WO2021035120A1 - Adeno-associated virus vector delivery of alpha-sarcoglycan and the treatment of muscular dystrophy - Google Patents

Adeno-associated virus vector delivery of alpha-sarcoglycan and the treatment of muscular dystrophy Download PDF

Info

Publication number
WO2021035120A1
WO2021035120A1 PCT/US2020/047339 US2020047339W WO2021035120A1 WO 2021035120 A1 WO2021035120 A1 WO 2021035120A1 US 2020047339 W US2020047339 W US 2020047339W WO 2021035120 A1 WO2021035120 A1 WO 2021035120A1
Authority
WO
WIPO (PCT)
Prior art keywords
raav
subject
composition
alpha
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2020/047339
Other languages
English (en)
French (fr)
Inventor
Louise RODINO-KLAPAC
Danielle GRIFFIN
Jerry R. Mendell
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nationwide Childrens Hospital Inc
Original Assignee
Nationwide Childrens Hospital Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=72340432&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2021035120(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to PL20765424.5T priority Critical patent/PL4017871T3/pl
Priority to CN202510544897.2A priority patent/CN120400170A/zh
Priority to HRP20240505TT priority patent/HRP20240505T1/hr
Priority to MYPI2022000917A priority patent/MY210230A/en
Priority to CA3150964A priority patent/CA3150964A1/en
Priority to EP24212789.2A priority patent/EP4488287A3/en
Priority to AU2020331987A priority patent/AU2020331987B2/en
Priority to LTEPPCT/US2020/047339T priority patent/LT4017871T/lt
Priority to BR112022003142A priority patent/BR112022003142A2/pt
Priority to ES20765424T priority patent/ES2978666T3/es
Priority to FIEP20765424.5T priority patent/FI4017871T3/fi
Priority to RS20240449A priority patent/RS65421B1/sr
Priority to MX2022002132A priority patent/MX2022002132A/es
Priority to DK20765424.5T priority patent/DK4017871T5/da
Priority to SM20240152T priority patent/SMT202400152T1/it
Priority to EP24152241.6A priority patent/EP4374880A3/en
Priority to JP2022510976A priority patent/JP7532503B2/ja
Application filed by Nationwide Childrens Hospital Inc filed Critical Nationwide Childrens Hospital Inc
Priority to US17/635,978 priority patent/US12258573B2/en
Priority to EP20765424.5A priority patent/EP4017871B1/en
Priority to CN202080073755.8A priority patent/CN114945583B/zh
Priority to SI202030411T priority patent/SI4017871T1/sl
Priority to KR1020227007040A priority patent/KR20220092489A/ko
Publication of WO2021035120A1 publication Critical patent/WO2021035120A1/en
Priority to IL290734A priority patent/IL290734A/en
Anticipated expiration legal-status Critical
Priority to CONC2022/0002864A priority patent/CO2022002864A2/es
Priority to JP2024124753A priority patent/JP2024156816A/ja
Priority to US18/991,087 priority patent/US20250122531A1/en
Priority to IL323311A priority patent/IL323311A/en
Priority to JP2026005785A priority patent/JP2026065148A/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0075Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/04Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4716Muscle proteins, e.g. myosin, actin
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/008Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination

