WO2024039236A1 - 엑소좀을 이용한 생식세포 내 물질 전달 및 유전자 편집 시스템 - Google Patents

엑소좀을 이용한 생식세포 내 물질 전달 및 유전자 편집 시스템 Download PDF

Info

Publication number
WO2024039236A1
WO2024039236A1 PCT/KR2023/012305 KR2023012305W WO2024039236A1 WO 2024039236 A1 WO2024039236 A1 WO 2024039236A1 KR 2023012305 W KR2023012305 W KR 2023012305W WO 2024039236 A1 WO2024039236 A1 WO 2024039236A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
target substance
germ cells
exosomes
germ
Prior art date
Application number
PCT/KR2023/012305
Other languages
English (en)
French (fr)
Inventor
한재용
정경민
Original Assignee
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교산학협력단 filed Critical 서울대학교산학협력단
Publication of WO2024039236A1 publication Critical patent/WO2024039236A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/89—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microinjection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues

Definitions

  • the present invention relates to a material transfer and gene editing system in germ cells using exosomes, and this patent application has priority over Korean Patent Application No. 10-2022-0104274 submitted to the Korean Intellectual Property Office on August 19, 2022. It is claimed that the disclosure of said patent application is incorporated herein by reference.
  • Germ cells are an important cellular resource that can transmit genetic information to the next generation.
  • primordial germ cells are a useful resource for conducting basic research on the development and differentiation of germ cells, as well as basic medical research such as infertility research and germ cell-derived disease research, and for the preservation of national life resources and endangered species. and has important value as a genetic resource for restoration.
  • recently, rapidly developing biotechnology technology has been applied to the germ cells of birds, and gene-edited birds such as disease resistance models and heat resistance models that can adapt to changing habitats are being developed.
  • conditions for isolation and culture of germ cells such as primordial germ cells have not been established, making it difficult to secure sufficient cell resources, which limits research and utilization. Avian germ cells are particularly difficult to transfect.
  • exosomes one of the nanoparticle-sized substances secreted by cells, have excellent cell absorption effects as a carrier that transfers information from a specific cell to other cells.
  • little research has been conducted on the transfer of foreign substances and gene editing into germline cells in vitro and in vivo using exosomes, and the development of gene-edited animals using the same.
  • the present inventors attempted to isolate exosomes from avian cells and use them to develop an in vivo gene editing system. As a result, when using the exosomes, they can be transferred into germ cells in vitro and in vivo. It was confirmed that genes of germ cells in vitro and in vivo could be edited with high efficiency by delivering target substances (e.g., foreign genes, etc.) with high efficiency. In addition, it was confirmed that the exosomes can be usefully used to develop transgenic or gene-edited animals without isolating and culturing germ cells such as primordial germ cells from animals.
  • target substances e.g., foreign genes, etc.
  • One object of the present invention is to provide a composition for delivering a target substance to germ cells containing exosomes with the target substance inserted therein.
  • Another object of the present invention is to provide a composition for gene editing in germ cells containing exosomes with nucleic acids inserted therein.
  • Another object of the present invention is to provide a method of delivering a target substance to reproductive cells using exosomes with the target substance inserted therein.
  • Another object of the present invention is to provide a method of editing the genes of germ cells using exosomes with nucleic acids inserted therein.
  • Another object of the present invention is to provide a method of producing a gene-edited animal using exosomes with nucleic acids inserted therein or germ cells into which the exosomes have been introduced.
  • Another object of the present invention is to provide the use of exosomes with a target substance inserted therein to deliver the target substance to reproductive cells.
  • Another object of the present invention is to provide the use of exosomes with nucleic acids inserted therein for editing genes in germ cells.
  • Another object of the present invention is to provide the use of exosomes with a target substance inserted therein to prepare a composition for delivering a target substance to reproductive cells.
  • Another object of the present invention is to provide the use of exosomes with nucleic acids inserted therein for producing a composition for gene editing in germ cells.
  • One aspect provides a composition for delivering a target substance to germ cells including an exosome with a target substance inserted therein.
  • the exosome may be separated from a cell or may be an isolated cell-derived exosome.
  • the cell-derived exosomes may be endogenous exosomes.
  • the exosomes may be isolated from cells of humans or non-human animals.
  • Animals other than humans may include, but are not limited to, mammals, birds, reptiles, amphibians, fish, etc.
  • the exosomes may be separated from algal cells.
  • the birds may include, but are not limited to, chickens, ducks, geese, quails, pheasants, or turkeys.
  • the exosomes may be isolated from stem cells, somatic cells, germ cells, or cancer cells of humans or non-human animals.
  • the exosomes may be isolated from avian stem cells, somatic cells, germ cells, or cancer cells.
  • the stem cells may include embryonic (or embryonic) stem cells, adult stem cells, or induced pluripotent stem cells (iPS).
  • the stem cells are totipotency stem cells, pluripotency stem cells, multipotent stem cells, oligopotent stem cells, bipotent stem cells, or unipotent stem cells. It may include stem cells, etc., but is not limited thereto.
  • the somatic cells include vascular endothelial cells, leukocytes, immune cells, epithelial cells, fibroblasts, muscle cells, bone marrow cells, epidermal cells, osteoblasts, hepatocytes, heart cells, small intestine cells, colon cells, pancreatic cells, or nerve cells. It can be done, and is not limited to this.
  • the term "germ cells” refers to cells that participate in reproduction and includes sperm and eggs, which are gametes of organisms that reproduce sexually, and ancestral cells at all stages of their development.
  • the reproductive cells may include, but are not limited to, primordial germ cells, spermatogonial stem cells, oval stem cells, spermatogonia, oval cells, spermatocytes, oocytes, sperm cells, follicular cells, sperm, or eggs.
  • the cancer cells include breast cancer, lung cancer, cerebrospinal tumor, head and neck cancer, thymoma, mesothelioma, esophageal cancer, stomach cancer, colon cancer, liver cancer, pancreas cancer, biliary tract cancer, kidney cancer, bladder cancer, prostate cancer, testicular cancer, germ cell tumor, ovarian cancer, cervical cancer, It may be a cell derived from a cancer selected from the group consisting of endometrial cancer, lymphoma, acute leukemia, chronic leukemia, multiple myeloma, sarcoma, malignant melanoma, and skin cancer, but is not limited thereto, and preferably, the cancer cell is liver cancer. It could be a cell.
  • the exosome may be isolated from primordial germ cells or hepatocytes of humans or non-human animals.
  • the exosomes may be isolated from avian primordial germ cells or hepatocytes.
  • primordial germ cells refers to cells that diverge from normal somatic cells early in ontogeny and differentiate to become future germ cells.
  • the primordial germ cells may be isolated from the germinal crescent, blood, primordial genitalia, or embryo of an animal (eg, bird), but are not limited thereto.
  • liver cells refers to the constituent cells that make up the liver.
  • the liver cells may be hepatocellular carcinoma cells, but are not limited thereto.
  • the exosome may have the form of a small vesicle with a membrane structure.
  • the exosome may have a diameter of about 50 to 250 nm.
  • the exosomes are about 50 to 200 nm, about 50 to 150 nm, about 60 to 200 nm, about 60 to 150 nm, about 70 to 200 nm, about 70 to 150 nm, about 80 to 200 nm, about a diameter of 80 to 150 nm, about 80 to 130 nm, about 80 to 120 nm, about 90 to 200 nm, about 90 to 150 nm, about 90 to 130 nm, about 90 to 120 nm, or about 90 to 110 nm. It can be something to have.
