WO2020139031A1 - Crispr-cas를 기반으로 하는 유전자 교정용 조성물 - Google Patents

Crispr-cas를 기반으로 하는 유전자 교정용 조성물 Download PDF

Info

Publication number
WO2020139031A1
WO2020139031A1 PCT/KR2019/018627 KR2019018627W WO2020139031A1 WO 2020139031 A1 WO2020139031 A1 WO 2020139031A1 KR 2019018627 W KR2019018627 W KR 2019018627W WO 2020139031 A1 WO2020139031 A1 WO 2020139031A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
cas9
arg
seq
rnp
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2019/018627
Other languages
English (en)
French (fr)
Inventor
최제민
구자현
이홍균
이재웅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Industry University Cooperation Foundation IUCF HYU
Original Assignee
Industry University Cooperation Foundation IUCF HYU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020190174907A external-priority patent/KR102386498B1/ko
Application filed by Industry University Cooperation Foundation IUCF HYU filed Critical Industry University Cooperation Foundation IUCF HYU
Priority to US17/312,174 priority Critical patent/US12503492B2/en
Publication of WO2020139031A1 publication Critical patent/WO2020139031A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/10—Fusion polypeptide containing a localisation/targetting motif containing a tag for extracellular membrane crossing, e.g. TAT or VP22
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]

