn1的化合物和方法
MX2022013707A MX2022013707A (es) 2020-05-01 2021-04-30 Compuestos y metodos para modular atxn1.
JP2022566328A JP7738573B2 (ja) 2020-05-01 2021-04-30 Atxn1を調節するための化合物及び方法
EP21797200.9A EP4143321A4 (en) 2020-05-01 2021-04-30 Compounds and methods for modulating atxn1
AU2021264010A AU2021264010A1 (en) 2020-05-01 2021-04-30 Compounds and methods for modulating ATXN1
CA3181546A CA3181546A1 (en) 2020-05-01 2021-04-30 Compounds and methods for modulating atxn1
BR112022021333A BR112022021333A2 (pt) 2020-05-01 2021-04-30 Compostos e métodos para modular atxn1
US17/751,450 US11542504B2 (en) 2020-05-01 2022-05-23 Compounds and methods for modulating ATXN1
US18/047,973 US12180479B2 (en) 2020-05-01 2022-10-19 Compounds and methods for modulating ATXN1
US18/947,785 US20250297254A1 (en) 2020-05-01 2024-11-14 Compounds and methods for modulating atxn1
JP2025145172A JP2026012176A (ja) 2020-05-01 2025-09-02 Atxn1を調節するための化合物及び方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063019089P 2020-05-01 2020-05-01
US63/019,089 2020-05-01

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US17/751,450 Continuation US11542504B2 (en) 2020-05-01 2022-05-23 Compounds and methods for modulating ATXN1

Publications (2)

Publication Number Publication Date
WO2021222768A2 true WO2021222768A2 (en) 2021-11-04
WO2021222768A3 WO2021222768A3 (en) 2021-12-09

Family

ID=78374018

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/030203 Ceased WO2021222768A2 (en) 2020-05-01 2021-04-30 Compounds and methods for modulating atxn1

Country Status (11)

Country Link
US (3) US11542504B2 (cg-RX-API-DMAC7.html)
EP (1) EP4143321A4 (cg-RX-API-DMAC7.html)
JP (2) JP7738573B2 (cg-RX-API-DMAC7.html)
KR (1) KR20230005933A (cg-RX-API-DMAC7.html)
AU (1) AU2021264010A1 (cg-RX-API-DMAC7.html)
BR (1) BR112022021333A2 (cg-RX-API-DMAC7.html)
CA (1) CA3181546A1 (cg-RX-API-DMAC7.html)
IL (1) IL297435A (cg-RX-API-DMAC7.html)
MX (1) MX2022013707A (cg-RX-API-DMAC7.html)
TW (1) TWI901676B (cg-RX-API-DMAC7.html)
WO (1) WO2021222768A2 (cg-RX-API-DMAC7.html)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11542504B2 (en) 2020-05-01 2023-01-03 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating ATXN1
CN119410579A (zh) * 2024-12-02 2025-02-11 中国医学科学院输血研究所 一种培养nk细胞的方法及应用