  • the insertion efficiency of the target substance into the exosome when the diameter of the exosome is outside the above numerical range, the insertion efficiency of the target substance into the exosome, the transfection (i.e. introduction) efficiency of the exosome into the germ cell, and the germ cell of the exosome may be reduced.
  • the exosome contains or expresses one or more proteins selected from the group consisting of Beta ( ⁇ )-actin (ACTB) protein, CD9 protein, CD81 (Cluster of Differentiation 81) protein, and Hsp70 (70 kilodalton heat shock proteins) protein. It may be. According to one embodiment, the exosome may contain or express the protein, thereby exhibiting an excellent effect of delivering a target substance or gene editing within germ cells (eg, avian germ cells).
  • ACTB Beta
  • CD9 protein CD9 protein
  • CD81 Cluster of Differentiation 81
  • Hsp70 70 kilodalton heat shock proteins
  • the target substance refers to a substance to be delivered into reproductive cells, and may specifically be a substance that regulates cell physiological activity, but is not particularly limited.
  • cell-bioactivity modulator refers to an active substance that acts on cells, regulates biological responses, and affects physiological functions.
  • the target substance may include one or more selected from the group consisting of nucleic acids, proteins, antibodies, and drugs, but is not limited thereto.
  • the nucleic acid may include a gene intended to be delivered into a cell and expressed within the cell.
  • the nucleic acid may be in the form of a gene such as DNA or RNA, or a plasmid or vector containing the gene.
  • the plasmid or vector may further include an expression control element or an expression cassette that allows the gene to be delivered into the cell to be expressed within the cell.
  • the plasmid or vector may include a promoter capable of initiating transcription, an optional operator sequence to regulate such transcription, a sequence encoding a suitable mRNA ribosome binding site, a sequence regulating termination of transcription and translation, the plasmid or It may include one or more selection markers for selecting cells containing the vector, an origin of replication, a restriction enzyme site (eg, multiple cloning site), etc.
  • the plasmid or vector can replicate or function within a cell independently of the cell genome, and can also be integrated into the genome itself.
  • the target substance may be an intracellular gene regulatory substance.
  • the intracellular gene regulatory substance deletes or replaces some of the genes in the cell, inserts a foreign gene into the intracellular genome, decomposes or modifies the gene in the cell, or regulates the expression of the gene in the cell. etc., any substance that can edit, manipulate, correct, rearrange, regulate, modify, decompose, or recombine genes within a cell can be used without limitation.
  • the target material may include components used in the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) nuclease system.
  • the CRISPR nuclease system may also be called an RNA-guided nuclease (RGEN) or CRISPR/Cas system.
  • the CRISPR/Cas system may include the CRISPR/Cpf1 system.
  • the Cas (CRISPR associated) nuclease refers to the Cas protein used in the CRISPR/Cas system.
  • the Cas nuclease acts as an endonuclease and can induce cleavage, insertion, or a combination thereof of the target nucleic acid.
  • the components used in the CRISPR nuclease system include a Cas protein, a guide RNA, a nucleic acid (e.g., DNA) encoding the Cas protein and/or the guide RNA, and the nucleic acid. It may include one or more selected from the group consisting of plasmids or vectors.
  • the plasmid or vector is two or more plasmids or vectors each containing a nucleic acid encoding the Cas protein and a nucleic acid encoding the guide RNA, or a nucleic acid encoding the Cas protein in one plasmid or vector and the above It may be a plasmid or vector containing both nucleic acids encoding guide RNA.
  • Cas protein refers to a protein that constitutes the CRISPR nuclease system and is capable of recognizing, cutting, and editing a specific nucleotide sequence to be used.
  • the Cas protein may be a protein that acts as a genetic scissor that allows genetic manipulation, such as inserting a specific gene into a target location in the genome or stopping the activity of a specific gene.
  • Each wild-type Cas protein can interact with one or more polynucleotides (most typically a guide RNA) to form a Cas protein-RNA hybrid.
  • the Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, or homologs or variants thereof It may refer to a CRISPR-associated protein, which may be water, but is not limited thereto.
  • the Cas protein may be Cas9 protein (CRISPR associated protein 9).
  • the Cas9 protein contains sequences related to the Cas9 function as a minimum sequence and may additionally include other sequences, and preferably consists of sequences known in the art.
  • guide RNA refers to a target DNA-specific RNA (e.g., an RNA capable of hybridizing with a target site of DNA), capable of forming a hybrid with a Cas protein, and bringing the Cas protein to the target DNA. This refers to RNA.
  • the guide RNA may include two guide RNAs, i.e., a CRISPR RNA (crRNA) having a nucleotide sequence capable of hybridizing to the target region of the gene, and an additional trans-activating crRNA (tracrRNA) for the desired gene correction,
  • a dual guide RNA dual guide RNA
  • dual guide RNA which is a crRNA-tracrRNA complex in which crRNA and tracrRNA are partially combined
  • a single guide RNA in which the ends of crRNA and the ends of tracrRNA are connected while forming a crRNA-tracrRNA complex like the above dual guide RNA
  • sgRNA single guide RNA
  • the guide RNA has a base sequence complementary to the target gene, and various guide RNAs can be used depending on the target gene.
  • the exosome may be one in which the target substance is inserted into the exosome.
  • insertion may be used interchangeably with the terms encapsulation, introduction, transfection, or transduction.
  • the method for inserting the target substance into the exosome may be performed according to methods known in the art.
  • the target substance may be inserted into the exosome according to a method such as electroporation, lipofection, or microinjection, but is not limited thereto.
  • the exosome with the target substance inserted therein can deliver the target substance into germ cells with high efficiency. Therefore, the exosome with the target substance inserted therein has the purpose of delivering the target substance to reproductive cells.
  • the reproductive cells which are recipient cells, may be reproductive cells of humans or non-human animals.
  • the reproductive cells include primordial germ cells, spermatogonia stem cells, oval stem cells, spermatogonia, oval cells, spermatocytes, It may be an oocyte, a sperm cell, a follicle cell, a sperm cell, an egg cell, or a combination thereof, but is not limited thereto.
  • Animals other than humans may include, but are not limited to, mammals, birds, reptiles, amphibians, fish, etc., and the birds may include chickens, ducks, geese, quails, pheasants, or turkeys, etc. Not limited.
  • the term "recipient cell” refers to a cell into which an exosome containing the target substance (e.g., nucleic acid) is introduced, and the target substance (e.g., nucleic acid) is delivered into the cell, or a cell whose gene is edited thereby. It can mean.
  • the target substance e.g., nucleic acid
  • the germ cells which are recipient cells, may be germ cells in vitro, ex vivo, or in vivo.
  • the exosome with the target substance inserted therein not only can deliver the target substance with high efficiency into isolated germ cells existing in vitro or in vitro, but also can transfer the target substance to the living body by being injected into the body.
  • the target substance can be delivered with high efficiency even to reproductive cells existing within the system.
  • the in vitro or in vitro germ cells which are recipient cells, are germ cells (e.g., primordial germ cells) isolated from an embryo (or embryo) or adult cells (human or non-human animal (sexual axis)).
  • germ cells e.g., primordial germ cells
  • adult cells human or non-human animal (sexual axis)
  • reproductive cells e.g., spermatogonia stem cells, oval stem cells, spermatogonia, oval cells, spermatocytes, oocytes, sperm cells, follicular cells, sperm, or eggs
  • adult refers to an individual (human or non-human animal) that has completed ontogeny and is capable of reproduction, and if the individual is an animal other than human, the adult can be called an “adult animal.”