Definitions

  • the present invention relates to a composition for improving the cell permeability and gene correction efficiency of Cas protein and guide RNA, and more specifically, the composition of the present invention provides a higher gene by delivering gene scissors in a cell in the form of a protein-based RNP complex. Since it can lower the correction efficiency and off-target effect, it can be used for clinical treatment or cell therapy.
  • Genetic editing techniques include first-generation ZFNs; zinc-finger nucleases, second-generation TALENs (transcription activator-like effector nucleases), and third-generation gene scissors Cas9 and Cpf1 derived from the CRISPR/Cas system.
  • the CRISPR/Cas system originated from the adaptive immunity of microorganisms. It started with an immune system that cuts and removes a fragment of a bacteriophage as a DNA in a bacteriophage infection and then cuts and removes it by re-infection with the nuclease Cas9 (CRISPR associated protein 9: RNA-guided DNA endonuclease enzyme), which acts as a gene scissor. .
  • CRISPR associated protein 9 CRISPR associated protein 9: RNA-guided DNA endonuclease enzyme
  • gRNA guide RNA
  • the third generation gene scissors are continuously expressed in cells, an off-targeting problem occurs that cuts a gene other than the target gene.
  • the gene editing system using the initial method was required to verify the safety of antibiotic resistance and various immune responses when delivered to the body.
  • a system of constructing and delivering in vitro a gene scissors made of protein (Cas9) and a guide RNA has been applied as an alternative, but this also raises the problem of efficient delivery in cells and stability of proteins and RNA (Ramakrishna S et al., 2014).
  • An object of the present invention is to provide a cell permeation peptide for Cas protein-RNA complex (Ribonucleoprotein: RNP).
  • Another object of the present invention is to provide a composition for gene correction comprising a Cas protein-RNA complex (Ribonucleoprotein: RNP).
  • RNP Cas protein-RNA complex
  • Another object of the present invention is to provide a method for producing transformants excluding humans through the composition.
  • the present invention provides a cell permeation peptide for Cas protein-RNA complex (Ribonucleoprotein: RNP) represented by the following general formula (1).
  • n is 5 to 15.
  • m may be an integer from 9 to 15, more preferably m may be an integer from 10 to 12.
  • the cell permeation peptide for the Cas protein-RNA complex may be represented by SEQ ID NO: 6.
  • the present invention is a) a cell permeable peptide represented by Formula 1 Cas protein bound; And b) guide RNA; provides a composition for genetic correction comprising a complex (RNP) consisting of.
  • RNP complex
  • n is 5 to 15.
  • m may be an integer from 9 to 15, more preferably m may be an integer from 10 to 12.
  • the Cas protein may be represented by SEQ ID NO: 9.
  • the guide RNA may be in the form of double RNA (dual RNA) or single-chain guide RNA (sgRNA) including crRNA and tracrRNA.
  • double RNA dual RNA
  • sgRNA single-chain guide RNA
  • the composition may be to induce a targeted mutation of a single-position or multi-position gene in prokaryotic cells, eukaryotic cells or eukaryotic organisms other than humans.
  • the present invention is 1) a topical injection method, microinjection (electroporation), and electroporation (electroporation) and the prokaryotic cells, eukaryotic cells or eukaryotic organisms other than the isolated composition for genetic modification Introducing any one selected from lipofection methods; provides a method for producing transformants except humans.
  • the present invention provides a transformant except human produced by the above method.
  • the present invention relates to a composition for gene correction comprising a complex (RNP) of a Cas protein and a guide RNA to which a cell-permeable peptide is bound, and in the case of gene correction technology through CRISPR-Cas currently being used, injection into a cell in the form of a complex Difficult, even when injected, stability has not been demonstrated, efficiency is low, and there is an off-target problem.
  • RNP complex
  • CRISPR-Cas complex
  • injection into a cell in the form of a complex Difficult even when injected, stability has not been demonstrated, efficiency is low, and there is an off-target problem.
  • the composition for gene editing of the present invention is used, not only the intracellular delivery efficiency is remarkably high, but also off-target can be suppressed and stability can be secured, and thus can be usefully utilized as a gene therapy.
  • 1A is a pET28a vector inserted with AP-HE10-SpCas9 prepared from Example 1-6) and a pET28a vector inserted with CPP-SpCas9 prepared from Comparative Examples 2, 4 and 6.
  • Figure 1b SDS-PAGE of the purified AP-HE10-SpCas9 protein (SEQ ID NO: 15) obtained through Example 6 and CPP-SpCas9 protein (SEQ ID NO: 23, 26, 31) purified through Comparative Examples 2, 4, and 6 As a result of analysis.
  • Figure 2a is a pET28a vector inserted with CPP-SpCas9 prepared from Comparative Examples 1, 3, 5, 7.
  • Figure 2b is a result of analyzing the CPP-SpCas9 protein (SEQ ID NO: 19, 21, 25, 29) purified through Comparative Examples 1, 3, 5, 7 by SDS-PAGE.
  • Figure 2c is a result of analyzing the AP-SpCas9 protein prepared from Comparative Example 1 in a variety of columns (purification technology), each analyzed by SDS-PAGE.
  • 3A is a pET28a vector into which CPP-AsCas12a prepared from Comparative Examples 8 to 11 was inserted.
  • Figure 3b is a result of analyzing the CPP-AsCas12a protein (SEQ ID NO: 69, 70, 71, 72) purified through Comparative Examples 8 to 11 by SDS-PAGE.
  • Figure 3c is a result of purifying the AP-AsCas12a protein prepared from Comparative Example 8 in a variety of columns (purification technology), each analyzed by SDS-PAGE.
  • 4A is a pET28a vector into which CPP-LbCas12a prepared from Comparative Examples 12 to 16 was inserted.
  • Figure 4b is a result of analyzing the CPP-LbCas12a protein (SEQ ID NO: 73, 74, 75, 76) prepared from Comparative Examples 11 to 15 by SDS-PAGE.
  • Figure 5 is treated with AP-HE-Cas9 (2 ⁇ M) (Example 6) alone, or mixed with CQ (1, 10, 50, 100, 250, 500 ⁇ M) and control (2 ⁇ M) each It is a graph measured by flow cytometry after treatment in a well.
  • FIG. 6 is a photograph of intracellular fluorescence after AP-HE-Cas9 (2 ⁇ M) (Example 6) was treated alone or mixed with CQ (500 ⁇ M) in each well.
  • Figure 10 is a Cas9 (SEQ ID NO: 9), AP-Cas9 (SEQ ID NO: 19) of Comparative Example 1 or AP-HE-Cas9 (SEQ ID NO: 15) of Example 6 mixed with sgDNA to prepare RNP, which is the target DNA After treatment for 15, 30, and 60 minutes, the analyzed results of Agarose electrophoresis.
  • FIG. 12 shows the AP-HE-Cas9 (SEQ ID NO: 10 and SEQ ID NO: 15) prepared from Examples 1 and 6 in each well at various concentrations (1, 2, 5 ⁇ M) and various pH conditions (pH 7.4, 6.5, It is a graph measured by flow cytometry after treatment with 6.0).
  • 13A to 13G show various concentrations (1, 2, 5 ⁇ M) of AP-Cas9 prepared from Comparative Example 1 and AP-HE-Cas9 prepared from Examples 1, 2, 4, 6, and 8 in each well. And after treatment with various pH conditions (pH 7.4, 6.5, 6.0), it is a graph measured by flow cytometry.
  • the present inventors tried to overcome the limitations of gene correction technology through CRISPR-Cas, and to develop an efficient gene correction technology to replace it.
  • a specific gene correction technology strategy using a cell permeation peptide was devised to efficiently transfer the Cas protein-RNA complex (Ribonucleoprotein: RNP) into the cell, and using this, a Cas protein-RNA complex (Ribonucleoprotein) was used in the cell line. : RNP) to complete delivery of the present invention.
  • One aspect of the present invention relates to a cell permeation peptide for Cas protein-RNA complex (Ribonucleoprotein: RNP) represented by the following general formula (1).
  • n may be an integer from 3 to 7
  • n is 5 to 15.
  • [Gly] m serves to link each peptide to each other with a linker
  • m is not particularly limited, but preferably, m may be 3 to 7. If m is higher than 7, the length of the sequence is excessively long, and thus the cell permeation efficiency may be reduced. If it is shorter than 3, sufficient flexibility cannot be secured. More preferably, m may be 4 to 6 in the above formula.
  • n is an integer of 5 to 15, it can be used as a cell permeation peptide, but preferably an integer of 9 to 15, more preferably 10 to 12, in terms of masking and delivery efficiency, 1.3 to 1.5 times. It is better than that. Even more preferably, n may be an integer of 10.
  • the present invention is a new Cas that ensures stability by increasing the efficiency of gene correction and reducing off-target by improving the permeability of the Cas protein-RNA complex (Ribonucleoprotein: RNP), which is not easily introduced into cells, into cells.
  • RNP Cas protein-RNA complex
  • a protein capable of providing a protein-RNA complex (Ribonucleoprotein: RNP) was developed.
  • the cell permeation peptide for Cas protein-RNA complex (Ribonucleoprotein: RNP) having the amino acid sequence represented by the general formula 1 used in the present invention is the smallest peptide with the best delivery efficiency and masking effect, and thus may cause biological interference. Can be minimized.
  • the general formula 1 may be represented by any one of SEQ ID NOs: 10 to 17, preferably any one of SEQ ID NOs: 15 to 17, and most preferably the amino acid sequence represented by SEQ ID NO: 15 It may be indicated by. Since the cell permeation peptide for the Cas protein-RNA complex (Ribonucleoprotein: RNP) contains an appropriate amount of HE as an attenuator, it has an effect of not interfering with the formation of the Cas protein-RNA complex (Ribonucleoprotein: RNP). Have.
  • Another aspect of the present invention is a) a cell permeable peptide represented by Formula 1 Cas protein bound; And b) guide RNA; relates to a composition for genetic correction comprising a complex (RNP) consisting of.
  • RNP complex
  • n is 5 to 15.
  • [Gly] m serves to link each peptide to each other with a linker
  • m is not particularly limited, but preferably, m may be 3 to 7. If m is higher than 7, the length of the sequence is excessively long, and thus the cell permeation efficiency may be reduced. If it is shorter than 3, sufficient flexibility cannot be secured. More preferably, m may be 4 to 6 in the above formula.
  • n is an integer of 5 to 15, it can be used as a cell permeation peptide, but preferably an integer of 9 to 15, more preferably 10 to 12, in terms of masking and delivery efficiency, 1.3 to 1.5 times. It is better than that. Even more preferably, n may be an integer of 10.
  • the Cas protein or gene information can be obtained from a known database such as GenBank of the National Center for Biotechnology Information (NCBI).
  • the Cas protein may be a Cas9 protein.
  • the Cas protein may be a Cas protein derived from Campylobacter genus (Campylobacter), more specifically Campylobacter jejuni, and more specifically Cas9 protein.
  • Campylobacter Campylobacter
  • the amino acid sequence of SEQ ID NO: 9 or a protein having homology while having activity of the protein of the sequence.
  • the protein is SEQ ID NO: 39 and at least 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, It may have sequence identity of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, but is not limited to the examples described above.
  • the Cas protein is used in the present invention as a concept including all variants capable of acting as an endonuclease or nickase activated in cooperation with guide RNA in addition to the native protein.
  • an activated endonuclease or kinase target DNA cleavage can be brought about, and this can be used to bring genomic correction.
  • an inactivated variant it may be used to control transcription or to isolate a desired DNA.
  • the variant of the Cas protein may be a catalytic aspartate residue or a mutant form of Cas9 in which the histidine residue has been changed to any other amino acid.
  • other amino acids may be alanine, but are not limited thereto.
  • the Cas protein specifically, the Cas9 protein derived from C. jejuni, may be substituted with 8 catalytic aspartic acid (D), or 559 histidine residues (histidine, H) with other amino acids.
  • D catalytic aspartic acid
  • H 559 histidine residues
  • other amino acids may be alanine, but are not limited thereto.
  • the Cas9 nuclease protein produced by introducing a mutation at only one active site of the Cas9 nuclease protein may act as a nickase when bound with guide RNA. These two nickases are included in the category of RGEN because two DNA strands can be cut when both are used to cause double strand breakage (DSB).
  • the term "inactivated Cas protein” refers to a Cas nuclease protein in which the function of the nuclease is partially or partially inactivated.
  • the inactivated Cas is also called dCas.
  • cleavage includes the breakage of the covalent backbone of a nucleotide molecule.
  • the a) Cas protein to which the cell permeable peptide represented by Formula 1 is bound is a form developed to function in cells, and preferably, the cell permeable peptide represented by Formula 1 is represented by SEQ ID NO: 9. It may be bound or linked to the Cas protein.
  • the cell permeation peptide is preferably represented by SEQ ID NOs: 10 to 17, more preferably SEQ ID NOs: 15 to 17, and most preferably, a cell permeation peptide represented by SEQ ID NO: 15.
  • the Cas protein to which the cell permeable peptide represented by SEQ ID NO: 15 is bound may be represented by SEQ ID NO: 15.
  • the Cas protein or nucleic acid encoding the same may further include a nuclear localization signal (NLS) for positioning the Cas protein in the nucleus.
  • NLS nuclear localization signal
  • the nucleic acid encoding the Cas protein may additionally include a nuclear localization signal (NLS) sequence.
  • the expression cassette including the nucleic acid encoding the Cas protein may include an NLS sequence in addition to a regulatory sequence such as a promoter sequence for expressing the Cas protein.
  • a regulatory sequence such as a promoter sequence for expressing the Cas protein.
  • Cas proteins can be linked to tags that are advantageous for isolation and/or purification.
  • a small peptide tag such as a His tag, a Flag tag, an S tag, or a GST (Glutathione S-transferase) tag or a MBP (Maltose binding protein) tag may be connected according to purposes, but is not limited thereto.
  • RNP is a) a Cas protein to which the cell permeable peptide represented by Formula 1 is bound; And b) target DNA specific guide RNA; refers to a ribonucleic acid protein in the form of a complex bound to it.
  • the RNP is a) a cell permeable peptide represented by the general formula 1 Cas protein or nucleic acid encoding the same; And b) target DNA-specific guide RNA or DNA encoding the guide RNA; but it is not limited thereto.
  • the guide RNA or the DNA encoding the same and a) a cell permeable peptide represented by the general formula 1 Cas protein or nucleic acid encoding the same can be applied to the cells simultaneously or sequentially.
  • the present invention is a) a cell permeable peptide represented by Formula 1 Cas protein is bound; And b) guide RNA; is delivered to the cell in the form of an RNP complex, most preferably in terms of stability, gene editing efficiency and delivery efficiency.
  • a DNA carrier preferably a DNA carrier.
  • the general formula 1 may be represented by any one of SEQ ID NOs: 10 to 17, preferably any one of SEQ ID NOs: 15 to 17, and most preferably the amino acid sequence represented by SEQ ID NO: 15 It may be indicated by.
  • the cell permeation peptide for the Cas protein-RNA complex represented by SEQ ID NO: 15 is the smallest peptide with the best transfer efficiency and masking effect, and thus can minimize biological interference that may occur.
  • guide RNA refers to RNA specific to a target DNA, and can bind to a Cas protein to guide the Cas protein to the target DNA.
  • Guide RNA can be prepared to be specific to any target to be cleaved.
  • the guide RNA comprises two RNAs, namely, a dual RNA comprising crRIS (CRISPR RNA) and tracrRNA (trans-activating crRNA) as components; Or a form comprising a first site comprising a sequence capable of forming a base pair with a complementary strand of a target DNA and a second site comprising a sequence interacting with a Cas protein, more specifically crRNA and tracrRNA It may be a sgRNA (single-chain guide RNA) in which the main part of the fused form.
  • CRISPR RNA CRISPR RNA
  • tracrRNA trans-activating crRNA
  • a form comprising a first site comprising a sequence capable of forming a base pair with a complementary strand of a target DNA and a second site comprising a sequence interacting with a Cas protein, more specifically crRNA and tracrRNA
  • sgRNA single-chain guide RNA
  • the length of the sequence capable of forming a base pair with the complementary chain of the target DNA sequence of the guide RNA is 17 to 23 bp, 18 to 23 bp, 19 to 23 bp, more specifically 20 to 23 bp, more specifically, 21 to 23 bp It may be, but is not limited thereto. This applies to both dual RNA and sgRNA, and more specifically, to sgRNA.
  • the guide RNA may have 1 to 3 additional nucleotides, more specifically 2 or 3 nucleotides, in front of the 5'site of the sequence capable of forming a base pair with the complementary chain of the target DNA sequence.
  • the nucleotides include A, T, G, and C.
  • the guide RNA may more specifically have 1 to 3 guanine (G), and more specifically 2 or 3 G. This applies to both dual RNA and sgRNA, and more specifically, to sgRNA. However, it is not limited to the examples described above.
  • the sgRNA may include a portion having a sequence complementary to a sequence in the target DNA (also referred to as a Spacer region, Target DNA recognition sequence, base pairing region, etc.) and a hairpin structure for Cas protein binding. More specifically, a portion having a sequence complementary to a sequence in the target DNA, a hairpin structure for Cas protein binding, and a terminator sequence may be included.
  • the above-described structures may be sequentially present in 5'to 3'order. However, it is not limited thereto.
  • guide RNA any type of guide RNA can be used in the present invention if the guide RNA includes a major part of crRNA and tracrRNA and a complementary part of target DNA.
  • the guide RNA includes a first region capable of forming a base pair with a complementary chain of a target DNA sequence; And a second part having a stem or loop structure having a length of 13 to 18 bp (preferably 5 to 10 bp); and may be included.
  • the guide RNA may be appropriately selected according to a target sequence or a type of endonuclease to form a complex and/or a microorganism derived therefrom.
  • the guide RNA may be one or more selected from the group consisting of CRISPR RNA (crRNA), trans-activating crRNA (tracrRNA), and single-stranded guide RNA (sgRNA), depending on the type of endonucleotide, CRISPR RNA (crRNA) And a double-stranded complex of trans-activating crRNA (tracrRNA), or single-strand guide RNA (sgRNA).
  • the sgRNA may include a portion of crRNA and tracrRNA.
  • the composition is for correcting a target DNA (or gene) present in a single position or multiple positions in a prokaryotic cell, a eukaryotic cell, or a eukaryotic organism other than humans.
  • gene editing generates double-stranded DNA cleavage at a target site in a target gene, thereby causing mutation (deletion, substitution, and/or insertion, etc.) of one or more nucleotides. It means action.
  • the gene correction as described above generates a termination codon at a target site or a codon encoding an amino acid different from the wild type, thereby knocking out the target gene or not generating a protein. It may be in various forms, such as introducing a mutation into the non-coding DNA sequence, but is not limited thereto.
  • target gene' refers to a gene to be subjected to gene correction
  • target site or target region' is a region where gene correction by Cas (or Cas9) in the target gene occurs.
  • the'target sequence' may be a base sequence of a target gene or a site including a nucleotide (nt) hybridized by a guide RNA in a target site of the target gene.
  • the prokaryotic and eukaryotic cells are isolated cells, and the eukaryotic cells are yeast, fungi, protozoa, plants, higher plants and insects, or amphibian cells, or CHO, HeLa, HEK293, and COS-1. It may be a cell isolated from the same mammal.
  • the eukaryotic cells are commonly used in the art, cultured cells (in vitro), transplanted cells (graft cells) and primary cell culture (in vitro and ex vivo), and in vivo (in vivo)
  • the cells may also be cells isolated from mammals including humans (mammalian cells).
  • the eukaryotic organism includes eukaryotic cells (e.g., fungi such as yeast, eukaryotic animals and/or eukaryotic plant-derived cells (e.g., embryonic cells, stem cells, somatic cells, germ cells, etc.)), eukaryotic animals (e.g., monkeys other than humans). Primates, dogs, pigs, cows, sheep, goats, mice, rats, etc.), and eukaryotic plants (e.g., algae such as green algae, corn, soybeans, wheat, rice, etc.). .
