WO2021157818A1 - 그래핀 기반 신장 질환 치료용 조성물 - Google Patents

그래핀 기반 신장 질환 치료용 조성물 Download PDF

Info

Publication number
WO2021157818A1
WO2021157818A1 PCT/KR2020/015512 KR2020015512W WO2021157818A1 WO 2021157818 A1 WO2021157818 A1 WO 2021157818A1 KR 2020015512 W KR2020015512 W KR 2020015512W WO 2021157818 A1 WO2021157818 A1 WO 2021157818A1
Authority
WO
WIPO (PCT)
Prior art keywords
quantum dots
graphene quantum
kidney disease
present
chronic kidney
Prior art date
Application number
PCT/KR2020/015512
Other languages
English (en)
French (fr)
Inventor
홍병희
이정표
양승희
리려림
김주희
김동훈
박종보
Original Assignee
바이오그래핀 주식회사
서울대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 바이오그래핀 주식회사, 서울대학교 산학협력단 filed Critical 바이오그래핀 주식회사
Priority to JP2022544194A priority Critical patent/JP2023512960A/ja
Priority to US17/759,220 priority patent/US20230055621A1/en
Priority to CN202080095781.0A priority patent/CN115397437A/zh
Priority to EP20917974.6A priority patent/EP4101456A4/en
Publication of WO2021157818A1 publication Critical patent/WO2021157818A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/44—Elemental carbon, e.g. charcoal, carbon black
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y30/00—Nanotechnology for materials or surface science, e.g. nanocomposites
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00—Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery

Definitions

  • the present invention relates to a pharmaceutical composition for treating kidney disease, including graphene quantum dots (GQDs), which are graphene-based nanomaterials.
  • GQDs graphene quantum dots
  • the kidneys play an important role in maintaining body homeostasis. It regulates the volume of body fluids, the concentration of ions in the blood and the pH, discharges waste products such as metabolic wastes, toxins and drugs, and performs blood pressure control, metabolic and endocrine functions. In addition, the kidney activates vitamin D to help the absorption of calcium in the small intestine and is involved in the synthesis of various hormones.
  • Kidney disease refers to an abnormal condition caused by a decrease in the overall function of the kidney or the failure of the kidney to normally perform secretion, control, metabolism and endocrine functions, and is classified into chronic kidney disease and acute kidney disease.
  • Chronic kidney disease is a serious disease in which the incidence and mortality of cardiovascular disease are 10 times higher than in the age group, and the number of patients suffering from this disease is increasing exponentially in recent years.
  • Chronic kidney disease refers to the gradual loss of kidney function over months or years. Chronic kidney disease can be caused by a variety of causes, including cardiovascular disease, hypertension, diabetes, glomerulonephritis, polycystic kidney disease, and kidney transplant rejection.
  • Kidney damage is associated with the release of cytokines/growth factors such as TGF- ⁇ , Epidermal Growth Factor (EGF) and Platelet Derived Growth Factor (PDGF), and an increase in TGF- ⁇ expression leads to renal fibrosis.
  • TGF- ⁇ 1 induces substrate expression by promoting the activity of fibroblasts and interacting with the TGF- ⁇ receptor.
  • the present inventors tried to develop an optimized graphene-based nanomaterial for treating chronic kidney disease or inhibiting kidney fibrosis, and confirmed the present invention by confirming that graphene quantum dots inhibit kidney fibrosis in chronic kidney disease. completed.
  • an object of the present invention is to provide a pharmaceutical composition for preventing or treating chronic kidney disease comprising graphene quantum dots as an active ingredient.
  • the present invention provides a pharmaceutical composition for preventing or treating chronic kidney disease comprising graphene quantum dots as an active ingredient.
  • the chronic kidney disease may be caused by kidney fibrosis.
  • the chronic kidney disease is End-Stage Kidney Disease (ESKD), Diabetic Nephropathy (DN), IgA Nephropathy (IgAN), HIV-associated nephropathy, Selected from the group consisting of Non-diabetic Chronic Kidney Disease, Focal Segmental Glomerulosclerosis (FSGS), Minimal change disease (MCD) and xanthine oxidase deficiency There may be more than one.
  • EKD End-Stage Kidney Disease
  • DN Diabetic Nephropathy
  • IgAN IgA Nephropathy
  • HIV-associated nephropathy Selected from the group consisting of Non-diabetic Chronic Kidney Disease, Focal Segmental Glomerulosclerosis (FSGS), Minimal change disease (MCD) and xanthine oxidase deficiency There may be more than one.
  • the composition is fibronectin, collagen 1a1 (collagen 1a1), Bcl-2-associated X protein (Bcl-2-associated X protein; Bax), tumor growth factor beta 1 (Transforming growth It may be to reduce the expression of one or more proteins selected from the group consisting of factor- ⁇ 1; TGF- ⁇ 1), Smad2/3, and ⁇ -smooth muscle actin ( ⁇ -SMA).
  • the composition may increase the expression of one or more proteins selected from the group consisting of E-cadherin, Smad7, MnSOD, and SOD1.
  • the graphene quantum dots may have an average diameter of 1 to 5 nm.
  • the graphene quantum dots may have an average height of 0.5 to 2.5 nm.
  • the present invention provides a method for preventing, improving or treating chronic kidney disease, comprising administering to an individual a pharmaceutical composition comprising graphene quantum dots as an active ingredient.
  • the present invention provides the use of a pharmaceutical composition comprising graphene quantum dots as an active ingredient for preventing, improving or treating chronic kidney disease.
  • the present invention provides the use of graphene quantum dots for producing a medicament used for the prevention, improvement or treatment of chronic kidney disease.
  • the pharmaceutical composition comprising graphene quantum dots according to the present invention as an active ingredient suppresses the expression of fibronectin, collagen 1a1, Bax, TGF- ⁇ 1, Smad2/3 and ⁇ -SMA, which are kidney fibrosis-related proteins, in a mouse model of chronic kidney disease. It was confirmed that the expression of E-cadherin, Smad7, MnSOD and SOD1 was increased, thereby inhibiting renal fibrosis. Accordingly, the graphene quantum dots of the present invention are expected to be usefully used for the prevention and treatment of chronic kidney disease caused by kidney fibrosis.
  • 1A is a diagram showing a schematic diagram of graphene quantum dot synthesis according to an embodiment of the present invention.
  • 1b is a view showing a representative HR-TEM image and size distribution of graphene quantum dots according to an embodiment of the present invention.
  • 1c is a view showing a representative AFM image and height distribution of graphene quantum dots according to an embodiment of the present invention.
  • 1D is a view confirming the type of functional group through FT-IR (left) and confirming the Raman effect through Raman spectroscopy (right) according to an embodiment of the present invention.
  • Figure 2 shows the results of measuring the tubular atrophy inhibitory effect of the renal tissue after administration of graphene quantum dots in a mouse model of unilateral ureteral obstruction renal fibrosis according to an embodiment of the present invention through PAS (Periodic Acid-Schiff) staining method.
  • PAS Periodic Acid-Schiff
  • Figure 3a shows the effect of suppressing collagen deposition in kidney tissue after administration of graphene quantum dots in a mouse model of unilateral ureteral obstruction renal fibrosis according to an embodiment of the present invention.
  • Sirius Red, MT (Masson's trichrome) and immunohistochemistry are shown.
  • Figure 3b shows the results of measuring the change in expression of related proteins through qRT-PCR during renal fibrosis after administration of graphene quantum dots in a mouse model of unilateral ureteral obstruction renal fibrosis according to an embodiment of the present invention.
  • Figure 3c shows the results of measuring the expression changes of related proteins through western blot during renal fibrosis after administration of graphene quantum dots in a mouse model of unilateral ureteral obstruction renal fibrosis according to an embodiment of the present invention.
  • Figures 4a and 4b show the results of measuring the effect of TGF- ⁇ 1/Smad signaling improvement through immunohistochemistry (IHC) after administration of graphene quantum dots in a mouse model of unilateral ureteral obstruction renal fibrosis according to an embodiment of the present invention. it has been shown
  • Figure 4c shows the results of measuring the TGF- ⁇ 1/Smad signaling improvement effect through qRT-PCR after administration of graphene quantum dots in a mouse model of unilateral ureteral obstruction renal fibrosis according to an embodiment of the present invention.
  • 4d and 4e show the results of measuring the TGF- ⁇ 1/Smad signaling improvement effect through Western blot after administration of graphene quantum dots in a mouse model of unilateral ureteral obstruction renal fibrosis according to an embodiment of the present invention.
  • 5A and 5B show the results of measuring the apoptosis inhibitory effect of graphene quantum dots during renal fibrosis in the unilateral ureteral obstruction renal fibrosis mouse model according to an embodiment of the present invention through TUNEL analysis.
  • Figure 5c shows the results of measuring the apoptosis inhibitory effect of graphene quantum dots during renal fibrosis in the unilateral ureteral obstruction renal fibrosis mouse model according to an embodiment of the present invention through qRT-PCR.
  • 5d and 5e show the results of measuring the apoptosis inhibitory effect of graphene quantum dots during renal fibrosis in the unilateral ureteral obstruction renal fibrosis mouse model according to an embodiment of the present invention through Western blot.
  • 5f shows the results of measuring the renal damage protective effect of graphene quantum dots during renal fibrosis in the unilateral ureteral obstruction renal fibrosis mouse model according to an embodiment of the present invention through immunofluorescence (IF) analysis.
  • IF immunofluorescence
  • 6A and 6B are immunohistochemistry of 8-OHdG and MnSOD expression levels to confirm the oxidative stress inhibitory effect of graphene quantum dots during renal fibrosis in a mouse model of unilateral ureteral obstruction renal fibrosis according to an embodiment of the present invention.
  • the results measured by (IHC) are shown.
  • 6c shows the results of measuring the SOD1 expression level through qRT-PCR to confirm the oxidative stress inhibitory effect of graphene quantum dots during renal fibrosis in the unilateral ureteral obstruction renal fibrosis mouse model according to an embodiment of the present invention. will be.
  • 7a and 7b show the results of measuring the size and weight change of the kidney by graphene quantum dots in a mouse model of unilateral ischemia-reperfusion progressive renal injury according to an embodiment of the present invention.
  • FIG. 8 is a graph showing the inhibitory effect of tubular atrophy in renal tissue by graphene quantum dots in a mouse model of unilateral ischemia-reperfusion progressive renal injury according to an embodiment of the present invention. The results measured by PAS (Periodic Acid-Schiff) staining are shown.
  • PAS Periodic Acid-Schiff
  • FIG. 9 shows the results of measuring the collagen deposition inhibitory effect of graphene quantum dots by MT (Masson's trichrome) staining in a mouse model of unilateral ischemia-reperfusion progressive renal injury according to an embodiment of the present invention.
  • FIG. 10 shows the results of measuring the expression change of TGF- ⁇ 1 by graphene quantum dots through immunohistochemistry (IHC) in a mouse model of unilateral ischemia-reperfusion progressive renal injury according to an embodiment of the present invention.
  • IHC immunohistochemistry
  • FIG. 11 shows the results of measuring the expression changes of related proteins by graphene quantum dots through western blot during renal fibrosis in the unilateral ischemia-reperfusion advanced renal injury mouse model according to an embodiment of the present invention.
  • FIG. 12 is a graph showing the fibrosis inhibitory effect of recombinant TGF- ⁇ -induced human renal proximal tubule cells (hPTECs) of graphene quantum dots according to an embodiment of the present invention through morphological changes of the cells.
  • hPTECs human renal proximal tubule cells
  • Figure 13a is immunofluorescence (IF) of the expression change of renal fibrosis-related proteins (FN and Col 1a1) by graphene quantum dots in human renal proximal tubule cells (hPTECs) induced with recombinant TGF- ⁇ according to an embodiment of the present invention. ) through the analysis.
  • IF immunofluorescence
  • Figure 13b shows changes in the mRNA expression of renal fibrosis-related proteins (FN, Col 1a1 and E-cad) by graphene quantum dots in human renal proximal tubule cells (hPTECs) induced with recombinant TGF- ⁇ according to an embodiment of the present invention; was shown through qRT-PCR.
  • hPTECs human renal proximal tubule cells
  • FIG. 14a and 14b show the apoptosis inhibitory effect of graphene quantum dots in human renal proximal tubule cells (hPTECs) induced with recombinant TGF- ⁇ according to an embodiment of the present invention by Annexin V/7-Amino-Actinomycin D (7). -AAD) through flow cytometry.
  • the present invention provides a pharmaceutical composition for preventing or treating chronic kidney disease comprising graphene quantum dots as an active ingredient.
  • graphene used in the present invention means that a plurality of carbon atoms are covalently linked to each other to form a polycyclic aromatic molecule, and the covalently linked carbon atoms form a 6-membered ring as a basic repeating unit. It is also possible to further include a single, 5-membered ring and/or 7-membered ring.
  • graphene quantum dots As used herein, the term “graphene quantum dots (GQDs)” refers to graphene having nano-sized fragments.
  • the graphene quantum dots of the present invention may exist in solid or liquid form.
  • Solvates may include non-aqueous solvents such as ethanol, isopropanol, DMSO, acetic acid, ethanolamine and ethyl acetate, or may include water as the solvent incorporated into the crystalline lattice.
  • Solvates, in which water is the solvent incorporated into the crystalline lattice, are typically referred to as “hydrates”.
  • the present invention includes all such solvates.
  • the chronic kidney disease may be caused by renal fibrosis, and the chronic kidney disease is end-stage kidney disease (ESKD), diabetic nephropathy (DN), IgA nephropathy ( IgA Nephropathy (IgAN), HIV-associated nephropathy, Non-diabetic Chronic Kidney Disease, Focal Segmental Glomerulosclerosis (FSGS), Minimal change disease (MCD) ) and may be at least one selected from the group consisting of xanthine oxidase deficiency, but is not limited thereto.
  • EKD end-stage kidney disease
  • DN diabetic nephropathy
  • IgA Nephropathy IgA Nephropathy
  • HIV-associated nephropathy Non-diabetic Chronic Kidney Disease
  • FGS Focal Segmental Glomerulosclerosis
  • MCD Minimal change disease
  • the pharmaceutical composition according to the present invention may further include suitable carriers, excipients and diluents commonly used in the preparation of pharmaceutical compositions.
  • the excipient may be, for example, at least one selected from the group consisting of a diluent, a binder, a disintegrant, a lubricant, an adsorbent, a humectant, a film-coating material, and a controlled-release additive.
  • the pharmaceutical composition according to the present invention can be prepared according to a conventional method according to a conventional method, such as powders, granules, sustained-release granules, enteric granules, liquids, eye drops, elsilic, emulsions, suspensions, alcohols, troches, fragrances, and limonaade.
  • a conventional method such as powders, granules, sustained-release granules, enteric granules, liquids, eye drops, elsilic, emulsions, suspensions, alcohols, troches, fragrances, and limonaade.
  • tablets, sustained release tablets, enteric tablets, sublingual tablets, hard capsules, soft capsules, sustained release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, perfusates, Warnings, lotions, pasta, sprays, inhalants, patches, sterile injection solutions, or external preparations such as aerosols can be formulated and used, and the external preparations are creams, gels, patches, sprays, ointments, warning agents , lotion, liniment, pasta, or cataplasma.
  • Carriers, excipients and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.
  • the liquid additives according to the present invention include water, dilute hydrochloric acid, dilute sulfuric acid, sodium citrate, monostearate sucrose, polyoxyethylene sorbitol fatty acid esters (Twinester), polyoxyethylene monoalkyl ethers, lanolin ethers, Lanolin esters, acetic acid, hydrochloric acid, aqueous ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethyl cellulose, sodium carboxymethyl cellulose, and the like can be used.
  • sucrose solution other sugars or sweeteners may be used, and if necessary, a fragrance, colorant, preservative, stabilizer, suspending agent, emulsifying agent, thickening agent, etc. may be used.
  • Purified water may be used in the emulsion according to the present invention, and if necessary, an emulsifier, preservative, stabilizer, fragrance, etc. may be used.
  • Suspending agents such as acacia, tragacantha, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose, 1828, 2906, and 2910 may be used in the suspending agent according to the present invention, If necessary, surfactants, preservatives, stabilizers, colorants, and fragrances may be used.
  • Injectables according to the present invention include distilled water for injection, 0.9% sodium chloride injection, ring gel injection, dextrose injection, dextrose + sodium chloride injection, PEG (PEG), lactated ring gel injection, ethanol, propylene glycol, non-volatile oil-sesame oil , solvents such as cottonseed oil, peanut oil, soybean oil, corn oil, ethyl oleate, isopropyl myristate, and benzene benzoate; Solubilizing aids such as sodium benzoate, sodium salicylate, sodium acetate, urea, urethane, monoethylacetamide, butazolidine, propylene glycol, tweens, nijeongtinamide, hexamine, and dimethylacetamide; Weak acids and their salts (acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, buffers such as albumin, pepton
  • the suppository according to the present invention includes cacao fat, lanolin, Witepsol, polyethylene glycol, glycerogelatin, methyl cellulose, carboxymethyl cellulose, a mixture of stearic acid and oleic acid, Subanal, cottonseed oil, peanut oil, palm oil, cacao butter + Cholesterol, Lecithin, Lanet Wax, Glycerol Monostearate, Tween or Span, Imhausen, Monolene (Propylene Glycol Monostearate), Glycerin, Adeps Solidus, Butyrum Tego -G), Cebes Pharma 16, Hexalide Base 95, Cotomar, Hydroxote SP, S-70-XXA, S-70-XX75 (S-70-XX95), Hydro Hydrokote 25, Hydrokote 711, Idropostal, Massa estrarium, A, AS, B, C, D, E, I, T, Massa-MF, Masupol, Masupol-15, Neos
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations include at least one excipient in the extract, for example, starch, calcium carbonate, sucrose ) or lactose, gelatin, etc.
  • excipients for example, starch, calcium carbonate, sucrose ) or lactose, gelatin, etc.
  • lubricants such as magnesium stearate talc are also used.
  • Liquid formulations for oral administration include suspensions, internal solutions, emulsions, syrups, etc.
  • various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories.
  • Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • composition according to the present invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type, severity, drug activity, and type of the patient's disease; Sensitivity to the drug, administration time, administration route and excretion rate, treatment period, factors including concurrent drugs and other factors well known in the medical field may be determined.
  • the pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or may be administered in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered single or multiple. In consideration of all of the above factors, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, which can be easily determined by a person skilled in the art to which the present invention pertains.
  • the pharmaceutical composition of the present invention may be administered to an individual by various routes. All modes of administration can be envisaged, for example, oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, paraspinal (intrathecal) injection, sublingual administration, buccal administration, rectal insertion, vaginal It can be administered according to internal insertion, ocular administration, ear administration, nasal administration, inhalation, spraying through the mouth or nose, skin administration, transdermal administration, and the like.
  • the pharmaceutical composition of the present invention is determined according to the type of drug as an active ingredient along with several related factors such as the disease to be treated, the route of administration, the patient's age, sex, weight, and the severity of the disease.
  • “individual” means a subject in need of treatment for a disease, and more specifically, human or non-human primates, mice, rats, dogs, cats, horses, cattle, etc. means the mammals of
  • administration means providing a predetermined composition of the present invention to an individual by any suitable method.
  • prevention means any action that inhibits or delays the onset of a desired disease
  • treatment means that the desired disease and metabolic abnormalities are improved or It means all actions that are advantageously changed
  • improvement means all actions that reduce the parameters related to the desired disease, for example, the degree of symptoms by administration of the composition according to the present invention.
  • the therapeutically effective amount is not particularly limited, but preferably 5 mg/kg to 50 mg/kg, more preferably 10 mg/kg to 40 mg/kg and most preferably 20 mg/kg to 30 mg/kg.
  • the composition is fibronectin (Fibronectin), collagen 1a1 (collagen 1a1), Bcl-2 related X protein (Bcl-2-associated X protein; Bax), tumor growth factor beta 1 (Transforming growth factor- ⁇ 1;
  • fibronectin Fibronectin
  • collagen 1a1 collagen 1a1
  • Bcl-2 related X protein Bcl-2-associated X protein
  • Bax tumor growth factor beta 1
  • TGF- ⁇ 1 TGF- ⁇ 1
  • Smad2/3 and ⁇ -smooth muscle actin ⁇ -SMA
  • the composition can prevent or treat chronic kidney disease caused by kidney fibrosis by increasing the expression of one or more proteins selected from the group consisting of E-cadherin, Smad7, MnSOD and SOD1. there is.
  • fibronectin is an extracellular matrix glycoprotein that binds to integrin, a transmembrane receptor protein, and is known to be mainly expressed by the activity of fibroblasts, and various organs It is mainly expressed in the early stages of the fibrosis process.
  • ⁇ -SMA smooth muscle actin
  • E-cadherin is one of the cell adhesion molecules, and plays an important role in forming an adhesion junction (adherens junction) for adhesion between cells. It has a length of about 720-750 amino acids and is composed of a small cytoplasmic portion, a transmembrane portion and a large extracellular portion, which is lost by TGF- ⁇ 1, which induces fibrosis, and loss of E-cadherin has been shown to cause fibrosis. is known
  • tumor growth factor beta 1 Transforming growth factor- ⁇ 1; TGF- ⁇ 1
  • TGF- ⁇ 1 Transforming growth factor- ⁇ 1
  • TGF- ⁇ 1 Transforming growth factor- ⁇ 1
  • TGF- ⁇ 1 Tumor growth factor- ⁇ 1
  • Smad2/3 is a major signal transducer for the receptor of the TGF- ⁇ superfamily, and constitutes a structurally similar protein group.
  • Smad7 inhibits TGF- ⁇ signaling by preventing the formation of the Smad2/Smad4 complex that initiates TGF- ⁇ signaling. It interacts with the activated TGF- ⁇ type I receptor, blocking the binding, phosphorylation and activation of Smad2.
  • 8-hydroxy-2'-deoxyguanosine (8-OHdG) is an oxidized derivative of deoxyguanosine produced by oxidation of DNA.
  • the expression level of 8-OHdG in the cell indicates the level of oxidative stress.
  • MnSOD manganese superoxide dismutase
  • SOD1 superoxide dismutase 1
  • the term “expression” refers to a process in which a polypeptide is produced from a structural gene. The process involves the transcription of the gene into mRNA, and the translation of such mRNA into the polypeptide(s).
  • PCR polymerase chain reaction
  • reverse transcription polymerase chain reaction reverse transcription polymerase chain reaction
  • RT-PCR competitive reverse transcription polymerase reaction
  • Competitive RTPCR real-time PCR
  • quantitative PCR quantitative PCR
  • RNase protection assay RNase protection assay
  • Northern blotting or a method such as a DNA chip
  • mRNA expression level can be measured using real-time PCR (quantitative PCR), but is not limited thereto.
  • a method known in the art may be used, for example, Western blotting, ELISA (enzyme linked immunosorbent assay, ELISA), radioimmunity. Radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, Immunoprecipitation Assay, Complement Fixation Assay), flow cytometry (Fluorescence Activated Cell Sorter, FACS), or a protein chip (protein chip), but is not limited thereto.
  • the graphene quantum dots may have an average diameter (lateral size) of 1 to 5 nm, and an average height (height) of 0.5 to 2.5 nm.
  • the present invention provides a method for preventing, improving or treating chronic kidney disease, comprising administering to an individual a pharmaceutical composition comprising graphene quantum dots as an active ingredient.
  • the present invention provides the use of a pharmaceutical composition comprising graphene quantum dots as an active ingredient to prevent, improve or treat chronic kidney disease.
  • the present invention provides the use of graphene quantum dots for producing a medicament used for the prevention, improvement or treatment of chronic kidney disease.
  • graphene quantum dots were prepared, and characteristics were analyzed by confirming the size and types of functional groups of the graphene quantum dots (see Example 1).
  • Carbon fiber was put in a strong acid solution mixed with sulfuric acid and nitric acid in a 3:1 ratio, and then heated at 80° C. for 24 hours (thermo-oxidation process). After dilution of the solution, the acid was removed by dialysis against a regenerated nitrocellulose membrane (Cat#: 06-680-2G; MWCO 1,000 Daltons; Fisher Sicentific) and a porous inorganic membrane filter (Cat#: 6809-5002; Whatman-Anodisc) 47; GE Healthcare) was vacuum-filtered and then freeze-dried to prepare graphene quantum dots in powder form. The graphene quantum dot powder was redispersed in distilled water and used for the experiment (FIG. 1a).
  • a regenerated nitrocellulose membrane Cat#: 06-680-2G; MWCO 1,000 Daltons; Fisher Sicentific
  • a porous inorganic membrane filter Cat#: 6809-5002; Whatman-Anodisc 47; GE Healthcare
  • the diameter was measured by high-resolution transmission electron microscopy (HR-TEM), the height was measured by force microscopy (AFM), and Fourier-transform infrared spectroscopy (FT-IR). ) to confirm the type of functional group.
  • HR-TEM high-resolution transmission electron microscopy
  • AFM force microscopy
  • FT-IR Fourier-transform infrared spectroscopy
  • AFM a sample was prepared by dropping a graphene quantum dot solution on a 1x1 Si wafer and drying, and analyzed in contact mode using AFM (Park Systems, Suwon, Korea).
  • the Raman effect was prepared by drying a graphene quantum dot solution on a 1x1 Si wafer to prepare a sample, and the spectrum was measured by a Raman spectrometer (Micro-Raman spectrometer, Renishaw, UK) with a 514 nm laser.
  • the diameter of the graphene quantum dots was measured to be 2.20 nm (Fig. 1b) and the height was 1.42 nm (Fig. 1c).
  • a wavenumber corresponding to was observed at 1620 cm -1 (Fig. 1d left).
  • graphene's D band (1400 cm -1 ) and G band (1600 cm -1 ) were confirmed ( FIG. 1d right).
  • mice 7-week-old male mice (C57BL/6 mice) were anesthetized by intraperitoneal administration of Zoletil (30 mg/kg) and Rompun (10 mg/kg). After tying the proximal part of the ureter with 4-0 silk at 1-2 mm intervals, an incision was made between them to prepare a mouse unilateral ureteral obstruction (UUO) model, an animal experimental model for chronic kidney disease.
  • the graphene quantum dots according to Example 1 were administered to the mouse at a dose of 20 mg/kg/day one day before, 2 days, and 6 days after surgery, after tail vein administration, the mouse was sacrificed on the 10th day of the UUO procedure, and the kidneys were removed. Induction of renal fibrosis was observed.
  • the excised kidneys were fixed in 4% paraformaldehyd at 4 °C for 24 hours and embedded in paraffin. After dehydration, paraffin blocks were cut into 4 ⁇ m sections. Sections were placed in an oven at 60° C. for 1 hour, deparaffinized with xylene and ethanol, and PAS staining was performed according to the method of the Periodic Acid Schiff Stain Kit (ScyTek; Logan, Utah, USA).
  • Kidney tissue samples were prepared in the same manner as in Experimental Example 1-2, ScyTek (Logan, Utah, USA) Sirius Red is Picro-Sirius Red Stain Kit (For Collagen), MT stain is Trichrome Stain Kit (Modified Masson's) Staining was performed according to the method of
  • Col 1a1 For immunohistochemical analysis, a kidney tissue sample was prepared in the same manner as above, and endogenous peroxide enzyme and endogenous peroxide enzyme and Ten non-specific expression was blocked. Thereafter, the expression of Col 1a1 was evaluated by incubation overnight at 4° C. with the primary antibody, Col 1a1 (Abcam; ab21286) antibody.
  • Quantitative real-time (qRT)-PCR and Western blot were performed to analyze changes in protein expression associated with UUO-induced renal fibrosis.
  • Trizol reagent Bioline; Luckenwalde, Germany
  • Trizol reagent Bioline; Luckenwalde, Germany
  • the quality and concentration of RNA extracts were measured by spectrophotometry at 260 and 280 nm.
  • each sample at the same concentration was reverse transcribed into cDNA using a synthesis kit and amplification equipment (C1000TM, Thermal Cycle, BIO-RAD).
  • C1000TM synthesis kit and amplification equipment
  • the same concentration of cDNA was added to TaqMan probe or SYBR Green primer together with PCR master mixture, and then measured using LightCycler480 instrument II (Roche; Pleasanton, CA, USA).
  • the relative expression levels of each gene were calculated using a comparative threshold (CT) cycle (2 - ⁇ CT).
  • CT comparative threshold
  • proteins extracted from cells and tissues were prepared as proteins for electrophoresis, and then electrophoresis and membrane transfer were performed. After transfer, the membranes were incubated for at least 1 hour in blocking buffer, and then primary antibodies FN (Santa cruz, sc-8422), Col 1a1 (Abcam, ab21286), E-cad (Abcam, ab11512), ⁇ -SMA at 4°C. (Abcam, ab5694) and GAPDH (Cell signaling technology, 2118) were incubated overnight. The membrane was then washed 3 times for 10 minutes with TBST buffer.
  • the membrane was incubated in blocking buffer containing anti-rabbit IgG, HRP-linked antibody, or anti-mouse IgG, HRP-linked antibody (both Cell Signaling Technology; Danvers, MA, USA). After washing, the membrane was developed with a western Bright ECL kit (Advansta; San Jose, CA, USA) in a Luminescent Image Analyzer LAS4000 system (Fuji Film; Dusseldorf, Germany).
  • ECM extracellular matrix
  • FN fibronectin
  • Col 1a1 collagen 1a1
  • ⁇ -SMA ⁇ -smooth muscle actin
  • TGF- ⁇ 1/Smad signaling pathway is known to be mainly associated with renal fibrosis, immunohistochemistry (IHC), qRT-PCR and Western Blots were performed.
  • TGF- ⁇ 1 (Abcam, ab92486) was used as the primary antibody.
  • TUNEL assay was performed to detect apoptosis markers by TUNEL assay from paraffin-embedded kidney tissue sections using an apoptosis detection kit (ApopTag® Plus Peroxidase In Situ Apoptosis Kit, Merck Millipore; Billerica, MA, USA). Deparaffinize the paraffin sections, incubate with proteinase K (Dako; Carpinteria, CA, USA), and incubate the sections with the enzyme terminal deoxynucleotide transferase (TdT, used diluted in reaction buffer at 37 °C for 1 h). Incubate at 37 °C for 30 min. And, it was combined with anti-digoxigenin (Roche; Mannheim, Germany).
  • Nuclei were counterstained with DAPI. The degree of apoptosis was assessed in a blinded manner by averaging the total number of apoptotic cells in 10 randomly selected regions observed in a field of view at ⁇ 200 magnification in each slice.
  • Primer/Probe order Species SEQ ID NO: Bax Primer1 GTTCCCGAAGTAGGAGAGGA mouse 9 Bax Primer2 CTAAAGTGCCCCGAGCTGAT mouse 10 Bax Probe /56-FAM/AAGTCCAGT/ZEN/GTCCAGCCCATGATG/3IABkFQ/ mouse 11
  • kidney tissue sections were incubated overnight at 4 °C with primary antibodies AQP1 (Abcam, ab15080) and NGAL (Santa cruz, sc-515876) in antibody dilution buffer. After that, sufficient amounts of Goat-anti-rabbit Alexa Fluor488 and Goat-anti-mouse Alexa Fluor555 (both Invitrogen; OR, USA) secondary antibodies were added to cover the sections and incubated for 30 min at room temperature in the dark. Next, slides and counterstaining were mounted using a mounting solution containing 4',6-Diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific; Waltham, MA, USA). High-quality fluorescence images were obtained using confocal microscopy (Leica TCS SP8 STED CW; Wetzlar, Germany).
  • DAPI 4',6-Diamidino-2-phenylindole
  • graphene quantum dots reduced Bcl2-related X protein (Bax) at both mRNA and protein levels (Fig. 5c, Fig. 5d and Fig. 5e). However, there was no significant difference in Bcl2 (Fig. 5d and Fig. 5e), which means that graphene quantum dots inhibit apoptosis by inhibiting the production of proapoptotic factors, rather than restoring the anti-apoptosis protein.
  • NGAL neutrophil gelatinase-associated lipocalin
  • AQP1 aquaporin
  • ROS reactive oxygen species
  • mice 7-week-old male mice (C57BL/6 mice) were anesthetized by intraperitoneal administration of Zoletil (30 mg/kg) and Rompun (10 mg/kg), and the left flank was incised to expose the pedicle of the left kidney. After ligation of blood vessels with microvascular clamp, reperfusion was performed 26 minutes later to prepare a unilateral IRI progressive renal injury mouse model.
  • the graphene quantum dots according to Example 1 were administered to the mouse at a dose of 20 mg/kg one day before surgery, 3 days, 7 days, 14 days, 21 days, and 28 days after the tail vein administration, and then 6 weeks after the operation. The kidneys were sacrificed and the induction of fibrosis of the kidneys was observed.
  • the reduction in the size and weight of the kidney is a typical characteristic of UIRI induction.
  • the left kidney was significantly atrophied in the UIRI experimental group, but the atrophy was decreased in the group administered with graphene quantum dots and the weight was also measured higher than in the UIRI experimental group. was confirmed ( FIGS. 7A and 7B ).
  • the experimental method was performed in the same manner as in Experimental Example 1-2.
  • Kidney tissue samples were prepared in the same manner as in Experimental Example 1-2, and MT staining was performed according to the method of Trichrome Stain Kit (Modified Masson's).
  • Immunohistochemistry was performed to analyze the expression change of TGF- ⁇ 1, a profibrotic factor, in the control group and the experimental group.
  • TGF- ⁇ 1 (Abcam, ab92486) was used as the primary antibody.
  • hPTECs human proximal tubular cells
  • TGF- ⁇ R&D; Minneapolis, MN, USA
  • the control group was treated only with graphene quantum dots to observe whether the graphene quantum dots were toxic to cells.
  • EMT epithelial-mesenchymal transition
  • kidney fibrosis-related protein in the control group and the experimental group, immunofluorescence (IF) analysis and qRT-PCR were performed.
  • IF assay cells were fixed with 4% paraformaldehyde at room temperature for 10 min, and primary antibodies Col 1a1 (Abcam, ab21286) and FN (Santa cruz, sc-8422) were mixed with 4% BSA blocking buffer in 1% BSA blocking buffer. After overnight co-incubation at °C, Donkey-anti-mouse Alexa Fluor488 and Donkey-anti-goat Alexa Fluor555 were combined with conjugated secondary antibodies (both from Life Technologies; Waltham, MA, USA). High-quality fluorescence images were obtained using confocal microscopy (Leica TCS SP8 STED CW; Wetzlar, Germany).
  • the pharmaceutical composition comprising the graphene quantum dots according to the present invention as an active ingredient reduces the expression of fibronectin, collagen 1a1, Bax, TGF- ⁇ 1, Smad2/3 and ⁇ -SMA, which are proteins related to kidney fibrosis, while reducing the expression of E-cadherin.
  • Smad7, MnSOD, and SOD1 can inhibit renal fibrosis by increasing the expression, so it is expected to be usefully used for the prevention and treatment of chronic kidney disease induced by renal fibrosis.
  • alpha-smooth muscle actin (alpha-SMA) Forward
  • alpha-smooth muscle actin alpha-SMA