  • the germ cells in the living body, which are recipient cells may be germ cells in an embryo (or embryo) or adult body (or sex axis).
  • the germ cells in the living body, which are recipient cells may be germ cells in the gonads of an embryo (or embryo) or adult (or sex axis).
  • the embryo (or embryo) includes, but is not limited to, a freshly fertilized egg, an early embryo, or a recipient embryo.
  • compositions for gene editing in germ cells comprising exosomes with nucleic acids inserted therein.
  • the nucleic acid may be a nucleic acid used for gene editing.
  • the nucleic acid may include components used in the CRISPR nuclease system.
  • exosomes, nucleic acids, inserts, components used in the CRISPR nuclease system, and germ cells (i.e., germ cells that are recipient cells) that are the target of gene editing are as described above.
  • the exosome when the nucleic acid is a component used in the CRISPR nuclease system targeting a specific gene, the exosome is the CRISPR nuclease Components used in the system can be delivered into germ cells in vitro or in vivo, and components used in the CRISPR nuclease system delivered into the germ cells can edit target genes in the germ cells ( Figure 1).
  • exosomes with the nucleic acid inserted therein can edit genes in germ cells in vitro or in vivo with high efficiency. Therefore, exosomes with the nucleic acid inserted therein are used for editing genes in germ cells in vitro or in vivo.
  • gene editing refers collectively to the work of changing the properties of genes by rearranging genes or causing mutations, and more specifically, refers to genetic manipulation technologies.
  • editing a specific gene e.g., a target gene
  • editing a specific gene in the genome of an organism involves recognizing and cutting a specific base or base sequence, adding a new base or base sequence to that site, or subtracting an existing base or base sequence. It may mean editing a specific gene by a method of replacement or deletion (i.e., a genetic manipulation method of deleting, inserting, replacing, or modifying a gene).
  • gene editing not only means editing a specific gene, but also includes gene regulation, gene manipulation, gene correction, gene rearrangement, insertion of foreign genes or deletion or modification of existing genes using recombinant gene technology, etc. It includes all meanings such as genetic recombination, and can be used interchangeably with the above terms in this specification.
  • the exosome with the target substance (e.g., nucleic acid) inserted therein is an avian cell (specifically, an avian somatic cell (e.g., hepatocyte) or germ cell (e.g., primordial cell).
  • an avian somatic cell e.g., hepatocyte
  • germ cell e.g., primordial cell.
  • the target material can be delivered to germ cells with greater efficiency or genes in germ cells can be edited with greater efficiency than when the exosomes are exosomes derived from other cells. .
  • the composition can be prepared into a composition suitable for administration to a subject according to a method that can be easily performed by a person skilled in the art to which the present invention pertains.
  • the composition may include a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier includes any and all physiologically compatible solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, etc.
  • Examples of the pharmaceutically acceptable carrier include one or more of water, saline solution, phosphate-buffered saline, dextrose, glycerol, ethanol, etc., as well as combinations thereof.
  • composition may be prepared in unit dose form by being formulated using a pharmaceutically acceptable carrier and/or excipient, or may be prepared by placing it in a multi-dose container.
  • the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet, or capsule, and may additionally contain a dispersant or stabilizer.
  • the composition when used by administering to an individual, the composition may be in, for example, an oral dosage form (e.g., powder, tablet, capsule, syrup, pill, or granule), or a parenteral dosage form (e.g., injection). It can be formulated as: Additionally, the composition may be prepared as a systemic or topical formulation.
  • an oral dosage form e.g., powder, tablet, capsule, syrup, pill, or granule
  • a parenteral dosage form e.g., injection
  • the composition may be prepared as a systemic or topical formulation.
  • the composition may include an effective amount of exosomes with a target substance (eg, nucleic acid) inserted therein.
  • a target substance eg, nucleic acid
  • the term “effective amount” refers to an amount sufficient to exhibit the effect (e.g., prevention or treatment, or gene editing effect) of the target substance on the cells or individuals to which the target substance is administered.
  • the effective amount can be appropriately selected by a person skilled in the art depending on the cell or organism selected. Factors including, for example, the severity of the disease, the subject's age, weight, health, sex, the subject's sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, composition used and drugs combined or used simultaneously. and other factors well known in the medical field.
  • the effective amount may be from about 0.0001 ⁇ g to about 2 g, from about 0.001 ⁇ g to about 1 g, from about 0.01 ⁇ g to about 500 mg, from about 0.1 ⁇ g to about 100 mg, or from about 1 ⁇ g to about 50 mg, per composition. It is not limited to this.
  • the composition when the composition is administered to an individual, the composition may be administered orally, intravenously, intratumorally, intramuscularly, transdermally, mucosally, intranasally, intratracheally, subcutaneously, or a combination thereof.
  • the dosage of the composition may be, for example, from about 0.00001 mg/kg to about 100 mg/kg, from about 0.001 mg/kg to about 10 mg/kg, or from about 0.1 mg/kg to about 0.1 mg/kg, based on the weight of the individual. It may be within the range of 1 mg/kg, but is not limited thereto.
  • the administration may be administered once a day, multiple times a day, or once a week, once every two weeks, once every three weeks, or once every four weeks to once a year.
  • the entity may be a human or a non-human animal.
  • Animals other than humans may include, but are not limited to, mammals, birds, reptiles, amphibians, fish, etc., and the birds may include chickens, ducks, geese, quails, pheasants, or turkeys, etc. Not limited.
  • Another aspect provides a method of delivering a target substance to an isolated germ cell or germ cell in an organism, comprising the step of administering an exosome with a target substance inserted therein to an isolated germ cell or organism.
  • Another aspect provides a method of editing the genes of an isolated germ cell or germ cell in an organism, comprising administering an exosome with a nucleic acid inserted therein to the isolated germ cell or organism.
  • Another aspect is injecting exosomes with nucleic acids inserted therein or germ cells into which the exosomes have been introduced (e.g., transduced or transfected) into embryos (or blood vessels within the embryo) of animals other than humans.
  • a method for producing a gene-edited animal comprising the steps is provided.
  • the exosome, the target substance, the nucleic acid, the insert, an exosome with the target substance inserted therein, an exosome with the nucleic acid inserted therein, and the germ cell (i.e., a germ cell that is a recipient cell) , and the gene editing is as described above.
  • the organism may include a human or non-human animal individual, or an embryo (or embryo).
  • Animals other than humans may include, but are not limited to, mammals, birds, reptiles, amphibians, fish, etc., and the birds may include chickens, ducks, geese, quails, pheasants, or turkeys, etc. Not limited.
  • the embryo includes, but is not limited to, a freshly fertilized egg, an early embryo, or a recipient embryo.
  • the organism may be an algae or an algae embryo (eg, a recipient embryo).
  • the administration includes processing, contact, injection, introduction, etc.
  • the method of administering the exosome with the target substance inserted therein or the exosome with the nucleic acid inserted therein to isolated reproductive cells or organisms can be performed by a general method known in the art and is not particularly limited. No.
  • the exosomes are administered to the isolated reproductive cells or organisms without undergoing additional artificial processes. It may be spontaneously or spontaneously introduced or absorbed into cells or germ cells within the organism. Due to this, the exosome can deliver the target substance or nucleic acid to the isolated reproductive cell or reproductive cell within the organism with high efficiency, and as a result, the genes of the isolated reproductive cell or reproductive cell within the organism can be edited with high efficiency. You can.