  • eukaryotic cells e.g., fungi such as yeast, eukaryotic animals and/or eukaryotic plant-derived cells (e.g., embryonic cells, stem cells, somatic cells, germ cells, etc.)
  • eukaryotic animals e.g., monkeys other than humans. Primates, dogs, pigs, cows, sheep, goats, mice, rats, etc.
  • Another aspect of the present invention is 1) the composition for genetic modification, the isolated prokaryotic cells, eukaryotic cells or eukaryotic organisms other than human, local injection method, microinjection (microinjection), electroporation (electroporation) and lipofection (lipofection) method Introducing any one selected from; It relates to a method for producing a transformant except for the human.
  • the present invention can provide a pharmaceutical composition containing the composition for genetic modification.
  • the pharmaceutically acceptable carrier included in the pharmaceutical composition of the present invention is commonly used in formulation, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, Calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, but is not limited thereto It does not work.
  • the pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetener, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components.
  • a lubricant e.g., a talc, a kaolin, a kaolin, a kaolin, a kaolin, a kaolin, kaolin, kaolin, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, a talct, a talct, a talct, a stevia, glycerin, a stevia, glycerin, glycerin, g
  • composition of the present invention may be administered orally or parenterally, and preferably parenteral administration, for example, intravenous injection, topical injection and intraperitoneal injection.
  • Suitable dosages of the pharmaceutical compositions of the invention vary by factors such as formulation method, mode of administration, patient's age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion, and response sensitivity, Usually, a skilled physician can easily determine and prescribe a dose effective for the desired treatment or prevention. According to a preferred embodiment of the invention, the daily dosage of the pharmaceutical composition of the invention is 0.0001-100 mg/kg.
  • the pharmaceutical composition of the present invention is prepared in a unit dose form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by those skilled in the art to which the present invention pertains. Or it can be manufactured by incorporating into a multi-dose container.
  • the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or may be in the form of ex, powder, granule, tablet, or capsule, and may further include a dispersant or stabilizer.
  • the protein expression vector pET28a was cut with NheI, EcoRI restriction enzyme, and then NheI-SpCas9- DNA encoding EcoRI (SEQ ID NO: 49) was inserted as a linking enzyme.
  • AP-[HE] m SEQ ID NOs: 1 to 8
  • the vector is cut with NdeI and NheI restriction enzymes, and then the DNA encoding NdeI-AP-HE-NheI (SEQ ID NOs: 32 to 39) is linked.
  • Each transformed plasmid DNA was transformed into DH5 ⁇ Escherichia coli, and the colonies obtained were inoculated into LB medium, and cultured in a shaking incubator under conditions of 200 rpm at 37°C for 12 hours. After the culture was completed, E. coli was recovered, plasmid DNA was separated therefrom, and then DNA sequencing was commissioned to Cosmogenetech to confirm whether the vector was correctly produced.
  • Each plasmid DNA prepared through 1) was transformed into E. coli BL21(DE3)star pLysS strain. Each colony was inoculated into 50 ml of LB liquid medium containing chloramphenicol (34 ⁇ g/ml) and ampicillin (50 ⁇ g/ml) antibiotics, cultured at 37° C. for 10 hours, and transferred to 500 ml of fresh LB liquid medium. Incubation was performed using a spectrophotometer until the value at OD 600nm was between 0.4 and 0.6. After adding IPTG to a concentration of 0.2 mM, the temperature was lowered to 20° C., and further cultured at 150 rpm for 14 hours.
  • the culture solution was recovered, and the supernatant was discarded by centrifugation, and the pellet was resuspended by adding a lysis solution (0.5M NaCl, 5mM imidazole, 20mM Tris-HCl, pH 8.0) to the pellet.
  • the re-suspended solution was treated with an ultrasonic cell disruptor (VCX-130 (Sonics & Materials)), then centrifuged, and the supernatant was separated.
  • a lysis solution 0.5M NaCl, 5mM imidazole, 20mM Tris-HCl, pH 8.0
  • the separated supernatant was filtered using a 0.45 ⁇ m filter, then purified using a 1M imidazole solution using an AKTA prime protein purification machine, and AP-HE-SpCas9 protein (SEQ ID NOs: 10 to 10) using a PD-10 desalting column. 17) was finally separated. Each of these was confirmed through 12% SDS-PAGE (FIG. 1B).
  • Figure 1a is a pET28a vector inserted with AP-HE10-SpCas9 prepared from Example 1-6
  • Figure 1b is an SDS-PAGE of the AP-HE10-SpCas9 protein (SEQ ID NO: 15) purified through Example 6 It is the result of the analysis. According to this, it can be seen that the final separation was properly performed.
  • the protein expression vector pET28a was cut with NheI and EcoRI restriction enzymes, and then the DNA encoding NheI-SpCas9-EcoRI (SEQ ID NO: 40) was linked to the enzyme.
  • the vector is cut with NdeI and NheI restriction enzymes, and then the DNA encoding NdeI-CPP-NheI is connected. It was inserted using an enzyme.
  • the colonies obtained were inoculated in LB medium, and cultured in a shaking incubator at 37°C and 200 RPM for 12 hours. After the culture was completed, E. coli was recovered, plasmid DNA was separated therefrom, and then DNA sequencing was commissioned to Cosmogenetech to confirm whether the vector was correctly produced.
  • Ala Ser is a restriction enzyme site (AS:Nhel).
  • the culture solution was recovered, and the supernatant was discarded by centrifugation, and the pellet was resuspended by adding a lysis solution (0.5M NaCl, 5mM imidazole, 20mM Tris-HCl, pH 8.0) to the pellet.
  • the re-suspended solution was treated with an ultrasonic cell disruptor (VCX-130 (Sonics & Materials)), then centrifuged, and the supernatant was separated.
  • a lysis solution 0.5M NaCl, 5mM imidazole, 20mM Tris-HCl, pH 8.0
  • the separated supernatant was filtered using a 0.45 ⁇ m filter, and then purified using a 1M imidazole solution using an AKTA prime protein purification machine, and a CPP-SpCas9 protein (SEQ ID NOs: 19, 21, using a PD-10 desalting column). 23, 25, 27, 29, 31) were finally separated. This was confirmed by 12% SDS-PAGE (Fig. 1b, Fig. 2).
  • FIG. 1A shows vectors prepared from Comparative Examples 2, 4, and 6, and FIG. 2A shows pET28a vectors inserted with CPP-SpCas9 prepared from Comparative Examples 1, 3, 5, and 7, and FIG. 1B CPP-SpCas9 protein purified through Comparative Examples 2, 4, and 6 (SEQ ID NOs: 23, 26, and 31) was analyzed by SDS-PAGE, and FIG. 2B was purified through Comparative Examples 1, 3, 5, and 7 CPP-SpCas9 protein (SEQ ID NO: 19, 21, 25, 29) is the result of analysis by SDS-PAGE. According to this, it can be seen that the final separation was properly performed.
  • FIG. 2c shows that when the AP-SpCas9 proteins prepared from Comparative Example 1 were purified by a column (purification technique) with each other by SDS-PAGE, it can be seen that it is most preferable to purify according to the method.
  • the protein expression vector pET28a was cut with NheI and EcoRI restriction enzymes, and then DNA encoding NheI-AsCas12a (or LbCas12a)-EcoRI (SEQ ID NO: 63, 64) was inserted as a linking enzyme.
  • CPP AP, dNP2, R9, TAT
  • the vector was cut with NdeI and NheI restriction enzymes, and then DNA encoding NdeI-CPP-NheI was inserted using a linking enzyme.
  • the transformed plasmid DNA was transformed into DH5 ⁇ E. coli, and the colonies obtained were inoculated into LB medium, and cultured in a shaking incubator at 37°C and 200 RPM for 12 hours. After the culture was completed, E. coli was recovered, plasmid DNA was separated therefrom, and then DNA sequencing was commissioned to Cosmogenetech to confirm whether the vector was correctly produced.
  • the culture solution was recovered, and the supernatant was discarded by centrifugation, and the pellet was resuspended by adding a lysis solution (0.5M NaCl, 5mM imidazole, 20mM Tris-HCl, pH 8.0) to the pellet.
  • the re-suspended solution was treated with an ultrasonic cell disruptor (VCX-130 (Sonics & Materials)), then centrifuged, and the supernatant was separated.
  • a lysis solution 0.5M NaCl, 5mM imidazole, 20mM Tris-HCl, pH 8.0
  • the separated supernatant was filtered using a 0.45 ⁇ m filter, then purified using a 1M imidazole solution using an AKTA prime protein purification machine, and CPP (AP, dNP2, R9, TAT) using a PD-10 desalting column.
  • AsCas12a SEQ ID NOs: 69, 70, 71, 72
  • CPP AP, dNP2, R9, TAT
  • LbCas12a protein SEQ ID NOs: 73, 74, 75, 76
  • FIG. 3A is a pET28a vector into which CPP-AsCas12a prepared from Comparative Examples 8-11 was inserted
  • FIG. 4A is a pET28a vector into which CPP-LbCas12a prepared from Comparative Examples 12-15 was inserted
  • Figure 3b is a result of analyzing the CPP-AsCas12a protein (SEQ ID NO: 69, 70, 71, 72) purified through Comparative Examples 8 to 11 by SDS-PAGE
  • Figure 4b CPP- prepared from Comparative Examples 11 to 15 LbCas12a protein (SEQ ID NO: 73, 74, 75, 76) is the result of SDS-PAGE analysis. According to this, it can be seen that the final separation was properly performed.
  • FIG. 3c shows that the AP-AsCas12a protein prepared from Comparative Example 8 was purified by various columns (refining technology), and each was analyzed by SDS-PAGE, confirming that it was well purified without impurities.
  • HEK293 T cells are cultured using DMEM, and cells are dispensed by adding 25 ⁇ l of DMEM medium containing 2.5 ⁇ 10 5 cells to each well of a 96-well plate in which 155 ⁇ l of DMEM medium is dispensed. did.
  • cells and proteins were cultured together under various conditions so that the total volume was 200 ⁇ l by mixing D-PBS and the protein to be treated at an appropriate concentration in 20 ⁇ l.
  • AP-HE-Cas9 (2 ⁇ M) mixed with CQ (1, 10, 50, 100, 250, 500 ⁇ M), AP-HE-Cas9 (2 ⁇ M) alone and control (2 ⁇ M) was treated in each well and incubated at 37° C. in a 5% CO 2 cell incubator for 2 hours.
  • the cultured cells were centrifuged, washed twice with PBS buffer, and treated with trypsin solution for 5 minutes to remove proteins attached to the cell surface.
  • neutralization was performed using a DMEM solution, washed again with PBS buffer, and intracellular fluorescence was measured using a flow cytometry (FACS machine, BD science FACS canto II) to confirm delivery efficiency.
  • CQ is chloroquine, an inhibitor of lysosomal degradation.
  • FIG. 5 shows AP-HE-Cas9 (2 ⁇ M) (Example 6) alone or mixed with CQ (1, 10, 50, 100, 250, 500 ⁇ M) and control (2 ⁇ M). After treatment in each well, it is a graph measured by a flow cytometer.
  • the AP-HE-Cas9 protein according to the present invention increases in cell permeation efficiency as the concentration increases, and when mixed with CQ, the concentration of CQ increases. According to the results, it can be seen that the cell permeability is increasing.
  • Test Example 6 It was confirmed through Test Example 1 that the AP-HE-SpCas9 protein of the present invention (Example 6) was well delivered into cells. However, since it was not possible to analyze where it was located after it was transferred into the cell, it was intended to analyze the position inside the cell through a microscope.
  • Each well of a 6-well plate is pre-layed with a 24 mm 2 square cover glass for microscopy, and 1 ⁇ 10 5 cells of HeLa cells are dispensed, and then cultured in DMEM medium for 24 hours to allow cells to adhere to the cover glass. To ensure that. After that, the DMEM medium was removed, and 900 ⁇ l of fresh DMEM medium was added. To this, 50 ⁇ l of the AP-HE-SpCas9 protein prepared from Example 6 was mixed with D-PBS to a concentration of 0.5 ⁇ M, 1 ⁇ M, and 2 ⁇ M. Thereafter, the cells were cultured in a 5% CO 2 cell incubator at 37° C. for 2 hours.
  • the proteins and DMEM medium excluding adherent cells were removed, washed twice with PBS buffer, and then fixed with 1 ml of 4% paraformaldehyde phosphate buffer solution (Wako), and then PBS again. After washing with buffer and staining F-actin with a green fluorescent material (Alexa fluor 488 conjugated phalloidin) (invitrogen), the nucleus was stained with Hoechst 33342 (invitrogen).
  • a green fluorescent material Alexa fluor 488 conjugated phalloidin
  • FIG. 6 is a photograph of intracellular fluorescence after treating AP-HE-Cas9 (2 ⁇ M) (Example 6) alone or mixing with CQ (500 ⁇ M) in each well, It was confirmed that the AP-HE-Cas9 (Example 6) protein of the present invention was well delivered in the cell and located in the cell.
  • the Cas9 protein-RNA complex (Ribonucleoprotein: RNP) was mixed with the AP-HE-SpCas9 protein (5 ⁇ M) and sgRNA (5 ⁇ M) of Example 6 in a ratio of 1:1, and reacted for 10 minutes at room temperature.
  • -HE-Cas9 protein-RNA complex was prepared, and then designated as AP-HE-Cas9 RNP.
  • crRNP is a generic term for Cas9 protein-RNA complex (RNP) regardless of Cas9 protein type.
  • AP-HE-SpCas9 protein of Example 6 was prepared in the form of a Cas9 protein-RNA complex (Ribonucleoprotein: RNP), it was attempted to confirm whether it showed gene correction efficacy in cells.
  • RNP Cas9 protein-RNA complex
  • an RFP/GFP reporter system and a T7 endonuclease 1 assay that expresses RFP and expresses GFP when a specific gene is cut was used.
  • the rat HEK293 T cell line was cultured with DMEM medium. 400 ⁇ l DMEM medium was dispensed into each well of a 24-well plate, and 50 ⁇ l DMEM medium containing 2.5 ⁇ 10 5 cell numbers was mixed in each well. CQ (50 ⁇ M) and AP-HE-Cas9 RNP were added to a suitable concentration with D-PBS present in the 50 ⁇ l medium (day 0). At this time, the final volume was set to 500 ⁇ l.
  • day 1 After incubation, on day 1 (day 1), 5 ⁇ M of AP-HE-Cas9 RNP was applied to each well of the HEK293 T cell line, and cultured at 37° C. in a 5% CO 2 cell incubator for 6 hours, and then replaced with fresh DMEM medium .
  • AP-HE-Cas9 RNP was treated with 5 ⁇ M in each well and reacted at 37° C. in a 5% CO 2 cell incubator for 6 hours, and then replaced with fresh DMEM medium.
  • the AP-HE RNp was treated in the same manner as the 2nd day, reacted for 6 hours, and then the culture solution was recovered and centrifuged to remove the supernatant.
  • PBS buffer was added to the remaining pellet, washed twice, and treated with trypsin for 5 minutes to remove proteins attached to the cell surface.
  • the purpose of this study was to determine whether AP-SpCas9 of Comparative Example 1 exhibits gene correction efficacy in cells.
  • an RFP/GFP reporter system and a T7 endonuclease 1 assay that expresses RFP and expresses GFP when a specific gene is cut was used.
  • the rat HEK293 T cell line was cultured with DMEM medium. 400 ⁇ l DMEM medium was dispensed into each well of a 24-well plate, and 50 ⁇ l DMEM medium containing 2.5 ⁇ 10 5 cell numbers was mixed in each well. CQ (50 ⁇ M) and AP-Cas9 of Comparative Example 1 were added to a suitable concentration with D-PBS present in the 50 ⁇ l medium (day 0). At this time, the final volume was set to 500 ⁇ l.
  • the HEK293 T cells were transformed with lipofectamine in the sgRNA plasmid targeting the CCR5 gene before adding AP-Cas9 of Comparative Example 1.
  • the sgRNA plasmid targeting the AP-Cas9 plasmid (Comparative Example 1-1) CCR5 gene was delivered to HEK293 T cells via lipofectamine, and then cultured at 37° C. for 24 hours in a 5% CO 2 cell incubator.
  • the DMEM medium was newly replaced, and 5 ⁇ M of AP-SpCas9 protein (Comparative Example 1) was treated in each well and reacted at 37° C. in a 5% CO 2 cell incubator for 6 hours. After 6 hours, it was replaced with fresh DMEM medium.
  • AP-SpCas9 protein (Comparative Example 1) was treated in each well, reacted at 37° C. in a 5% CO 2 cell incubator for 6 hours, and then replaced with fresh DMEM medium.
  • AP-SpCas9 was treated and reacted for 6 hours, and then the culture was collected and centrifuged to remove the supernatant.
  • PBS buffer was added to the remaining pellet, washed twice, and treated with trypsin for 5 minutes to remove proteins attached to the cell surface. After neutralization by adding the RPMI solution, it was washed once again with PBS buffer, and the gene correction efficiency was confirmed using a flow cytometry (FACS machine, BD science FACS canto II) and T7 endonulease 1 assay.
  • AP-SpCas9 protein of Comparative Example 1 was prepared in the form of Cas9 protein-RNA complex (Ribonucleoprotein: RNP), it was attempted to confirm whether it shows gene-correcting efficacy in cells.
  • RNP Cas9 protein-RNA complex
  • an RFP/GFP reporter system and a T7 endonuclease 1 assay that expresses RFP and expresses GFP when a specific gene is cut was used.
  • the rat HEK293 T cell line was cultured with DMEM medium. 400 ⁇ l DMEM medium was dispensed into each well of a 24-well plate, and 50 ⁇ l DMEM medium containing 2.5 ⁇ 10 5 cell numbers was mixed in each well. CQ (50 ⁇ M) and AP RNP were added to a suitable concentration with D-PBS present in the 50 ⁇ l medium (day 0). At this time, the final volume was set to 500 ⁇ l.
  • the AP-HE-SpCas9 protein prepared from Example 6 of the present invention contains 10 HEs which are transcription attenuators (Attenuator), and functions to suppress +charge of the cell-permeable peptide.
  • HEs transcription attenuators
  • AP-HE-SpCas9 protein of Example 1 of the present invention it was confirmed whether the target DNA is cut in vitro.
  • Cas9 (SEQ ID NO: 9), AP-Cas9 (SEQ ID NO: 19) of Comparative Example 1 or AP-HE-Cas9 (SEQ ID NO: 15) of Example 6 was mixed with 50 nM and sgRNA 50 nM, and then 15 minutes at room temperature.
  • the gene correcting effect is reduced in the CPP (cell permeable peptide) such as TAT, R9, dNP2 to which the HE sequence is added.
  • CPP cell permeable peptide
  • the cultured cells were centrifuged, washed twice with PBS buffer, and treated with trypsin solution for 5 minutes to remove proteins attached to the cell surface.
  • neutralization was performed using a DMEM solution, washed again with PBS buffer, and intracellular fluorescence was measured using a flow cytometry (FACS machine, BD science FACS canto II) to confirm delivery efficiency.
  • FIG. 12 shows the AP-HE-Cas9 (SEQ ID NO: 10 and SEQ ID NO: 15) prepared from Examples 1 and 6 in each well at various concentrations (1, 2, 5 ⁇ M) and various pH conditions (pH 7.4, 6.5, It is a graph measured by flow cytometry after treatment with 6.0). According to this, it can be seen that AP-HE10-Cas9 (SEQ ID NO: 15) of Example 6 shows a significantly higher masking effect than AP-HE5-Cas9 (SEQ ID NO: 10) of Example 1 under the same conditions.
  • the AP-HE10-Cas9 (SEQ ID NO: 15) of Example 6 has a higher delivery efficiency than the AP-HE5-Cas9 (SEQ ID NO: 10) of Example 1 under the conditions of pH 7.4 and 6.5.
  • 13A to 13G show various concentrations (1, 2, 5 ⁇ M) of AP-Cas9 prepared from Comparative Example 1 and AP-HE-Cas9 prepared from Examples 1, 2, 4, 6, and 8 in each well. And after treatment with various pH conditions (pH 7.4, 6.5, 6.0), it is a graph measured by flow cytometry.
  • AP-HE10-Cas9 (SEQ ID NO: 15) of Example 6 is '10HE'
  • AP-HE5-Cas9 (SEQ ID NO: 10) of Example 1 is '5HE'
  • AP-HE6-Cas9 of Example 2 SEQ ID NO: 11
  • AP-HE8-Cas9 of Example 4 SEQ ID NO: 13
  • AP-HE5-Cas9 of Example 8 SEQ ID NO: 17
  • AP-HE10-Cas9 (SEQ ID NO: 15) of Example 6 under the same conditions is AP-HE5-Cas9 (SEQ ID NO: 10) of Example 1, AP-HE6-Cas9 (SEQ ID NO: 11) of Example 2, It was confirmed that it showed a significantly higher Masking effect than AP-HE8-Cas9 (SEQ ID NO: 13) of Example 4.
  • AP-HE10-Cas9 (SEQ ID NO: 15) of Example 6 under the conditions of pH 7.4 to 6.0 is AP-HE5-Cas9 (SEQ ID NO: 10) of Example 1, AP-HE6-Cas9 of Example 2 (SEQ ID NO: 11), it can be confirmed that the delivery efficiency is higher than that of AP-HE8-Cas9 (SEQ ID NO: 13) of Example 4.
  • AP-HE10-Cas9 (SEQ ID NO: 15) of Example 6 and AP-HE5-Cas9 (SEQ ID NO: 17) of Example 8 showed no significant difference in masking and delivery efficiency even though the HE sequence length was changed.
  • Example 6 which has 10 HE sequences than Examples 2 and 4, which has 6 or 8 HE sequences at various pH conditions, showed excellent masking efficiency, but AP-HE of Examples 6 and 9 -Cas9 showed little difference. Through this, it can be confirmed that the increase in HE after 10 repetitions is not significantly in effect, and it can be seen that AP-HE10-Cas9 of Example 6 is most preferable.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 Cas 단백질 및 가이드 RNA의 세포 투과성과 유전자 교정 효율을 향상시키기 위한 조성물에 관한 것으로서 현재 사용되고 있는 CRISPR-Cas를 통한 유전자 교정기술의 경우 복합체 형태로 세포 내에 주입이 어렵고, 주입하더라도 안정성이 입증되지 않았으며 효율이 낮으며, off-target 문제가 있다. 그러나 본 발명의 유전자 교정용 조성물을 이용할 경우 세포 내 전달 효율이 현저히 높을 뿐만 아니라, off-target을 억제할 수 있고, 안정성을 확보할 수 있어, 유전자 치료로서 유용하게 활용될 수 있다.