Family Cites Families (169)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4500707A (en) 1980-02-29 1985-02-19 University Patents, Inc. Nucleosides useful in the preparation of polynucleotides
US5132418A (en) 1980-02-29 1992-07-21 University Patents, Inc. Process for preparing polynucleotides
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4415732A (en) 1981-03-27 1983-11-15 University Patents, Inc. Phosphoramidite compounds and processes
US4973679A (en) 1981-03-27 1990-11-27 University Patents, Inc. Process for oligonucleo tide synthesis using phosphormidite intermediates
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
DE3329892A1 (de) 1983-08-18 1985-03-07 Köster, Hubert, Prof. Dr., 2000 Hamburg Verfahren zur herstellung von oligonucleotiden
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
USRE34036E (en) 1984-06-06 1992-08-18 National Research Development Corporation Data transmission using a transparent tone-in band system
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
FR2567892B1 (fr) 1984-07-19 1989-02-17 Centre Nat Rech Scient Nouveaux oligonucleotides, leur procede de preparation et leurs applications comme mediateurs dans le developpement des effets des interferons
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
FR2575751B1 (fr) 1985-01-08 1987-04-03 Pasteur Institut Nouveaux nucleosides de derives de l'adenosine, leur preparation et leurs applications biologiques
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5506337A (en) 1985-03-15 1996-04-09 Antivirals Inc. Morpholino-subunit combinatorial library and method
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5405938A (en) 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
EP0260032B1 (en) 1986-09-08 1994-01-26 Ajinomoto Co., Inc. Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
EP0366685B1 (en) 1987-06-24 1994-10-19 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US4924624A (en) 1987-10-22 1990-05-15 Temple University-Of The Commonwealth System Of Higher Education 2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof
ATE151467T1 (de) 1987-11-30 1997-04-15 Univ Iowa Res Found Durch modifikationen an der 3'-terminalen phosphodiesterbindung stabilisierte dna moleküle, ihre verwendung als nukleinsäuresonden sowie als therapeutische mittel zur hemmung der expression spezifischer zielgene
US5403711A (en) 1987-11-30 1995-04-04 University Of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
JPH03503894A (ja) 1988-03-25 1991-08-29 ユニバーシィティ オブ バージニア アランミ パテンツ ファウンデイション オリゴヌクレオチド n‐アルキルホスホラミデート
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
US5194599A (en) 1988-09-23 1993-03-16 Gilead Sciences, Inc. Hydrogen phosphonodithioate compositions
US5256775A (en) 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US5134066A (en) 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5721218A (en) 1989-10-23 1998-02-24 Gilead Sciences, Inc. Oligonucleotides with inverted polarity
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
DE69034150T2 (de) 1989-10-24 2005-08-25 Isis Pharmaceuticals, Inc., Carlsbad 2'-Modifizierte Oligonukleotide
US5264562A (en) 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5177198A (en) 1989-11-30 1993-01-05 University Of N.C. At Chapel Hill Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5130302A (en) 1989-12-20 1992-07-14 Boron Bilogicals, Inc. Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same
US5457191A (en) 1990-01-11 1995-10-10 Isis Pharmaceuticals, Inc. 3-deazapurines
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5623065A (en) 1990-08-13 1997-04-22 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
US5859221A (en) 1990-01-11 1999-01-12 Isis Pharmaceuticals, Inc. 2'-modified oligonucleotides
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US7101993B1 (en) 1990-01-11 2006-09-05 Isis Pharmaceuticals, Inc. Oligonucleotides containing 2′-O-modified purines
US5587470A (en) 1990-01-11 1996-12-24 Isis Pharmaceuticals, Inc. 3-deazapurines
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US6005087A (en) 1995-06-06 1999-12-21 Isis Pharmaceuticals, Inc. 2'-modified oligonucleotides
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5149797A (en) 1990-02-15 1992-09-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
US5220007A (en) 1990-02-15 1993-06-15 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
GB9009980D0 (en) 1990-05-03 1990-06-27 Amersham Int Plc Phosphoramidite derivatives,their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
ES2116977T3 (es) 1990-05-11 1998-08-01 Microprobe Corp Soportes solidos para ensayos de hibridacion de acidos nucleicos y metodos para inmovilizar oligonucleotidos de modo covalente.
US5378825A (en) 1990-07-27 1995-01-03 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs
US5386023A (en) 1990-07-27 1995-01-31 Isis Pharmaceuticals Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling
US5610289A (en) 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5223618A (en) 1990-08-13 1993-06-29 Isis Pharmaceuticals, Inc. 4'-desmethyl nucleoside analog compounds
JPH0874B2 (ja) 1990-07-27 1996-01-10 アイシス・ファーマシューティカルス・インコーポレーテッド 遺伝子発現を検出および変調するヌクレアーゼ耐性、ピリミジン修飾オリゴヌクレオチド
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
MY107332A (en) 1990-08-03 1995-11-30 Sterling Drug Inc Compounds and methods for inhibiting gene expression.
US5177196A (en) 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5214134A (en) 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
JPH06505704A (ja) 1990-09-20 1994-06-30 ギリアド サイエンシズ,インコーポレイテッド 改変ヌクレオシド間結合
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US6582908B2 (en) 1990-12-06 2003-06-24 Affymetrix, Inc. Oligonucleotides
US5948903A (en) 1991-01-11 1999-09-07 Isis Pharmaceuticals, Inc. Synthesis of 3-deazapurines
US5672697A (en) 1991-02-08 1997-09-30 Gilead Sciences, Inc. Nucleoside 5'-methylene phosphonates
US7015315B1 (en) 1991-12-24 2006-03-21 Isis Pharmaceuticals, Inc. Gapped oligonucleotides
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
EP0538194B1 (de) 1991-10-17 1997-06-04 Novartis AG Bicyclische Nukleoside, Oligonukleotide, Verfahren zu deren Herstellung und Zwischenprodukte
US5594121A (en) 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
US5484908A (en) 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
AU3222793A (en) 1991-11-26 1993-06-28 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
TW393513B (en) 1991-11-26 2000-06-11 Isis Pharmaceuticals Inc Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5792608A (en) 1991-12-12 1998-08-11 Gilead Sciences, Inc. Nuclease stable and binding competent oligomers and methods for their use
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US5700922A (en) 1991-12-24 1997-12-23 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
FR2687679B1 (fr) 1992-02-05 1994-10-28 Centre Nat Rech Scient Oligothionucleotides.
US5633360A (en) 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
EP0577558A2 (de) 1992-07-01 1994-01-05 Ciba-Geigy Ag Carbocyclische Nukleoside mit bicyclischen Ringen, Oligonukleotide daraus, Verfahren zu deren Herstellung, deren Verwendung und Zwischenproduckte
US5652355A (en) 1992-07-23 1997-07-29 Worcester Foundation For Experimental Biology Hybrid oligonucleotide phosphorothioates
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
GB9304618D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Chemical compounds
GB9304620D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Compounds
CA2159631A1 (en) 1993-03-30 1994-10-13 Sanofi Acyclic nucleoside analogs and oligonucleotide sequences containing them
HU9501974D0 (en) 1993-03-31 1995-09-28 Sterling Winthrop Inc Oligonucleotides with amide linkages replacing phosphodiester linkages
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5801154A (en) 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
DE733059T1 (de) 1993-12-09 1997-08-28 Univ Jefferson Verbindungen und verfahren zur ortsspezifischen mutation in eukaryotischen zellen
US5446137B1 (en) 1993-12-09 1998-10-06 Behringwerke Ag Oligonucleotides containing 4'-substituted nucleotides
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5625050A (en) 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5646269A (en) 1994-04-28 1997-07-08 Gilead Sciences, Inc. Method for oligonucleotide analog synthesis
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5652356A (en) 1995-08-17 1997-07-29 Hybridon, Inc. Inverted chimeric and hybrid oligonucleotides
CN1120707C (zh) 1995-11-22 2003-09-10 约翰斯·霍普金斯大学 增强生物分子的细胞摄取的配体
USRE44779E1 (en) 1997-03-07 2014-02-25 Santaris Pharma A/S Bicyclonucleoside and oligonucleotide analogues
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
US7572582B2 (en) 1997-09-12 2009-08-11 Exiqon A/S Oligonucleotide analogues
US20030228597A1 (en) 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
US6300319B1 (en) 1998-06-16 2001-10-09 Isis Pharmaceuticals, Inc. Targeted oligonucleotide conjugates
US6043352A (en) 1998-08-07 2000-03-28 Isis Pharmaceuticals, Inc. 2'-O-Dimethylaminoethyloxyethyl-modified oligonucleotides
US7053207B2 (en) 1999-05-04 2006-05-30 Exiqon A/S L-ribo-LNA analogues
US6525191B1 (en) 1999-05-11 2003-02-25 Kanda S. Ramasamy Conformationally constrained L-nucleosides
US7491805B2 (en) 2001-05-18 2009-02-17 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
WO2002058626A2 (en) 2000-10-27 2002-08-01 Baylor College Of Medicine Methods and compositions for the identification and treatment of neurodegenerative disorders
US6426220B1 (en) 2000-10-30 2002-07-30 Isis Pharmaceuticals, Inc. Antisense modulation of calreticulin expression
