WO2021096220A1 - 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 유래된 엑소좀을 포함하는 신장 질환의 예방 또는 치료용 조성물 - Google Patents

유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 유래된 엑소좀을 포함하는 신장 질환의 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2021096220A1
WO2021096220A1 PCT/KR2020/015790 KR2020015790W WO2021096220A1 WO 2021096220 A1 WO2021096220 A1 WO 2021096220A1 KR 2020015790 W KR2020015790 W KR 2020015790W WO 2021096220 A1 WO2021096220 A1 WO 2021096220A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
stem cells
mesenchymal stem
exosomes
bxc
Prior art date
Application number
PCT/KR2020/015790
Other languages
English (en)
French (fr)
Inventor
김수
이슬기
Original Assignee
브렉소젠 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 브렉소젠 주식회사 filed Critical 브렉소젠 주식회사
Priority to EP20888516.0A priority Critical patent/EP4079313A4/en
Priority to JP2022527079A priority patent/JP2023501510A/ja
Priority to CN202080079648.6A priority patent/CN114728024B/zh
Priority to US17/774,562 priority patent/US20220387509A1/en
Priority claimed from KR1020200149965A external-priority patent/KR102630220B1/ko
Publication of WO2021096220A1 publication Critical patent/WO2021096220A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0668—Mesenchymal stem cells from other natural sources
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0684—Cells of the urinary tract or kidneys
    • C12N5/0686—Kidney cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0696—Artificially induced pluripotent stem cells, e.g. iPS
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • C12N2502/1352—Mesenchymal stem cells
    • C12N2502/1388—Mesenchymal stem cells from other natural sources

