WO2021141421A1 - 조류인플루엔자 바이러스에 저항성을 갖는 유전자 편집 조류의 제조방법 - Google Patents

조류인플루엔자 바이러스에 저항성을 갖는 유전자 편집 조류의 제조방법 Download PDF

Info

Publication number
WO2021141421A1
WO2021141421A1 PCT/KR2021/000216 KR2021000216W WO2021141421A1 WO 2021141421 A1 WO2021141421 A1 WO 2021141421A1 KR 2021000216 W KR2021000216 W KR 2021000216W WO 2021141421 A1 WO2021141421 A1 WO 2021141421A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
gene
anp32a
avian influenza
bird
Prior art date
Application number
PCT/KR2021/000216
Other languages
English (en)
French (fr)
Inventor
한재용
박영현
서정용
임정묵
Original Assignee
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교산학협력단 filed Critical 서울대학교산학협력단
Priority to US17/776,141 priority Critical patent/US20220380797A1/en
Publication of WO2021141421A1 publication Critical patent/WO2021141421A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/30—Bird
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/02—Animal zootechnically ameliorated
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites

Definitions

  • the present invention relates to a method for producing a gene-edited bird having resistance to avian influenza virus.
  • This patent application claims priority to Korean Patent Application No. 20-2154, filed with the Korean Intellectual Property Office on January 07, 2020, the disclosure of which is incorporated herein by reference.
  • Avian Influenza Viruses cause huge economic losses in the poultry industry and are highly likely to cause infection and mortality in humans.
  • recent studies have focused on targeting host cell factors that are inevitably necessary for virus propagation (Korean Patent Application Laid-Open No. 10-2013-0126243).
  • vPol viral polymerases
  • vPol select host cell cell machinery, including DNA-dependent RNA polymerases, splicing factors and other RNA processing factors. It efficiently replicates and transcribes viral RNA in host cells.
  • viral ribonucleoproteins are released into the cytoplasm and then transported to the host nucleus for viral RNA replication.
  • AIV replication from positive-sense complementary RNA to negative-sense single-stranded viral RNA occurs in the host nucleus by cellular DNA-dependent RNA polymerase II, where vPol actively selects the cellular machinery of the host cell.
  • ANP32A Acidic Nuclear Phosphoprotein 32 Family Member A
  • the present inventors identified the key amino acids involved in virus replication in ANP32A, and efficiently modified the ANP32A gene by inducing only the modification of the key amino acids through precise gene editing based on the CRISPR/Cas9 system to form a cell line resistant to avian influenza and It was confirmed that a bird model could be manufactured, and the present invention was completed.
  • gRNA guide RNA
  • ANP32A Acidic Nuclear Phosphoprotein 32 Family Member A
  • CRISPR associated protein 9 CRISPR associated protein 9
  • Cpf1 CRISPR from Prevotella and Francisella 1
  • TALEN Transcription activator-like effector nuclease
  • ZFN Zinc Finger Nuclease
  • Another aspect is to provide a transformed cell into which the recombinant vector or the composition for genome editing is introduced, and a method for preparing the same.
  • Another aspect is to provide a method for producing a gene-edited bird comprising the step of transplanting the transformed cell into an avian embryo, and a gene-edited bird having resistance to the avian influenza virus produced by the method.
  • the term "vector” refers to DNA that can be propagated by introducing a desired DNA fragment into a host bacteria, etc., and is also referred to as a cloning vehicle.
  • the vector DNA is cut with restriction enzymes, etc. to open the ring and Here, a target DNA fragment is inserted, ligated, and introduced into the host bacteria.
  • the vector DNA linking the target DNA fragment is replicated as the host bacteria proliferates, and is distributed to each cystic cell along with the division of the fungus to maintain the target DNA fragment from generation to generation, and plasmids and phage chromosomes are mainly used.
  • the term "recombinant vector” is used as a vector for performing gene editing by inducing a nucleotide sequence double-strand deletion in a specific gene site using a CRISPR/Cas9 system, etc., and efficiently modifying a target gene in an appropriate host cell.
  • the host cell may preferably be a eukaryotic cell, and an expression control sequence such as a promoter, terminator, enhancer, etc., a sequence for membrane targeting or secretion, etc. is appropriately selected according to the type of host cell. and can be combined in various ways depending on the purpose.
  • guide RNA refers to an RNA specific to a target DNA.
  • the guide RNA may be, for example, one or more selected from the group consisting of CRISPR RNA (crRNA), trans-activating crRNA (tracrRNA), and single guide RNA (sgRNA), specifically crRNA and tracrRNA It may be a double-stranded RNA comprising as a component, or a single-stranded guide RNA (sgRNA) in which crRNA or a portion thereof and tracrRNA or a portion thereof are linked by an oligonucleotide linker, but the (RNA-guide) nuclease has activity in the target sequence. It may be included without limitation as long as it is possible.
  • nuclease refers to an enzyme that cuts a specific nucleotide sequence of a gene.
  • the nuclease may specifically be TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease), or RNA-guided nuclease.
  • RNA-guided nuclease refers to a nuclease capable of recognizing and cleaving a specific position on a desired genome, particularly a nuclease having target specificity by a guide RNA.
  • the RNA-guided nuclease is not limited thereto, and specifically, a Cas9 protein derived from CRISPR, which is a microbial immune system, specifically Cas9 (CRISPR Associated Protein 9) and Cpf1, may be included.
  • the nuclease may cause a double strand break (DSB) by recognizing a specific nucleotide sequence in the genome of an animal or plant cell including a human cell, and may form a nick.
  • the double helix cutting includes cutting the double helix of DNA to make a blunt end or a cohesive end.
  • the double helix cut is efficiently repaired by a homologous recombination or non-homologous end-joining (NHEJ) mechanism in the cell, and at this time, a desired mutation can be introduced into the target site.
  • NHEJ non-homologous end-joining
  • the nuclease may be artificial or engineered non-naturally occurring.
  • CRISPR/Cas9 or “CRISPR/Cas9 system” is a genome editing method called CRISPR (Clustered regularly interspaced short palindromic repeat: CRISPR) gene scissors, and RNA that specifically binds to a specific nucleotide sequence ( gRNA) and Cas9 protein, which acts as a scissors to cut a specific base sequence.
  • CRISPR Clustered regularly interspaced short palindromic repeat
  • CRISPR associated protein 9 protein refers to an essential protein element in the CRISPR/Cas9 system, and two RNAs called CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA). When complexed with , it forms an active endonuclease or nickase.
  • Cas protein or gene information can be obtained from a known database such as GenBank of the National Center for Biotechnology Information (NCBI).
  • the Cas protein may be a Cas9 protein.
  • the Cas protein is not limited thereto, but Streptococcus genus, Neisseria genus, Pasteurella genus, Francisella genus, Campylobacter genus It may be a derived Cas protein.
  • Cpf1 CRISPR from Prevotella and Francisella 1 protein
  • CRISPR / Cas system CRISPR from Prevotella and Francisella 1 protein
  • gRNA guide RNA
  • ANP32A Acidic Nuclear Phosphoprotein 32 Family Member A
  • the ANP32A (Acidic Nuclear Phosphoprotein 32 Family Member A) gene may be a chicken ANP32A gene (cANP32A; NCBI gene ID: 415562) or a human ANP32A gene (hANP32A; NCBI gene ID: 8125), and the genes are each of SEQ ID NO: 1 It may be composed of the nucleotide sequence or the nucleotide sequence of SEQ ID NO: 2, but is not limited thereto.
  • the ANP32A protein may be a chicken ANP32A protein (NCBI accession No. XP_413932) or a human ANP32A protein (NCBI accession No. NP_006296), and the proteins consist of the amino acid sequence of SEQ ID NO: 3 or the amino acid sequence of SEQ ID NO: 4, respectively. may be, but is not limited thereto.
  • sequence of the ANP32A gene is only an example and is not limited thereto. Sequences having substantial sequence identity or substantial sequence identity to the above sequences are also included in the scope of the present invention.
  • the ANP32A gene is not only involved in transcriptional activity and replication of avian influenza virus, but also mRNA stability and movement in relation to cell proliferation and differentiation, caspase-dependent or caspase-independent apoptosis, tumor suppressor, and ELAVL1. It performs various functions within the cell, including the regulation of E4F1-mediated transcriptional repression.
  • the guide RNA may be represented by SEQ ID NO: 14, and the polynucleotide encoding the guide RNA may include a protospacer adjacent motif (PAM).
  • PAM protospacer adjacent motif
  • the PAM sequence may be 5'-TGG'-3' or 5'-TTN-3' (wherein N is A, T, C or G), but is not limited thereto.
  • a polynucleotide including guide RNAs and PAM sequences targeting exons 4 and 5 to induce modifications to specific amino acid residues in the cANP32A gene was prepared.
  • sequence of the polynucleotide is as follows:
  • double-cut donor-mediated HDR was performed using a donor plasmid comprising the polynucleotide for precise genome editing.
  • CRISPR associated protein 9 CRISPR associated protein 9
  • Cpf1 CRISPR from Prevotella and Francisella 1
  • TALEN Transcription activator-like effector nuclease
  • ZFN Zinc Finger Nuclease
  • gene editing refers to a nucleic acid molecule (one or more, such as 1-100,000bp, 1-10,000bp, 1-1000bp) by cleavage at a target site of a target gene. , 1-100bp, 1-70bp, 1-50bp, 1-30bp, 1-20bp or 1-10bp) by deletion, insertion, substitution, etc., loss, alteration, and / or restoration (correction) of gene function means can be used to
  • the nuclease coding sequence may be used in a form contained in a separate recombinant vector distinct from the donor plasmid.
  • composition may induce one or more substitutions selected from the group consisting of D149Y, D152H, D182Y and D185H in the ANP32A gene.
  • composition may be for inducing resistance to avian influenza virus.
  • a CRISPR/Cas9 vector and a donor plasmid comprising guide RNAs targeting exons 4 and 5 of the cANP32A gene are co-transfected into DF-1 cells, wherein the transfected cells contain D149Y in the cANP32A gene, It was confirmed that the correct substitution with D152H, D182Y and D185H could induce resistance to avian influenza virus in chicken host cells.
  • Another aspect provides a transformed cell into which the recombinant vector or the composition for genome editing is introduced.
  • transformation refers to a change in the genetic properties of an organism by DNA given from the outside, that is, when DNA, a type of nucleic acid extracted from a cell of a certain lineage of an organism, is injected into a living cell of another lineage. It is a phenomenon in which a cell enters the cell and changes its genotype, also called transformation, transformation, or transformation. That is, “transformation” means introducing a gene into a host cell so that it can be expressed in the host cell.
  • a method for transforming by introducing a recombinant vector into a cell line according to an aspect is known in the art, for example, but not limited thereto, transient transfection using lipofectamine, etc., fine Injection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE Dextran-mediated transfection, polybrene-mediated transfection Infection (polybrene-mediated transfection), electroporation (electroporation) can be introduced into eukaryotic cells can be transformed, preferably using Lipofectamine 2000 reagent can be transformed.
  • Selection of the transformed cells may be selected by a method of confirming whether or not a gene is corrected, which is known in the art, and preferably an antibiotic resistance gene such as G418, neomycin or puromycin may be used, but is limited thereto no.
  • an antibiotic resistance gene such as G418, neomycin or puromycin
  • the transformation may be performed in vitro, ex vivo, or in vivo.
  • the transformed cells are in vitro or in vitro for about 1 hour to about 2 years, about 6 hours to about 1 year, about 1 day to about 200 days, about 15 days to about 200 days, or about 1 month to about 1 It can be cultivated for years.
  • the key amino acid residues important for virus propagation were discovered, and it was confirmed that the transformed cells in which Asp149, Asp152, Asp182 and Asp185 were modified (substituted) in the ANP32A gene acquired resistance to avian influenza.
  • the cell may be selected from the group consisting of avian stem cells, somatic cells, germ cells, fertilized eggs and embryos, preferably, the cells may be somatic cells or germ cells, and the germ cells are most preferably the germ cells.
  • the cells may be, but are not limited to, primordial germ cells (PGCs).
  • the recombinant vector or composition for genome editing may be introduced into avian primitive germ cells according to various methods known in the art.
  • gene transfer to primordial germ cells may be performed with reference to electroporation, liposome-mediated delivery, and retrovirus-mediated delivery.
  • the primordial germ cells that can be used in the present invention can be obtained from various sources, but most preferably, they are isolated from the embryonic gonad of an avian embryo.
  • donor embryos used in the present invention can be used that have entered various stages, and embryos 1-10 days old can be used, preferably embryonic development stage about 24- Embryos of 36 (about 4-8 days of age), most preferably embryonic stage of embryonic development, of about 28 (about 5.5 days of age) can be used.
  • a method for obtaining primordial germ cells from the primordial reproductive system can be carried out in various ways, and reference may be made to those disclosed in Patent Nos. 0305715 and 0267633 of the present inventors.
  • the primordial gonad is recovered from the embryo from which the yolk has been removed, and the primordial gonad is treated with a protease (eg, trypsin) to separate the primordial gonad cells.
  • a protease eg, trypsin
  • These primordial gonad cells are a group of various cell types, and include basal cells (stroma cells), etc. in addition to primordial germ cells.
  • the term “gonadal cells” refers to a population of all cell species present in the primordial genitalia
  • the term “gonadal primordial germ cells” refers to a group of cells that later become germ cells. It represents a type of primordial reproductive cells, and may be represented by an abbreviation "gPGCs" or "PGC".
  • Another aspect provides a method for producing a transformed cell comprising the step of introducing the recombinant vector or the composition for genome editing into avian somatic cells.
  • Another aspect provides a method for producing a gene-edited bird, comprising the step of transplanting the transformed cell into the embryo of the bird.
  • genetically edited transformed cells eg, primordial germ cells
  • the method of injecting primordial germ cells into the recipient embryo may be carried out according to various methods, preferably by injecting into the aorta of the embryo. For example, it can be carried out by injecting a cell suspension containing an appropriate number of primitive germ cells into the dorsal aorta of the embryo with a microneedle, sealing the egg containing the embryo, and then culturing for an appropriate time. Then, an egg containing the embryo of the recipient is cultured and hatched, and the gene-edited algae can be produced by crossbreeding the receptor that has reached sexual maturity.