Definitions

  • INCORPORATION BY REFERENCE OF THE SEQUENCE LISTING [0003] This application contains, as a separate part of disclosure, a Sequence Listing in computer- readable form (filename: 54652_SeqListing.txt; 18,768 byte – ASCII text file; created August 17, 2020) which is incorporated by reference herein in its entirety.
  • BACKGROUND Muscular dystrophies (MDs) are a group of genetic diseases.
  • LGMD limb girdle muscular dystrophies
  • LGMDs cause weakness in the shoulder and pelvic girdle, with nearby muscles in the upper legs and arms sometimes also weakening with time. Weakness of the legs often appears before that of the arms. Facial muscles are usually unaffected. As the condition progresses, people can have problems with walking and may need to use a wheelchair over time. The involvement of shoulder and arm muscles can lead to difficulty in raising arms over head and in lifting objects. In some types of LGMD, the heart and breathing muscles may be involved. [0006] Specialized tests for LGMD are now available through a national scheme for diagnosis, the National Commissioning Group (NCG).
  • NCG National Commissioning Group
  • LGMD subtype 2D is an autosomal recessive disorder caused by mutations in the alpha-sarcoglycan gene (SGCA; a-sarcoglycan), leading to complete or reduced loss of functional protein with loss of other structural components of the dystrophin-associated protein complex.
  • SGCA alpha-sarcoglycan gene
  • loss of the alpha-sarcoglycan protein leads to a progressive muscular dystrophy with deteriorating muscle function, with an onset from 3 to 8 years of age.
  • Symptoms include: delayed ambulation, weakness in proximal muscles caused by fat replacement and fibrosis, elevated creatine kinase, scoliosis, and joint contractures.
  • Described herein are methods for treating muscular dystrophy in a subject in need thereof comprising the step of administering a recombinant adeno-associated virus (rAAV) AAVrh74.tMCK.hSCGA, wherein the rAAV is administered using a systemic route of administration and at a dose of about 1.0 x 10 12 vg/kg to about 5.0 x 10 15 vg/kg based on a supercoiled DNA or plasmid as the quantitation standard.
  • rAAV recombinant adeno-associated virus
  • the disclosure relates to an rAAV expressing the alpha-sarcoglycan gene and methods of delivering alpha-sarcoglycan to the muscle to reduce and/or prevent fibrosis; and/or to increase muscular force, and/or to treat a a-sarcoglycanopathy in a subject suffering from muscular dystrophy.
  • rAAV recombinant AAV
  • described herein is a recombinant AAV (rAAV) comprising a polynucleotide sequence encoding alpha-sarcoglycan protein.
  • the polynucleotide sequence comprises a sequence at least 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% identical to the nucleotide sequence set forth in SEQ ID NO: 1 and encodes a protein that retains alpha-sarcoglycan activity.
  • the polynucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO: 1.
  • the polynucleotide encodes a protein that is at least 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% identical to the nucleotide sequence set forth in SEQ ID NO: 2.
  • the polynucleotide encodes a protein that comprises an amino acid sequence set forth in SEQ ID NO: 2.
  • the rAAV comprises a nucleotide sequence comprising a tMCK promoter.
  • the tMCK promoter comprises a nucleotide sequence set forth in SEQ ID NO: 3.
  • the rAAV comprises a 5’ inverted terminal repeat sequence of SEQ ID NO: 5 and/or a 3’ inverted terminal repeat sequence of SEQ ID NO: 6.
  • the rAAV comprises a poly A sequence of SEQ ID NO: 7.
  • the disclosed rAAV is of the serotype AAVrh.74.
  • the polynucleotide comprises a nucleotide sequence that is at least 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% identical to SEQ ID NO: 4.
  • the polynucleotide comprises a nucleotide sequence set forth in SEQ ID NO: 4.
  • the disclosure provides for methods of treating muscular dystrophy in a subject in need thereof comprising the step of administering any of the rAAV disclosed herein, wherein the rAAV is administered by a systemic route.
  • the rAAV is AAVrh74.tMCK.hSCGA, wherein the rAAV is administered using a systemic route of administration.
  • the rAAV is administered at a dose of about 1.0 x 10 12 vg/kg to about 5.0 x 10 15 vg/kg based on a supercoiled DNA or plasmid as the quantitation standard.
  • the rAAV is administered at a dose of about 1.0 x 10 12 vg/kg to about 2.0 x 10 15 vg/kg, about 5 x 10 12 vg/kg to about 1.0 x 10 15 vg/kg, about 1.0 x 10 13 vg/kg to about 5.0 x 10 14 vg/kg, about 2.0 x 10 13 vg/kg to about 3.0 x 10 14 vg/kg, or about 5x10 13 vg/kg to about 2x10 14 vg/kg, or the rAAV is administered at a dose of about 5x10 13 vg/kg, about 6x10 13 vg/kg, about 7x10 13 vg/kg, about 8x10 13 vg/kg, about 9x10 13 vg/kg, about 1x10 14 vg/kg, about 2x10 14 vg/kg, about 3x10 14 vg/kg, about 4x10 14 vg/kg or about 5x10
  • the rAAV is administered at a dose about 1.85 x 10 13 vg/kg or 7.41 x 10 13 vg/kg based on a linearized DNA or plasmid as the quantitation standard.
  • the rAAV is administered at a dose of about 1.0 x 10 13 vg/kg to about 8.0 x 10 13 vg/kg, about 1.5 x 10 13 vg/kg to about 8.0 x 10 13 vg/kg, about 1.6 x 10 13 vg/kg to about 8.0 x 10 13 vg/kg.
  • the systemic route of administration is an intravenous route.
  • the rAAV is administered by injection, infusion or implantation.
  • the rAAV is administered by an intravenous route through a peripheral limb vein.
  • the muscular dystrophy is limb-girdle muscular dystrophy.
  • the muscular dystrophy is limb-girdle muscular dystrophy type 2D (LGMD2D).
  • the methods of treating muscular dystrophy comprise administering the rAAV to a subject is suffering from limb-girdle muscular dystrophy, and the rAAV is administered by intravenous infusion at a dose of about 5x10 13 vg/kg to about 2x10 14 vg/kg based on a supercoiled DNA or plasmid as the quantitation standard, and wherein the rAAV comprises the scAAVrh74.tMCK.hSGCA construct nucleotide sequence of SEQ ID NO: 4.
  • the disclosure provides for methods of treating muscular dystrophy in a subject in need thereof, the method comprising the step of administering a rAAV to the subject wherein the subject is suffering from limb-girdle muscular dystrophy, and the rAAV is administered by intravenous infusion at a dose of about 5x10 13 vg/kg to about 2x10 14 vg/kg based on a supercoiled DNA or plasmid as the quantitation standard, and wherein the rAAV comprises the scAAVrh74.tMCK.hSGCA construct nucleotide sequence of SEQ ID NO: 4.
  • the level of alpha-sarcoglycan gene expression in a cell of the subject is increased after administration of the rAAV as compared to the level of alpha-sarcoglycan gene expression before administration of the rAAV.
  • the level of alpha-sarcoglycan gene expression in a cell of the subject is increased after administration of the rAAV as compared to the level of alpha- sarcoglycan gene expression before administration of the rAAV; and/or wherein the serum CK level in the subject is decreased after administration of the rAAV as compared to serum CK level before administration of the rAAV; and/or wherein the locomotor activity and specific-force generation are increased; wherein fibrosis is reduced; wherein the resistance to contraction-induced injury in tibialis anterior muscle is increased; and/or wherein the number of alpha-sarcoglycan positive fibers in the muscle tissue of the subject is increased after administration of the rAAV as compared to the number of alpha-sarcoglycan positive fibers before administration of the rAAV; or wherein fibrosis is reduced in the subject after administration of the rAAV as compared to before administration of the rAAV;
  • the alpha-sarcoglycan gene expression is detected by measuring the alpha-sarcoglycan protein level by Western blot, and/or immunohistochemistry.
  • the disclosure provides for methods of expressing alpha-sarcoglycan gene in a cell comprising administering to a subject any of the disclosed rAAV.
  • the disclosure provides for method of expressing alpha-sarcoglycan gene in a cell comprising administering to a subject the scAAVrh74.tMCK.hSGCA construct nucleotide sequence of SEQ ID NO: 4.
  • the expression of the alpha-sarcoglycan gene in the cell of the subject is detected by measuring the alpha-sarcoglycan protein level on a Western blot in muscle biopsies.
  • the expression of the alpha-sarcoglycan gene in the cell is detected by measuring the alpha-sarcoglycan protein level by immunohistochemistry in muscle biopsies.
  • the expression of the alpha-sarcoglycan gene is measured in the subject by detecting the number of vector genome per microgram of genomic DNA.
  • the disclosure provides for methods of decreasing serum CK level in a subject in need thereof, the method comprising administering to the subject any of the disclosed rAAV.
  • the disclosure provides for methods of decreasing a serum CK level in a subject in need thereof, the method comprising administering to the subject the scAAVrh74.tMCK.hSGCA construct nucleotide sequence of SEQ ID NO: 4.
  • the disclosure provide for methods of increasing alpha-sarcoglycan positive fibers in a muscle tissue of a subject comprising administering to the subject any of the disclosed rAAV.
  • the disclosure provides for method of increasing alpha-sarcoglycan positive fibers in a muscle tissue of a subject in a need thereof, the method comprising administering to the subject the scAAVrh74.tMCK.hSGCA construct nucleotide sequence of SEQ ID NO: 4.
  • the disclosure also provides for methods of increasing the expression of alpha- sarcoglycan in a subject in need thereof comprising administering to the subject any of the disclosed rAAV.
  • the disclosure provides for methods of increasing the expression of alpha- sarcoglycan in a subject in need thereof, the method comprising administering to the subject the scAAVrh74.tMCK.hSGCA construct nucleotide sequence of SEQ ID NO: 4.
  • the expression of the alpha-sarcoglycan gene in the cell of the subject is detected by measuring the alpha-sarcoglycan protein level on a Western blot in muscle biopsies.
  • the expression of the alpha-sarcoglycan gene in the cell is detected by measuring the alpha-sarcoglycan protein level by immunohistochemistry in muscle biopsies.
  • the expression of the alpha-sarcoglycan gene is measured in the subject by detecting the number of vector genome per microgram of genomic DNA.
  • the disclosure provides for compositions for treating muscular dystrophy in a subject in need thereof, wherein the composition comprises any of the rAAV disclosed herein, wherein the composition is formulated for administration by a systemic route.
  • the rAAV is AAVrh74.tMCK.hSCGA.
  • Any of the disclosed compositions comprise rAAV at a dose of about 1.0 x 1012 vg/kg to about 5.0 x 10 15 vg/kg based on a supercoiled DNA or plasmid as the quantitation standard.
  • the rAAV is at a dose of about 1.0 x 10 12 vg/kg to about 2.0 x 10 15 vg/kg, about 5 x 10 12 vg/kg to about 1.0 x 10 15 vg/kg, about 1.0 x 10 13 vg/kg to about 5.0 x 10 14 vg/kg, about 2.0 x 10 13 vg/kg to about 3.0 x 10 14 vg/kg, or about 5x10 13 vg/kg to about 2x10 14 vg/kg, or the rAAV is at a dose of about 5x10 13 vg/kg, about 6x10 13 vg/kg, about 7x10 13 vg/kg, about 8x10 13 vg/kg, about 9x10 13 vg/kg, about 1x10 14 vg/kg, about 2x10 14 vg/kg, about 3x10 14 vg/kg, about 4x10 14 vg/kg or about 5x10 14 vg
  • the rAAV is administered at a dose about 1.85 x 10 13 vg/kg or about 7.41 x 10 13 vg/kg based on a linearized DNA or plasmid as the quantitation standard.
  • the rAAV is administered at a dose of about 1.0 x 10 13 vg/kg to about 8.0 x 10 13 vg/kg, about 1.5 x 10 13 vg/kg to about 8.0 x 10 13 vg/kg, about 1.6 x 10 13 vg/kg to about 8.0 x 10 13 vg/kg.
  • any of the disclosed compositions are formulated for administration by an intravenous route, such as compositions formulated for administration by injection, infusion or implantation.
  • the disclosed compositions are formulated for administration by an intravenous route through a peripheral limb vein.
  • Any of the disclosed compositions are for the treatment for limb-girdle muscular dystrophy, such as limb-girdle muscular dystrophy type 2D (LGMD2D).
  • the disclosure provides for compositions for treating a subject suffering from limb-girdle muscular dystrophy, wherein the composition comprises a dose of rAAV at about 5x10 13 vg/kg to about 2x10 14 vg/kg based on a supercoiled DNA or plasmid as the quantitation standard, and wherein the composition is formulated for administration by intravenous infusion, and wherein the rAAV comprises the scAAVrh74.tMCK.hSGCA construct nucleotide sequence of SEQ ID NO: 4.
  • compositions for treating limb-girdle muscular dystrophy in a subject in need thereof comprising a dose of rAAV of about 5x10 13 vg/kg to about 2x10 14 vg/kg based on a supercoiled DNA or plasmid as the quantitation standard, and the composition is formulated for administration by intravenous infusion and wherein the rAAV comprises the scAAVrh74.tMCK.hSGCA construct nucleotide sequence of SEQ ID NO: 4.
  • administration of the composition increases the level of alpha-sarcoglycan gene expression in a cell of the subject as compared to the level of alpha-sarcoglycan gene expression before administration of the composition.
  • administration of any of the disclosed compositions increases the level of alpha-sarcoglycan gene expression in a cell of the subject as compared to the level of alpha- sarcoglycan gene expression before administration of the composition; and/or wherein administration of the disclosed composition decreased the serum CK level in the subject as compared to serum CK level before administration of the composition; and/or wherein the locomotor activity and specific-force generation are increased; wherein fibrosis is reduced; wherein the resistance to contraction-induced injury in tibialis anterior muscle is increased; and/or wherein administration of the composition increases the number of alpha-sarcoglycan positive fibers in the muscle tissue of the subject as compared to the number of alpha-sarcoglycan positive fibers before administration of the composition; and/or
  • the alpha-sarcoglycan gene expression is detected by measuring the alpha-sarcoglycan protein level by Western blot, and/or immunohistochemistry.
  • the disclosure provides for compositions for expressing alpha- sarcoglycan gene in a cell, wherein composition comprises any of the disclosed rAAV.
  • the disclosure provides compositions for expressing alpha-sarcoglycan gene in a cell comprising the scAAVrh74.tMCK.hSGCA construct nucleotide sequence of SEQ ID NO: 4.
  • the expression of the alpha-sarcoglycan gene in the cell of the subject is detected by measuring the alpha-sarcoglycan protein level on a Western blot in muscle biopsies.
  • the expression of the alpha-sarcoglycan gene in the cell is detected by measuring the alpha-sarcoglycan protein level by immunohistochemistry in muscle biopsies.
  • the expression of the alpha-sarcoglycan gene is measured in the subject by detecting the number of vector genome per microgram of genomic DNA.
  • the disclosure provides for compositions for decreasing a serum CK level in a subject in need thereof, the composition comprises the scAAVrh74.tMCK.hSGCA construct nucleotide sequence of SEQ ID NO: 4.
  • the disclosure provides for composition for increasing alpha-sarcoglycan positive fibers in a muscle tissue of a subject, wherein the composition comprises any of the disclosed rAAV.
  • the disclosure provides for compositions for increasing alpha-sarcoglycan positive fibers in a muscle tissue of a subject, wherein the composition comprises the scAAVrh74.tMCK.hSGCA construct nucleotide sequence of SEQ ID NO: 4.
  • the disclosure also provides for composition for increasing the expression of alpha- sarcoglycan in a subject in need thereof, wherein the composition comprises any of the disclosed rAAV.
  • the disclosure provides compositions for increasing the expression of alpha- sarcoglycan in a subject in need thereof, wherein the composition comprises the scAAVrh74.tMCK.hSGCA construct nucleotide sequence of SEQ ID NO: 4.
  • the expression of the alpha-sarcoglycan gene in the cell of the subject is detected by measuring the alpha-sarcoglycan protein level on a Western blot in muscle biopsies.
  • the expression of the alpha-sarcoglycan gene in the cell is detected by measuring the alpha-sarcoglycan protein level by immunohistochemistry in muscle biopsies.
  • the expression of the alpha-sarcoglycan gene is measured in the subject by detecting the number of vector genome per microgram of genomic DNA.
  • the disclosure provides for use of AAVrh74.tMCK.hSCGA for the preparation of a medicament for treating muscular dystrophy, wherein the medicament is formulated for administration by a systemic route of administration.
  • the medicament comprises rAAV at a dose of about 1.0 x 1012 vg/kg to about 5.0 x 10 15 vg/kg based on a supercoiled DNA or plasmid as the quantitation standard.
  • the rAAV is at a dose of about 1.0 x 10 12 vg/kg to about 2.0 x 10 15 vg/kg, about 5 x 10 12 vg/kg to about 1.0 x 10 15 vg/kg, about 1.0 x 10 13 vg/kg to about 5.0 x 10 14 vg/kg, about 2.0 x 10 13 vg/kg to about 3.0 x 10 14 vg/kg, or about 5x10 13 vg/kg to about 2x10 14 vg/kg, or the rAAV is at a dose of about 5x10 13 vg/kg, about 6x10 13 vg/kg, about 7x10 13 vg/kg, about 8x10 13 vg/kg, about 9x10 13 vg/kg, about 1x10 14 vg/kg, about 2x10 14 vg/kg, about 3x10 14 vg/kg, about 4x10 14 vg/kg or about 5x10 14 vg
  • the medicament comprises rAAV at a dose about 1.85 x 10 13 vg/kg or 7.41 x 10 13 vg/kg based on a linearized DNA or plasmid as the quantitation standard.
  • the medicament comprises rAAV at a dose of about 1.0 x 10 13 vg/kg to about 8.0 x 10 13 vg/kg, about 1.5 x 10 13 vg/kg to about 8.0 x 10 13 vg/kg, about 1.6 x 10 13 vg/kg to about 8.0 x 10 13 vg/kg.
  • the medicament is formulated for administration by an intravenous route.
  • the medicament is formulated for administration by injection, infusion or implantation.
  • the medicament is formulated for administration by an intravenous route through a peripheral limb vein.
  • the medicament is for the treatment of limb-girdle muscular dystrophy, such as limb-girdle muscular dystrophy type 2D (LGMD2D).
  • the disclosure provides for use of a rAAV for the preparation of a medicament for treating limb-girdle muscular dystrophy, wherein the medicament is formulated for administration by intravenous infusion and the rAAV is at a dose of about 5x10 13 vg/kg to about 2x10 14 vg/kg based on a supercoiled DNA or plasmid as the quantitation standard.
  • the rAAV comprises the scAAVrh74.tMCK.hSGCA construct nucleotide sequence of SEQ ID NO: 4.
  • administration of the medicament to a subject in need results in an increase in alpha- sarcoglycan gene expression in a cell of the subject as compared to the level of alpha-sarcoglycan gene expression before administration of the rAAV.
  • administration of the medicament to a subject in need results in an increase in the level of alpha-sarcoglycan gene expression in a cell of the subject as compared to the level of alpha-sarcoglycan gene expression before administration of the medicament; and/or administration of the medicament to a subject results in decrease in the the serum CK level in the subject as compared to serum CK level before administration of the medicament; and/or wherein the locomotor activity and specific-force generation are increased; wherein fibrosis is reduced; wherein the resistance to contraction-induced injury in tibialis anterior muscle is increased; and/or administration of the medicament to the subject results in an increase in the number of alpha- sarcoglycan positive fibers in the muscle tissue of the subject is increased as compared to the number of alpha-sarcoglycan positive fibers before administration of the medicament, and/or administration of the medicament to the subject in need results in reduced fibrosis in the subject as compared to before administration of the medicament; and/or
  • the alpha- sarcoglycan gene expression is detected by measuring the alpha-sarcoglycan protein level by Western blot, and/or immunohistochemistry.
  • the disclosure provides for use of any of the disclosed rAAV for the preparation of a medicament for expressing alpha-sarcoglycan gene in a cell in a subject in need.
  • the disclosure provides for use of scAAVrh74.tMCK.hSGCA construct for the preparation of a medicament for expressing alpha-sarcoglycan gene in a cell in a subject in need, wherien the scAAVrh74.tMCK.hSGCA construct comprises a nucleotide sequence of SEQ ID NO: 4.
  • the expression of the alpha-sarcoglycan gene in the cell of the subject is detected by measuring the alpha-sarcoglycan protein level on a Western blot in muscle biopsies.
  • the expression of the alpha-sarcoglycan gene in the cell is detected by measuring the alpha-sarcoglycan protein level by immunohistochemistry in muscle biopsies.
  • the expression of the alpha-sarcoglycan gene is measured in the subject by detecting the number of vector genome per microgram of genomic DNA.
  • the disclosure provides for use of scAAVrh74.tMCK.hSGCA construct for the preparation of a medicament for decreasing a serum CK level in a subject in need thereof, wherein scAAVrh74.tMCK.hSGCA construct comprises the nucleotide sequence of SEQ ID NO: 4.
  • the disclosure provides for use of any of the disclosed rAAV for the preparation of a medicament for increasing alpha-sarcoglycan positive fibers in a muscle tissue of a subject.
  • the disclosure provides for use of scAAVrh74.tMCK.hSGCA construct for the preparation of a medicament for increasing alpha-sarcoglycan positive fibers in a muscle tissue of a subject, wherein scAAVrh74.tMCK.hSGCA construct comprises the nucleotide sequence of SEQ ID NO: 4.
  • the disclosure also provides for use any of the disclosed rAAV for the preparation of a medicament for increasing the expression of alpha-sarcoglycan in a subject in need thereof.
  • the disclosure provides for use of scAAVrh74.tMCK.hSGCA construct for the preparation of a medicament for increasing the expression of alpha-sarcoglycan in a subject in need thereof, wherein the scAAVrh74.tMCK.hSGCA construct comprises the nucleotide sequence of SEQ ID NO: 4.
  • the expression of the alpha-sarcoglycan gene in the cell of the subject is detected by measuring the alpha-sarcoglycan protein level on a Western blot in muscle biopsies.
  • expression of the alpha-sarcoglycan gene in the cell is detected by measuring the alpha-sarcoglycan protein level by immunohistochemistry in muscle biopsies. In other embodiments, the expression of the alpha-sarcoglycan gene is measured in the subject by detecting the number of vector genome per microgram of genomic DNA.
  • the subject is a human subject that is 4 to 15 years of age, or a human subject that is 25 to 55 years of age or a human subject that is over 50 years of age.
  • the subject is a pediatric subject, an adolescent subject or a young adult subject.
  • the subject is a middle aged adult or elderly subject.
  • the subject is a human subject that is 4-15 years of age, has a confirmed alpha-sarcoglycan (SGCA) mutation in both alleles, was negative for AAVrh74 antibodies and/or had >40% or normal 100 meter walk test.
  • SGCA alpha-sarcoglycan
  • the disclosure provides for methods of generating a rAAV administered in a method of any of the disclosed methods, compositions or uses, the method comprising transferring an AAV vector plasmid to a host cell, wherein the AAV vector plasmid comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 8.
  • the AAV vector plasmid comprises a nucleotide sequence of SEQ ID NO: 8.
  • the vector plasmid comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 1, 4, or 8, or the vector plasmid comprises a nucleotide sequence of SEQ ID NO: 1, 4, or 8.
  • the method further comprises transferring a packaging plasmid and/or a helper virus to the host cell.
  • a packaging cell comprises a stably integrated AAV cap gene and/or comprises a packaging cell comprises a stably integrated AAV rep gene.
  • the disclosure provides for host cells comprising an AAV vector plasmid that comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 1, 4, or 8.
  • the host cell comprises an AAV vector plasmid that comprises a nucleotide sequence of SEQ ID NO: 1, 4, or 8.
  • Figure 1 shows the scAAVrh74.tMCK.hSGCA gene cassette.
  • FIG. 2 shows transgene expression in a dose-escalation study after systemic treatment with scAAVrh74.tMCK.hSGCA.
  • Muscle fibers expressing the alpha-sarcoglycan 12 weeks post-treatment ranged from 70%-93% compared to untreated controls.
  • FIG. 1 Western blots of muscles from treated sgca -/- mice confirm hSGCA protein expression.
  • Figure 3 shows improvement in muscle morphology by scAAVrh74.tMCK.hSGCA independent of dose in sgca-/-mice.
  • (B) Quantification confirming myofiber diameter normalization of various muscles in treated groups compared to vehicle-treated mice and wild-type controls (n 6 per group).
  • Figure 4 shows reduction fibrosis in sgca-/- mice treated with scAAVrh74.tMCK.hSGCA.
  • TA tibialis anterior
  • B Diaphragm muscle strips were harvested to measure specific force. Following 12 weeks of treatment, the force was significantly increased in treated mice compared to untreated sgca -/- mice.
  • FIG. 7A shows biodistribution analysis of systemic scAAVrh74.tMCK.hSGCA delivery— distribution histogram of mean vg copies of transcript per microgram DNA added to quantitative polymerase chain reaction in various tissues from sgca -/- mice after intravenous delivery of scAAVrh74.tMCK.hSGCA at 3x10 12 vg and 6x10 12 vg (or 1x10 14 vg/kg, and 2x10 14 vg/kg, respectively, based on a 20-g mouse).
  • Figure 7B shows Western blots of alpha-sarcoglycan protein expression in the liver of WT and sgca -/- mice treated with either vehicle (sgca -/- LR (lactate ringer)) or scAArh74.tMCK.hSGCA at 1.0 x10 12 vg (Left Western blot) or 6 x 10 12 vg (Right Western blot).
  • Each lane represents an independent mouse (M1: Mouse 1; M2: Mouse 2; M3: Mouse 3).
  • Bottom panel represents vinculin that was used as loading control.
  • Figure 8 shows expression of scAAVrh74.tMCK.hSGCA in skeletal muscle of 12-month- old sgca -/- mice by immunofluorescence staining (Fig.8A) and western blot (Fig.8B).
  • the graph in Figure 8C provides the percent positive muscle fibers in the scAAVrh74.tMCK.hSGCA sgca -/- mice.
  • FIG. 9 shows histological results of administering scAAVrh74.tMCK.hSGCA in 12- month-old SGCA -/- mice.