Definitions

  • the present invention relates to a composition for preventing or treating kidney disease, comprising as an active ingredient exosomes derived from induced pluripotent stem cell-derived mesenchymal stem cell progenitor cells that are pretreated or not pretreated with a pretreatment material.
  • Mesenchymal stem cells are stromal cells with multipotency, and refer to cells that can differentiate into various cells including osteoblasts, chondrocytes, muscle cells, and adipocytes. Since mesenchymal stem cells can differentiate into various connective tissues such as cartilage, bone tissue, ligaments, and bone marrow matrix, studies are being conducted for various diseases such as treating soft tissue defects caused by arthritis, trauma, and burns.
  • each kidney consists of a basic structure of about 1 million nephrons, and one nephron is composed of a microscopic capillary lump called a glomerulus and a renal tubule for filtering and absorption. Functions.
  • Kidney disease is a condition in which the kidney does not normally perform excretion, regulation, metabolic and endocrine functions, and is generally degraded or caused abnormalities. Kidney disease is classified as acute renal failure or chronic renal failure according to its progression, or depending on the cause of the onset. Accordingly, it is divided into glomerulonephritis due to deposition of vascular complex, diabetic nephropathy due to complications such as diabetes or high blood pressure, toxic nephropathy due to administration of drugs such as antibiotics or anticancer drugs, and urinary tract infection due to bacterial infection.
  • kidney disease Regardless of the type of kidney disease that causes kidney disease, if renal dysfunction progresses chronically and the glomerular filtration rate decreases to less than 50%, in most cases, the glomerular filtration rate continues to decrease, ultimately reaching end-stage renal failure and blood. Complications such as medical abnormalities, nervous system complications, gastrointestinal complications, immunological complications, infections or osteodystrophy occur, leading to death in severe cases.
  • kidney disease is increasing every year around the world, and moreover, symptoms do not appear or are not well recognized, leading to end-stage renal failure even if detected early in many cases.
  • the treatment of renal failure although long-term dialysis and renal transplantation and other treatment means exist, it does not solve the problem of early and mid-term treatment of chronic renal failure, and the treatment cost is high, which puts a heavy economic burden on the country and the patient's family. give.
  • the present inventors made intensive research efforts to develop a therapeutic agent for kidney disease using exosomes of mesenchymal stem cells.
  • progenitor cells of mesenchymal stem cells that are in the undifferentiated stage than mesenchymal stem cells derived from induced pluripotent stem cells (iPSCs) were established, and the induced pluripotent cells were pretreated with or without pretreatment. It was found that exosomes derived from stem cell-derived mesenchymal stem cell progenitor cells exhibit excellent preventive or therapeutic effects of kidney disease, and the present invention was completed.
  • an object of the present invention is to include exosomes isolated from progenitor cells of induced pluripotent stem cells (iPSC)-derived mesenchymal stem cells (MSCs) as an active ingredient. disease) to provide a pharmaceutical composition for the prevention or treatment.
  • iPSC induced pluripotent stem cells
  • MSCs mesenchymal stem cells
  • Another object of the present invention is to provide an exosome isolated from progenitor cells of induced pluripotent stem cells-derived mesenchymal stem cells.
  • Another object of the present invention is to use exosomes isolated from progenitor cells of induced pluripotent stem cells (iPSC)-derived mesenchymal stem cells (MSCs) pretreated with a pretreatment material as an active ingredient. It is to provide a pharmaceutical composition for the prevention or treatment of kidney disease (Kidney disease) comprising.
  • iPSC induced pluripotent stem cells
  • MSCs mesenchymal stem cells
  • Another object of the present invention is to provide an exosome isolated from progenitor cells of induced pluripotent stem cells-derived mesenchymal stem cells pretreated with a pretreatment material.
  • the present inventors made intensive research efforts to develop a therapeutic agent for kidney disease using exosomes of mesenchymal stem cells.
  • progenitor cells of mesenchymal stem cells that are in the undifferentiated stage than mesenchymal stem cells derived from induced pluripotent stem cells (iPSCs) were established, and the induced pluripotent cells were pretreated with or without pretreatment. It was found that the exosomes derived from stem cell-derived mesenchymal stem cell progenitor cells exhibit excellent preventive or therapeutic effects of kidney disease.
  • the present invention is an induced pluripotent stem cell-derived mesenchymal stem cell, an exosome isolated from the progenitor cells, and a pharmaceutical composition for the prevention or treatment of kidney disease comprising the same as an active ingredient, and pretreated with a pretreatment material, induced pluripotent stem cells -It relates to a pharmaceutical composition for preventing or treating kidney disease comprising exosomes isolated from progenitor cells of derived mesenchymal stem cells and the same as an active ingredient.
  • kidney disease comprising exosomes isolated from progenitor cells of induced pluripotent stem cells (iPSC)-derived mesenchymal stem cells (MSCs) as an active ingredient.
  • iPSC induced pluripotent stem cells
  • MSCs mesenchymal stem cells
  • stem cell refers to a cell having the ability to differentiate into two or more different types of cells while having the ability to self-replicate as an undifferentiated cell.
  • the stem cells of the present invention may be autologous or allogeneic stem cells.
  • induced pluripotent stem cell induces dedifferentiation in already differentiated cells such as somatic cells to return to the initial undifferentiated state and to have pluripotency. Means the cells that have been
  • the dedifferentiation can be induced by introducing and expressing a specific gene (eg, Sox2, c-Myc, Klf4, Oct-4, etc.) or by injecting a dedifferentiation inducing protein made in a cell into which the specific gene has been introduced. .
  • a specific gene eg, Sox2, c-Myc, Klf4, Oct-4, etc.
  • the pluripotency refers to the ability to differentiate into tissues or organs of the three germ layers constituting a living body, that is, endoderm, mesoderm and ectoderm.
  • mesenchymal stem cell refers to a stem cell capable of differentiating into various cells including osteoblasts, chondrocytes, muscle cells, adipocytes, etc. as cells having multipotency.
  • the mesenchymal stem cells are most commonly used as bone marrow-derived mesenchymal stem cells, but may be derived from umbilical cord or umbilical cord blood, adipose tissue, amniotic fluid, tooth buds of molars in addition to bone marrow.
  • Mesenchymal stem cells are also called stromal cells.
  • the progenitor cells of the mesenchymal stem cells are not general mesenchymal stem cells, but are progenitor cells (BxC) of mesenchymal stem cells derived from induced pluripotent stem cells (iPSCs) [developed by the present inventors]. .
  • the "derived pluripotent stem cell” refers to cells induced to have pluripotent differentiation ability through an artificial dedifferentiation process from differentiated cells, and is also referred to as a dedifferentiated stem cell.
  • the artificial dedifferentiation process is performed by introduction of a non-viral-mediated dedifferentiation factor using a virus-mediated or non-viral vector using a retrovirus, a lentivirus, and a Sendai virus, a protein and cell extract, or a stem cell extract. , Dedifferentiation by compounds, etc.
  • the induced pluripotent stem cells have almost the same characteristics as embryonic stem cells, specifically show similar cell shapes, similar gene and protein expression patterns, have pluripotency in vitro and in vivo, teratoma And, when inserted into a blastocyst of a mouse, a chimera mouse is formed, and germline transmission of genes is possible.
  • the induced pluripotent stem cells of the present invention include induced pluripotent stem cells derived from all mammals such as humans, monkeys, pigs, horses, cattle, sheep, dogs, cats, mice, rabbits, but preferably human induced pluripotent stem cells. It is a cell.
  • somatic cells before the induced pluripotent stem cells of the present invention are dedifferentiated may be somatic cells derived from umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane, amniotic fluid or placenta, but is not limited thereto.
  • the somatic cells are fibroblasts, hepatocytes, adipocytes, epithelial cells, epidermal cells, chondrocytes, muscle cells, and myocardial cells. Includes, but is limited to, cardiac muscle cells, melanocytes, neural cells, glial cells, astroglial cells, monocytes, macrophages, etc. It does not become.
  • the progenitor cells of the mesenchymal stem cells of the present invention are ANKRD1, CPE, NKAIN4, LCP1, CCDC3, MAMDC2, CLSTN2, SFTA1P, EPB41L3, PDE1C, compared to the same number of mesenchymal stem cells.
  • one or more genes selected from the group consisting of EMILIN2, SULT1C4, TRIM58, DENND2A, CADM4, AIF1L, NTM, SHISA2, RASSF4, and ACKR3 are expressed at higher levels.
  • the progenitor cells of the mesenchymal stem cells of the present invention are 1 selected from the group consisting of DHRS3, BMPER, IFI6, PRSS12, RDH10, and KCNE4 compared to the same number of mesenchymal stem cells. These genes are expressed at a lower level.
  • the progenitor cells of the mesenchymal stem cells and the same number of mesenchymal stem cells are derived from allogeneic tissues. More specifically, the progenitor cells of the mesenchymal stem cells are progenitor cells of mesenchymal stem cells derived from induced pluripotent stem cells.
  • the progenitor cells of the mesenchymal stem cells are progenitor cells of mesenchymal stem cells derived from induced pluripotent stem cells derived from umbilical cord tissue, and an equivalent number of mesenchymal stem cells compared thereto are umbilical cord It is a tissue-derived mesenchymal stem cell.
  • the present inventors named the progenitor cells of the mesenchymal stem cells derived from the induced pluripotent stem cells as BxC (brexogen stem cells).
  • BxC induced pluripotent stem cells
  • the "progenitor cells of mesenchymal stem cells derived from induced pluripotent stem cells (BxC)" are also expressed as “mesenchymal progenitor cells derived from induced pluripotent stem cells”.
  • Progenitor cells (BxC) of mesenchymal stem cells of induced pluripotent stem cells derived from the same tissue (eg umbilical cord tissue) of the present invention are compared with mesenchymal stem cells (MSC) derived from the same tissue (eg, umbilical cord tissue).
  • MSC mesenchymal stem cells
  • the BxC of the present invention shows a difference in proliferative capacity of at least 10 times compared to that of mesenchymal stem cells (MSC) derived from the same tissue when passages are repeated 9 or more times. No reduction was observed.
  • the expression level of Ki67 a marker related to cell proliferation ability, is more than twice as high in BxC as compared to MSC.
  • the progenitor cells (BxC) of mesenchymal stem cells derived from the induced pluripotent stem cells contain functional proteins such as Endostatin, Endothelin-1, VEGF-A, Thrombospondin-2, PlGF, PDGF-AA, beta-NGF, and HB-EGF. It secretes a large amount compared to the same number of mesenchymal stem cells.
  • Endostatin is a 20 kDa C-terminal fragment derived from naturally produced type XVIII collagen, and is reported as an anti-angiogenic agent.
  • endothelin-1 also known as preproendothelin-1 (PPET1)
  • PPET1 preproendothelin-1
  • EDN1 vascular endothelial cells
  • endothelin-1 is known as a powerful vasoconstrictor.
  • vascular endothelial growth factor A is a protein encoded by the VEGFA gene and is known to induce the growth of blood vessels through interaction with VEGFR1 and VEGFR2 of vascular endothelial cells.
  • Thrombospondin-2 is a protein encoded by the THBS2 gene, and is known to mediate cell-cell interaction or cell-substrate interaction. Although the role of Thrombospondin-2 on cancer is controversial, it has been reported to regulate cell surface properties of mesenchymal stem cells, and is known to be involved in cell adhesion and cell migration.
  • the PLGF placental growth factor
  • the PLGF is a protein encoded by the PGF gene and is known as a protein that plays a major role in angiogenesis in embryogenesis as a member of the VEGF sub-family.
  • the PDGF-AA platelet-derived growth factor
  • the PDGF-AA is a growth factor that regulates cell growth and division, and plays an important role in the generation and growth of blood vessels, and proliferation, chemotaxis, and migration of mesenchymal stem cells. It is known to do.
  • NGF Neve growth factor
  • gamma-NGF a neurotrophic factor and a neuropeptide
  • NGF is a complex of three proteins in which alpha-, beta-, and gamma-NGF are expressed in a ratio of about 2:1:2, where gamma-NGF acts as a serine protease, and the N-terminal of beta-NGF It is known to activate NGF by cleavage.
  • HB-EGF heparin-binding EGF-like growth factor
  • exosome refers to a membrane vesicle having a membrane structure composed of a lipid-bilayer existing in cells or secreted by a cell extracellularly, and is present in almost all eukaryotic body fluids.
  • the diameter of exosomes is about 30-1000 nm, and when multivesicular bodies fuse with the cell membrane, they are released from the cell, or are released directly from the cell membrane.
  • exosomes play a role in transporting proteins, bioactive lipids, and RNA (miRNA), which are biomolecules within cells, in order to play a functional role in mediating coagulation, cell-cell communication, and cellular immunity.
  • the exosome is a concept encompassing microvesicles.
  • marker proteins for exosomes CD63 and CD81 are known.Other than that, receptors on the surface of cells such as EGFR, molecules related to signal transduction, proteins related to cell adhesion, MSC-related antigens, heat shock proteins, and vesicle formation. Proteins such as Alix are known.
  • the exosomes isolated from the progenitor cells of the induced pluripotent stem cells-derived mesenchymal stem cells are present in the progenitor cells (BxC) of the induced pluripotent stem cells-derived mesenchymal stem cells or the exo secreted from BxC. Means little.
  • the term “comprising as an active ingredient” means that the exosomes isolated from progenitor cells of induced pluripotent stem cells-derived mesenchymal stem cells contain an amount sufficient to achieve the prophylactic or therapeutic activity of kidney disease do.
  • the kidney disease is renal fibrosis, diabetic nephropathy, hypertensive nephropathy, glomerulonephritis, pyelonephritis, interstitial nephritis, lupus nephritis, polycystic kidney disease, renal failure, glomerular sclerosis, acute rejection after transplantation and/or kidney damage due to drugs.
  • renal fibrosis diabetic nephropathy, hypertensive nephropathy, glomerulonephritis, pyelonephritis, interstitial nephritis, lupus nephritis, polycystic kidney disease, renal failure, glomerular sclerosis, acute rejection after transplantation and/or kidney damage due to drugs.
  • diabetic nephropathy diabetic nephropathy
  • hypertensive nephropathy glomerulonephritis
  • pyelonephritis pye
  • the drug may be an anticancer agent, for example, cisplatin, but is not limited thereto.
  • prevention refers to any action that suppresses or delays progression of kidney disease by administration of the composition of the present invention.
  • treatment refers to (a) inhibition of the development of kidney disease; (b) alleviation of kidney disease; And (c) it means the elimination of kidney disease.
  • the pharmaceutical composition according to the present invention may include a pharmaceutically acceptable carrier in addition to the active ingredient.
  • the pharmaceutically acceptable carrier is commonly used in the formulation, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose , Polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil, but are not limited thereto.
  • a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like may be additionally included in addition to the above components.
  • composition of the present invention can be administered orally or parenterally (for example, intravenous, subcutaneous, intraperitoneal or topical application) according to a desired method, and the dosage is It depends on the degree, drug form, administration route and time, but may be appropriately selected by those skilled in the art.
  • composition of the present invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective amount is the type, severity, activity of the drug, and Sensitivity to, administration time, route of administration and rate of excretion, duration of treatment, factors including drugs used concurrently, and other factors well known in the medical field.
  • the pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or administered in combination with other therapeutic agents, may be administered sequentially or simultaneously with a conventional therapeutic agent, and may be administered single or multiple. It is important to administer an amount capable of obtaining the maximum effect in a minimum amount without side effects in consideration of all of the above factors, and this can be easily determined by a person skilled in the art.
  • the effective amount of the pharmaceutical composition of the present invention may vary depending on the patient's age, sex, condition, weight, absorption of the active ingredient in the body, inactivation rate and excretion rate, the type of disease, and the drug to be used in combination.
  • Another aspect of the present invention relates to exosomes isolated from progenitor cells of induced pluripotent stem cells-derived mesenchymal stem cells.
  • the exosomes (BxC-e) isolated from the progenitor cells of the induced pluripotent stem cells-derived mesenchymal stem cells of the present invention are exosomes having characteristics as conventional exosomes.
  • the renal cell regeneration effect of exosomes isolated from progenitor cells of the induced pluripotent stem cells-derived mesenchymal stem cells was excellent (FIG. 2).
  • the BxC-e of the present invention inhibits inflammation, apoptosis, and suppresses endoplasmic reticulum stress in kidney cells in which Kidney failure is induced (FIGS. 4A to 6B ).
  • Another aspect of the present invention relates to a method for treating kidney disease comprising administering to an individual exosomes isolated from progenitor cells of the induced pluripotent stem cells-derived mesenchymal stem cells.
  • the "individual” refers to a subject in need of treatment of a disease, and more specifically, refers to a mammal such as a human or non-human primate, mouse, dog, cat, horse, and cow.
  • Another aspect of the present invention relates to the use of exosomes isolated from progenitor cells of the induced pluripotent stem cells-derived mesenchymal stem cells to treat kidney disease.
  • the renal disease treatment method and therapeutic use are the exosomes isolated from the progenitor cells of the induced pluripotent stem cell-derived mesenchymal stem cells of the present invention described above, and a pharmaceutical composition and components including the same, so that Description of the common content is omitted in order to avoid excessive complexity of the present specification.
  • an exosome isolated from progenitor cells of induced pluripotent stem cells (iPSC)-derived mesenchymal stem cells (MSCs) pretreated with a pretreatment material is an active ingredient. It relates to a pharmaceutical composition for the prevention or treatment of kidney disease (Kidney disease) comprising as.
  • pretreatment refers to contacting the cell culture medium to which the pretreatment material is added to the progenitor cells of the induced pluripotent stem cells-derived mesenchymal stem cells during the cultivation of the progenitor cells of the induced pluripotent stem cells-derived mesenchymal stem cells. Means process.
  • the pretreatment may be performed by culturing the progenitor cells of the induced pluripotent stem cells-derived mesenchymal stem cells in a cell culture medium containing a pretreatment material.
  • the cell culture medium may be any medium commonly used for animal cell culture, for example, DMEM (Dulbecco's modification of Eagle's medium), a mixture of DMEM and F12, Eagles' MEM (Eagle's minimum essential medium), ⁇ -MEM , Iscove's MEM, 199 medium, CMRL 1066, RPMI 1640, F12, F10, Way-mouth's MB752/1, McCoy's 5A and MCDB series, and the like can be used.
  • DMEM Dulbecco's modification of Eagle's medium
  • Eagles' MEM Eagles' MEM
  • ⁇ -MEM Iscove's MEM
  • the cultivation may be performed for 6 to 48 hours.
  • the culture is 6 to 42 hours, 6 to 36 hours, 6 to 30 hours, 6 to 27 hours, 12 to 48 hours, 12 to 42 hours, 12 to 36 hours, 12 to 30 hours, 12 to 27 hours , 18 to 48 hours, 18 to 42 hours, 18 to 36 hours, 18 to 30 hours, 18 to 27 hours, 21 to 48 hours, 21 to 42 hours, 21 to 36 hours, 21 to 30 hours or 21 to 27 hours Can be done.
  • the pretreatment material may be Exendin-4.
  • Exendin-4 of the present invention is a peptide agonist of a glucagon-like peptide (GLP) receptor. Exendin-4 is known to promote insulin secretion, and has been used clinically for the treatment of type 2 diabetes and Parkinson's disease.
  • GLP glucagon-like peptide
  • the exendin-4 may be included in a concentration of 1 to 100 nM in the cell culture medium.
  • the exendin-4 is 1 to 90 nM, 1 to 80 nM, 1 to 70 nM, 1 to 60 nM, 1 to 50 nM, 1 to 40 nM, 1 to 30 nM, 10 to in the cell culture medium It may be included in concentrations of 90 nM, 10 to 80 nM, 10 to nM, 10 to 60 nM, 10 to 50 nM, 10 to 40 nM, and 10 to 30 nM.
  • the pretreatment material may be Lanifibranor.
  • Ranifibranor of the present invention is a peroxisome proliferator-activated receptors (PPAR) agonist that activates three PPAR isoforms known as PPAR ⁇ , PPAR ⁇ and PPAR ⁇ , respectively, to induce antifibrotic, anti-inflammatory and beneficial metabolic changes in the body. It is a known small molecule.
  • PPAR is a ligand-activated transcription factor belonging to the family of nuclear hormone receptors that regulate the expression of genes.
  • PPAR plays an essential role in the regulation of cell differentiation, development and tumor formation. It is known to reduce abnormal growth of connective tissue by activating PPAR, which regulates fibrosis.
  • ranifibranor has been used clinically as a therapeutic agent for systemic sclerosis and idiopathic pulmonary fibrosis.
  • the ranifibranor may be included in a concentration of 1 to 100 nM in the cell culture medium.
  • the ranifibranor is 1 to 1000 ⁇ M, 1 to 500 ⁇ M, 1 to 100 ⁇ M, 1 to 90 ⁇ M, 1 to 80 ⁇ M, 1 to 70 ⁇ M, 1 to 60 ⁇ M, 1 to 50 ⁇ M, 1 to 40 ⁇ M, 1 in the cell culture medium