  • Identification of gene-edited birds is, for example, sequence editing by polymerase-chain reaction (PCR), real-time PCR method or sequencing method using genomic DNA obtained from feather pulp or blood of gene-edited birds as a template. It can be carried out by checking whether it has been
  • the method may further include screening for homozygous genetic variants by assay-crossing the genetic variants produced by the method.
  • the method may further include the step of introducing a nucleic acid encoding a fluorescent protein into the avian primitive germ cells for selection of the genetically modified primitive germ cells.
  • Fluorescent protein is not particularly limited as long as it can be expressed in algal cells, and examples thereof include Green Fluorescent Protein (GFP). These proteins can be introduced into vectors acting on algae and introduced together into PGCs. After introduction, cells expressing the fluorescent protein are selected by the same method as FACS, and only these cells are introduced into the receptor embryos for transformation. It is possible to increase the production efficiency of algae.
  • the bird may be selected from the group consisting of, but not limited to, chicken, duck, geese, quail, pheasant and turkey, preferably chicken.
  • the gene-edited bird may have resistance to avian influenza virus.
  • Another aspect provides a gene-edited bird having resistance to the avian influenza virus produced by the above method.
  • the method according to one aspect corrects only the key amino acids of the ANP32A gene, so that while maintaining the original function of the ANP32A gene in the host, only the interaction between viral proteins can be precisely restricted.
  • it is possible to efficiently develop new poultry and avian varieties that do not pose a biological stability problem, including cell lines resistant to avian influenza virus, and thus it is expected to have high industrial application potential.
  • 1 is a diagram showing the results of establishing a chicken ANP32A knockout DF-1 clone through CRISPR/Cas9-mediated genome editing.
  • (1a) Results of T7E1 analysis of DF-1 cells transfected with CRISPR/Cas9 vector containing A#1 guide RNA (gRNA) targeting exon 1 of chicken ANP32A (cANP32A). Wild-type DF-1 cells were used as controls.
  • Strikethrough letters indicate deleted nucleotides
  • non-strikethrough letters indicate inserted nucleotides.
  • 'AAAGGATCCACTTAGAGCTG' indicates the gRNA binding site sequence
  • 'CGG' indicates the protospacer adjacent motif (PAM) sequence
  • the ATG codon is indicated in italics at the beginning of the sequence.
  • FIG. 2 is a diagram showing the results of analyzing the functional significance of amino acid residues 149-175 of human ANP32 family members for viral replication and viral polymerase (vPol).
  • vPol viral polymerase
  • 3 is a diagram showing the results of excavating key residues involved in influenza virus replication among amino acid residues 149-175 of the ANP32A protein.
  • (3a) The result of paired sequence alignment of amino acid residues 149-175 of human ANP32A (hANP32A) and hANP32C.
  • FIG. 4 is a diagram showing the results of analyzing the functional roles of D149 and D152 of ANP32A in relation to the interaction with influenza virus PB2 protein.
  • (4b) single amino acid-modified hANP32A comprising D149Y, D149A, D149E, D149N, D152H, D152A, D152E or D152N was overexpressed in ANP32A-deficient (A_KO) chicken DF-1 cells, and the cells were subjected to PR8-H5N8 PB2 Viral titers measured after 24 hours of infection with -627E influenza virus (MOI 0.1).
  • 5 is a diagram showing the results of genome editing by CRISPR/Cas9 of exon 4 of chicken ANP32A.
  • 5a Gene structure of chicken ANP32A (cANP32A) and target locus of A#4 guide RNA (gRNA) (exon 4).
  • 5b T7E1 analysis result of DF-1 cells transfected with A#4 CRISPR/Cas9 vector. Wild-type DF-1 cells were used as controls.
  • the binding site, 'TGG' indicates a protospacer adjacent motif (PAM) sequence.
  • PAM protospacer adjacent motif
  • cANP32A represents the wild-type sequence
  • HDR donor represents the sequence of the HDR donor plasmid.
  • NHEJ non-homologous end joining
  • HDR homology-directed repair
  • FIG. 7 is a view showing the result of confirming the acquisition of AIV resistance through precise correction of the chicken ANP32A gene in DF-1 cells.
  • 7a Schematic showing the HDR-mediated precision calibration process of exons 4 and 5 of chicken ANP32A.
  • Donor plasmids contain D149Y, D52H, D182Y, and D185H-modified cANP32A with flanks of homology arms (HAs).
  • 7b Protein sequence of cANP32A-modified DF-1 clone through cDNA sequencing of exons 4 to 5 of cANP32A.
  • ANP32 family genes Human and chicken ANP32 family genes (ANP32A, ANP32B, ANP32C, ANP32D and ANP32E) were analyzed to discover key genes involved in the proliferation of avian influenza virus. Specifically, sequence information of cANP32A (XP_413932), cANP32B (NP_001026105), cANP32E (NP_001006564), hANP32A (NP_006296), hANP32B (NP_006392), hANP32C (NP_036535), and hANP11232D (NP036536) (NP036536) provided by the NCBI database was obtained and analyzed for pairwise sequence alignment and multiple sequence alignment. Protein sequences were aligned using Geneious R6 software (Biomatters Ltd., Auckland, New Zealand) using a Blosum62 scoring matrix, with a gap open penalty of 12 and a gap extension penalty of 3 extension penalty) was used.
  • Geneious R6 software Biomatters Ltd.,
  • Recombinant avian influenza viruses PR8-H5N8 PB2-627E and -627K were produced using reverse genetics from eight bidirectional PHW2000 plasmids in the same manner as in the previous study (Park et al., J Infect Dis, 2019). Briefly, virus was obtained by co-transfection of eight bidirectional plasmids into co-cultured Madin-Darby canine kidney cells (MDCK; ATCC, CCL-34) and human 293T embryonic kidney cells (HEK293T; ATCC, CRL-11268). .
  • the obtained virus was grown in MDCK infection medium consisting of DMEM supplemented with 0.3% bovine serum albumin (BSA), 1x ABAM and 1 ⁇ g/ml TPCK-treated trypsin (Sigma-Aldrich, MO, USA) at 37°C. incubated for 48 hours. Virus stocks were further propagated in 10-day-old hatched eggs and aliquots of infectious virus were stored at -80°C for further experiments.
  • BSA bovine serum albumin
  • TPCK-treated trypsin Sigma-Aldrich, MO, USA
  • TCID 50 Viral titration of infected cells in MDCK cells was performed to determine TCID 50 . Briefly, a confluent layer of MDCK cells cultured in serum-free DMEM supplemented with 0.3% BSA, 1% penicillin/streptomycin and 1 ⁇ g/ml TPCK-trypsin in 96-well plates was placed on top of the infected cells. Infection was carried out using liquid. Serial dilutions of the supernatant were added in triplicate to 5 wells of a 96-well plate. After 72-96 hours, the cytopathic effect was observed and quantified through crystal violet (Sigma-Aldrich) staining. TCID 50 per ml was calculated using the Spearman-Karber formula (Gilles, Eur J Toxicol Environ Hyg, 1974).
  • RNA was extracted using RNeasy mini kit (Qiagen) and reverse transcribed using Superscript IV First-strand Synthesis System (Thermo Fisher Scientific). RT-qPCR based on EvaGreen qPCR dye (Biotium, CA, USA) was performed three times using the StepOnePlus real-time PCR system (Thermo Fisher Scientific). The target gene-specific forward and reverse primers are shown in Table 1 below. Relative quantification of target gene expression is 2 were calculated using the formula ⁇ Ct (where, ⁇ Ct (Ct of the target gene - Ct of ACTB) group, - (Ct of the target gene - Ct of ACTB) control).
  • Total protein was prepared from cell lysates of transfected cells using immunoprecipitation lysis buffer (Thermo Fisher Scientific).
  • Target antibody-conjugated magnetic beads were prepared for immunoprecipitation using the Dynabeads Protein G kit (Thermo Fisher Scientific) according to the manufacturer's instructions. Briefly, non-specific binding proteins were previously removed by incubation with unbound magnetic beads with gentle rotation at 4°C for 30 min. The previously removed cell lysates were then incubated with target antibody-conjugated magnetic beads at 4°C overnight with gentle rotation. Magnetic beads were collected using a magnetic field, and then 4 washes were performed on unbound proteins with wash buffer.
  • Immunoprecipitated proteins were eluted for 5 min using elution buffer and denatured at 95°C for 5 min using 2x Laemmli sample buffer (BioRad). Magnetic beads were collected using a magnetic field, and then the supernatant was used for subsequent experiments.
  • Chicken ANP32A contains additional amino acid residues 176-208 duplicated from amino acid residues 149-175 (27 residues) when compared to human ANP32A (hANP32A).
  • hANP32A human ANP32A
  • the functional role of the 27 amino acid residues of hANP32A has not yet been studied. Therefore, based on the comparison between hANP32A family members, it was attempted to discover key amino acid residues contributing to viral polymerase activity through the modification of 27 residues.
  • the percent identity of hANP32A with hANP32B, hANP32C, hANP32D and hANP32E was about 68.3%, 86.1%, 89.3% and 56.6%, respectively.
  • LRR N-terminal Leucine Rich Repeat
  • LCAR C-terminal Low Complexity Acidic Region
  • the percent identity between hANP32A and hANP32B, hANP32C and hANP32E was approximately 4.7%, 84.4% and 43.7% (except for hANP32D due to the absence of an LCAR domain).
  • a CRISPR/Cas9 vector targeting the cANP32A gene was constructed using the pX459 vector in the same manner as in the previous study (Lee et al., Dev Comp Immunol, 2017).
  • the sequences of all oligonucleotides used for PCR analysis and CRISPR/Cas9 vector construction are shown in Table 1 below.
  • the annealed oligonucleotide for each gRNA was ligated to the pX459 vector through Golden Gate assembly, and the constructed CRISPR/Cas9 vector was analyzed by Sanger sequencing.
  • HDR Homology Directed Repair
  • cANP32A double-cleavage using a donor plasmid (Bionics, Seoul, Korea) in the same manner as in a previous study (Park et al., J Infect Dis, 2019) Donor-mediated (double-cut donor-mediated) HDR was performed.
  • the HDR donor plasmid for amino acid residue substitution of D149Y, D152H, D182Y and D185H is a target locus with two gRNA-PAM sequences flanking, and 400 bp homology arms to the right and left. ) is included.
  • the gRNA sequence targeting cANP32A exon 4 (A#4) between the right and left homologous sequences of the donor plasmid was modified to prevent further cleavage after HDR.
  • the CRISPR/Cas9 recombinant vector prepared in Example 2 was mixed with Lipofectamine 2000 reagent (Thermo Fisher-Invitrogen) in Opti-MEM (Thermo Fisher-Invitrogen), and the mixture was mixed with chicken fibroblast line DF-1 (CRL-12203). ; ATCC, VA, USA) was introduced and transfected.
  • DF-1 used at this time was DMEM (Hyclone, Logan, UT, 10% fetal bovine serum (FBS; Hyclone)) and 1x antibiotic-antimycotic (ABAM; Thermo Fisher-Invitrogen, Carlsbad, CA, USA) added. USA) in the medium.
  • T7 endonuclease 1 T7E1 analysis was performed.
  • the primer sets used for amplification of the genomic region including the CRISPR/Cas9 target site are shown in Table 1 above.
  • T7E1 New England Biolabs
  • the product digested with T7E1 was analyzed by 1% agarose gel electrophoresis.
  • PCR products containing target sites were cloned into pGEM-T Easy vector (Promega, WI, USA) and sequenced using an ABI Prism 3730 XL DNA analyzer (Thermo Fisher-Applied Biosystems, CA, USA). . BLAST (http://blast.ncbi.nlm.nih.gov) and Geneious R6 software (Biomatters Ltd.) were used for sequence analysis.
  • a CRISPR/Cas9 vector targeting exon 1 of cANP32A was fabricated (Fig. 1a).
  • the A#1 vector was transfected into DF-1 cells, genomic DNA was isolated from the transfected cells, and T7E1 analysis was performed. As a result, it was confirmed that the DF-1 cells transfected with the A#1 vector had an indel mutation in exon 1 of cANP32A (Fig. 1b).
  • the constructed vector was transfected into DF-1 cells using Lipofectamine 2000 reagent (Thermo Fisher-Invitrogen).
  • the expression of hANP32 protein in A_KO cells after 48 hours of transfection was verified by Western blot ( FIG. 2A ).
  • the transfected cells were infected with recombinant avian influenza viruses PR8-H5N8 PB2-627E and -627K for 24 hours to analyze virus replication and growth.
  • residues 149-175 of hANP32A are removed (hANP23A27del), residues 149-175 of hANP32A are exchanged with residues 149-175 of hANP32C (hAANP32A27C), residues 149-175 of residues hANP32C are residues 149-175 of hANP32A
  • a vector (hANP32C27A) in which residues 149-175 of hANP32E were exchanged with residues 149-175 of hANP32A (hANP32E27A) was constructed.
  • h32A was prepared in which residues 149-161 and residues 162-175 of hANP32A were exchanged with sites 149-161C and 162-175C of hANP32C, respectively ( FIG. 3A ).
  • residues 149-161 and residues 162-175 of hANP32A were exchanged with sites 149-161C and 162-175C of hANP32C, respectively ( FIG. 3A ).
  • FIG. 3A As a result, compared with the expression of hANP32A in A_KO cells, it was confirmed that the expression of 149-161C in hANP32A showed a significant decrease in the viral titer of AIV, whereas the expression of 162-175C did not show a significant difference ( 3b).
  • Pairwise sequence alignment of residues 149-161 was performed to determine whether the functional roles of D149 and D152 are conserved in both hANP32A and hANP32B. As a result, it was confirmed that D149 and D152 were conserved in both hANP32A and hANP32B ( FIG. 3D ).
  • Immunoprecipitation analysis was additionally performed to confirm whether the mutation of the identified residues affects the protein interaction between ANP32A and vPol protein. Specifically, the interaction between wild-type or mutant hANP32A and vPol protein in the A_KO DF-1 clone was analyzed. As a result, viral PA and PB2 proteins were co-immunoprecipitated with wild-type hANP32A (hANP32Awt). On the other hand, it was confirmed that the hANP32AD149Y/D152H mutant exhibited reduced interaction with viral proteins after anti-FLAG co-immunoprecipitation regardless of residues PB2-627 ( FIG. 4c ). From the above results, it was confirmed that mutations in residues D149 and D152 of hANP32A are involved in the interaction between ANP32A and vPol protein.
  • a DF-1 clone was established through single-cell clone expansion of the transfected cells, and as a result of performing cDNA sequencing on the established clone, a clone in which the target sequence was precisely edited (A YHYH 106) was identified (Fig. 7b). In addition, it was confirmed that A YHYH 101, A YHYH 102, A YHYH 104, A YHYH 105, and A YHYH 107 have an early stop codon in exon 4.
  • the method according to one aspect can acquire avian influenza virus (AIV) resistance by inducing mutations in ANP32A involved in virus replication in host cells.
  • AIV avian influenza virus
  • resistance to AIV can be acquired by precisely limiting only the interaction with the AIV protein while maintaining the original function of the ANP32A gene.
  • the method according to one aspect can be widely applied to the production of disease-resistant cell lines, disease-resistant poultry and animals.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Veterinary Medicine (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Environmental Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Animal Husbandry (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Mycology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