  • Figure 9a shows improved muscle pathology.
  • Figure 9b shows reduction in central nucleation and increase in average fiber size in gastrocnemius (GAS) and triceps (TRI) muscles.
  • Figure 9c shows a reduction in levels of fibrosis compared to untreated controls.
  • Figure 10 shows functional improvement in aged mouse after administering scAAVrh74.tMCK.hSGCA.
  • the present disclosure is based on the discovery that administration of an rAAV comprising a polynucleotide expressing alpha-sarcoglycan results in a reduction or complete reversal of muscle fibrosis in a limb-girdle muscular dystrophy animal model.
  • administration of the rAAV described herein resulted in the reversal of dystrophic features including reduced CK levels, increased muscle force, improved ambulation and vertical activity, and other motor functions.
  • the practice of the present invention will employ, unless otherwise indicated, conventional methods of virology, microbiology, molecular biology and recombinant DNA techniques within the skill of the art.
  • a cell includes a plurality of such cells and reference to “the culture” includes reference to one or more cultures and equivalents thereof known to those skilled in the art, and so forth.
  • Reference to “a recombinant AAV” includes a mixture of two or more rAAV virions, and the like. All technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs unless clearly indicated otherwise.
  • vector or “expression vector” is meant to be any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, virus, virion, etc., which is capable of replication when associated with the proper control elements and which can transfer gene sequences between cells.
  • the vector is a viral vector.
  • Expression vectors can contain a variety of control sequences, structural genes (e.g., genes of interest), and nucleic acid sequences that serve other functions as well.
  • AAV is a standard abbreviation for adeno-associated virus.
  • Adeno-associated virus is a single-stranded DNA parvovirus that grows only in cells in which certain functions are provided by a co-infecting helper virus. There are currently thirteen serotypes of AAV that have been characterized.
  • AAV vector refers to a vector comprising one or more polynucleotides of interest (or transgenes) that are flanked by AAV terminal repeat sequences (ITRs).
  • Such AAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been transfected with a vector encoding and expressing rep and cap gene products.
  • the AAV vector is a vector derived from an adeno-associated virus serotype, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV rh10, and AAV rh74.
  • AAV vectors can have one or more of the AAV wild-type genes deleted in whole or part, preferably the rep and/or cap genes, but retain functional flanking ITR sequences.
  • an AAV vector is defined herein to include at least those sequences required in cis for replication and packaging (e.g., functional ITRs) of the virus.
  • the ITRs need not be the wild-type nucleotide sequences, and may be altered, e.g., by the insertion, deletion or substitution of nucleotides, so long as the sequences provide for functional rescue, replication and packaging.
  • AAV helper functions refer to AAV-derived coding sequences that can be expressed to provide AAV gene products that, in turn, function in trans for productive AAV replication.
  • AAV helper functions comprise the major AAV open reading frames (ORFs), reps and cap.
  • the Rep expression products have been shown to possess many functions, including, among others: recognition, binding and nicking of the AAV origin of DNA replication; DNA helicase activity; and modulation of transcription from AAV (or other heterologous) promoters.
  • the Cap expression products supply necessary packaging functions.
  • AAV helper functions are used herein to complement AAV functions in trans that are missing from AAV vectors.
  • recombinant virus is meant a virus that has been genetically altered, e.g., by the addition or insertion of a heterologous nucleic acid sequence into the viral particle.
  • AAV virion refers to a viral particle composed of at least one AAV capsid protein and an encapsidated polynucleotide AAV vector.
  • the AAV virion in one embodiment, comprises a heterologous polynucleotide (i.e. a polynucleotide other than a wild-type AAV genome such as a transgene to be delivered to a mammalian cell).
  • Production of AAV viral particles in some embodiment, includes production of AAV vector, as such a vector is contained within an AAV vector particle. If the particle comprises a heterologous polynucleotide (i.e.
  • rAAV vector a polynucleotide other than a wild-type AAV genome such as a transgene to be delivered to a mammalian cell
  • production of AAV vector particle necessarily includes production of rAAV, as such a rAAV genome is contained within an rAAV vector particle.
  • wt wild-type AAV virus particle comprising a linear, single-stranded AAV nucleic acid genome associated with an AAV capsid protein coat.
  • the AAV virion can be either a single-stranded (ss) AAV or self-complementary (SC) AAV.
  • a single-stranded AAV nucleic acid molecules of either complementary sense, e.g., “sense” or “antisense” strands can be packaged into a AAV virion and both strands are equally infectious.
  • the term “recombinant AAV,” or “rAAV” is defined herein as an infectious, replication- defective virus composed of an AAV protein shell, encapsidating a heterologous nucleotide sequence of interest which is flanked on both sides by AAV ITRs.
  • a rAAV in one embodiment, is produced in a suitable host cell which has an AAV vector, AAV helper functions and accessory functions introduced therein.
  • the host cell is capable of encoding AAV polypeptides that are required for packaging the AAV vector (containing a recombinant nucleotide sequence of interest) into infectious recombinant virion particles for subsequent gene delivery.
  • transfection refers to the uptake of foreign DNA by a cell, and a cell has been “transfected” when exogenous DNA has been introduced inside the cell membrane.
  • transfection techniques are generally known in the art. See, e.g., Graham et al. (1973) Virology, 52:456, Sambrook et al. (1989) Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York, Davis et al.
  • transduction denotes the delivery of a DNA molecule to a recipient cell either in vivo or in vitro, via a replication-defective viral vector, such as via a recombinant AAV virion.
  • host cell denotes, for example, microorganisms, yeast cells, insect.
  • a “host cell” as used herein generally refers to a cell which has been transfected with an exogenous DNA sequence. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement as the original parent, due to natural, accidental, or deliberate mutation.
  • heterologous as it relates to nucleic acid sequences such as coding sequences and control sequences, denotes sequences that are not normally joined together, and/or are not normally associated with a particular cell.
  • a “heterologous” region of a nucleic acid construct or a vector is a segment of nucleic acid within or attached to another nucleic acid molecule that is not found in association with the other molecule in nature.
  • a heterologous region of a nucleic acid construct could include a coding sequence flanked by sequences not found in association with the coding sequence in nature.
  • heterologous coding sequence is a construct where the coding sequence itself is not found in nature (e.g., synthetic sequences having codons different from the native gene). Similarly, a cell transformed with a construct which is not normally present in the cell would be considered heterologous for purposes of this invention. Allelic variation or naturally occurring mutational events do not give rise to heterologous DNA, as used herein.
  • a “coding sequence” or a sequence which “encodes” a particular protein is a nucleic acid sequence which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences.
  • a coding sequence can include, but is not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and even synthetic DNA sequences.
  • a transcription termination sequence will usually be located 3’ to the coding sequence.
  • a “nucleic acid” sequence refers to a DNA or RNA sequence.
  • the nucleic acids include base analogues of DNA and RNA including, but not limited to 4-acetylcytosine, 8-hydroxy-N6- methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxylmethyl)uracil, 5- fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5- carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1- methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2- methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueos
  • control sequences refers collectively to promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites (“IRES”), enhancers, and the like, which collectively provide for the replication, transcription and translation of a coding sequence in a recipient cell. Not all of these control sequences need always be present so long as the selected coding sequence is capable of being replicated, transcribed and translated in an appropriate host cell.
  • IRS internal ribosome entry sites
  • promoter is used herein in its ordinary sense to refer to a nucleotide region comprising a DNA regulatory sequence, wherein the regulatory sequence is derived from a gene which is capable of binding RNA polymerase and initiating transcription of a downstream (3-direction) coding sequence.
  • Transcription promoters can include “inducible promoters” (where expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), “repressible promoters” (where expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), and “constitutive promoters.”
  • the promoter is a muscle-specific promoter, which includes but is not limited to, a human skeletal actin gene element, a cardiac actin gene element, a desmin promoter, a skeletal alpha-actin (ASKA) promoter, a troponin I (TNNI2) promoter, a myocyte- specific enhancer binding factor mef binding element, a muscle creatine kinase (MCK) promoter, a truncated MCK (tMCK) promoter, a myosin heavy chain (MHC
  • the promoter is an MCK promoter, a tMCK promoter, or an MHCK7 promoter.
  • operably linked refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function.
  • control sequences operably linked to a coding sequence are capable of effecting the expression of the coding sequence.
  • the control sequences need not be contiguous with the coding sequence, so long as they function to direct the expression thereof.
  • intervening untranslated yet transcribed sequences can be present between a promoter sequence and the coding sequence and the promoter sequence can still be considered “operably linked” to the coding sequence.
  • a promoter “directs the transcription” of a coding sequence in a cell when RNA polymerase will bind the promoter sequence and transcribe the coding sequence into mRNA, which is then translated into the polypeptide encoded by the coding sequence.
  • “Expression cassette” or “expression construct” refers to an assembly which is capable of directing the expression of the sequence(s) or gene(s) of interest.
  • the expression cassette includes control elements, as described above, such as a promoter which is operably linked to (so as to direct transcription of) the sequence(s) or gene(s) of interest, and often includes a polyadenylation sequence as well.
  • the expression cassette described herein may be contained within a plasmid construct.
  • the plasmid construct may also include, one or more selectable markers, a signal which allows the plasmid construct to exist as single-stranded DNA, at least one multiple cloning site, and a “mammalian” origin of replication (e.g., a SV40 or adenovirus origin of replication).
  • a “mammalian” origin of replication e.g., a SV40 or adenovirus origin of replication.
  • an “isolated nucleic acid molecule which encodes a particular polypeptide” refers to a nucleic acid molecule which is substantially free of other nucleic acid molecules that do not encode the subject polypeptide; however, the molecule may include some additional bases or moieties which do not deleteriously affect the basic characteristics of the composition.
  • sequence identity As the purpose of describing the relative position of nucleotide sequences in a particular nucleic acid molecule throughout the instant application, such as when a particular nucleotide sequence is described as being situated “upstream,” “downstream,” “3,” or “5” relative to another sequence, it is to be understood that it is the position of the sequences in the “sense” or “coding” strand of a DNA molecule that is being referred to as is conventional in the art.
  • sequence identity “percent sequence identity”, or “percent identical” in the context of nucleic acid or amino acid sequences refers to the residues in the two sequences which are the same when aligned for maximum correspondence.
  • the length of sequence identity comparison may be over the full-length of the genome, the full-length of a gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides, is desired. However, identity among smaller fragments, e.g. of at least about nine nucleotides, usually at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides, may also be desired.
  • the percentage identity of the sequences can be determined by techniques known in the art. For example, homology can be determined by a direct comparison of the sequence information between two polypeptide molecules by aligning the sequence information and using readily available computer programs such as ALIGN, ClustalW2 and BLAST.
  • subject refers to any member of the animal kingdom, which includes, without limitation, humans and nonhuman primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs, and the like.
  • the subject is a human ranging in age from birth to 2 years, from 1 to 10 years, or ranging from 4 to 15 years, or ranging from 10 to 19 years, or from 20 to 40 years of age, or from 15 to 29 years of age or from 25-55 years, or ranging from 40 to 60 years, or over 50 years or over 60 years or over 65 years or over 70 years.
  • the subject is a human child (2 to 12 years), a human adolescent (10 to 19 years).
  • the subject is an adult human (18 years or older).
  • the subject is a young adult human (15 to 29 years of age), middle aged adult human (25 to 55 year of age) or an older adult human (over 50 years of age) or elderly human subject (over 65 years of age) or a geriatric human subject (over 70 years of age).
  • therapeutic effect is meant any therapeutic benefit conferred by the treatment described herein.
  • such an effect can be sustained expression, in an appropriate target tissue, of a protein or an enzyme which is deficient or missing in the muscular dystrophy of interest.
  • a therapeutic effect may be any reduction or elimination of one or more clinical or subclinical manifestations of the disease or disorder of interest.
  • a reduction in the CK level, reduction in fibrosis is reduced; an increase in the resistance to contraction-induced injury in tibialis anterior muscle; and/increased specific force in the muscle, and improved motor function provides a therapeutic benefit to the treated subject with LGMD-2D.
  • a recombinant AAV vector described herein comprises a polynucleotide sequence encoding alpha-sarcoglycan that is at least 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO: 2, or a protein retains a -sarcoglycan activity.
  • the alpha-sarcoglycan comprises a polypeptide sequence set forth in SEQ ID NO: 2.
  • a recombinant AAV vector comprising a polynucleotide sequence encoding functional alpha-sarcoglycan that comprises a nucleotide sequence that hybridizes under stringent conditions to the nucleic acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1, or a complement thereof.
  • the rAAV comprises a nucleotide sequence with at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 4.
  • the rAAV comprises a nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 4.
  • stringent is used to refer to conditions that are commonly understood in the art as stringent. Hybridization stringency is principally determined by temperature, ionic strength, and the concentration of denaturing agents such as formamide. Examples of stringent conditions for hybridization and washing are 0.015 M sodium chloride, 0.0015 M sodium citrate at 65-68 o C or 0.015 M sodium chloride, 0.0015M sodium citrate, and 50% formamide at 42 o C. See Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, (Cold Spring Harbor, N.Y.1989).
  • More stringent conditions may also be used, however, the rate of hybridization will be affected.
  • additional exemplary stringent hybridization conditions include washing in 6x SSC 0.05% sodium pyrophosphate at 37°C (for 14-base oligos), 48°C (for 17-base oligos), 55°C (for 20-base oligos), and 60°C (for 23- base oligos).
  • Examples are 0.1% bovine serum albumin, 0.1% polyvinyl-pyrrolidone, 0.1% sodium pyrophosphate, 0.1% sodium dodecylsulfate, NaDodSO4, (SDS), ficoll, Denhardt’s solution, sonicated salmon sperm DNA (or other non-complementary DNA), and dextran sulfate, although other suitable agents can also be used.
  • concentration and types of these additives can be changed without substantially affecting the stringency of the hybridization conditions. Hybridization experiments are usually carried out at pH 6.8-7.4, however, at typical ionic strength conditions, the rate of hybridization is nearly independent of pH.
  • LGMD2D Limb-girdle muscular dystrophy type 2D
  • LGMD2D is a progressive muscular dystrophy that manifests with muscle weakness, respiratory abnormalities, and in rare cases cardiomyopathy. LGMD2D is caused by mutations in the alpha-sarcoglycan gene resulting in loss of protein and concomitant loss of the sarcoglycan and dystrophin-associated glycoprotein complex.
  • the Sgca-null (sgca -/- ) mouse recapitulates the clinical phenotype of patients with LGMD2D, including dystrophic features such as muscle necrosis and fibrosis, elevated serum creatine kinase (CK), and reduction in generation of absolute muscle force and locomotor activity.
  • sgca -/- mice provide a relevant model to test the safety and efficacy of gene replacement.
  • this disclosure provides a self- complementary AAVrh74 vector containing a codon-optimized full-length human SGCA (hSGCA) transgene driven by a muscle-specific promoter, truncated muscle creatine kinase (tMCK).
  • scAAVrh74.tMCK.hSGCA was effective in improving the histopathology of limb and diaphragm muscle of sgca -/- mice, as indicated by reductions in fibrosis and central nucleation and normalization of myofiber size. These molecular changes were concomitant with significant increases in specific force generation in the diaphragm and tibialis anterior muscle, protection against eccentric force loss, and reduction in serum CK. Locomotor activity was improved at all doses of vector-treated compared to vehicle-treated sgca -/- mice. Lastly, a lack of vector- associated toxicity was detected in a serum chemistry panel and by gross necropsy.
  • the study provides support for a systemic delivery of scAAVrh74.tMCK.hSGCA in a clinical setting for the treatment of LGMD2D.
  • the recombinant AAV vectors described herein may be operably linked to a muscle-specific control element.
  • the muscle-specific promoter comprises one or more of a human skeletal actin gene element, a cardiac actin gene element, a desmin promoter, a skeletal alpha-actin (ASKA) promoter, a troponin I (TNNI2) promoter, a myocyte-specific enhancer binding factor mef binding element, a muscle creatine kinase (MCK) promoter, a truncated MCK (tMCK) promoter, a myosin heavy chain (MHC) promoter, a hybrid a-myosin heavy chain enhancer- /MCK enhancer-promoter (MHCK7) promoter, a C5-12 promoter, a murine creatine kinase enhancer element, a skeletal fast-twitch troponin c gene element, a slow-twitch cardiac troponin c gene element, a slow-twitch troponin i gene element, hypoxia- inducible nuclear factor (HIF)-response element (HIF
  • the muscle-specific promoter is a tMCK promoter, which comprises a sequence of SEQ ID NO: 3.
  • An exemplary rAAV described herein is AAVrh74.tMCK.hSCGA which comprises a nucleotide sequence of SEQ ID NO: 4.
  • the polynucleotide sequence encoding a AAVrh74.tMCK.hSCGA comprises a sequence at least 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identical to the nucleotide sequence set forth in SEQ ID NO: 4, or to a nucleotide sequence that is at least 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identical to SEQ ID NO: 1.
  • the polynucleotide sequence encoding a AAVrh74.tMCK.hSCGA comprises a nucleotide sequence that encodes a polypeptide sequence at least 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identical to the nucleotide sequence set forth in SEQ ID NO: 1.
  • the polynucleotide sequence encodes a protein that retains the alpha-sarcoglycan activity.
  • the rAAV comprises a 5’ inverted terminal repeat sequence of SEQ ID NO: 5. In another embodiment, the rAAV comprises a 3’ inverted terminal repeat sequence of SEQ ID NO: 6. In some embodiments, the rAAV comprises a poly A sequence of SEQ ID NO: 7.
  • the AAV can be any serotype, for example AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV-10, AAV-11, AAV-12, AAV-13, AAV rh.10, AAV rh.74, or variants and derivatives thereof. In one embodiment, the rAAV is of the serotype AAVrh.74.
  • rAAV Production of pseudotyped rAAV is disclosed in, for example, WO 2001/083692, which is incorporated by reference in its entirety.
  • Other types of rAAV variants for example rAAV with capsid mutations, are also contemplated. See, for example, Marsic et al., Molecular Therapy, 22(11): 1900-1909 (2014).
  • Compositions comprising any of the rAAV vectors described herein are also contemplated.
  • rAAV recombinant adeno-associated virus
  • the dose of the rAAV administered is between about 1.0 x 10 12 vg/kg to about 2.0 x 10 15 vg/kg, about 5 x 10 12 vg/kg to about 1.0 x 10 15 vg/kg, about 1.0 x 10 13 vg/kg to about 5.0 x 10 14 vg/kg, about 5x10 13 vg/kg to about 2x10 14 vg/kg, or about 2.0 x 10 13 vg/kg to about 3.0 x 10 14 vg/kg.
  • the dose is about 5.0 x 10 13 vg/kg, 1.0 x 10 14 vg/kg, or 2.0 x 10 14 vg/kg.
  • the rAAV is administered by a systemic route, which comprises an intravenous route. In another embodiment, the rAAV is administered intravenously at a dose of about 5.0 x 10 13 vg/kg, 1.0 x 10 14 vg/kg, or 2.0 x 10 14 vg/kg. In one embodiment, the muscular dystrophy is limb-girdle muscular dystrophy.
  • the dose of the rAAV administered is about 1.5 x 10 13 vg to about 3.5 x 10 16 vg, or 3 x 10 13 vg to 1 x 10 16 vg, or about 1.5 x 10 13 vg to about 2 x 10 15 vg, or about 1.5 x 10 13 vg to about 1 x 10 15 vg.
  • the dose of rAAV is administered at a concentration of about 10 mL/kg.
  • the muscular dystrophy is limb-girdle muscular dystrophy. In one embodiment, the muscular dystrophy is limb-girdle muscular dystrophy, type 2D.
  • the doses in this disclosure are based on a titration qualification method by quantitative PCR (qPCR).
  • the qPCR-based titration method is known in the art.
  • a recombinant adeno-associated virus (rAAV) scAAVrh74.tMCK.hSGCA wherein the rAAV is administered using a systemic route of administration and at a dose of about 1.0 x 10 12 vg/kg to about 2.0 x 10 15 vg/kg; wherein the level of alpha- sarcoglycan gene expression in a cell of the subject is increased after administration of the rAAV as compared to the level of alpha-sarcoglycan gene expression before administration of the rAAV; wherein the serum CK level in the subject is decreased after administration of the rAAV as compared
  • the muscle tissues include but are not limited to triceps, tibialis anterior, soleus, gastrocnemius, biceps, trapezius, gluteus, psoas major, deltoids, quadriceps, and diaphragm.
  • the muscle tissues comprise tibialis anterior, gastrocnemius, gluteus, psoas major, and triceps.
  • the expression of alpha-sarcoglycan is determined by methods known to a person with ordinary skill in the art. In one embodiment, the expression is determined by Western blot, immunochemistry in muscle biopsies, and/or by detecting the number of vector genome per microgram of genomic DNA.
  • the disclosure includes a method of treating muscular dystrophy in a subject in need thereof comprising the step of administering a recombinant adeno- associated virus (rAAV) scAAVrh74.tMCK.hSGCA, wherein motor function is demonstrably improved in said human subject as compared to motor function of said human subject before administration of the rAAV.
  • rAAV adeno- associated virus
  • the subject is 4-15 years of age, has confirmed alpha-sarcoglycan (SGCA) mutation in both alleles, is negative for AAVrh74 antibodies and/or had >40% or normal 100 meter walk test.
  • the subject is a pediatric subject.
  • the subject is a pediatric subject, such as a subject ranging in age from 1 to 21 years.
  • the subject is 1 to 10 years of age, or 2 to 12 years of age,4 to 15 years of age, or 10 to 19 years of age.
  • the subject in one embodiment, is an adolescent subject, such as a subject ranging in age from 12 to 21 years.
  • the subject in one embodiment, is a young adult subject such as a subject ranging in age from 15 to 29 years of age or 18-39 years of age.
  • the subject is a middle-aged adult or an elderly subject, such that the middle-aged adult may range in age from 25-55 years of age, the older adult subject may range in age over 50 years of age, and the elderly subject may range in age over 65 years of age.
  • the rAAV is administered by injection, infusion or implantation.
  • the rAAV is administered by infusion over approximately 1 to 2 hours.
  • the rAAV is administered by an intravenous route through a peripheral limb vein.
  • a recombinant adeno-associated virus (rAAV) scAAVrh74.tMCK.hSGCA wherein the rAAV is administered using a systemic route of administration and at a dose of about 1.0 x 10 12 vg/kg to about 5.0 x 10 14 vg/kg and the rAAV comprises a nucleotide sequence at least 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 1.
  • the rAAV comprises a nucleotide sequence set forth in SEQ ID NO: 1.
  • the rAAV encodes a protein comprising a polypeptide sequence that is at least 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 2.
  • the rAAV comprises a nucleotide sequence encoding a protein comprising a polypeptide sequence set forth in SEQ ID NO: 2.
  • the any of the disclosed rAAV comprise a promoter such as the tMCK promoter sequence of SEQ ID NO: 3.