  • exosomes with the target substance inserted therein or exosomes with the nucleic acid inserted therein are administered (e.g., treated) to isolated reproductive cells, introduction of the exosomes into the isolated reproductive cells Alternatively, to increase absorption efficiency, a general transfection process known in the art (e.g., electroporation, lipofection, microinjection, etc.) can be additionally performed.
  • exosomes with the target substance inserted therein or exosomes with the nucleic acid inserted therein are administered to an organism
  • the administration may be administered intravascularly, intravenously, intratumorally, orally, transdermally, subcutaneously, or rectally.
  • the germ cells into which the exosomes with the nucleic acid inserted therein are introduced (or treated) by administering (e.g., treating) the exosomes to isolated germ cells, as described above. It can be prepared by transfecting the exosome into the germ cell (by additionally going through the general transfection process known in the art described above).
  • the embryo may specifically be a recipient embryo, but is not limited thereto.
  • the receptor embryo may refer to an embryo at the stage of development when primordial germ cells move along blood vessels.
  • the step of injecting the exosome with the nucleic acid inserted therein or the germ cell into which the exosome is introduced into the embryo (or blood vessel within the embryo) of an animal other than a human is a method known in the art. It can be performed by a common injection method known to the public (e.g., microinjection, etc.).
  • the exosome with the nucleic acid inserted therein when the exosome with the nucleic acid inserted therein is injected into the embryo (or blood vessel within the embryo) of an animal other than human, the exosome transfers the nucleic acid to the germ cells within the embryo.
  • the genes of the germ cells in the embryo are edited by the transferred nucleic acid, and a gene-edited animal can be generated from the gene-edited embryo.
  • the method of producing the gene-edited animal may be a method of producing gene-edited birds.
  • the method of producing the gene-edited algae involves injecting an exosome with the nucleic acid inserted therein or a germ cell into which the exosome is introduced into the embryo (or blood vessel within the embryo) of the bird, and then the nucleic acid is It may further include the step of producing gene-edited birds by culturing and hatching eggs containing exosomes inserted therein or embryos injected with gametes into which the exosomes have been introduced.
  • the step of producing the gene-edited algae can be performed, for example, by sealing the eggs containing the embryos and then culturing them for an appropriate time. Then, the eggs containing the embryos are cultured and hatched, and the receptors that have reached sexual maturity are test-crossed to produce gene-edited birds. Additionally, the step of producing the gene-edited algae can be performed by general methods known in the art. Additionally, gene-edited birds can be identified by, for example, using genomic DNA obtained from blood as a template to check whether the sequence has been edited using PCR (polymerase-chain reaction), real-time PCR, or base sequencing. It can be implemented.
  • the gene-edited animals also include transgenic animals, and the term “gene-edited animal” may be used interchangeably with the term “transgenic animal.”
  • Another aspect provides the use of exosomes with a target substance inserted therein to deliver the target substance to reproductive cells.
  • Another aspect provides the use of exosomes with nucleic acids inserted therein for editing genes in germ cells.
  • Another aspect provides the use of exosomes with a target substance inserted therein to prepare a composition for delivering a target substance to reproductive cells.
  • Another aspect provides the use of exosomes with nucleic acids inserted therein for producing a composition for gene editing in germ cells.
  • exosomes with a target substance e.g., foreign gene, etc.
  • a target substance e.g., foreign gene, etc.
  • exosomes with a target substance inserted therein enable transfer of the target substance and gene editing within germ cells in vitro and in vivo, thereby enabling germ cells such as primordial germ cells from animals. It can be used in a system for producing transgenic or gene-edited animals without the process of isolating and culturing.
  • transgenic or gene-edited animals e.g., transgenic or gene-edited birds
  • exosomes with target substances eg, foreign genes, etc.
  • target substances eg, foreign genes, etc.
  • exosomes with target substances can be used as a delivery vehicle or gene editing tool for therapeutic purposes targeting human reproductive cells.
  • Figure 1 shows the manufacturing process of a complex in which a target substance (e.g., CRISPR/Cas9 expression plasmid DNA) is inserted into a cell-derived exosome according to an embodiment, and the target substance in vitro cultured in gametes and animals using the complex.
  • a target substance e.g., CRISPR/Cas9 expression plasmid DNA
  • Figure 2 is an image showing the results of Cryo-EM imaging on exosomes derived from avian primordial germ cells according to an example.
  • Figure 3 is an image showing the results of western blot analysis on exosomes derived from avian primordial germ cells according to an example.
  • Figure 4 is a diagram showing an image (A) of avian hepatocytes observed under a microscope according to an embodiment and an image (B) of exosomes derived from avian hepatocytes observed by Cryo-EM according to an embodiment.
  • Figure 5 is a graph showing the size distribution of exosomes as a result of NTA analysis on exosomes derived from avian hepatocytes according to an example.
  • Figure 6 shows the results of NTA analysis analyzing the concentration of exosome particles contained in the final concentrate (i.e., total protein including exosomes) obtained by the method of isolating exosomes from avian hepatocytes according to an embodiment. This is a graph that represents
  • Figure 7 is an image showing the results of western blot analysis on exosomes derived from avian hepatocytes according to an example.
  • Figure 8 is a graph showing the results of analyzing the absorption capacity of avian primordial germ cell-derived exosomes (PGC-Exo) and avian hepatocyte-derived exosomes (LMH-Exo) into avian primordial germ cells according to an example (Mock: Untreated group; Dio-labeled PGC-Exo: Group treated with exosomes derived from avian primordial germ cells to which Dio lipophilic dye is attached; Dio-labeled LMH-Exo: Group treated with exosomes derived from avian hepatocytes to which Dio lipophilic dye is attached; x-axis: Fluorescence intensity; y-axis: number of cells).
  • Figure 9 shows a complex in which a target substance (specifically, EGFP expression plasmid DNA) is inserted into an exosome derived from avian primordial germ cells according to an embodiment, is treated with avian primordial germ cells cultured in vitro, and then EGFP is expressed.
  • a target substance specifically, EGFP expression plasmid DNA
  • Figure 10 is a graph showing the results of a numerical analysis of the percentage (%) of avian primordial germ cells expressing EGFP and showing fluorescence, based on the image taken in Figure 9.
  • Figure 11 shows a complex in which a target substance (specifically, EGFP expression plasmid DNA) is inserted inside an avian hepatocyte-derived exosome according to an embodiment, is treated with avian sex axis-derived germ cells cultured in vitro, and then EGFP is expressed to produce fluorescence.
  • a target substance specifically, EGFP expression plasmid DNA
  • N untreated group
  • LIPO group treated with Lipofectamine 2000 (Invitrogen) reagent and target substance
  • EXO target substance inserted inside avian hepatocyte-derived exosomes complex treatment group.
  • Figure 12 is a graph showing the results of numerical analysis of the percentage (%) of avian sex axis-derived germ cells expressing EGFP and showing fluorescence based on the image taken in Figure 11 (NC: untreated group; LIPO: Lipofectamine 2000 ( Invitrogen) group treated with reagent and target substance; EXO: group treated with complex with target substance inserted inside avian hepatocyte-derived exosomes).
  • Figure 13 shows a complex in which a target substance (specifically, CRISPR/Cas9 expression plasmid DNA) is inserted into an exosome derived from avian primordial germ cells according to an example, after treatment with avian primordial germ cells cultured in vitro.