조류인플루엔자 바이러스에 저항성을 갖는 유전자 편집 조류의 제조방법에 관한 것이다. 일 양상에 따른 방법은 ANP32A 유전자의 핵심 아미노산만을 교정하여, 숙주에서 ANP32A 유전자의 본래 기능은 유지하면서도 바이러스 단백질 간의 상호작용만을 정교하게 제한할 수 있다. 상기 방법을 사용하면 조류인플루엔자 바이러스에 저항성을 가지는 세포주를 비롯하여, 생물학적 안정성 문제가 제기되지 않는 새로운 가금 및 조류 품종을 효율적으로 개발할 수 있어, 산업적 활용 가능성이 높을 것으로 기대된다.

Description

조류인플루엔자 바이러스에 저항성을 갖는 유전자 편집 조류의 제조방법
본 발명은 조류인플루엔자 바이러스에 저항성을 갖는 유전자 편집 조류의 제조방법에 관한 것이다. 본 특허출원은 2020년 01월 07일에 대한민국 특허청에 제출된 대한민국 특허출원 제20-2154호에 대하여 우선권을 주장하며, 상기 특허출원의 개시 사항은 본 명세서에 참조로서 삽입된다.
조류인플루엔자 바이러스 (Avian Influenza Viruses: AIVs)는 가금류 산업에서 막대한 경제적 손실을 일으키고, 인간에게도 감염과 치사를 일으킬 가능성이 높다. 새로운 항바이러스 약물을 개발하기 위하여, 최근 연구들은 바이러스 증식에 불가피하게 필요한 숙주세포 인자를 타겟으로 삼는 것에 초점을 맞추고 있다 (한국공개특허 제10-2013-0126243호). 바이러스 수명 주기 동안, 바이러스와 이들의 바이러스 폴리머라제 (viral polymerase: vPol)는 DNA-의존성 RNA 폴리머라제, 스플라이싱 인자 및 다른 RNA 처리 인자를 포함하는 숙주세포의 세포 기구 (cell machinery)를 선택하여 숙주세포에서 바이러스 RNA를 효율적으로 복제하고 전사한다. 바이러스 감염 후 바이러스 리보핵단백질은 세포질로 방출되고, 이어서 바이러스 RNA 복제를 위해 숙주 핵으로 운반된다. 포지티브-센스 상보적 RNA에서 네거티브-센스 단일 가닥 바이러스 RNA로의 AIV 복제는 세포 DNA-의존적 RNA 폴리머라제 Ⅱ에 의해 숙주 핵에서 발생하며, 여기에서 vPol은 숙주세포의 세포 기구를 적극적으로 선택한다.
최근 ANP32A (Acidic Nuclear Phosphoprotein 32 Family Member A) 유전자가 AIV의 바이러스 RNA 복제에 관여함이 보고되었다. 그러나, ANP32A 유전자는 바이러스의 복제를 돕는 역할 이외에 세포 내에서 다양한 기능을 수행하고 있기 때문에, ANP32A 유전자에 대한 완전한 파괴 또는 변형은 부작용을 초래할 가능성이 높다. 따라서, 바이러스의 복제에 관여하는 특정 숙주 인자에 대한 소수의 교정만을 수행하여, 부작용이 거의 없는 AIV 저항성 가금 및 동물을 개발하는 기술이 필요한 실정이다.
본 발명자들은 ANP32A에서 바이러스 복제에 관여하는 핵심 아미노산을 동정하고, CRISPR/Cas9 시스템에 기반한 유전자 정밀 교정을 통해 상기 핵심 아미노산의 변형만을 유도하여 효율적으로 ANP32A 유전자를 변형시켜 조류인플루엔자에 저항성을 가진 세포주 및 조류모델을 제조할 수 있음을 확인하고 본 발명을 완성하였다.
일 양상은 ANP32A (Acidic Nuclear Phosphoprotein 32 Family Member A) 유전자 내 Asp149, Asp152, Asp182 및 Asp185로 이루어진 군으로부터 선택되는 하나 이상의 잔기를 타겟으로 하는 가이드 RNA (gRNA) 또는 이를 암호화하는 폴리뉴클레오티드를 포함하는 재조합 벡터를 제공하는 것이다.
다른 양상은 상기 재조합 벡터 및 Cas9 (CRISPR associated protein 9), Cpf1 (CRISPR from Prevotella and Francisella 1), TALEN (Transcription activator-like effector nuclease) 및 ZFN (Zinc Finger Nuclease)으로 이루어진 군으로부터 선택되는 하나 이상의 뉴클레아제 암호화 서열을 포함하는 유전체 교정용 조성물을 제공하는 것이다.
또 다른 양상은 상기 재조합 벡터 또는 상기 유전체 교정용 조성물이 도입된 형질전환 세포 및 이를 제조하는 방법을 제공하는 것이다.
또 다른 양상은 상기 형질전환 세포를 조류의 배아에 이식하는 단계를 포함하는 유전자 편집 조류를 제조하는 방법 및 상기 방법으로 제조된 조류인플루엔자 바이러스에 대한 저항성을 갖는 유전자 편집 조류를 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
본 명세서에서 용어 "벡터"는, 목적하는 DNA 단편을 숙주균 등에 도입시켜 주고 증식할 수 있는 DNA로서, 클로닝 운반체 (cloning vehicle)라고도 하는데, 벡터 (vector) DNA는 제한효소 등으로 절단하여 개환하고 여기에 목적으로 하는 DNA 단편을 삽입하여 연결하고 숙주균에 도입시킨다. 목적 DNA 단편을 연결한 벡터 DNA는 숙주균이 증식됨에 따라 복제하여 균의 분열과 더불어 각 낭세포로 분배되어 목적 DNA 단편을 대대로 유지하여 이어져 나가며, 플라스미드 (plasmid), 파지 염색체를 주로 사용한다.
본 명세서에서 용어 "재조합 벡터"는, CRISPR/Cas9 시스템 등을 사용하여 특정 유전자 부위에 염기서열 이중나선 결손을 유도하여 유전자 편집을 실시하고, 적절한 숙주 세포에서 효율적으로 타겟 유전자를 변형시키는 벡터로서 사용될 수 있다. 숙주 세포는 바람직하게는 진핵세포일 수 있으며, 숙주세포의 종류에 따라 프로모터 (promoter), 종결자 (terminator), 인핸서 (enhancer) 등과 같은 발현 조절 서열, 막 표적화 또는 분비를 위한 서열 등을 적절히 선택하고 목적에 따라 다양하게 조합할 수 있다.
본 명세서에서 용어 "가이드 RNA (guide RNA 또는 gRNA)"는, 타겟으로 하는 DNA에 특이적인 RNA를 의미한다. 상기 가이드 RNA는 예를 들어, CRISPR RNA (crRNA), trans-activating crRNA (tracrRNA), 및 단일 가이드 RNA (single guide RNA: sgRNA)로 이루어진 군으로부터 선택되는 하나 이상일 수 있으며, 구체적으로 crRNA 및 tracrRNA를 구성요소로 포함하는 이중 가닥 RNA, 또는 crRNA 또는 그 일부와 tracrRNA 또는 그 일부가 올리고뉴클레오티드 링커로 연결된 단일 가닥 가이드 RNA (sgRNA)일 수 있으나, (RNA-가이드) 뉴클레아제가 타겟 서열에서 활성을 가질 수 있는 형태라면 제한 없이 포함될 수 있다.
본 명세서에서 용어 "뉴클레아제 (핵산가수분해효소 또는 핵산절단효소)"는, 유전자의 특정 염기서열을 절단하는 효소를 의미한다. 상기 뉴클레아제는 구체적으로 TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease) 또는 RNA-가이드 뉴클레아제일 수 있다.
본 명세서에서 용어 "RNA-가이드 뉴클레아제"는, 목적하는 유전체 상의 특정 위치를 인식하여 절단할 수 있는 뉴클레아제로서, 특히 가이드 RNA에 의해 표적 특이성을 갖는 뉴클레아제를 말한다. 상기 RNA-가이드 뉴클레아제는 이에 제한되는 것은 아니나, 구체적으로 미생물 면역체계인 CRISPR에서 유래한 Cas9 단백질, 구체적으로 Cas9 (CRISPR Associated Protein 9) 및 Cpf1 등이 포함될 수 있다.
상기 뉴클레아제는 인간 세포를 비롯한 동식물 세포의 유전체에서 특정 염기서열을 인식해 이중나선절단 (double strand break: DSB)을 일으킬 수 있으며, 닉 (nick)을 형성할 수 있다. 상기 이중나선절단은 DNA의 이중 나선을 잘라 둔단 (blunt end) 또는 점착종단 (cohesive end)을 만드는 것을 모두 포함한다. 상기 이중나선절단은 세포 내에서 상동재조합 (homologous recombination) 또는 비상동재접합 (non-homologous end-joining: NHEJ) 기작에 의해 효율적으로 수선되는데 이 때 원하는 변이를 타겟 부위에 도입할 수 있다. 상기 뉴클레아제는 인공적인, 혹은 조작된 비자연적으로 발생된 (non-naturally occurring)것일 수 있다.
본 명세서에서 용어 "CRISPR/Cas9" 또는 "CRISPR/Cas9 시스템"은, 크리스퍼(Clustered regularly interspaced short palindromic repeat: CRISPR) 유전자 가위라 불리는 게놈 편집 방법으로, 특정 염기서열에 특이적으로 결합하는 RNA(gRNA)와 특정한 염기서열을 자르는 가위 역할인 Cas9 단백질로 구성된다. 이러한 CRISPR/Cas9 시스템을 이용하면 세포나 동물에 플라스미드 (Plasmid) DNA를 도입하여 특정 유전자의 기능을 억제할 수 있는 녹-아웃 (knock-out)이 가능하다.
본 명세서에서 용어 "Cas9 (CRISPR associated protein 9) 단백질"은, CRISPR/Cas9 시스템에서 필수적인 단백질 요소를 의미하고, CRISPR RNA(crRNA) 및 트랜스-활성화 crRNA (trans-activating crRNA, tracrRNA)로 불리는 두 RNA와 복합체를 형성할 때, 활성 엔도뉴클레아제 또는 니카아제(nickase)를 형성한다.
Cas 단백질 또는 유전자 정보는 NCBI (National Center for Biotechnology Information)의 GenBank와 같은 공지의 데이터 베이스에서 얻을 수 있다. 구체적으로, 상기 Cas 단백질은 Cas9 단백질일 수 있다. 또한, 상기 Cas 단백질은 이에 제한되는 것은 아니나, 스트렙토코커스 (Streptococcus) 속, 네이세리아 (Neisseria) 속, 파스테우렐라 (Pasteurella) 속, 프란시셀라 (Francisella) 속, 캄필로박터 속 (Campylobacter) 속 유래의 Cas 단백질일 수 있다.
본 명세서에서 용어 "Cpf1 (CRISPR from Prevotella and Francisella 1) 단백질"은 상기 CRISPR/Cas 시스템과는 구별되는 새로운 CRISPR 시스템의 뉴클레아제로서, 단일 RNA에 의해 구동되어 tracrRNA가 필요 없고 Cas9에 비해 상대적으로 크기가 작은 특징을 가진다.
일 양상은 ANP32A (Acidic Nuclear Phosphoprotein 32 Family Member A) 유전자 내 Asp149, Asp152, Asp182 및 Asp185로 이루어진 군으로부터 선택되는 하나 이상의 잔기를 타겟으로 하는 가이드 RNA (gRNA) 또는 이를 암호화하는 폴리뉴클레오티드를 포함하는 재조합 벡터를 제공한다.
상기 ANP32A (Acidic Nuclear Phosphoprotein 32 Family Member A) 유전자는 닭 ANP32A 유전자 (cANP32A; NCBI gene ID: 415562) 또는 인간 ANP32A 유전자(hANP32A; NCBI gene ID: 8125)일 수 있으며, 상기 유전자들은 각각 서열번호 1의 뉴클레오티드 서열 또는 서열번호 2의 뉴클레오티드 서열로 구성된 것일 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 ANP32A 단백질은 닭 ANP32A 단백질 (NCBI accession No. XP_413932) 또는 인간 ANP32A 단백질 (NCBI accession No. NP_006296)일 수 있으며, 상기 단백질들은 각각 서열번호 3의 아미노산 서열 또는 서열번호 4의 아미노산 서열로 구성된 것일 수 있으나, 이에 제한되는 것은 아니다.
본 명세서에서, 상기 ANP32A 유전자의 서열은 예시일 뿐 이에 한정되는 것은 아님은 당업자에게 자명하다. 상기 서열들에 대해 실질적인 서열 동일성 또는 실질적인 서열 상동성 (sequence identity)을 지닌 서열 또한 본 발명의 범주에 포함된다. 여기서 사용된 "실질적인 서열 동일성" 또는 "실질적인 서열 상동성"이라는 용어는 서열이 또 다른 서열과의 실질적인 구조적 또는 기능적 동일성을 나타냄을 의미한다.
상기 ANP32A 유전자는 조류인플루엔자 바이러스의 전사 활성 및 복제에 관여할 뿐만 아니라, 세포 증식 및 분화, 카스파제 의존성 혹은 카스파제 비의존적 세포 사멸, 종양억제자 (tumor suppressor), ELAVL1과 관련하여 mRNA 안정성 및 이동을 조절, E4F1 매개 전사 억제 등 세포 내에서 다양한 기능을 수행한다.
상기 가이드 RNA는 서열번호 14로 표시될 수 있고, 상기 가이드 RNA를 암호화하는 폴리뉴클레오티드는 프로토스페이서 인접 모티프 (protospacer adjacent motif: PAM)를 포함할 수 있다.
상기 PAM 서열은 5'-TGG'-3' 또는 5'-TTN-3'(여기에서, N은 A, T, C 또는 G임)일 수 있으나, 이에 제한되는 것은 아니다.
일 구체예에서는, cANP32A 유전자에서 특정 아미노산 잔기에 변형을 유도하기 위하여 엑손 4 및 5를 타겟으로 하는 가이드 RNA 및 PAM 서열을 포함하는 폴리뉴클레오티드를 제작하였다.
상기 폴리뉴클레오티드의 서열은 다음과 같다:
5'- CCACAACTCACATACCTCGATGG-3'(서열번호 15)
일 구체예에서는, 상기 정밀한 유전체 편집을 위하여 상기 폴리뉴클레오티드를 포함하는 공여체 플라스미드 (donor plasmid)를 사용하여 이중-절단 공여체-매개된 (double-cut donor-mediated) HDR을 수행하였다.
다른 양상은 상기 재조합 벡터 및 Cas9 (CRISPR associated protein 9), Cpf1 (CRISPR from Prevotella and Francisella 1), TALEN (Transcription activator-like effector nuclease) 및 ZFN (Zinc Finger Nuclease)으로 이루어진 군으로부터 선택되는 하나 이상의 뉴클레아제 암호화 서열을 포함하는 유전체 교정용 조성물을 제공한다.