  • the rAAV is of the serotype AAVrh.74.
  • the rAAV comprises the scAAVrh74.tMCK.hSGCA construct nucleotide sequence of SEQ ID NO: 3.
  • the rAAV comprises a 5’ inverted terminal repeat sequence of SEQ ID NO: 5.
  • the rAAV comprises a 3’ inverted terminal repeat sequence of SEQ ID NO: 6.
  • the rAAV comprises a poly A sequence of SEQ ID NO: 7.
  • AAV dosage can be determined by multiple methods, which include but are not limited to LISA, assessment of the reverse transcriptase activity, FACS, transduction assays northern blotting (e.g., semi-quantitative northern), dot blot analysis or PCR (e.g., qPCR). It is well known that the AAV doses can be determined by measuring AAV vector genomes with quantitative real-time PCR (qPCR). Such qPCR methods overcome the inconsistency or arbitrary results from conventional transduction assays. In one embodiment of PCR dosage determination, plasmid DNA is used as a calibration standard. The forms of the plasmids can impact the dosage results from the qPCR methods.
  • the circular or supercoiled DNA or plasmids are used as a quantification standard.
  • the linearized DNA or plasmids are used as the quantification standard.
  • the term “supercoiled DNA” or “supercoiled plasmid” refers to a DNA or plasmid that comprises no free end.
  • the term “linearized DNA” or linearized plasmid” refer to a DNA or plasmid that comprises a free 5' end and a free 3' end, which are not linked to each other.
  • a linearized DNA or plasmid is obtained by a restriction digest of a circular DNA (e.g. plasmid DNA) or by a restriction digest of a dbDNA.
  • methods of treating muscular dystrophy in a human subject in need thereof comprise the step of administering a recombinant adeno- associated virus (rAAV) scAAVrh74. tMCK7.hSGCA, wherein the rAAV is administered using a systemic route of administration and at a dose of about 1.0 x 10 12 vg/kg to about 5.0 x 10 14 vg/kg, wherein the human subject is suffering from limb-girdle muscular dystrophy.
  • rAAV adeno- associated virus
  • the rAAV is administered by intravenous infusion over approximately 1 to 2 hours at a dose of about 5.0 x 10 13 vg/kg, 1.0 x 10 14 vg/kg, or 2.0 x 10 14 vg/kg based on a supercoiled DNA or plasmid as the quantitation standard, and wherein the rAAV comprises the scAAVrh74. tMCK7.hSGCA construct nucleotide sequence of SEQ ID NO: 3.
  • the dose is about 1.85 x 10 13 vg/kg or 7.41 x 10 13 vg/kg based on a linearized DNA or plasmid as the quantitation standard.
  • the disclosure also provides a method of increasing sarcoglycan expression in muscle tissue of a subject comprising administering to the subject a scAAVrh74.tMCK.hSGCA construct comprising a nucleotide sequence at least 90% identical, at least 95% identical, or 99% identical to SEQ ID NOs: 1, and/or 4.
  • the disclosure further provides a method of improving muscle function of a subject comprising administering to the subject a construct comprising a nucleotide sequence at least 90% identical, at least 95% identical, or 99% identical to SEQ ID NO: 1, and/or 4.
  • the subject suffers from a genetic mutation in a gene encoding a sarcoglycan protein or a muscular dystrophy. In some aspects, the subject suffers from a genetic mutation in a gene encoding alpha-sarcoglycan protein.
  • the level of alpha-sarcoglycan gene expression in a cell of the subject is increased after administration of scAAVrh74.tMCK 7.hSGCA construct as compared to the level of alpha-sarcoglycan gene expression before administration of scAAVrh74.tMCK.hSGCA construct .
  • the expression of the alpha-sarcoglycan gene in the cell is detected by measuring the alpha-sarcoglycan protein level on a Western blot or immunohistochemistry in muscle biopsied before and after administration of scAAVrh74.tMCK.hSGCA construct.
  • the level of alpha-sarcoglycan protein is increased after administration of scAAVrh74.tMCK.hSGCA construct.
  • the level of the level of alpha- sarcoglycan protein is increased by at least 33% as detected by measuring the alpha-sarcoglycan protein level on a Western blot in muscle biopsied before and after administration of scAAVrh74.tMCK.hSGCA construct, or the level of alpha -sarcoglycan protein is measured by immunohistochemistry in muscle biopsies and/or by detecting the number of vector genome per microgram of genomic DNA before and after administration ofscAAVrh74.tMCK.hSGCA construct .
  • the serum CK level in the subject is decreased after administration of scAAVrh74.tMCK.hSGCA construct as compared to serum CK level before administration of scAAVrh74.tMCK.hSGCA construct .
  • the number of alpha-sarcoglycan positive fibers in the muscle tissue of the subject is increased after administration of scAAVrh74.tMCK.hSGCA construct as compared to the number of alpha-sarcoglycan positive fibers before administration ofscAAVrh74.tMCK.hSGCA construct .
  • the number of alpha-sarcoglycan positive fibers is detected by measuring the alpha-sarcoglycan protein level by Western blot or immunohistochemistry on muscle biopsies before and after administration of scAAVrh74.tMCK.hSGCA construct.
  • the number of alpha-sarcoglycan positive fibers in the muscle tissue of the subject is increased after administration of scAAVrh74.tMCK.hSGCA construct.
  • the level of alpha-sarcoglycan in the subject is increased after administration of the rAAV as compared to the level of alpha-sarcoglycan before administration of scAAVrh74.tMCK.hSGCA construct .
  • the level of alpha-sarcoglycan is detected by measuring the alpha-sarcoglycan protein level by immunohistochemistry or Western blot on muscle biopsies before and after administration of scAAVrh74.tMCK.hSGCA construct .
  • Another embodiment provides for methods expressing alpha-sarcoglycan gene in a patient cell comprising administering to the patient the scAAVrh74.tMCK.hSGCA construct nucleotide sequence of SEQ ID NO: 4.
  • expression of the alpha-sarcoglycan gene in the patient cell is detected by measuring the alpha-sarcoglycan protein level on a Western blot or immunohistochemistry in muscle biopsies before and after administration of the scAAVrh74.tMCK.hSGCA construct.
  • the alpha-sarcoglycan gene is measured in the patient by detecting greater than one rAAV vector genome copy per nucleus. In another embodiment, the expression of the alpha-sarcoglycan gene is measured in the subject by detecting the number of vector genome per microgram of genomic DNA. [00126] Methods of decreasing serum CK levels in a patient in need thereof, the method comprising administering to the subject the scAAVrh74.tMCK.hSGCA construct nucleotide sequence of SEQ ID NO: 4 are also provided.
  • Methods of increasing alpha-sarcoglycan positive fibers in a patient muscle tissue comprising administering to the subject the scAAVrh74.tMCK.hSGCA construct nucleotide sequence of SEQ ID NO: 4 are provided.
  • the number of alpha-sarcoglycan positive fibers is detected by measuring the alpha-sarcoglycan protein level by Western blot or immunohistochemistry on muscle biopsies before and after administration of the rAAV.
  • Another embodiment provides for methods of increasing the expression of alpha- sarcoglycan in a subject in need thereof comprising administering to the subject the scAAVrh74.tMCK.hSGCA construct nucleotide sequence of SEQ ID NO: 4.
  • the level of alpha-sarcoglycan is detected by measuring the alpha-sarcoglycan protein level by Western blot or immunohistochemistry on muscle biopsies before and after administration of the rAAV.
  • Methods of producing a recombinant AAV vector particle comprising culturing a host cell that is transferred with any recombinant AAV vector described herein and recovering recombinant AAV particles from the supernatant of the transfected cells are also provided.
  • Viral particles comprising any of the recombinant AAV vectors described herein are also contemplated.
  • the method of generating the rAAV comprising transferring an AAV vector plasmid to a host cell.
  • the recombinant AAV vector particle and/or the AAV vector plasmid comprises a nucleotide sequence that is at least about 65%, about 70%, about 75%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, or about 89%, more typically about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% or more identical to SEQ ID NO: 8.
  • the disclosure provides a host cell that comprising an AAV vector plasmid that comprises a nucleotide sequence of SEQ ID NO: 8.
  • the AAV vector plasmid is stably expressed in the host cell.
  • the host cell stably harboring the AAV vector plasmid can be used to generate rAAV.
  • the AAV vector plasmid is a pAAV.tMCK.hSGCA. KAN plasmid (SEQ ID NO: 8).
  • the method comprises administering a therapeutically effective amount of an AAV vector described herein (or composition comprising an AAV vector described herein) to the mammalian subject.
  • the mammalian subject suffers from muscular dystrophy.
  • the muscular dystrophy is LGMD2D.
  • administration of an AAV vector described herein reduces fibrosis in the muscle tissue of the subject.
  • the muscle tissue comprises psoas major, diaphragm, triceps, and/or gluteus.
  • muscle dystrophy refers to a disorder in which strength and muscle bulk gradually decline.
  • Non-limiting examples of muscular dystrophy diseases may include Becker muscular dystrophy, tibial muscular dystrophy, Duchenne muscular dystrophy, Emery-Dreifuss muscular dystrophy, facioscapulohumeral muscular dystrophy, sarcoglycanopathies, congenital muscular dystrophy such as congenital muscular dystrophy due to partial LAMA2 deficiency, merosin- deficient congenital muscular dystrophy, type 1D congenital muscular dystrophy, Fukuyama congenital muscular dystrophy, limb-girdle type 1A muscular dystrophy, limb-girdle type 2A muscular dystrophy, limb-girdle type 2B muscular dystrophy, limb-girdle type 2C muscular dystrophy, limb-girdle type 2D muscular dystrophy, limb-girdle type 2E muscular dystrophy, limb-girdle type 2F muscular dystrophy, limb-girdle type 2G muscular dystrophy, limb-girdle
  • the subject is suffering from limb-girdle muscular dystrophy. In some embodiments, the subject us suffering from limb-girdle muscular dystrophy type 2D (LGMD2D).
  • LGMD2D limb-girdle muscular dystrophy type 2D
  • the term “fibrosis” as used herein refers to the excessive or unregulated deposition of extracellular matrix (ECM) components and abnormal repair processes in tissues upon injury including skeletal muscle, cardiac muscle, liver, lung, kidney, and pancreas.
  • ECM components that are deposited include collagen, e.g. collagen 1, collagen 2 or collagen 3, and fibronectin.
  • a method of increasing alpha-sarcoglycan positive fibers in a muscle tissue, fiber diameter size, eccentric contraction in the muscle, muscular force and/or expression of alpha-sarcoglycan in a mammalian subject comprising administering a therapeutically effective amount of an AAV vector described herein (or composition comprising an AAV vector described herein) to the mammalian subject.
  • a method of reducing fibrosis, central nucleation, CK level, and/or collage deposition in a subject comprising administering a therapeutically effective amount of an AAV vector described herein (or composition comprising an AAV vector described herein) to a subject.
  • the subject may be suffering from muscular dystrophy such as limb-girdle muscular dystrophy or any other dystrophin-associated muscular dystrophy.
  • the muscular dystrophy is LGMD-2D.
  • a method of treating muscular dystrophy in a mammalian subject comprising administering a therapeutically effective amount of an AAV vector described herein (or composition comprising an AAV vector described herein) to the mammalian subject.
  • the muscular dystrophy is limb-girdle muscular dystrophy.
  • the rAAV is administered by intramuscular injection or intravenous injection.
  • the rAAV is administered systemically, such as parental administration by injection, infusion or implantation.
  • the compositions of the invention are formulated for intramuscular injection or intravenous injection.
  • the compositions of the invention are formulated for systemic administration, such as parental administration by injection, infusion or implantation.
  • any of the compositions formulated for administration to a subject suffering from muscular dystrophy such as limb-girdle muscular dystrophy or any other dystrophin-associated muscular dystrophy).
  • the composition may further comprise a second recombinant AAV vector that expressed alpha-sarcoglycan or a second recombinant AAV vector comprising a polynucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 4.
  • the medicament is formulated for intramuscular injection or intravenous injection.
  • the medicament is formulated for systemic administration, such as parental administration by injection, infusion or implantation.
  • any of the medicaments may be prepared for administration to a subject suffering from muscular dystrophy (such as limb-girdle muscular dystrophy or any other dystrophin associated muscular dystrophy).
  • the medicament may further comprise a second recombinant AAV vector that expressed alpha-sarcoglycan or a second recombinant AAV vector comprising a polynucleotide sequence in SEQ ID NO: 1 or SEQ ID NO: 4.
  • AAV Recombinant AAV genomes of the invention comprise nucleic acid molecule of the invention and one or more AAV ITRs flanking a nucleic acid molecule.
  • the DNA plasmids are transferred to cells permissible for infection with a helper virus of AAV (e.g., adenovirus, E1-deleted adenovirus or herpesvirus) for assembly of the rAAV genome into infectious viral particles.
  • AAV e.g., adenovirus, E1-deleted adenovirus or herpesvirus
  • a helper virus of AAV e.g., adenovirus, E1-deleted adenovirus or herpesvirus
  • the AAV rep and cap genes may be from any AAV serotype for which recombinant virus can be derived and may be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV rh10, and AAV rh.74.
  • Production of pseudotyped rAAV is disclosed in, for example, WO 2001/083692, which is incorporated by reference herein in its entirety.
  • a method of generating a packaging cell is to create a cell line that stably expresses all the necessary components for AAV particle production.
  • a plasmid (or multiple plasmids) comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker, such as a neomycin resistance gene, are integrated into the genome of a cell.
  • AAV genomes have been introduced into bacterial plasmids by procedures such as GC tailing (Samulski et al., 1982, Proc. Natl. Acad. S6.
  • the packaging cell line is then infected with a helper virus such as adenovirus.
  • a helper virus such as adenovirus.
  • packaging cells that produce infectious rAAV.
  • packaging cells may be stably transformed cancer cells such as HeLa cells, 293 cells and PerC.6 cells (a cognate 293 line).
  • packaging cells are cells that are not transformed cancer cells, such as low passage 293 cells (human fetal kidney cells transformed with E1 of adenovirus), MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells) and FRhL-2 cells (rhesus fetal lung cells).
  • Recombinant AAV i.e., infectious encapsidated rAAV particles
  • Embodiments include, but are not limited to, the rAAV named pAAV.tMCK.hSCGA which comprises the polynucleotide sequence set forth in SEQ ID NO: 3..
  • the rAAV may be purified by methods standard in the art such as by column chromatography or cesium chloride gradients. Methods for purifying rAAV vectors from helper virus are known in the art and include methods disclosed in, for example, Clark et al., Hum. Gene Ther., 10(6): 1031-1039 (1999); Schenpp and Clark, Methods Mol. Med., 69427-443 (2002); U.S. Patent No.6,566,118 and WO 98/09657. [00148] In another embodiment, the invention contemplates compositions comprising rAAV of the present invention. Compositions described herein comprise rAAV in a pharmaceutically acceptable carrier.
  • compositions may also comprise other ingredients such as diluents and adjuvants.
  • Acceptable carriers, diluents and adjuvants are nontoxic to recipients and are preferably inert at the dosages and concentrations employed, and include buffers such as phosphate, citrate, or other organic acids; antioxidants such as ascorbic acid; low molecular weight polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-formig counterions such as sodium; and/or nonionic surfactants such as Tween, pluronics or polyethylene glycol (PEG).
  • buffers
  • Titers of rAAV to be administered in methods of the invention will vary depending, for example, on the particular rAAV, the mode of administration, the treatment goal, the individual, and the cell type(s) being targeted, and may be determined by methods standard in the art. Titers of rAAV may range from about 1x10 6 , about 1x10 7 , about 1x10 8 , about 1x10 9 , about 1x10 10 , about 1x10 11 , about 1x10 12 , about 1x10 13 to about 1x10 14 or more DNase resistant particles (DRP) per ml. Dosages may also be expressed in units of viral genomes (vg) as measured by qPCR.
  • vg viral genomes
  • Methods of transducing a target cell with rAAV, in vivo or in vitro are contemplated by the invention.
  • the in vivo methods comprise the step of administering an effective dose, or effective multiple doses, of a composition comprising a rAAV of the invention to an animal (including a human being) in need thereof. If the dose is administered prior to development of a disorder/disease, the administration is prophylactic. If the dose is administered after the development of a disorder/disease, the administration is therapeutic.
  • an effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disorder/disease state being treated, that slows or prevents progression to a disorder/disease state, that slows or prevents progression of a disorder/disease state, that diminishes the extent of disease, that results in remission (partial or total) of disease, and/or that prolongs survival.
  • An example of a disease contemplated for prevention or treatment with methods of the invention is muscular dystrophy, such as limb-girdle muscular dystrophy.
  • the disclosure provides a method of generating the rAAV scAAVrh74.tMCK.hSGCA which comprises transferring an AAV vector plasmid to a host cell.
  • the methods of transferring a DNA to a host cell are well known in the art, which include but are not limited to transfection, infection, transformation, electroporation, and transduction.
  • the vector plasmid comprises a nucleotide sequence that is at least about 65%, about 70%, about 75%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, or about 89%, more typically about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% or more identical to SEQ ID NO: 8.
  • the vector plasmid comprises a nucleotide sequence that is at least 90%, 95%, or 99% identical to SEQ ID NO: 8.
  • the vector plasmid comprises a nucleotide sequence of SEQ ID NO: 8.
  • the disclosure provides a host cell that comprising an AAV vector plasmid that comprises a nucleotide sequence of SEQ ID NO: 8.
  • the AAV vector plasmid is stably expressed in the host cell.
  • the host cell stably harboring the AAV vector plasmid can be used to generate rAAV.
  • the AAV vector plasmid is a pAAV.tMCK.hSGCA. KAN plasmid.
  • the vector plasmid comprises a nucleotide sequence that is at least about 65%, about 70%, about 75%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, or about 89%, more typically about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% or more identical to SEQ ID NO: 1, 4, or 8.
  • the vector plasmid comprises a nucleotide sequence that is at least about 90%, 95%, or 99% identical to SEQ ID NO: 1, 4, or 8.
  • the vector plasmid comprises a nucleotide sequence of SEQ ID NO: 1, 4, or 8.
  • the method of generating rAAV further comprises transferring a packaging plasmid and/or a helper virus to the host cell.
  • the packaging plasmid in some embodiments, comprises an AAV rep and/or cap gene that is operably linked to a promoter.
  • the promoter in one embodiment, is an AAV transcription promoter.
  • the host cell is a packaging cell.
  • the packaging cell comprises a stably integrated AAV cap gene.
  • the packaging cell comprises a stably integrated AAV rep gene.
  • the term “host cell” refers to a cell that can be used to express an exogenous DNA sequence.
  • a host cell comprise a microorganism, a yeast cell, an insect cell, and/or a mammalian cell.
  • the host cell can be used as a recipient for an AAV helper construct, a packaging plasmid, an AAV vector plasmid, an accessary function vector, or other DNA.
  • the term as used here encompasses the progeny of the original cell after expressing the exogenous DNA sequence in the original host cell.
  • Non-limiting examples of host cells for AAV production include Sf9 insect cells and HEK 293T cells.
  • the AAV vector plasmid can be introduced to the host cells, e.g., Sf9 or 293T, by infection (virus or baculovirus), transient transfection using reagents (e.g., liposomal, calcium phosphate) or physical means (e.g., electroporation), or other means know in the art.
  • the host cell lines are stably integrated with the rAAV plasmids into their genomes. Such stable cell lines can be established by incorporating a selection marker into the vector plasmid.
  • the host cell is a packaging cell for production of AAV viral particles.
  • the disclosure provides a host cell that comprises an AAV vector plasmid that comprises a nucleotide sequence that is at least 90%, 95%, or 99% identical to SEQ ID NO: 8.
  • the host cell comprises a nucleotide sequence of SEQ ID NO: 1, 4, or 8.
  • Combinations of methods of the invention with standard medical treatments are specifically contemplated, as are combinations with novel therapies.
  • the combinations include administering to a subject one or more steroids, corticosteroids, and/or glucocorticoids including but not limited to one or more of prednisone, prednisolone; and deflazacort before administering an rAAV of the inventive methods to the subject, simultaneously with administering the rAAV to the subject, or after administering the rAAV to the subject.
  • the glucocorticoid includes, but is not limited to beclomethasone, betamethasone, budesonide, cortisone, dexamethasone, hydrocortisone, methylprednisolone, or triamcinolone.
  • an antigen specific T-cell response may occur in a subject administered with the rAAV vector. This is an expected response between 2-4 weeks following gene transfer.
  • One possible consequence to such antigen specific T-cell responses is clearance of the transduced cells and loss of transgene expression.
  • subjects can be started on approximately 1mg/kg/day prophylactic prednisone or comparable glucocorticoid by mouth with a maximum dose of 60 mg/day. IV administration of a comparable glucocorticoid at the approximate dose of 1 mg/kg/day would also be allowable if needed. Treatment will continue for approximately one month.
  • a tapering protocol for prednisone or comparable glucocorticoid can be implemented based on individual subjects’ immune response to the gene transfer, assessed by ELISpot assay and also by liver function monitoring with GGT.
  • a therapeutically effective amount of the rAAV vector is a dose of rAAV ranging from between about 1.0 x 10 12 vg/kg to about 2.0 x 10 15 vg/kg, about 5 x 10 12 vg/kg to about 1.0 x 10 15 vg/kg, about 1.0 x 10 13 vg/kg to about 5.0 x 10 14 vg/kg, about 5x10 13 vg/kg to about 2x10 14 vg/kg, or about 2.0 x 10 13 vg/kg to about 3.0 x 10 14 vg/kg.
  • the dose is about 5.0 x 10 13 vg/kg, about 1.0 x 10 14 vg/kg, or about 2.0 x 10 14 vg/kg. In another embodiment, the dose is 5.0 x 10 13 vg/kg, 1.0 x 10 14 vg/kg, or 2.0 x 10 14 vg/kg.
  • the invention is also contemplated to include compositions comprising these ranges of rAAV vector.
  • Dosages may also be expressed in units of viral genomes (vg).
  • the titers of rAAV may be determined by the supercoiled DNA or plasmid quantitation standard or the linearized DNA or plasmid quantitation standard.
  • the titer or dosage of AAV vectors can vary based on the physical forms of plasmid or DNA as a quantitation standard.
  • the value of titer or dosage may vary based off of a supercoiled standard qPCR titering method or a linear standard qPCR titering method.
  • the dosage in this disclosure is based on a supercoiled DNA or plasmid as the quantitation standard.
  • the dosage in this disclosure is based on a linearized DNA or plasmid as the quantitation standard.
  • the therapeutically effective amount of the rAAV vector is a dose of rAAV ranging from between about 1.0 x 10 12 vg/kg to about 2.0 x 10 15 vg/kg, about 5 x 10 12 vg/kg to about 1.0 x 10 15 vg/kg, about 1.0 x 10 13 vg/kg to about 5.0 x 10 14 vg/kg, about 5x10 13 vg/kg to about 2x10 14 vg/kg, or about 2.0 x 10 13 vg/kg to about 3.0 x 10 14 vg/kg based on a supercoiled DNA or plasmid as the quantitation standard.
  • the dose is about 5.0 x 10 13 vg/kg, about 1.0 x 10 14 vg/kg, or about 2.0 x 10 14 vg/kg based on a supercoiled DNA or plasmid as the quantitation standard. In another embodiment, the dose is 5.0 x 10 13 vg/kg, 1.0 x 10 14 vg/kg, or 2.0 x 10 14 vg/kg based on a supercoiled DNA or plasmid as the quantitation standard.
  • the therapeutically effective amount of the rAAV vector is a dose of rAAV ranging from between about 1.0 x 10 13 vg/kg to about 8.0 x 10 13 vg/kg, about 1.5 x 10 13 vg/kg to about 8.0 x 10 13 vg/kg, about 1.6 x 10 13 vg/kg to about 8.0 x 10 13 vg/kg.
  • the therapeutically effective amount of the rAAV vector is a dose of about 1.85 x 10 13 vg/kg or 7.41 x 10 13 vg/kg based on a linearized DNA or plasmid as the quantitation standard.
  • the dose of 5.0 x 1013 vg/kg based on a supercoiled DNA or plasmid as the quantitation standard is equivalent to the dose of 1.85 x 10 13 vg/kg based on a linearized DNA or plasmid as the quantitation standard.
  • the dose of 2.0 x 10 14 vg/kg based on a supercoiled DNA or plasmid is equivalent to 7.41 x 10 13 vg/kg based on a linearized DNA or plasmid as the quantitation standard. Therefore, in another embodiment, about 1.85 x 10 13 vg/kg or 7.41 x 10 13 vg/kg based on a linearized DNA or plasmid as the quantitation standard.
  • Administration of an effective dose of the compositions may be by routes standard in the art including, but not limited to, intramuscular, parenteral, intravenous, oral, buccal, nasal, pulmonary, intracranial, intraosseous, intraocular, rectal, or vaginal.