  • Diagram showing the results of gene editing in primordial germ cells A: showing the target site (exon 2 of the Hoxb13 gene) and primer binding site for gene editing in avian primordial germ cells; B: in the target site Shows the result of gene editing (in the Edited sequence of B, the area marked with a line below the sequence refers to the target site, and the area marked with a line through the sequence letters refers to the deleted sequence).
  • Figure 14 shows a complex in which a target substance (specifically, EGFP expression plasmid DNA) is inserted into an exosome derived from avian primordial germ cells according to an embodiment, is injected into the blood vessel of an avian receptor embryo, and then within the gonad of the embryo. This is an image taken of cells expressing EGFP and showing fluorescence.
  • a target substance specifically, EGFP expression plasmid DNA
  • Exosomes were isolated from algal cell culture fluid, and the characteristics of the isolated exosomes were sought to be confirmed.
  • primordial germ cells of birds were cultured in a medium from which serum and antibiotics were removed, and then isolated from the cell culture medium using the ExoQuick ® ULTRA EV Isolation Kit according to the kit manufacturer's instructions. Exosomes were isolated. Specifically, avian primordial germ cells were supplemented with 20% FBS, 2% chicken serum, 1 ⁇ nucleosides, 2 mM l-glutamine, 1 ⁇ nonessential amino acids, ⁇ -mercaptoethanol, 10 mM sodium pyruvate, 1 ⁇ antibiotic-antimycotic, human basic. The cells were cultured in knockout DMEM medium (Gibco) supplemented with fibroblast growth factor (10 ng/ml).
  • the cultured avian primordial germ cells were cultured in a medium without FBS to harvest the cell culture fluid.
  • the cell culture fluid was centrifuged at a speed of 300 xg for 5 minutes, and the supernatant was filtered through a 0.45 ⁇ m filter and a 0.22 ⁇ m filter. Microvesicles were removed by sequential filtration using (Merck Millipore). Afterwards, the supernatant from which the microvesicles were removed was centrifuged using the ExoQuick ® ULTRA EV Isolation Kit (System Biosciences) according to the manufacturer's instructions to obtain a pellet. The obtained pellet was resuspended in PBS, and Amicon Ultra Exosomes isolated from avian primordial germ cells were obtained by concentrating them into pure exosomes using a -15 Centrifugal Filter (100 kDa).
  • avian specifically, chicken hepatocytes (Hepatocellular carcinoma cell line, LMH; Figure 4A) were cultured in Waymouth's Medium (Gibco) supplemented with 10% FBS, and the culture was coated with 0.1% gelatin. It was performed in a culture dish. The cultured avian hepatocytes were cultured in a medium without FBS, and then the cell culture was harvested. The cell culture was centrifuged at a speed of 300 ) were sequentially filtered to remove microvesicles.
  • Waymouth's Medium Gibco
  • the supernatant from which the microvesicles were removed was centrifuged using ExoQuick-TCTM Exosome Precipitation Solution (System Biosciences) according to the manufacturer's instructions to obtain a pellet, and the obtained pellet was resuspended in PBS and Amicon Exosomes isolated from avian hepatocytes were obtained by concentrating them into pure exosomes using an Ultra-15 Centrifugal Filter (100 kDa).
  • Cryogenic Electron Microscopy (Cryo-EM) imaging was performed to confirm the shape and size of exosomes derived from isolated avian primordial germ cells, and western blot analysis was performed using exosome-specific markers to determine the characteristics of isolated exosomes. was confirmed.
  • Cryogenic Electron Microscopy (Cryo-EM) imaging was performed on the isolated avian hepatocyte-derived exosomes to confirm the shape and size of the exosomes, and Nanoparticle Tracking Analysis (NTA) analysis was performed to determine the size distribution and size of the exosomes. The concentration was confirmed, and western blot analysis using exosome-specific markers was performed to confirm the characteristics of the isolated exosomes.
  • exosomes isolated from avian primordial germ cells have a phospholipid bilayer that is the same or similar to the structure of the cell membrane and have a diameter of about 50 to 150 nm or about 80 to 120 nm in length. (Specifically, about 100 nm) ( Figure 2), and was confirmed to contain Beta ( ⁇ )-actin (ACTB) protein and CD9 protein ( Figure 3).
  • ACTB Beta ( ⁇ )-actin
  • exosomes isolated from avian hepatocytes have a phospholipid bilayer that is the same or similar to the structure of the cell membrane (Figure 4B), and have a diameter of about 50 to 250 nm and a length of about 50 nm. 60 to 200 nm, about 70 to 150 nm, about 80 to 130 nm, or about 90 to 110 nm ( Figure 5), and the final concentrate obtained by the method of isolating exosomes from avian hepatocytes described above (i.e.
  • exosome particles total proteins including exosomes
  • concentration of exosome particles is approximately 6x10 7 particles/ ⁇ g protein (Figure 6), including CD81 (Cluster of Differentiation 81) protein and Hsp70 (70 kilodalton heat shock proteins) protein. This was confirmed ( Figure 7).
  • Dio lipophilic dye a green fluorescent dye
  • Dio lipophilic dye a green fluorescent dye
  • Cultured avian (chicken) primordial germ cells were treated and cultured for 3 hours. Afterwards, the uptake of each of the two types of exosomes into avian (chicken) primordial germ cells was confirmed through flow cytometry. Additionally, avian (chicken) primordial germ cells that were not treated with exosomes were used as a control (Mock).
  • a fluorescence intensity range (fluorescence intensity section indicated by a bar in the center of the graph in Figure 8) in which the proportion of fluorescence-expressing cells is 0% was derived, and the Dio lipophilic dye attached
  • the fluorescence intensity of the avian (chicken) primordial germ cells showing fluorescence within the range derived above was measured, and the ratio of each of the two types of exosomes was measured.
  • the absorption capacity into avian (chicken) primordial germ cells was analyzed (see Figure 8).
  • exosomes derived from avian cells such as avian primordial germ cells, hepatocytes, etc.
  • animal e.g., avian
  • target substances e.g., foreign genes, etc.
  • a complex was prepared in which the target substance (specifically, plasmid DNA) was inserted into the avian cell-derived exosome.
  • the term “complex” used herein refers to an exosome in which the target substance is inserted into the exosome.
  • ExofectTM solution System Biosciences
  • exosomes derived from avian primordial germ cells or exosomes derived from avian hepatocytes prepared in Example 1 plasmid DNA expressing the target substance EGFP (Enhanced green fluorescent protein), and PBS.
  • ExofectTM solution was mixed according to the manufacturer's instructions and incubated at 37°C for 10 minutes to obtain a complex with EGFP expression plasmid DNA inserted inside avian primordial germ cell-derived exosomes or avian hepatocyte-derived exosomes.
  • ExofectTM solution System Biosciences
  • exosomes derived from avian primordial germ cells or exosomes derived from avian hepatocytes prepared in Example 1 CRISPR/Cas9 expression plasmid DNA as the target material, and PBS from the manufacturer of the ExofectTM solution.
  • the mixture was incubated at 37°C for 10 minutes to obtain a complex in which CRISPR/Cas9 expression plasmid DNA was inserted inside exosomes derived from avian primordial germ cells or exosomes derived from avian hepatocytes.
  • the CRISPR/Cas9 expression plasmid DNA expresses the CRISPR/Cas9 system (guide RNA and Cas9 protein) targeting exon 2 of the Hoxb13 gene and includes the base sequence of SEQ ID NO: 1. That is, the CRISPR/Cas9 expression plasmid DNA includes a base sequence (SEQ ID NO: 2) encoding a guide RNA targeting exon 2 of the Hoxb13 gene and a base sequence (SEQ ID NO: 3) encoding the Cas9 protein.