  • 1 to 20 ⁇ M 5 to 1000 ⁇ M, 5 to 500 ⁇ M, 5 to 100 ⁇ M, 5 to 90 ⁇ M, 5 to 80 ⁇ M, 5 to 70 ⁇ M, 5 to 60 ⁇ M, 5 to 50 ⁇ M, 5 to 40 ⁇ M, 5 to 30 ⁇ M, 5 to 20 ⁇ M It can be included in the concentration of.
  • Another aspect of the present invention relates to exosomes isolated from progenitor cells of induced pluripotent stem cells-derived mesenchymal stem cells pretreated with a pretreatment material.
  • exosomes (BxC-G63e) isolated from progenitor cells of induced pluripotent stem cells-derived mesenchymal stem cells pretreated with the pretreatment material of the present invention are exosomes having characteristics as conventional exosomes.
  • the BxC-G63e of the present invention inhibits inflammation, apoptosis, and suppresses endoplasmic reticulum stress in kidney cells induced kidney failure. (Figs. 4A to 6B).
  • Another aspect of the present invention relates to a method for treating kidney disease comprising administering to an individual exosomes isolated from progenitor cells of induced pluripotent stem cells-derived mesenchymal stem cells pretreated with the pretreatment material.
  • the "individual” refers to a subject in need of treatment of a disease, and more specifically, refers to a mammal such as a human or non-human primate, mouse, dog, cat, horse, and cow.
  • Another aspect of the present invention relates to the use of exosomes isolated from progenitor cells of induced pluripotent stem cells-derived mesenchymal stem cells pretreated with the pretreatment material to treat kidney disease.
  • the renal disease treatment method and therapeutic use are pre-treated with the pretreatment material of the present invention, an exosome isolated from progenitor cells of induced pluripotent stem cells-derived mesenchymal stem cells, and a pharmaceutical composition and components including the same. Because of this, descriptions of common content between them are omitted in order to avoid excessive complexity of the present specification.
  • the present invention relates to a pharmaceutical composition for the prevention or treatment of kidney disease comprising as an active ingredient exosomes isolated from progenitor cells of induced pluripotent stem cells-derived mesenchymal stem cells that are pretreated or not pretreated with a pretreatment material.
  • the exosomes of the present invention exhibit improved kidney disease prevention or treatment effects compared to exosomes isolated from existing mesenchymal stem cells, and can be usefully used for related research and development and commercialization.
  • FIG. 1A is a diagram showing the average size and distribution of exosomes (BxC-e) isolated from induced pluripotent stem cells-derived mesenchymal stem cell progenitor cells (BxC).
  • 1B is an electron micrograph of an exosome (BxC-e) isolated from an induced pluripotent stem cell-derived mesenchymal stem cell progenitor cell (BxC).
  • FIGS. 2A to 2C are diagrams showing the regeneration effect of kidney cells in various kidney cells of exosomes (BxC-e) isolated from induced pluripotent stem cells-derived mesenchymal stem cell progenitor cells (BxC).
  • 3A is a diagram showing the average size and distribution of exosomes (BxC-G63e) isolated from induced pluripotent stem cells-derived mesenchymal stem cell progenitor cells (BxC) of Exendin-4 pretreatment.
  • 3B is an electron micrograph of exosomes (BxC-G63e) isolated from induced pluripotent stem cells-derived mesenchymal stem cell progenitor cells (BxC) of Exendin-4 pretreatment.
  • Figure 3c is a diagram showing the average size and distribution of exosomes (BxC-V37e) isolated from induced pluripotent stem cells-derived mesenchymal stem cell progenitor cells (BxC) of Lanifibranor pretreatment.
  • 3D is an electron micrograph of an exosome (BxC-V37e) isolated from an induced pluripotent stem cell-derived mesenchymal stem cell progenitor cell (BxC) of Lanifibranor pretreatment.
  • Figures 4a and 4b are induction pluripotency of exosomes (BxC-e) and Exendin-4 pretreatment isolated from induced pluripotent stem cells-derived mesenchymal stem cell progenitor cells (BxC) in various kidney cells induced with kidney failure.
  • BxC-G63e A diagram showing the effect of inhibiting inflammation by exosomes isolated from stem cell-derived mesenchymal stem cell progenitor cells.
  • 5A and 5B show induction pluripotency of exosomes (BxC-e) and Exendin-4 pretreatment isolated from induced pluripotent stem cells-derived mesenchymal stem cell progenitor cells (BxC) in various kidney cells induced with kidney failure.
  • BxC-G63e A diagram showing the effect of inhibiting apoptosis by exosomes isolated from stem cell-derived mesenchymal stem cell progenitor cells.
  • Figures 6a and 6b are induction pluripotency of exosomes (BxC-e) and Exendin-4 pretreatment isolated from induced pluripotent stem cells-derived mesenchymal stem cell progenitor cells (BxC) in various kidney cells induced with kidney failure (Kidney failure)
  • BxC-G63e induced pluripotent stem cells-derived mesenchymal stem cell progenitor cells
  • FIG. 7A and 7B show kidney damage treatment and recovery function by exosomes (BxC-G63e) isolated from induced pluripotent stem cell-derived mesenchymal stem cell progenitor cells of exendin-4 pretreatment of kidney cells induced kidney failure (Kidney failure) It is a degree that has been confirmed.
  • Figure 8 shows the effect of inhibiting apoptosis by exosomes (BxC-V37e) isolated from induced pluripotent stem cells-derived mesenchymal stem cell progenitor cells of kidney cell Ranifibranor pretreatment induced kidney failure (Kidney failure) Is a diagram showing. (Where * is p ⁇ 0.05 vs. TGF ⁇ -, # is p ⁇ 0.05 vs. TGF ⁇ +, ⁇ is p ⁇ 0.05 vs. TGF ⁇ +e)
  • Figures 9a to 9d are renal fibrosis by exosomes (BxC-V37e) isolated from induced pluripotent stem cells-derived mesenchymal stem cell progenitor cells of kidney cells Rani fibronor pretreatment induced kidney failure (Kidney failure)
  • This is a diagram confirming the inhibitory effect through the inhibition of Collagen I, CTGF, ⁇ -SMA and Fibronectin expression.
  • * is p ⁇ 0.05 vs. TGF ⁇ -
  • # is p ⁇ 0.05 vs. TGF ⁇ +
  • ⁇ is p ⁇ 0.05 vs. TGF ⁇ +e
  • Figures 10a to 10e are kidney failure (Kidney failure) induced pluripotent stem cell-derived mesenchymal stem cell pre-treatment of kidney cells Rani fibrinore renal fibrosis by exosomes (BxC-V37e) isolated from progenitor cells This is a diagram confirming the inhibitory effect through inhibition of the formation of nodules.
  • kidney fibrosis Fibrosis
  • BxC-V37e exosomes isolated from induced pluripotent stem cell-derived mesenchymal stem cell progenitor cells of kidney cell Rani fibranor pretreatment in which kidney failure (Kidney failure) is induced It is a diagram confirmed through inhibition of Smad2 phosphorylation.
  • 12A to 12C are renal fibrosis caused by exosomes (BxC-V37e) isolated from induced pluripotent stem cells-derived mesenchymal stem cell progenitor cells of kidney cells Rani fibranor pretreatment in which Kidney failure is induced.
  • This is a diagram confirming the inhibitory effect through the effect of regulating the Epithelial-mesenchymal transition (EMT) pathway, an important mechanism related to fibrosis of kidney cells.
  • EMT Epithelial-mesenchymal transition
  • 13A to 13B are renal fibrosis caused by exosomes (BxC-V37e) isolated from induced pluripotent stem cells-derived mesenchymal stem cell progenitor cells of kidney cells Rani fibronor pretreatment in which Kidney failure is induced.
  • This is a diagram confirming the inhibitory effect through the regulating effect of sub-signals (snail1 and slug mRNA expression) of the Epithelial-mesenchymal transition (EMT) pathway, an important mechanism related to fibrosis in kidney cells.
  • EMT Epithelial-mesenchymal transition
  • 14A and 14B show kidney damage treatment and recovery functions by exosomes (BxC-V37e) isolated from induced pluripotent stem cells-derived mesenchymal stem cell progenitor cells of Lanifibranor pretreatment with kidney cells induced kidney failure. It is a degree.
  • Kidney disease containing exosomes isolated from progenitor cells of induced pluripotent stem cells (iPSC)-derived mesenchymal stem cells (MSC) as an active ingredient
  • iPSC induced pluripotent stem cells
  • MSC mesenchymal stem cells
  • % used to indicate the concentration of a specific substance is (weight/weight)% for solids/solids, (weight/volume)% for solids/liquids, and Liquid/liquid is (vol/vol)%.
  • iPSC induced pluripotent stem cells
  • BxC derived mesenchymal stem cell progenitor cells
  • induced pluripotent stem cells were cultured for 7 days in DMEM to which 10% of FBS and 10 ng/ml of bFGF were added.
  • SSEA-4(-) cells that do not express the stage-specific embryonic antigen 4 (SSEA-4) protein on the cell surface were isolated from the cultured induced pluripotent stem cells through FACS.
  • the isolated SSEA-4(-) cells were passaged and further cultured for 7 days in the same medium as above to prepare the induced pluripotent stem cell-derived mesenchymal stem cell progenitor cells of the present invention.
  • the present inventors named the progenitor cells of the induced pluripotent stem cells-derived mesenchymal stem cells as BxC (brexogen stem cells).
  • Progenitor cells of mesenchymal stem cells derived from induced pluripotent stem cells named BxC were cultured in medium (high glucose DMEM (Gibco, Cat no. 11995-065), 10% Fetal bovine Serum (HyClone), 1% MEM Non-Essential Amino). Acids Solution (100X) (Gibco, Cat no. 11140-050) was further cultured.
  • Example 1 Isolation of exosomes derived from induced pluripotent stem cells-derived mesenchymal stem cell progenitor cells (BxC)
  • the culture medium of the induced pluripotent stem cells-derived mesenchymal stem cells cultured in the above Preparation Example (hereinafter, referred to as BxC) was collected and centrifuged at 300xg for 10 minutes to remove the remaining cells and cell residues.
  • the supernatant was taken and filtered using a 0.22 ⁇ m filter, and then centrifuged at 10,000xg and 4° C. for 70 minutes using a high speed centrifuge.
  • the centrifuged supernatant was again taken and centrifuged at 100,000xg for 90 minutes at 4°C using an ultracentrifuge to remove the supernatant.
  • the exosomes remaining in the lower layer were diluted in phosphate buffered salin (PBS) and used in the following experiments.
  • PBS phosphate buffered salin
  • Example 1 For the exosomes isolated in Example 1 (hereinafter, BxC-e), the size distribution of exosomes was confirmed using a nanoparticle tracking assay (NanoSight NS300, Malvern), and the shape of the exosomes was determined using an electron microscope. Confirmed.
  • exosomes derived from BxC of the present invention have properties as exosomes.
  • Example 1 After 16 hours of cell inoculation, the condition of the cells was checked and 25 ⁇ M of cisplatin (Sigma P4394) was treated with serum free growth media for 24 hours. After 24 hours, the supernatant was discarded and washed with DPBS (HyClone SH30028.02), and then the exosomes isolated in Example 1 were added 50 ⁇ g (low dose) or 100 ⁇ g (high dose) each 48 with a new serum-free growth medium. Treated for hours.
  • CCK-8 solution Cell Counting Kit-8, Enzo ALX-850-039-KI01
  • Example 2 Isolation of induced pluripotent stem cells-derived mesenchymal stem cell progenitor cells-derived exosomes (BxC-G63e) according to treatment with pre-treatment material
  • the BxC pretreated with Exendin-4 was washed, and incubated for an additional 72 hours in a culture medium containing 10% fetal bovine serum (FBS) from which exosomes were removed.
  • FBS fetal bovine serum
  • the BxC culture medium treated with the pre-treatment material was collected and centrifuged at 300xg for 10 minutes to remove remaining cells and cell residues.
  • the supernatant was taken and filtered using a 0.22 ⁇ m filter, and then centrifuged at 10,000xg and 4° C. for 70 minutes using a high speed centrifuge.
  • the centrifuged supernatant was again taken and centrifuged at 100,000xg for 90 minutes at 4°C using an ultracentrifuge to remove the supernatant.
  • the exosomes remaining in the lower layer were diluted in phosphate buffered saline (PBS) and used in the following experiments.
  • PBS phosphate buffered saline
  • LANIFIBRANOR 10 ⁇ M-containing culture medium high glucose DMEM (Gibco, Cat no. 11995-065); 10% Fetal bovine Serum (HyClone), 1% MEM Non-Essential Amino Acids Solution (100X) (Gibco, Cat no. 11140-050)] from the induced pluripotent stem cells (iPSC)-derived mesenchyme Stem cell progenitor cells (BxC) were cultured for 24 hours.
  • iPSC induced pluripotent stem cells
  • BxC mesenchyme Stem cell progenitor cells
  • the BxC pretreated with Lanifibranor was washed, and incubated for an additional 72 hours in a culture medium containing 10% fetal bovine serum (FBS) from which exosomes were removed.
  • FBS fetal bovine serum
  • the BxC culture medium treated with the pre-treatment material was collected and centrifuged at 300xg for 10 minutes to remove remaining cells and cell residues.
  • the supernatant was taken and filtered using a 0.22 ⁇ m filter, and then centrifuged at 10,000xg and 4° C. for 70 minutes using a high speed centrifuge.
  • the centrifuged supernatant was again taken and centrifuged at 100,000xg for 90 minutes at 4°C using an ultracentrifuge to remove the supernatant.
  • the exosomes remaining in the lower layer were diluted in phosphate buffered saline (PBS) and used in the following experiments.
  • PBS phosphate buffered saline
  • Example 2 For the exosomes (BxC-G63e, BxC-V37e) isolated in Example 2, the size distribution of exosomes was confirmed using a nanoparticle tracking assay (NanoSight NS300, Malvern), and the exosomes were The shape was confirmed.
  • Example 1 The exosomes (BxC-e) isolated in Example 1 and the exosomes (BxC-G63e) isolated in Example 2-1 were tested as follows.
  • the epithelial cell line HK-2, the kidney epithelial cells RPTEC, and the kidney epithelial cells GEC were inoculated at 1 ⁇ 10 5 per well, respectively. 16 hours after cell inoculation, the condition of the cells was checked, cisplatin 25 ⁇ M or LPS 20 ⁇ g/mL with serum-free growth medium, and exosomes (BxC-e) isolated in Example 1 or exo isolated in Example 2 above. 100 ⁇ g of moth (BxC-G63e) was treated for 24 hours. At this time, as a positive control group, a group in which renal failure was induced by treating only cisplatin or LPS was used.
  • exosomes (BxC-e and BxC-G63e) of the present invention have the effect of remarkably inhibiting inflammation in various kidney cells in which toxicity is induced by cisplatin or LPS treatment. have.
  • the epithelial cell line HK-2, the kidney epithelial cells RPTEC, and the kidney epithelial cells GEC were inoculated at 1 ⁇ 10 5 per well, respectively. 16 hours after cell inoculation, the condition of the cells was checked, cisplatin 25 ⁇ M or LPS 20 ⁇ g/mL with serum-free growth medium, and exosomes (BxC-e) isolated in Example 1 or exo isolated in Example 2 above. 100 ⁇ g of moth (BxC-G63e) was treated for 24 hours. At this time, as a positive control group, a group in which renal failure was induced by treating only cisplatin or LPS was used.
  • the exosomes (BxC-e and BxC-G63e) of the present invention have the effect of remarkably inhibiting apoptosis in various kidney cells caused by toxicity by cisplatin or LPS treatment. I can.
  • the epithelial cell line HK-2, the kidney epithelial cells RPTEC, and the kidney epithelial cells GEC were inoculated at 1 ⁇ 10 5 per well, respectively. 16 hours after cell inoculation, the condition of the cells was checked, cisplatin 25 ⁇ M or LPS 20 ⁇ g/mL with serum-free growth medium, and exosomes (BxC-e) isolated in Example 1 or exo isolated in Example 2 above. 100 ⁇ g of moth (BxC-G63e) was treated for 24 hours. At this time, as a positive control group, a group in which renal failure was induced by treating only cisplatin or LPS was used.
  • the exosomes (BxC-e and BxC-G63e) of the present invention have the effect of remarkably inhibiting endoplasmic reticulum stress in renal cells in various renal cells in which toxicity is induced by cisplatin or LPS treatment. You can see that there is.
  • Renal injury was induced by intraperitoneal administration of cisplatin (15mg/kg) to 8-week-old Balb/c male mice.
  • Cisplatin injection Exendin-4 pre-treatment induced pluripotent stem cell-derived mesenchymal stem cell exosomes (BxC-G63e) isolated from progenitor cells were administered IV. After 3 days, blood was separated and creatinine and BUN levels were measured. The function of BxC-G63e in treating and recovering kidney damage was confirmed.
  • Exendin-4 pre-treatment induced pluripotent stem cell-derived mesenchymal stem cell progenitor cells according to the present invention isolated from exosomes (BxC-G63e) are It was confirmed that the increased kidney blood urea nitrogen (BUN) and creatinine levels can be significantly reduced. Through this, BxC-G63e exosomes have a remarkably excellent effect of restoring the function of the kidney. Was confirmed.
  • Kidney epithelial cells were inoculated at 1 ⁇ 10 5 per well in a well culture dish. 16 hours after cell inoculation, check the state of the cells and induce TGF- ⁇ (10 ng/mL) with serum-free growth medium and the exosomes (BxC-e) isolated in Example 1 or Ranifibranor treatment Pluripotent stem cell-derived mesenchymal stem cell progenitor cell-derived exosomes (BxC-V37e) were treated with 100 ⁇ g for 24 hours. At this time, as a positive control group, a group in which renal failure was induced by treatment with only TGF- ⁇ was used.
  • the exosomes (BxC-e and BxC-V37e) of the present invention have the effect of remarkably inhibiting apoptosis in renal cells caused by fibrosis by TGF- ⁇ treatment. I can.
  • Kidney epithelial cells were inoculated with 1 ⁇ 10 5 per well in a 6-well culture dish. 16 hours after cell inoculation, check the state of the cells and induce TGF- ⁇ with serum-free growth medium (10 ng/mL) according to the exosome (BxC-e) or ranifibranor treatment isolated in Example 1 above Pluripotent stem cell-derived mesenchymal stem cell progenitor cell-derived exosomes (BxC-V37e) were treated with 100 ⁇ g for 24 hours. At this time, as a positive control group, a group in which kidney failure was induced by treatment with only TGF- ⁇ was used.
  • the exosomes (BxC-e and BxC-V37e) of the present invention are fibrosis of kidney cells in kidney cells induced kidney failure (Kidney failure) by TGF ⁇ treatment. ), it was confirmed that the expression of the related genes Collagen I, CTGF, ⁇ -SMA and Fibronectin can be significantly reduced.
  • Kidney epithelial cells were inoculated at 1 ⁇ 10 5 per well in a 6-well culture dish. Upon cell inoculation, induced pluripotent stem cells-derived mesenchymal stem cell progenitor cells derived from TGF- ⁇ with serum-free growth medium and exosomes (BxC-e) or ranifibranor treatment isolated in Example 1 above. 100 ⁇ g of moth (BxC-V37e) was treated for 24 hours. At this time, as a positive control group, a group in which renal failure was induced by treatment with only TGF- ⁇ was used.
  • TGF ⁇ - TGF ⁇ + TGF ⁇ +e TGF ⁇ +V37e Ratio to control One 1.71 1.28 1.14
  • the exosomes (BxC-e and BxC-V37e) of the present invention generate nodules formed in kidney cells in which Kidney failure is induced by TGF ⁇ treatment. It was confirmed that can be significantly reduced.
  • Kidney epithelial cells were inoculated at 1 ⁇ 10 5 per well in a 6-well culture dish. 16 hours after cell inoculation, the condition of the cells was checked, and induced pluripotent stem cells according to treatment with TGF- ⁇ and exosomes (BxC-e) isolated in Example 1 or Ranifibranor with serum-free growth medium-derived Mesenchymal stem cell progenitor cell-derived exosomes (BxC-V37e) were treated with 100 ⁇ g for 24 hours. At this time, as a positive control group, a group in which renal failure was induced by treatment with only TGF- ⁇ was used.
  • the exosomes (BxC-e and BxC-V37e) of the present invention inhibit the phosphorylation of Smad2 protein by TGF- ⁇ in kidney cells induced kidney failure by TGF ⁇ treatment. Confirmed.
  • EMT Epithelial-mesenchymal transition
  • Kidney epithelial cells were inoculated at 1 ⁇ 10 5 per well in a 6-well culture dish. 16 hours after cell inoculation, the condition of the cells was checked, and induced pluripotent stem cells according to treatment with TGF- ⁇ and exosomes (BxC-e) isolated in Example 1 or Ranifibranor with serum-free growth medium-derived Mesenchymal stem cell progenitor cell-derived exosomes (BxC-V37e) were treated with 100 ⁇ g for 24 hours. At this time, as a positive control group, a group in which renal failure was induced by treatment with only TGF- ⁇ was used.
  • TGF ⁇ - TGF ⁇ + TGF ⁇ +e TGF ⁇ +V37e Vimentin mRNA (A.U.) 1.56 26.77 9.9 0.90
  • the exosomes (BxC-e and BxC-V37e) of the present invention are important for fibrosis in kidney cells in which Kidney failure is induced by TGF ⁇ treatment. It was confirmed that the control effect of the mechanism Epithelial-mesenchymal transition (EMT) pathway was excellent.
  • EMT Epithelial-mesenchymal transition
  • Kidney epithelial cells were inoculated at 1 ⁇ 10 5 per well in a 6-well culture dish. 16 hours after cell inoculation, check the state of the cells and induce TGF- ⁇ (10 ng/mL) with serum-free growth medium and the exosomes (BxC-e) isolated in Example 1 or Ranifibranor treatment Pluripotent stem cell-derived mesenchymal stem cell progenitor cell-derived exosomes (BxC-V37e) were treated with 100 ⁇ g for 24 hours. At this time, as a positive control group, a group in which renal failure was induced by treatment with only TGF- ⁇ was used.
  • TGF ⁇ - TGF ⁇ + TGF ⁇ +e TGF ⁇ +V37e Slug mRNA (A.U.) 1.07 6.38 3.48 0.62
  • the exosomes (BxC-e and BxC-V37e) of the present invention are important for fibrosis in kidney cells in which Kidney failure is induced by TGF ⁇ treatment. It was confirmed that the effect of regulating the expression of snail1 and slug mRNA, which is a subsignal of the mechanism Epithelial-mesenchymal transition (EMT) pathway, is excellent.
  • EMT Epithelial-mesenchymal transition
  • Renal injury was induced by intraperitoneal administration of cisplatin (15mg/kg) to 8-week-old Balb/c male mice.
  • cisplatin 15mg/kg
  • Trifibranor pre-treatment induced pluripotent stem cell-derived mesenchymal stem cell exosomes (BxC-V63e) isolated from progenitor cells were administered IV, and after 3 days, blood was separated and Creatinine and BUN were measured to measure BxC-G63e. Of the kidney damage treatment and recovery function was confirmed.
  • Exendin-4 pre-treatment induced pluripotent stem cell-derived mesenchymal stem cell progenitor cells according to the present invention are in Cisplatin It was confirmed that the increased kidney blood urea nitrogen (BUN) and creatinine levels can be remarkably reduced. Through this, BxC-V37e exosomes have a remarkably excellent effect of restoring the function of the kidney. Was confirmed.
  • the BxC-e, BxC-G63e and BxC-V37e of the present invention inhibit inflammation in kidney cells induced kidney failure, inhibit apoptosis, and inhibit endoplasmic reticulum stress. It can be seen that the effect of preventing or treating kidney disease is excellent.
  • the present invention relates to a composition for preventing or treating kidney disease, comprising as an active ingredient exosomes derived from induced pluripotent stem cell-derived mesenchymal stem cell progenitor cells that are pretreated or not pretreated with a pretreatment material.