  • Route(s) of administration and serotype(s) of AAV components of the rAAV (in particular, the AAV ITRs and capsid protein) of the invention may be chosen and/or matched by those skilled in the art taking into account the infection and/or disease state being treated and the target cells/tissue(s) that are to express the a-sarcoglycan.
  • the invention provides for local administration and systemic administration of an effective dose of rAAV and compositions of the invention.
  • systemic administration is administration into the circulatory system so that the entire body is affected.
  • Systemic administration includes enteral administration such as absorption through the gastrointestinal tract and parental administration through injection, infusion or implantation.
  • rAAV of the present invention may be accomplished by using any physical method that will transport the rAAV recombinant vector into the target tissue of an animal.
  • Administration according to the invention includes, but is not limited to, injection into muscle, the bloodstream and/or directly into the liver. Simply resuspending a rAAV in phosphate buffered saline has been demonstrated to be sufficient to provide a vehicle useful for muscle tissue expression, and there are no known restrictions on the carriers or other components that can be co- administered with the rAAV (although compositions that degrade DNA should be avoided in the normal manner with rAAV).
  • Capsid proteins of a rAAV may be modified so that the rAAV is targeted to a particular target tissue of interest such as muscle. See, for example, WO 02/053703, the disclosure of which is incorporated by reference herein.
  • Pharmaceutical compositions can be prepared as injectable formulations or as topical formulations to be delivered to the muscles by transdermal transport. Numerous formulations for both intramuscular injection and transdermal transport have been previously developed and can be used in the practice of the invention.
  • the rAAV can be used with any pharmaceutically acceptable carrier for ease of administration and handling.
  • the application is directed to a formulation that comprises an rAAV that comprises an AAVrh74 derived capsid, a buffer agent, an ionic strength agent, and a surfactant.
  • the rAAV is at a concentration of about 1.0 x 10 12 vg/kg to about 5.0 x 10 14 vg/kg.
  • the rAAV is at a concentration of about 5.0 x 10 12 vg/kg to about 1.0 x 10 14 vg/kg.
  • the rAAV is at a concentration of about 5x10 13 vg/kg, about 1x10 14 vg/kg, and/or about 2x10 14 vg/kg.
  • the dosage is based on a supercoiled DNA or plasmid as the quantitation standard.
  • the rAAV is an scAAVrh74. tMCK.hSGCA vector.
  • the buffer agent comprises one or more of tris, tricine, Bis-tricine, HEPES, MOPS, TES, TAPS, PIPES, and CAPS.
  • the buffer agent comprises tris with pH 8.0 at concentration of about 5 mM to about 40 mM. In one embodiment, the buffer agent comprises tris with pH 8.0 at about 20 mM.
  • the ionic strength agent comprises one of more of potassium chloride (KCl), potassium acetate, potassium sulfate, ammonium sulfate, ammonium chloride (NH4Cl), ammonium acetate, magnesium chloride (MgCl2), magnesium acetate, magnesium sulfate, manganese chloride (MnCl2), manganese acetate, manganese sulfate, sodium chloride (NaCl), sodium acetate, lithium chloride (LiCl), and lithium acetate.
  • the ionic strength agent comprises MgCl2 at a concentration of about 0.2 mM to about 4 mM.
  • the ionic strength agent comprises NaClat a concentration of about 50 mM to about 500 mM. In another embodiment, the ionic strength agent comprises MgCl2 at a concentration of about 0.2 mM to about 4 mM and NaClat a concentration of about 50 mM to about 500 mM. In another embodiment, the ionic strength agent comprises MgCl2 at a concentration of about 1 mM and NaCl at a concentration of about 200 mM. In one embodiment, the surfactant comprises one or more of a sulfonate, a sulfate, a phosphonate, a phosphate, a Poloxamer, and a cationic surfactant.
  • the Poloxamer comprises one or more of Poloxamer 124, Poloxamer 181, Poloxamer 184, Poloxamer 188, Poloxamer 237, Poloxamer 331, Poloxamer 338, and Poloxamer 407.
  • the surfactant comprises the Poloxamer at a concentration of about 0.00001% to about 1%.
  • the surfactant comprises Poloxamer 188 at a concentration of about 0.001%.
  • solutions in an adjuvant such as sesame or peanut oil or in aqueous propylene glycol can be employed, as well as sterile aqueous solutions.
  • aqueous solutions can be buffered, if desired, and the liquid diluent first rendered isotonic with saline or glucose.
  • Solutions of rAAV as a free acid (DNA contains acidic phosphate groups) or a pharmacologically acceptable salt can be prepared in water suitably mixed with a surfactant such as hydroxpropylcellulose.
  • a dispersion of rAAV can also be prepared in glycerol, liquid polyethylene glycols and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • the sterile aqueous media employed are all readily obtainable by standard techniques well-known to those skilled in the art.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating actions of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), suitable mixtures thereof, and vegetable oils.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion and by the use of surfactants.
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases it will be preferable to include isotonic agents, for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by use of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions are prepared by incorporating rAAV in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization.
  • dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and the freeze drying technique that yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile-filtered solution thereof.
  • Transduction with rAAV may also be carried out in vitro.
  • desired target muscle cells are removed from the subject, transduced with rAAV and reintroduced into the subject.
  • syngeneic or xenogeneic muscle cells can be used where those cells will not generate an inappropriate immune response in the subject.
  • Suitable methods for the transduction and reintroduction of transduced cells into a subject are known in the art.
  • cells can be transduced in vitro by combining rAAV with muscle cells, e.g., in appropriate media, and screening for those cells harboring the DNA of interest using conventional techniques such as Southern blots and/or PCR, or by using selectable markers.
  • Transduced cells can then be formulated into pharmaceutical compositions, and the composition introduced into the subject by various techniques, such as by intramuscular, intravenous, subcutaneous and intraperitoneal injection, or by injection into smooth and cardiac muscle, using e.g., a catheter.
  • Transduction of cells with rAAV of the invention results in sustained expression of a- sarcoglycan.
  • the present invention thus provides methods of administering/delivering rAAV which express alpha-sarcoglycan to a mammalian subject, preferably a human being. These methods include transducing tissues (including, but not limited to, tissues such as muscle, organs such as liver and brain, and glands such as salivary glands) with one or more rAAV of the present invention.
  • Transduction may be carried out with gene cassettes comprising tissue specific control elements.
  • muscle specific control elements including, but not limited to, those derived from the actin and myosin gene families, such as from the myoD gene family [See Weintraub et al., Science, 251: 761-766 (1991)], the myocyte-specific enhancer binding factor MEF-2 [Cserjesi and Olson, Mol Cell Biol 11: 4854-4862 (1991)], control elements derived from the human skeletal actin gene [Muscat et al., Mol Cell Biol, 7: 4089-4099 (1987)], the cardiac actin gene, muscle creatine kinase sequence elements [See Johnson et al., Mol Cell Biol, 9:3393-3399 (1989)] and the murine creatine kinase enhancer (mCK) element, control elements derived from the skeletal fast-twitch troponin C gene, the slow
  • Muscle tissue is an attractive target for in vivo DNA delivery, because it is not a vital organ and is easy to access.
  • the invention contemplates sustained expression of miRNAs from transduced myofibers.
  • muscle cell or “muscle tissue” is meant a cell or group of cells derived from muscle of any kind (for example, skeletal muscle and smooth muscle, e.g. from the digestive tract, urinary bladder, blood vessels or cardiac tissue). Such muscle cells may be differentiated or undifferentiated, such as myoblasts, myocytes, myotubes, cardiomyocytes and cardiomyoblasts.
  • transduction is used to refer to the administration/delivery of a polynucleotide of interest (e.g., a polynucleotide sequence encoding a-sarcoglycan) to a recipient cell either in vivo or in vitro, via a replication-deficient rAAV described resulting in expression of alpha-sarcoglycan by the recipient cell.
  • a polynucleotide of interest e.g., a polynucleotide sequence encoding a-sarcoglycan
  • mice were bred and maintained as homozygous animals under standardized conditions in the Animal Resources Core at the Research Institute at National Children’s Hospital. Mice were maintained on Teklad Global Rodent Diet (3.8% fiber, 18.8% protein, 5% fat chow) with a 12:12-hour dark:light cycle. All animals were housed in standard mouse cages with food and water ad libitum. Genotyping [00179] DNA genotyping was used to identify sgca-/- mice.
  • DNA from tail clippings was isolated and analyzed by polymerase chain reaction (PCR) using OneTaq DNA Polymerase (New England Biolabs, Ipswich, MA).
  • PCR polymerase chain reaction
  • a series of primers was used in the PCR analysis to determine the a-SG knockout status.
  • the following primers and conditions were used: Intron1 (CAGGGCTGGGAGCTGGGTTCTG; SEQ ID NO: 9); mutant primer-intron 3 (CCCAGGGCCTTGATGCCT; SEQ ID NO: 10); and NEOTR (GCTATCAGGACATAGCGTTGGCTA; SEQ ID NO: 11).
  • scAAVrh74.tMCK.hSGCA transgene cassette was made using an adeno-associated virus (AAV) vector DNA plasmid pAAV.tMCK.aSG-neo, by inserting the tMCK expression cassette driving a codon-optimized human a-SG cDNA sequence (human cDNA, Genbank Accession # U08895) into the self-complementary vector backbone pHpa7.
  • AAV adeno-associated virus
  • the only viral sequences included in this vector are the inverted terminal repeats of AAV2, which are required for both viral DNA replication and packaging of the rAAV vector genome.
  • One of the inverted terminal repeats (ITRs) has a targeted deletion of the terminal resolution site (TRS) to restrict replication from this ITR facilitating generation of the dimeric replicative form for self-complementary vector packaging.
  • the AAVrh74 virus has been proven in mice, non-human primates (NHPs), and humans to be safe and highly efficient in transducing muscle across the vascular barrier.
  • Vector production [00181] The recombinant AAV, (sc)rAAVrh74.tMCK.hSGCA, was made in by triple transfection.
  • a qPCR-based titration method was used to determine an encapsulated vg titer utilizing a Prism 7500 Fast Taqman detector system (PE Applied Biosystems).
  • the construct comprises a chimeric intron to promote high-level expression.
  • the chimeric intron is composed of the 5' donor site from the first intron of the human b-globin gene and the branchpoint and 3' splice acceptor site from the intron that is between the leader and the body of an immunoglobulin gene heavy chain variable region.
  • the rAAV also comprises a synthetic SV40 polyadenylation signal is used for efficient transcription termination.
  • a schematic of the expression cassette is shown below in Figure 1.
  • the vector was produced using the human alpha-sacroglycan (a-SG) gene flanked by AAV2 ITR sequences and encapsidated into AAVrh74 virions.
  • the construct contains the tMCK immediate early promoter/enhancer (GenBank Accession No. M21390) and uses the ß-globin intron for high-level expression.
  • Gene delivery [00182] Systemic delivery in mice was achieved through injection of vector into the tail vein of sgca-/- mice.
  • mice were injected with a 1x10 12 vg, 3x10 12 vg, or 6x10 12 vg total dose (mice ranging from 13–20 g; 5x10 13 vg/kg, 1x10 14 vg/kg, and 2x10 14 vg/kg—the dosages based on a supercoiled DNA or plasmid as the quantitation standard--respectively, based on a 20-g mouse) of scAAVrh74.tMCK.hSGCA diluted in lactated Ringer’s solution in a 200-250 mL volume using a 30- gauge ultra-fine insulin syringe.
  • mice All treated mice were injected at 4-5 weeks of age and euthanized 12 weeks post-injection.
  • the dose is about 1.85 x 10 13 vg/kg or 7.41 x 10 13 vg/kg based on a linearized DNA or plasmid as the quantitation standard.
  • DIA strips were tied firmly with braided surgical silk (6/0; Surgical Specialties, Reading, PA) at the central tendon, and sutured through a portion of rib bone affixed to the distal end of the strip.
  • Each muscle was transferred to a water bath filled with oxygenated K-H solution that was maintained at 37°C.
  • the muscles were aligned horizontally and tied directly between a fixed pin and a dual-mode force transducer-servomotor (305C; Aurora Scientific, Aurora, Ontario, Canada).
  • Two platinum plate electrodes were positioned in the organ bath so as to flank the length of the muscle. The muscle was stretched to optimal length for measurement of twitch contractions, and then allowed to rest for 10 minutes before initiation of the tetanic protocol.
  • the muscle was set to an optimal length of 1 g and subjected to a warm-up, which consisted of three 1-Hz twitches every 30 sec followed by three 150-Hz twitches every minute.
  • the DIA was stimulated at 20, 50, 80, 120, 150, 180 Hz, allowing a 2-min rest period between each stimulus, each with a duration of 250 ms to determine maximum tetanic force. Muscle length and weight were measured. The force was normalized for muscle weight and length.
  • mice were anesthetized via intraperitoneal cavity using ketamine/xylazine mixture (100 mg/kg and 10 mg/kg, respectively). Under a dissecting scope, the hind limb skin was removed to expose the TA muscle and patella. A double square was tied around the patella tendon with a 4-0 suture. The TA distal tendon was then dissected out and a double square knot was tied around the tendon with 4-0 suture as close to the muscle as possible and then the tendon was cut. The exposed muscle was constantly dampened with saline. Mice were then transferred to a thermal controlled platform and maintained at 37°C.
  • the knee was secured to the metal pin with the patella tendon suture and the distal TA tendon suture to the level arm of the force transducer (Aurora Scientific, Aurora, Canada).
  • An electrode was placed near the sciatic nerve to stimulate it.
  • the resting tension was set to a length (optimal length) where twitch contractions were maximal.
  • the TA was stimulated at 50, 100, 150 and 200 Hz, allowing a 1-min rest between each stimulus.
  • the muscles were then subjected to a series of 10 isometric contractions, occurring at 1-min intervals with a 10% stretch-re- lengthening procedure.
  • mice were then euthanized and the TA muscle was dissected and frozen for histology.
  • Immunofluorescence [00186] Cryosections (12-mm thick) from the TA, gastrocnemius (GAS), quadricep (QD), psoas major (PSOAS), gluteus (GLUT), tricep (TRI), DIA, and heart (HRT) muscles were subjected to immunofluorescence staining for the hSGCA transgene. Sections were incubated with a rabbit monoclonal a-SG primary antibody (Abcam; Cambridge, UK; catalog no.ab189254) at a dilution of 1:100.
  • a 1:1,000 dilution of a rabbit monoclonal mouse vinculin antibody (Invitrogen, catalog no.70062) was also used.
  • Anti- mouse (Millipore, catalog no. AP308P) and anti-rabbit (Life Technologies, catalog no.656120) secondary horseradish peroxidase antibodies were used for enhanced chemiluminescence immunodetection.
  • PCR Biodistribution quantitative polymerase chain reaction
  • a vector-specific primer probe set was used to amplify a sequence of the intronic region directly downstream from the tMCK promoter that is unique and located within the scAAVrh.74.tMCK.hSGCA transgene cassette.
  • the following primers and probe were used in this study: tMCK intron Forward Primer 5-ACC CGA GAT GCC TGG TTA TAA TT-3; tMCK intron Reverse Primer 5-TCC ATG GTG TAC AGA GCC TAA GAC-3; and tMCK intron probe 5-FAM-CTG CTG CCT GAG CCT GAG CGG TTA C- IABkFQ-3’ (Integrated DNA Technologies). Copy number was reported as vector genomes per microgram of genomic DNA.
  • mice that were not individually housed.
  • Mouse activity was monitored using the Photobeam activity system (San Diego Instruments, San Diego, CA). This system uses a grid of invisible infrared light beams that traverse the animal chamber front to back and left to right to monitor the position and movement of the mouse within an x-y-z plane. Activity was recorded for 1-hour cycles at 5-min intervals. Mice were acclimatized to the activity test room for an initial 1-hour session several days prior to beginning data acquisition. Mice were tested in individual chambers in sets of four. The testing equipment was cleaned between each use to reduce mouse reactionary behavioral variables that could alter results.
  • mice deficient for a-SG showed a complete absence of the protein when analyzed by immunofluorescence (Fig.2A; representative images of TA, GAS, TRI and DIA).
  • the therapeutic dose of 1x10 12 vg total dose resulted in a mean 54 ⁇ 23.81% vector transduction across all skeletal muscles including the DIA 4 weeks post-gene delivery.
  • mice were euthanized 12 weeks post-gene delivery to assess hSGCA transgene expression in the TA, GAS, QD, GLUT, PSOAS, TRI, DIA, and HRT muscles using immunofluorescence.
  • Mean hSGCA expression in mice treated with the lowest dose of 1x10 12 vg total dose (5x10 13 vg/kg) was 70.07 ⁇ 3.71% overall expression in the skeletal muscles, including the DIA.
  • Mean hSGCA expression in mice treated with the intermediate dose of 3x10 12 vg total dose (1x10 14 vg/kg) was 85.35 ⁇ 2.36% in all skeletal muscles.
  • hSGCA expression in mice treated with the highest dose of 6x10 12 vg total dose (2x10 14 vg/kg) was 93.86 ⁇ 2.02% in all skeletal muscles.
  • the doses were calculated based on a supercoiled DNA or plasmid as the quantitation standard.
  • the hSGCA expression in the HRT muscle remained at 75% independent of dose. Representative images of tissues are shown in Fig.2A.
  • the robust hSGCA expression shows efficacy of gene delivery at all three doses. The gene delivery targeted multiple muscles in both forelimbs and hind limbs, showing exceptional a-SG expression in the mice at all three doses. Most importantly, the vital diaphragm muscle also showed a-SG gene expression after delivery.
  • a normalization of fiber size distribution similar to that observed in wild-type controls, was observed in the TA, QD, and TRI of scAAVrh74.tMCK.hSGCA-treated sgca -/- mice compared to vehicle-treated sgca -/- controls.
  • the average diameter size of fibers was significantly increased at all doses in the TA, QD, and TRI muscles compared to vehicle-treated sgca-/- control mice (Table 1).
  • TA tibialis anterior
  • GAS gastrocnemius
  • QD quadricep
  • GLUT gluteus
  • PSO psoas majorl
  • AVG average
  • TRI tricept
  • Example 3 scAAVrh74.tMCK.hSGCA rAAV improved diaphragm and tibialis anterior muscle function and increases locomotor ability [00201] As weakness and loss of function of proximal muscles are major symptoms of LGMD2D and respiratory failure is the leading cause of death in LGMD2D, improving the functionality and strength of the TA and DIA is imperative to increasing the length and quality of life in subjects with LGMD2D. Strips of the DIA and whole TA muscles were used to confirm the correlation between hSGCA expression and muscle strength.
  • TA muscles of sgca -/- mice exhibited a significant functional deficit of 44% in the reduction of specific force output compared to wild-type mice (161.6 ⁇ 8.20 mN/mm 2 vs.291.7 ⁇ 6.17 mN/mm 2 , respectively; p ⁇ 0.0001), as well as a greater loss of force from that produced following a rigorous eccentric contraction protocol (44.0 ⁇ 6.0% loss in sgca -/- mice; 18.0 ⁇ 1.0% loss in wild-type mice; p ⁇ 0.0001) (Fig.5A).
  • mice The ambulation-related activities of mice were monitored to determine if the lack of a-SG in the sgca -/- mouse leads to a decrease in ambulation compared to wild-type mice.
  • the mean horizontal ambulatory beam breaks recorded in the sgca -/- mice was 2000 ⁇ 159 beam breaks/hr, a 77.5% decrease in ambulation compared to 8911 ⁇ 1193 beam breaks/ hr in wild-type controls.
  • the mean vertical rearing beam breaks recorded in the sgca -/- mice was 24.75 ⁇ 11.47 beam breaks/hr, a 97% decrease in vertical rearing compared to 803.3 ⁇ 55.03 beam break/hr in wild-type mice.
  • the ambulation and vertical rearing activities of mice increased 12 weeks post-gene delivery.
  • the mean horizontal ambulation increased to 3595 ⁇ 55.03 beam breaks/hr in mice treated with 1x10 12 vg total dose, 5238 ⁇ 861.9 beam breaks/hr in mice treated with 3x10 12 vg total dose, and 6487 ⁇ 467.9 beam breaks/hr in mice treated with 6x10 12 vg total dose.
  • the physical activities of the treated mice showed improvement from 44%-69% in ambulation and 92%-94% in vertical rearing compared to vehicle-treated sgca -/- mice. Additionally, serum creatine kinase levels were significantly reduced in all treated groups compared to untreated mice (Fig.5D).
  • Vector-specific tMCK.hSGCA primer probe sets were used to detect vector genomes in all muscles and organs tested from the scAAVrh74.tMCK/hSGCA-dosed sgca -/- mice. As expected, vector genomes were present in the tissues tested, with the highest copy number in the liver, followed by muscles. Western blots of alpha-sarcoglycan protein in the liver of WT and sgca-/- mice treated with either vehicle (sgca -/- LR) or scAArh74.tMCK.hSGCA are shown in Fig.7B.
  • the hSGCA cDNA sequence is packaged into a self-complementary vector.
  • Self-complementary AAV vectors contain an inverted repeat genome that promotes the formation of dsDNA, thus allowing replication and transcription to occur without the need for multiple vector genomes to promote these processes.
  • use of self-complementary vectors eliminates the rate-limiting step to allow more rapid expression of the transgene.
  • Applicant has shown that intravascular delivery of scAAVrh74.tMCK.hSGCA in patients with LGMD2D was associated with increased a-SG expression 180 days post-gene transfer at doses of 1 x 10 12 and 3 x 10 12 .
  • Intravenous delivery of scAAVrh74.tMCK.hSGCA provides muscles with increased strength and resistance against contraction-induced damage in the tibialis anterior and diaphragm muscles in all three vector-treated cohorts compared to vehicle-treated controls.
  • treatment with scAAVrh74.tMCK.hSGCA resulted in a significant reduction in CK.
  • mice were able to ambulate and rear onto hind limbs more frequently than vehicle-treated mice.
  • Prominent histopathology which includes centrally located nuclei, wide variability in fiber size, inflammation, necrosis, and fibrosis, is typically observed through muscle biopsies of patients with LGMD2D After hSGCA delivery, mice had a reduction in CN, a more even distribution of myofiber size, and a reduction in collagen content, with muscles having an overall healthier appearance compared to vehicle-treated mice. The total reduction in histopathology and scar tissue was concomitantly associated with improvement in the overall normal function and physiology of the muscles in vector-treated mice. [00210] Finally, safety studies conducted through quantitative PCR, serum chemistry analysis, and histopathology did not review signs of toxicity.
  • tMCK promoter was detected only in targeted tissues (all muscles) and was absent in other (non-muscle) organs, except for the liver. tMCK detection in the liver is not uncommon or concerning as it is a clearance organ. Histopathology review of all tissues (including liver) by a certified veterinarian pathologist concluded that the systemic delivery of scAAVrh74.tMCK.hSGCA was not only safe in all tissues but also that gene delivery dramatically reduced the amount of dystrophic pathology found in skeletal muscles of vehicle-treated sgca -/- mice. Chemistries performed on blood samples of vector-treated mice also support the lack of toxicity.
  • the dose-escalation study provides preclinical data to support that the lowest dose systemically tested here, i.e 1 x 10 12 vg total (5 x 10 13 vg/kg), is ample to reduce the signs and symptoms associated with loss of a-SG protein.
  • Safety studies show no signs of toxicity, even at the highest delivered dose of 6 x 10 12 vg total (2 x 10 14 vg/kg).
  • Example 4 Elder patients and durability
  • the rAAVrh74.tMCK.hSGCA -mediated gene replacement has shown positive results in treating LGMD-2D and other associated diseases. This study was designed to test the ability of rAAVrh74.tMCK.hSGCA to treat older, more severely affected muscle, and to determine the long-term durability of the AAV viral vector. [00213] All procedures were conducted in accordance with approval by the Research Institute at the National Children’s Hospital Institutional Animal Care and Use Committee. Mice were maintained under standardized conditions on a 12:12-hour light:dark cycle, with food and water provided ad libitum.
  • LRS lactated ringers solution
  • muscle from the treated mice were evaluated for SCGA protein expression, histological rescue, and functional improvement.
  • scAAVrh74.tMCK.hSGCA Functional improvement after administration of scAAVrh74.tMCK.hSGCA was evidenced by improved force output (specific force) in the tibialis anterior (TA) and diaphragm (DIA) muscle and increased resistance to contraction-induced injury in the TA muscle (Fig.10).
  • TA tibialis anterior
  • DIA diaphragm
  • sgca -/- mice at 4 weeks of age are systemically administered rAAVrh74.tMCK.hSGCA. More than 24 months post-treatment, the vector genome copy numbers are detected with qPCR across all transduced muscles tested (TA, TRI, DIA, GLUT, PSOAS, GAS and QUAD). Protein expression and localization is studied by immunofluorescence staining of treated muscle.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Toxicology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Neurology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/US2020/047339 2019-08-21 2020-08-21 Adeno-associated virus vector delivery of alpha-sarcoglycan and the treatment of muscular dystrophy Ceased WO2021035120A1 (en)