Description

CRISPR-CAS를 기반으로 하는 유전자 교정용 조성물
본 발명은 Cas 단백질 및 가이드 RNA의 세포 투과성과 유전자 교정 효율을 향상시키기 위한 조성물에 관한 것으로서, 보다 상세하게는 본 발명의 조성물은 유전자 가위를 단백질 기반의 RNP 복합체형태로 세포 내에 전달함으로써 더 높은 유전자 교정 효율 및 off-target 효과를 낮출 수 있으므로, 임상치료 또는 세포 치료용도로 사용될 수 있다.
유전자 편집 기술로는 제1세대 ZFNs; zinc-finger nucleases, 제2세대 탈렌 TALENs(transcription activator-like effector nucleases)과 CRISPR/Cas 시스템에서 유래한 제3세대 유전자가위인 Cas9 및 Cpf1이 있다.
CRISPR/Cas 시스템은 미생물의 적응면역에서 비롯되었다. 박테리오파지 감염에 박테리오파지의 단편을 DNA로 기억하고 있다가 재감염되었을 때 유전자 가위 역할을 하는 누클레아제(nuclease)인 Cas9(CRISPR associated protein 9 : RNA-guided DNA endonuclease enzyme)으로 잘라 없애는 면역 시스템에서 시작되었다. 이는 유전체에서도 특정 염기 서열을 가이드 RNA(guide RNA, gRNA)에 의해서 인식 가능하면 원하는 부위를 간편하게 잘라 고칠 수 있다. 하지만 제3세대 유전자가위는 세포 내에서 지속적으로 발현되기 때문에 표적 유전자가 아닌 다른 유전자를 자르는 off targeting 문제가 발생하였다.
특히 초기 방식인 Cas9 플라스미드를 사용한 유전자 편집 시스템은 체내 전달시의 항생제 저항성, 여러 면역 반응 등의 안전성에 대한 검증이 필요하였다. 최근에는 단백질로 이뤄진 유전자가위(Cas9)와 가이드 RNA를 실험관내에서 만들어 전달하는 시스템이 그 대안으로 적용되고 있으나, 이 또한 세포내 효율적인 전달과 단백질과 RNA의 안정성에 대한 문제가 제기되고 있다(Ramakrishna S et al., 2014).
이에, off-target 위험성이 적은 생체적용이 가능한 단백질 기반의 유전자 교정기술의 발굴 필요성이 대두되고 있다. 임상치료 및 세포치료에 안정적으로 적용가능한 신규 유전자가위를 개발하기 위해서는 세포 내 효율적인 전달과 세포 독성을 감소시켜야하는데, Cas9 단백질-RNA 복합체(Ribonucleoprotein: RNP) 자체가 세포 내로 전달되는 효율이 약 10% 내외로 매우 제한적이기 때문에 기존에 사용해오던 유전자 교정기술 발굴전략으로는 한계가 있다.
본 발명의 목적은 Cas 단백질-RNA 복합체(Ribonucleoprotein: RNP)용 세포투과펩티드를 제공하는데 있다.
본 발명의 다른 목적은 Cas 단백질-RNA 복합체(Ribonucleoprotein: RNP)를 포함하는 유전자 교정용 조성물을 제공하는데 있다.
본 발명의 또 다른 목적은 상기 조성물을 통해 인간을 제외한 형질 전환체를 제조하는 방법을 제공하는데 있다.
상기 목적을 달성하기 위하여, 본 발명은 하기 일반식 1로 표시되는 Cas 단백질-RNA 복합체(Ribonucleoprotein: RNP)용 세포투과펩티드를 제공한다.
[일반식 1]
Arg-Arg-Arg-Trp-Cys-Lys-Arg-Arg-Arg-Ala-Ser-[Gly]m-[His-Glu]n
상기 식에서, m은 3 내지 7, n은 5 내지 15의 정수이다.
상기 일반식 1에서, m은 9 내지 15의 정수일 수 있고, 더 바람직하게는 m은 10 내지 12의 정수일 수 있다.
상기 Cas 단백질-RNA 복합체(Ribonucleoprotein: RNP)용 세포투과펩티드는 서열번호 6으로 표시되는 것일 수 있다.
상기 다른 목적을 달성하기 위하여, 본 발명은 a) 일반식 1로 표시되는 세포투과펩티드가 결합된 Cas 단백질; 및 b) 가이드 RNA;로 구성된 복합체(RNP)를 포함하는 유전자 교정용 조성물을 제공한다.
[일반식 1]
Arg-Arg-Arg-Trp-Cys-Lys-Arg-Arg-Arg-Ala-Ser-[Gly]m-[His-Glu]n
상기 식에서, m은 3 내지 7, n은 5 내지 15의 정수이다.
상기 일반식 1에서, m은 9 내지 15의 정수일 수 있고, 더 바람직하게는 m은 10 내지 12의 정수일 수 있다.
상기 Cas 단백질은 서열번호 9로 표시되는 것일 수 있다.
상기 가이드 RNA는 crRNA 및 tracrRNA를 포함하는 이중 RNA(dual RNA) 또는 단일-사슬 가이드 RNA(sgRNA) 형태일 수 있다.
상기 조성물은 원핵세포, 진핵세포 또는 인간을 제외한 진핵 유기체에서 단일 위치 또는 다중 위치 유전자의 표적화된 돌연변이를 유도하는 것일 수 있다.
상기 또 다른 목적을 달성하기 위하여, 본 발명은 1) 상기 유전자 교정용 조성물을 분리된 원핵세포, 진핵세포 또는 인간을 제외한 진핵 유기체에 국소 주입법, 마이크로주입법(microinjection), 전기천공법(electroporation) 및 리포펙션(lipofection) 방법 중에서 선택되는 어느 하나로 도입하는 단계;를 포함하는 인간을 제외한 형질 전환체의 제조방법을 제공한다.
상기 또 다른 목적을 달성하기 위하여, 본 발명은 상기 방법에 의하여 제조된 인간을 제외한 형질 전환체를 제공한다.
본 발명은 세포투과성펩티드가 결합된 Cas 단백질 및 가이드 RNA의 복합체(RNP)를 포함하는 유전자 교정용 조성물에 관한 것으로, 현재 사용되고 있는 CRISPR-Cas를 통한 유전자 교정기술의 경우 복합체 형태로 세포 내에 주입이 어렵고, 주입하더라도 안정성이 입증되지 않았으며 효율이 낮으며, off-target 문제가 있다. 그러나 본 발명의 유전자 교정용 조성물을 이용할 경우 세포 내 전달 효율이 현저히 높을 뿐만 아니라, off-target을 억제할 수 있고, 안정성을 확보할 수 있어, 유전자 치료로서 유용하게 활용될 수 있다.
도 1a는 실시예 1-6)으로부터 제조된 AP-HE10-SpCas9가 삽입된 pET28a 벡터와 비교예 2, 4, 6로부터 제조된 CPP-SpCas9가 삽입된 pET28a 벡터이다.
도 1b는 실시예 6을 통해 정제된 AP-HE10-SpCas9 단백질(서열번호 15)과 비교예 2, 4, 6을 통해 정제된 CPP-SpCas9 단백질(서열번호 23, 26, 31)을 SDS-PAGE로 분석한 결과이다.
도 2a는 비교예 1, 3, 5, 7로부터 제조된 CPP-SpCas9가 삽입된 pET28a 벡터이다.
도 2b는 비교예 1, 3, 5, 7을 통해 정제된 CPP-SpCas9 단백질(서열번호 19, 21, 25, 29)을 SDS-PAGE로 분석한 결과이다.
도 2c는 비교예 1로부터 제조된 AP-SpCas9 단백질을 다양한 컬럼(정제기술)으로 정제하고, 각각을 SDS-PAGE로 분석한 결과이다.
도 3a는 비교예 8 내지 11로부터 제조된 CPP-AsCas12a가 삽입된 pET28a 벡터이다.
도 3b는 비교예 8 내지 11을 통해 정제된 CPP-AsCas12a 단백질(서열번호 69, 70, 71, 72)을 SDS-PAGE로 분석한 결과이다.
도 3c는 비교예 8로부터 제조된 AP-AsCas12a 단백질을 다양한 컬럼(정제기술)으로 정제하고, 각각을 SDS-PAGE로 분석한 결과이다.
도 4a는 비교예 12 내지 16으로부터 제조된 CPP-LbCas12a가 삽입된 pET28a 벡터이다.
도 4b는 비교예 11 내지 15로부터 제조된 CPP-LbCas12a 단백질(서열번호 73, 74, 75, 76)을 SDS-PAGE로 분석한 결과이다.
도 5는 AP-HE-Cas9(2 μM)(실시예 6)을 단독으로 처리하거나, CQ(1, 10, 50, 100, 250, 500 μM)와 함께 혼합한 것과 control(2 μM)을 각 well 에 처리한 후, 유세포분석기로 측정한 그래프이다.
도 6은 AP-HE-Cas9(2 μM)(실시예 6)을 단독으로 처리하거나, CQ(500 μM)와 함께 혼합한 것을 각 well 에 처리한 후, 세포 내 형광을 촬영한 사진이다.
도 7은 HEK293T세포에서의 AP-HE-Cas9 RNP에 의한 유전자 교정 효율을 측정한 결과이다.
도 8은 HEK293T세포에서의 AP-SpCas9에 의한 유전자 교정 효율을 측정한 결과이다.
도 9는 HEK293T세포에서의 AP RNP에 의한 유전자 교정 효율을 측정한 결과이다.
도 10은 Cas9(서열번호 9), 비교예 1의 AP-Cas9(서열번호 19) 또는 실시예 6의 AP-HE-Cas9(서열번호 15)를 sgDNA와 혼합하여 RNP를 제조하고, 이를 표적 DNA에 15, 30, 60 분 동안 처리한 후, 분석한 Agarose 전기영동결과이다.
도 11은 Cas9(서열번호 9), 비교예 7의 TAT-Cas9(서열번호 29), 비교예 6의 TAT-HE-Cas9(서열번호 31), 비교예 5의 R9-Cas9(서열번호 25), 비교예 4의 R9-HE-Cas9(서열번호 27), 비교예 3의 dNP2-Cas9(서열번호 21) 혹은 비교예 2의 dNP2-HE-Cas9(서열번호 23)를 sgDNA와 혼합하여 RNP를 제조하고, 이를 표적 DNA에 15, 60 분 동안 처리한 후, 분석한 Agarose 전기영동결과이다.
도 12는 각 well에 실시예 1 및 6으로부터 제조된 AP-HE-Cas9(서열번호 10 및 서열번호 15) 각각을 다양한 농도(1, 2, 5 μM)와 다양한 pH 조건(pH 7.4, 6.5, 6.0)으로 처리한 후, 유세포분석기로 측정한 그래프이다.
도 13a 내지 도 13g는 각 well에 비교예 1로부터 제조된 AP-Cas9와 실시예 1, 2, 4, 6, 8로부터 제조된 AP-HE-Cas9 각각을 다양한 농도(1, 2, 5 μM)와 다양한 pH 조건(pH 7.4, 6.5, 6.0)으로 처리한 후, 유세포분석기로 측정한 그래프이다.
본 발명자들은 CRISPR-Cas를 통한 유전자 교정기술의 한계를 극복하고, 이를 대체할 수 있는 효율적인 유전자 교정기술을 개발하고자 노력하였다. 그 결과, Cas 단백질-RNA 복합체(Ribonucleoprotein: RNP)를 세포 내에 효율적으로 전달되도록 하기 위하여 세포투과펩티드를 활용한 특이적 유전자 교정기술 전략을 고안하였고, 이를 이용하여 세포주에 Cas 단백질-RNA 복합체(Ribonucleoprotein: RNP)를 주입하였을 때 확실히 전달되도록 함으로써 본 발명을 완성하였다.
본 발명의 일 측면은 하기 일반식 1로 표시되는 Cas 단백질-RNA 복합체(Ribonucleoprotein: RNP)용 세포투과펩티드에 관한 것이다.
[일반식 1]
Arg-Arg-Arg-Trp-Cys-Lys-Arg-Arg-Arg-Ala-Ser-[Gly]m-[His-Glu]n
상기 식에서, m은 3 내지 7, n은 5 내지 15의 정수일 수 있다.
상기 식에서, [Gly]m는 링커로 각각의 펩티드를 서로 연결시켜주는 역할을 하는 것으로, m은 특별히 제한되지 않으나, 바람직하게는 상기 m이 3 내지 7일 수 있다. 만일 상기 m이 7보다 높으면 서열의 길이가 과도하게 길어져 세포투과효율이 저하될 수 있고, 3보다 짧으면 충분한 유연성을 확보할 수 없다. 보다 바람직하게 상기 식에서 m은 4 내지 6일 수 있다.
상기 식에서, n이 5 내지 15의 정수이면 세포투과펩티드로서 사용이 가능하나, 바람직하게는 9 내지 15, 더 바람직하게는 10 내지 12의 정수인 것이 마스킹(masking) 및 전달효율면에서 1.3~1.5배 이상 더 우수하다. 보다 더 바람직하게는 상기 n이 10의 정수일 수 있다.
본 발명은 세포 내로의 도입이 용이하지 않은 Cas 단백질-RNA 복합체(Ribonucleoprotein: RNP)를 세포 내로 투과성이 우수하도록 함으로써, 유전자 교정 효율을 증가시키고, off-target을 감소시켜 안정성을 확보하도록 하는 새로운 Cas 단백질-RNA 복합체(Ribonucleoprotein: RNP)를 제공할 수 있는 단백질을 개발하였다.
본 발명에서 사용된 일반식 1로 표시되는 아미노산 서열을 갖는 Cas 단백질-RNA 복합체(Ribonucleoprotein: RNP)용 세포투과펩티드는 전달효율 및 masking 효과가 가장 우수하면서 가장 작은 펩티드이므로, 혹시 발생할 수 있는 생물학적 간섭을 최소화할 수 있다.
일 구현예에 따르면 상기 일반식 1은 서열번호 10 내지 17 중에서 어느 하나로 표시할 수 있고, 바람직하게는 서열번호 15 내지 17 중에서 어느 하나일 수 있으며, 가장 바람직하게는 서열번호 15로 표시되는 아미노산 서열로 표시되는 것일 수 있다. 이러한 Cas 단백질-RNA 복합체(Ribonucleoprotein: RNP)용 세포투과펩티드는 전사약화부위(Attenuator)인 HE를 적정량 포함하고 있기 때문에 Cas 단백질-RNA 복합체(Ribonucleoprotein: RNP)의 형성에 전혀 간섭하지 않도록 하는 효과를 가지고 있다. 종래 세포투과성펩티드와 달리, 본 발명의 세포투과성펩티드가 결합된 Cas 단백질-RNA 복합체(Ribonucleoprotein: RNP)가 세포 내 전달효율 및 유전자 교정 효율이 가장 우수함을 후술하는 실험을 통해 확인하였다.
본 발명의 다른 측면은 a) 일반식 1로 표시되는 세포투과펩티드가 결합된 Cas 단백질; 및 b) 가이드 RNA;로 구성된 복합체(RNP)를 포함하는 유전자 교정용 조성물에 관한 것이다.
[일반식 1]
Arg-Arg-Arg-Trp-Cys-Lys-Arg-Arg-Arg-Ala-Ser-[Gly]m-[His-Glu]n
상기 식에서, m은 3 내지 7, n은 5 내지 15의 정수이다.
상기 식에서, [Gly]m는 링커로 각각의 펩티드를 서로 연결시켜주는 역할을 하는 것으로, m은 특별히 제한되지 않으나, 바람직하게는 상기 m이 3 내지 7일 수 있다. 만일 상기 m이 7보다 높으면 서열의 길이가 과도하게 길어져 세포투과효율이 저하될 수 있고, 3보다 짧으면 충분한 유연성을 확보할 수 없다. 보다 바람직하게 상기 식에서 m은 4 내지 6일 수 있다.
상기 식에서, n이 5 내지 15의 정수이면 세포투과펩티드로서 사용이 가능하나, 바람직하게는 9 내지 15, 더 바람직하게는 10 내지 12의 정수인 것이 마스킹(masking) 및 전달효율면에서 1.3~1.5배 이상 더 우수하다. 보다 더 바람직하게는 상기 n이 10의 정수일 수 있다.
상기 Cas 단백질 또는 유전자 정보는 NCBI(National Center for Biotechnology Information)의 GenBank와 같은 공지의 데이터 베이스에서 얻을 수 있다. 구체적으로, 상기 Cas 단백질은 Cas9 단백질일 수 있다. 또한, 상기 Cas 단백질은 캄필로박터 속(Campylobacter), 보다 구체적으로 캄필로박터 제주니 (Campylobacter jejuni) 유래의 Cas 단백질, 보다 구체적으로 Cas9 단백질일 수 있다. 보다 구체적인 예로 서열번호 9에 기재된 아미노산 서열, 또는 상기 서열의 단백질의 활성을 가지면서도 상동성을 가지는 단백질일 수 있다. 또한, 상기 단백질은 상기 서열번호 39과 적어도 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 또는 99%의 서열 동일성을 가질 수 있다 그러나, 상기 기술된 예에 제한되지 않는다.
또한, 상기 Cas 단백질은 천연형 단백질 외에도 가이드 RNA와 협동하여 활성화된 엔도뉴클레아제 또는 nickase로 작용할 수 있는 변이체를 모두 포함하는 개념으로 본 발명에서 사용된다. 활성화된 엔도뉴클레아제 또는 니카아제인 경우, 표적 DNA 절단을 가져올 수 있고, 이를 이용하여 유전체 교정을 가지고 올 수 있다. 또한, 불활성화된 변이체인 경우, 이를 이용하여 전사 조절 혹은 목적하는 DNA의 분리를 가져올 수 있다.
상기 Cas 단백질의 변이체는 촉매적 아스파라긴산 잔기(catalytic aspartate residue) 또는 히스티딘 잔기가 임의의 다른 아미노산으로 변경된 Cas9의 돌연변이 형태일 수 있다. 구체적으로, 다른 아미노산은 알라닌(alanine)일 수 있지만, 이에 제한되지 않는다.