Abstract

본 발명은 전처리 물질로 전처리 하거나 또는 전처리 하지 않은 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포로부터 분리된 엑소좀을 유효성분으로 포함하는 신장 질환의 예방 또는 치료용 약제학적 조성물에 관한 것이다. 본 발명의 엑소좀은 기존 중간엽 줄기세포로부터 분리된 엑소좀에 비하여 보다 개선된 신장 질환 예방 또는 치료 효과를 나타내는 바, 이를 관련 연구개발 및 제품화에 유용하게 사용할 수 있다.

Description

유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 유래된 엑소좀을 포함하는 신장 질환의 예방 또는 치료용 조성물
본 발명은 전처리 물질로 전처리 하거나 또는 전처리 하지 않은 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 유래된 엑소좀을 유효성분으로 포함하는 신장 질환의 예방 또는 치료용 조성물에 관한 것이다.
중간엽 줄기세포는 다분화능을 가진 기질세포로서 조골세포, 연골세포, 근육세포, 지방세포 등을 포함하는 다양한 세포로 분화할 수 있는 세포를 말한다. 중간엽 줄기세포는 연골이나 골조직, 인대, 골수 기질 등 다양한 결합조직으로 분화할 수 있으므로 관절염이나, 외상, 화상 등에 의해 생긴 연부조직 결손을 치료하는 등 다양한 질환에 대한 치료 용도로 연구되고 있다.
최근에는 중간엽 줄기세포 자체를 사용하지 않고 중간엽 줄기세포가 분비하는 엑소좀을 이용하여 다양한 질환의 치료효과에 대한 연구가 활발하게 진행 중이다. 이러한 엑소좀을 상업적으로 이용하기 위해서는 다량의, 그리고 양질의 엑소좀이 필요하다. 그러나 중간엽 줄기세포로부터 얻을 수 있는 엑소좀의 양은 매우 소량에 불과하고, 중간엽 줄기세포의 기능과 증식능력 또한 계대가 반복될수록 감소하기 때문에, 중간엽 줄기세포와 동등하거나 그보다 우수한 기능성을 가지면서도 증식능력이 우수한 세포를 확립하는 기술 개발의 필요성이 대두되었다.
한편, 신장은 좌, 우에 하나씩 두 개가 있으며, 각 신장은 약 100만개의 네프론(nephron)이라는 기본구조로 이루어지고 하나의 네프론은 사구체라고 불리는 미세한 모세혈관 덩어리와 신세뇨관으로 구성되어 여과와 흡수의 기능을 한다.
신장이 배설, 조절, 대사 및 내분비적 기능을 정상적으로 수행하지 못하고 전체적으로 저하되거나 이상이 초래된 상태를 신장 질환이라고 하는데, 신장 질환은 진행 상태에 따라 급성신부전증, 만성신부전증으로 분류되며, 또는 발병 원인에 따라 혈관 복합체의 침착으로 인한 사구체 신염, 당뇨병 또는 고혈압 등의 합병증으로 인한 당뇨병성 신병증, 항생제 또는 항암제 등의 약물투여에 의한 독성신병증, 세균 감염에 의한 요로감염 등으로 나뉜다.
신장 질환은 원인이 되는 신장 질환의 종류에 관계없이 만성적으로 신기능 장애가 진행되어 사구체 여과율이 50% 이하로 감소하면, 대부분의 경우 계속적으로 사구체 여과율이 감소하게 되며, 궁극적으로 말기 신부전증에 도달하게 되고 혈액학적 이상, 신경계 합병증, 위장관계 합병증, 면역학적 합병증, 감염 또는 골이영양증 등의 합병증이 일어나 심한 경우 죽음에 이르게 된다.
신장 질환은 전세계적으로 매년 그 발병자가 증가하고 있으며, 더욱이 증상이 나타나지 않거나 잘 인지하지 못하여 초기 발견하더라도 말기 신부전에 이르는 경우가 많다. 국내에도 대략 45만 명의 신부전증 환자가 있으며 초기 신부전증 환자까지 고려한다면 발병자는 더 많을 것으로 예측된다. 신부전증의 치료에 있어서 비록 장기적 투석과 신장이식(renal transplantation) 등 치료수단이 존재하지만 만성 신부전증의 초기, 중기의 치료문제를 해결하지는 못하며, 게다가 치료비용이 높아 나라와 환자가정에 심한 경제부담을 가져다준다.
따라서, 보다 안전하고 효과적인 신장 질환의 치료에 적합한 새로운 치료용 조성물의 개발에 대한 요구는 커지고 있는 상황이다.
본 발명자들은 중간엽 줄기세포의 엑소좀을 이용한 신장 질환 치료제를 개발하고자 예의 연구 노력하였다. 그 결과, 유도만능줄기세포(induced pluripotent stem cell, iPSC)에서 유래한 중간엽 줄기세포보다 미분화 단계에 있는 중간엽 줄기세포의 전구세포를 확립하고, 전처리 물질로 전처리 하거나 또는 전처리 하지 않은 상기 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 유래된 엑소좀이 우수한 신장 질환의 예방 또는 치료 효과를 나타냄을 규명하고, 본 발명을 완성하게 되었다.
따라서, 본 발명의 목적은 유도만능줄기세포(induced pluripotent stem cell, iPSC)-유래 중간엽 줄기세포(mesenchymal stem cell, MSC)의 전구세포로부터 분리된 엑소좀을 유효성분으로 포함하는 신장 질환(Kidney disease)의 예방 또는 치료용 약제학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포로부터 분리된 엑소좀을 제공하는 것이다.
본 발명의 또 다른 목적은 전처리 물질로 전처리된, 유도만능줄기세포(induced pluripotent stem cell, iPSC)-유래 중간엽 줄기세포(mesenchymal stem cell, MSC)의 전구세포로부터 분리된 엑소좀을 유효성분으로 포함하는 신장 질환(Kidney disease)의 예방 또는 치료용 약제학적 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 전처리 물질로 전처리된, 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포로부터 분리된 엑소좀을 제공하는 것이다.
본 발명자들은 중간엽 줄기세포의 엑소좀을 이용한 신장 질환 치료제를 개발하고자 예의 연구 노력하였다. 그 결과, 유도만능줄기세포(induced pluripotent stem cell, iPSC)에서 유래한 중간엽 줄기세포보다 미분화 단계에 있는 중간엽 줄기세포의 전구세포를 확립하고, 전처리 물질로 전처리 하거나 또는 전처리 하지 않은 상기 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 유래된 엑소좀이 우수한 신장 질환의 예방 또는 치료 효과를 나타냄을 규명하였다.
본 발명은 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포로부터 분리된 엑소좀 및 이를 유효성분으로 포함하는 신장 질환의 예방 또는 치료용 약제학적 조성물, 및 전처리 물질로 전처리된, 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포로부터 분리된 엑소좀 및 이를 유효성분으로 포함하는 신장 질환의 예방 또는 치료용 약제학적 조성물에 관한 것이다.
이하, 본 발명을 더욱 자세히 설명하고자 한다.
본 발명의 일 양태는 유도만능줄기세포(induced pluripotent stem cell, iPSC)-유래 중간엽 줄기세포(mesenchymal stem cell, MSC)의 전구세포로부터 분리된 엑소좀을 유효성분으로 포함하는 신장 질환(Kidney disease)의 예방 또는 치료용 약제학적 조성물에 관한 것이다.
본 명세서에서 용어 "줄기세포"는 미분화된 세포로서 자기 복제 능력을 가지면서 두 개 이상의 서로 다른 종류의 세포로 분화하는 능력을 갖는 세포를 말한다. 본 발명의 줄기세포는 자가 또는 동종 유래 줄기세포일 수 있다.
본 명세서에서 용어 "유도만능줄기세포(induced pluripotent stem cell, iPSC)"는 체세포와 같은 이미 분화된 세포에 역분화(dedifferentiation)를 유도하여 초기의 미분화된 상태로 돌아가, 전분화능(pluripotency)을 가지게 된 세포를 의미한다.
상기 역분화는 특정 유전자(예를 들어, Sox2, c-Myc, Klf4, Oct-4 등)를 도입하여 발현시키거나 상기 특정 유전자가 도입된 세포에서 만들어진 역분화 유도 단백질을 주입하여 유도될 수 있다.
상기 전분화능은 생체를 구성하는 3가지 배엽(germ layer), 즉 내배엽(endoderm), 중배엽(mesoderm) 및 외배엽(ectoderm) 기원의 조직 또는 기관으로 분화할 수 있는 능력을 의미한다.
본 명세서에서 용어 "중간엽 줄기세포"는 다분화능을 가진 세포로서 조골세포, 연골세포, 근육세포, 지방세포 등을 포함하는 다양한 세포로 분화할 수 있는 줄기세포를 말한다. 상기 중간엽 줄기세포는 골수 유래 중간엽 줄기세포가 가장 흔히 사용되나, 골수 외에도 제대 또는 제대혈, 지방조직, 양수, 어금니의 치아 돌기(tooth bud)로부터 유래할 수 있다. 중간엽 줄기세포는 기질세포(stromal cell)이라는 용어로도 불리운다.
상기 중간엽 줄기세포의 전구세포는 일반적인 중간엽 줄기세포가 아닌, [본 발명자들이 개발한] 유도만능줄기세포(induced pluripotent stem cell, iPSC)에서 유래한 중간엽 줄기세포의 전구세포(BxC)이다.
상기 "유도만능줄기세포"는 분화된 세포들로부터 인위적인 역분화 과정을 통해 다능성 분화능을 가지도록 유도된 세포들을 일컫는 말로서 역분화 줄기세포 라고도 한다.
상기 인위적인 역분화 과정은 레트로바이러스, 렌티바이러스 및 센다이바이러스를 이용한 바이러스-매개 또는 비바이러스성 벡터 이용, 단백질 및 세포 추출물 등을 이용하는 비바이러스-매개 역분화 인자의 도입에 의해 수행되거나, 줄기세포 추출물, 화합물 등에 의한 역분화 과정을 포함한다.
상기 유도만능줄기세포는 배아줄기세포와 거의 같은 특성을 가지며, 구체적으로는 비슷한 세포 모양을 보여주고, 유전자 및 단백질 발현 패턴이 유사하며, in vitro 및 in vivo에서 전분화능을 가지고, 테라토마(teratoma)를 형성하며, 생쥐의 배반포(blastocyst)에 삽입시켰을 때 키메라(chimera) 생쥐를 형성하고, 유전자의 생식선 전이(germline transmission)가 가능하다.
본 발명의 유도만능줄기세포는 인간, 원숭이, 돼지, 말, 소, 양, 개, 고양이, 생쥐, 토끼 등 모든 포유동물 유래의 유도만능줄기세포를 포함하나, 바람직하게는 인간 유래의 유도만능줄기세포이다.
또한, 본 발명의 상기 유도만능줄기세포가 역분화 되기 전의 체세포는 제대, 제대혈, 골수, 지방, 근육, 신경, 피부, 양막, 양수 또는 태반 등으로부터 유래된 체세포일 수 있으나, 이에 한정되지 않는다.
구체적으로 상기 체세포는 섬유아세포(fibroblast), 간세포(hepatocyte), 지방세포(adipose cell), 상피세포(epithelial cell), 표피세포(epidermal cell), 연골세포(chondrocyte), 근세포(muscle cell), 심근세포(cardiac muscle cell), 멜라노사이트(melaonocyte), 신경세포(neural cell), 교세포(glial cell), 성상교세포(astroglial cell), 단핵구(monocyte), 대식세포(macrophage) 등을 포함하나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 본 발명의 중간엽 줄기세포의 전구세포는 동등한 수의 중간엽 줄기세포에 비하여 ANKRD1, CPE, NKAIN4, LCP1, CCDC3, MAMDC2, CLSTN2, SFTA1P, EPB41L3, PDE1C, EMILIN2, SULT1C4, TRIM58, DENND2A, CADM4, AIF1L, NTM, SHISA2, RASSF4, 및 ACKR3로 이루어진 군으로부터 선택된 1 이상의 유전자를 더 높은 수준으로 발현한다.
또한, 본 발명의 다른 구현예에 있어서, 상기 본 발명의 중간엽 줄기세포의 전구세포는 동등한 수의 중간엽 줄기세포에 비하여 DHRS3, BMPER, IFI6, PRSS12, RDH10, 및 KCNE4로 이루어진 군으로부터 선택된 1 이상의 유전자를 더 낮은 수준으로 발현한다.
상기 중간엽 줄기세포의 전구세포 및 동등한 수의 중간엽 줄기세포는 동종조직 유래이다. 보다 구체적으로는, 상기 중간엽 줄기세포의 전구세포는 유도만능줄기세포에서 유래한 중간엽 줄기세포의 전구세포이다.
본 발명의 일 실시예에서 있어서, 상기 중간엽 줄기세포의 전구세포는 제대 조직 유래의 유도만능줄기세포에서 유래한 중간엽 줄기세포의 전구세포이고, 이와 비교되는 동등한 수의 중간엽 줄기세포는 제대 조직 유래의 중간엽 줄기세포이다.
본 발명자들은 상기 유도만능줄기세포 유래 중간엽 줄기세포의 전구세포를 BxC(brexogen stem cell)로 명명하였다. 본 명세서에서 상기 "유도만능줄기세포 유래 중간엽 줄기세포의 전구세포(BxC)"는 "유도만능줄기세포 유래 중간엽 전구세포"로도 표현된다.
본 발명의 동일한 조직 유래(e.g. 제대 조직)의 유도만능줄기세포의 중간엽 줄기세포의 전구세포(BxC)는 동일한 조직 유래(e.g. 제대 조직)의 중간엽 줄기세포(MSC)와 비교하여 염색체 핵형에 있어서 이상이 없고, 증식능력이 우수하다. 구체적으로, 본 발명의 BxC는 계대를 9번 이상 거듭할 경우 동일 조직 유래의 중간엽 줄기세포(MSC)와 비교하여 10배 이상 증식능의 차이가 나타나며, 12 번 이상의 횟수로 계대를 하여도 증식능의 감소가 관찰되지 않는다. 또한, BxC는 MSC에 비하여 세포 증식능과 관련된 마커인 Ki67의 발현량도 2배 이상 높게 나타난다.
상기 유도만능 줄기세포 유래 중간엽 줄기세포의 전구세포(BxC)는 Endostatin, Endothelin-1, VEGF-A, Thrombospondin-2, PlGF, PDGF-AA, beta-NGF, 및 HB-EGF 등의 기능성 단백질을 동등한 수의 중간엽 줄기세포와 비교하여 다량 분비한다.
본 명세서에서 상기 Endostatin은 자연적으로 생성되는 type XVIII 콜라겐에서 유래한 20 kDa C-터미널 단편으로, 항-신생혈관제제로 보고되어 있다.
본 명세서에서 상기 endothelin-1은 preproendothelin-1(PPET1)으로도 알려져 있으며, EDN1 유전자에 의해 인코딩되는 단백질로서 혈관 내피세포에서 생산된다. endothelin-1은 강력한 혈관수축제로 알려져 있다.
본 명세서에서 상기 VEGF-A(vascular endothelial growth factor A)는 VEGFA 유전자가 인코딩하는 단백질로서 혈관 내피세포의 VEGFR1 및 VEGFR2와 상호작용을 통해 혈관의 성장을 유도하는 것으로 알려져 있다.
본 명세서에서 상기 Thrombospondin-2는 THBS2 유전자에 의해 인코딩되는 단백질로서, 세포-세포 상호작용 또는 세포-기질 상호작용을 매개하는 것으로 알려져 있다. Thrombospondin-2의 암에 대한 역할은 논란의 여지가 있으나, 중간엽 줄기세포의 세포 표면 특성을 조절하는 것으로 보고되어 있으며 세포 부착 및 세포 이동에 관여한다고 알려져 있다.
본 명세서에서 상기 PlGF(placental growth factor)는 PGF 유전자에 의해 인코딩되는 단백질로서 VEGF sub-family의 멤버로서 배아발생기에서 혈관신생에 주된 역할을 하는 단백질로 알려져 있다.
본 명세서에서 상기 PDGF-AA(platelet-derived growth factor)는 세포의 성장 및 분열을 조절하는 성장인자로서 혈관의 생성 및 성장, 및 중간엽 줄기세포의 증식, 화학주성, 및 이동에 있어서 중요한 역할을 하는 것으로 알려져 있다.
본 명세서에서 NGF(Nerve growth factor)는 신경친화성 인자 및 뉴로펩타이드로서, 신경의 성장, 유지, 증식 및 생존에 주로 관여한다. NGF는 alpha-, beta-, 및 gamma-NGF가 약 2:1:2의 비율로 발현되는 세 가지 단백질의 복합체로서, 여기에서 gamma-NGF는 세린 프로테아제로 작용하고, beta-NGF의 N-터미널을 절단하여 NGF를 활성화시킨다고 알려져 있다.
본 명세서에서 상기 HB-EGF(heparin-binding EGF-like growth factor)는 HBEGF 유전자에 의해 인코딩되는 EGF family 단백질의 멤버이다. HB-EGF는 심장의 발달 및 혈관분포에 중요한 역할을 한다고 알려져 있고, 표피 창상의 치유에서 상피화 과정에 필수적인 단백질로 알려져 있다.