본 명세서에서 용어 "유전체 교정 (genome editing)"은, 특별한 언급이 없는 한, 표적 유전자의 표적 부위에서의 절단에 의한 핵산 분자 (하나 이상, 예컨대 1-100,000bp, 1-10,000bp, 1-1000bp, 1-100bp, 1-70bp, 1-50bp, 1-30bp, 1-20bp 또는 1-10bp)의 결실, 삽입, 치환 등에 의하여 유전자 기능을 상실, 변경, 및/또는 회복(수정) 시키는 것을 의미하기 위하여 사용될 수 있다.
상기 뉴클레아제 암호화 서열은 공여체 플라스미드와 구별되는 별도의 재조합 벡터에 포함된 형태로 사용될 수 있다.
상기 조성물은 ANP32A 유전자에서 D149Y, D152H, D182Y 및 D185H로 이루어진 군으로부터 선택되는 하나 이상의 치환을 유도하는 것일 수 있다.
또한, 상기 조성물은 조류인플루엔자 바이러스에 대한 저항성을 유도하기 위한 것일 수 있다.
일 구체예에서는, cANP32A 유전자의 엑손 4 및 5를 타겟으로 하는 가이드 RNA를 포함하는 공여체 플라스미드 및 CRISPR/Cas9 벡터를 DF-1 세포에 공동-형질감염시키고, 상기 형질감염 세포는 cANP32A 유전자에서 D149Y, D152H, D182Y 및 D185H로의 정확한 치환이 이루어져 닭 숙주세포의 조류인플루엔자 바이러스에 대한 저항성을 유도할 수 있음을 확인하였다.
또 다른 양상은 상기 재조합 벡터 또는 상기 유전체 교정용 조성물이 도입된 형질전환 세포를 제공한다.
본 명세서에서 용어 "형질전환"은 외부로부터 주어진 DNA에 의하여 생물의 유전적인 성질이 변하는 것으로, 즉 생물의 어떤 계통의 세포에서 추출된 핵산의 일종인 DNA를 다른 계통의 살아있는 세포에 주입하였을 때 DNA가 그 세포에 들어가서 유전형질이 변화하는 현상으로 형질변환, 형전환 또는 형변환 등이라고도 한다. 즉, "형질전환"이란 유전자를 숙주세포 내에 도입하여 숙주세포 내에서 발현시킬 수 있도록 하는 것을 의미한다.
일 양상에 따른 재조합 벡터를 세포주에 도입하여 형질전환하는 방법은 당업계에 공지된 방법, 예를 들어 이에 한정되지는 않으나, 리포펙타민 (lipofectamine) 등을 이용한 일시적인 형질감염 (transient transfection), 미세주사, 형질도입 (transduction), 세포 융합, 칼슘 포스페이트 침전법, 리포좀 매개된 형질감염 (liposem-mediated transfection), DEAE 덱스트란-매개된 형질감염 (DEAE Dextran-mediated transfection), 폴리브렌-매개된 형질 감염 (polybrene-mediated transfection), 전기 침공법 (electroporation) 등의 방법으로 진핵세포에 도입하여 형질전환시킬 수 있으며, 바람직하게는 리포펙타민 2000 시약을 이용하여 형질전환시킬 수 있다.
상기 형질전환된 세포의 선별은 당업계에서 공지된 유전자 교정 여부를 확인하는 방법으로 선별할 수 있으며, 바람직하게는 G418, 네오마이신 또는 퓨로마이신과 같은 항생제 내성 유전자를 사용할 수 있으나, 이에 제한되는 것은 아니다.
상기 형질전환은 시험관 내 (in vitro), 체외 (ex vivo), 또는 체내 (in vivo)에서 수행될 수 있다. 상기 형질전환된 세포는 시험관 내 또는 체외에서 약 1시간 내지 약 2년, 약 6시간 내지 약 1년, 약 1일 내지 약 200일, 약 15일 내지 약 200일, 또는 약 1개월 내지 약 1년 동안 배양될 수 있다.
일 구체예에서는, 바이러스 증식에 중요하게 관여하는 핵심 아미노산 잔기를 발굴하고, ANP32A 유전자 내 Asp149, Asp152, Asp182 및 Asp185가 변형 (치환)된 형질전환 세포는 조류인플루엔자에 대한 저항성이 획득됨을 확인하였다.
상기 세포는 조류의 줄기세포, 체세포, 생식세포, 수정란 및 배아로 이루어진 군으로부터 선택되는 것일 수 있으며, 바람직하게는 상기 세포는 체세포 또는 생식세포일 수 있고, 상기 생식세포는 가장 바람직하게는 상기 생식세포는 원시생식세포 (primordial germ cells: PGCs)일 수 있으나, 이에 제한되는 것은 아니다.
상기 재조합 벡터 또는 유전체 교정용 조성물은 당업계에 공지된 다양한 방법에 따라 조류 원시생식세포에 도입될 수 있다. 예를 들어, 원시생식세포로의 유전자 전달은 전기천공법 (electroporation), 리포좀-매개 전달방법 및 레트로바이러스-매개 전달방법 등을 참고하여 실시할 수 있다.
본 발명에서 이용될 수 있는 원시생식세포는 다양한 소스로부터 얻을 수 있으나, 가장 바람직하게는 조류의 배아의 생식기 (embryonic gonad)로부터 분리된 것이다. 원시생식세포의 소스로서 배아를 이용하는 경우, 본 발명에서 이용되는 공여체 배아는 다양한 단계에 진입한 것이 이용될 수 있으며, 1-10일령 배아가 이용될 수 있고, 바람직하게는 배 발달 스테이지 약 24-36 (약 4-8 일령), 가장 바람직하게는 배 발달 스테이지 배 발달 스테이지 약 28 (약 5.5 일령)의 배아가 이용될 수 있다. 원시생식기로부터 원시생식세포를 수득하는 방법은 다양하게 실시될 수 있으며, 본 발명자들의 특허 제 0305715 호 및 특허 제 0267633 호에 개시된 것을 참고할 수 있다. 예컨대, 난황이 제거된 배아로부터 원시생식기를 회수하고, 원시생식기에 단백질분해효소 (예를 들어, 트립신)를 처리하여, 원시생식기 세포를 분리한다. 이러한 원시생식기 세포는 다양한 세포종의 군집으로서, 원시생식세포 이외에 기저세포 (stroma cells) 등이 포함되어 있다. 본 명세서에서 용어 "원시생식기 세포 (gonadal cells)" 는 원시생식기에 존재하는 모든 세포 종의 군집을 의미하며, 용어 "원시생식기-유래 원시생식세포 (gonadal primordial germ cells)" 는 후에 생식세포가 되는 원시생식기 세포의 일종을 나타내며, 약어 "gPGCs" 또는 "PGC"로 나타낼 수 있다.
또 다른 양상은 상기 재조합 벡터 또는 상기 유전체 교정용 조성물을 조류 체세포에 도입하는 단계를 포함하는 형질전환 세포를 제조하는 방법을 제공한다.
또 다른 양상은 상기 형질전환 세포를 조류의 배아에 이식하는 단계를 포함하는 유전자 편집 조류를 제조하는 방법을 제공한다.
예를 들어, 유전자가 편집된 형질전환 세포 (예를 들어, 원시생식세포)는 수용체 배아에 주입될 수 있다. 원시생식세포를 수용체 배아에 주입하는 방법은 다양한 방법에 따라 실시될 수 있으며, 바람직하게는 배아의 대동맥에 주입하여 실시될 수 있다. 예를 들어, 적합한 개수의 원시생식세포를 포함하는 세포 현탁액을 배아의 등쪽 대동맥에 미세바늘로 주입하고, 배아를 포함하는 난을 밀봉한 다음 적절한 시간 동안 배양하여 실시될 수 있다. 그런 다음, 상기 수용체 배아를 포함하는 난을 배양 및 부화하고, 성성숙에 이른 수용체를 검정교배를 통해 유전자 편집된 조류를 생산할 수 있다. 유전자 편집 조류의 확인은 예를 들어, 유전자 편집 조류의 깃털수질 (feather pulp) 또는 혈액으로부터 얻은 유전체 DNA를 주형으로 이용하여 PCR (polymerase-chain reaction), 실시간 PCR 방법 또는 염기서열분석법으로 서열이 편집되어 있는 지 여부를 검사하여 실시할 수 있다.
상기 방법은 상기 방법에 의해 생산된 유전자 변형체를 검정교배하여, 동형접합 유전자 변형체 선별하는 단계를 추가로 포함할 수 있다.
또한, 상기 방법은 유전자 변형이 발생한 원시생식세포의 선별을 위해, 형광 단백질을 암호화하는 핵산을 조류 원시생식세포에 도입하는 단계를 추가로 포함할 수 있다. 형광 단백질은 조류의 세포에서 발현될 수 있는 한 특별히 제한되는 것은 아니며, 예를 들면 Green Fluorescent Protein (GFP)를 들 수 있다. 이러한 단백질은 조류에서 작용하는 벡터에 도입되어, PGC에 함께 도입될 수 있으며, 도입 후에 형광단백질을 발현하는 세포를 FACS와 같은 방법으로 선별한 후, 이러한 세포만을 수용체의 배아에 도입하여, 형질전환 조류의 생산 효율을 높일 수 있다.
상기 조류는 이에 제한되지는 않으나 닭, 오리, 거위, 메추리, 꿩 및 칠면조로 이루어진 군으로부터 선택될 수 있고, 바람직하게는 닭일 수 있다.
상기 유전자 편집 조류는 조류인플루엔자 바이러스에 대한 저항성을 가질 수 있다.
또 다른 양상은 상기 방법으로 제조된 조류인플루엔자 바이러스에 대한 저항성을 갖는 유전자 편집 조류를 제공한다.
일 양상에 따른 방법은 ANP32A 유전자의 핵심 아미노산만을 교정하여, 숙주에서 ANP32A 유전자의 본래 기능은 유지하면서도 바이러스 단백질 간의 상호작용만을 정교하게 제한할 수 있다. 상기 방법을 사용하면 조류인플루엔자 바이러스에 저항성을 가지는 세포주를 비롯하여, 생물학적 안정성 문제가 제기되지 않는 새로운 가금 및 조류 품종을 효율적으로 개발할 수 있어, 산업적 활용 가능성이 높을 것으로 기대된다.
도 1은 CRISPR/Cas9-매개된 게놈 편집을 통한 닭 ANP32A 녹아웃 DF-1 클론 확립 결과를 나타낸 도이다. (1a) 닭 ANP32A (cANP32A)의 엑손 1을 타겟팅하는 A#1 가이드 RNA (gRNA)를 포함하는 CRISPR/Cas9 벡터로 형질감염시킨 DF-1 세포의 T7E1 분석 결과. 야생형 DF-1 세포를 대조군으로 사용함. (1b) 생어 시퀀싱을 통한 형질감염된 DF-1 세포의 돌연변이 분석 결과. 인델 (Insertion-deletion: in-del) 돌연변이 빈도를 괄호 안에 표시하였음. 취소선이 있는 글자 (가장 두꺼운 볼드체)는 삭제된 뉴클레오티드를, 취소선이 없는 글자 (가장 두꺼운 볼드체)는 삽입된 뉴클레오티드를 나타냄. 'AAAGGATCCACTTAGAGCTG'는 gRNA 결합 부위 서열을, 'CGG'는 프로토스페이서 인접 모티프 (Protospacer adjacent motif: PAM) 서열을 나타내며, ATG 코돈은 서열 맨 앞의 이탤릭체로 표시하였음. (1c) cANP32A-녹아웃 클론 (A112)의 크로마토그래피를 사용한 시퀀싱 결과.
도 2는 바이러스 복제 및 바이러스 폴리머라제 (vPol)에 대한 인간 ANP32 패밀리 구성원의 149-175번 아미노산 잔기의 기능적 중요성을 분석한 결과를 나타낸 도이다. (2a) Anti-FLAG 항체를 사용한 웨스턴 블롯 분석 결과로서, ANP32A-결핍 (A_KO) 닭 DF-1 세포에서 hANP32A, hANP32B, hANP32C, hANP32D 및 hANP32E를 포함하는 인간 ANP32 패밀리 구성원의 과발현이 확인됨. (2b) hANP32 단백질을 발현하는 각 A_KO 세포를 PR8-H5N8 PB2-627E 또는 PB2-627K 인플루엔자 바이러스 (MOI 0.1)로 감염시킨 후, TCID50 분석으로 바이러스 역가를 결정한 결과. (2c) hANP32 및 닭 ANP32 (cANP32) 패밀리 구성원의 149-175번 아미노산 잔기의 다중 서열 정렬 (Multiple sequence alignment) 결과. cANP32A의 149-175번 아미노산 잔기에 대한 동일성 백분율을 표시하였다. 모든 단백질 서열은 Geneious 소프트웨어에서 Blosum62 점수행렬을 사용하여 정렬하였음 (검은 색, 100 %; 진회색, 80-100 %; 밝은 회색, 60-80 %; 흰색, <60 %). (2d) PR8-H5N8 PB2-627E로 감염시킨 후 A_KO 세포에서 바이러스 유전자 발현에 대한 hANP32A, hANP32A_27del, hANP32A_27C, hANP32C, hANP32C_27A, hANP32E 또는 hANP32E_27A의 강제 발현 효과. 빈 벡터로 형질감염된 A_KO 세포 (empty)를 대조군으로 사용함. 데이터는 평균 ± 표준 편차 (n = 3)로 표시하였음. *P <0.05, **P <0.01, ***P <0.001 및 ****P <0.0001. ns = 유의하지 않음 (non-significant).
도 3은 ANP32A 단백질의 149-175번 아미노산 잔기 중, 인플루엔자 바이러스 복제에 관여하는 핵심적인 잔기를 발굴한 결과를 나타낸 도이다. (3a) 인간 ANP32A (hANP32A) 및 hANP32C의 149-175번 아미노산 잔기의 쌍 서열 정렬 결과. (3b) hANP32C의 149-161번 또는 162-175번 아미노산 잔기를 hANP32A의 상응하는 아미노산 잔기 (각각 149-161C 및 162-175C)로 교환, 또는 (3c) D149Y, R150W, D152H, D157Y 및 A160I를 포함하는 단일 아미노산-변형된 hANP32A를 ANP32A-결핍 (A_KO) 닭 DF-1 세포에서 과발현시키고, 상기 세포를 PR8-H5N8 PB2-627E 인플루엔자 바이러스 (MOI 0.1)로 24시간 동안 감염시킨 후 측정한 바이러스 역가 (상단); 및 hANP32B 또는 D149Y 및 D152H-변형된 hANP32B (hANP32BY149H152)를 A_KO DF-1 세포에서 과발현시키고, 상기 세포를 PR8-H5N8 PB2-627E 바이러스로 24시간 동안 감염시킨 후 측정한 바이러스 역가 (후단). (3d) hANP32A 및 hANP32B의 149-161번 아미노산 잔기의 쌍 서열 정렬 결과. 데이터는 평균 ± 표준 편차 (n = 3)로 표시하였음. *P <0.05, **P <0.01, ***P <0.001 및 ****P <0.0001. ns = 유의하지 않음 (non-significant).
도 4는 인플루엔자 바이러스 PB2 단백질과의 상호작용과 관련, ANP32A의 D149 및 D152의 기능적 역할을 분석한 결과를 나타낸 도이다. (4a) 인간 ANP32A (hANP32A)에서 D149Y 및 D152H 치환의 극성 맵핑 (polar mapping)에 대한 개략도. (4b) D149Y, D149A, D149E, D149N, D152H, D152A, D152E 또는 D152N을 포함하는 단일 아미노산-변형된 hANP32A를 ANP32A-결핍 (A_KO) 닭 DF-1 세포에서 과발현시키고, 상기 세포를 PR8-H5N8 PB2-627E 인플루엔자 바이러스 (MOI 0.1)로 24시간 동안 감염시킨 후 측정한 바이러스 역가. 데이터는 평균 ± 표준 편차 (n = 3)로 표시하였음. *P <0.05, **P <0.01, ***P <0.001 및 ****P <0.0001. ns = 유의하지 않음 (non-significant). (4c) FLAG 태그가 있는 hANP32A 야생형 (WT) 또는 hANP32A_D149Y/D152H를 바이러스 폴리머라제 (PA, PB1 및 PB2-627E 또는 627K)와 함께 A_KO 세포에 24시간 동안 공동 형질감염시키고, FLAG 항체를 사용하여 공동면역침강 분석을 수행한 결과. 각각의 세포 용해물 및 FLAG-면역침강된 단백질 (FLAG-immunoprecipitated proteins: FLAG-IP)은 표시된 항체를 사용하여 웨스턴 블롯팅에 의해 분석함.