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Nanotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Urology & Nephrology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Inorganic Chemistry (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Condensed Matter Physics & Semiconductors (AREA)
  • Materials Engineering (AREA)
  • Composite Materials (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Medical Informatics (AREA)
  • Molecular Biology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 그래핀 양자점을 유효성분으로 포함하는 만성 신장 질환의 예방 또는 치료용 약학적 조성물에 관한 것으로, 본 발명에 따른 그래핀 양자점은 신장 섬유화 관련 단백질인 피브로넥틴, 콜라겐 1a1, Bax, TGF-β1, Smad2/3 및 α-SMA 등의 발현을 감소시키고, E-cadherin, Smad7, MnSOD, 및 SOD1의 발현을 증가시키는 효과를 냄으로써 신장 섬유화를 억제하는 것을 확인하였다. 이에 본 발명의 그래핀 양자점은 신장 섬유화에 의해 유발되는 만성 신장 질환에 대한 치료제 또는 개선제 개발 분야에서 유용하게 이용될 수 있을 것으로 기대된다.

Description

그래핀 기반 신장 질환 치료용 조성물
본 발명은 그래핀(Graphene) 기반의 나노물질인 그래핀 양자점(Graphene quantum dots, GQDs)을 포함하는 신장 질환을 치료하기 위한 약학적 조성물에 관한 것이다.
본 발명은 2020년 02월 05일에 출원된 한국특허출원 제10-2020-0013989호에 기초한 우선권을 주장하며, 해당 출원의 명세서 및 도면에 개시된 모든 내용은 본 출원에 원용된다.
신장은 신체의 항상성을 유지하는 데에 중요한 역할을 한다. 체액의 부피, 혈액 내 이온 농도 및 pH를 조절하고, 대사 폐기물, 독소 및 약물과 같은 노폐물을 배출하며, 혈압 제어, 대사 및 내분비 기능을 수행한다. 또한, 신장은 비타민 D를 활성화하여 소장에서 칼슘의 흡수를 돕고 다양한 호르몬의 합성에 관여한다.
신장 질환은 신장의 전반적인 기능이 낮아지거나, 신장이 분비, 제어, 대사 및 내분비 기능을 정상적으로 수행하지 못함으로 인해 발생되는 비정상적인 상태를 의미하며, 만성 신장 질환 및 급성 신장 질환으로 분류된다.
만성 신장 질환은 심혈관 질환 발병율과 사망률이 연령대조군 보다 10배 이상 높은 심각한 질환으로, 최근 들어 이 질환을 겪는 환자가 기하급수적으로 증가하고 있다.
만성 신장 질환은 수 개월 또는 수 년 동안 신장 기능이 점차적으로 상실되는 것을 의미한다. 만성 신장 질환은 심혈관 질환, 고혈압, 당뇨병, 사구체신염, 다낭성 신장 질환 및 신장 이식 거부 반응 등 다양한 원인에 의해 발생될 수 있다.
신장 손상은 TGF-β, EGF (Epidermal Growth Factor) 및 PDGF (Platelet Derived Growth Factor)와 같은 사이토카인/성장 인자의 방출과 관련되며, TGF-β 발현의 증가는 신장 섬유화로 이어지게 된다. TGF-β1은 섬유아세포의 활성을 촉진하고 TGF-β 수용체와 상호작용함으로써 기질 발현을 유도한다.
사구체 경화증 및 세뇨관의 위축, 간질성 섬유화는 만성 신장 질환의 공통적인 징후이다. 또한 세포 외 매트릭스(기질) 성분의 과도한 축적 및 침착이 발생한다. 만성콩팥병은 결과적으로 말기 신부전으로 이어져 투석 또는 신장 이식을 필요로 하게 된다. 그러나 아직까지 만성콩팥병의 악화를 늦추는 치료법은 없는 실정이다.
한편, 신장 질환을 치료하기 위한 많은 천연물이나 화학약품 등이 제시된 바가 있으나 현재 치료 효능이 제한되어 있다. 새로운 치료제로 생명과학에서의 나노 물질 적용에 대한 연구가 많이 진행되고 있지만 그래핀 기반 나노 물질을 응용하여 신장 질환을 치료하는 기술은 제시되지 않았다.
본 발명자들은 만성 신장 질환을 치료하기 위한, 또는 신장 섬유화를 억제하기 위한 최적화된 그래핀 기반의 나노 물질을 개발하고자 하였으며, 그래핀 양자점이 만성 신장 질환에서 신장 섬유화를 억제하는 것을 확인함으로써 본 발명을 완성하였다.
이에, 본 발명의 목적은 그래핀 양자점을 유효성분으로 포함하는 만성 신장 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
그러나, 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 본 발명이 속하는 기술 분야의 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
상기와 같은 목적을 달성하기 위해 본 발명은 그래핀 양자점을 유효성분으로 포함하는 만성 신장 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 일 구현예로서, 상기 만성 신장 질환은 신장 섬유화에 의해 유발되는 것일 수 있다.
본 발명의 다른 구현예로서, 상기 만성 신장 질환은 말기 신장 질환(End-Stage Kidney Disease; ESKD), 당뇨병성 신증(Diabetic Nephropathy; DN), IgA 신증(IgA Nephropathy; IgAN), HIV-관련 신증, 비-당뇨병성 만성 신장 질환(Non-diabetic Chronic Kidney Disease), 국소분절 사구체경화증(Focal Segmental Glomerulosclerosis; FSGS), 미세변화형 신증후군(Minimal change disease; MCD) 및 크산틴 옥시다아제 결핍증으로 이루어진 군으로부터 선택되는 하나 이상일 수 있다.
본 발명의 또 다른 구현예로서, 상기 조성물은 피브로넥틴(Fibronectin), 콜라겐 1a1(collagen 1a1), Bcl-2 관련 X 단백질(Bcl-2-associated X protein; Bax), 종양성장인자 베타1(Transforming growth factor-β1; TGF-β1), Smad2/3 및 알파 평활근 액틴(α-smooth muscle actin; α-SMA)으로 이루어진 군으로부터 선택되는 하나 이상의 단백질의 발현을 감소시키는 것일 수 있다.
본 발명의 또 다른 구현예로서, 상기 조성물은 E-카드헤린(E-cadherin), Smad7, MnSOD, 및 SOD1로 이루어진 군으로부터 선택되는 하나 이상의 단백질의 발현을 증가시키는 것일 수 있다.
본 발명의 또 다른 구현예로서, 상기 그래핀 양자점은 평균 직경이 1 내지 5 nm 인 것일 수 있다.
본 발명의 또 다른 구현예로서, 상기 그래핀 양자점은 평균 높이가 0.5 내지 2.5 nm 인 것일 수 있다.
또한, 본 발명은 그래핀 양자점을 유효성분으로 포함하는 약학적 조성물을 개체에 투여하는 단계를 포함하는, 만성 신장 질환의 예방, 개선 또는 치료 방법을 제공한다.
또한, 본 발명은 그래핀 양자점을 유효성분으로 포함하는 약학적 조성물의, 만성 신장 질환 예방, 개선 또는 치료 용도를 제공한다.
또한, 본 발명은 그래핀 양자점의, 만성 신장 질환 예방, 개선 또는 치료에 이용되는 약제를 생산하기 위한 용도를 제공한다.
본 발명에 따른 그래핀 양자점을 유효성분으로 포함하는 약학적 조성물은 만성 신장 질환 마우스 모델에서 신장 섬유화 관련 단백질인 피브로넥틴, 콜라겐 1a1, Bax, TGF-β1, Smad2/3 및 α-SMA 등의 발현을 감소시키고, E-cadherin, Smad7, MnSOD 및 SOD1의 발현을 증가시키는 것을 확인하여 신장 섬유화를 억제하는 것을 확인하였다. 이에 본 발명의 그래핀 양자점은 신장 섬유화에 의해 유발되는 만성 신장 질환의 예방 및 치료에 유용하게 이용될 것으로 기대된다.
도 1a는 본 발명의 일 구현예에 따른 그래핀 양자점 합성의 개략도를 나타낸 도면이다.
도 1b는 본 발명의 일 구현예에 따른 그래핀 양자점의 대표적인 HR-TEM 이미지 및 크기 분포를 나타낸 도면이다.
도 1c는 본 발명의 일 구현예에 따른 그래핀 양자점의 대표적인 AFM 이미지 및 높이 분포를 나타낸 도면이다.
도 1d는 본 발명의 일 구현예에 따른 FT-IR을 통해 작용기의 종류를 확인(좌측) 및 라만 분광기를 통한 라만 효과를 확인한 도면(우측)이다.
도 2는 본 발명의 일 구현예에 따른 일측요관폐색 신장섬유화 마우스 모델에서 그래핀 양자점의 투여 후 신장조직의 세뇨관 위축 억제 효과를 PAS(Periodic Acid-Schiff) 염색법을 통해 측정한 결과를 나타낸 것이다.
도 3a는 본 발명의 일 구현예에 따른 일측요관폐색 신장섬유화 마우스 모델에서 그래핀 양자점의 투여 후 신장조직의 콜라겐 침착 억제 효과를 시리우스 레드(Sirius Red), MT(Masson's trichrome) 및 면역조직화학(IHC) 염색법을 통해 측정한 결과를 나타낸 것이다.
도 3b는 본 발명의 일 구현예에 따른 일측요관폐색 신장섬유화 마우스 모델에서 그래핀 양자점의 투여 후 신장 섬유화가 진행되는 동안 관련 단백질 발현 변화를 qRT-PCR을 통해 측정한 결과를 나타낸 것이다.
도 3c는 본 발명의 일 구현예에 따른 일측요관폐색 신장섬유화 마우스 모델에서 그래핀 양자점의 투여 후 신장 섬유화가 진행되는 동안 관련 단백질 발현 변화를 웨스턴 블롯을 통해 측정한 결과를 나타낸 것이다.
도 4a 및 도 4b는 본 발명의 일 구현예에 따른 일측요관폐색 신장섬유화 마우스 모델에서 그래핀 양자점의 투여 후 TGF-β1/Smad 신호전달 개선 효과를 면역조직화학(IHC)을 통해 측정한 결과를 나타낸 것이다.
도 4c는 본 발명의 일 구현예에 따른 일측요관폐색 신장섬유화 마우스 모델에서 그래핀 양자점의 투여 후 TGF-β1/Smad 신호전달 개선 효과를 qRT-PCR을 통해 측정한 결과를 나타낸 것이다.
도 4d 및 도 4e는 본 발명의 일 구현예에 따른 일측요관폐색 신장섬유화 마우스 모델에서 그래핀 양자점의 투여 후 TGF-β1/Smad 신호전달 개선 효과를 웨스턴 블롯을 통해 측정한 결과를 나타낸 것이다.
도 5a 및 도 5b는 본 발명의 일 구현예에 따른 일측요관폐색 신장섬유화 마우스 모델에서 신장 섬유화 진행 중 그래핀 양자점의 apoptosis 억제 효과를 TUNEL 분석을 통해 측정한 결과를 나타낸 것이다.
도 5c는 본 발명의 일 구현예에 따른 일측요관폐색 신장섬유화 마우스 모델에서 신장 섬유화 진행 중 그래핀 양자점의 apoptosis 억제 효과를 qRT-PCR을 통해 측정한 결과를 나타낸 것이다.
도 5d 및 5e는 본 발명의 일 구현예에 따른 일측요관폐색 신장섬유화 마우스 모델에서 신장 섬유화 진행 중 그래핀 양자점의 apoptosis 억제 효과를 웨스턴 블롯을 통해 측정한 결과를 나타낸 것이다.
도 5f는 본 발명의 일 구현예에 따른 일측요관폐색 신장섬유화 마우스 모델에서 신장 섬유화 진행 중 그래핀 양자점의 신장 손상 보호 효과를 면역형광(IF) 분석을 통해 측정한 결과를 나타낸 것이다.
도 6a 및 도 6b는 본 발명의 일 구현예에 따른 일측요관폐색 신장섬유화 마우스 모델에서 신장 섬유화 진행 중 그래핀 양자점의 산화적 스트레스 억제 효과를 확인하기 위해 8-OHdG 및 MnSOD 발현 수준을 면역조직화학(IHC)을 통해 측정한 결과를 나타낸 것이다.
도 6c는 본 발명의 일 구현예에 따른 일측요관폐색 신장섬유화 마우스 모델에서 신장 섬유화 진행 중 그래핀 양자점의 산화적 스트레스 억제 효과를 확인하기 위해 SOD1 발현 수준을 qRT-PCR을 통해 측정한 결과를 나타낸 것이다.
도 7a및 7b는 본 발명의 일 구현예에 따른 일측 허혈 재관류 진행성 신손상 마우스 모델에서 그래핀 양자점에 의한 신장의 크기 및 체중변화를 측정한 결과를 나타낸 것이다.
도 8은 본 발명의 일 구현예에 따른 일측 허혈 재관류 진행성 신손상 마우스 모델에서 그래핀 양자점에 의한 신장조직의 세뇨관 위축 억제 효과를 PAS(Periodic Acid-Schiff) 염색법을 통해 측정한 결과를 나타낸 것이다.
도 9는 본 발명의 일 구현예에 따른 일측 허혈 재관류 진행성 신손상 마우스 모델에서 그래핀 양자점에 의한 콜라겐 침착 억제 효과를 MT(Masson's trichrome) 염색법을 통해 측정한 결과를 나타낸 것이다.
도 10은 본 발명의 일 구현예에 따른 일측 허혈 재관류 진행성 신손상 마우스 모델에서 그래핀 양자점에 의한 TGF-β1의 발현 변화를 면역조직화학(IHC)을 통해 측정한 결과를 나타낸 것이다.
도 11은 본 발명의 일 구현예에 따른 일측 허혈 재관류 진행성 신손상 마우스 모델에서 신장 섬유화가 진행되는 동안 그래핀 양자점에 의한 관련 단백질 발현 변화를 웨스턴 블롯을 통해 측정한 결과를 나타낸 것이다.
도 12는 본 발명의 일 구현예에 따른 그래핀 양자점의 재조합 TGF-β로 유도된 인간 신장 근위세뇨관 세포(hPTECs)의 섬유화 억제 효과를 세포의 형태학적 변화를 통해 나타낸 것이다.
도 13a는 본 발명의 일 구현예에 따른 재조합 TGF-β로 유도된 인간 신장 근위세뇨관 세포(hPTECs)에서 그래핀 양자점에 의한 신장 섬유화 관련 단백질(FN 및 Col 1a1)의 발현 변화를 면역형광(IF) 분석을 통해 나타낸 것이다.
도 13b는 본 발명의 일 구현예에 따른 재조합 TGF-β로 유도된 인간 신장 근위세뇨관 세포(hPTECs)에서 그래핀 양자점에 의한 신장 섬유화 관련 단백질(FN, Col 1a1 및 E-cad)의 mRNA 발현 변화를 qRT-PCR을 통해 나타낸 것이다.
도 14a및 도 14b는 본 발명의 일 구현예에 따른 재조합 TGF-β로 유도된 인간 신장 근위세뇨관 세포(hPTECs)에서 그래핀 양자점에 의한 apoptosis 억제효과를 Annexin V/7-Amino-Actinomycin D(7-AAD)의 유세포 분석(flow cytometry)을 통해 나타낸 것이다.
본 발명은 그래핀 양자점을 유효성분으로 포함하는 만성 신장 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명에서 사용되는 용어 "그래핀"은 복수개의 탄소 원자들이 서로 공유 결합으로 연결되어 폴리시클릭 방향족 분자를 형성한 것을 의미하는 것으로서, 상기 공유 결합으로 연결된 탄소 원자들은 기본 반복 단위로서 6 원환을 형성하나, 5 원환 및/또는 7 원환을 더 포함하는 것도 가능하다.
본 발명에서 사용되는 용어 "그래핀 양자점 (graphene quantum dots, GQDs)"은 나노-크기 단편을 가진 그래핀을 의미한다.
본 발명의 그래핀 양자점은 고체 또는 액체 형태로 존재할 수 있다. 용매화물은 비수성 용매, 예컨대 에탄올, 이소프로판올, DMSO, 아세트산, 에탄올아민 및 에틸 아세테이트를 포함할 수 있고, 또는 결정질 격자에 혼입되는 용매로서 물을 포함할 수 있다. 물이 결정질 격자 내로 혼입된 용매인 용매화물은 전형적으로 "수화물"로 지칭된다. 본 발명은 이러한 모든 용매화물을 포함한다.
본 발명에 있어서, 상기 만성 신장 질환은 신장 섬유화에 의해 유발될 수 있으며, 상기 만성 신장 질환은 말기 신장 질환(End-Stage Kidney Disease; ESKD), 당뇨병성 신증(Diabetic Nephropathy; DN), IgA 신증(IgA Nephropathy; IgAN), HIV-관련 신증, 비-당뇨병성 만성 신장 질환(Non-diabetic Chronic Kidney Disease), 국소분절 사구체경화증(Focal Segmental Glomerulosclerosis; FSGS), 미세변화형 신증후군(Minimal change disease; MCD) 및 크산틴 옥시다아제 결핍증으로 이루어진 군으로부터 선택되는 하나 이상일 수 있으나, 이에 제한되지 않는다.
본 발명에 따른 약학적 조성물은 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다. 상기 부형제는 예를 들어, 희석제, 결합제, 붕해제, 활택제, 흡착제, 보습제, 필름-코팅 물질, 및 제어방출첨가제로 이루어진 군으로부터 선택된 하나 이상일 수 있다.
본 발명에 따른 약학적 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 서방형 과립제, 장용과립제, 액제, 점안제, 엘실릭제, 유제, 현탁액제, 주정제, 트로키제, 방향수제, 리모나아데제, 정제, 서방형정제, 장용정제, 설하정, 경질캅셀제, 연질캅셀제, 서방캅셀제, 장용캅셀제, 환제, 틴크제, 연조엑스제, 건조엑스제, 유동엑스제, 주사제, 캡슐제, 관류액, 경고제, 로션제, 파스타제, 분무제, 흡입제, 패취제, 멸균주사용액, 또는에어로졸 등의 외용제 등의 형태로 제형화하여 사용될 수 있으며, 상기 외용제는 크림, 젤, 패치, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 또는 카타플라스마제 등의 제형을 가질 수 있다.