Priority Applications (28)

Application Number Priority Date Filing Date Title
KR1020227007040A KR20220092489A (ko) 2019-08-21 2020-08-21 알파-사코글리칸의 아데노 관련 바이러스 벡터 전달 및 근위축증 치료
SM20240152T SMT202400152T1 (it) 2019-08-21 2020-08-21 Erogazione di vettore di virus adeno-associato di alfa-sarcoglicano e il trattamento di distrofia muscolare
HRP20240505TT HRP20240505T1 (hr) 2019-08-21 2020-08-21 Dostava alfa-sarkoglikana vektorom povezanim s adenovirusom i liječenje mišićne distrofije
MYPI2022000917A MY210230A (en) 2019-08-21 2020-08-21 Adeno-associated virus vector delivery of alpha-sarcoglycan and the treatment of muscular dystrophy
CA3150964A CA3150964A1 (en) 2019-08-21 2020-08-21 Adeno-associated virus vector delivery of alpha-sarcoglycan and the treatment of muscular dystrophy
EP24212789.2A EP4488287A3 (en) 2019-08-21 2020-08-21 Adeno-associated virus vector delivery of alpha-sarcoglycan and the treatment of muscular dystrophy
AU2020331987A AU2020331987B2 (en) 2019-08-21 2020-08-21 Adeno-associated virus vector delivery of alpha-sarcoglycan and the treatment of muscular dystrophy
LTEPPCT/US2020/047339T LT4017871T (lt) 2019-08-21 2020-08-21 Alfa-sarkoglikano pristatymas adeno-asocijuoto viruso vektoriumi ir raumenų distrofijos gydymas
JP2022510976A JP7532503B2 (ja) 2019-08-21 2020-08-21 アルファ-サルコグリカンのアデノ随伴ウイルスベクター送達、および筋ジストロフィーの治療
ES20765424T ES2978666T3 (es) 2019-08-21 2020-08-21 Suministro de alfa-sarcoglicano por vector de virus adenoasociado y tratamiento de la distrofia muscular
FIEP20765424.5T FI4017871T3 (fi) 2019-08-21 2020-08-21 Alfa-sarkoglykaaniin liittyvä adeno-assosioidun virusvektorin antaminen ja lihasdystrofian hoito
RS20240449A RS65421B1 (sr) 2019-08-21 2020-08-21 Isporuka adeno-asociranog virusnog vektora alfa-sarkoglikana i lečenje mišićne distrofije
MX2022002132A MX2022002132A (es) 2019-08-21 2020-08-21 Administracion de vectores de virus adenoasociado de alfa-sarcoglicano y el tratamiento de la distrofia muscular.
DK20765424.5T DK4017871T5 (da) 2019-08-21 2020-08-21 Adenoassocieret virusvektoradministration af alfa-sarcoglycan og behandling af muskeldystrofi
EP24152241.6A EP4374880A3 (en) 2019-08-21 2020-08-21 Adeno-associated virus vector delivery of alpha-sarcoglycan and the treatment of muscular dystrophy
PL20765424.5T PL4017871T3 (pl) 2019-08-21 2020-08-21 Dostarczanie alfa-sarkoglikanu za pomocą wektora wirusa związanego z adenowirusami i leczenie dystrofii mięśniowej
BR112022003142A BR112022003142A2 (pt) 2019-08-21 2020-08-21 Entrega de vetor de vírus adenoassociado de alfa-sarcoglicano e tratamento de distrofia muscular
CN202510544897.2A CN120400170A (zh) 2019-08-21 2020-08-21 Α-肌聚糖的腺相关病毒载体递送和肌营养不良症的治疗
US17/635,978 US12258573B2 (en) 2019-08-21 2020-08-21 Adeno-associated virus vector delivery of alpha-sarcoglycan and the treatment of muscular dystrophy
EP20765424.5A EP4017871B1 (en) 2019-08-21 2020-08-21 Adeno-associated virus vector delivery of alpha-sarcoglycan and the treatment of muscular dystrophy
CN202080073755.8A CN114945583B (zh) 2019-08-21 2020-08-21 Α-肌聚糖的腺相关病毒载体递送和肌营养不良症的治疗
SI202030411T SI4017871T1 (sl) 2019-08-21 2020-08-21 Dostava alfa-sarkoglikana z adeno povezanim virusnim vektorjem in zdravljenje mišične distrofije
IL290734A IL290734A (en) 2019-08-21 2022-02-20 Adeno-associated virus vector delivery of alpha-sarcoglycan and the treatment of muscular dystrophy
CONC2022/0002864A CO2022002864A2 (es) 2019-08-21 2022-03-11 Administración de vectores de virus adenoasociado de alfa-sarcoglicano y el tratamiento de la distrofia muscular
JP2024124753A JP2024156816A (ja) 2019-08-21 2024-07-31 アルファ-サルコグリカンのアデノ随伴ウイルスベクター送達、および筋ジストロフィーの治療
US18/991,087 US20250122531A1 (en) 2019-08-21 2024-12-20 Adeno-associated virus vector delivery of alpha-sarcoglycan and the treatment of muscular dystrophy
IL323311A IL323311A (en) 2019-08-21 2025-09-11 Administration of an alpha-sarcoglycan adenovirus-related vector and treatment of muscular dystrophy
JP2026005785A JP2026065148A (ja) 2019-08-21 2026-01-16 アルファ-サルコグリカンのアデノ随伴ウイルスベクター送達、および筋ジストロフィーの治療