본 명세서에서 용어 "엑소좀(exosome)"이란 세포가 세포 외로 분비하거나, 세포 내에 존재하는 지질-이중층으로 구성된 막 구조를 갖는 소낭(membrane vesicle)으로, 거의 모든 진핵 생물의 체액에 존재한다. 엑소좀의 직경은 30-1000 nm 정도이며, 다중소포체(multivesicular bodies)가 세포막과 융합될 때 세포로부터 방출되거나, 세포막으로부터 곧바로 방출된다. 엑소좀이 응고, 세포-세포간 커뮤니케이션 및 세포성 면역을 중재하는 기능적 역할을 수행하기 위해, 세포 내의 생체분자인 단백질, 생체활성 지질 및 RNA(miRNA)를 수송하는 역할을 하는 것은 잘 알려져 있다.
상기 엑소좀은 미세소포체(microvesicle)를 포괄하는 개념이다. 엑소좀의 마커 단백질로는 CD63, CD81 등이 알려져 있고, 그 외에는 EGFR과 같은 세포 표면의 수용체, 신호전달에 관련 분자, 세포 부착 관련 단백질, MSC 연관 항원, 열충격단백질(heat shock protein), 소포 형성과 관련된 Alix 등의 단백질이 알려져 있다.
본 발명에서 상기 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포로부터 분리된 엑소좀은 상술한 유도만능줄기세포-유래 중간엽줄기세포의 전구세포(BxC) 내에 존재하거나, BxC로부터 분비된 엑소좀을 의미한다.
본 명세서에서 용어, "유효성분으로 포함하는"이란 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포로부터 분리된 엑소좀이 신장 질환의 예방 또는 치료 활성을 달성하는 데 충분한 양을 포함하는 것을 의미한다.
상기 신장 질환은 신장 섬유증, 당뇨병성 신증, 고혈압성 신증, 사구체 신염, 신우 신염, 간질성 신염, 루프스 신장염, 다낭성 신장질환, 신부전증, 사구체 경화증, 이식 후 급성거부반응 및/또는 약물에 의한 신장 손상일 수 있으나, 이에 제한되는 것은 아니다.
상기 약물은 항암제일 수 있고, 예를 들어, 시스플라틴(Cisplatin)일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 사용되는 용어 "예방"은 본 발명의 조성물의 투여로 신장 질환을 억제시키거나 진행을 지연시키는 모든 행위를 의미한다.
본 명세서에서 사용되는 용어 "치료"는 (a) 신장 질환의 발전의 억제; (b) 신장 질환의 경감; 및 (c) 신장 질환의 제거를 의미한다.
본 발명에 따른 약제학적 조성물은 유효성분 이외에 약제학적으로 허용되는 담체를 포함할 수 있다. 이때, 약제학적으로 허용되는 담체는 제제 시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세 결정성셀룰로스, 폴리비닐피로리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필 히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 또한, 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다.
본 발명의 약제학적 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구 투여(예를 들어, 정맥 내, 피하, 복강 내 또는 국소에 적용)할 수 있으며, 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 시간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다.
본 발명의 약제학적 조성물은 약제학적으로 유효한 양으로 투여한다. 본 발명에 있어서 "약제학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효량은 환자의 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.
본 발명에 따른 약제학적 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고, 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.
구체적으로 본 발명의 약제학적 조성물의 유효량은 환자의 연령, 성별, 상태, 체중, 체내에 활성 성분의 흡수도, 불활성율 및 배설속도, 질병종류, 병용되는 약물에 따라 달라질 수 있다.
본 발명의 다른 일 양태는 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포로부터 분리된 엑소좀에 관한 것이다.
본 발명의 상기 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포로부터 분리된 엑소좀(BxC-e)은 종래의 엑소좀으로서의 특성을 가진 엑소좀이다. 본 발명의 실시예에서 입증한 바와 같이, 상기 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포로부터 분리된 엑소좀의 신장세포 재생 효과가 우수함을 확인하였다(도 2). 또한, 본 발명의 BxC-e는 신부전(Kidney failure)이 유도된 신장세포에서 염증을 억제하고, 세포사멸을 억제할 뿐만 아니라, 소포체 스트레스를 억제함을 확인하였다(도 4a 내지 도 6b).
본 발명의 또 다른 일 양태는 상기 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포로부터 분리된 엑소좀을 개체에 투여하는 단계를 포함하는 신장 질환 치료방법에 관한 것이다.
상기 "개체"란 질병의 치료를 필요로 하는 대상을 의미하고, 보다 구체적으로는, 인간 또는 비-인간인 영장류, 마우스(mouse), 개, 고양이, 말 및 소 등의 포유류를 의미한다.
본 발명의 또 다른 일 양태는 상기 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포로부터 분리된 엑소좀의 신장 질환 치료 용도에 관한 것이다.
상기 신장 질환 치료방법 및 치료용도는 상술한 본 발명의 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포로부터 분리된 엑소좀 및 이를 포함하는 약제학적 조성물과 구성성분을 공통으로 하기 때문에, 이들 사이에 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.
본 발명의 또 다른 일 양태는 전처리 물질로 전처리된, 유도만능줄기세포(induced pluripotent stem cell, iPSC)-유래 중간엽 줄기세포(mesenchymal stem cell, MSC)의 전구세포로부터 분리된 엑소좀을 유효성분으로 포함하는 신장 질환(Kidney disease)의 예방 또는 치료용 약제학적 조성물에 관한 것이다.
본 명세서에서 용어 "전처리"란 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포의 배양 과정에서 전처리 물질이 첨가된 세포배양 배지를 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포에 접촉시키는 과정을 의미한다.
상기 전처리는 상기 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포를 전처리 물질을 포함하는 세포배양 배지에서 배양하는 방법에 의해 수행될 수 있다.
상기 세포배양 배지는 동물세포 배양에 통상적으로 이용되는 어떠한 배지도 가능하며, 예를 들어, DMEM(Dulbecco's modification of Eagle's medium), DMEM과 F12의 혼합물, Eagles's MEM(Eagle's minimum essential medium), α-MEM, Iscove's MEM, 199 배지, CMRL 1066, RPMI 1640, F12, F10, Way-mouth's MB752/1, McCoy's 5A 및 MCDB 시리즈 등이 이용될 수 있다.
상기 배양은 6 내지 48시간 동안 수행될 수 있다.
구체적으로, 상기 배양은 6 내지 42시간, 6 내지 36시간, 6 내지 30시간, 6 내지 27시간, 12 내지 48시간, 12 내지 42시간, 12 내지 36시간, 12 내지 30시간, 12 내지 27시간, 18 내지 48시간, 18 내지 42시간, 18 내지 36시간, 18 내지 30시간, 18 내지 27시간, 21 내지 48시간, 21 내지 42시간, 21 내지 36시간, 21 내지 30시간 또는 21 내지 27시간 수행될 수 있다.
상기 전처리 물질은 엑센딘-4(Exendin-4)일 수 있다.
본 발명의 엑센딘-4(Exendin-4)는 글루카곤 유사 펩타이드(glucagon-like peptide; GLP) 수용체의 펩타이드 아고니스트이다. 엑센딘-4는 인슐린 분비를 촉진하는 것으로 알려져 있으며, 2형 당뇨 및 파킨슨 질환 치료 용도로서 임상적으로 사용되어 왔다.
상기 엑센딘-4는 세포배양 배지 내 1 내지 100 nM의 농도로 포함될 수 있다.
구체적으로, 상기 엑센딘-4는 세포배양 배지 내 1 내지 90 nM, 1 내지 80 nM, 1 내지 70 nM, 1 내지 60 nM, 1 내지 50 nM, 1 내지 40 nM, 1 내지 30 nM, 10 내지 90 nM, 10 내지 80 nM, 10 내지 nM, 10 내지 60 nM, 10 내지 50 nM, 10 내지 40 nM 및 10 내지 30 nM의 농도로 포함될 수 있다.
상기 전처리 물질은 라니피브라노르(Lanifibranor)일 수 있다.
본 발명의 라니피브라노르는 peroxisome proliferator-activated receptors (PPAR) 작용제(agonist)로 PPARα, PPARδ and PPARγ 로 알려진 3가지 PPAR isoforms을 각각 활성화시켜서 신체 내에서 항섬유화, 항염 그리고 유익한 대사 변화를 유도하는 것으로 알려져 있는 small molecule다. PPAR은 유전자의 발현을 조절하는 핵 호르몬 수용체 패밀리에 속하는 리간드-활성화된 전사 인자이다. PPAR은 세포 분화, 발달 및 종양 형성의 조절에 필수적인 역할을 한다. 섬유증을 조절하는 PPAR을 활성화하여 결합 조직의 비정상적인 성장을 감소시키는 것으로 알려져 있다. 또한, 라니피브라노르는 전신 경화증 치료제, 특발성 폐 섬유증 치료제 등의 용도로서 임상적으로 사용되어 왔다.
상기 라니피브라노르는 세포배양 배지 내 1 내지 100 nM의 농도로 포함될 수 있다.
구체적으로, 상기 라니피브라노르는 세포배양 배지 내 1 내지 1000μM, 1 내지 500μM, 1 내지 100μM, 1 내지 90μM, 1 내지 80μM, 1 내지 70μM, 1 내지 60μM, 1 내지 50μM, 1 내지 40μM, 1 내지 30μM, 1 내지 20μM, 5 내지 1000μM, 5 내지 500μM, 5 내지 100μM, 5 내지 90μM, 5 내지 80μM, 5 내지 70μM, 5 내지 60μM, 5 내지 50μM, 5 내지 40μM, 5 내지 30μM, 5 내지 20μM의 농도로 포함될 수 있다.
본 발명의 또 다른 일 양태는 전처리 물질로 전처리된, 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포로부터 분리된 엑소좀에 관한 것이다.
본 발명의 상기 전처리 물질로 전처리된, 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포로부터 분리된 엑소좀(BxC-G63e)은 종래의 엑소좀으로서의 특성을 가진 엑소좀이다. 본 발명의 실시예에서 입증한 바와 같이, 본 발명의 BxC-G63e는 신부전(Kidney failure)이 유도된 신장세포에서 염증을 억제하고, 세포사멸을 억제할 뿐만 아니라, 소포체 스트레스를 억제함을 확인하였다(도 4a 내지 도 6b).
본 발명의 또 다른 일 양태는 상기 전처리 물질로 전처리된, 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포로부터 분리된 엑소좀을 개체에 투여하는 단계를 포함하는 신장 질환 치료방법에 관한 것이다.
상기 "개체"란 질병의 치료를 필요로 하는 대상을 의미하고, 보다 구체적으로는, 인간 또는 비-인간인 영장류, 마우스(mouse), 개, 고양이, 말 및 소 등의 포유류를 의미한다.
본 발명의 또 다른 일 양태는 상기 전처리 물질로 전처리된, 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포로부터 분리된 엑소좀의 신장 질환 치료 용도에 관한 것이다.
상기 신장 질환 치료방법 및 치료용도는 상술한 본 발명의 전처리 물질로 전처리된, 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포로부터 분리된 엑소좀 및 이를 포함하는 약제학적 조성물과 구성성분을 공통으로 하기 때문에, 이들 사이에 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.
본 발명은 전처리 물질로 전처리 하거나 또는 전처리 하지 않은 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포로부터 분리된 엑소좀을 유효성분으로 포함하는 신장 질환의 예방 또는 치료용 약제학적 조성물에 관한 것이다. 본 발명의 엑소좀은 기존 중간엽 줄기세포로부터 분리된 엑소좀에 비하여 보다 개선된 신장 질환 예방 또는 치료 효과를 나타내는 바, 이를 관련 연구개발 및 제품화에 유용하게 사용할 수 있다.
도 1a는 유도만능줄기세포-유래 중간엽 줄기세포 전구세포(BxC)로부터 분리한 엑소좀(BxC-e)의 평균 크기 및 분포를 나타낸 도이다.
도 1b는 유도만능줄기세포-유래 중간엽 줄기세포 전구세포(BxC)로부터 분리한 엑소좀(BxC-e)의 전자현미경 사진이다.
도 2a 내지 2c는 유도만능줄기세포-유래 중간엽 줄기세포 전구세포(BxC)로부터 분리한 엑소좀(BxC-e)의 다양한 신장세포에서의 신장세포 재생 효과를 나타낸 도이다.
도 3a는 Exendin-4 전처리의 유도만능줄기세포-유래 중간엽 줄기세포 전구세포(BxC)로부터 분리한 엑소좀(BxC-G63e)의 평균 크기 및 분포를 나타낸 도이다.
도 3b는 Exendin-4 전처리의 유도만능줄기세포-유래 중간엽 줄기세포 전구세포(BxC)로부터 분리한 엑소좀(BxC-G63e)의 전자현미경 사진이다.
도 3c는 Lanifibranor 전처리의 유도만능줄기세포-유래 중간엽 줄기세포 전구세포(BxC)로부터 분리한 엑소좀(BxC-V37e)의 평균 크기 및 분포를 나타낸 도이다.
도 3d는 Lanifibranor 전처리의 유도만능줄기세포-유래 중간엽 줄기세포 전구세포(BxC)로부터 분리한 엑소좀(BxC-V37e)의 전자현미경 사진이다.
도 4a 및 4b는 신부전(Kidney failure)이 유도된 다양한 신장세포에서 유도만능줄기세포-유래 중간엽 줄기세포 전구세포(BxC)로부터 분리한 엑소좀(BxC-e) 및 Exendin-4 전처리의 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 분리한 엑소좀(BxC-G63e)에 의한 염증(Inflammation) 억제 효과를 나타낸 도이다.
도 5a 및 5b는 신부전(Kidney failure)이 유도된 다양한 신장세포에서 유도만능줄기세포-유래 중간엽 줄기세포 전구세포(BxC)로부터 분리한 엑소좀(BxC-e) 및 Exendin-4 전처리의 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 분리한 엑소좀(BxC-G63e)에 의한 세포사멸(Apoptosis) 억제 효과를 나타낸 도이다.
도 6a 및 6b는 신부전(Kidney failure)이 유도된 다양한 신장세포에서 유도만능줄기세포-유래 중간엽 줄기세포 전구세포(BxC)로부터 분리한 엑소좀(BxC-e) 및 Exendin-4 전처리의 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 분리한 엑소좀(BxC-G63e)에 의한 소포체 스트레스(ER Stress) 억제 효과를 나타낸 도이다.