보다 구체적으로 상기 Cas 단백질, 구체적으로 C. 제주니 유래의 Cas9 단백질은 8번의 촉매 아스파라긴산(aspartic acid, D), 또는 559번의 히스티딘 잔기(histidine, H)가 다른 아미노산으로 치환된 것일 수 있다. 구체적으로, 다른 아미노산은 알라닌(alanine)일 수 있지만, 이에 제한되지 않는다. 즉 Cas9 뉴클레아제 단백질 중 하나의 활성 부위(active site)에만 변이를 도입해 만든 Cas9 뉴클레아제 단백질은 가이드 RNA와 결합하였을 때, 니카아제(nickase)로 작용할 수 있다. 이와 같은 nickase는 두 개를 사용할 경우 양쪽 DNA 가닥을 둘 다 잘라 DSB(double strand breakage)를 일으킬 수 있으므로 RGEN의 범주에 포함된다.
본 발명에서 용어, "불활성화된 Cas 단백질"은 뉴클레아제의 기능이 전부 또는 일부 불활성화된 Cas 뉴클레아제단백질을 의미한다. 상기 불활성화된 Cas는 dCas로도 명명된다.
본원에 사용된, 용어 "절단"은 뉴클레오타이드 분자의 공유 결합 백본(covalent backbone)의 파손(breakage)을 포함한다.
상기 a) 일반식 1로 표시되는 세포투과펩티드가 결합된 Cas 단백질은, 세포 내에서 작용할 수 있도록 개발된 형태의 것으로, 바람직하게는 일반식 1로 표시되는 세포투과펩티드가 서열번호 9로 표시되는 Cas 단백질에 결합 또는 연결된 것일 수 있다. 상기 세포투과펩티드는 서열번호 10 내지 17로 표시되는 것이 바람직하고, 보다 바람직하게는 서열번호 15 내지 17이며, 가장 바람직하게는 서열번호 15로 표시되는 세포투과펩티드일 수 있다. 상기 서열번호 15로 표시되는 세포투과펩티드가 결합된 Cas 단백질은 서열번호 15로 표시될 수 있다.
만약 상기 일반식 1로 표시되는 세포투과펩티드 외에 다른 펩티드가 연결되면, 후술하는 실험예에서와 같이 유전자 교정효율 및 세포내 전달 효율이 현저히 저하되는 문제가 발생함은 물론이거니와, 세포내 전달 효율이 높더라도 off-target 비율이 높아지는 문제가 발생할 수 있다.
상기 Cas 단백질 또는 이를 암호화하는 핵산은 Cas 단백질을 핵 내에 위치시키기 위한 핵 위치 신호(nuclear localization signal, NLS)를 더 포함할 수 있다.
또한, 상기 Cas 단백질을 코딩하는 핵산은 추가적으로 핵 위치 신호 (nuclear localization signal, NLS) 서열을 포함할 수 있다. 따라서, 상기 Cas 단백질을 코딩하는 핵산을 포함하는 발현 카세트는 상기 Cas 단백질을 발현시키기 위한 프로모터 서열 등 조절 서열 외에도 NLS 서열을 포함할 수 있다. 그러나, 이에 제한되지 않는다.
Cas 단백질은 분리 및/또는 정제에 유리한 태그와 연결될 수 있다. 그 예로, His 태그, Flag 태그, S 태그 등과 같은 작은 펩타이드 태그, 또는 GST(Glutathione S-transferase) 태그, MBP(Maltose binding protein) 태그 등을 목적에 따라 연결할 수 있으나, 이에 제한되지 않는다.
본 발명에서 RNP는 a) 일반식 1로 표시되는 세포투과펩티드가 결합된 Cas 단백질; 및 b) 표적 DNA 특이적 가이드 RNA;가 결합한 복합체 형태의 리보핵산 단백질을 의미한다.
본 발명에서 상기 RNP는 a) 일반식 1로 표시되는 세포투과펩티드가 결합된 Cas 단백질 또는 이를 코딩하는 핵산; 및 b) 표적 DNA 특이적 가이드 RNA 또는 상기 가이드 RNA를 코딩하는 DNA;의 형태로 세포에 적용될 수 있으나, 이에 제한되지 않는다. 이때 상기 가이드 RNA 또는 이를 코딩하는 DNA와 a) 일반식 1로 표시되는 세포투과펩티드가 결합된 Cas 단백질 또는 이를 코딩하는 핵산;은 동시에 또는 순차적으로 세포에 적용될 수 있다.
따라서, 본 발명은 a) 일반식 1로 표시되는 세포투과펩티드가 결합된 Cas 단백질; 및 b) 가이드 RNA;로 구성된 RNP 복합체 형태로 세포에 전달되는 것이, 안정성과 유전자 교정 효율 및 전달효율 측면에서 가장 바람직하다. 특히 DNA 운반체를 매개로 하지 않으므로 유전자 변형 유기체의 위험성이 없다는 이점이 있다.
일 구현예에 따르면 상기 일반식 1은 서열번호 10 내지 17 중에서 어느 하나로 표시할 수 있고, 바람직하게는 서열번호 15 내지 17 중에서 어느 하나일 수 있으며, 가장 바람직하게는 서열번호 15로 표시되는 아미노산 서열로 표시되는 것일 수 있다. 상기 서열번호 15로 표시되는 Cas 단백질-RNA 복합체용 세포투과펩티드는 전달효울 및 masking 효과가 가장 우수하면서 가장 작은 펩티드이므로, 혹시 발생할 수 있는 생물학적 간섭을 최소화할 수 있다.
상기 "가이드 RNA(guide RNA)"는 표적 DNA 특이적인 RNA를 의미하며, Cas 단백질과 결합하여 Cas 단백질을 표적 DNA로 인도할 수 있다. 가이드 RNA는 절단하고자하는 어떠한 표적에 특이적이 되도록 제조될 수 있다.
본 발명에서 가이드 RNA는 두 개의 RNA, 즉, crRNA(CRISPR RNA) 및 tracrRNA (trans-activating crRNA)를 구성요소로 포함하는 이중 RNA(dual RNA); 또는 표적 DNA의 상보적 사슬(complementary strand)과 염기쌍을 형성할 수 있는 서열을 포함하는 제1 부위 및 Cas 단백질과 상호작용하는 서열을 포함하는 제2 부위를 포함하는 형태, 보다 구체적으로 crRNA 및 tracrRNA의 주요 부분이 융합된 형태인 sgRNA(single-chain guide RNA)일 수 있다.
상기 가이드 RNA의 표적 DNA 서열의 상보적 사슬과 염기 쌍을 형성할 수 있는 서열의 길이는 17 내지 23bp, 18 내지 23bp, 19 내지 23bp, 보다 구체적으로 20 내지 23bp, 보다 더 구체적으로, 21 내지 23bp 일 수 있으나, 이에 제한되지 않는다. 이는 이중 RNA 및 sgRNA에 모두 적용되며, 보다 구체적으로는 sgRNA에 적용될 수 있다.
또한, 상기 가이드 RNA는 표적 DNA 서열의 상보적 사슬과 염기쌍을 형성할 수 있는 서열의 5' 부위 앞에 1 내지 3 개의 추가적인 뉴클레오타이드, 보다 구체적으로 2개 또는 3개의 뉴클레오타이드를 가질 수 있다. 상기 뉴클레오타이드의 예로, A, T, G, C를 들 수 있다. 상기 가이드 RNA는 보다 구체적으로 1 개 내지 3개의 구아닌(guanine, G), 보다 더 구체적으로 2개 또는 3개의 G를 가질 수 있다. 이는 이중 RNA 및 sgRNA에 모두 적용되며, 보다 구체적으로는 sgRNA에 적용될 수 있다. 그러나, 상기 기술된 예들에 제한되는 것은 아니다.
상기 sgRNA는 표적 DNA 내 서열과 상보적인 서열을 가지는 부분(이를 Spacer region, Target DNA recognition sequence, base pairing region 등으로도 명명함) 및 Cas 단백질 결합을 위한 hairpin 구조를 포함할 수 있다. 보다 구체적으로, 표적 DNA 내 서열과 상보적인 서열을 가지는 부분, Cas 단백질 결합을 위한 hairpin 구조 및 Terminator 서열을 포함할 수 있다. 상기 기술된 구조는 5' 에서 3' 순으로 순차적으로 존재하는 것일 수 있다. 그러나, 이에 제한되는 것은 아니다.
상기 가이드 RNA가 crRNA 및 tracrRNA의 주요 부분 및 표적 DNA의 상보적인 부분을 포함하는 경우라면 어떠한 형태의 가이드 RNA도 본 발명에서 사용될 수 있다.
상기 가이드 RNA는 표적 DNA 서열의 상보적 사슬(complementary strand)과 염기 쌍을 형성할 수 있는 제1 부위; 및 13 내지 18bp(바람직하게는 5 내지 10bp)의 길이의 줄기 또는 루프 구조를 갖는 제2부위;를 포함하는 것일 수 있다.
즉, 상기 가이드 RNA는 표적 서열에 따라 또는 복합체를 형성할 엔도뉴클레아제의 종류 및/또는 그 유래 미생물에 따라서 적절히 선택될 수 있다. 예컨대, 상기 가이드 RNA는 CRISPR RNA(crRNA), trans-activating crRNA(tracrRNA), 및 단일 가닥 가이드 RNA(sgRNA)로 이루어진 군에서 선택된 1종 이상일 수 있으며, 엔도뉴클레오타이드 종류에 따라서, CRISPR RNA(crRNA) 및 trans-activating crRNA(tracrRNA)의 이중가닥 복합체, 또는 단일 가닥 가이드 RNA(sgRNA)일 수 있다. 상기 sgRNA는 crRNA 및 tracrRNA의 부분을 포함할 수 있다.
상기 조성물은 원핵세포, 진핵세포 또는 인간을 제외한 진핵 유기체에서 단일 위치 또는 다중 위치에 존재하는 표적 DNA(또는 유전자)를 교정하기 위한 것이다.
본 발명에서 "유전자 교정(gene editing)"은 표적 유전자 내의 표적 부위에 이중가닥 절단(double-stranded DNA cleavage)을 발생시켜서 하나 이상의 뉴클레오타이드의 변이(결실, 치환, 및/또는 삽입 등)를 유발하는 작용을 의미한다. 일 예에서, 상기와 같은 유전자 교정은 표적 부위에 종료코돈을 생성시키거나, 야생형과 다른 아미노산을 코딩하는 코돈을 생성시킴으로써, 표적 유전자를 불활성화 (knock-out)시키거나, 단백질을 생성하지 않는 비코딩 DNA 서열에 변이를 도입하는 등 다양한 형태일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 '표적 유전자(target gene)'는 유전자 교정의 대상이 되는 유전자를 의미하고, '표적 부위(target site or target region)'는 표적 유전자 내의 Cas(또는 Cas9)에 의한 유전자 교정이 일어나는 부위를 의미한다.
본 발명에서 '표적 서열(target sequence)'은 표적 유전자 또는 표적 유전자의 표적 부위 내의 가이드 RNA가 혼성화하는 뉴클레오타이드(nt)를 포함하는 부위의 염기서열일 수 있다.
상기 원핵세포, 진핵세포는 분리된 세포로, 상기 진핵세포는 효모, 곰팡이, 원생동물(protozoa), 식물, 고등 식물 및 곤충, 또는 양서류의 세포, 또는 CHO, HeLa, HEK293, 및 COS-1과 같은 포유동물로부터 분리된 세포일 수 있다. 상기 진핵세포는 당업계에서 일반적으로 사용되는, 배양된 세포(인 비트로), 이식된 세포(graft cell) 및 일차세포 배양(인 비트로 및 엑스 비보(ex vivo)), 및 인 비보(in vivo) 세포, 또한 인간을 포함하는 포유동물로부터 분리된 세포(mammalian cell)일 수 있다.
상기 진핵 유기체는 진핵세포(예컨대, 효모 등의 균류, 진핵 동물 및/또는 진핵 식물 유래세포(예컨대, 배아세포, 줄기세포, 체세포, 생식세포 등) 등), 진핵 동물(예컨대, 인간을 제외한 원숭이 등의 영장류, 개, 돼지, 소, 양, 염소, 마우스, 래트 등), 및 진핵식물(예컨대, 녹조류 등의 조류, 옥수수, 콩, 밀, 벼 등)로 이루어진 군에서 선택된 어느 하나일 수 있다.
본 발명의 다른 측면은 1) 상기 유전자 교정용 조성물을 분리된 원핵세포, 진핵세포 또는 인간을 제외한 진핵 유기체에 국소 주입법, 마이크로주입법(microinjection), 전기천공법(electroporation) 및 리포펙션(lipofection) 방법 중에서 선택되는 어느 하나로 도입하는 단계;를 포함하는 인간을 제외한 형질 전환체의 제조방법에 관한 것이다.
본 발명의 인간을 제외한 형질 전환체의 제조방법에 의하여 인간을 제외한 형질 전환체를 제조하는 경우 높은 성공률을 나타냈으며, 원하는 형질 전환체를 얻을 수 있는 것으로 확인되었다. 본 발명의 유전자 교정용 조성물을 통한 성공률은, 다른 유전자 교정용 조성물을 사용한 것에 비해 성공적으로 형질전환체를 얻을 수 있다는 점을 고려하면 현저하게 개선된 효과라고 할 수 있다.
본 발명은 상기 유전자 교정용 조성물을 함유하는 약제학적 조성물을 제공할 수 있다. 본 발명의 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다.
본 발명의 약제학적 조성물은 경구 또는 비경구로 투여할 수 있고, 바람직하게는 비경구 투여이며, 예컨대, 정맥 내 주입, 국소 주입 및 복강 주입 등으로 투여할 수 있다.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 소망하는 치료 또는 예방에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다. 본 발명의 바람직한 구현예에 따르면, 본 발명의 약제학적 조성물의 1일 투여량은 0.0001-100 ㎎/㎏이다.
본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화 함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시 예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
<실시예 1 내지 8> AP-HE-SpCas9 단백질을 포함하는 유전자 교정용 조성물의 제조
1) AP-HE-SpCas9이 삽입된 pET28a 벡터 제조
AP-HE-SpCas9 단백질(서열번호 10 내지 17)을 발현시킬 플라스미드 DNA(서열번호 41 내지 48; 도 1a)를 클로닝하기 위해 단백질 발현 벡터인 pET28a을 NheI, EcoRI 제한 효소로 자른 뒤 NheI-SpCas9-EcoRI를 코딩하는 DNA(서열번호 49)를 연결효소로 삽입하였다. 또한 AP-[HE]m(서열번호 1 내지 8)를 앞부분에 삽입하기 위하여 벡터를 NdeI과 NheI 제한효소로 자른 뒤 NdeI-AP-HE-NheI을 코딩하는 DNA(서열번호 32 내지 39)를 연결효소를 이용해 삽입하였다. 만들어진 각각의 플라스미드 DNA를 DH5α 대장균에 형질전환 후 얻어진 콜로니를 LB 배지(medium)에 접종한 후, 12 시간 동안 37 ℃ 200 RPM의 조건으로 진탕배양기(shaking incubator)에서 배양하였다. 배양이 완료된 후, 대장균을 회수하고, 이로부터 플라스미드 DNA를 분리한 다음, 이를 코스모진텍에 DNA 서열분석을 의뢰해 벡터가 정확히 제조되었는지를 최종확인하였다.
2) 대장균에서 AP-HE-SpCas9 단백질의 발현 및 정제
1) 단계를 통해 제조된 각각의 플라스미드 DNA를 대장균 BL21(DE3)star pLysS 균주에 형질전환 시켰다. 각각의 콜로니를 클로람페니콜(34 μg/㎖)과 엠피실린(50 μg/㎖) 항생제가 포함된 LB 액체배지 50 ㎖에 접종하여 37 ℃에서 10 시간 배양하여 이를 새로운 LB 액체배지 500 ㎖에 옮겨 담았다. 배양은 분광 광도계를 이용해 O.D600nm에서의 값이 0.4 ~ 0.6 사이가 될 때까지 수행하였다. IPTG를 농도가 0.2 mM이 되도록 첨가한 후 온도를 20 ℃로 낮추고, 150 rpm으로 14시간을 더 배양하였다. 배양이 완료된 후, 배양액을 회수하고, 이를 원심분리하여 상등액은 버리고, 펠렛(pellet)에 용해액(0.5M NaCl, 5mM 이미다졸, 20mM Tris-HCl, pH 8.0)을 첨가하여 재혼탁시켰다. 상기 재혼탁액를 초음파 세포 파쇄기(VCX-130(Sonics & Materials))로 처리한 다음 원심분리하고, 상등액을 분리하였다. 분리한 상등액을 0.45 ㎛ 필터를 이용해 여과한 후, AKTA prime 단백질 정제 기계를 이용하여 1M 이미다졸 용액을 사용하여 정제하고, PD-10 탈염 칼럼을 사용하여 AP-HE-SpCas9 단백질(서열번호 10 내지 17)을 최종 분리하였다. 이들을 각각 12% SDS-PAGE를 통해 확인하였다(도 1b).
도 1a는 실시예 1-6)으로부터 제조된 AP-HE10-SpCas9가 삽입된 pET28a 벡터이고, 도 1b는 실시예 6을 통해 정제된 AP-HE10-SpCas9 단백질(서열번호 15)을 SDS-PAGE로 분석한 결과이다. 이에 따르면 제대로 최종 분리 정제되었음을 알 수 있다.
<비교예 1 내지 7> CPP-SpCas9가 삽입된 pET28a 벡터 제조
1) CPP-SpCas9이 삽입된 pET28a 벡터 제조