도 5는 닭 ANP32A의 엑손 4의 CRISPR/Cas9에 의한 게놈 편집 결과를 나타낸 도이다. (5a) 닭 ANP32A(cANP32A)의 유전자 구조 및 A#4 가이드 RNA (gRNA)의 타겟 유전자좌 (엑손 4). (5b) A#4 CRISPR/Cas9 벡터로 형질감염시킨 DF-1 세포의 T7E1 분석 결과. 야생형 DF-1 세포를 대조군으로 사용함. (5c) 생어 시퀀싱을 통한 형질감염된 DF-1 세포의 돌연변이 분석 결과. 인델 (돌연변이 빈도를 괄호 안에 표시하였음. 취소선이 있는 글자 (가장 두꺼운 볼드체)는 삭제된 뉴클레오티드를, 취소선이 없는 글자 (가장 두꺼운 볼드체)는 삽입된 뉴클레오티드를 나타냄. 볼드체로 표시한 글자는 gRNA 결합 부위를, 'TGG'는 프로토스페이서 인접 모티프 (Protospacer adjacent motif: PAM) 서열을 나타냄.
도 6은 DF-1 세포에서 닭 ANP32A 유전자의 HDR-매개된 정밀 잔기 치환 결과를 나타낸 것으로, 형질감염된 DF-1 세포로부터 수득한 닭 ANP32A(cANP32A)의 엑손 4 및 5의 시퀀싱 결과를 크로마토그래피를 사용하여 표시하였음. cANP32A는 야생형 서열을 나타내며, HDR 공여체는 HDR 공여체 플라스미드의 서열을 나타냄. 괄호 안은 인델을 수반하는 비상동말단연결 (Non-homologous end joining: NHEJ) 또는 상동성 지정 복구 (Homology-directed repair: HDR)을 나타냄.
도 7은 DF-1 세포에서 닭 ANP32A 유전자의 정밀 교정을 통한 AIV 저항성 획득을 확인한 결과를 나타낸 도이다. (7a) 닭 ANP32A의 엑손 4 및 5의 HDR-매개된 정밀 교정 과정을 나타낸 개략도. 공여체 플라스미드는 양옆에 상동염기서열 (homology arms: HAs)이 있는 D149Y, D52H, D182Y, 및 D185H-변형된 cANP32A를 포함함. (7b) cANP32A의 엑손 4에서 5까지의 cDNA 시퀀싱을 통한 cANP32A-변형된 DF-1 클론의 단백질 서열. (7c) 조기 종결 코돈 (premature stop codon) (AYHYH101), 야생형 (AYHYH103) 및 HDR (AYHYH106) DF-1 클론을 PR8-H5N8 PB2-627E 또는 PB2-627K 인플루엔자 바이러스 (MOI 0.1)로 감염시킨 후 측정한 바이러스 역가. 데이터는 평균 ± 표준 편차 (n = 3)로 표시하였음. *P <0.05, **P <0.01, ***P <0.001 및 ****P <0.0001. ns = 유의하지 않음 (non-significant).
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실험 방법
ANP32 패밀리 유전자의 서열 분석
조류인플루엔자 바이러스의 증식에 관여하는 핵심 유전자를 발굴하기 위하여 사람과 닭의 ANP32 패밀리 유전자 (ANP32A, ANP32B, ANP32C, ANP32D 및 ANP32E)를 분석하였다. 구체적으로, NCBI 데이터베이스에서 제공하는 cANP32A (XP_413932), cANP32B (NP_001026105), cANP32E (NP_001006564), hANP32A (NP_006296), hANP32B (NP_006392), hANP32C (NP_036535), hANP11232D (NP_036536) 및 hANP32D (NP_036536)의 서열 정보를 수득하여 쌍 서열 정렬(pairwise sequence alignment) 및 다중 서열 정렬(multiple sequence alignment) 분석을 수행하였다. 단백질 서열들은 Blosum62 점수행렬 (scoring matrix)을 사용하는 Geneious R6 소프트웨어 (Biomatters Ltd., Auckland, New Zealand)를 사용하여 정렬하였고, 12의 갭 오픈 페널티(gap open penalty) 및 3의 갭 연장 페널티(gap extension penalty)를 사용하였다.
재조합 조류인플루엔자 바이러스의 제조
재조합 조류인플루엔자 바이러스 PR8-H5N8 PB2-627E 및 -627K는 이전 연구 (Park et al., J Infect Dis, 2019)와 동일한 방법으로 8개의 양방향 (bidirectional) PHW2000 플라스미드에서 역 유전학 방법을 이용해 생산하였다. 간단히 말해서, 8개의 양방향 플라스미드를 공동배양된 Madin-Darby 개 신장 세포 (MDCK; ATCC, CCL-34) 및 인간 293T 배아 신장 세포 (HEK293T; ATCC, CRL-11268)로 공동 형질감염시켜 바이러스를 수득하였다. 수득한 바이러스는 0.3% 소 혈청 알부민 (BSA), 1x ABAM 및 1 μg/ml TPCK-처리된 트립신 (Sigma-Aldrich, MO, USA)이 보충된 DMEM으로 구성된 MDCK 감염 배지에서 성장시킨 뒤, 37℃에서 48시간 동안 배양하였다. 바이러스 스톡을 10일된 부화란에서 더 번식시키고, 추가 실험을 위하여 감염성 바이러스의 분취량을 -80℃에서 보관하였다.
바이러스 적정
MDCK 세포에서 감염된 세포의 바이러스 적정을 수행하여 TCID50을 결정하였다. 간단히 말해서, 96-웰 플레이트에서 0.3% BSA, 1% 페니실린/스트렙토마이신 및 1 μg/ml TPCK-트립신이 보충된 무혈청 DMEM으로 배양된 MDCK 세포의 밀집층 (confluent layer)을, 감염된 세포의 상층액을 사용하여 감염시켰다. 상층액의 연속희석액을 96-웰 플레이트의 5개 웰에 3중으로 첨가하였다. 72-96시간 후, 세포 변성 효과를 관찰하고, 크리스탈 바이올렛 (Sigma-Aldrich) 염색을 통해 정량화하였다. Spearman-Karber 공식 (Gilles, Eur J Toxicol Environ Hyg, 1974)을 사용하여 ml당 TCID50을 계산하였다.
RT-qPCR
RNeasy 미니 키트 (Qiagen)를 사용하여 총 RNA를 추출하고, Superscript IV First-strand Synthesis System (Thermo Fisher Scientific)을 사용하여 역전사하였다. EvaGreen qPCR 염료 (Biotium, CA, USA) 기반의 RT-qPCR은 StepOnePlus real-time PCR system (Thermo Fisher Scientific)을 사용하여 3회 수행하였다. 타겟 유전자 특이적 정방향 및 역방향 프라이머는 하기 표 1에 나타내었다. 타겟 유전자 발현의 상대적 정량화는 2-△△Ct 공식을 사용하여 계산하였다 (여기서, △△Ct= (타겟 유전자의 Ct - ACTB의 Ct) 그룹 - (타겟 유전자의 Ct - ACTB의 Ct) 대조군).
공동면역침강 (Co-Immunoprecipitation)
면역침강 용해 버퍼 (Thermo Fisher Scientific)를 사용하여 형질감염된 세포의 세포 용해물로부터 총 단백질을 준비하였다. 면역침강을 위해 제조업체의 지침에 따라 Dynabeads Protein G 키트 (Thermo Fisher Scientific)를 사용하여 타겟 항체-접합된 자기 비드 (magnetic bead)를 준비하였다. 간단히 말해서, 비특이적 결합 단백질은 4℃에서 30분 동안 부드럽게 회전하면서 결합되지 않은 자기 비드와 함께 배양하여 미리 제거되었다. 이어서, 미리 제거된 세포 용해물을 타겟 항체-접합된 자기 비드와 함께 4℃에서 밤새 부드럽게 회전하면서 배양하였다. 자기장을 사용하여 자기 비드를 수집한 다음, 세척 버퍼로 결합되지 않은 단백질에 대하여 4회 세척을 수행하였다. 용출 버퍼를 사용하여 면역침강된 단백질을 5분 동안 용출하고, 2x Laemmli 샘플 버퍼 (BioRad)를 사용하여 95℃에서 5분간 변성시켰다. 자기장을 사용하여 자기 비드를 수집한 다음, 상층액을 이후 실험에 사용하였다.
웨스턴 블롯
총 단백질 또는 면역침강된 단백질을 10% SDS-PAGE에서 분리하였다. 분리된 단백질을 PVDF 막으로 옮기고 1시간 동안 블로킹하였다. 상기 막을 적절한 1차 항체와 함께 배양한 다음, HRP-접합된 적절한 2차 항체 (Thermo Fisher Scientific)와 함께 배양하였다. 실험에 사용된 모든 항체는 다음과 같다: anti-ACTB (sc-47778, Santa Cruz, TX, USA), anti-ANP32A (sc-100767, Santa Cruz), anti-FLAG (F1804, Sigma-Aldrich), anti-PA (GTX125932, GeneTex, CA, USA), anti-PB1 (GTX125923, GeneTex), anti-PB2 (GTX125926, GeneTex), 및 anti-NP (GTX125989, GeneTex). ECL Select 웨스턴 블롯팅 검출 시약 (GE Healthcare Bio-Sciences, NJ, USA)을 사용하여 면역반응성 단백질을 시각화하였고, BioRad ChemiDoc XRS 이미징 시스템 (BioRad, CA, USA)을 사용하여 신호를 검출하였다.
통계 분석
통계 분석에는 GraphPad Prism (GraphPad Software, CA, USA)을 사용하였다. 그룹 간 유의성은 본페르니 다중 비교를 사용한 일원분산분석 (one-way ANOVA)을 통해 결정하였다. P <0.05는 통계적 유의성을 나타낸다.
실험 결과
실시예 1. ANP32 패밀리 유전자의 서열 분석
인간 ANP32A (hANP32A)와 비교할 때 닭 ANP32A (cANP32A)는 149-175번 아미노산 잔기 (27개 잔기)에서 복제된 추가적인 176-208번 아미노산 잔기를 포함한다. 그러나, hANP32A의 상기 27개 아미노산 잔기들의 기능적 역할에 대하여는 아직까지 연구된 바가 없다. 이에, hANP32A 패밀리 구성원들 간의 비교를 기반으로 27개 잔기의 변형을 통해 바이러스 폴리머라제 활성에 기여하는 핵심 아미노산 잔기를 발굴하고자 하였다. 쌍 서열 정렬을 통해 hANP32 패밀리 구성원의 149-175번 아미노산 잔기의 서열 동일성을 조사한 결과, hANP32A의 hANP32B, hANP32C, hANP32D 및 hANP32E와의 동일성 백분율은 각각 약 68.3%, 86.1%, 89.3% 및 56.6%였다. 다음으로, 쌍 서열 정렬을 통해 LRR (N-terminal Leucine Rich Repeat) 및 LCAR (C-terminal Low Complexity Acidic Region) 도메인의 서열 동일성을 조사한 결과, hANP32A의 LRR 및 LCAR 도메인과 hANP32B, hANP32C, hANP32D 및 hANP32E의 LRR 및 LCAR 도메인과의 동일성 백분율은 각각 약 81.1%, 87.2%, 89.3% 및 71.6%였다. LCAR 도메인에서, hANP32A와 hANP32B, hANP32C 및 hANP32E 간 동일성 백분율은 약 4.7%, 84.4% 및 43.7%였다 (hANP32D는 LCAR 도메인이 존재하지 않아 제외).
실시예 2. CRISPR/Cas9 시스템을 통한 cANP32A 유전자 타겟 재조합 벡터 제작
이전 연구 (Lee et al., Dev Comp Immunol, 2017)와 동일한 방법으로 pX459 벡터를 사용하여 cANP32A 유전자를 타겟으로 하는 CRISPR/Cas9 벡터를 제작하였다. PCR 분석 및 CRISPR/Cas9 벡터 제작에 사용한 모든 올리고뉴클레오티드의 서열을 하기 표 1에 나타내었다.
ID 서열 (5'-3') 용도 서열번호
ANP32A ex1-F CACCGGCGACGATGGACGGGACGAG 시퀀싱 5
ANP32A ex1-R AAACCTCGTCCCGTCCATCGTCGC C 시퀀싱 6
ANP32A ex4/5-F CTGTCTGTCCTGTAGAGGTTTA 시퀀싱 7
ANP32A ex4/5-R GTCTTCCTCCTTCCAGTCTCT 시퀀싱 8
ACTB qRT-F AGGAGATCACAGCCCTGGCA RT-qPCR 9
ACTB qRT-R CAATGGAGG GTCCGG ATTCA RT-qPCR 10
viral M qRT-F AACCGAGGTCGAAACGTACG RT-qPCR 11
viral M qRT-R CGGTGAGCGTGA ACACAAAT RT-qPCR 12
A#1 gRNA AAAGGATCCACTTAGAGCTG gRNA 서열 13
A#4 gRNA CCACAACTCACATACCTCGA gRNA 서열 14
간단히 말해서, 각 gRNA에 대해 어닐링된 올리고뉴클레오티드를 골든 게이트 어셈블리 방법 (Golden Gate assembly)을 통해 pX459 벡터에 연결하고, 제작한 CRISPR/Cas9 벡터를 생어 시퀀싱 (Sanger sequencing)을 통해 분석하였다. cANP32A의 HDR (Homology Directed Repair)-매개된 정밀 유전자 편집을 위해서는, 이전 연구 (Park et al., J Infect Dis, 2019)와 동일한 방법으로 공여체 플라스미드 (Bionics, Seoul, Korea)를 사용하여 이중-절단 공여체-매개된 (double-cut donor-mediated) HDR을 수행하였다. D149Y, D152H, D182Y 및 D185H의 아미노산 잔기 치환을 위한 HDR 공여체 플라스미드는 양옆 (flanking)에 2개의 gRNA-PAM 서열이 있는 타겟 유전자좌 (locus)로서, 우측 및 좌측에 400 bp의 상동염기서열 (homology arms)을 포함한다. 공여체 플라스미드의 우측 및 좌측 상동염기서열 사이의 cANP32A 엑손 4 (A#4)를 타겟으로 하는 gRNA 서열은 HDR 이후 추가적인 절단을 방지하도록 변형시켜 사용하였다.
실시예 3. 재조합 벡터를 이용한 섬유아세포의 형질감염