  • Example 4 Confirmation of the effect of the complex of avian cell-derived exosomes and target substances on delivery of the target substance to animal germ cells
  • the effect of the complex inserting the target substance (specifically, plasmid DNA) inside the avian cell-derived exosome into the germ cells of an animal (e.g., avian) cultured in vitro was confirmed.
  • the complex in which the target substance, EGFP expression plasmid DNA was inserted inside the avian primordial germ cell-derived exosome prepared in Example 3 at a concentration of about 15 ⁇ g/2x10 5 cells or about 30 ⁇ g/2x10 5 cells.
  • 2 days after treatment with in vitro cultured avian (chicken) primordial germ cells cells expressing EGFP were observed under a fluorescence microscope, and EGFP was detected among all cells treated with the exosome complex through flow cytometry. The proportion of expressing cells was measured.
  • the complex in which the target substance, EGFP expression plasmid DNA, was inserted into the avian hepatocyte-derived exosome prepared in Example 3 was about 1 ⁇ g/1x10 5 cells, about 5 ⁇ g/1x10 5 cells, or about 10 ⁇ g/
  • avian (chicken) sex axis-derived germ cells specifically, spermatogonial stem cells
  • cells expressing EGFP were observed under a fluorescence microscope 4 days later.
  • the proportion of cells expressing EGFP among all cells treated with the exosome complex was measured through flow cytometry.
  • avian (chicken) sex axis-derived germ cells (NC) that were not treated with the exosome complex
  • avian (chicken) sex axis-derived germ cells (LIPO) treated with EGFP expression plasmid DNA together with Lipofectamine 2000 (Invitrogen) reagent were used as controls. It was used as.
  • the Lipofectamine 2000 (Invitrogen) reagent is a transfection reagent commonly used in the art, and functions to liposome the target substance (nucleic acid) and deliver it into cells. Therefore, in delivering the target substance (eg, plasmid DNA) into germ cells, it was found that the liposome method most commonly used in the art has a significantly low delivery efficiency.
  • a complex in which a target substance (e.g., a foreign gene) is inserted inside an avian cell-derived exosome can deliver the target substance (e.g., a foreign gene) to animal (e.g., avian) reproductive cells with high efficiency.
  • a complex with a foreign gene inserted inside an avian cell-derived exosome can deliver the foreign gene to animal (e.g., avian) germ cells with significantly higher efficiency than the existing liposome method, thereby delivering the foreign gene to the germ cells. It was found that the problems of existing technology, which had limitations, could be resolved.
  • a target substance e.g., CRISPR/Cas9 expression plasmid DNA
  • avian cell-derived exosome was confirmed in in vitro cultured animal (e.g., avian) germ cells.
  • the target substance guide RNA targeting exon 2 of the Hoxb13 gene ( Figure 13A) and Cas9 protein
  • Figure 13A guide RNA targeting exon 2 of the Hoxb13 gene
  • Figure 13A the target substance
  • Cas9 protein a CRISPR/Cas9 expression plasmid expressing the target substance (guide RNA targeting exon 2 of the Hoxb13 gene ( Figure 13A) and Cas9 protein) inside the avian primordial germ cell-derived exosome prepared in Example 3.
  • Two days after the complex into which DNA) was inserted was treated with in vitro cultured avian (chicken) primordial germ cells, genomic DNA was extracted from the cells treated with the exosome complex to check whether gene editing had occurred.
  • primers were designed that bind to intron 1 and exon 2 of the Hoxb13 gene, respectively (Forward primer: CCTCACGTTGGTGGTCGTTA (SEQ ID NO: 4); Reverse primer: CACCCTCCTGTTCTGGAACC (SEQ ID NO: 5); Figure 13A). After performing PCR on the extracted genomic DNA using the primers, the amplified PCR product was inserted into a T vector and analyzed for gene editing through DNA sequencing.
  • a complex containing CRISPR/Cas9 expression plasmid DNA inserted inside avian cell-derived exosomes can edit target genes in animal (e.g., avian) germ cells with high efficiency.
  • Example 6 Confirmation of the effect of the complex of avian cell-derived exosomes and target substances on delivery of the target substance to animal germ cells in vivo
  • the target substance EGFP
  • EGFP avian primordial germ cell-derived exosome prepared in Example 3 above.
  • the complex containing the expression plasmid DNA was injected into the blood vessel of the receptor embryo through microinjection. Then, 3 to 4 days later, gonad tissue was harvested from the receptor embryo, and fluorescent cells in the gonad tissue were confirmed under a fluorescence microscope.
  • a complex in which a target substance (e.g., a foreign gene) is inserted inside an avian cell-derived exosome can deliver the target substance to reproductive cells in an animal (e.g., bird) body (e.g., embryo) with high efficiency. It was confirmed that gene editing is possible in germ cells within an animal (e.g., bird) living organism (e.g., embryo).
  • the complex in which the target substance (e.g., foreign gene) is inserted into the avian cell-derived exosome is directly injected into the animal (e.g., bird) body (e.g., embryo), thereby producing the target substance in the germ cells of the animal body.
  • transgenic or gene-edited animals e.g., transgenic or gene-edited birds
  • germ cells such as primordial germ cells from animals. I could see that it was there.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Environmental Sciences (AREA)
  • Animal Husbandry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Cell Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Veterinary Medicine (AREA)

Abstract

본 출원은 엑소좀을 이용한 생식세포 내 물질 전달 및 유전자 편집 시스템에 관한 것으로, 일 양상에 따른 목적 물질 (예컨대, 외래 유전자 등)이 내부에 삽입된 엑소좀은, 생체 외 및 생체 내의 생식세포 내 목적 물질 전달 및 유전자 편집을 가능하게 하므로, 동물로부터 원시생식세포 등의 생식세포를 분리하고 배양하는 과정 없이 형질전환 또는 유전자 편집 동물을 제조하기 위한 시스템에 활용될 수 있다.

Description

엑소좀을 이용한 생식세포 내 물질 전달 및 유전자 편집 시스템
본 발명은 엑소좀을 이용한 생식세포 내 물질 전달 및 유전자 편집 시스템에 관한 것으로, 본 특허출원은 2022년 08월 19일에 대한민국 특허청에 제출된 대한민국 특허출원 제10-2022-0104274호에 대하여 우선권을 주장하며, 상기 특허출원의 개시 사항은 본 명세서에 참조로서 삽입된다.