CPP-SpCas9 단백질을 발현시킬 플라스미드 DNA(도 1a, 2)를 클로닝하기 위해 단백질 발현 벡터인 pET28a을 NheI, EcoRI 제한 효소로 자른 뒤 NheI-SpCas9-EcoRI를 코딩하는 DNA(서열번호 40)를 연결효소로 삽입하였다. 또한 CPP(AP, dNP2-HE, dNP2, R9-HE, R9, TAT-HE, TAT)를 앞부분에 삽입하기 위하여 벡터를 NdeI과 NheI 제한효소로 자른 뒤 NdeI-CPP-NheI을 코딩하는 DNA를 연결효소를 이용해 삽입하였다. 만들어진 플라스미드 DNA를 DH5α 대장균에 형질전환 후 얻어진 콜로니를 LB 배지(medium)에 접종한 후, 12 시간 동안 37 ℃ 200 RPM의 조건으로 진탕배양기(shaking incubator)에서 배양하였다. 배양이 완료된 후, 대장균을 회수하고, 이로부터 플라스미드 DNA를 분리한 다음, 이를 코스모진텍에 DNA 서열분석을 의뢰해 벡터가 정확히 제조되었는지를 최종확인하였다.
표 1에서 Ala Ser은 restriction enzyme site(AS:Nhel)이다.
구분 이름 서열번호 서열
비교예 1 AP 18(protein) ArgArgArgTrpCysLysArgArgArgAlaSer
49(gene) ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGCGCCGGCGCTGGTGCAAACGCCGCCGG
비교예 2 dNP2-HE10 22(protein) LysIleLysLysValLysLysLysGlyArgLysGlySerLysIleLysLysValLysLysLysGlyArgLysAlaSerGlyGlyGlyGlyGlyHisGluHisGluHisGluHisGluHisGluHisGluHisGluHisGluHisGluHisGlu
53(gene) ATGGGCGGTTCTCATCATCATCATCATCATCATATGAAGATCAAGAAGGTTAAAAAAAAGGGTCGCAAGGGCTCTAAAATTAAAAAAGTCAAGAAGAAAGGAAGAAAAGCTAGCGGTGGTGGTGGAGGTCACGAACATGAACATGAACATGAACACGAGCACGAGCATGAGCACGAACACGAACACGAA
비교예 3 dNP2 20(protein) LysIleLysLysValLysLysLysGlyArgLysGlySerLysIleLysLysValLysLysLysGlyArgLysAlaSer
51(gene) ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGAAGATCAAGAAGGTTAAAAAAAAGGGTCGCAAGGGCTCTAAAATTAAAAAAGTCAAGAAGAAAGGAAGAAAA
비교예 4 R9-HE10 26(protein) ArgArgArgArgArgArgArgArgArgAlaSerGlyGlyGlyGlyGlyHisGluHisGluHisGluHisGluHisGluHisGluHisGluHisGluHisGluHisGlu
57(gene) ATGGGCGGTTCTCATCATCATCATCATCATCATATGAGACGAAGACGAAGACGTAGACGTAGAGCTAGCGGTGGTGGTGGAGGTCACGAACATGAACATGAACATGAACACGAGCACGAGCATGAGCACGAACACGAACACGAA
비교예 5 R9 24(protein) ArgArgArgArgArgArgArgArgArgAlaSer
55(gene) ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGAGACGAAGACGAAGACGTAGACGTAGA
비교예 6 TAT-HE10 30(protein) TyrGlyArgLysLysArgArgGlnArgArgArgArgAlaSerGlyGlyGlyGlyGlyHisGluHisGluHisGluHisGluHisGluHisGluHisGluHisGluHisGluHisGlu
61(gene) ATGGGCGGTTCTCATCATCATCATCATCATCATATGTATGGACGCAAGAAGCGCCGCCAGCGCCGCCGCGCTAGCGGTGGTGGTGGAGGTCACGAACATGAACATGAACATGAACACGAGCACGAGCATGAGCACGAACACGAACACGAA
비교예 7 TAT 28(protein) TyrGlyArgLysLysArgArgGlnArgArgArgArgAlaSer
59(gene) ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGTATGGACGCAAGAAGCGCCGCCAGCGCCGCCGC
2) 대장균에서 CPP-SpCas9 단백질의 발현 및 정제
1) 단계를 통해 제조된 각각의 플라스미드 DNA를 대장균 BL21(DE3)star pLysS 균주에 형질전환 시킨 후 얻은 콜로니를 클로람페니콜(34 μg/㎖)과 엠피실린(50 μg/㎖) 항생제가 포함된 LB 액체배지 50 ㎖에 접종하여 37 ℃에서 10 시간 배양하여 이를 새로운 LB 액체배지 500 ㎖에 옮겨 담았다. 배양은 분광 광도계를 이용해 O.D600nm에서의 값이 0.4 ~ 0.6 사이가 될 때까지 수행하였다. IPTG를 농도가 0.2 mM이 되도록 첨가한 후 온도를 20 ℃로 낮추고, 150 rpm으로 14시간을 더 배양하였다. 배양이 완료된 후, 배양액을 회수하고, 이를 원심분리하여 상등액은 버리고, 펠렛(pellet)에 용해액(0.5M NaCl, 5mM 이미다졸, 20mM Tris-HCl, pH 8.0)을 첨가하여 재혼탁시켰다. 상기 재혼탁액를 초음파 세포 파쇄기(VCX-130(Sonics & Materials))로 처리한 다음 원심분리하고, 상등액을 분리하였다. 분리한 상등액을 0.45㎛ 필터를 이용해 여과한 후, AKTA prime 단백질 정제 기계를 이용하여 1M 이미다졸 용액을 사용하여 정제하고, PD-10 탈염 칼럼을 사용하여 CPP-SpCas9 단백질(서열번호 19, 21, 23, 25, 27, 29, 31)을 최종 분리하였다. 이를 12% SDS-PAGE를 통해 확인하였다(도 1b, 도 2).
도 1a는 비교예 2, 4, 6로부터 제조된 벡터가 도시되어 있고, 도 2a는 비교예 1, 3, 5, 7로부터 제조된 CPP-SpCas9가 삽입된 pET28a 벡터가 도시되어 있으며, 도 1b는 비교예 2, 4, 6을 통해 정제된 CPP-SpCas9 단백질(서열번호 23, 26, 31)을 SDS-PAGE로 분석한 결과이고, 도 2b는 비교예 1, 3, 5, 7을 통해 정제된 CPP-SpCas9 단백질(서열번호 19, 21, 25, 29)을 SDS-PAGE로 분석한 결과이다. 이에 따르면 제대로 최종 분리 정제되었음을 알 수 있다.
도 2c는 비교예 1로부터 제조된 AP-SpCas9 단백질을 서로 칼럼(정제기술)으로 정제하였을 때를 SDS-PAGE로 분석한 것으로, 본 방법에 따라 정제하는 것이 가장 바람직함을 알 수 있다.
<비교예 8 내지 15> CPP-AsCas12a, CPP-LbCas12a가 삽입된 pET28a 벡터 제조
1) CPP-AsCas12a, CPP-LbCas12a가 삽입된 pET28a 벡터 제조
CPP-AsCas12a, CPP-LbCas12a 단백질을 발현시킬 플라스미드 DNA(도 3, 4)를 클로닝하기 위해 단백질 발현 벡터인 pET28a을 NheI, EcoRI 제한 효소로 자른 뒤 NheI-AsCas12a(또는 LbCas12a)-EcoRI를 코딩하는 DNA(서열번호 63, 64)를 연결효소로 삽입하였다. 또한 CPP(AP, dNP2, R9, TAT)를 앞부분에 삽입하기 위하여 벡터를 NdeI과 NheI 제한효소로 자른 뒤 NdeI-CPP-NheI을 코딩하는 DNA를 연결효소를 이용해 삽입하였다. 만들어진 플라스미드 DNA를 DH5α 대장균에 형질전환 후 얻어진 콜로니를 LB 배지(medium)에 접종한 후, 12 시간 동안 37 ℃, 200 RPM의 조건으로 진탕배양기(shaking incubator)에서 배양하였다. 배양이 완료된 후, 대장균을 회수하고, 이로부터 플라스미드 DNA를 분리한 다음, 이를 코스모진텍에 DNA 서열분석을 의뢰해 벡터가 정확히 제조되었는지를 최종확인하였다.
2) 대장균에서 CPP-AsCas12a, CPP-LbCas12a 단백질의 발현 및 정제
1) 단계를 통해 제조된 각각의 플라스미드 DNA를 대장균 BL21(DE3)star pLysS 균주에 형질전환 시킨 후 얻은 콜로니를 클로람페니콜(34 μg/㎖)과 엠피실린(50 μg/㎖) 항생제가 포함된 LB 액체배지 50 ㎖에 접종하여 37 ℃에서 10 시간 배양하여 이를 새로운 LB 액체배지 500 ㎖에 옮겨 담았다. 배양은 분광 광도계를 이용해 O.D600nm에서의 값이 0.4 ~ 0.6 사이가 될 때까지 수행하였다. IPTG를 농도가 0.2 mM이 되도록 첨가한 후 온도를 20 ℃로 낮추고, 150 rpm으로 14시간을 더 배양하였다. 배양이 완료된 후, 배양액을 회수하고, 이를 원심분리하여 상등액은 버리고, 펠렛(pellet)에 용해액(0.5M NaCl, 5mM 이미다졸, 20mM Tris-HCl, pH 8.0)을 첨가하여 재혼탁시켰다. 상기 재혼탁액를 초음파 세포 파쇄기(VCX-130(Sonics & Materials))로 처리한 다음 원심분리하고, 상등액을 분리하였다. 분리한 상등액을 0.45㎛ 필터를 이용해 여과한 후, AKTA prime 단백질 정제 기계를 이용하여 1M 이미다졸 용액을 사용하여 정제하고, PD-10 탈염 칼럼을 사용하여 CPP(AP, dNP2, R9, TAT)-AsCas12a(서열번호 69, 70, 71, 72)(순서대로 비교예 8-11)와 CPP(AP, dNP2, R9, TAT)-LbCas12a 단백질(서열번호 73, 74, 75, 76)(순서대로 비교예 12-15)을 최종 분리하였다. 이를 12% SDS-PAGE를 통해 확인하였다(도 1b, 도 2).
도 3a는 비교예 8 내지 11로부터 제조된 CPP-AsCas12a가 삽입된 pET28a 벡터이고, 도 4a는 비교예 12 내지 15로부터 제조된 CPP-LbCas12a가 삽입된 pET28a 벡터이다. 도 3b는 비교예 8 내지 11을 통해 정제된 CPP-AsCas12a 단백질(서열번호 69, 70, 71, 72)을 SDS-PAGE로 분석한 결과이고, 도 4b는 비교예 11 내지 15로부터 제조된 CPP-LbCas12a 단백질(서열번호 73, 74, 75, 76)을 SDS-PAGE로 분석한 결과이다. 이에 따르면 제대로 최종 분리 정제되었음을 알 수 있다.
도 3c는 비교예 8로부터 제조된 AP-AsCas12a 단백질을 다양한 컬럼(정제기술)으로 정제하고, 각각을 SDS-PAGE로 분석한 결과로, 불순물없이 잘 정제되었음을 확인하였다.
<시험예 1> HEK293 T 세포주 안으로 단백질의 전달
상기 실시예 6에서 정제된 AP-HE-SpCas9 단백질을 인간 HEK293 T 세포주 내로 전달하는 실험을 통해 세포 투과능을 확인하였다. HEK293 T 세포를 DMEM를 사용하여 배양하고, 155 ㎕의 DMEM 배지를 분주해 놓은 96-well 플레이트의 각 well에 세포수가 2.5×105 만큼 들어있는 25 ㎕의 DMEM 배지를 첨가하는 방식으로 세포를 분주했다. 그리고 20 ㎕안에 D-PBS와 알맞은 농도가 되도록 처리할 단백질을 섞어주는 방식으로 총 부피가 200 ㎕가 되도록 세포와 단백질을 함께 다양한 조건에서 배양했다.
AP-HE-Cas9(2 μM)를 CQ(1, 10, 50, 100, 250, 500 μM)와 함께 혼합한 것, AP-HE-Cas9(2 μM)를 단독으로 사용한 것과 control(2 μM)을 각 well에 처리 후 2 시간 동안 5% CO2 세포 배양기에서 37 ℃로 배양했다. 배양한 세포는 원심분리 후 PBS 완충액으로 2번 세척하고, 트립신(trypsin) 용액으로 5분간 처리해 세포 표면에 붙은 단백질을 제거하였다. 여기에 DMEM 용액을 이용해 중화하고, 다시 PBS 완충액으로 세척한 다음, 유세포분석기(flow cytometry, FACS machine, BD science FACS canto II)를 이용해 세포내 형광을 측정해 전달효율을 확인하였다. 이때, CQ는 chloroquine으로, lysosomal degradation 억제제이다.
도 5는 AP-HE-Cas9(2 μM)(실시예 6)을 단독으로 처리하거나, CQ(1, 10, 50, 100, 250, 500 μM)와 함께 혼합한 것 및 control(2 μM)을 각 well에 처리한 후, 유세포분석기로 측정한 그래프이고, 이에 따르면 본 발명에 따른 AP-HE-Cas9 단백질은 농도가 증가할수록 세포투과효율도 증가하며, CQ과 혼합할 경우에는 CQ의 농도가 높아짐에 따라 세포투과율이 증가하고 있음을 알 수 있다.
<시험예 2> 암세포 주인 HeLa 세포주 안으로 AP-HE-SpCas9의 전달
시험예 1을 통해 본 발명의 AP-HE-SpCas9 단백질(실시예 6)이 세포 안으로 잘 전달됨을 확인하였다. 하지만 세포 안으로 전달 된 후 어디에 위치하는지는 분석할 수 없기에 현미경을 통해 세포 내부에서의 위치를 분석하고자 하였다.
6-well 플레이트의 각 well에 미리 현미경용 24 mm2 사각 커버글라스를 깔아두고 1×105 세포수의 HeLa 세포를 분주한 후, 24시간 동안 DMEM 배지에서 배양해 세포가 커버글라스에 부착될 수 있도록 하였다. 이후 DMEM 배지를 제거하고, 새로운 DMEM 배지 900 ㎕를 넣어주었다. 여기에 실시예 6으로부터 제조된 AP-HE-SpCas9 단백질을 0.5 μM, 1 μM, 2 μM 농도가 되도록 D-PBS와 혼합한 50 ㎕을 첨가하였다. 이후 2시간 동안 37 ℃ 조건하에서, 5% CO2 세포 배양기에서 배양하였다. 배양이 완료된 다음 부착세포를 제외한 단백질과 DMEM 배지를 제거하고 PBS 완충액으로 2번 세척한 후, 4% 파라포름알데하이드 인산완충액(paraformaldehyde phosphate buffer solution)(Wako) 1 ml로 세포를 고정한 다음, 다시 PBS 완충액으로 세척하고 녹색형광물질(Alexa fluor 488 conjugated phalloidin)(invitrogen)을 이용해 F-actin을 염색한 후, Hoechst 33342(invitrogen)으로 핵을 염색하였다. PBS 완충액으로 2번 세척하고, 이를 슬라이드 글라스 위에 마운팅한 다음 형광현미경(Eclipse 50i, Nikon) 혹은 공초점현미경(TCS SP5, Leica)을 이용함으로써, 세포내에서 본 발명의 AP-HE-Cas9(실시예 6) 단백질 위치를 확인하였다.
도 6은 AP-HE-Cas9(2 μM)(실시예 6)을 단독으로 처리하거나, CQ(500 μM)와 함께 혼합한 것을 각 well 에 처리한 후, 세포 내 형광을 촬영한 사진으로, 본 발명의 AP-HE-Cas9(실시예 6) 단백질은 세포 내에 잘 전달되어, 세포 내에 위치하고 있음을 확인하였다.
<시험예 3> Cas9 단백질-RNA 복합체(Ribonucleoprotein: RNP)의 유전자 교정 효능
1) AP-HE Cas9 단백질-RNA 복합체(Ribonucleoprotein: RNP) 제조
Cas9 단백질-RNA 복합체(Ribonucleoprotein: RNP)는 실시예 6의 AP-HE-SpCas9 단백질(5 μM)과 sgRNA(5 μM)를 1:1의 비율로 섞어준 후, 상온에서 10 분동안 반응시켜 AP-HE-Cas9 단백질-RNA 복합체를 제조하였고, 이후 AP-HE-Cas9 RNP로 표기하였다. crRNP는 Cas9 단백질 종류에 관계없이 Cas9 단백질-RNA 복합체(Ribonucleoprotein: RNP)를 통칭하는 것이다.
2) 유전자 교정
실시예 6의 AP-HE-SpCas9 단백질이 Cas9단백질-RNA 복합체(Ribonucleoprotein: RNP) 형태로 제조되었을 때, 세포 내에서 유전자 교정 효능을 나타내는지 확인하고자 하였다. 이를 위해 특정 유전자가 잘리면 RFP를 발현하는 동시에 GFP도 발현을 하는 RFP/GFP reporter system 및 T7 endonuclease 1 assay 이용하였다. 쥐 HEK293 T 세포주를 DMEM 배지로 배양하였다. 24 웰 플레이트의 각 웰에 400 ㎕ DMEM 배지를 분주해 놓고, 각각에 2.5×105 세포 수가 포함되어 있는 50 ㎕ DMEM 배지를 혼합하였다. 상기 50 ㎕ 배지에 존재하는 D-PBS와 알맞은 농도가 되도록 CQ(50 μM), AP-HE-Cas9 RNP을 첨가하였다(0일째). 이때 최종 부피는 500㎕가 되도록 하였다.