상기 실시예 2에서 제조한 CRISPR/Cas9 재조합 벡터를 Opti-MEM (Thermo Fisher-Invitrogen)에서 Lipofectamine 2000 시약 (Thermo Fisher-Invitrogen)과 혼합하고, 상기 혼합물을 닭 섬유아세포주 DF-1 (CRL-12203; ATCC, VA, USA)에 도입하여 형질감염 시켰다. 이때 사용한 DF-1은 10% 소태아혈청 (FBS; Hyclone) 및 1x 안티바이오틱-안티마이코틱 (ABAM; Thermo Fisher-Invitrogen, Carlsbad, CA, USA)이 첨가된 DMEM (Hyclone, Logan, UT, USA) 배지 내에서 유지하였다. 형질감염 후, 퓨로마이신 (Thermo Fisher Scientific)을 배양 배지에 4일 동안 첨가하여 형질감염된 세포를 선별하였다. 퓨로마이신-선별된 단일 DF-1 세포를 96-웰 플레이트의 개별 웰에 접종하였다. 단일 DF-1 세포의 클론 확장 후, 게놈 DNA를 클론에서 추출하여 서열 분석에 사용하였다.
실시예 4. T7E1 분석 및 게놈 DNA 서열 분석
상기 실시예 3에서 생산한 형질감염 DF-1 세포에서 CRISPR/Cas9의 타겟 효율을 평가하기 위하여, T7 엔도뉴클라아제 1(T7E1) 분석을 수행하였다. CRISPR/Cas9 타겟 부위를 포함하는 게놈 영역의 증폭에 사용한 프라이머 세트는 상기 표 1에 나타내었다. 이형접합 (heteroduplex) DNA를 형성하기 위하여 앰플리콘들을 변성 (denaturation) 이후 재어닐링하였고, 상기 재어닐링한 이형접합 앰플리콘들을 37℃에서 20분 동안 T7E1 (New England Biolabs) 효소로 분해하였다. T7E1으로 분해된 산물은 1% 아가로스 겔 전기영동을 통해 분석하였다. 서열 분석을 위해, 타겟 부위를 포함하는 PCR 산물을 pGEM-T Easy 벡터 (Promega, WI, USA)에 클로닝하고 ABI Prism 3730 XL DNA 분석기 (Thermo Fisher-Applied Biosystems, CA, USA)를 사용하여 시퀀싱하였다. 서열 분석에는 BLAST (http://blast.ncbi.nlm.nih.gov) 및 Geneious R6 소프트웨어 (Biomatters Ltd.)를 사용하였다.
구체적으로, hANP32 패밀리 구성원이 cANP32A-녹아웃 (knockout) DF-1 세포 (A_KO)에서 조류인플루엔자의 복제에 관여할 수 있는지 알아보기 위해 cANP32A의 엑손 1을 타겟으로 하는 CRISPR/Cas9 벡터 (A#1 벡터)를 제작하였다 (도 1a). 상기 A#1 벡터를 DF-1 세포로 형질감염시키고, 형질감염된 세포로부터 게놈 DNA를 분리하고 T7E1 분석을 수행하였다. 그 결과, A#1 벡터로 형질감염된 DF-1 세포가 cANP32A의 엑손 1에서 인델 (indel) 돌연변이를 가지고 있음을 확인하였다 (도 1b). 또한, 게놈 DNA 시퀀싱 결과, 돌연변이율은 81.8% (9/11)임을 확인하였다 (도 1c). 개별 DF-1 세포의 배양 후, cANP32A의 엑손 1에서 2nt가 삭제된 A_KO112 DF-1 클론을 이후 실험에서 대표적인 A_KO 세포로 사용하였다.
실시예 5. ANP32 패밀리의 기능적 효과 및 ANP32 돌연변이의 vPol 활성에 대한 영향
ANP32 단백질에서 149-175번 잔기에 유발된 돌연변이가 조류인플루엔자의 vPol (바이러스 폴리머라제) 활성에 영향을 미칠 수 있는지 알아보기 위하여, 이전 연구 (Park et al., J Infect Dis, 2019)와 동일한 방법으로 CMV (cytomegalovirus) 프로모터에 의해 발현되는 cANP32A 또는 코돈최적화된 hANP32A, hANP32C 또는 hANP32E 서열을 운반하는 과발현 벡터를 구축하였다. ANP32 단백질의 149-175번 잔기의 변형 또는 유전자 교환 (swapping) 실험은 Q5 위치-지정 돌연변이 키트 (New England Biolabs, MA, USA)를 사용하여 수행하였다. 모든 플라스미드 구축물은 DNA 시퀀싱에 의해 검증되었다. 변형된 ANP32 단백질의 일시적인 발현을 위해, 구축된 벡터를 Lipofectamine 2000 시약 (Thermo Fisher-Invitrogen)을 사용하여 DF-1 세포에 형질감염시켰다. 48시간의 형질감염 후 A_KO 세포에서 hANP32 단백질의 발현을 웨스턴 블롯을 통해 검증하였다 (도 2a). 그런 다음, 형질감염된 세포를 재조합 조류인플루엔자 바이러스 PR8-H5N8 PB2-627E 및 -627K로 24시간 동안 감염시켜 바이러스 복제 및 성장을 분석하였다.
그 결과, hANP32C, hANP32D 또는 hANP32E 과발현이 바이러스 복제에 기여하지 않는 반면, hANP32A 및 hANP32B 발현은 PB2-627 잔기와 무관하게 A_KO 세포에서 바이러스 복제를 가능하게 함을 확인하였다 (도 2b). 상기 결과를 통해, hANP32C는 ANP32B에 비해 hANP32A와 더 높은 서열 동일성을 공유하지만, hANP32A 및 hANP32B와 달리 AIV의 바이러스 복제에 효율적으로 관여하지는 못함을 알 수 있었다.
다음으로, vPol 활성에 대한 27개 잔기의 기능적 중요성을 분석하기 위해, 인간 및 닭의 ANP32 단백질의 149-175번 잔기를 정렬하였다. 그 결과, 27개 잔기의 서열 동일성은 인간과 닭의 ANP32 패밀리 구성원에서 48.1%에서 100%까지 다양함을 확인하였다. 구체적으로, cANP32A와 hANP32A, cANP32B, hANP32B, hANP32C, cANP32E 및 hANP32E 사이의 서열 동일성은 각각 100%, 51.9%, 70.4%, 66.7%, 48.1% 및 48.1%였다 (도 2c).
이와 관련하여, hANP32A와 hANP32C 간의 서로 다른 잔기가 vPol 활성 및 바이러스 복제에 대하여 차등적 역할을 수행하는지 여부를 분석하였다. 먼저, hANP32A의 149-175 잔기가 제거된 벡터 (hANP23A27del), hANP32A의 149-175 잔기가 hANP32C의 149-175 잔기로 교환된 벡터 (hAANP32A27C), hANP32C의 149-175 잔기가 hANP32A의 149-175 잔기로 교환된 벡터 (hANP32C27A), 또는 hANP32E의 149-175 잔기가 hANP32A의 149-175 잔기로 교환된 벡터(hANP32E27A)를 구축하였다. 구축된 벡터들을 A_KO 세포에 형질감염시킨 후, 상기 세포들을 H5N8-627E로 감염시키고 RT-qPCR을 사용하여 바이러스 유전자의 발현 수준을 분석하였다. 그 결과, hANP32A27del, hANP32A27C, hANP32C, hANP32E, 또는 hANP32E27A의 과발현은 바이러스 유전자 전사 (transcription)에 기여하지 않는 반면, 대조군 hANP32A 또는 hANP32C27A의 과발현은 A_KO 세포에서 바이러스 유전자 전사에 기여할 수 있음을 확인하였다. 특히, hANP32C에 대하여 hANP32A의 27개 잔기로 교환된 벡터 (hANP32C27A)는 vPol 활성에 기여할 수 있는 반면, hANP32E27A의 경우 그렇지 않은 것으로 나타났으며, 상기 결과를 통해 27개 잔기뿐만 아니라 보존된 LRR 및 LCAR 도메인도 vPol 활성에 필수적으로 관여함을 알 수 있었다 (도 2d).
실시예 6. vPol 활성에 관여하는 ANP32A의 핵심 아미노산 동정
vPol 활성 및 바이러스 증식에 관여하는 27개 잔기들 중 핵심이 되는 아미노산 잔기를 동정하기 위하여, ANP32A 서열에 대한 돌연변이를 유발하였다. 먼저 hANP32A의 149-161 잔기 및 162-175 잔기가 각각 hANP32C의 149-161C 및 162- 175C 부위로 교환된 h32A를 제조하였다 (도 3a). 그 결과, A_KO 세포에서의 hANP32A의 발현과 비교하여, hANP32A에서 149-161C의 발현은 AIV의 바이러스 역가의 유의한 감소를 보인 반면, 162-175C의 발현은 유의한 차이를 보이지 않음을 확인하였다 (도 3b).
다음으로, D149Y, R150A, D152H, D156Y, A161I 치환을 포함하는 hANP32A 및 hANP32C 간의 쌍 서열 비교를 통해 단일 잔기 치환이 AIV 복제를 억제할 수 있는지 여부를 알아보았다. 그 결과, hANP32A에서 D149Y 및 D152H의 치환이 바이러스 유전자 전사 수준을 현저히 감소시킴을 확인하였다. 상기 결과를 통해, Asp149 (D149)와 Asp152 (D152)가 vPol 활성 및 바이러스 증식에 관여하는 핵심 아미노산 잔기임을 알 수 있었다. 추가적으로, A_KO 세포에서 hANP32B-변형된 단백질을 과발현시키고 바이러스 역가를 분석한 결과, hANP32B에서의 D149Y 및 D152H 치환 (hANP32BY149H152)은 야생형 hANP32B의 과발현에 비해 AIV의 바이러스 역가를 현저히 감소시킴을 확인하였다 (도 3c).
D149 및 D152의 기능적 역할이 hANP32A 및 hANP32B 모두에서 보존되는지 여부를 확인하기 위해 149-161번 잔기의 쌍 서열 정렬을 수행하였다. 그 결과, D149 및 D152는 hANP32A 및 hANP32B 모두에서 보존되어 있음을 확인하였다 (도 3d).
실시예 7. 단백질 상호작용의 vPol 활성에 대한 영향
hANP32A와 hANP32C 간에 149번 및 152번 아미노산 잔기에서 현저한 극성 차이가 있음에 착안하여, Geneious Program에 의한 극성 매핑을 사용하여 잔기의 극성과 전하에 집중하여 어떤 분자 상호 작용이 잔기에 관여하는지 확인하였다 (도 4a). 그런 다음, 149번 및 152번 잔기를 각각 대표적인 비극성 (A; 알라닌), 극성 산성 (E, 글루타메이트) 및 극성 비-전하 (N, 아스파라긴)으로 치환하였다. A_KO 세포에서 상기 hANP32 돌연변이 단백질을 과발현시킨 결과, D149Y, D149A 및 D149E는 바이러스 역가를 현저히 감소시키는 반면, D149N은 야생형 hANP32A에 비해 유의한 차이를 나타내지 않음을 확인하였다. 또한, D152H, D152A 및 D152N이 바이러스 역가를 현저히 감소시키는 반면, D152E는 야생형 hANP32A에 비해 유의한 차이를 나타내지 않음을 확인하였다 (도 4b). 상기 결과를 통해, D149 및 D152 잔기는 각각 수소 결합 및 정전기 상호작용을 통해 vPol 활성에 관여함을 알 수 있었다.
상기 확인된 잔기의 돌연변이가 ANP32A와 vPol 단백질 간의 단백질 상호작용에 영향을 미치는지 확인하기 위하여 추가적으로 면역침강 분석을 수행하였다. 구체적으로, A_KO DF-1 클론에서 야생형 또는 돌연변이 hANP32A와 vPol 단백질 간의 상호작용을 분석하였다. 그 결과, 바이러스성 PA 및 PB2 단백질은 야생형 hANP32A (hANP32Awt)와 공동 면역침강되었다. 반면, hANP32AD149Y/D152H 돌연변이체는 PB2-627 잔기와 무관하게 항-FLAG 공동 면역침강 후 바이러스 단백질과의 상호작용 감소를 나타냄을 확인하였다 (도 4c). 상기 결과를 통해, hANP32A의 D149 및 D152 잔기의 돌연변이는 ANP32A와 vPol 단백질 간의 상호작용에 관여함을 확인하였다.
실시예 8. 닭 ANP32A에 대한 정밀 유전자 편집
CRISPR/Cas9 시스템을 사용하여, 상동재조합을 통한 닭 ANP32A에 대한 아미노산 잔기의 정확한 치환이 닭 세포에서 바이러스 복제를 현저히 감소시키는지 확인하였다. 먼저, cANP32A 유전자의 엑손 4를 타겟으로 하기 위해 A#4 gRNA 서열을 포함하는 CRISPR/Cas9 벡터로 DF-1 세포를 형질 감염시키고, T7E1 분석 및 형질감염된 DF-1 세포의 게놈 DNA 시퀀싱으로 타겟 효율을 확인하였다 (도 5a, 5b 및 5c).
cANP32A에는 추가로 복제된 D182 및 D185 잔기가 있기 때문에, 이중 절단-매개된 HDR 시스템을 사용하여 이전 연구 (Zhang et al., Genome Biol, 2017; Park et al., J Infect Dis, 2019)와 동일한 방법으로 cANP32A 유전자에 대하여 D149Y, D152H, D182Y 및 D185H (AYHYH) 변형을 유도하였다 (도 7a). A#4 CRISPR/Cas9 벡터 및 공여체 플라스미드를 DF-1 세포에 공동-형질감염시킨 결과, HDR 효율은 약 11% (1/9)임을 확인하였다 (도 6).
다음으로, 형질감염된 세포의 단일 세포 클론 확장을 통해 DF-1 클론을 확립하고, 확립된 클론에 대하여 cDNA 시퀀싱을 수행한 결과 타겟 서열이 정밀하게 편집된 클론 (AYHYH106)을 확인하였다 (도 7b). 또한, AYHYH101, AYHYH102, AYHYH104, AYHYH105, 및 AYHYH107이 엑손 4에서 조기 종결 코돈을 가지고 있음을 확인하였다.
DF-1에서 cANP32A 잔기의 정확한 변형 효과를 평가하기 위하여 AYHYH101 (조기 종결 코돈), AYHYH103 (야생형) 및 AYHYH106 (HDR)을 포함하는 확립된 세포 클론을 MOI 0.1의 PR8-H5N8 LPAI (PB2-627E 또는 PB2-627K)로 감염시켰다. 그 결과, AYHYH101 및 AYHYH106 클론 둘 다에서 바이러스 역가가 PB2-627 잔기와 무관하게 AYHYH103 클론보다 현저히 낮음을 확인하였다 (도 7c). 상기 결과를 통해, cANP32A 유전자에서 D149Y, D152H, D182Y 및 D185H로의 정확한 치환이 닭 숙주 세포에서의 AIV 증식을 현저히 감소시킬 수 있음을 확인하였다.
상기 결과를 통해, 일 양상에 따른 방법은 숙주 세포에서 바이러스 복제에 관여하는 ANP32A에 변이를 유도하여 조류인플루엔자 바이러스 (AIV) 저항성을 획득할 수 있음을 확인하였다. 특히, ANP32A의 핵심 아미노산 잔기만을 변형시켜, ANP32A 유전자의 본래 기능은 유지하면서 AIV 단백질과의 관계에서 상호작용만을 정교하게 제한함으로써 AIV에 대한 저항성을 획득할 수 있음을 확인하였다. 따라서, 일 양상에 따른 방법은 질병 저항성 세포주, 질병 저항성 가금 및 동물 생산에 널리 적용될 수 있다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.