도 7a 및 7b는 신부전(Kidney failure)이 유도된 신장세포 Exendin-4 전처리의 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 분리한 엑소좀(BxC-G63e)에 의한 신장손상 치료 및 회복 기능을 확인한 도이다.
도 8은 신부전(Kidney failure)이 유도된 신장세포 라니피브라노르 전처리의 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 분리한 엑소좀(BxC-V37e)에 의한 세포사멸(Apoptosis) 억제 효과를 나타낸 도이다. (여기서, *는 p < 0.05 vs. TGFβ-, #은 p < 0.05 vs. TGFβ+, †는 p < 0.05 vs. TGFβ+e 임)
도 9a 내지 9d은 신부전(Kidney failure)이 유도된 신장세포 라니피브라노르 전처리의 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 분리한 엑소좀(BxC-V37e)에 의한 신장 섬유화(Fibrosis) 억제 효과를 Collagen Ⅰ, CTGF, α-SMA 및 Fibronectin 발현 억제를 통해 확인한 도이다. (여기서, *는 p < 0.05 vs. TGFβ-, #은 p < 0.05 vs. TGFβ+, †는 p < 0.05 vs. TGFβ+e 임)
도 10a 내지 10e은 신부전(Kidney failure)이 유도된 신장세포 라니피브라노르 전처리의 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 분리한 엑소좀(BxC-V37e)에 의한 신장 섬유화(Fibrosis) 억제 효과를 결절(Nodule) 생성 억제 통해 확인한 도이다.
도 11은 신부전(Kidney failure)이 유도된 신장세포 라니피브라노르 전처리의 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 분리한 엑소좀(BxC-V37e)에 의한 신장 섬유화(Fibrosis) 억제 효과를 Smad2 인산화 억제 통해 확인한 도이다.
도 12a 내지 12c는 신부전(Kidney failure)이 유도된 신장세포 라니피브라노르 전처리의 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 분리한 엑소좀(BxC-V37e)에 의한 신장 섬유화(Fibrosis) 억제 효과를 신장세포의 섬유화(Fibrosis) 관련 중요 기전인 Epithelial-mesenchymal transition (EMT) 경로(pathway) 조절 효과를 통해 확인한 도이다. (여기서, *는 p < 0.05 vs. TGFβ-, #은 p < 0.05 vs. TGFβ+, †는 p < 0.05 vs. TGFβ+e 임)
도 13a 내지 13b는 신부전(Kidney failure)이 유도된 신장세포 라니피브라노르 전처리의 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 분리한 엑소좀(BxC-V37e)에 의한 신장 섬유화(Fibrosis) 억제 효과를 신장세포의 섬유화(Fibrosis) 관련 중요 기전인 Epithelial-mesenchymal transition (EMT) 경로(pathway)의 하위 시그널 (snail1 및 slug mRNA 발현) 조절 효과를 통해 확인한 도이다. (여기서, *는 p < 0.05 vs. TGFβ-, #은 p < 0.05 vs. TGFβ+, †는 p < 0.05 vs. TGFβ+e 임)
도 14a 및 14b는 신부전(Kidney failure)이 유도된 신장세포 Lanifibranor 전처리의 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 분리한 엑소좀(BxC-V37e)에 의한 신장손상 치료 및 회복 기능을 확인한 도이다.
유도만능줄기세포(induced pluripotent stem cell, iPSC)-유래 중간엽 줄기세포(mesenchymal stem cell, MSC)의 전구세포로부터 분리된 엑소좀을 유효성분으로 포함하는 신장 질환(Kidney disease)의 예방 또는 치료용 약제학적 조성물.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
본 명세서 전체에 걸쳐, 특정 물질의 농도를 나타내기 위하여 사용되는 “%“는 별도의 언급이 없는 경우, 고체/고체는 (중량/중량)%, 고체/액체는 (중량/부피)%, 그리고 액체/액체는 (부피/부피)%이다.
제조예: 유도만능줄기세포(iPSC)-유래 중간엽 줄기세포 전구세포(BxC)의 분리 및 배양
먼저 유도만능줄기세포(iPSC)를 10%의 FBS 및 10 ng/ml의 bFGF를 첨가한 DMEM에서 7일간 배양하였다. 다음으로, 배양된 유도만능줄기세포에서 FACS를 통하여 세포 표면에 SSEA-4(stage-specific embryonic antigen 4) 단백질을 발현하지 않는 SSEA-4(-) 세포를 분리하였다. 또한 분리된 SSEA-4(-) 세포를 계대하여 상기와 동일한 배지에서 7일간 추가 배양하여, 본 발명의 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포를 제작하였다. 본 발명자들은 상기 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포를 BxC(brexogen stem cell)로 명명하였다.
BxC로 명명된 유도만능줄기세포 유래 중간엽 줄기세포의 전구세포를 배양배지[high glucose DMEM(Gibco, Cat no.11995-065), 10% Fetal bovine Serum(HyClone), 1% MEM Non-Essential Amino Acids Solution(100X)(Gibco, Cat no.11140-050)]에서 추가 배양하였다.
실시예 1: 유도만능줄기세포-유래 중간엽 줄기세포 전구세포(BxC) 유래 엑소좀 분리
상기 제조예에서 배양된 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포(이하, BxC) 배양배지를 수거하여 300xg에서 10분간 원심분리하여 남아있는 세포와 세포잔여물을 제거하였다. 상층액을 취하여 0.22μm 필터를 이용하여 여과한 다음, 고속원심분리기(high speed centrifuge)를 이용하여 10,000xg, 4℃에서 70분간 원심분리하였다. 원심분리된 상층액을 다시 취하여 초원심분리기(ultracentrifuge)를 이용하여 100,000xg, 4℃에서 90분간 원심분리하여 상층액을 제거하였다. 하층에 남아있는 엑소좀을 PBS(phosphate bufferd salin)에 희석하여 이하의 실험에 사용하였다.
실험예 1: 유도만능줄기세포-유래 중간엽 줄기세포 전구세포(BxC) 유래 엑소좀 특성 확인
상기 실시예 1에서 분리된 엑소좀(이하, BxC-e)에 대하여, nanoparticle tracking assay(NanoSight NS300, Malvern)를 이용하여 엑소좀의 크기 분포를 확인하고, 전자 현미경을 이용하여 엑소좀의 형태를 확인하였다.
도 1a 및 1b에서 확인할 수 있듯이, 본 발명의 BxC로부터 유래한 엑소좀은 엑소좀으로서의 특성을 가짐을 알 수 있다.
실험예 2: 유도만능줄기세포-유래 중간엽 줄기세포 전구세포 유래 엑소좀(BxC-e)의 신장세포 재생 효과 확인
상기 실시예 1에서 분리된 엑소좀에 대하여, 시스플라틴(Cisplatin) 또는 LPS(Lipopolysaccharide) 처리에 의해 손상된 신장세포에 대한 재생 효과를 확인하였다.
2-1. 시스플라틴 손상
먼저, 96웰 배양 접시(culture dish)에 상피세포주(epithelial cell line)인 HK-2(한국세포주은행), 신장 상피세포(kidney epithelial cell)인 RPTEC(Renal Proximal Tubule Epithelial Cells, Lonza, CC-2553) 및 신장 상피세포인 GEC(Glomerular Endothelial Cells, Cell Systems, ACBRI 128)을 각각 웰당 1x104씩 접종(seeding)하였다.
세포 접종 16시간 후, 세포의 상태를 확인하고 무 혈청 성장 배지(serum free growth media)와 함께 시스플라틴(Sigma P4394) 25μM을 24시간 처리하였다. 24시간 후, 상층액을 버리고 DPBS(HyClone SH30028.02)로 세척한 다음, 새로운 무 혈청 성장 배지와 함께 상기 실시예 1에서 분리된 엑소좀을 50μg(low dose) 또는 100μg(high dose)씩 48시간 동안 처리하였다.
끝으로, 10μL의 CCK-8용액(Cell Counting Kit-8, Enzo ALX-850-039-KI01)을 넣고 37℃ CO2 인큐베이터에서 2시간 동안 인큐베이션 하였다. 색깔이 변하는 것을 확인하고 450nm에서 흡광도를 측정하였다.
2-2. LPS 손상
상기 실험예 2-1의 시스플라틴 대신 LPS(Sigma L2880) 20μg/mL을 처리한 것을 제외하고, 상기 실험예 2-1과 동일한 방법으로 실험을 진행하였다.
도 2a 내지 2c에서 확인할 수 있듯이, 본 발명의 BxC로부터 유래한 엑소좀(BxC-e)은 다양한 신장세포에 대한 재생 효과가 뛰어난 것을 알 수 있었다.
실시예 2: 전처리 물질의 처리에 따른 유도만능줄기세포-유래 중간엽 줄기세포 전구세포 유래 엑소좀(BxC-G63e) 분리
2-1. Exendin-4 처리에 따른 유도만능줄기세포-유래 중간엽 줄기세포 전구세포 유래 엑소좀(BxC-G63e) 분리
Exendin-4 20nM이 포함된 배양배지[high glucose DMEM(Gibco, Cat no.11995-065); 10% Fetal bovine Serum(HyClone), 1% MEM Non-Essential Amino Acids Solution(100X)(Gibco, Cat no.11140-050)]에서 상기 제조예에서 제조된 유도만능줄기세포(iPSC)-유래 중간엽 줄기세포 전구세포(BxC)를 24시간 배양하였다.
배양을 완료한 후 Exendin-4가 전처리 된 BxC를 세척하고 엑소좀이 제거된 우태아혈청(FBS)을 10% 첨가한 배양배지에서 추가적으로 72시간 배양하였다. 엑소좀이 제거된 FBS를 사용하는 이유는 일반적으로 사용하는 FBS에는 소 혈청유래의 엑소좀이 매우 많이 포함되어 있기 때문에, 세포가 분비하는 엑소좀 외에 FBS 유래 엑소좀이 혼입되는 것을 방지하기 위함이다.
72시간 배양 후 전처리 물질이 처리된 BxC 배양배지를 수거하여 300xg에서 10분간 원심분리하여 남아있는 세포와 세포잔여물을 제거하였다. 상층액을 취하여 0.22μm 필터를 이용하여 여과한 다음, 고속원심분리기(high speed centrifuge)를 이용하여 10,000xg, 4℃에서 70분간 원심분리하였다. 원심분리된 상층액을 다시 취하여 초원심분리기(ultracentrifuge)를 이용하여 100,000xg, 4℃에서 90분간 원심분리하여 상층액을 제거하였다. 하층에 남아있는 엑소좀을 PBS(phosphate bufferd saline)에 희석하여 이하의 실험에 사용하였다.
2-2. Lanifibranor 처리에 따른 유도만능줄기세포-유래 중간엽 줄기세포 전구세포 유래 엑소좀(BxC-V37e) 분리
LANIFIBRANOR 10μM이 포함된 배양배지[high glucose DMEM(Gibco, Cat no.11995-065); 10% Fetal bovine Serum (HyClone), 1% MEM Non-Essential Amino Acids Solution (100X) (Gibco, Cat no.11140-050)]에서 상기 제조예에서 제조된 유도만능줄기세포(iPSC)-유래 중간엽 줄기세포 전구세포(BxC)를 24시간 배양하였다.
배양을 완료한 후 Lanifibranor가 전처리 된 BxC를 세척하고 엑소좀이 제거된 우태아혈청(FBS)을 10% 첨가한 배양배지에서 추가적으로 72시간 배양하였다.
72시간 배양 후 전처리 물질이 처리된 BxC 배양배지를 수거하여 300xg에서 10분간 원심분리하여 남아있는 세포와 세포잔여물을 제거하였다. 상층액을 취하여 0.22μm 필터를 이용하여 여과한 다음, 고속원심분리기(high speed centrifuge)를 이용하여 10,000xg, 4℃에서 70분간 원심분리하였다. 원심분리된 상층액을 다시 취하여 초원심분리기(ultracentrifuge)를 이용하여 100,000xg, 4℃에서 90분간 원심분리하여 상층액을 제거하였다. 하층에 남아있는 엑소좀을 PBS(phosphate bufferd saline)에 희석하여 이하의 실험에 사용하였다.
실험예 3: 전처리 물질의 처리에 따른 유도만능줄기세포-유래 중간엽 줄기세포 전구세포 유래 엑소좀 특성 확인
상기 실시예 2에서 분리된 엑소좀(BxC-G63e, BxC-V37e)에 대하여, nanoparticle tracking assay(NanoSight NS300, Malvern)를 이용하여 엑소좀의 크기 분포를 확인하고, 전자 현미경을 이용하여 엑소좀의 형태를 확인하였다.
도 3a 내지 3d에서 확인할 수 있듯이, 본 발명의 Exendin-4 및 Lanifibranor 처리에 따른 BxC 유래 엑소좀이 엑소좀으로서의 특성을 가짐을 알 수 있다.
실험예 4: Exendin-4 처리에 따른 유도만능줄기세포-유래 중간엽 줄기세포 전구세포 유래 엑소좀(BxC-G63e)의 신장질환 치료 활성 평가
상기 실시예 1에서 분리된 엑소좀(BxC-e) 및 상기 실시예 2-1에서 분리된 엑소좀(BxC-G63e)에 대하여, 하기와 같이 실험하였다.
4-1. 염증(Inflammation) 억제 효과
6웰 배양 접시에 상피세포주인 HK-2, 신장 상피세포인 RPTEC 및 신장 상피세포인 GEC을 각각 웰당 1x105씩 접종하였다. 세포 접종 16시간 후, 세포의 상태를 확인하고 무 혈청 성장 배지와 함께 시스플라틴 25μM 또는 LPS 20μg/mL, 및 상기 실시예 1에서 분리된 엑소좀(BxC-e) 또는 상기 실시예 2에서 분리된 엑소좀(BxC-G63e) 100μg을 24시간 동안 처리하였다. 이때, 양성대조군으로는 시스플라틴 또는 LPS만 처리하여 신부전을 유도한 그룹을 사용하였다.
24시간 후, 상층액을 버리고 DPBS로 세척한 다음, Trizol을 처리하여 total RNA를 추출하였다. RNA를 이용하여 cDNA를 합성한 후 qRT-PCR로 TNFα 유전자의 발현을 측정하였다.
도 4a 및 4b에서 확인할 수 있듯이, 본 발명의 엑소좀(BxC-e 및 BxC-G63e)은 시스플라틴 또는 LPS 처리에 의해 독성이 유발된 다양한 신장세포에서 현저하게 염증을 억제하는 효과가 있음을 알 수 있다.
4-2. 세포사멸(Apoptosis) 억제 효과
6웰 배양 접시에 상피세포주인 HK-2, 신장 상피세포인 RPTEC 및 신장 상피세포인 GEC을 각각 웰당 1x105씩 접종하였다. 세포 접종 16시간 후, 세포의 상태를 확인하고 무 혈청 성장 배지와 함께 시스플라틴 25μM 또는 LPS 20μg/mL, 및 상기 실시예 1에서 분리된 엑소좀(BxC-e) 또는 상기 실시예 2에서 분리된 엑소좀(BxC-G63e) 100μg을 24시간 동안 처리하였다. 이때, 양성대조군으로는 시스플라틴 또는 LPS만 처리하여 신부전을 유도한 그룹을 사용하였다.
24시간 후, 상층액을 버리고 DPBS로 세척한 다음, Trizol을 처리하여 total RNA를 추출하였다. RNA를 이용하여 cDNA를 합성한 후 qRT-PCR로 caspase-3 유전자의 발현을 측정하였다.
도 5a 및 5b에서 확인할 수 있듯이, 본 발명의 엑소좀(BxC-e 및 BxC-G63e)은 시스플라틴 또는 LPS 처리에 의해 독성이 유발된 다양한 신장세포에서 현저하게 세포사멸을 억제하는 효과가 있음을 알 수 있다.
4-3. 소포체 스트레스(ER Stress) 억제 효과
6웰 배양 접시에 상피세포주인 HK-2, 신장 상피세포인 RPTEC 및 신장 상피세포인 GEC을 각각 웰당 1x105씩 접종하였다. 세포 접종 16시간 후, 세포의 상태를 확인하고 무 혈청 성장 배지와 함께 시스플라틴 25μM 또는 LPS 20μg/mL, 및 상기 실시예 1에서 분리된 엑소좀(BxC-e) 또는 상기 실시예 2에서 분리된 엑소좀(BxC-G63e) 100μg을 24시간 동안 처리하였다. 이때, 양성대조군으로는 시스플라틴 또는 LPS만 처리하여 신부전을 유도한 그룹을 사용하였다.