본 발명에 따른 약학적 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 올리고당, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.
제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다.
본 발명에 따른 정제, 산제, 과립제, 캡슐제, 환제, 트로키제의 첨가제로 옥수수전분, 감자전분, 밀전분, 유당, 백당, 포도당, 과당, 디-만니톨, 침강탄산칼슘, 합성규산알루미늄, 인산일수소칼슘, 황산칼슘, 염화나트륨, 탄산수소나트륨, 정제 라놀린, 미결정셀룰로오스, 덱스트린, 알긴산나트륨, 메칠셀룰로오스, 카르복시메칠셀룰로오스나트륨, 카올린, 요소, 콜로이드성실리카겔, 히드록시프로필스타치, 히드록시프로필메칠셀룰로오스, 1928, 2208, 2906, 2910, 프로필렌글리콜, 카제인, 젖산칼슘, 프리모젤 등 부형제; 젤라틴, 아라비아고무, 에탄올, 한천가루, 초산프탈산셀룰로오스, 카르복시메칠셀룰로오스, 카르복시메칠셀룰로오스칼슘, 포도당, 정제수, 카제인나트륨, 글리세린, 스테아린산, 카르복시메칠셀룰로오스나트륨, 메칠셀룰로오스나트륨, 메칠셀룰로오스, 미결정셀룰로오스, 덱스트린, 히드록시셀룰로오스, 히드록시프로필스타치, 히드록시메칠셀룰로오스, 정제쉘락, 전분호, 히드록시프로필셀룰로오스, 히드록시프로필메칠셀룰로오스, 폴리비닐알코올, 폴리비닐피롤리돈 등의 결합제가 사용될 수 있으며, 히드록시프로필메칠셀룰로오스, 옥수수전분, 한천가루, 메칠셀룰로오스, 벤토나이트, 히드록시프로필스타치, 카르복시메칠셀룰로오스나트륨, 알긴산나트륨, 카르복시메칠셀룰로오스칼슘, 구연산칼슘, 라우릴황산나트륨, 무수규산, 1-히드록시프로필셀룰로오스, 덱스트란, 이온교환수지, 초산폴리비닐, 포름알데히드처리 카제인 및 젤라틴, 알긴산, 아밀로오스, 구아르고무(Guar gum), 중조, 폴리비닐피롤리돈, 인산칼슘, 겔화전분, 아라비아고무, 아밀로펙틴, 펙틴, 폴리인산나트륨, 에칠셀룰로오스, 백당, 규산마그네슘알루미늄, 디-소르비톨액, 경질무수규산 등 붕해제; 스테아린산칼슘, 스테아린산마그네슘, 스테아린산, 수소화식물유(Hydrogenated vegetable oil), 탈크, 석송자, 카올린, 바셀린, 스테아린산나트륨, 카카오지, 살리실산나트륨, 살리실산마그네슘, 폴리에칠렌글리콜 4000,6000, 유동파라핀, 수소첨가대두유(Lubri wax), 스테아린산알루미늄, 스테아린산아연, 라우릴황산나트륨, 산화마그네슘, 마크로골(Macrogol), 합성규산알루미늄, 무수규산, 고급지방산, 고급알코올, 실리콘유, 파라핀유, 폴리에칠렌글리콜지방산에테르, 전분, 염화나트륨, 초산나트륨, 올레인산나트륨, dl-로이신, 경질무수규산 등의 활택제;가 사용될 수 있다.
본 발명에 따른 액제의 첨가제로는 물, 묽은 염산, 묽은 황산, 구연산나트륨, 모노스테아린산슈크로스류, 폴리옥시에칠렌소르비톨지방산에스텔류(트윈에스텔), 폴리옥시에칠렌모노알킬에텔류, 라놀린에텔류, 라놀린에스텔류, 초산, 염산, 암모니아수, 탄산암모늄, 수산화칼륨, 수산화나트륨, 프롤아민, 폴리비닐피롤리돈, 에칠셀룰로오스, 카르복시메칠셀룰로오스나트륨 등이 사용될 수 있다.
본 발명에 따른 시럽제에는 백당의 용액, 다른 당류 혹은 감미제 등이 사용될 수 있으며, 필요에 따라 방향제, 착색제, 보존제, 안정제, 현탁화제, 유화제, 점조제 등이 사용될 수 있다.
본 발명에 따른 유제에는 정제수가 사용될 수 있으며, 필요에 따라 유화제, 보존제, 안정제, 방향제 등이 사용될 수 있다.
본 발명에 따른 현탁제에는 아카시아, 트라가칸타, 메칠셀룰로오스, 카르복시메칠셀룰로오스, 카르복시메칠셀룰로오스나트륨, 미결정셀룰로오스, 알긴산나트륨, 히드록시프로필메칠셀룰로오스, 1828, 2906, 2910 등 현탁화제가 사용될 수 있으며, 필요에 따라 계면활성제, 보존제, 안정제, 착색제, 방향제가 사용될 수 있다.
본 발명에 따른 주사제에는 주사용 증류수, 0.9%염화나트륨주사액, 링겔주사액, 덱스트로스주사액, 덱스트로스+염화나트륨주사액, 피이지(PEG), 락테이티드 링겔주사액, 에탄올, 프로필렌글리콜, 비휘발성유-참기름, 면실유, 낙화생유, 콩기름, 옥수수기름, 올레인산에칠, 미리스트산 이소프로필, 안식향산벤젠과 같은 용제; 안식향산나트륨, 살리실산나트륨, 초산나트륨, 요소, 우레탄, 모노에칠아세트아마이드, 부타졸리딘, 프로필렌글리콜, 트윈류, 니정틴산아미드, 헥사민, 디메칠아세트아마이드와 같은 용해보조제; 약산 및 그 염(초산과 초산나트륨), 약염기 및 그 염(암모니아 및 초산암모니움), 유기화합물, 단백질, 알부민, 펩 톤, 검류와 같은 완충제; 염화나트륨과 같은 등장화제; 중아황산나트륨(NaHSO 3) 이산화탄소가스, 메타중아황산나트륨(Na 2S 2O 3), 아황산나트륨(Na 2SO 3), 질소가스(N 2), 에칠렌디아민테트라초산과 같은 안정제; 소디움비설파이드 0.1%, 소디움포름알데히드 설폭실레이트, 치오우레아, 에칠렌디아민테트라초산디나트륨, 아세톤소디움비설파이트와 같은 황산화제; 벤질알코올, 클로로부탄올, 염산프로카인, 포도당, 글루콘산칼슘과 같은 무통화제; 시엠시나트륨, 알긴산나트륨, 트윈 80, 모노스테아린산알루미늄과 같은 현탁화제를 포함할 수 있다.
본 발명에 따른 좌제에는 카카오지, 라놀린, 위텝솔, 폴리에틸렌글리콜, 글리세로젤라틴, 메칠셀룰로오스, 카르복시메칠셀룰로오스, 스테아린산과 올레인산의 혼합물, 수바날(Subanal), 면실유, 낙화생유, 야자유, 카카오버터+콜레스테롤, 레시틴, 라네트왁스, 모노스테아린산글리세롤, 트윈 또는 스판, 임하우젠(Imhausen), 모놀렌(모노스테아린산프로필렌글리콜), 글리세린, 아뎁스솔리두스(Adeps solidus), 부티룸 태고-G(Buytyrum Tego-G), 세베스파마 16 (Cebes Pharma 16), 헥사라이드베이스 95, 코토마(Cotomar), 히드록코테 SP, S-70-XXA, S-70-XX75(S-70-XX95), 히드록코테(Hydrokote) 25, 히드록코테 711, 이드로포스탈 (Idropostal), 마사에스트라리움(Massa estrarium, A, AS, B, C, D, E, I, T), 마사-MF, 마수폴, 마수폴-15, 네오수포스탈-엔, 파라마운드-B, 수포시로(OSI, OSIX, A, B, C, D, H, L), 좌제기제 IV 타입 (AB, B, A, BC, BBG, E, BGF, C, D, 299), 수포스탈 (N, Es), 웨코비 (W, R, S, M ,Fs), 테제스터 트리글리세라이드 기제 (TG-95, MA, 57)와 같은 기제가 사용될 수 있다.
경구 투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 추출물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다.
경구 투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜 (propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다.
본 발명에 따른 약학적 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에 있어서, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.
본 발명에 따른 약학적 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 본 발명이 속하는 기술분야에 통상의 기술자에 의해 용이하게 결정될 수 있다.
본 발명의 약학적 조성물은 개체에게 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구 복용, 피하 주사, 복강 투여, 정맥 주사, 근육 주사, 척수 주위 공간(경막내) 주사, 설하 투여, 볼점막 투여, 직장 내 삽입, 질 내 삽입, 안구 투여, 귀 투여, 비강 투여, 흡입, 입 또는 코를 통한 분무, 피부 투여, 경피 투여 등에 따라 투여될 수 있다.
본 발명의 약학적 조성물은 치료할 질환, 투여 경로, 환자의 연령, 성별, 체중 및 질환의 중등도 등의 여러 관련 인자와 함께 활성성분인 약물의 종류에 따라 결정된다.
본 발명에서 "개체"란 질병의 치료를 필요로 하는 대상을 의미하고, 보다 구체적으로는 인간 또는 비-인간인 영장류, 생쥐 (mouse), 쥐 (rat), 개, 고양이, 말, 및 소 등의 포유류를 의미한다.
본 발명에서 “투여”란 임의의 적절한 방법으로 개체에게 소정의 본 발명의 조성물을 제공하는 것을 의미한다.
본 발명에서 "예방"이란 목적하는 질환의 발병을 억제하거나 지연시키는 모든 행위를 의미하고, "치료"란 본 발명에 따른 약학적 조성물의 투여에 의해 목적하는 질환과 그에 따른 대사 이상 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미하며, “개선"이란 본 발명에 따른 조성물의 투여에 의해 목적하는 질환과 관련된 파라미터, 예를 들면 증상의 정도를 감소시키는 모든 행위를 의미한다.
본 발명에 따른 약학적 조성물에 있어서, 치료적 유효량은 특별히 제한되는 것은 아니지만, 바람직하게는 5 mg/kg 내지 50 mg/kg 일 수 있고, 더욱 바람직하게는 10 mg/kg 내지 40 mg/kg 일 수 있으며, 가장 바람직하게는 20 mg/kg 내지 30 mg/kg 일 수 있다.
본 발명에 있어서, 상기 조성물은 피브로넥틴(Fibronectin), 콜라겐 1a1(collagen 1a1), Bcl-2 관련 X 단백질(Bcl-2-associated X protein; Bax), 종양성장인자 베타1(Transforming growth factor-β1; TGF-β1), Smad2/3 및 알파 평활근 액틴(α-smooth muscle actin; α-SMA)으로 이루어진 군으로부터 선택되는 하나 이상의 단백질의 발현을 감소시킴으로써 신장 섬유화로 유발되는 만성 신장 질환을 예방 또는 치료할 수 있다.
본 발명에 있어서, 상기 조성물은 E-카드헤린(E-cadherin), Smad7, MnSOD 및 SOD1으로 이루어진 군으로부터 선택되는 하나 이상의 단백질의 발현을 증가시킴으로써 신장 섬유화로 유발되는 만성 신장 질환을 예방 또는 치료할 수 있다.
본 발명에 있어서, "피브로넥틴 (Fibronectin)"은 막관통 수용체 단백질인 인테그린 (integrin)에 결합하는 세포외 기질의 당단백질로서, 섬유아세포 (fibroblast)의 활성에 의해 주로 발현되는 것으로 알려졌으며, 다양한 장기의 섬유화 과정 초기에 주로 발현된다.
본 발명에 있어서, "알파 평활근 액틴(α-smooth muscle actin; α-SMA)"은 α-액틴-2, SMactin, 또는 ASMA로 알려져 있으며, ACTA2 유전자에 의하여 발현되는 단백질로, 모든 종류의 장기 섬유화에서 근섬유모세포(myofibroblast)의 활성화를 나타내는 분자 마커이다.
본 발명에 있어서, "E-카드헤린(E-cadherin)"은 세포 부착 분자 중 하나로, 세포 간 부착하기 위한 접착 연접(adherens junction)을 형성하는 데에 중요한 역할을 한다. 약 720-750 개 아미노산의 길이를 가지며, 작은 세포질 부분, 막관통 부분 및 거대한 세포외 부분으로 구성되고, 섬유화를 유도하는 TGF-β1에 의하여 손실되며, E-cadherin의 손실은 섬유화를 야기하는 것으로 알려져 있다.
본 발명에 있어서, "종양성장인자 베타1(Transforming growth factor-β1; TGF-β1)"는 다양한 이형체를 포함하는 전환 성장 인자 슈퍼패밀리에 속하는 다기능 사이토카인으로서, 대부분의 만성 신장 질환의 섬유화 형태를 유도하는 주요 인자로 알려져 있다.
본 발명에 있어서, "Smad2/3"은 TGF-β superfamily의 수용체에 대한 주요 신호 변환기로, 구조적으로 유사한 단백질군을 구성한다.
본 발명에 있어서, "Smad7"은 TGF-β 신호 전달을 개시하는 Smad2/Smad4 복합체의 형성을 방지함으로써 TGF-β 신호 전달을 억제한다. 이는 활성화 된 TGF-β 타입 I 수용체와 상호 작용하여 Smad2의 결합, 인산화 및 활성화를 차단한다.
본 발명에 있어서 “8-하이드록시-2'-데옥시구아노신(8-hydroxy-2'-deoxyguanosine; 8-OHdG)”은 DNA의 산화로 인해 생성되는 디옥시구아노신(Deoxyguanosine)의 산화 유도체로서, 세포 내 8-OHdG의 발현양은 산화적 스트레스의 수준을 나타낸다.
본 발명에 있어서 “망간 초과산화물 불균등화효소(manganese superoxide dismutase; MnSOD” 및 초과산화물 불균등화효소1(superoxide dismutase1; SOD1)은 초과산화물(superoxide)을 산소나 과산화수소로 바꾸는 효소로서, 세포의 산화적 스트레스를 해소하는 것으로 알려져 있다.
본 발명에서 사용되는 용어, "발현(expression)"은 폴리펩티드(polypeptide)가 구조 유전자로부터 생산되는 과정을 지칭한다. 상기 과정은 유전자의 mRNA로의 전사, 및 이러한 mRNA의 폴리펩티드(들)로의 해독을 포 함한다.
본 발명에 있어서, mRNA 발현량을 측정하기 위한 분석 방법으로는 당업계에 공지된 방법을 이용할 수 있으며, 예컨대 중합효소연쇄반응(polymerase chain reaction, PCR), 역전사 중합효소연쇄반응(reverse transcription polymerase chain reaction, RT-PCR), 경쟁적 역전사 중합효소반응(Competitive RTPCR), 실시간 중합효소연쇄반응(Real-time PCR, quantitative PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블롯팅(Northern blotting), 또는 DNA 칩 등의 방법을 이용할 수 있고, 본 발명의 일 실시예에 따르면 실시간 중합효소연쇄반응(Real-time PCR, quantitative PCR)을 이용하여 mRNA 발현량을 측정할 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, 단백질 발현량을 측정하기 위한 분석 방법으로는, 당업계에 공지된 방법을 이용할 수 있으며, 예컨대 웨스턴블롯팅(Western blotting), 엘라이자(enzyme linked immunosorbent assay,ELISA), 방사선면역분석(RIA: Radioimmunoassay), 방사 면역 확산법(radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역확산법, 로케트(rocket) 면역전기영동, 조직면역 염색, 면역침전 분석법(Immunoprecipitation Assay), 보체 고정 분석법(Complement Fixation Assay), 유세포분석(Fluorescence Activated Cell Sorter, FACS), 또는 단백질 칩(protein chip) 등이 있으나, 이에 제한되지 않는다.
본 발명에 따른 약학적 조성물에 있어서, 상기 그래핀 양자점은 평균 직경 (lateral size)이 1 내지 5 nm일 수 있으며, 평균 높이 (height)가 0.5 내지 2.5 nm일 수 있다.
또한, 본 발명은 그래핀 양자점을 유효성분으로 포함하는 약학적 조성물을 개체에 투여하는 단계를 포함하는, 만성 신장 질환의 예방, 개선 또는 치료 방법을 제공한다.
또한, 본 발명은 그래핀 양자점을 유효성분으로 포함하는 약학적 조성물의, 만성 신장 질환 예방, 개선 또는 치료 용도를 제공한다.
또한, 본 발명은 그래핀 양자점의, 만성 신장 질환 예방, 개선 또는 치료에 이용되는 약제를 생산하기 위한 용도를 제공한다.
본 발명의 일 실시예에서는 그래핀 양자점을 제조하고, 그래핀 양자점의 크기 및 작용기의 종류를 확인하여 특성을 분석하였다(실시예 1 참조).
본 발명의 일 실험예에서는 일측요관폐색 모델에서 세뇨관 위축 억제, 콜라겐 침착 억제, 신장 섬유화 관련 단백질의 발현 변화, TGF-β1/Smad 신호전달 개선, apoptosis 억제 효과 및 산화적 스트레스(oxidative stress) 억제 효과를 분석하여, 본 발명의 그래핀 양자점의 신장 섬유화 억제효과를 확인하였다(실험예 1 참조).
본 발명의 다른 실험예에서는 일측 허혈 재관류 모델에서 신장의 크기와 무게 변화, 세뇨관 위축 억제, 콜라겐 침착 억제, TGF-β1 발현 억제 및 신장 섬유화 관련 단백질의 발현 변화를 분석하여, 본 발명의 그래핀 양자점의 신장 섬유화 억제효과를 확인하였다(실험예 2 참조).
본 발명의 또 다른 실험예에서는 인간 신장 근위세뇨관 세포에서 세포의 형태학적 변화, 신장 섬유화 관련 단백질의 발현 변화 및 apoptosis 억제 효과를 분석하여, 본 발명의 그래핀 양자점의 신장 섬유화 억제효과를 확인하였다(실험예 3 참조).
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예 및 실험예를 제시한다. 그러나 하기의 실시예 및 실험예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예 및 실험예에 의해 본 발명의 내용이 한정되는 것은 아니다.
실시예 1. 그래핀 양자점(Graphene quantum dots, GQDs)의 제조
1-1. 그래핀 양자점의 제조