배양하고 1일째(1일째), HEK293 T 세포주에 AP-HE-Cas9 RNP를 각 well 에 5μM 처리하고, 6 시간 동안 5% CO2 세포 배양기에서 37 ℃로 배양한 다음, 새로운 DMEM 배지로 교체하였다.
다음날(2일째), AP-HE-Cas9 RNP를 각 well 에 5 μM 처리하고 6 시간 동안 5% CO2 세포 배양기에서 37 ℃로 반응시킨 후, 새로운 DMEM 배지로 교체하였다. 배양 3일째, 2일째와 동일하게 AP-HE RNp를 처리하고, 6 시간 반응시킨 다음, 배양액을 회수하고 원심분리하여 상등액을 제거하였다. 남아있는 펠렛에 PBS 완충액을 넣어 2번 세척하고, 트립신(trypsin)을 5분간 처리하여 세포 표면에 붙은 단백질을 제거하였다. RPMI 용액을 첨가하여 중화시킨 후, 다시 한번 PBS 완충액으로 세척하고, 유세포분석기(flow cytometry, FACS machine, BD science FACS canto II )및 T7 endonulease 1 assay를 이용해 유전자 교정 효율을 확인하였다. 이때 대조군으로 상기 세포에 CCR5 sgRNA vector 250 ng과 SpCas9 vector 250 ng을 매일 1회 혼합하였다.
도 7은 HEK293T세포에서의 AP-HE-Cas9 RNP에 의한 유전자 교정 효율을 측정한 결과로, 이에 따르면 본 발명에 따른 AP-HE-Cas9 단백질-RNA 복합체(Ribonucleoprotein: RNP)를 세포에 직접 처리함에도 불구하고, 세포 내에서 6.5 indel(%) 효율적으로 유전자가 교정되었음을 알 수 있다.
<시험예 4> HEK293 T 세포주에서의 AP-SpCas9 유전자 교정
비교예 1의 AP-SpCas9이 세포 내에서 유전자 교정 효능을 나타내는지 확인하고자 하였다. 이를 위해 특정 유전자가 잘리면 RFP를 발현하는 동시에 GFP도 발현을 하는 RFP/GFP reporter system 및 T7 endonuclease 1 assay 이용하였다. 쥐 HEK293 T 세포주를 DMEM 배지로 배양하였다. 24 웰 플레이트의 각 웰에 400 ㎕ DMEM 배지를 분주해 놓고, 각각에 2.5×105 세포 수가 포함되어 있는 50 ㎕ DMEM 배지를 혼합하였다. 상기 50 ㎕ 배지에 존재하는 D-PBS와 알맞은 농도가 되도록 CQ(50 μM), 비교예 1의 AP-Cas9를 첨가하였다(0일째). 이때 최종 부피는 500㎕가 되도록 하였다.
이때, 상기 HEK293 T 세포는 비교예 1의 AP-Cas9를 첨가하기 전에, CCR5 유전자를 표적으로하는 sgRNA 플라스미드를 lipofectamine으로 형질전환하였다.
배양하고 1일째, HEK293 T 세포에 AP-Cas9 플라스미드(비교예 1-1) CCR5 유전자를 표적으로 하는 sgRNA 플라스미드를 lipofectamine을 통해 전달한 후, 5% CO2 세포 배양기에서 37 ℃, 24 시간동안 배양하였다. 2일째, DMEM 배지를 새로 교체하고, AP-SpCas9 단백질(비교예 1) 5μM를 각 well 에 처리하고, 6 시간 동안 5% CO2 세포 배양기에서 37 ℃로 반응시켰다. 6 시간이 지난후 새로운 DMEM 배지로 교체하였다. 3일째, AP-SpCas9 단백질(비교예 1) 5μM를 각 well 에 처리하고, 6 시간 동안 5% CO2 세포 배양기에서 37 ℃로 반응시킨 후, 새로운 DMEM 배지로 교체하였다. 4일째, 3일째와 동일하게 AP-SpCas9을 처리하고, 6 시간 반응시킨 다음, 배양액을 회수하고 원심분리하여 상등액을 제거하였다. 남아있는 펠렛에 PBS 완충액을 넣어 2번 세척하고, 트립신(trypsin)을 5분간 처리하여 세포 표면에 붙은 단백질을 제거하였다. RPMI 용액을 첨가하여 중화시킨 후, 다시 한번 PBS 완충액으로 세척하고, 유세포분석기(flow cytometry, FACS machine, BD science FACS canto II )및 T7 endonulease 1 assay를 이용해 유전자 교정 효율을 확인하였다.
도 8은 HEK293T세포에서의 AP-SpCas9에 의한 유전자 교정 효율을 측정한 결과로, 이에 따르면 본 발명에 따른 AP-SpCas9와 sgRNA 플라스미드를 세포에 처리하면 indel(%)가 1.8~4.0인 것을 확인하였다.
<시험예 5> HEK293 T 세포주에서의 AP-RNP(Ribonucleoprotein) 유전자 교정
1) AP-HE Cas9 단백질-RNA 복합체(Ribonucleoprotein: RNP) 제조
Cas9 단백질-RNA 복합체(Ribonucleoprotein: RNP)는 비교예 1의 AP-SpCas9 단백질(5 μM)과 sgRNA(5 μM)를 1:1의 비율로 섞어준 후, 상온에서 10 분동안 반응시켜 AP Cas9 단백질-RNA 복합체를 제조하였고, 이후 AP-Cas9 RNP로 표기하였다. crRNP는 Cas9 단백질 종류에 관계없이 Cas9 단백질-RNA 복합체(Ribonucleoprotein: RNP)를 통칭하는 것이다.
2) 유전자 교정
비교예 1의 AP-SpCas9 단백질이 Cas9 단백질-RNA 복합체(Ribonucleoprotein: RNP) 형태로 제조되었을 때, 세포 내에서 유전자 교정 효능을 나타내는지 확인하고자 하였다. 이를 위해 특정 유전자가 잘리면 RFP를 발현하는 동시에 GFP도 발현을 하는 RFP/GFP reporter system 및 T7 endonuclease 1 assay 이용하였다. 쥐 HEK293 T 세포주를 DMEM 배지로 배양하였다. 24 웰 플레이트의 각 웰에 400 ㎕ DMEM 배지를 분주해 놓고, 각각에 2.5×105 세포 수가 포함되어 있는 50 ㎕ DMEM 배지를 혼합하였다. 상기 50 ㎕ 배지에 존재하는 D-PBS와 알맞은 농도가 되도록 CQ(50 μM), AP RNP을 첨가하였다(0일째). 이때 최종 부피는 500㎕가 되도록 하였다.
배양하고 1일째(1일째), HEK293 T 세포주에 AP-Cas9 RNP를 각 well 에 5μM 처리하고, 6 시간 동안 5% CO2 세포 배양기에서 37 ℃로 배양한 다음, 새로운 DMEM 배지로 교체하였다.
다음날(2일째), AP-Cas9 RNP를 각 well 에 5 μM 처리하고 6 시간 동안 5% CO2 세포 배양기에서 37 ℃로 반응시킨 후, 새로운 DMEM 배지로 교체하였다. 배양 3일째, 2일째와 동일하게 AP-Cas9 RNP를 처리하고, 6 시간 반응시킨 다음, 배양액을 회수하고 원심분리하여 상등액을 제거하였다. 남아있는 펠렛에 PBS 완충액을 넣어 2번 세척하고, 트립신(trypsin)을 5분간 처리하여 세포 표면에 붙은 단백질을 제거하였다. RPMI 용액을 첨가하여 중화시킨 후, 다시 한번 PBS 완충액으로 세척하고, 유세포분석기(flow cytometry, FACS machine, BD science FACS canto II)및 T7 endonulease 1 assay를 이용해 유전자 교정 효율을 확인하였다. 이때 대조군으로 상기 세포에 CCR5 sgRNA vector 250 ng과 SpCas9 vector 250 ng을 매일 1회 혼합하였다.
도 9는 HEK293T세포에서의AP-Cas9 RNP에 의한 유전자 교정 효율을 측정한 결과로, 이에 따르면 본 발명에 따른 AP Cas9 단백질-RNA 복합체(Ribonucleoprotein: RNP)를 세포에 직접 처리하면 indel(%)가 0.1~1.8로 나타났으며, 이는 본 발명의 일반식 1로 표시되는 AP-HE-Cas9 RNP, 특히 실시예 6의 AP-HE-Cas9 RNP를 사용하는 것이 약 3~6배 더 효율적임을 알 수 있다.
<시험예 6> 생체 외(in vitro)에서 실시예 6으로부터 제조된 AP-HE-SpCas9의 유전자 교정 효능
본 발명의 실시예 6으로부터 제조된 AP-HE-SpCas9 단백질은 전사약화부위(Attenuator)인 HE가 10개 포함된 것으로, 세포투과성 펩티드의 +전하를 억제할 수 있는 기능을 한다. 본 발명의 실시예 1의 AP-HE-SpCas9 단백질을 이용하여 생체 외(In vitro)에서 표적 DNA가 잘리는지 효율을 확인하였다. 먼저 Cas9(서열번호 9), 비교예 1의 AP-Cas9(서열번호 19) 또는 실시예 6의 AP-HE-Cas9(서열번호 15) 50 nM와 sgRNA 50 nM를 혼합한 다음, 상온에서 15 분 동안 반응시켜 Cas9 단백질-RNA 복합체(Ribonucleoprotein: RNP)를 제조하였다. 이후 300 ng의 표적 DNA를 37 ℃에서 15, 30 혹은 60 분 동안 반응시켜 표적 DNA가 잘리는지를 Agarose 전기영동(0.8%아가로스 젤)을 통해 확인하였다.
도 10은 Cas9(서열번호 9), 비교예 1의 AP-Cas9(서열번호 19) 또는 실시예 6의 AP-HE-Cas9(서열번호 15)를 sgDNA와 혼합하여 RNP를 제조하고, 이를 표적 DNA에 15, 30, 60 분 동안 처리한 후, 분석한 Agarose 전기영동결과이다. 이에 따르면 본 발명의 실시예 6의 AP-HE-Cas9(서열번호 15)와 sgDNA의 복합체(RNP)가 가장 우수한 절단 효율을 나타내고 있음을 확인할 수 있다. 즉 HE 서열이 추가된 단백질(AP-HE-Cas9)의 경우 HE 서열이 없는 단백질(AP-Cas9)보다 뛰어난 유전자 교정 효율을 갖고 있음을 알 수 있다.
<시험예 7> 생체 외(in vitro)에서 비교예들의 유전자 교정 효능
본 발명의 실시예 6으로부터 제조된 AP-HE-SpCas9 단백질은 전사약화부위(Attenuator)인 HE가 10개 포함된 것으로, 세포투과성 펩티드의 +전하를 억제할 수 있는 기능을 한다. 본 발명의 실시예 6의 AP-HE-SpCas9 단백질을 이용하여 생체 외(In vitro)에서 표적 DNA가 잘리는지 효율을 확인하였다. 먼저 Cas9(서열번호 9), 비교예 7의 TAT-Cas9(서열번호 29), 비교예 6의 TAT-HE-Cas9(서열번호 31), 비교예 5의 R9-Cas9(서열번호 25), 비교예 4의 R9-HE-Cas9(서열번호 27), 비교예 3의 dNP2-Cas9(서열번호 21) 혹은 비교예 2의 dNP2-HE-Cas9(서열번호 23) 50 nM와 sgRNA 50 nM을 혼합하고, 상온에서 15 분 동안 반응시켜 Cas9 단백질-RNA 복합체(Ribonucleoprotein: RNP)를 제조하였다. 이후 300 ng의 표적 DNA를 37 ℃에서 15분 혹은 60 분 동안 반응시켜 표적 DNA가 잘리는지를 Agarose 전기영동(0.8% 아가로스 젤)을 통해 확인하였다.
도 11은 Cas9(서열번호 9), 비교예 7의 TAT-Cas9(서열번호 29), 비교예 6의 TAT-HE-Cas9(서열번호 31), 비교예 5의 R9-Cas9(서열번호 25), 비교예 4의 R9-HE-Cas9(서열번호 27), 비교예 3의 dNP2-Cas9(서열번호 21) 혹은 비교예 2의 dNP2-HE-Cas9(서열번호 23)를 sgDNA와 혼합하여 RNP를 제조하고, 이를 표적 DNA에 15, 60 분 동안 처리한 후, 분석한 Agarose 전기영동결과이다. 이에 따르면 비교예 2 내지 7의 CPP-SpCas9 단백질과 sgDNA와의 복합체는 절단되지 않은 표적 DNA가 일부 남아 있는 것을 확인하였다. 종합하면 본 발명의 실시예 6의 AP-HE-Cas9(서열번호 15)와 sgDNA의 복합체(RNP)가 가장 우수한 절단 효율을 나타내고 있음을 확인할 수 있다.
즉, HE 서열이 추가된 TAT, R9, dNP2 등의 CPP(세포투과성펩티드)에서는 오히려 유전자 교정 효과가 줄어듬을 알 수 있다.
<시험예 8> 전사약화부위인 HE 길이에 따른 유전자 교정 효능
본 발명의 실시예 1 내지 8로부터 제조된 AP-HE-Cas9 단백질을 이용하여 생체 외(in vitro)에서 표적 DNA의 유전자 교정 효율을 확인하고자 하였다. 본 발명의 실시예 1 내지 8로부터 제조된 AP-HE-SpCas9 단백질 50 nM과 sgRNA 50 nM을 혼합하고, 상온에서 15 분 동안 반응시켜 Cas9 단백질-RNA 복합체(Ribonucleoprotein: RNP)를 제조하였다.
6-well 플레이트의 각 well에 미리 현미경용 24 mm2 사각 커버글라스를 깔아두고 1×105 세포수의 HeLa 세포를 분주한 후, 24시간 동안 DMEM 배지에서 배양해 세포가 커버글라스에 부착될 수 있도록 하였다. 이후 DMEM 배지를 제거하고, 새로운 DMEM 배지 900 ㎕를 넣어주었다. 상기 Hela 세포 각각에 실시예 1 내지 8로부터 제조된 AP-HE-Cas9 단백질을 1, 2, 5 μM 농도로 첨가하고 1 시간 동안 다양한 pH 조건(pH 7.4, 6.5, 6.0)과 37 ℃ 조건하에서, 5% CO2 세포 배양기에서 배양하였다. 배양한 세포는 원심분리 후 PBS 완충액으로 2번 세척하고, 트립신(trypsin) 용액으로 5분간 처리해 세포 표면에 붙은 단백질을 제거하였다. 여기에 DMEM 용액을 이용해 중화하고, 다시 PBS 완충액으로 세척한 다음, 유세포분석기(flow cytometry, FACS machine, BD science FACS canto II)를 이용해 세포내 형광을 측정해 전달효율을 확인하였다.
도 12는 각 well에 실시예 1 및 6으로부터 제조된 AP-HE-Cas9(서열번호 10 및 서열번호 15) 각각을 다양한 농도(1, 2, 5 μM)와 다양한 pH 조건(pH 7.4, 6.5, 6.0)으로 처리한 후, 유세포분석기로 측정한 그래프이다. 이에 따르면 동일조건에서 실시예 1의 AP-HE5-Cas9(서열번호 10)보다 실시예 6의 AP-HE10-Cas9(서열번호 15)인 것이 현저히 더 높은 Masking 효과를 보임을 알 수 있다.
또한, pH 7.4 및 6.5 조건에서 실시예 1의 AP-HE5-Cas9(서열번호 10)보다 실시예 6의 AP-HE10-Cas9(서열번호 15)가 더 전달효율이 높음을 확인할 수 있다.
도 13a 내지 도 13g는 각 well에 비교예 1로부터 제조된 AP-Cas9와 실시예 1, 2, 4, 6, 8로부터 제조된 AP-HE-Cas9 각각을 다양한 농도(1, 2, 5 μM)와 다양한 pH 조건(pH 7.4, 6.5, 6.0)으로 처리한 후, 유세포분석기로 측정한 그래프이다. 이때, 실시예 6의 AP-HE10-Cas9(서열번호 15)은 ‘10HE’, 실시예 1의 AP-HE5-Cas9(서열번호 10)은 ‘5HE’, 실시예 2의 AP-HE6-Cas9(서열번호 11)는 ‘6HE’, 실시예 4의 AP-HE8-Cas9(서열번호 13)는 ‘8HE’, 실시예 8의 AP-HE5-Cas9(서열번호 17)는 ‘12HE’로 표기하였다.
이에 따르면 동일조건에서 실시예 6의 AP-HE10-Cas9(서열번호 15)가 실시예 1의 AP-HE5-Cas9(서열번호 10), 실시예 2의 AP-HE6-Cas9(서열번호 11), 실시예 4의 AP-HE8-Cas9(서열번호 13)보다 현저히 더 높은 Masking 효과를 보임을 확인하였다.
또한, pH 7.4 내지 6.0 조건에서 실시예 6의 AP-HE10-Cas9(서열번호 15)가 실시예 1의 AP-HE5-Cas9(서열번호 10), 실시예 2의 AP-HE6-Cas9(서열번호 11), 실시예 4의 AP-HE8-Cas9(서열번호 13)보다 더 전달효율이 높음을 확인할 수 있다.
한편, 실시예 6의 AP-HE10-Cas9(서열번호 15)과 실시예 8의 AP-HE5-Cas9(서열번호 17)는 HE 서열길이가 달라졌음에도 masking 및 delivery 효율에서 큰 차이를 보이지 않았다.
즉, 다양한 pH 조건에서 6개 또는 8개 HE 서열을 갖는 실시예 2, 4보다 10개의 HE 서열을 갖는 실시예 6이 masking 효율이 뛰어난 것을 보였으나, 실시예 6과 실시예 9의 AP-HE-Cas9는 거의 차이가 나타나지 않았다. 이를 통해 HE를 10개 반복 이후로 더 늘리는 것이 효과에 크게 없음을 확인할 수 있는 바, 실시예 6의 AP-HE10-Cas9가 가장 바람직함을 알 수 있다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.