생식세포는 유전정보를 다음 세대로 전달할 수 있는 중요한 세포 자원이다. 특히 원시생식세포는 생식세포의 발달 및 분화를 연구하는 기초 연구뿐만 아니라 난임 연구, 생식세포 유래 질병 연구 등의 의학적 기초 연구 등을 수행 할 수 있는 유용한 자원이며, 국가 생명 자원 및 멸종 위기 종의 보존 및 복원을 위한 유전자원으로써 중요한 가치를 지닌다. 특히, 최근에는 급속도로 발전하고 있는 생명공학 기술이 조류의 생식세포에 적용되어 변화하는 서식지에 적응할 수 있는 질병 저항성 모델, 열 저항성 모델과 같은 유전자 편집 조류들이 개발되고 있다. 그러나, 대부분 조류 종의 경우 원시생식세포 등의 생식세포의 분리 및 배양 조건이 확립되어 있지 않아 충분한 세포 자원을 확보하기 어려워 연구 및 활용에 제한이 있고, 조류 생식세포는 특히 비교적 트렌스펙션이 어려운 세포로 알려져 있다. 대한민국 공개특허공보 제10-2012-0054119호는 생식세포 특이적 유전자 발현 조절 서열을 이용한 형질전화 조류 생산에 관한 것으로 NANOG 프로모터 또는 DAZL 프로모터-목적 단백질 코딩 서열을 포함하는 렌티바이러스 벡터를 체외 배양된 조류 원시생식세포에 트렌스펙션시키는 것을 개시하고 있으나, 트렌스펙션 효율은 낮은 수준이다. 이에 따라 원시생식세포 등의 생식세포의 분리 및 배양 없이 생식세포로 외래 유전자를 트렌스펙션시켜 형질전환 조류를 생산하기 위해 리포좀 또는 바이러스 매개의 생체 내 유전자 편집이 시도되었으나 이 또한 효율이 매우 낮아 새로운 방법의 개발이 요구되고 있다.
한편, 세포에서 분비되는 나노입자 크기의 물질 중 하나인 엑소좀은 특정 세포의 정보를 다른 세포에 전달하는 전달체로서 우수한 세포 흡수 효과를 가진다. 다만, 엑소좀을 이용한 생체 외 및 생체 내의 생식계열 세포 내 외래 물질 전달 및 유전자 편집, 및 이를 이용한 유전자 편집 동물의 개발에 대한 연구는 거의 이루어지지 않고 있는 실정이다.
상기한 바와 같은 문제를 해결하기 위하여, 본 발명자들은 조류 세포로부터 엑소좀을 분리하여 생체 내 유전자 편집 시스템 개발에 활용하고자 하였고, 그 결과, 상기 엑소좀을 이용하는 경우, 생체 외 및 생체 내의 생식세포 내로 목적 물질 (예컨대, 외래 유전자 등)을 고효율로 전달하여, 생체 외 및 생체 내의 생식세포의 유전자를 고효율로 편집할 수 있음을 확인하였다. 또한, 이로 인해, 상기 엑소좀은, 동물로부터 원시생식세포 등의 생식세포의 분리 및 배양 없이 형질전환 또는 유전자 편집 동물을 개발하는데 유용하게 활용될 수 있음을 확인하였다.
본 발명의 일 목적은 목적 물질이 내부에 삽입되어 있는 엑소좀을 포함하는 생식세포로의 목적 물질 전달용 조성물을 제공하고자 한다.
본 발명의 다른 목적은 핵산이 내부에 삽입되어 있는 엑소좀을 포함하는 생식세포 내 유전자 편집용 조성물을 제공하고자 한다.
본 발명의 또 다른 목적은 목적 물질이 내부에 삽입되어 있는 엑소좀을 이용하는 생식세포로 목적 물질을 전달하는 방법을 제공하고자 한다.
본 발명의 또 다른 목적은 핵산이 내부에 삽입되어 있는 엑소좀을 이용하는 생식세포의 유전자를 편집하는 방법을 제공하고자 한다.
본 발명의 또 다른 목적은 핵산이 내부에 삽입되어 있는 엑소좀 또는 상기 엑소좀이 도입된 생식세포를 이용하는 유전자 편집 동물을 제조하는 방법을 제공하고자 한다.
본 발명의 또 다른 목적은 생식세포로 목적 물질을 전달하기 위한 목적 물질이 내부에 삽입되어 있는 엑소좀의 용도를 제공하고자 한다.
본 발명의 또 다른 목적은 생식세포 내 유전자를 편집하기 위한 핵산이 내부에 삽입되어 있는 엑소좀의 용도를 제공하고자 한다.
본 발명의 또 다른 목적은 생식세포로의 목적 물질 전달용 조성물을 제조하기 위한 목적 물질이 내부에 삽입되어 있는 엑소좀의 용도를 제공하고자 한다.
본 발명의 또 다른 목적은 생식세포 내 유전자 편집용 조성물을 제조하기 위한 핵산이 내부에 삽입되어 있는 엑소좀의 용도를 제공하고자 한다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술 분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로 본 명세서에서 사용된 명명법은 본 기술 분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
일 양상은 목적 물질이 내부에 삽입되어 있는 엑소좀 (exosome)을 포함하는 생식세포로의 목적 물질 전달용 조성물를 제공한다.
상기 엑소좀은 세포로부터 분리되거나 단리된 세포 유래 엑소좀일 수 있다. 상기 세포 유래 엑소좀은 내재적 (endogenous) 엑소좀일 수 있다.
상기 엑소좀은 인간 또는 인간을 제외한 동물의 세포로부터 분리된 것일 수 있다. 상기 인간을 제외한 동물은 포유류, 조류, 파충류, 양서류, 어류 등을 포함할 수 있고, 이에 제한되지 않는다. 바람직하게는, 상기 엑소좀은 조류 세포로부터 분리된 것일 수 있다. 상기 조류는 닭, 오리, 거위, 메추리, 꿩, 또는 칠면조 등을 포함할 수 있고, 이에 제한되지 않는다.
상기 엑소좀은 인간 또는 인간을 제외한 동물의 줄기세포, 체세포, 생식세포, 또는 암세포로부터 분리된 것일 수 있다. 바람직하게는, 상기 엑소좀은 조류의 줄기세포, 체세포, 생식세포, 또는 암세포로부터 분리된 것일 수 있다.
상기 줄기세포는 배아 (또는 배자) 줄기세포, 성체 줄기세포, 또는 유도만능 줄기세포 (iPS)를 포함할 수 있다. 구체적으로, 상기 줄기세포는 전능 (totipotency) 줄기세포, 만능 (pluripotency) 줄기세포, 다능 (multipotent) 줄기세포, 협능 (oligopotent) 줄기세포, 이분화성 (bipotent) 줄기세포, 또는 단일 분화성 (unipotent) 줄기세포 등을 포함할 수 있고, 이에 제한되는 것은 아니다.
상기 체세포는 혈관내피 세포, 백혈구, 면역세포, 상피세포, 섬유아세포, 근육세포, 골수세포, 표피세포, 골아세포, 간세포, 심장세포, 소장세포, 대장세포, 췌장세포, 또는 신경세포 등을 포함할 수 있고, 이에 제한되는 것은 아니다.
용어 "생식세포 (germ cells)"는 생식에 참여하는 세포로 유성생식으로 번식하는 생물의 배우자인 정자와 난자 및 이들을 발생시키는 모든 단계에 있는 조상 세포들을 포함한다. 상기 생식세포는 원시생식세포, 정원줄기세포, 난원줄기세포, 정원세포, 난원세포, 정모세포, 난모세포, 정세포, 난포세포, 정자, 또는 난자 등을 포함할 수 있고, 이에 제한되는 것은 아니다.
상기 암세포는 유방암, 폐암, 뇌척수종양, 두경부암, 흉선종, 중피종, 식도암, 위암, 대장암, 간암, 췌장암, 담도암, 신장암, 방광암, 전립선암, 고환암, 생식세포종, 난소암, 자궁 경부암, 자궁 내막암, 림프종, 급성 백혈병, 만성 백혈병, 다발성 골수종, 육종, 악성 흑색종, 및 피부암으로 이루어진 군으로부터 선택된 암으로부터 유래된 세포일 수 있으나, 이에 제한되지 않고, 바람직하게는, 상기 암세포는 간암세포일 수 있다.