카본파이버(Carbon Fiber)를 황산과 질산을 3:1 비율로 섞은 강산 용액에 넣은 후 80℃에서 24시간 동안 가열하였다(thermo-oxidation process). 상기 용액을 희석한 후, 재생 니트로셀룰로오스 멤브레인(Cat#: 06-680-2G; MWCO 1,000 달톤; Fisher Sicentific)으로 투석하여 산을 제거하고 다공성 무기 멤브레인 필터 (Cat#: 6809-5002; Whatman-Anodisc 47; GE Healthcare)로 진공-여과 한 뒤 동결건조 하여 파우더 형태의 그래핀 양자점을 제조하였다. 그래핀 양자점 파우더는 증류수에 재분산 시켜서 실험에 사용하였다(도 1a).
1-2. 그래핀 양자점 특성 분석
그래핀 양자점의 평균 형태를 측정하기 위해 직경(lateral size)은 HR-TEM(high-resolution transmission electron microscopy)으로 측정하였고, 높이는 AFM(force microscopy)으로 측정하였으며, FT-IR(Fourier-transform infrared spectroscopy)을 통해 작용기의 종류를 확인하였다. 또한 라만 분광기를 통해 라만 효과를 확인하였다.
HR-TEM은 사용전에, lacey carbon (01890-F, TedPella, USA)을 가지는 300-메쉬 구리 TEM 그리드(grid)를 그래핀으로 코팅하였다. 희석된 그래핀 양자점 용액을 그리드 상에 떨어뜨리고 공기 중에 건조시켰다. 그래핀 양자점의 이미지는 HR-TEM (JEM-3010, JEOL Ltd, Japan) 및 Gatan Digital Camera (MSC-794)에 의해 확인되었다. 그래핀 양자점의 직경은 Image J에 의해 측정되었다.
AFM은 그래핀 양자점 용액을 1x1 Si 웨이퍼에 떨어 뜨려 건조시켜 시료를 제조하고, AFM(Park Systems, 수원, 한국)를 이용하여 접촉모드로 분석하였다.
FT-IR은 그래핀 양자점 시료를 통상적인 KBr 펠렛 방법으로 제조하여, 스펙트럼을 FT-IR spectrometer(Nicolet 6700, Thermo Scientific, USA)로 측정하였다.
라만 효과는 그래핀 양자점 용액을 1x1 Si 웨이퍼에 건조시켜 샘플을 제조하고, 스펙트럼을 514 nm 레이저로 Raman spectrometer (Micro-Raman spectrometer, Renishaw, UK)에 의해 측정되었다.
그 결과, 그래핀 양자점의 직경은 2.20 nm(도 1b), 높이는 1.42 nm(도 1c)로 측정되었다. Edge 부분에 있는 카르복실기와 (C=O) 하이드록실기의 (O-H) stretching에 해당하는 파수가 각각 1730 cm -1, 3440 cm -1에서 나타났고, 그래핀 영역에 해당하는 sp 2 C=C stretching에 해당하는 파수가 1620 cm -1에서 관찰되었다(도 1d 왼쪽). Raman shift를 분석한 결과 그래핀의 D band (1400 cm -1)와 G band가 (1600 cm -1) 확인되었다(도 1d 오른쪽).
실험예 1. 일측요관폐색(Unilateral Ureteral Obstruction, UUO) 모델에서의 신장 조직 섬유화 억제 효과
1-1. 동물모델 제작
7주령의 수컷 마우스(C57BL/6 mice)를 졸레틸(Zoletil, 30 mg/kg)과 럼푼(Rompun 10 mg/kg)을 복강투여 하여 마취하고, 좌측 옆구리를 절개하여 콩팥을 노출시켜 요관을 찾은 후 4-0 실크로 요관 근위부를 1-2 mm 간격으로 묶은 후 그 사이를 절개하여 만성콩팥병 동물실험모델인 마우스 일측요관폐색 (Unilateral Ureteral Obstruction, UUO) 모델을 제작하였다. 마우스에 상기 실시 예 1에 따른 그래핀 양자점을 20 mg/kg/day 용량으로 수술 하루 전, 수술 후 2일, 6일에 꼬리 정맥 투여 후, UUO 시술 10일에 마우스를 희생시켜 신장을 적출하고 신장의 섬유화 유도를 관찰하였다.
Sham: 정상대조군/vehicle 투여; GQDs: 정상대조군/GQDs 투여; UUO: UUO 실험군/vehicle 투여; UUO + GQDs: UUO실험군/GQDs 투여로 군을 구분하였고, 대조군은 vehicle. (그룹 별 n=7)
1-2. 세뇨관 위축 억제 효과 분석
대조군과 실험군에서 신장섬유화 정도의 차이를 확인하기 위해, PAS(Periodic Acid-Schiff) 염색법을 통해 세뇨관의 조직학적 변화를 관찰하였다.
적출한 신장을 4 % paraformaldehyd에 4 ℃에서 24 시간 동안 고정시키고 파라핀에 포매시켰다. 탈수 후, 파라핀 블록을 4μm 섹션으로 절단 하였다. 섹션을 60℃에서 1시간 동안 오븐에 두고, 자일렌 및 에탄올로 파라핀을 제거하고, Periodic Acid Schiff Stain Kit(ScyTek; Logan, Utah, USA)의 방법에 따라 PAS 염색을 수행하였다.
그 결과, PAS 염색으로부터 UUO 실험군에서는 명백한 세뇨관 위축이 관찰되었지만, UUO + GQDs 군에서 비교적 온전한 구조가 발견되었다(도 2).
1-3. 콜라겐 침착 억제 효과 분석
대조군과 실험군에서 신장섬유화 정도의 차이를 확인하기 위해, 시리우스 레드(Sirius Red) 및 MT(Masson's trichrome) 염색, 콜라겐 1a1(Col 1a1)의 면역조직화학(IHC)을 수행하여 콜라겐 침착 정도를 확인하였다.
신장조직 샘플은 실험예 1-2의 방법과 동일하게 준비하고, ScyTek(Logan, Utah, USA)사의 시리우스 레드는 Picro-Sirius Red Stain Kit(For Collagen), MT 염색은 Trichrome Stain Kit(Modified Masson's)의 방법에 따라 염색을 수행하였다.
면역조직화학 분석을 위해서도 상기와 같이 동일하게 신장 조직 샘플을 준비하고, 3% 과산화수소(덕산; 대한민국 경기도 안산시) 및 10% gout 혈청 (RD, Minneapolis, MN, USA)으로 조직 섹션에서 내인성 과산화물 효소 및 10 개의 비특이적 발현을 차단하였다. 그 후, 1차 항체인 Col 1a1(Abcam; ab21286) 항체와 함께 4 ℃에서 밤새 인큐베이션 하여 Col 1a1의 발현을 평가하였다.
그 결과, UUO 실험군 대비 UUO + GQDs 군에서 시리우스 레드 염색의 양성 면적은 20% 감소하였고, MT 염색 및 Col 1a1 IHC에서는 약 60%의 양성 면적 감소가 확인되어, 그래핀 양자점에 의해 콜라겐 축적이 감소되는 것을 확인하였다(도 3a).
1-4. 신장 섬유화 관련 단백질 발현 변화 분석
UUO로 유도된 신장 섬유화가 진행되는 동안 관련 단백질 발현 변화를 분석하기 위해 qRT(quantitative real-time)-PCR 및 웨스턴 블롯을 수행하였다.
qRT-PCR은 Trizol 시약(Bioline; Luckenwalde, Germany)을 사용하여 제조사의 방법에 따라 세포 및 조직으로부터 총 RNA를 추출 하였다. RNA 추출물의 품질 및 농도는 spectrophotometry 260 및 280nm에서 측정되었다. 이어서, 동일한 농도의 각 샘플을 합성 키트 및 증폭 장비(C1000TM, Thermal Cycle, BIO-RAD)를 사용하여 cDNA로 역전사시켰다. 동일한 농도의 cDNA를 PCR 마스터 혼합물과 함께 TaqMan probe 또는 SYBR Green 프라이머에 첨가 한 다음, LightCycler480 instrument II(Roche; Pleasanton, CA, USA)를 사용하여 측정 하였다. 각 유전자의 상대적인 발현 수준은 comparative threshold (CT) cycle (2 -ΔΔCT) 을 사용하여 계산되었다. 이 실험에 사용된 TaqMan probe 또는 SYBR Green 프라이머 서열은 하기의 표 1과 같다.
primer 서열 Species 서열번호
Fibronectin(FN)
Forward		 CGA GGT GAC AGA GAC CAC AA mouse 1
Fibronectin(FN)
Reverse		 CTG GAG TCA AGC CAG ACA CA mouse 2
Collagen 1a1(Col 1a1)Forward ATC TCC TGG TGC TGA TGG AC mouse 3
Collagen 1a1(Col 1a1)
Reverse		 ACC TTG TTT GCC AGG TTC AC mouse 4
α-smooth muscle actin(α-SMA)
Forward		 ACT GGG ACG ACA TGG AAA AG mouse 5
α-smooth muscle actin(α-SMA)
Reverse		 CAT CTC CAG AGT CCA GCA CA mouse 6
웨스턴 블롯은 세포 및 조직으로부터 추출 된 단백질을 전기영동용 단백질로 제조 한 다음, 전기영동 및 막 전달을 수행 하였다. 전달 후, 막을 차단 완충액에서 1 시간 이상 인큐베이션 한 후, 4℃에서 1차 항체 FN(Santa cruz, sc-8422), Col 1a1(Abcam, ab21286), E-cad(Abcam, ab11512), α-SMA(Abcam, ab5694) 및 GAPDH(Cell signaling technology, 2118)와 함께 밤새 인큐베이션 하였다. 이어서, 막을 TBST 완충액으로 10분 동안 3회 세척하였다. 다음으로, 막을 anti-rabbit IgG, HRP-linked 항체 또는 anti-mouse IgG, HRP-linked 항체(모두 Cell Signaling Technology; Danvers, MA, USA)를 함유하는 차단 완충액에서 배양 하였다. 세척 후, Luminescent Image Analyzer LAS4000 system (Fuji Film; Dusseldorf, Germany)에서 western Bright ECL kit (Advansta; San Jose, CA, USA)로 막을 현상 하였다.
그 결과, 신장 섬유화의 진행 동안, 피브로넥틴(FN) 및 collagen 1a1(Col 1a1), α-smooth muscle actin(α-SMA)과 같은 ECM(Extracellular matrix) 단백질의 mRNA 수준이 현저하게 증가되었다. 그러나, FN, Col 1a1 및 α-SMA는 그래핀 양자점의 존재 하에 유의미하게 감소한 것으로 확인되었다(도 3b). 마찬가지로, 웨스턴 블롯 분석에서도 FN, Col 1a1 및 α-SMA의 발현이 감소되었다. 한편, E-cadherin의 발현 수준은 그래핀 양자점에 의해 증가되었는데, 이는 EMT(epithelial-mesenchymal transition)의 억제가 세포-세포 접착을 덜 방해한다는 것을 시사한다(도 3c).
1-5. TGF-β1/Smad 신호전달 개선 효과 분석
TGF-β1/Smad 신호전달 경로는 주로 신장 섬유증과 관련이 있는 것으로 알려져 있기 때문에 그래핀 양자점이 TGF-β1/Smad 신호전달에 미치는 영향을 확인하기 위해서 면역조직화학(IHC), qRT-PCR 및 웨스턴 블롯을 수행하였다.
면역조직화학은 실험예 1-3과 동일한 방법으로 수행하였으며, 1차 항체로는 TGF-β1(Abcam, ab92486)을 사용하였다.
qRT-PCR은 실험예 1-4과 동일한 방법으로 수행하였으며, 프라이머 서열은 하기의 표 2와 같다.
primer 서열 Species 서열번호
TGF-β
Forward		 CAA CAA TTC CTG GCG TTA CCT TGG mouse 7
TGF-β
Reverse		 GAA AGC CCT GTA TTC CGT CTC CT mouse 8
웨스턴 블롯 또한 실험예 1-4와 동일한 방법으로 수행하였으며, 1차항체는 TGF-β1(Abcam, ab92486), p-smad2/3(Abcam, ab63399), smad2/3(Cell signaling technology, 8685), Smad7(Abcam, ab216428) 및 GAPDH(Cell signaling technology, 2118)을 사용하였다.
그 결과, 면역조직화학 분석에서 UUO 유도로부터 10 일 후, 폐색된 신장에서의 TGF-β1의 발현은 대조군보다 현저하게 높았으며, 그래핀 양자점의 투여 군에서는 TGF-β1의 양성 염색 된 영역이 30%가 감소되었다(도 4a 및 도 4b). 그래핀 양자점은 TGF-β1의 mRNA 수준 또한 감소 시켰다(도 4c). 웨스턴 블록 실험 결과, TGF-β1/Smad 신호전달 경로의 다운 스트림 단백질에서 변화가 또한 관찰되었다. 그래핀 양자점의 투여로 인해, ECM 단백질의 생성을 촉진하는 p-Smad2/3의 수준이 30% 감소되었다. 한편, Smad2/3 복합체의 활성화를 방해하는 Smad7은 그래핀 양자점의 투여로 인해 1.5배 증가되었다(도 4d 및 도 4e). 따라서, 그래핀 양자점이 TGF-β1/Smad 신호전달 경로에 대한 전반적인 조절을 통해 ECM 단백질의 과잉 형성을 억제 하는 것을 확인하였다.
1-6. 신장 섬유화 진행 중 apoptosis 억제 효과 및 신장손상 보호 효과 분석
그래핀 양자점의 apoptosis 억제 효과를 확인하기 위해, TUNEL 분석, qRT-PCR, 웨스턴 블롯 및 면역형광(Immunofluorescence, IF) 분석을 실시하였다.
TUNEL 분석은 apoptosis 검출 키트(ApopTag® Plus Peroxidase In Situ Apoptosis Kit, Merck Millipore; Billerica, MA, USA)를 사용하여 파라핀-포함 신장 조직 섹션으로부터 TUNEL 분석을 통해 apoptosis 마커를 검출 하였다. 파라핀 섹션에서 파라핀을 제거하고, proteinase K(Dako; Carpinteria, CA, USA)와 함께 인큐베이션 하고, 섹션을 효소인 terminal deoxynucleotide transferase(TdT, 37°C에서 1 시간 동안 반응 버퍼에 희석하여 사용)와 함께 37°C에서 30분 동안 인큐베이션 하였다. 그리고, anti-digoxigenin(Roche; Mannheim, Germany)과 결합하였다. 핵은 DAPI로 대조 염색되었다. Apoptosis의 정도는 각각의 슬라이스에서 ×200 배율의 시야에서 관찰 된 무작위로 선택된 10개 영역의 apoptosis 세포의 총 수를 평균화 함으로써 맹검 방식으로 평가되었다.
qRT-PCR은 실험예 1-4와 동일한 방법으로 수행하였으며, 프라이머 및 프로브 서열은 하기의 표 3과 같다.
Primer/Probe 서열 Species 서열번호
Bax Primer1 GTTCCCGAAGTAGGAGAGGA mouse 9
Bax Primer2 CTAAAGTGCCCGAGCTGAT mouse 10
Bax Probe /56-FAM/AAGTCCAGT/ZEN/GTCCAGCCCATGATG/3IABkFQ/ mouse 11
웨스턴 블롯은 실험예 1-4와 동일한 방법으로 수행하였으며, 1차항체는 Bax(Cell signaling technology, 2772), Bcl2(Thermo Fisher, MA5-11757) 및 GAPDH(Cell signaling technology, 2118)을 사용하였다.
IF 분석은 파라핀 제거, 재수화 및 항원 회복 후, 신장조직 절편을 항체 희석 완충액에서 1차 항체 AQP1(Abcam, ab15080) 및 NGAL (Santa cruz, sc-515876)과 함께 4 ℃에서 밤새 인큐베이션 하였다. 그 후, 충분한 양의 Goat-anti-rabbit Alexa Fluor488 및 Goat-anti-mouse Alexa Fluor555(모두 Invitrogen; OR, USA) 2차 항체를 첨가하여 섹션을 덮고 30분 동안 어두운 곳에서 실온에서 배양 하였다. 다음으로, 4', 6-Diamidino-2-phenylindole(DAPI) (Thermo Fisher Scientific; Waltham, MA, USA)을 포함하는 마운팅 용액을 사용하여 슬라이드 및 counterstaining을 마운팅 하였다. Confocal microscopy(Leica TCS SP8 STED CW; Wetzlar, Germany)를 사용하여 고화질 형광 이미지를 수득하였다.
그 결과, 염색된 이미지 및 정량화된 결과로부터 나타난 바와 같이, 그래핀 양자점의 존재는 TUNEL-양성 apoptosis 세포의 수를 현저하게 감소시켰다(도 5a 및 도 5b).
마찬가지로, 그래핀 양자점은 mRNA와 단백질 수준 모두에서 Bcl2 관련 X 단백질 (Bax)을 감소시켰다(도 5c, 도 5d 및 도 5e). 그러나, Bcl2에는 유의한 차이가 없었으며(도 5d 및 도 5e), 이는 그래핀 양자점이 항-apoptosis 단백질을 회복시키는 것이 아니라, proapoptotic 인자의 생성을 억제함으로써 apoptosis를 억제하는 것을 의미한다.
세뇨관 세포의 보존에서 그래핀 양자점의 효과를 검증하기 위해, neutrophil gelatinase-associated lipocalin(NGAL) 및 aquaporin(AQP1)의 면역형광(immunofluorescence, IF) 염색에 의해 신장 손상 정도를 측정 하였다. NGAL은 새로운 바이오 마커로 급성 신장 질환에서 만성 신장 질환으로 진행의 매개 변수로 볼 수 있다. AQP1은 근위세뇨관에 위치하며 수로로 기능을 한다. 실험결과, UUO군에서는NGAL의 현저한 증가와 AQP1의 손실이 관찰되었지만, 그래핀 양자점에 의해 NGAL 및 AQP1의 변화가 현저하게 약화된 것을 확인하였으며(도 5f), 이는 근위세뇨관 손상에 대한 그래핀 양자점의 보호 효과를 시사 한다.