Claims (15)

  1. ANP32A (Acidic Nuclear Phosphoprotein 32 Family Member A) 유전자 내 Asp149, Asp152, Asp182 및 Asp185로 이루어진 군으로부터 선택되는 하나 이상의 잔기를 타겟으로 하는 가이드 RNA (gRNA) 또는 이를 암호화하는 폴리뉴클레오티드를 포함하는 재조합 벡터.
  2. 청구항 1에 있어서,
    상기 가이드 RNA는 서열번호 14로 표시되는 것인, 재조합 벡터.
  3. 청구항 1에 있어서,
    상기 폴리뉴클레오티드는 프로토스페이서 인접 모티프 (protospacer adjacent motif: PAM)를 포함하는 것인, 재조합 벡터.
  4. 청구항 1의 재조합 벡터 및 Cas9 (CRISPR associated protein 9), Cpf1 (CRISPR from Prevotella and Francisella 1), TALEN (Transcription activator-like effector nuclease) 및 ZFN (Zinc Finger Nuclease)으로 이루어진 군으로부터 선택되는 하나 이상의 뉴클레아제 암호화 서열을 포함하는 유전체 교정용 조성물.
  5. 청구항 4에 있어서,
    상기 조성물은 ANP32A 유전자에서 D149Y, D152H, D182Y 및 D185H로 이루어진 군으로부터 선택되는 하나 이상의 치환을 유도하는 것인, 조성물.
  6. 청구항 4에 있어서,
    상기 조성물은 조류인플루엔자 바이러스에 대한 저항성을 유도하기 위한 것인, 조성물.
  7. 청구항 1의 재조합 벡터 또는 청구항 4의 유전체 교정용 조성물이 도입된 형질전환 세포.
  8. 청구항 7에 있어서,
    상기 세포는 조류의 줄기세포, 체세포, 생식세포, 수정란 및 배아로 이루어진 군으로부터 선택되는 것인, 형질전환 세포.
  9. 청구항 8에 있어서,
    상기 생식세포는 원시생식세포 (primordial germ cells: PGCs)인 것인, 형질전환 세포.
  10. 청구항 7에 있어서,
    상기 형질전환 세포는 ANP32A 유전자 내 Asp149, Asp152, Asp182 및 Asp185로 이루어진 군으로부터 선택되는 하나 이상의 잔기가 치환된 것인, 형질전환 세포.
  11. 청구항 1의 재조합 벡터 또는 청구항 4의 유전체 교정용 조성물을 조류 체세포에 도입하는 단계를 포함하는 형질전환 세포를 제조하는 방법.
  12. 청구항 7의 형질전환 세포를 조류의 배아에 이식하는 단계를 포함하는 유전자 편집 조류를 제조하는 방법.
  13. 청구항 12에 있어서,
    상기 조류는 닭, 오리, 거위, 메추리, 꿩 및 칠면조로 이루어진 군으로부터 선택되는 것인, 방법.
  14. 청구항 12에 있어서,
    상기 유전자 편집 조류는 조류인플루엔자 바이러스에 대한 저항성을 갖는 것인, 방법.
  15. 청구항 12의 방법으로 제조된 조류인플루엔자 바이러스에 대한 저항성을 갖는 유전자 편집 조류.
PCT/KR2021/000216 2020-01-07 2021-01-07 조류인플루엔자 바이러스에 저항성을 갖는 유전자 편집 조류의 제조방법 WO2021141421A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US17/776,141 US20220380797A1 (en) 2020-01-07 2021-01-07 Method for producing genetically edited birds having resistance to avian influenza viruses