24시간 후, 상층액을 버리고 DPBS로 세척한 다음, Trizol을 처리하여 total RNA를 추출하였다. RNA를 이용하여 cDNA를 합성한 후 qRT-PCR로 CHOP 유전자의 발현을 측정하였다.
도 6a 및 6b에서 확인할 수 있듯이, 본 발명의 엑소좀(BxC-e 및 BxC-G63e)은 시스플라틴 또는 LPS 처리에 의해 독성이 유발된 다양한 신장세포에서 현저하게 신장세포 내 소포체 스트레스를 억제하는 효과가 있음을 알 수 있다.
4.4 신장 손상 치료 및 회복 기능
Cisplatin에 의해 신부전(Kidney failure)이 유도된 마우스 신장손상 모델에서 Exendin-4 전처리 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 분리한 엑소좀(BxC-G63e)의 신장 손상 치료 및 회복 기능을 확인하였다.
8주령의 Balb/c 수컷 마우스에 시스플라틴 (cisplatin) (15mg/kg)을 복강내 투여하여 신장손상을 유발하였다. Cisplatin 주입 후 Exendin-4 전처리 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 분리한 엑소좀(BxC-G63e)을 IV 투여하고 3일 후 혈액을 분리하여 크레아티닌 (Creatinine), BUN 레벨을 측정하여 BxC-G63e의 신장 손상 치료 및 회복 기능을 확인하였다.
Normal control No treatment BxC-G63e
BUN level (mg/dL) 21.2 316 157
Normal control No treatment BxC-G63e
Creatinine level (mg/dL) 0.1 1.5 0.9
실험결과, 도 7a 및 7b 및 표 1 내지 2에서 확인할 수 있듯이, 본 발명에 따른 Exendin-4 전처리 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 분리한 엑소좀(BxC-G63e)은 Cisplatin에 의해 증가된 신장의 혈중요소질소(BUN) 수치와 크레아티닌(Creatinine) 수치를 월등하게 감소시킬 수 있음을 확인하였으며, 이를 통해, BxC-G63e 엑소좀이 손장된 신장의 기능을 회복시키는 효과가 현저히 우수함을 확인하였다.
실험예 5: Lanifibranor 처리에 따른 유도만능줄기세포-유래 중간엽 줄기세포 전구세포 유래 엑소좀(BxC-V37e)의 신장질환 치료 활성 평가
5.1. 세포사멸(Apoptosis) 억제 효과
웰 배양 접시에 신장 상피세포를 웰당 1x105씩 접종하였다. 세포 접종 16시간 후, 세포의 상태를 확인하고 무 혈청 성장 배지와 함께 TGF-β (10ng/mL) 및 상기 실시예 1에서 분리된 엑소좀(BxC-e) 또는 라니피브라노르 처리에 따른 유도만능줄기세포-유래 중간엽 줄기세포 전구세포 유래 엑소좀 (BxC-V37e)을 100μg을 24시간 동안 처리하였다. 이때, 양성대조군으로는 TGF-β 만 처리하여 신부전을 유도한 그룹을 사용하였다.
24시간 후, 상층액을 버리고 DPBS로 세척한 다음, 트리졸 (Trizol)을 처리하여 total RNA를 추출하였다. 그 후, 하기 표 3의 프라이머를 이용하여, RNA를 cDNA를 합성한 후 qRT-PCR로 caspase-3 유전자의 발현을 측정하였다.
순번 명명 서열 (5'→3') 비고
1 Human_Caspase-3_Foward TCTGGTTTTCGGTGGGTGTG
2 Human_Caspase-3_Reverse CGCTTCCATGTATGATCTTTGGTT
TGFβ- TGFβ+ TGFβ+e TGFβ+V37e
Casepase-3 mRNA (A.U.) 1.2 5.2 1.1 0.9
도 8 및 표 4에서 확인할 수 있듯이, 본 발명의 엑소좀(BxC-e 및 BxC-V37e)은 TGF-β 처리에 의해 섬유화가 유발된 신장세포에서 현저하게 세포사멸을 억제하는 효과가 있음을 알 수 있다.
5.2. 섬유화 (Fibrosis) 억제 효과
5.2.1. Collagen Ⅰ, CTGF, α-SMA 및 Fibronectin 발현 억제
6웰 배양 접시에 신장 상피세포를 웰당 1x105씩 접종하였다. 세포 접종 16시간 후, 세포의 상태를 확인하고 무 혈청 성장 배지와 함께 TGF-β (10 ng/mL) 상기 실시예 1에서 분리된 엑소좀(BxC-e) 또는 라니피브라노르 처리에 따른 유도만능줄기세포-유래 중간엽 줄기세포 전구세포 유래 엑소좀(BxC-V37e)을 100μg을 24시간 동안 처리하였다. 이때, 양성대조군으로는 TGF-β 만 처리하여 신부전을 유도한 그룹을 사용하였다.
24시간 후, 상층액을 버리고 DPBS로 세척한 다음, 트리졸 (Trizol)을 처리하여 total RNA를 추출하였다. 하기 표 5의 프라이머를 이용하여, RNA를 cDNA로 합성한 후 qRT-PCR로 Collagen I, CTGF, α-SMA, Fibronectin 유전자의 발현을 측정하였다.
순번 명명 서열 (5'→3') 비고
3 Human_Collagen1_Foward CACAGAGGTTTCAGTGGTTT
4 Human_Collagen1_Reverse GCACCAGTAGCACCATCATT
5 Human_CTGF_Foward CAAGGGCCTCTTCTGTGACT
6 Human_CTGF_Reverse ACGTGCACTGGTACTTGCAG
7 Human_αSMA_Foward AGGTAACGAGTCAGAGCTTTGGC
8 Human_αSMA_Reverse CTCTCTGTCCACCTTCCAGCAG
9 Human_Fibronectin_Foward AAGATTGGAGAGAAGTGGGACC
10 Human_Fibronectin_Reverse GAGCAAATGGCACCGAGATA
TGFβ- TGFβ+ TGFβ+e TGFβ+V37e
Collagen Ⅰ mRNA (A.U.) 1 98.2 63.8 4.2
TGFβ- TGFβ+ TGFβ+e TGFβ+V37e
CTGF mRNA (A.U.) 1.8 5.7 5.2 1.7
TGFβ- TGFβ+ TGFβ+e TGFβ+V37e
α-SMA mRNA (A.U.) 1.7 5.8 1.9 1.7
TGFβ- TGFβ+ TGFβ+e TGFβ+V37e
Fibronectin mRNA (A.U.) 1.4 13.6 6.7 1.2
도 9a 내지 9d 및 표 6 내지 9에서 확인할 수 있듯이, 본 발명의 엑소좀(BxC-e 및 BxC-V37e)은 TGFβ 처리에 의해 신부전(Kidney failure)이 유도된 신장세포에서 신장세포의 섬유화(Fibrosis)와 관련된 유전자인 Collagen Ⅰ, CTGF, α-SMA 및 Fibronectin의 발현을 현저하게 감소시킬 수 있음을 확인하였다.
5.2.2. 결절 (Nodule) 형성 억제
6웰 배양 접시에 신장 상피세포를 웰당 1x105씩 접종하였다. 세포 접종 시, 무 혈청 성장 배지와 함께 TGF-β 및 상기 실시예 1에서 분리된 엑소좀(BxC-e) 또는 라니피브라노르 처리에 따른 유도만능줄기세포-유래 중간엽 줄기세포 전구세포 유래 엑소좀(BxC-V37e)을 100μg을 24시간 동안 처리하였다. 이때, 양성대조군으로는 TGF-β 만 처리하여 신부전을 유도한 그룹을 사용하였다. 24시간 후, 상층액을 제거하고 DPBS로 세척한다음, 메탄올로 5분간 4도씨에서 고정한후, Picrosirius Red solution을 넣고 1 처리하고 아세트산 수용액 (Acetic Acid solution) (0.5%)로 2번 세척하여 현미경을 이용하여 결절(nodule) 형성 정도를 관찰하여 비교하였으며, 0.1N KOH로 Picrosirius Red dye를 녹여내어 540nm에서 흡광도를 측정하여 양성대조군과 비교하였다.
TGFβ- TGFβ+ TGFβ+e TGFβ+V37e
Ratio to control 1 1.71 1.28 1.14
도 10a 내지 10e 및 표 10에서 확인할 수 있듯이, 본 발명의 엑소좀(BxC-e 및 BxC-V37e)은 TGFβ 처리에 의해 신부전(Kidney failure)이 유도된 신장세포에서 형성되는 결절(nodule)의 생성을 현저하게 감소시킬 수 있음을 확인하였다.
5.2.3. Smad2 인산화 방지
6웰 배양 접시에 신장 상피세포를 웰당 1x105씩 접종하였다. 세포 접종 16시간 후, 세포의 상태를 확인하고 무 혈청 성장 배지와 함께 TGF-β 및 상기 실시예 1에서 분리된 엑소좀(BxC-e) 또는 라니피브라노르 처리에 따른 유도만능줄기세포-유래 중간엽 줄기세포 전구세포 유래 엑소좀(BxC-V37e)을 100μg을 24시간 동안 처리하였다. 이때, 양성대조군으로는 TGF-β 만 처리하여 신부전을 유도한 그룹을 사용하였다.
24시간 후, 상층액을 버리고 DPBS로 세척한 다음, 세포를 모아 NP40 버퍼 로 단백질을 추출하였다. 단백질은 웨스턴블랏 (western blot)을 이용하여 총 Smad2 단백질과 인산화 단백질을 분석하였다. 각각의 총 단백질로 인산화된 Smad2 단백질을 정량하고 TGF-β 가 처리되지 않은 음성대조군과 비교하였다.
도 11에서 확인할 수 있듯이, 본 발명의 엑소좀(BxC-e 및 BxC-V37e)은 TGFβ 처리에 의해 신부전(Kidney failure)이 유도된 신장세포에서 TGF-β에 의한 Smad2 단백질의 인산화를 억제하는 것을 확인하였다.
5.2.4. Epithelial-mesenchymal transition (EMT) 경로(pathway) 조절
6웰 배양 접시에 신장 상피세포를 웰당 1x105씩 접종하였다. 세포 접종 16시간 후, 세포의 상태를 확인하고 무 혈청 성장 배지와 함께 TGF-β 및 상기 실시예 1에서 분리된 엑소좀(BxC-e) 또는 라니피브라노르 처리에 따른 유도만능줄기세포-유래 중간엽 줄기세포 전구세포 유래 엑소좀(BxC-V37e)을 100μg을 24시간 동안 처리하였다. 이때, 양성대조군으로는 TGF-β 만 처리하여 신부전을 유도한 그룹을 사용하였다.
24시간 후, 상층액을 버리고 DPBS로 세척한 다음, 트리졸을 처리하여 총 RNA를 추출하였다. 그 후, 표 11의 프라이머를 이용하여, RNA로 cDNA를 합성한 후 qRT-PCR로 E-cadherin, N-cadherin, Vimentin 유전자의 발현을 측정하였다.
순번 명명 서열 (5'→3') 비고
11 Human_E-cadherin_Foward GCTGGACCGAGAGAGTTTCC
12 Human_E-cadherin_Reverse CGACGTTAGCCTCGTTCTCA
13 Human_N-cadherin_Foward GACAATGCCCCTCAAGTGTT
14 Human_N-cadherin_Reverse CCATTAAGCCGAGTGATGGT
15 Human_Vimentin_Foward CTCCCTGAACCTGAGGGAAAC
16 Human_Vimentin_Reverse TTGCGCTCCTGAAAAACTGC
TGFβ- TGFβ+ TGFβ+e TGFβ+V37e
E-cadherin mRNA (A.U.) 1.39 0.74 0.79 0.9
TGFβ- TGFβ+ TGFβ+e TGFβ+V37e
N-cadherin mRNA (A.U.) 1.30 21.2 18.07 1.63
TGFβ- TGFβ+ TGFβ+e TGFβ+V37e
Vimentin mRNA (A.U.) 1.56 26.77 9.9 0.90
도 12a 내지 12c 및 표 12 내지 14에서 확인할 수 있듯이, 본 발명의 엑소좀(BxC-e 및 BxC-V37e)은 TGFβ 처리에 의해 신부전(Kidney failure)이 유도된 신장세포에서 섬유화(Fibrosis) 관련 중요 기전인 Epithelial-mesenchymal transition (EMT) 경로의 조절 효과가 우수함을 확인하였다.
5.2.5. snail1 및 slug의 mRNA 발현 억제
6웰 배양 접시에 신장 상피세포를 웰당 1x105씩 접종하였다. 세포 접종 16시간 후, 세포의 상태를 확인하고 무 혈청 성장 배지와 함께 TGF-β (10ng/mL) 및 상기 실시예 1에서 분리된 엑소좀(BxC-e) 또는 라니피브라노르 처리에 따른 유도만능줄기세포-유래 중간엽 줄기세포 전구세포 유래 엑소좀(BxC-V37e)을 100μg을 24시간 동안 처리하였다. 이때, 양성대조군으로는 TGF-β 만 처리하여 신부전을 유도한 그룹을 사용하였다.
24시간 후, 상층액을 버리고 DPBS로 세척한 다음, 트리졸을 처리하여 total RNA를 추출하였다. 그 후, 표 15의 프라이머로 RNA로 cDNA를 합성한 후 qRT-PCR로 Snail, Slug 유전자의 발현을 측정하였다.
순번 명명 서열 (5'→3') 비고
17 Human_Snail1_Foward CCTGTCTGCGTGGGTTTTTG
18 Human_Snail1_Reverse ACCTGGGGGTGGATTATTGC
19 Human_Slug_Foward ACTGGACACACATACAGTGATT
20 Human_Slug_Reverse ACTCACTCGCCCCAAAGATG
TGFβ- TGFβ+ TGFβ+e TGFβ+V37e
Snail1 mRNA (A.U.) 1.3 104.2 101.7 6.8
TGFβ- TGFβ+ TGFβ+e TGFβ+V37e
Slug mRNA (A.U.) 1.07 6.38 3.48 0.62
도 13a 내지 13b 및 표 16 내지 17에서 확인할 수 있듯이, 본 발명의 엑소좀(BxC-e 및 BxC-V37e)은 TGFβ 처리에 의해 신부전(Kidney failure)이 유도된 신장세포에서 섬유화(Fibrosis) 관련 중요 기전인 Epithelial-mesenchymal transition (EMT) 경로의 하위 시그널인 snail1 및 slug mRNA의 발현(Expression)을 조절하는 효과가 우수함을 확인하였다.
5.3 신장 손상 치료 및 회복 기능
Cisplatin에 의해 신부전(Kidney failure)이 유도된 마우스 신장손상 모델에서 Lanifibranor 전처리 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 분리한 엑소좀(BxC-V37e)의 신장 손상 치료 및 회복 기능을 확인하였다.
8주령의 Balb/c 수컷 마우스에 cisplatin (15mg/kg)을 복강내 투여하여 신장손상을 유발하였다. Cisplatin 주입 후 라니피브라노르 전처리 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 분리한 엑소좀(BxC-V63e)을 IV 투여하고 3일 후 혈액을 분리하여 Creatinine, BUN을 측정하여 BxC-G63e의 신장 손상 치료 및 회복 기능을 확인하였다.
Normal control No treatment BxC-V37e
BUN level (mg/dL) 21.2 316 212
Normal control No treatment BxC-V37e
Creatinine level (mg/dL) 0.1 1.5 0.3
실험결과, 도 14a 및 14b 및 표 18 내지 19에서 확인할 수 있듯이, 본 발명에 따른 Exendin-4 전처리 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 분리한 엑소좀(BxC-V37e)은 Cisplatin에 의해 증가된 신장의 혈중요소질소(BUN) 수치와 크레아티닌(Creatinine) 수치를 월등하게 감소시킬 수 있음을 확인하였으며, 이를 통해, BxC-V37e 엑소좀이 손장된 신장의 기능을 회복시키는 효과가 현저히 우수함을 확인하였다.
소결
상기 내용을 종합해 보면, 본 발명의 BxC-e, BxC-G63e 및 BxC-V37e는 신부전(Kidney failure)이 유도된 신장세포에서 염증을 억제하고, 세포사멸을 억제할 뿐만 아니라, 소포체 스트레스를 억제시키므로 신장질환의 예방 또는 치료 효능이 탁월함을 알 수 있다.
본 발명은 전처리 물질로 전처리 하거나 또는 전처리 하지 않은 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 유래된 엑소좀을 유효성분으로 포함하는 신장 질환의 예방 또는 치료용 조성물에 관한 것이다.