1-7. 산화적 스트레스 억제 효과 분석
활성산소종(reactive oxygen species, ROS)의 축적은 산화적 스트레스를 유발하여 섬유화를 악화시키는 것으로 알려져 있으므로, 그래핀 양자점이 활성산소종에 의한 산화적 스트레스에 미치는 영향을 확인하기 위해 면역조직화학(IHC)으로 8-OHdG 및 MnSOD의 발현을 확인하고, qRT-PCR로 SOD1의 발현을 확인하였다.
면역조직화학은 실험예 1-3과 동일한 방법으로 수행하였으며, 1차 항체로는 8OHdG(JaICA; M0G0209) 및 MnSOD(Abcam; Ab31533)을 사용하였다. qRT-PCR은 실험예 1-4와 동일한 방법으로 수행하였으며, 프라이머 및 프로브 서열은 하기의 표 5와 같다.
Primer/Probe 서열 Species 서열번호
SOD1 Primer1 GTCCTTTCCAGCAGTCACAT mouse 12
SOD1 Primer2 GGTTCCACGTCCATCAGTATG mouse 13
SOD1 Probe /56-FAM/TCCAACATG/ZEN/CCTCTCTTCATCCGC/3IABkFQ/ mouse 14
그 결과, UUO 실험군 대비 UUO + GODs 군에서 8-OHdG 양성 면적이 87% 감소한 반면, MnSOD 양성 면적은 9배 증가한 것이 확인되었으며(도 6a 및 도6b), SOD1의 mRNA 발현은 정상 수준으로 회복된 것이 확인되었다(도 6c). 이와 같은 결과는 그래핀 양자점이 활성산소종을 소거할 뿐만 아니라 항산화제와 활성산소종 사이의 균형을 조절함으로써 산화적 스트레스를 억제할 수 있음을 시사한다.
실험예 2. 일측 허혈 재관류(unilateral ischemia-reperfusion injury, UIRI) 모델에서의 신장 조직 섬유화 억제 효과
2-1. 동물모델 제작
7주령의 수컷 마우스(C57BL/6 mice)를 졸레틸(Zoletil, 30 mg/kg)과 럼푼(Rompun 10 mg/kg)을 복강투여 하여 마취하고, 좌측 옆구리를 절개하여 좌측신장의 pedicle을 노출시켜 microvascular clamp로 혈관을 결찰한 후 26분 후 재관류를 하여 일측 허혈 재관류 (Unilateral IRI) 진행성 신손상 생쥐 모델을 제작하였다. 마우스에 상기 실시 예 1에 따른 그래핀 양자점을 20 mg/kg 용량으로 수술 하루 전, 수술 후 3일, 7일, 14일, 21일, 28일에 꼬리 정맥 투여 후, 시술 6주 후에 마우스를 희생시켜 신장을 적출하고 신장의 섬유화 유도를 관찰하였다.
Sham: 정상대조군/vehicle 투여 (n=2); GQDs: 정상대조군/GQDs투여 (n=2); Unilateral IRI: Unilateral IRI 실험군/vehicle 투여 (n=4); Unilateral IRI + GQDs: Unilateral IRI 실험군/GQDs 투여 (n=4)로 군을 구분하였고, 대조군은 vehicle.
2-2. 신장 크기 및 체중 변화 분석
신장의 크기와 무게 감소는 UIRI 유도의 대표적인 특징으로, 실험결과, UIRI 실험군에서는 왼쪽 신장이 현저하게 위축되었으나, 그래핀 양자점을 투여한 군에서는 위축이 감소하고 무게 또한 UIRI 실험군에 비해 높게 측정된 것으로 확인되었다(도 7a 및 도 7b).
2-3. 세뇨관 위축 억제 효과 분석
대조군과 실험군에서 신장섬유화 정도의 차이를 확인하기 위해, PAS (Periodic Acid-Schiff) 염색법을 통해 세뇨관의 조직학적 변화를 관찰하였다.
실험 방법은 상기 실험예 1-2와 동일한 방법으로 수행되었다.
그 결과, PAS 염색으로부터 UIRI 실험군에서는 명백한 세뇨관 및 사구체 위축이 관찰되었지만, UIRI + GQDs 군에서는 손상이 방지된 것으로 확인되었다(도 8).
2-4. 콜라겐 침착 억제 효과 분석
대조군과 실험군에서 신장섬유화 정도의 차이를 확인하기 위해, MT(Masson's trichrome) 염색을 수행하여 콜라겐 침착 정도를 확인하였다.
신장 조직 샘플은 실험예 1-2의 방법과 동일하게 준비하고, MT 염색은 Trichrome Stain Kit(Modified Masson's)의 방법에 따라 염색을 수행하였다.
그 결과, UIRI 실험군에서는 과도한 콜라겐 침착이 확인되었으나, UIRI + GQDs 군에서는 콜라겐 축적이 감소되는 것을 확인하였다(도 9).
2-5. TGF-β1 발현 변화 분석
대조군과 실험군에서 전섬유성(profibrotic) 인자인 TGF-β1의 발현 변화를 분석하기 위해서 면역조직화학(IHC)를 수행하였다.
면역조직화학은 실험예 1-3과 동일한 방법으로 수행하였으며, 1차 항체로는 TGF-β1(Abcam, ab92486)을 사용하였다.
그 결과, UIRI 실험군에 비해서 UIRI + GQDs 군에서 TGF-β1의 발현이 감소하는 것을 확인하였다(도 10).
2-6. 신장 섬유화 관련 단백질 발현 변화 분석
UIRI로 유도된 신장 섬유화가 진행되는 동안 관련 단백질 발현 변화를 분석하기 위해 웨스턴 블롯을 수행하였다.
웨스턴 블롯은 상기 실험예 1-4와 동일한 방법으로 진행하였으며, 1차 항체는 FN(Santa cruz, sc-8422), Col 1a1(Abcam, ab21286), α-SMA(Abcam, ab5694), vimentin(Cell signaling technology, 5741), E-cad(Abcam, ab11512), TGF-β1(Abcam, ab92486), Smad7(Abcam, ab216428) 및 GAPDH(Cell signaling technology, 2118)를 사용하였다.
그 결과, UIRI군에서 FN, Col 1a1, a-SMA, vimentin(EMT의 마커) 및 TGF-β1의 과발현 된 단백질 수준은 그래핀 양자점에 의해 유의하게 약화되었다. 대조적으로, UIRI + GQDs 그룹에서 E-cad의 회복은 EMT의 억제를 나타내며, Smad7의 증가 된 수준은 TGF-β1/Smad 신호의 조절을 의미한다. 따라서, 그래핀 양자점은 UIRI에 의해 유도된 신장 섬유화를 억제하는 효과가 있음이 확인되었다(도 11).
실험예 3. 인간 신장 근위세뇨관 세포(human kidney proximal tubular cells)에서의 재조합 TGF-β로 유도된 섬유화 개선 효과
3-1. 세포 배양
인간 신장 근위세뇨관 세포(human proximal tubular cells, hPTECs)의 일차배양 세포를 계대 배양한 후, 재조합 TGF-β(R&D; Minneapolis, MN, USA) 2 ng/ml을 첨가하여 hPTEC의 세포 섬유화 모델을 제조하였다. 이후 세포를 그래핀 양자점 2 및 10 μg/ml의 농도로 투여하여 48시간 동안 배양 하였다. 대조군은 그래핀 양자점이 세포에 독성이 있는지 관찰하기 위해 그래핀 양자점으로만 처리되었다.
3-2. 인간 신장 근위세뇨관 세포(hPTEC)의 형태학적 변화 분석
그래핀 양자점의 재조합 TGF-β로 유도된 인간 신장 근위세뇨관 세포(hPTECs)의 섬유화 억제 효과를 확인하기 위해, 현미경으로 세포의 형태학적 변화를 관찰하였다(Magnification Х100. Scale bar 200 μm).
그 결과, 재조합 TGF-β로 유도된 세포에서는 EMT(epithelial-mesenchymal transition)이 진행되어 상피 세포는 근섬유 모세포로 변형되어, 방추형과 같은 길쭉한 형상으로 변화된 것을 확인하였다. 그러나, 그래핀 양자점의 존재하에서는 형태가 유지되었으며, 이는 EMT를 억제하는 것을 암시하는 것으로 볼 수 있다(도 12).
3-3. 신장 섬유화 관련 단백질 발현 변화 분석
대조군과 실험군에서 신장 섬유화 관련 단백질의 발현 변화를 확인하기 위해, 면역형광(Immunofluorescence, IF) 분석 및 qRT-PCR을 수행하였다.
IF분석은 세포를 4% 파라포름알데하이드(paraformaldehyde)로 실온에서 10 분 동안 고정시키고, 1차 항체 Col 1a1(Abcam, ab21286) 및 FN(Santa cruz, sc-8422)을 1% BSA 차단 완충제에서 4°C의 온도로 밤새 공동 인큐베이션 하고, Donkey-anti-mouse Alexa Fluor488 및 Donkey-anti-goat Alexa Fluor555가 결합된 2차 항체(모두 Life Technologies; Waltham, MA, USA)와 결합되었다. Confocal microscopy(Leica TCS SP8 STED CW; Wetzlar, Germany)를 사용하여 고화질 형광 이미지를 수득하였다.
qRT-PCR은 실험예 1-4과 동일한 방법으로 수행하였으며, 프라이머 서열은 하기의 표 5와 같다.
primer 서열 Species 서열번호
Fibronectin(FN)Forward CCA CCC CCA TAA GGC ATA GG human 15
Fibronectin(FN)Reverse GTA GGG GTC AAA GCA CGA GTC ATC human 16
Collagen 1a1(Col 1a1)Forward AGG GCT CCA ACG AGA TCG AGA TCC G human 17
Collagen 1a1(Col 1a1)Reverse TAC AGG AAG CAG ACA GGG CCA ACG human 18
E-cadherin(E-cad)Forward CAA TGC CGC CAT CGC TTA C human 19
E-cadherin(E-cad)Reverse ATG ACT CCT GTG TTC CTG TTA ATG human 20
실험 결과, IF 이미지에서 나타난 바와 같이, 재조합 TGF-β로 인한 FN 및 Col 1a1의 과발현이 그래핀 양자점에 의해 감소되는 것을 확인하였다(도 13a). FN 및 Col 1a1의 mRNA 수준 또한 그래핀 양자점 처리군에서 감소되는 것으로 확인되었다. 한편, E-cadherin의 mRNA 발현 수준은 그래핀 양자점에 의해 증가되었는데, 이는 EMT가 억제 되는 것을 시사한다(도 13b).
3-4. apoptosis 억제 효과 분석
재조합 TGF-β로 유도된 인간 신장 근위세뇨관 세포(hPTECs)에서 그래핀 양자점의 apoptosis 억제효과를 확인하기 위해 Annexin V/7-Amino-Actinomycin D(7-AAD)의 유세포 분석(flow cytometry)을 수행하였다.
배양 된 hPTECs의 단일세포(1X10 6)를 결합 완충액에 재현탁 시키고 30분 동안 실온에서Annexin V/7-Amino-Actinomycin D(7-AAD)(FITC Annexin V Apoptosis Detection Kit, BD Bioscience; San Jose, CA, USA)와 인큐베이션 하였다. 염색 후, 세포를 BD FACS Canto platform(BD Bioscience; San Jose, CA, 35 USA)을 사용하여 분석 하였다.
그 결과, 재조합 TGF-β로 유도된 hPTECs에서는 apoptotic 세포의 수가 현저하게 증가한 것으로 확인되었으나, 그래핀 양자점 처리군에서는 유의미하게 감소되는 것을 확인하였다(도 14a 및 도 14b).
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예 및 실험예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야 한다.
본 발명에 따른 그래핀 양자점을 유효성분으로 포함하는 약학적 조성물은 신장 섬유화 관련 단백질인 피브로넥틴, 콜라겐 1a1, Bax, TGF-β1, Smad2/3 및 α-SMA 등의 발현은 감소시키는 반면 E-cadherin, Smad7, MnSOD, 및 SOD1의 발현은 증가시킴으로써 신장 섬유화를 억제할 수 있으므로, 신장 섬유화에 의해 유발되는 만성 신장 질환의 예방 및 치료에 유용하게 이용될 것으로 기대된다.
<110> BioGraphene Inc.
Seoul National University R&DB Foundation
<120> Composition based on graphene for treating kidney disease
<130> MPCT20-080
<150> KR 10-2020-0013989
<151> 2020-02-05
<160> 20
<170> KoPatentIn 3.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Fibronectin(FN) Forward
<400> 1
cgaggtgaca gagaccacaa 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Fibronectin(FN) Reverse
<400> 2
ctggagtcaa gccagacaca 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Collagen 1a1(Col 1a1) Forward
<400> 3
atctcctggt gctgatggac 20
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Collagen 1a1(Col 1a1) Reverse
<400> 4
accttgtttg ccaggttcac 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> alpha-smooth muscle actin(alpha-SMA) Forward
<400> 5
actgggacga catggaaaag 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> alpha-smooth muscle actin(alpha-SMA) Reverse
<400> 6
catctccaga gtccagcaca 20
<210> 7
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> TGF-beta Forward
<400> 7
caacaattcc tggcgttacc ttgg 24
<210> 8
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> TGF-beta Reverse
<400> 8
gaaagccctg tattccgtct cct 23
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Bax Primer1
<400> 9
gttcccgaag taggagagga 20
<210> 10
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Bax Primer2
<400> 10
ctaaagtgcc cgagctgat 19
<210> 11
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Bax probe
<400> 11
aagtccagtg tccagcccat gatg 24
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> SOD1 Primer1
<400> 12
gtcctttcca gcagtcacat 20
<210> 13
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> SOD1 Primer2
<400> 13
ggttccacgt ccatcagtat g 21
<210> 14
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> SOD1 Probe
<400> 14
tccaacatgc ctctcttcat ccgc 24
<210> 15
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Fibronectin(FN) Forward - human
<400> 15
ccacccccat aaggcatagg 20
<210> 16
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Fibronectin(FN) Reverse - human
<400> 16
gtaggggtca aagcacgagt catc 24
<210> 17
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Collagen 1a1(Col 1a1) Forward - human
<400> 17
agggctccaa cgagatcgag atccg 25
<210> 18
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Collagen 1a1(Col 1a1) Reverse - human
<400> 18
tacaggaagc agacagggcc aacg 24
<210> 19
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> E-cadherin(E-cad) Forward - human
<400> 19
caatgccgcc atcgcttac 19
<210> 20
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> E-cadherin(E-cad) Reverse - human
<400> 20
atgactcctg tgttcctgtt aatg 24