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0002154 2020-01-07
KR20200002154 2020-01-07

Publications (1)

Publication Number Publication Date
WO2021141421A1 true WO2021141421A1 (ko) 2021-07-15

Family

ID=76788850

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/000216 WO2021141421A1 (ko) 2020-01-07 2021-01-07 조류인플루엔자 바이러스에 저항성을 갖는 유전자 편집 조류의 제조방법

Country Status (3)

Country Link
US (1) US20220380797A1 (ko)
KR (1) KR102544201B1 (ko)
WO (1) WO2021141421A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024039236A1 (ko) * 2022-08-19 2024-02-22 서울대학교산학협력단 엑소좀을 이용한 생식세포 내 물질 전달 및 유전자 편집 시스템

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190093171A (ko) * 2018-01-31 2019-08-08 서울대학교산학협력단 CRISPR/Cas9 시스템을 통한 닭 백혈병 바이러스(Avian Leukosis Virus, ALV) 저항성 조류의 제조방법

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190093171A (ko) * 2018-01-31 2019-08-08 서울대학교산학협력단 CRISPR/Cas9 시스템을 통한 닭 백혈병 바이러스(Avian Leukosis Virus, ALV) 저항성 조류의 제조방법

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DOMINGUES PATRICIA, ELETTO DAVIDE, MAGNUS CARSTEN, TURKINGTON HANNAH L., SCHMUTZ STEFAN, ZAGORDI OSVALDO, LENK MATTHIAS, BEER MART: "Profiling host ANP32A splicing landscapes to predict influenza A virus polymerase adaptation", NATURE COMMUNICATIONS, vol. 10, no. 1, 1 December 2019 (2019-12-01), XP055827682, DOI: 10.1038/s41467-019-11388-2 *
LONG JASON S, IDOKO-AKOH ALEWO, MISTRY BHAKTI, GOLDHILL DANIEL, STALLER ECCO, SCHREYER JOCELYN, ROSS CRAIG, GOODBOURN STEVE, SHELT: "Species specific differences in use of ANP32 proteins by influenza A virus", ELIFE, vol. 8, 4 June 2019 (2019-06-04), XP055827676, DOI: 10.7554/eLife.45066 *
PARK YOUNG HYUN, CHUNGU KELLY, LEE SU BIN, WOO SEUNG JE, CHO HO YEON, LEE HONG JO, RENGARAJ DEIVENDRAN, LEE JI-HO, SONG CHANG-SEON: "Host-specific restriction of avian influenza virus caused by differential dynamics of ANP32 family members", THE JOURNAL OF INFECTIOUS DISEASES, vol. 221, no. 1, 1 January 2020 (2020-01-01), pages 71 - 80, XP009528953, ISSN: 0022-1899, DOI: 10.1093/infdis/jiz506 *
ZHANG HAILI, ZHANG ZHENYU, WANG YUJIE, WANG MEIYUE, WANG XUEFENG, ZHANG XIANG, JI SHUANG, DU CHENG, CHEN HUALAN, WANG XIAOJUN: "Fundamental Contribution and Host Range Determination of ANP32A and ANP32B in Influenza A Virus Polymerase Activity", JOURNAL OF VIROLOGY, vol. 93, no. 13, 1 July 2019 (2019-07-01), XP055827685, DOI: 10.1128/JVI.00174-19 *

Also Published As

Publication number Publication date
KR20210089109A (ko) 2021-07-15
KR102544201B1 (ko) 2023-06-16
US20220380797A1 (en) 2022-12-01

Similar Documents

Publication Publication Date Title
US11905521B2 (en) Methods and systems for targeted gene manipulation
Chen et al. Engineering human stem cell lines with inducible gene knockout using CRISPR/Cas9
US20180055951A1 (en) Endonuclease targeting blood coagulation factor viii gene and composition for treating hemophilia comprising same
KR20200006980A (ko) 유전자 변형 동물의 생성 방법
KR102366081B1 (ko) Hla g-변형된 세포 및 방법
WO2016080795A1 (ko) 두 개의 벡터로부터 발현된 cas9 단백질을 이용한 유전자 발현 조절 방법
KR102136132B1 (ko) CRISPR/Cas9 시스템을 통한 닭 백혈병 바이러스(Avian Leukosis Virus, ALV) 저항성 조류의 제조방법
US11459586B2 (en) Methods for increasing efficiency of nuclease-mediated gene editing in stem cells
WO2018208067A1 (ko) 인위적으로 조작된 조작면역세포
US11851648B2 (en) Humanized cell line
JPH11507230A (ja) 細胞の不死化及び脱不死化
WO2018088694A2 (ko) 인위적으로 조작된 sc 기능 조절 시스템
WO2021141421A1 (ko) 조류인플루엔자 바이러스에 저항성을 갖는 유전자 편집 조류의 제조방법
JPWO2015199225A1 (ja) 家禽始原生殖細胞の遺伝子改変方法、遺伝子改変された家禽始原生殖細胞、遺伝子改変家禽の生産方法及び家禽卵
Park et al. Asp149 and Asp152 in chicken and human ANP32A play an essential role in the interaction with influenza viral polymerase
WO2022065689A1 (ko) 편집 효율이 향상된 프라임 편집 기반 유전자 교정용 조성물 및 이의 용도
WO2014142433A1 (ko) 바이러스 생산능이 증가된 세포주 및 그 제조방법
CN113748205A (zh) 用于改进的基因编辑的组合物和方法
CN116948975A (zh) Ifnar1基因敲除的mdck细胞株及其构建方法和应用
US20230257768A1 (en) Poultry cell in which a gene encoding a protein of interest is knocked-in at egg white protein gene, and method for producing said poultry cell
KR101658135B1 (ko) 혈액 응고인자 ⅷ 유전자를 타겟으로 하는 엔도뉴클레아제 및 이의 용도
WO2020139031A1 (ko) Crispr-cas를 기반으로 하는 유전자 교정용 조성물
WO2022231402A1 (ko) 바이러스 백신 생산용 조류 세포 제조용 조성물 및 바이러스 저항성 조류 세포 제조용 조성물
Li et al. Nuclear import of IRF11 via the importin α/β pathway is essential for its antiviral activity
WO2022114815A1 (ko) 트랜스-스플라이싱 아데노-연관 바이러스 벡터를 포함하는 프라임에디팅용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21738237

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21738237

Country of ref document: EP

Kind code of ref document: A1