CN100406065C (zh) 2000-12-01 2008-07-30 细胞工厂治疗公司 糖基化/半乳糖基化肽、双官能接头和核苷酸单体/多聚体的缀合物以及相关的组合物和使用方法
US20030175906A1 (en) 2001-07-03 2003-09-18 Muthiah Manoharan Nuclease resistant chimeric oligonucleotides
US20030158403A1 (en) 2001-07-03 2003-08-21 Isis Pharmaceuticals, Inc. Nuclease resistant chimeric oligonucleotides
US20050042646A1 (en) 2002-08-05 2005-02-24 Davidson Beverly L. RNA interference suppresion of neurodegenerative diseases and methods of use thereof
WO2004041889A2 (en) 2002-11-05 2004-05-21 Isis Pharmaceuticals, Inc. Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
AU2003291755A1 (en) 2002-11-05 2004-06-07 Isis Pharmaceuticals, Inc. Oligomers comprising modified bases for binding cytosine and uracil or thymine and their use
AU2003295600A1 (en) 2002-11-14 2004-06-15 Dharmacon, Inc. Functional and hyperfunctional sirna
US7250496B2 (en) 2002-11-14 2007-07-31 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory genes and uses thereof
US7605249B2 (en) 2002-11-26 2009-10-20 Medtronic, Inc. Treatment of neurodegenerative disease through intracranial delivery of siRNA
US7723509B2 (en) 2003-04-17 2010-05-25 Alnylam Pharmaceuticals IRNA agents with biocleavable tethers
EP1661905B9 (en) 2003-08-28 2012-12-19 IMANISHI, Takeshi Novel artificial nucleic acids of n-o bond crosslinkage type
CA2538252C (en) 2003-09-18 2014-02-25 Isis Pharmaceuticals, Inc. 4'-thionucleosides and oligomeric compounds
US20050244851A1 (en) 2004-01-13 2005-11-03 Affymetrix, Inc. Methods of analysis of alternative splicing in human
US20060148740A1 (en) 2005-01-05 2006-07-06 Prosensa B.V. Mannose-6-phosphate receptor mediated gene transfer into muscle cells
US7569686B1 (en) 2006-01-27 2009-08-04 Isis Pharmaceuticals, Inc. Compounds and methods for synthesis of bicyclic nucleic acid analogs
WO2007090071A2 (en) 2006-01-27 2007-08-09 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
US7666854B2 (en) 2006-05-11 2010-02-23 Isis Pharmaceuticals, Inc. Bis-modified bicyclic nucleic acid analogs
AU2007249349B2 (en) 2006-05-11 2012-03-08 Isis Pharmaceuticals, Inc. 5'-Modified bicyclic nucleic acid analogs
ES2526295T5 (es) 2006-10-18 2021-05-04 Ionis Pharmaceuticals Inc Compuestos antisentido
WO2008101157A1 (en) 2007-02-15 2008-08-21 Isis Pharmaceuticals, Inc. 5'-substituted-2'-f modified nucleosides and oligomeric compounds prepared therefrom
CA2688321A1 (en) 2007-05-30 2008-12-11 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
DK2173760T4 (en) 2007-06-08 2016-02-08 Isis Pharmaceuticals Inc Carbocyclic bicyclic nukleinsyreanaloge
AU2008272918B2 (en) 2007-07-05 2012-09-13 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
KR101654007B1 (ko) 2007-08-15 2016-09-05 아이오니스 파마수티컬즈, 인코포레이티드 테트라하이드로피란 핵산 유사체
WO2009067647A1 (en) 2007-11-21 2009-05-28 Isis Pharmaceuticals, Inc. Carbocyclic alpha-l-bicyclic nucleic acid analogs
WO2009073809A2 (en) 2007-12-04 2009-06-11 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
WO2009100320A2 (en) 2008-02-07 2009-08-13 Isis Pharmaceuticals, Inc. Bicyclic cyclohexitol nucleic acid analogs
DK2356129T3 (da) 2008-09-24 2013-05-13 Isis Pharmaceuticals Inc Substituerede alpha-L-bicykliske nukleosider
US9012421B2 (en) 2009-08-06 2015-04-21 Isis Pharmaceuticals, Inc. Bicyclic cyclohexose nucleic acid analogs
US10913767B2 (en) 2010-04-22 2021-02-09 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising acyclic and abasic nucleosides and analogs
EP2595663A4 (en) 2010-07-19 2014-03-05 Isis Pharmaceuticals Inc MODULATION OF DYSTROPHIA MYOTONICA PROTEIN KINASE (DMPK) EXPRESSION
EP3330377A1 (en) * 2010-08-02 2018-06-06 Sirna Therapeutics, Inc. Rna interference mediated inhibition of catenin (cadherin-associated protein), beta 1 (ctnnb1) gene expression using short interfering nucleic acid (sina)
CA2812046A1 (en) 2010-09-15 2012-03-22 Alnylam Pharmaceuticals, Inc. Modified irna agents
EP2673361B1 (en) 2011-02-08 2016-04-13 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
WO2013033230A1 (en) 2011-08-29 2013-03-07 Isis Pharmaceuticals, Inc. Oligomer-conjugate complexes and their use
WO2013159108A2 (en) 2012-04-20 2013-10-24 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
US9695418B2 (en) 2012-10-11 2017-07-04 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleosides and uses thereof
CN104837996A (zh) 2012-11-15 2015-08-12 罗氏创新中心哥本哈根有限公司 抗apob反义缀合物化合物
DK2992098T3 (da) 2013-05-01 2019-06-17 Ionis Pharmaceuticals Inc Sammensætninger og fremgangsmåder til modulering af hbv- og ttr-ekspression
TW202246503A (zh) * 2013-07-19 2022-12-01 美商百健Ma公司 用於調節τ蛋白表現之組合物
EP3585898A1 (en) * 2017-02-22 2020-01-01 CRISPR Therapeutics AG Materials and methods for treatment of spinocerebellar ataxia type 1 (sca1) and other spinocerebellar ataxia type 1 protein (atxn1) gene related conditions or disorders
TWI901676B (zh) 2020-05-01 2025-10-21 美商Ionis製藥公司 調節atxn1之化合物及方法