Claims (10)

  1. 그래핀 양자점을 유효성분으로 포함하는 만성 신장 질환의 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서,
    상기 만성 신장 질환은 신장 섬유화에 의해 유발되는 것을 특징으로 하는, 약학적 조성물.
  3. 제1항에 있어서,
    상기 만성 신장 질환은 말기 신장 질환(End-Stage Kidney Disease; ESKD), 당뇨병성 신증(Diabetic Nephropathy; DN), IgA 신증(IgA Nephropathy; IgAN), HIV-관련 신증, 비-당뇨병성 만성 신장 질환(Non-diabetic Chronic Kidney Disease), 국소분절 사구체경화증(Focal Segmental Glomerulosclerosis; FSGS), 미세변화형 신증후군(Minimal change disease; MCD) 및 크산틴 옥시다아제 결핍증으로 이루어진 군으로부터 선택되는 하나 이상인 것을 특징으로 하는, 약학적 조성물.
  4. 제1항에 있어서,
    상기 조성물은 피브로넥틴(Fibronectin), 콜라겐 1a1(collagen 1a1), Bcl-2 관련 X 단백질(Bcl-2-associated X protein; Bax), 종양성장인자 베타1(Transforming growth factor-β1; TGF-β1), Smad2/3 및 알파 평활근 액틴(α-smooth muscle actin; α-SMA)으로 이루어진 군으로부터 선택되는 하나 이상의 단백질의 발현을 감소시키는 것을 특징으로 하는, 약학적 조성물.
  5. 제1항에 있어서,
    상기 조성물은 E-카드헤린(E-cadherin), Smad7, MnSOD, 및 SOD1로 이루어진 군으로부터 선택되는 하나 이상의 단백질의 발현을 증가시키는 것을 특징으로 하는, 약학적 조성물.
  6. 제1항에 있어서,
    상기 그래핀 양자점은 평균 직경이 1 내지 5 nm 인 것을 특징으로 하는, 약학적 조성물.
  7. 제1항에 있어서,
    상기 그래핀 양자점은 평균 높이가 0.5 내지 2.5 nm 인 것을 특징으로 하는, 약학적 조성물.
  8. 제1항 내지 제7항 중 어느 한 항에 따른 그래핀 양자점을 유효성분으로 포함하는 약학적 조성물을 개체에 투여하는 단계를 포함하는, 만성 신장 질환의 치료 방법.
  9. 제1항 내지 제7항 중 어느 한 항에 따른 그래핀 양자점을 유효성분으로 포함하는 조성물의 만성 신장 질환의 치료 용도.
  10. 만성 신장 질환의 치료에 이용되는 약제를 제조하기 위한 그래핀 양자점의 용도.
PCT/KR2020/015512 2020-02-05 2020-11-06 그래핀 기반 신장 질환 치료용 조성물 WO2021157818A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP2022544194A JP2023512960A (ja) 2020-02-05 2020-11-06 グラフェンベースの腎疾患治療用組成物
US17/759,220 US20230055621A1 (en) 2020-02-05 2020-11-06 Graphene-based composition for treating kidney disease
CN202080095781.0A CN115397437A (zh) 2020-02-05 2020-11-06 用于治疗肾病的基于石墨烯的组合物
EP20917974.6A EP4101456A4 (en) 2020-02-05 2020-11-06 GRAPHENE-BASED COMPOSITION FOR THE TREATMENT OF KIDNEY DISEASE