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US201962889749P 2019-08-21 2019-08-21
US62/889,749 2019-08-21
US202063014934P 2020-04-24 2020-04-24
US63/014,934 2020-04-24
US202063022843P 2020-05-11 2020-05-11
US63/022,843 2020-05-11

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US17/635,978 A-371-Of-International US12258573B2 (en) 2019-08-21 2020-08-21 Adeno-associated virus vector delivery of alpha-sarcoglycan and the treatment of muscular dystrophy
US18/991,087 Continuation US20250122531A1 (en) 2019-08-21 2024-12-20 Adeno-associated virus vector delivery of alpha-sarcoglycan and the treatment of muscular dystrophy

Publications (1)

Publication Number Publication Date
WO2021035120A1 true WO2021035120A1 (en) 2021-02-25

Family

ID=72340432

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/047339 Ceased WO2021035120A1 (en) 2019-08-21 2020-08-21 Adeno-associated virus vector delivery of alpha-sarcoglycan and the treatment of muscular dystrophy

Country Status (25)

Country Link
US (2) US12258573B2 (https=)
EP (3) EP4374880A3 (https=)
JP (3) JP7532503B2 (https=)
KR (1) KR20220092489A (https=)
CN (2) CN114945583B (https=)
AU (1) AU2020331987B2 (https=)
BR (1) BR112022003142A2 (https=)
CA (1) CA3150964A1 (https=)
CO (1) CO2022002864A2 (https=)
DK (1) DK4017871T5 (https=)
ES (1) ES2978666T3 (https=)
FI (1) FI4017871T3 (https=)
HR (1) HRP20240505T1 (https=)
HU (1) HUE066215T2 (https=)
IL (2) IL290734A (https=)
LT (1) LT4017871T (https=)
MX (1) MX2022002132A (https=)
MY (1) MY210230A (https=)
PL (1) PL4017871T3 (https=)
PT (1) PT4017871T (https=)
RS (1) RS65421B1 (https=)
SI (1) SI4017871T1 (https=)
SM (1) SMT202400152T1 (https=)
TW (1) TWI873172B (https=)
WO (1) WO2021035120A1 (https=)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4198046A1 (en) * 2021-12-16 2023-06-21 Genethon Alpha-sarcoglycan gene transfer increase using modified itr sequences
US12257317B2 (en) 2017-03-17 2025-03-25 Newcastle University Adeno-associated virus vector delivery of a fragment of micro-dystrophin to treat muscular dystrophy
US12263230B2 (en) 2018-01-31 2025-04-01 Research Institute At Nationwide Children's Hospital Gene therapy for limb-girdle muscular dystrophy type 2C
US12285497B2 (en) 2021-10-15 2025-04-29 Research Institute At Nationwide Children's Hospital Self-complementary adeno-associated virus vector and its use in treatment of muscular dystrophy
US12377170B2 (en) 2019-02-26 2025-08-05 Research Institute At Nationwide Children's Hospital Adeno-associated virus vector delivery of β-sarcoglycan and the treatment of muscular dystrophy
US12391928B2 (en) 2018-06-29 2025-08-19 Research Institute At Nationwide Children's Hospital Recombinant adeno-associated virus products and methods for treating limb girdle muscular dystrophy 2A
WO2025226842A1 (en) 2024-04-24 2025-10-30 Kate Therapeutics, Inc. Expression control by drg-expressed mirnas
US12472239B2 (en) 2015-11-16 2025-11-18 Research Institute At Nationwide Children's Hospital Guide RNA for repairing a mutant human titin gene using CRISPR technology
US12491265B2 (en) 2018-06-18 2025-12-09 Research Institute At Nationwide Children's Hospital Adeno-associated virus vector delivery of muscle specific micro-dystrophin to treat muscular dystrophy
WO2026011009A1 (en) 2024-07-02 2026-01-08 Kate Therapeutics, Inc. Compositions and methods for muscle disorders

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RS65421B1 (sr) * 2019-08-21 2024-05-31 Res Inst Nationwide Childrens Hospital Isporuka adeno-asociranog virusnog vektora alfa-sarkoglikana i lečenje mišićne distrofije

Citations (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
WO1995013392A1 (en) 1993-11-09 1995-05-18 Medical College Of Ohio Stable cell lines capable of expressing the adeno-associated virus replication gene
WO1995013365A1 (en) 1993-11-09 1995-05-18 Targeted Genetics Corporation Generation of high titers of recombinant aav vectors
WO1996017947A1 (en) 1994-12-06 1996-06-13 Targeted Genetics Corporation Packaging cell lines for generation of high titers of recombinant aav vectors
WO1997006243A1 (fr) 1995-08-10 1997-02-20 Pasteur Merieux Serums Et Vaccins Procede de purification de virus par chromatographie
WO1997008298A1 (en) 1995-08-30 1997-03-06 Genzyme Corporation Chromatographic purification of adenovirus and aav
WO1997009441A2 (en) 1995-09-08 1997-03-13 Genzyme Corporation Improved aav vectors for gene therapy
WO1997021825A1 (en) 1995-12-15 1997-06-19 Systemix, Inc. Method for obtaining retroviral packaging cell lines producing high transducing efficiency retroviral supernatant
WO1998009657A2 (en) 1996-09-06 1998-03-12 Trustees Of The University Of Pennsylvania Method for recombinant adeno-associated virus-directed gene therapy
US5786211A (en) 1994-06-06 1998-07-28 Children's Hospital, Inc. Adeno-associated virus materials and methods
US5871982A (en) 1994-10-28 1999-02-16 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV virus and methods of use thereof
WO1999011764A2 (en) 1997-09-05 1999-03-11 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of recombinant aav vectors
US6258595B1 (en) 1999-03-18 2001-07-10 The Trustees Of The University Of Pennsylvania Compositions and methods for helper-free production of recombinant adeno-associated viruses
WO2001083692A2 (en) 2000-04-28 2001-11-08 The Trustees Of The University Of Pennsylvania Recombinant aav vectors with aav5 capsids and aav5 vectors pseudotyped in heterologous capsids
WO2002053703A2 (en) 2001-01-05 2002-07-11 Children's Hospital, Inc. Aav2 vectors and methods
US6566118B1 (en) 1997-09-05 2003-05-20 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of released recombinant AAV vectors
WO2013078316A1 (en) 2011-11-23 2013-05-30 Nationwide Children's Hospital, Inc. Recombinant adeno-associated virus delivery of alpha-sarcoglycan polynucleotides
US9613872B2 (en) 2014-09-29 2017-04-04 Kabushiki Kaisha Toshiba Method of manufacturing semiconductor device
US9614423B2 (en) 2012-04-07 2017-04-04 Traugott Weller Method for producing rotating electrical machines
US9620777B2 (en) 2013-09-30 2017-04-11 Tdk Corporation Positive electrode and lithium ion secondary battery using thereof
US9818600B2 (en) 2014-03-21 2017-11-14 Hitachi Kokusai Electric, Inc. Substrate processing apparatus and method of manufacturing semiconductor device

Family Cites Families (89)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0127839B1 (en) 1983-05-27 1992-07-15 THE TEXAS A&M UNIVERSITY SYSTEM Method for producing a recombinant baculovirus expression vector
ZA848495B (en) 1984-01-31 1985-09-25 Idaho Res Found Production of polypeptides in insect cells
US5449616A (en) 1990-05-23 1995-09-12 University Of Iowa Research Foundation Nucleic acid encoding dystrophin-associated protein
WO1995003392A1 (en) 1993-07-23 1995-02-02 Unichema Chemie Bv Process for producing transparent soap material
US6204059B1 (en) 1994-06-30 2001-03-20 University Of Pittsburgh AAV capsid vehicles for molecular transfer
US5672694A (en) 1995-10-24 1997-09-30 University Of Iowa Research Foundation β-sarcoglycan nucleic acid sequence, and nucleic acid probes
US5843078A (en) 1997-07-01 1998-12-01 Sharkey; Hugh R. Radio frequency device for resurfacing skin and method
WO1999043360A1 (en) 1998-02-26 1999-09-02 The Trustees Of The University Of Pennsylvania Stable protection from dystrophic sarcolemmal degeneration and restoration of the sarcoglycan complex
US6262035B1 (en) 1998-10-01 2001-07-17 University Of Iowa Research Foundation Gene replacement therapy for muscular dystrophy
US6632800B1 (en) 1999-08-17 2003-10-14 Mayo Foundation For Medical Education And Research System for monitoring the expression of transgenes
JP4520569B2 (ja) 2000-02-18 2010-08-04 照彦 豊岡 拡張型心筋症の遺伝子治療剤
US20040126762A1 (en) 2002-12-17 2004-07-01 Morris David W. Novel compositions and methods in cancer
PT1453547T (pt) 2001-12-17 2016-12-28 Univ Pennsylvania Sequências do vírus adeno-associado (aav) do serotipo 8, vetores contendo as mesmas, e utilizações destas
AU2003212708A1 (en) 2002-03-05 2003-09-16 Stichting Voor De Technische Wetenschappen Baculovirus expression system
US20030225260A1 (en) 2002-04-30 2003-12-04 Snyder Richard O. Production of recombinant AAV virions
US7858367B2 (en) 2002-04-30 2010-12-28 Duke University Viral vectors and methods for producing and using the same
BRPI0511764B8 (pt) 2004-06-01 2021-05-25 Avigen Inc método de prevenção de agregação de vírions de vírus adeno-associado recombinante (raav) em uma preparação purificada de virions raav
US7972593B2 (en) 2004-06-10 2011-07-05 Saint Louis University Delivery of therapeutic agents to the bone
US20090054823A1 (en) 2004-09-30 2009-02-26 The Trustees Of The University Of Pennsylvania Perfusion circuit and use therein in targeted delivery of macromolecules
JP2006121961A (ja) 2004-10-28 2006-05-18 Univ Of Tokushima 顎骨骨幹異形成症gddの原因遺伝子gdd1とその用途
US7883858B2 (en) 2005-01-27 2011-02-08 Institute For Systems Biology Methods for identifying and monitoring drug side effects
US7788045B2 (en) 2005-09-01 2010-08-31 Meditasks, Llc Systems and method for homeostatic blood states
EP1938104A2 (en) 2005-10-17 2008-07-02 Institute for Systems Biology Tissue-and serum-derived glycoproteins and methods of their use
WO2007049095A1 (en) 2005-10-25 2007-05-03 Cellectis Laglidadg homing endonuclease variants having mutations in two functional subdomains and use thereof
EP2018421B1 (en) 2006-04-28 2012-12-19 The Trustees of the University of Pennsylvania Scalable production method for aav
EP2052088A2 (en) 2006-08-02 2009-04-29 Genizon Biosciences Genemap of the human genes associated with psoriasis
AU2007284651B2 (en) 2006-08-09 2014-03-20 Institute For Systems Biology Organ-specific proteins and methods of their use
EP2087098A4 (en) 2006-11-09 2010-03-31 Univ Johns Hopkins DETERMINATION OF CARDIOMYOCYTES ADULT MAMMALS IN HEART STEM CELLS
CN101711164B (zh) 2007-01-18 2014-06-04 密苏里-哥伦比亚大学 可修复肌纤维膜中的神经元型一氧化氮合酶的合成小/微-抗肌萎缩蛋白基因
FR2919305B1 (fr) 2007-07-26 2009-09-18 Genethon Ass Loi De 1901 Vecteurs viraux adeno-associes pour l'expression de la dysferline.
GB0715087D0 (en) 2007-08-03 2007-09-12 Summit Corp Plc Drug combinations for the treatment of duchenne muscular dystrophy
ES2639852T3 (es) 2007-10-26 2017-10-30 Academisch Ziekenhuis Leiden Medios y métodos para contrarrestar los trastornos musculares
JP5634272B2 (ja) 2008-03-14 2014-12-03 ヒューマンザイム リミテッド ヒト細胞発現系を用いる真正ヒトタンパク質の組換え生産
US20090280103A1 (en) 2008-04-04 2009-11-12 Martin Flueck Regulation of muscle repair
WO2009137006A2 (en) * 2008-04-30 2009-11-12 The University Of North Carolina At Chapel Hill Directed evolution and in vivo panning of virus vectors
US8236557B2 (en) 2008-05-28 2012-08-07 University Of Missouri-Columbia Hybrid-AAV vectors to deliver large gene expression cassette
US20100026655A1 (en) 2008-07-31 2010-02-04 Avago Technologies Ecbu Ip (Singapore) Pte. Ltd. Capacitive Touchscreen or Touchpad for Finger or Stylus
US8729041B2 (en) 2008-12-03 2014-05-20 The Johns Hopkins University Compositions and methods for treating hepatic neoplasia
US20110023139A1 (en) 2008-12-04 2011-01-27 Sigma-Aldrich Co. Genomic editing of genes involved in cardiovascular disease
US20100247495A1 (en) 2009-03-30 2010-09-30 Tom Ichim Treatment of Muscular Dystrophy
WO2011044138A1 (en) 2009-10-05 2011-04-14 Catabasis Pharmaceuticals, Inc. Lipoic acid acylated salicylate derivatives and their uses
KR101841752B1 (ko) 2009-11-03 2018-05-04 더 리전트 오브 더 유니버시티 오브 캘리포니아 저온 수용액 내에서 성장한 다중 표면들 상의 산화 아연 층들에 의해 커버되는 고휘도 발광 다이오드
FR2962041B1 (fr) 2010-07-01 2012-07-27 Genethon Inhibiteurs de la calpaine 3 pour le traitement de dystrophies musculaires et de cardiomyopathies
EP2736539B1 (en) 2011-07-25 2017-08-23 Nationwide Children's Hospital, Inc. Recombinant virus products and methods for inhibition of expression of dux4
WO2013075008A1 (en) 2011-11-16 2013-05-23 University Of Florida Research Foundation Inc. Aav dual vector systems for gene therapy
MX367100B (es) 2012-02-17 2019-08-05 The Children´S Hospital Of Philadelphia Composiciones del vector aav y metodos para su transferencia genetica a celulas, organos y tejidos.
WO2013151665A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of proteins associated with human disease
US9254311B2 (en) 2012-04-02 2016-02-09 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins
AU2013266968B2 (en) 2012-05-25 2017-06-29 Emmanuelle CHARPENTIER Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
HUE054260T2 (hu) 2012-09-06 2021-08-30 Univ Chicago Antiszensz polinukleotidok exon-ugrás indukálására és eljárások disztrófiák kezelésére
WO2014037526A1 (en) 2012-09-07 2014-03-13 INSERM (Institut National de la Santé et de la Recherche Médicale) In vitro genetic diagnostic of inherited neuromuscular disorders
EP2900821B1 (en) 2012-09-25 2020-04-01 Genzyme Corporation Peptide-linked morpholino antisense oligonucleotides for treatment of myotonic dystrophy
US9624282B2 (en) 2012-11-26 2017-04-18 The Curators Of The University Of Missouri Microdystrophin peptides and methods for treating muscular dystrophy using the same
EP3031921B1 (en) 2012-12-12 2025-03-12 The Broad Institute, Inc. Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications
EP2840140B2 (en) 2012-12-12 2023-02-22 The Broad Institute, Inc. Crispr-Cas based method for mutation of prokaryotic cells
IL239344B2 (en) 2012-12-12 2024-06-01 Broad Inst Inc Systems engineering, methods and optimal guiding components for sequence manipulation
FR3004463A1 (fr) 2013-04-11 2014-10-17 Genethon Systeme d'expression pour une therapie genique selective
CN105492611A (zh) 2013-06-17 2016-04-13 布罗德研究所有限公司 用于序列操纵的优化的crispr-cas双切口酶系统、方法以及组合物
ITTO20130669A1 (it) 2013-08-05 2015-02-06 Consiglio Nazionale Ricerche Vettore adeno-associato ricombinante muscolo-specifico e suo impiego nel trattamento di patologie muscolari
TW201536329A (zh) 2013-08-09 2015-10-01 Isis Pharmaceuticals Inc 用於調節失養性肌強直蛋白質激酶(dmpk)表現之化合物及方法
ES2666322T3 (es) 2013-10-08 2018-05-04 Ystem S.R.L. Composiciones farmacéuticas para el tratamiento de trastornos musculares
US9850497B2 (en) 2013-11-04 2017-12-26 Regents Of The University Of Minnesota Gene targeting methods and tools
EP3470089A1 (en) 2013-12-12 2019-04-17 The Broad Institute Inc. Delivery, use and therapeutic applications of the crispr-cas systems and compositions for targeting disorders and diseases using particle delivery components
PL3097197T3 (pl) 2014-01-21 2021-06-28 Vrije Universiteit Brussel Mięśniowo-specyficzne elementy regulatorowe kwasów nukleinowych oraz sposoby i ich zastosowanie
DE102014207498A1 (de) 2014-04-17 2015-10-22 Universitätsklinikum Hamburg-Eppendorf Viraler Vektor für den zielgerichteten Gentransfer in Gehirn und Rückenmark
EP2960336A1 (en) 2014-06-27 2015-12-30 Genethon Efficient systemic treatment of dystrophic muscle pathologies
JP6832280B2 (ja) 2015-01-16 2021-02-24 ユニバーシティ オブ ワシントンUniversity of Washington 新規のマイクロジストロフィンおよび使用の関連する方法
KR102877920B1 (ko) 2015-11-16 2025-10-30 더 리서치 인스티튜트 앳 네이션와이드 칠드런스 하스피탈 티틴-기반 근증 및 다른 티틴성병증의 치료를 위한 물질 및 방법
WO2017165859A1 (en) 2016-03-24 2017-09-28 Research Institute At Nationwide Children's Hospital Modified viral capsid proteins
ES2977730T3 (es) 2016-04-15 2024-08-29 Res Inst Nationwide Childrens Hospital Administración de microARN-29 y micro-distrofina por virus adenoasociado para tratar la distrofia muscular
MX2018012537A (es) 2016-04-15 2019-02-25 Univ Pennsylvania Terapia de genes para tratar hemofilia a.
LT3442600T (lt) 2016-04-15 2024-05-27 Research Institute At Nationwide Children's Hospital Su adeno virusu susijusio viruso vektoriaus iš β-sarkoglikano ir mikro- rnr-29 pristatymas ir raumenų distrofijos gydymas
CA2971303C (en) 2016-06-21 2026-03-03 Bamboo Therapeutics, Inc. Optimized mini-dystrophin genes and expression cassettes and their use
EP3596112A2 (en) 2017-03-17 2020-01-22 Newcastle University Adeno-associated virus vector delivery of a fragment of micro-dystrophin to treat muscular dystrophy
JP7676111B2 (ja) 2017-03-17 2025-05-14 リサーチ インスティチュート アット ネイションワイド チルドレンズ ホスピタル 筋ジストロフィーを治療するための筋肉特異的マイクロジストロフィンのアデノ随伴ウイルスベクター送達
MA50836A (fr) 2017-10-18 2020-08-26 Res Inst Nationwide Childrens Hospital Administration par vecteur à virus adéno-associé de micro-dystrophine spécifique de muscles pour traiter la dystrophie musculaire
US11926653B2 (en) 2017-10-20 2024-03-12 Research Institute At Nationwide Children's Hospital Methods and materials for NT-3 gene therapy
WO2019118806A1 (en) 2017-12-14 2019-06-20 Solid Biosciences Inc. Non-viral production and delivery of genes
AR114350A1 (es) 2018-01-31 2020-08-26 Res Institute At Nationwide Children’S Hospital Terapia genética para la distrofia muscular de cinturas del tipo 2c
US20210139550A1 (en) 2018-04-03 2021-05-13 Curators Of The University Of Missouri Hinges 1 and/or 4 modified dystrophins for dystrophinopathy therapy
US12152242B2 (en) 2018-04-23 2024-11-26 The Curators Of The University Of Missouri CRISPR therapy
MY208145A (en) 2018-06-18 2025-04-18 Res Inst Nationwide Childrens Hospital Adeno-associated virus vector delivery of muscle specific micro-dystrophin to treat muscular dystrophy
KR20210028162A (ko) 2018-06-29 2021-03-11 더 리서치 인스티튜트 앳 네이션와이드 칠드런스 하스피탈 지대근 이영양증 2a형을 치료하기 위한 재조합 아데노 연관 바이러스 생성물 및 방법
WO2020123645A1 (en) 2018-12-12 2020-06-18 Solid Biosciences Inc. Combination therapy for treating muscular dystrophy
AU2020229340A1 (en) 2019-02-26 2021-09-16 Research Institute At Nationwide Children's Hospital Adeno-associated virus vector delivery of B-sarcoglycan and the treatment of muscular dystrophy
RS65421B1 (sr) * 2019-08-21 2024-05-31 Res Inst Nationwide Childrens Hospital Isporuka adeno-asociranog virusnog vektora alfa-sarkoglikana i lečenje mišićne distrofije
IL299094A (en) 2020-06-15 2023-02-01 Res Inst Nationwide Childrens Hospital Administration of an adeno-associated virus vector for muscular dystrophies
JP2023534127A (ja) 2020-06-17 2023-08-08 アクセルロン ファーマ インコーポレイテッド ActRII-ALK4アンタゴニストおよび心不全を処置する方法
US20230390417A1 (en) 2022-06-02 2023-12-07 Research Institute At Nationwide Children's Hospital Recombinant Adeno-Associated Virus Products and Methods for Treating Limb Girdle Muscular Dystrophy 2A