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11542504B2 (en) 2020-05-01 2023-01-03 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating ATXN1
US12180479B2 (en) 2020-05-01 2024-12-31 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating ATXN1
CN119410579A (zh) * 2024-12-02 2025-02-11 中国医学科学院输血研究所 一种培养nk细胞的方法及应用

Also Published As

Publication number Publication date
JP2026012176A (ja) 2026-01-23
TWI901676B (zh) 2025-10-21
TW202206596A (zh) 2022-02-16
JP2023524065A (ja) 2023-06-08
AU2021264010A1 (en) 2022-12-08
US12180479B2 (en) 2024-12-31
KR20230005933A (ko) 2023-01-10
BR112022021333A2 (pt) 2022-12-13
EP4143321A2 (en) 2023-03-08
CN116096380A (zh) 2023-05-09
EP4143321A4 (en) 2025-02-19
MX2022013707A (es) 2022-12-07
CA3181546A1 (en) 2021-11-04
US20240067962A1 (en) 2024-02-29
US20220290146A1 (en) 2022-09-15
US11542504B2 (en) 2023-01-03
JP7738573B2 (ja) 2025-09-12
IL297435A (en) 2022-12-01
US20250297254A1 (en) 2025-09-25
WO2021222768A3 (en) 2021-12-09

Similar Documents

Publication Publication Date Title
WO2019217708A1 (en) Compounds and methods for reducing atxn3 expression
EP3918073A1 (en) Compounds and methods for reducing app expression
WO2020106996A1 (en) Compounds and methods for reducing prion expression
AU2020241693B2 (en) Compounds and methods for reducing KCNT1 expression
WO2020061497A1 (en) Compositions and methods for modulation of lmna expression
EP3947684A1 (en) Compounds and methods for modulating ube3a-ats
EP4192476A2 (en) Compounds and methods for modulating scn2a
US20250297254A1 (en) Compounds and methods for modulating atxn1
WO2023092057A1 (en) Compounds and methods for modulating progranulin expression
WO2020132558A1 (en) Compounds and methods for reducing pmp22 expression
WO2020243292A1 (en) Compounds and methods for reducing fus expression
EP3956450B1 (en) Compounds and methods for modulating gfap
EP4164656A2 (en) Compounds and methods for reducing msh3 expression
WO2021263082A2 (en) Compounds and methods for reducing kcnt1 expression
WO2021178769A1 (en) Compounds and methods for modulating kcnq2
EP4172338A2 (en) Compounds and methods for modulating plp1
WO2021102341A2 (en) Compounds for modulating beta globin expression

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21797200

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 3181546

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2022566328

Country of ref document: JP

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112022021333

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 20227041965

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021264010

Country of ref document: AU

Date of ref document: 20210430

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2021797200

Country of ref document: EP

Effective date: 20221201

ENP Entry into the national phase

Ref document number: 112022021333

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20221020

WWG Wipo information: grant in national office

Ref document number: 11202254191Y

Country of ref document: SG

WWP Wipo information: published in national office

Ref document number: 11202254191Y

Country of ref document: SG