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0013989 2020-02-05
KR1020200013989A KR102277665B1 (ko) 2020-02-05 2020-02-05 그래핀 기반 신장 질환 치료용 조성물

Publications (1)

Publication Number Publication Date
WO2021157818A1 true WO2021157818A1 (ko) 2021-08-12

Family

ID=76889535

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/015512 WO2021157818A1 (ko) 2020-02-05 2020-11-06 그래핀 기반 신장 질환 치료용 조성물

Country Status (6)

Country Link
US (1) US20230055621A1 (ko)
EP (1) EP4101456A4 (ko)
JP (1) JP2023512960A (ko)
KR (1) KR102277665B1 (ko)
CN (1) CN115397437A (ko)
WO (1) WO2021157818A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130216581A1 (en) * 2008-03-19 2013-08-22 Yale University Carbon Nanotube Compositions and Methods of Use Thereof
KR101633957B1 (ko) * 2012-08-27 2016-06-27 이화여자대학교 산학협력단 피라졸 유도체를 포함하는 신장질환 예방 또는 치료용 조성물
JP2016529310A (ja) * 2013-09-03 2016-09-23 ウィリアム・マーシュ・ライス・ユニバーシティ 炭素材料による炎症性疾患の処置
KR20190060492A (ko) * 2017-11-24 2019-06-03 서울대학교산학협력단 그래핀 양자점을 포함하는 항염증용 조성물
KR20200013989A (ko) 2018-07-31 2020-02-10 삼성에스디아이 주식회사 복수의 벤트를 갖는 이차전지

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9393396B2 (en) * 2002-02-14 2016-07-19 Gholam A. Peyman Method and composition for hyperthermally treating cells
WO2015152688A1 (ko) * 2014-04-04 2015-10-08 서울대학교산학협력단 퇴행성 신경 질환의 예방 또는 치료를 위한 그래핀 나노구조체 기반 약학적 조성물
JP6994726B2 (ja) * 2017-11-24 2022-02-04 ソウル大学校産学協力団 グラフェンナノ構造体を含む抗炎症用組成物
CN107955006B (zh) * 2017-11-29 2020-03-10 温州医科大学 一种氨基喹啉改性的氮参杂石墨烯量子点及其制备方法与制备组氨酸荧光检测试剂上的应用
US10814021B2 (en) * 2017-12-15 2020-10-27 University Of Washington Paramagnetic boron-doped graphene quantum dots and their application for safe magnetic resonance imaging
WO2020009551A1 (ko) * 2018-07-06 2020-01-09 바이오그래핀 주식회사 신경단백질의 비정상적 섬유화 또는 응집과 관련된 질환 치료제로서의 그래핀 양자점
JP7266800B2 (ja) * 2018-07-06 2023-05-01 バイオグラフェン インコーポレイテッド 神経タンパク質の異常な線維化または凝集に関連する疾患治療剤としてのグラフェン量子ドット

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130216581A1 (en) * 2008-03-19 2013-08-22 Yale University Carbon Nanotube Compositions and Methods of Use Thereof
KR101633957B1 (ko) * 2012-08-27 2016-06-27 이화여자대학교 산학협력단 피라졸 유도체를 포함하는 신장질환 예방 또는 치료용 조성물
JP2016529310A (ja) * 2013-09-03 2016-09-23 ウィリアム・マーシュ・ライス・ユニバーシティ 炭素材料による炎症性疾患の処置
KR20190060492A (ko) * 2017-11-24 2019-06-03 서울대학교산학협력단 그래핀 양자점을 포함하는 항염증용 조성물
KR20200013989A (ko) 2018-07-31 2020-02-10 삼성에스디아이 주식회사 복수의 벤트를 갖는 이차전지

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
HU ZONGTAO, QIN FENG, GAO SHILE, ZHEN YILAN, HUANG DAKE, DONG LIUYI: "Paeoniflorin exerts protective effect on radiation-induced hepatic fibrosis in rats via TGF-β1/Smads signaling pathway", AMERICAN JOURNAL OF TRANSLATIONAL RESEARCH, E-CENTURY PUBLISHING CORPORATION, US, vol. 10, no. 3, 1 January 2018 (2018-01-01), US, pages 1012 - 1021, XP055832710, ISSN: 1943-8141 *
LI, LILIN; JOO HEE KIM, SEUNG HEE YANG, JOO HONG JOUN, JUNG NAM AN, JEONG HWAN LEE, YOUNG WOOK CHOI, BYUNG HEE HONG, JUNG PYO LEE: "Effect of graphene-based nanomaterials treatment in kidney fibrosis", THE 39TH ANNUAL MEETING OF THE KOREAN SOCIETY OF NEPHROLOGY (KSN 2019); MAY 23-26, 2019; SEOUL, KOREA, vol. 39, 23 May 2019 (2019-05-23), Korea, pages 1297, XP009529471 *
LI, LILIN; YANG, SEUNG HEE; JOUN, JOO HONG; AN, JUNG NAM; LEE, JEONGHWAN; LEE, JUNG PYO: "TH-PO464 Graphene Quantum Dots Suppress Kidney Fibrosis After AKI by Affecting the Pericyte-Myofibroblast Transition", JOURNAL OF THE AMERICAN SOCIETY OF NEPHROLOGY, 7 November 2019 (2019-11-07), pages TH-PO464, XP009529470 *
See also references of EP4101456A4

Also Published As

Publication number Publication date
CN115397437A (zh) 2022-11-25
JP2023512960A (ja) 2023-03-30
KR102277665B1 (ko) 2021-07-15
EP4101456A1 (en) 2022-12-14
US20230055621A1 (en) 2023-02-23
EP4101456A4 (en) 2024-02-21

Similar Documents

Publication Publication Date Title
WO2019182370A1 (ko) Cox2 아세틸화제를 유효성분으로 포함하는 퇴행성 신경질환의 예방 또는 치료용 약학적 조성물
WO2021162451A1 (ko) 담즙산 또는 이의 유도체, 바이구아나이드 계열 화합물 및 항바이러스제 중 2종 이상을 유효성분으로 함유하는 암 예방 또는 치료용 약학적 조성물
WO2021256861A1 (ko) 신규한 산 분비 억제제 및 이의 용도
WO2021145552A1 (ko) 글루카곤, glp-1 및 gip 수용체 모두에 활성을 갖는 삼중 활성체의 지속형 결합체의 폐질환의 치료 용도
WO2020009551A1 (ko) 신경단백질의 비정상적 섬유화 또는 응집과 관련된 질환 치료제로서의 그래핀 양자점
WO2022139493A1 (ko) TGF-β 신호전달을 억제할 수 있는 신규한 펩타이드 및 이의 용도
WO2021157818A1 (ko) 그래핀 기반 신장 질환 치료용 조성물
WO2022015082A1 (ko) 글루카곤 유도체 또는 이의 결합체의 간질환에 대한 치료적 용도
WO2021066600A1 (ko) 글루카곤, 및 glp-1 수용체 및 gip 수용체 이중 작용제를 포함하는 조성물 및 이의 치료학적 용도
WO2022015115A1 (ko) 3중 작용성 지속형 결합체 또는 3중 작용제를 포함하는 조합물의 치료학적 용도
WO2020263063A1 (ko) 글루카곤, glp-1 및 gip 수용체 모두에 활성을 갖는 삼중 활성체 또는 이의 결합체의 간 질환에 대한 치료적 용도
WO2023080765A1 (ko) 신규 옥사다이아졸 유도체 및 이의 용도
WO2017010790A1 (ko) 나노입자-유리체 기반 단백질 복합체를 유효성분으로 포함하는 혈관신생억제용 조성물 및 이의 용도
WO2015046783A1 (en) Pharmaceutical composition for treatment of radiation- or drug-resistant cancer comprising hrp-3 inhibitor
WO2022065968A1 (ko) 에보디아민을 유효성분으로 포함하는 비소세포폐암의 예방 또는 치료용 약학적 조성물
WO2016178511A1 (ko) Kai1 폴리펩타이드 또는 이를 코딩하는 유전자를 포함하는 혈관신생 억제용 조성물 및 이의 용도
WO2017217741A1 (ko) 신규한 브롬화 퓨라논 유도체, 이의 제조방법 및 이를 유효성분으로 함유하는 약학적 조성물
WO2018016901A1 (ko) 골질환의 예방 또는 치료용 약학적 조성물
WO2021100897A1 (ko) 바이구아나이드 계열, 및 페로센 또는 페로센 유도체를 유효성분으로 함유하는 암 예방 또는 치료용 약학적 조성물
WO2009145488A2 (ko) 지방세포로의 분화 조절 기능을 갖는 지방세포 분화 표지자로서의 xbp1(s) 단백질 및 그 용도
WO2014175604A2 (ko) 아벨리노 각막이상증 진단용 조성물 및 이의 진단방법
WO2023085894A1 (ko) RORα의 활성자로서의 신규한 티오우레아 유도체 및 이를 포함하는 약학적 조성물
WO2021150069A1 (ko) 대사질환 치료제로서의 신규한 퀴나졸리논 화합물
WO2022005155A1 (ko) 신규 아텔로콜라겐 및 그의 용도
WO2023014062A1 (ko) Hapln1을 포함하는 섬유성 질환의 예방 또는 치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20917974

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022544194

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020917974

Country of ref document: EP

Effective date: 20220905