Claims (13)

  1. 하기 일반식 1로 표시되는 Cas 단백질-RNA 복합체(Ribonucleoprotein: RNP)용 세포투과펩티드.
    [일반식 1]
    Arg-Arg-Arg-Trp-Cys-Lys-Arg-Arg-Arg-Ala-Ser-[Gly]m-[His-Glu]n
    상기 식에서, m은 3 내지 7, n은 5 내지 15의 정수이다.
  2. 제1항에 있어서,
    상기 일반식 1에서, m은 9 내지 15의 정수인 것을 특징으로 하는 Cas 단백질-RNA 복합체(Ribonucleoprotein: RNP)용 세포투과펩티드.
  3. 제1항에 있어서,
    상기 일반식 1에서, m은 10 내지 12의 정수인 것을 특징으로 하는 Cas 단백질-RNA 복합체(Ribonucleoprotein: RNP)용 세포투과펩티드.
  4. 제1항에 있어서,
    상기 Cas 단백질-RNA 복합체(Ribonucleoprotein: RNP)용 세포투과펩티드는 서열번호 6으로 표시되는 것을 특징으로 하는 Cas 단백질-RNA 복합체(Ribonucleoprotein: RNP)용 세포투과펩티드.
  5. a) 일반식 1로 표시되는 세포투과펩티드가 결합된 Cas 단백질; 및
    b) 가이드 RNA;로 구성된 복합체(RNP)를 포함하는 유전자 교정용 조성물.
    [일반식 1]
    Arg-Arg-Arg-Trp-Cys-Lys-Arg-Arg-Arg-Ala-Ser-[Gly]m-[His-Glu]n
    상기 식에서, m은 3 내지 7, n은 5 내지 15의 정수이다.
  6. 제5항에 있어서,
    상기 일반식 1에서, m은 10 내지 12의 정수인 것을 특징으로 하는 유전자 교정용 조성물.
  7. 제5항에 있어서,
    상기 일반식 1에서, m은 9 내지 15의 정수인 것을 특징으로 하는 유전자 교정용 조성물.
  8. 제5항에 있어서,
    상기 일반식 1에서, m은 10 내지 12의 정수인 것을 특징으로 하는 유전자 교정용 조성물.
  9. 제5항에 있어서,
    상기 Cas 단백질은 서열번호 9로 표시되는 것을 특징으로 하는 유전자 교정용 조성물.
  10. 제5항에 있어서,
    상기 가이드 RNA는 crRNA 및 tracrRNA를 포함하는 이중 RNA(dual RNA) 또는 단일-사슬 가이드 RNA(sgRNA) 형태인 것을 특징으로 하는 유전자 교정용 조성물.
  11. 제5항에 있어서,
    상기 조성물은 원핵세포, 진핵세포 또는 인간을 제외한 진핵 유기체에서 단일 위치 또는 다중 위치 유전자의 표적화된 돌연변이를 유도하는 것을 특징으로 하는 유전자 교정용 조성물.
  12. 1) 제5항의 유전자 교정용 조성물을 분리된 원핵세포, 진핵세포 또는 인간을 제외한 진핵 유기체에 국소 주입법, 마이크로주입법(microinjection), 전기천공법(electroporation) 및 리포펙션(lipofection) 방법 중에서 선택되는 어느 하나로 도입하는 단계;를 포함하는 인간을 제외한 형질 전환체의 제조방법.
  13. 상기 제11항의 방법에 의하여 제조된 인간을 제외한 형질 전환체.
PCT/KR2019/018627 2018-12-27 2019-12-27 Crispr-cas를 기반으로 하는 유전자 교정용 조성물 Ceased WO2020139031A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US17/312,174 US12503492B2 (en) 2018-12-27 2019-12-27 CRISPR-Cas-based composition for gene correction

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20180170463 2018-12-27
KR10-2018-0170463 2018-12-27
KR10-2019-0174907 2019-12-26
KR1020190174907A KR102386498B1 (ko) 2018-12-27 2019-12-26 Crispr-cas를 기반으로 하는 유전자 교정용 조성물

Publications (1)

Publication Number Publication Date
WO2020139031A1 true WO2020139031A1 (ko) 2020-07-02

Family

ID=71129867

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/018627 Ceased WO2020139031A1 (ko) 2018-12-27 2019-12-27 Crispr-cas를 기반으로 하는 유전자 교정용 조성물

Country Status (2)

Country Link
US (1) US12503492B2 (ko)
WO (1) WO2020139031A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220136640A (ko) * 2021-04-01 2022-10-11 가톨릭대학교 산학협력단 세포투과성 Regnase-1 재조합 단백질 및 이를 유효성분으로 함유하는 항염증용 조성물

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100810927B1 (ko) * 2000-08-25 2008-03-10 아벤티스 파마슈티칼스 인크. 막 관통 펩타이드 및 이의 용도
KR20160089527A (ko) * 2013-12-12 2016-07-27 더 브로드 인스티튜트, 인코퍼레이티드 게놈 편집을 위한 ｃｒｉｓｐｒ-ｃａｓ 시스템 및 조성물의 전달, 용도 및 치료적 응용
US20160304893A1 (en) * 2013-12-13 2016-10-20 Cellectis Cas9 nuclease platform for microalgae genome engineering
KR101841211B1 (ko) * 2014-03-10 2018-03-22 한양대학교 산학협력단 세포 투과성 펩티드 및 이를 이용한 생물학적 활성 물질의 전달방법
WO2018062866A2 (en) * 2016-09-28 2018-04-05 Cellivery Therapeutics, Inc. CELL-PERMEABLE (CP)-Cas9 RECOMBINANT PROTEIN AND USES THEREOF

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100810927B1 (ko) * 2000-08-25 2008-03-10 아벤티스 파마슈티칼스 인크. 막 관통 펩타이드 및 이의 용도
KR20160089527A (ko) * 2013-12-12 2016-07-27 더 브로드 인스티튜트, 인코퍼레이티드 게놈 편집을 위한 ｃｒｉｓｐｒ-ｃａｓ 시스템 및 조성물의 전달, 용도 및 치료적 응용
US20160304893A1 (en) * 2013-12-13 2016-10-20 Cellectis Cas9 nuclease platform for microalgae genome engineering
KR101841211B1 (ko) * 2014-03-10 2018-03-22 한양대학교 산학협력단 세포 투과성 펩티드 및 이를 이용한 생물학적 활성 물질의 전달방법
WO2018062866A2 (en) * 2016-09-28 2018-04-05 Cellivery Therapeutics, Inc. CELL-PERMEABLE (CP)-Cas9 RECOMBINANT PROTEIN AND USES THEREOF

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220136640A (ko) * 2021-04-01 2022-10-11 가톨릭대학교 산학협력단 세포투과성 Regnase-1 재조합 단백질 및 이를 유효성분으로 함유하는 항염증용 조성물
KR102560134B1 (ko) * 2021-04-01 2023-07-27 가톨릭대학교 산학협력단 세포투과성 Regnase-1 재조합 단백질 및 이를 유효성분으로 함유하는 항염증용 조성물

Also Published As

Publication number Publication date
US12503492B2 (en) 2025-12-23
US20220009968A1 (en) 2022-01-13

Similar Documents

Publication Publication Date Title
Pause et al. The HRIGRXXR region of the DEAD box RNA helicase eukaryotic translation initiation factor 4A is required for RNA binding and ATP hydrolysis
WO2018030608A1 (ko) Cas9 단백질 및 가이드 RNA의 혼성체를 함유하는 나노 리포좀 전달체 조성물
KR20160050070A (ko) 기능성 뉴클레아제의 전달 시스템
WO2015137705A1 (ko) 세포 투과성 펩티드 및 이를 이용한 생물학적 활성 물질의 전달방법
WO2019117660A2 (ko) Crispr 시스템 기능 향상 방법 및 그의 이용
WO2023182858A1 (ko) 식물세포 소기관 dna의 아데닌을 구아닌으로 염기 교정하는 방법
WO2023128078A1 (ko) 수퍼옥시드 디스뮤타제 및 이의 건성안의 예방 또는 치료용 용도
KR101765394B1 (ko) 돼지 유행성설사 바이러스의 에피토프 단백질, 이를 암호화하는 유전자를 포함하는 재조합 벡터, 이를 발현하는 형질전환체 및 이를 포함하는 돼지 유행성설사 바이러스 예방 또는 치료용 조성물
WO2021215857A1 (ko) 삼량체를 형성하는 코로나-19 바이러스 (covid-19, coronavirus disease 2019)의 재조합 스파이크 단백질 및 식물에서의 상기 재조합 스파이크 단백질의 대량 생산 방법과 이를 기반으로하는 백신조성물 제조 방법
WO2021125840A1 (ko) Cpf1 및 키메릭 dna-rna 가이드를 포함하는 유전체 교정 또는 발현 억제용 조성물
WO2019240429A1 (ko) 세포 투과 펩티드 및 아데노신 탈아미노화효소의 융합 단백질을 포함하는 중증복합면역결핍증 치료용 약학적 조성물
WO2021141421A1 (ko) 조류인플루엔자 바이러스에 저항성을 갖는 유전자 편집 조류의 제조방법
WO2024085674A1 (ko) Cas 단백질 및 박테리아 톡신을 포함하는 융합 단백질 및 이의 용도
WO2023008887A1 (ko) 염기 편집기 및 이의 용도
WO2022114815A1 (ko) 트랜스-스플라이싱 아데노-연관 바이러스 벡터를 포함하는 프라임에디팅용 조성물
US12503492B2 (en) CRISPR-Cas-based composition for gene correction
WO2023167575A1 (ko) 저면역원성 줄기세포, 줄기세포로부터 분화되거나 유래된 저면역원성 세포 및 이의 제조방법
WO2019147055A1 (ko) 이황화결합 이성질화효소 신호 펩타이드를 포함하는 재조합 벡터 및 이의 용도
WO2022250503A1 (ko) Cas13 단백질 및 crrna를 포함하는 코로나바이러스감염증-19 예방 또는 치료용 약학적 조성물
Tang et al. High-level expression, purification and antibacterial activity of bovine lactoferricin and lactoferrampin in Photorhabdus luminescens
WO2016140419A1 (ko) 코리네박테리움 속 박테리아 및 이로부터 유래된 미니셀 그리고 이의 용도
WO2021125917A1 (ko) Whep 도메인 융합에 의한 목적 단백질의 수용성 증진 방법
WO2021256750A1 (ko) Ｓｉｒｎａ의 생성 및 기능 증진 활성을 갖는 ｃｍｔｒ１의 신규용도
JP6956995B2 (ja) ゲノム編集方法
WO2022131398A1 (ko) 유전자 발현 및 억제가 동시에 가능한 핵산 구조체

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19904900

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19904900

Country of ref document: EP

Kind code of ref document: A1