Claims (12)

  1. 유도만능줄기세포(induced pluripotent stem cell, iPSC)-유래 중간엽 줄기세포(mesenchymal stem cell, MSC)의 전구세포로부터 분리된 엑소좀을 유효성분으로 포함하는 신장 질환(Kidney disease)의 예방 또는 치료용 약제학적 조성물.
  2. 제1항에 있어서, 상기 중간엽 줄기세포의 전구세포는 동등한 수의 동종조직 유래 중간엽 줄기세포에 비하여 ANKRD1, CPE, NKAIN4, LCP1, CCDC3, MAMDC2, CLSTN2, SFTA1P, EPB41L3, PDE1C, EMILIN2, SULT1C4, TRIM58, DENND2A, CADM4, AIF1L, NTM, SHISA2, RASSF4, 및 ACKR3로 이루어진 군으로부터 선택된 1 이상의 유전자를 더 높은 수준으로 발현하는 것인, 약제학적 조성물.
  3. 제1항에 있어서, 상기 중간엽 줄기세포의 전구세포는 동등한 수의 동종조직 유래 중간엽 줄기세포에 비하여 DHRS3, BMPER, IFI6, PRSS12, RDH10, 및 KCNE4로 이루어진 군으로부터 선택된 1 이상의 유전자를 더 낮은 수준으로 발현하는 것인, 약제학적 조성물.
  4. 제1항에 있어서, 상기 신장 질환은 신장 섬유증, 당뇨병성 신증, 고혈압성 신증, 사구체 신염, 신우 신염, 간질성 신염, 루프스 신장염, 다낭성 신장질환, 신부전증, 사구체 경화증, 이식 후 급성거부반응 및 약물에 의한 신장 손상으로 이루어진 군으로부터 선택된 것인, 약제학적 조성물.
  5. 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포로부터 분리된 엑소좀.
  6. 전처리 물질로 전처리된, 유도만능줄기세포(induced pluripotent stem cell, iPSC)-유래 중간엽 줄기세포(mesenchymal stem cell, MSC)의 전구세포로부터 분리된 엑소좀을 유효성분으로 포함하는 신장 질환(Kidney disease)의 예방 또는 치료용 약제학적 조성물.
  7. 제6항에 있어서, 상기 전처리 물질은 엑센딘-4(Exendin-4)인, 약제학적 조성물.
  8. 제6항에 있어서, 상기 전처리 물질은 라니피브라노르(Lanifibranor)인, 약제학적 조성물.
  9. 제6항에 있어서, 상기 신장 질환은 신장 섬유증, 당뇨병성 신증, 고혈압성 신증, 사구체 신염, 신우 신염, 간질성 신염, 루프스 신장염, 다낭성 신장질환, 신부전증, 사구체 경화증, 이식 후 급성거부반응 및 약물에 의한 신장 손상으로 이루어진 군으로부터 선택된 것인, 약제학적 조성물.
  10. 전처리 물질로 전처리된, 유도만능줄기세포-유래 중간엽 줄기세포의 전구세포로부터 분리된 엑소좀.
  11. 제10항에 있어서, 상기 전처리 물질은 엑센딘-4(Exendin-4)인, 엑소좀.
  12. 제10항에 있어서, 상기 전처리 물질은 라니피브라노르(Lanifibranor)인, 엑소좀.
PCT/KR2020/015790 2019-11-12 2020-11-11 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 유래된 엑소좀을 포함하는 신장 질환의 예방 또는 치료용 조성물 WO2021096220A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP20888516.0A EP4079313A4 (en) 2019-11-12 2020-11-11 COMPOSITION FOR THE PREVENTION OR TREATMENT OF KIDNEY DISEASES, COMPRISING EXOSOMES DERIVED FROM PRECURSOR CELLS OF MESENCHYMAL STEM CELLS DERIVED FROM INDUCED PLURIPOTENT STEM CELLS
JP2022527079A JP2023501510A (ja) 2019-11-12 2020-11-11 誘導万能幹細胞由来間葉幹細胞の前駆細胞に由来するエクソソームを含む腎臓疾患の予防又は治療用組成物
CN202080079648.6A CN114728024B (zh) 2019-11-12 2020-11-11 包含源自诱导多能干细胞来源间充质干细胞的前体细胞外泌体的用于预防或治疗肾脏疾病的组合物
US17/774,562 US20220387509A1 (en) 2019-11-12 2020-11-11 Composition for preventing or treating renal diseases, comprising exosomes derived from precursor cells of induced pluripotent stem cell-derived mesenchymal stem cells

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20190144420 2019-11-12
KR10-2019-0144420 2019-11-12
KR1020200149965A KR102630220B1 (ko) 2019-11-12 2020-11-11 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 유래된 엑소좀을 포함하는 신장 질환의 예방 또는 치료용 조성물
KR10-2020-0149965 2020-11-11

Publications (1)

Publication Number Publication Date
WO2021096220A1 true WO2021096220A1 (ko) 2021-05-20

Family

ID=75911386

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/015790 WO2021096220A1 (ko) 2019-11-12 2020-11-11 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 유래된 엑소좀을 포함하는 신장 질환의 예방 또는 치료용 조성물

Country Status (3)

Country Link
US (1) US20220387509A1 (ko)
JP (1) JP2023501510A (ko)
WO (1) WO2021096220A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4190338A4 (en) * 2020-07-29 2024-03-27 Brexogen Inc COMPOSITION WITH STEM CELL EXOSOME AND METHOD FOR PRODUCING THEREOF

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014144462A1 (en) * 2012-03-15 2014-09-18 Scharp Technologies, Llc Compositions of cells, media, and methods thereof
KR20180003999A (ko) * 2016-07-01 2018-01-10 사회복지법인 삼성생명공익재단 트롬빈 처리 줄기세포에서 유래된 엑소좀을 포함하는 피부상처 치료용 조성물
KR20180063817A (ko) * 2016-12-02 2018-06-12 주식회사 미래셀바이오 기능성이 향상된 신규 간엽성 전구세포를 포함하는 혈관 재생용 또는 혈관 손상 방지용 세포치료제 조성물, 및 이의 제조방법
KR20190083932A (ko) * 2018-01-05 2019-07-15 재단법인 아산사회복지재단 유도만능 줄기세포 유래 중간엽 줄기세포 및 이로부터 유래된 엑소좀을 포함하는 피부질환의 개선, 예방 또는 치료용 조성물

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113728091B (zh) * 2019-06-10 2024-04-12 布瑞克斯奥根株式会社 用于促进干细胞来源外泌体产生和增加干性的组合物
CN114787340A (zh) * 2019-07-26 2022-07-22 布瑞克斯奥根株式会社 诱导多能干细胞来源间充质干细胞前体细胞及其制备方法
JP2023039190A (ja) * 2021-09-08 2023-03-20 日立Astemo株式会社 全固体電池制御装置

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014144462A1 (en) * 2012-03-15 2014-09-18 Scharp Technologies, Llc Compositions of cells, media, and methods thereof
KR20180003999A (ko) * 2016-07-01 2018-01-10 사회복지법인 삼성생명공익재단 트롬빈 처리 줄기세포에서 유래된 엑소좀을 포함하는 피부상처 치료용 조성물
KR20180063817A (ko) * 2016-12-02 2018-06-12 주식회사 미래셀바이오 기능성이 향상된 신규 간엽성 전구세포를 포함하는 혈관 재생용 또는 혈관 손상 방지용 세포치료제 조성물, 및 이의 제조방법
KR20190083932A (ko) * 2018-01-05 2019-07-15 재단법인 아산사회복지재단 유도만능 줄기세포 유래 중간엽 줄기세포 및 이로부터 유래된 엑소좀을 포함하는 피부질환의 개선, 예방 또는 치료용 조성물

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BAS W M VAN BALKOM, TRAIRAK PISITKUN, MARIANNE C VERHAAR, MARK A KNEPPER: "Exosomes and the kidney: prospects for diagnosis and therapy of renal diseases", KIDNEY INTERNATIONAL, vol. 80, no. 11, 1 December 2011 (2011-12-01), pages 1138 - 1145, XP055177367, ISSN: 00852538, DOI: 10.1038/ki.2011.292 *
DHANESHA NIRAV, JOHARAPURKAR AMIT, SHAH GAURANG, DHOTE VIPIN, KSHIRSAGAR SAMADHAN, BAHEKAR RAJESH, JAIN MUKUL: "Exendin-4 ameliorates diabetic symptoms through activation of glucokinase : Exendin-4 activates glucokinase", JOURNAL OF DIABETES, vol. 4, no. 4, 1 December 2012 (2012-12-01), pages 369 - 377, XP055812327, ISSN: 1753-0393, DOI: 10.1111/j.1753-0407.2012.00193.x *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4190338A4 (en) * 2020-07-29 2024-03-27 Brexogen Inc COMPOSITION WITH STEM CELL EXOSOME AND METHOD FOR PRODUCING THEREOF

Also Published As

Publication number Publication date
US20220387509A1 (en) 2022-12-08
JP2023501510A (ja) 2023-01-18

Similar Documents

Publication Publication Date Title
US20220333083A1 (en) Compositions and methods of preparing airway cells
El Omar et al. Umbilical cord mesenchymal stem cells: the new gold standard for mesenchymal stem cell-based therapies?
WO2011049414A2 (ko) 지방조직 유래 성체 줄기세포 이동을 유도하는 방법
WO2011096728A2 (en) Method for proliferating stem cells by activating c-met/hgf signaling and notch signaling
WO2014181954A1 (ko) 줄기세포의 재생능 향상을 위한 배지 조성물 및 이를 이용한 줄기세포의 배양방법
WO2018117573A1 (ko) 신경능선줄기세포의 다층세포시트 및 이의 제조방법
WO2019198995A1 (ko) 엑소좀 기반의 면역세포의 교차분화 방법
WO2021096220A1 (ko) 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 유래된 엑소좀을 포함하는 신장 질환의 예방 또는 치료용 조성물
WO2021033990A1 (ko) 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 유래된 엑소좀을 포함하는 비알콜성 지방간염의 예방 또는 치료용 조성물
WO2012047037A2 (ko) 배아줄기세포 유래 심근세포 및 이를 유효성분으로 포함하는 세포치료제
KR20210024417A (ko) 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 유래된 엑소좀을 포함하는 비알콜성 지방간염의 예방 또는 치료용 조성물
WO2011102680A9 (ko) Pi3k/akt/gsk3 경로를 통해 성체줄기세포의 증식, 다분화능 및 재프로그래밍을 촉진하는 cd49f
WO2018026212A2 (ko) 섬유증 질환 모델의 제조방법 및 섬유증 질환 모델의 용도
WO2020004893A1 (ko) 인간 유도 만능 줄기세포로부터 연골세포의 펠렛을 제조하는 방법 및 이의 용도
WO2020209636A1 (ko) 소변세포로부터 신장전구세포로의 직접 역분화를 유도하는 방법 및 이의 방법으로 역분화된 신장전구세포를 포함하는 신장세포 손상 질환 예방 또는 치료용 약학 조성물
EP2714896A1 (en) An adult stem cell line introduced with hepatocyte growth factor gene and neurogenic transcription factor gene with basic helix-loop-helix motif and uses thereof
WO2021006670A1 (ko) 혼합물 4f를 이용한 줄기세포 생물학적 활성 증가용 조성물
WO2020122498A1 (ko) 클로날 줄기세포를 포함하는 췌장염 치료용 약학적 조성물
WO2020122666A1 (ko) 중간엽줄기세포가 포함된 생체 이식용 임플란트를 포함하는 간 질환의 예방 또는 치료용 약학적 조성물
WO2021107234A1 (ko) Hiv 감염 치료 또는 예방을 위한 ccr5/cxcr4 유전자 동시 넉아웃 환자맞춤형 조혈모세포 및 이의 제조방법
EP4079313A1 (en) Composition for preventing or treating renal diseases, comprising exosomes derived from precursor cells of induced pluripotent stem cell-derived mesenchymal stem cells
WO2022235085A1 (ko) 3차원 스페로이드형 세포 응집체 유래 세포외소포를 포함하는 혈관신생촉진용 조성물
WO2021125841A1 (ko) 염기성 나선-고리-나선(basic helix-loop-helix; bhlh) 계열의 신경형성 전사인자 유전자가 도입된 성체 줄기세포주를 포함하는 동맥 투여용 약학적 조성물
WO2019078587A1 (ko) 닭 골수 유래 골·연골전구세포 배양액을 유효성분으로 포함하는 골 생성 촉진 또는 연골 분화 유도용 조성물
WO2024014721A1 (ko) 줄기세포 유래 엑소좀을 포함하는 항암 조성물 및 이의 제조방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20888516

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022527079

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020888516

Country of ref document: EP

Effective date: 20220613