Patent Citations (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
WO1995013392A1 (en) 1993-11-09 1995-05-18 Medical College Of Ohio Stable cell lines capable of expressing the adeno-associated virus replication gene
WO1995013365A1 (en) 1993-11-09 1995-05-18 Targeted Genetics Corporation Generation of high titers of recombinant aav vectors
US5658776A (en) 1993-11-09 1997-08-19 Targeted Genetics Corporation Generation of high titers of recombinant AAV vectors
US5786211A (en) 1994-06-06 1998-07-28 Children's Hospital, Inc. Adeno-associated virus materials and methods
US5871982A (en) 1994-10-28 1999-02-16 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV virus and methods of use thereof
WO1996017947A1 (en) 1994-12-06 1996-06-13 Targeted Genetics Corporation Packaging cell lines for generation of high titers of recombinant aav vectors
WO1997006243A1 (fr) 1995-08-10 1997-02-20 Pasteur Merieux Serums Et Vaccins Procede de purification de virus par chromatographie
WO1997008298A1 (en) 1995-08-30 1997-03-06 Genzyme Corporation Chromatographic purification of adenovirus and aav
WO1997009441A2 (en) 1995-09-08 1997-03-13 Genzyme Corporation Improved aav vectors for gene therapy
WO1997021825A1 (en) 1995-12-15 1997-06-19 Systemix, Inc. Method for obtaining retroviral packaging cell lines producing high transducing efficiency retroviral supernatant
WO1998009657A2 (en) 1996-09-06 1998-03-12 Trustees Of The University Of Pennsylvania Method for recombinant adeno-associated virus-directed gene therapy
WO1999011764A2 (en) 1997-09-05 1999-03-11 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of recombinant aav vectors
US6566118B1 (en) 1997-09-05 2003-05-20 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of released recombinant AAV vectors
US6258595B1 (en) 1999-03-18 2001-07-10 The Trustees Of The University Of Pennsylvania Compositions and methods for helper-free production of recombinant adeno-associated viruses
WO2001083692A2 (en) 2000-04-28 2001-11-08 The Trustees Of The University Of Pennsylvania Recombinant aav vectors with aav5 capsids and aav5 vectors pseudotyped in heterologous capsids
WO2002053703A2 (en) 2001-01-05 2002-07-11 Children's Hospital, Inc. Aav2 vectors and methods
WO2013078316A1 (en) 2011-11-23 2013-05-30 Nationwide Children's Hospital, Inc. Recombinant adeno-associated virus delivery of alpha-sarcoglycan polynucleotides
US9434928B2 (en) 2011-11-23 2016-09-06 Nationwide Children's Hospital, Inc. Recombinant adeno-associated virus delivery of alpha-sarcoglycan polynucleotides
US10105453B2 (en) 2011-11-23 2018-10-23 Nationwide Children's Hospital, Inc. Recombinant adeno-associated virus delivery of alpha-sarcoglycan polynucleotides
US9614423B2 (en) 2012-04-07 2017-04-04 Traugott Weller Method for producing rotating electrical machines
US9620777B2 (en) 2013-09-30 2017-04-11 Tdk Corporation Positive electrode and lithium ion secondary battery using thereof
US9818600B2 (en) 2014-03-21 2017-11-14 Hitachi Kokusai Electric, Inc. Substrate processing apparatus and method of manufacturing semiconductor device
US9613872B2 (en) 2014-09-29 2017-04-04 Kabushiki Kaisha Toshiba Method of manufacturing semiconductor device

Non-Patent Citations (33)

* Cited by examiner, † Cited by third party
Title
BERNS: "Virology", 1990, RAVEN PRESS, pages: 1743 - 1764
CARTER, CURRENT OPINIONS IN BIOTECHNOLOGY, 1992, pages 1533 - 539
CHU ET AL., GENE, vol. 13, 1981, pages 197
CLARK ET AL., GENE THERAPY, vol. 3, 1996, pages 1124 - 1132
CLARK ET AL., HUM. GENE THER., vol. 10, no. 6, 1999, pages 1031 - 1039
CSERJESIOLSON, MOL CELL BIOL, vol. 11, 1991, pages 4854 - 4862
DAVIS ET AL.: "Basic Methods in Molecular Biology", 1986, ELSEVIER
GRAHAM ET AL., VIROLOGY, vol. 52, 1973, pages 456
HAKIM ET AL., METHODS MOL BIOL, vol. 709, 2011, pages 75 - 89
HERMONAT ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 6466
JERRY R. MENDELL ET AL: "Gene Delivery for Limb-Girdle Muscular Dystrophy Type 2D by Isolated Limb Infusion", HUMAN GENE THERAPY, vol. 30, no. 7, 1 July 2019 (2019-07-01), GB, pages 794 - 801, XP055753316, ISSN: 1043-0342, DOI: 10.1089/hum.2019.006 *
JERRY R. MENDELL ET AL: "Gene therapy for muscular dystrophy: Lessons learned and path forward", NEUROSCIENCE LETTERS, vol. 527, no. 2, 1 October 2012 (2012-10-01), pages 90 - 99, XP055128775, ISSN: 0304-3940, DOI: 10.1016/j.neulet.2012.04.078 *
JERRY R. MENDELL ET AL: "Sustained alpha-sarcoglycan gene expression after gene transfer in limb-girdle muscular dystrophy, type 2D", ANNALS OF NEUROLOGY, vol. 68, no. 5, 29 November 2010 (2010-11-29), pages 629 - 638, XP055078625, ISSN: 0364-5134, DOI: 10.1002/ana.22251 *
JOHNSON ET AL., MOL CELL BIOL, vol. 9, 1989, pages 3393 - 3399
LAUGHLIN ET AL., GENE, vol. 23, 1983, pages 65 - 73
LEBKOWSKI ET AL., MOL. CELL. BIOL., vol. 7, 1988, pages 349
MADERWHITE, PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5603 - 5607
MARSIC ET AL., MOLECULAR THERAPY, vol. 22, no. 11, 2014, pages 1900 - 1909
MCLAUGHLIN ET AL., J. VIROL., vol. 62, 1988, pages 1963 - 174
MUSCAT ET AL., MOL CELL BIOL, vol. 7, 1987, pages 4089 - 4099
MUZYCZKA, CURR. TOPICS IN MICROBIAL. AND IMMUNOL., vol. 158, 1992, pages 97 - 129
PAUL ET AL., HUMAN GENE THERAPY, vol. 4, 1993, pages 609 - 615
PERRIN ET AL., VACCINE, vol. 13, 1995, pages 1244 - 1250
RATSCHIN ET AL., MOL. CELL. BIOL., vol. 4, 1984, pages 2072
ROSE, COMPREHENSIVE VIROLOGY, vol. 3, 1974, pages 1 - 61
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", vol. I & II, 1989, COLD SPRING HARBOR LABORATORY, article "DNA Cloning: A Practical Approach"
SAMULSKI ET AL., J. VIROL., vol. 63, 1989, pages 3822 - 3828
SAMULSKI ET AL., PROC. NATL. ACAD. S6. USA, vol. 79, 1982, pages 2077 - 2081
SCHENPPCLARK, METHODS MOL. MED., 2002, pages 69427 - 443
SEMENZA ET AL., PROC NATL ACAD SCI USA, vol. 88, 1991, pages 5680 - 5684
SENAPATHYCARTER, J. BIOL. CHEM., vol. 259, 1984, pages 4661 - 4666
TRATSCHIN ET AL., MO1. CELL. BIOL., vol. 5, 1985, pages 3251
WEINTRAUB ET AL., SCIENCE, vol. I & II, 1991, pages 761 - 766

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12472239B2 (en) 2015-11-16 2025-11-18 Research Institute At Nationwide Children's Hospital Guide RNA for repairing a mutant human titin gene using CRISPR technology
US12257317B2 (en) 2017-03-17 2025-03-25 Newcastle University Adeno-associated virus vector delivery of a fragment of micro-dystrophin to treat muscular dystrophy
US12263230B2 (en) 2018-01-31 2025-04-01 Research Institute At Nationwide Children's Hospital Gene therapy for limb-girdle muscular dystrophy type 2C
US12491265B2 (en) 2018-06-18 2025-12-09 Research Institute At Nationwide Children's Hospital Adeno-associated virus vector delivery of muscle specific micro-dystrophin to treat muscular dystrophy
US12391928B2 (en) 2018-06-29 2025-08-19 Research Institute At Nationwide Children's Hospital Recombinant adeno-associated virus products and methods for treating limb girdle muscular dystrophy 2A
US12377170B2 (en) 2019-02-26 2025-08-05 Research Institute At Nationwide Children's Hospital Adeno-associated virus vector delivery of β-sarcoglycan and the treatment of muscular dystrophy
US12285497B2 (en) 2021-10-15 2025-04-29 Research Institute At Nationwide Children's Hospital Self-complementary adeno-associated virus vector and its use in treatment of muscular dystrophy
EP4198046A1 (en) * 2021-12-16 2023-06-21 Genethon Alpha-sarcoglycan gene transfer increase using modified itr sequences
WO2023111102A1 (en) 2021-12-16 2023-06-22 Genethon Alpha-sarcoglycan gene transfer increase using modified itr sequences
WO2025226842A1 (en) 2024-04-24 2025-10-30 Kate Therapeutics, Inc. Expression control by drg-expressed mirnas
WO2026011009A1 (en) 2024-07-02 2026-01-08 Kate Therapeutics, Inc. Compositions and methods for muscle disorders

Also Published As

Publication number Publication date
CN114945583A (zh) 2022-08-26
AU2020331987B2 (en) 2025-10-16
DK4017871T3 (da) 2024-04-22
DK4017871T5 (da) 2024-08-05
ES2978666T3 (es) 2024-09-17
JP7532503B2 (ja) 2024-08-13
JP2026065148A (ja) 2026-04-14
MY210230A (en) 2025-09-04
TW202120532A (zh) 2021-06-01
HRP20240505T1 (hr) 2024-07-05
HUE066215T2 (hu) 2024-07-28
CN120400170A (zh) 2025-08-01
PT4017871T (pt) 2024-04-22
PL4017871T3 (pl) 2024-07-08
IL290734A (en) 2022-04-01
US20220290180A1 (en) 2022-09-15
CA3150964A1 (en) 2021-02-25
EP4017871B1 (en) 2024-01-17
SI4017871T1 (sl) 2024-06-28
LT4017871T (lt) 2024-05-10
BR112022003142A2 (pt) 2022-05-17
MX2022002132A (es) 2022-05-18
US20250122531A1 (en) 2025-04-17
US12258573B2 (en) 2025-03-25
KR20220092489A (ko) 2022-07-01
EP4374880A3 (en) 2024-08-14
FI4017871T3 (fi) 2024-04-22
IL323311A (en) 2025-11-01
EP4488287A2 (en) 2025-01-08
JP2024156816A (ja) 2024-11-06
EP4374880A2 (en) 2024-05-29
RS65421B1 (sr) 2024-05-31
EP4488287A3 (en) 2025-03-05
SMT202400152T1 (it) 2024-05-14
TWI873172B (zh) 2025-02-21
CO2022002864A2 (es) 2022-07-08
JP2022544627A (ja) 2022-10-19
AU2020331987A1 (en) 2022-03-31
EP4017871A1 (en) 2022-06-29
CN114945583B (zh) 2025-04-29

Similar Documents

Publication Publication Date Title
EP4017871B1 (en) Adeno-associated virus vector delivery of alpha-sarcoglycan and the treatment of muscular dystrophy
JP2022084940A (ja) β-サルコグリカン及びマイクロRNA-29のアデノ随伴ウイルスベクター送達ならびに筋ジストロフィーの治療
AU2025259905A1 (en) Gene therapy for limb-girdle muscular dystrophy type 2c
US12285497B2 (en) Self-complementary adeno-associated virus vector and its use in treatment of muscular dystrophy
US20240374684A1 (en) Systemic delivery of adeno-associated virus vector expressing gamma-sarcoglycan and the treatment of muscular dystrophy
HK40122372A (en) Adeno-associated virus vector delivery of alpha-sarcoglycan and the treatment of muscular dystrophy
HK40072405B (en) Adeno-associated virus vector delivery of alpha-sarcoglycan and the treatment of muscular dystrophy
HK40072405A (en) Adeno-associated virus vector delivery of alpha-sarcoglycan and the treatment of muscular dystrophy
EP4186919A1 (en) Self-complementary adeno-associated virus vector and its use in treatment of muscular dystrophy
EA050477B1 (ru) Доставка альфа-саркогликана с помощью вектора на основе аденоассоциированного вируса и лечение мышечной дистрофии
BR122024017812A2 (pt) Uso de um vírus adenoassociado recombinante (raav) de alfa- sarcoglicano no tratamento de distrofia muscular, método para gerar o raav, uso de um construto para diminuir um nível sérico de ck, sequência de polinucleotídeos, plasmídeo, célula, vetor raav e composição compreendendo raav

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20765424

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3150964

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 140050140003008959

Country of ref document: IR

ENP Entry into the national phase

Ref document number: 2022510976

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112022003142

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: NC2022/0002864

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 2020331987

Country of ref document: AU

Date of ref document: 20200821

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2020765424

Country of ref document: EP

Effective date: 20220321

ENP Entry into the national phase

Ref document number: 112022003142

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20220218

WWP Wipo information: published in national office

Ref document number: NC2022/0002864

Country of ref document: CO

WWE Wipo information: entry into national phase

Ref document number: 522431712

Country of ref document: SA

WWE Wipo information: entry into national phase

Ref document number: P-2024/0449

Country of ref document: RS

WWE Wipo information: entry into national phase

Ref document number: 522431712

Country of ref document: SA

WWR Wipo information: refused in national office

Ref document number: 522431712

Country of ref document: SA

WWG Wipo information: grant in national office

Ref document number: 17635978

Country of ref document: US

WWG Wipo information: grant in national office

Ref document number: 202080073755.8

Country of ref document: CN

WWD Wipo information: divisional of initial pct application

Ref document number: 323311

Country of ref document: IL