일 구체예에 따르면, 상기 엑소좀은 인간 또는 인간을 제외한 동물의 원시생식세포 (primordial germ cell) 또는 간세포 (hepatocyte)로부터 분리된 것일 수 있다. 바람직하게는, 상기 엑소좀은 조류의 원시생식세포 또는 간세포로부터 분리된 것일 수 있다.
용어 "원시생식세포 (primordial germ cells)"는 개체 발생의 초기에 일반 체세포에서 갈라져 장래 생식세포가 되기 위해 분화하는 세포를 의미한다. 일 구체예에 따르면, 상기 원시생식세포는 동물 (예컨대, 조류)의 생식반월 (germinal crescent), 혈액, 원시 생식기, 또는 배자 (embryo)로부터 분리된 것일 수 있으나, 이에 제한되는 것은 아니다.
용어 "간세포 (hepatocyte)"는 간을 구성하는 구성세포를 의미한다. 일 구체예에 따르면, 상기 간세포는 간암세포 (Hepatocellular carcinoma cell)일 수 있으나, 이에 제한되는 것은 아니다.
상기 엑소좀은 막 구조의 작은 소낭의 형태를 가질 수 있다. 상기 엑소좀은 약 50 내지 250 nm의 직경을 가지는 것일 수 있다. 구체적으로, 상기 엑소좀은 약 50 내지 200 nm, 약 50 내지 150 nm, 약 60 내지 200 nm, 약 60 내지 150 nm, 약 70 내지 200 nm, 약 70 내지 150 nm, 약 80 내지 200 nm, 약 80 내지 150 nm, 약 80 내지 130 nm, 약 80 내지 120 nm, 약 90 내지 200 nm, 약 90 내지 150 nm, 약 90 내지 130 nm, 약 90 내지 120 nm, 또는 약 90 내지 110 nm의 직경을 가지는 것일 수 있다. 일 구체예에 따르면, 상기 엑소좀의 직경이 상기 수치범위를 벗어나는 경우, 엑소좀 내부로 목적 물질의 삽입 효율, 엑소좀의 생식세포 내로의 트렌스펙션 (즉, 도입) 효율, 엑소좀의 생식세포 내로의 목적 물질 전달 효율, 또는 엑소좀의 생식세포 내 유전자 편집 효율이 저하될 수 있다.
상기 엑소좀은 Beta (β)-actin (ACTB) 단백질, CD9 단백질, CD81 (Cluster of Differentiation 81) 단백질, 및 Hsp70 (70 kilodalton heat shock proteins) 단백질로 구성된 군으로부터 선택된 하나 이상의 단백질을 포함 또는 발현하는 것일 수 있다. 일 구체예에 따르면, 상기 엑소좀은 상기 단백질을 포함 또는 발현함으로써, 우수한 생식세포 (예컨대, 조류의 생식세포) 내 목적 물질 전달 또는 유전자 편집 효과를 나타내는 것일 수 있다.
상기 목적 물질이 내부에 삽입되어 있는 엑소좀에 있어서, 상기 목적 물질은 생식세포 내로 전달하고자 하는 물질을 의미하고, 구체적으로는, 세포 생리 활성 조절 물질일 수 있으며, 특별히 제한되지 않는다.
용어, "세포 생리 활성 조절 물질 (cell-bioactivity modulator)"은 세포에 작용하여, 생물학적 반응을 조절하며, 생리 작용에 영향을 주는 활성 물질을 지칭한다.
예컨대, 상기 목적 물질은, 핵산, 단백질, 항체, 및 약물로 구성된 군으로부터 선택된 하나 이상을 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다. 상기 목적 물질이 핵산인 경우, 상기 핵산은, 세포 내로 전달되어 세포 내에서 발현되는 것을 목적으로 하는 유전자를 포함할 수 있다. 구체적으로, 상기 핵산은 DNA, RNA 등의 유전자, 또는 상기 유전자를 포함하는 플라스미드 또는 벡터의 형태를 가지는 것일 수 있다. 상기 플라스미드 또는 벡터는 세포 내로 전달하고자 하는 유전자가 세포 내에서 발현될 수 있도록 하는 발현 조절 요소 또는 발현 카세트를 더 포함할 수 있다. 예컨대, 상기 플라스미드 또는 벡터는, 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 코딩하는 서열, 전사 및 해독의 종결을 조절하는 서열, 상기 플라스미드 또는 벡터를 함유하는 세포를 선택하기 위한 하나 이상의 선택 마커, 복제원점, 제한효소 부위 (예컨대, 다중 클로닝 부위) 등을 포함할 수 있다. 상기 플라스미드 또는 벡터는, 세포 내에서 세포 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수도 있다.
일 구체예에 따르면, 상기 목적 물질은 세포 내 유전자 조절 물질일 수 있다. 구체적으로, 상기 세포 내 유전자 조절 물질은, 세포 내에서 유전자 중 일부를 삭제 또는 치환하거나, 세포 내 유전체에 외래 유전자를 삽입하거나, 세포 내 유전자를 분해 또는 변형하거나, 세포 내 유전자의 발현을 조절하는 등, 세포 내에서 유전자를 편집, 조작, 교정, 재배열, 조절, 변형, 분해, 또는 재조합할 수 있는 물질이라면, 제한없이 사용될 수 있다.
예컨대, 상기 목적 물질은 CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) 뉴클레아제 시스템에 이용되는 구성 성분을 포함하는 것일 수 있다. 상기 CRISPR 뉴클레아제 시스템은 RNA-가이드 뉴클레아제 (RNA-guided nuclease, RGEN) 또는 CRISPR/Cas 시스템으로도 불릴 수 있다. 상기 CRISPR/Cas 시스템은 CRISPR/Cpf1 시스템을 포함할 수 있다. 상기 Cas (CRISPR associated) 뉴클레아제는 CRISPR/Cas 시스템에 이용되는 Cas 단백질을 말한다. 상기 Cas 뉴클레아제는 가이드 RNA (guide RNA)와 복합체를 형성할 때 엔도뉴클레아제로서 표적 핵산의 절단, 삽입, 또는 이들의 조합을 유도할 수 있다.
일 구체예에 따르면, 상기 CRISPR 뉴클레아제 시스템에 이용되는 구성 성분은, Cas 단백질, 가이드 RNA, 상기 Cas 단백질 및/또는 상기 가이드 RNA를 암호화하는 핵산 (예컨대, DNA), 및 상기 핵산을 포함하는 플라스미드 또는 벡터로 구성된 군으로부터 선택되는 하나 이상을 포함할 수 있다. 예컨대, 상기 플라스미드 또는 벡터는, 상기 Cas 단백질을 암호화하는 핵산 및 상기 가이드 RNA를 암호화하는 핵산을 각각 포함하는 2종 이상의 플라스미드 또는 벡터이거나, 하나의 플라스미드 또는 벡터에 상기 Cas 단백질을 암호화하는 핵산 및 상기 가이드 RNA를 암호화하는 핵산을 모두 포함하는 플라스미드 또는 벡터일 수 있다.
용어, "Cas 단백질"은 CRISPR 뉴클레아제 시스템을 구성하는 단백질로서, 이용하고자 하는 특정 뉴클레오티드 서열을 인식하여 절단하고 편집할 수 있는 단백질을 지칭한다. 구체적으로, 상기 Cas 단백질은 게놈의 목적 장소에 특정 유전자를 삽입하거나 특정 유전자의 활동을 정지시키는 등의 유전자 조작이 가능한 유전자 가위 역할을 하는 단백질일 수 있다. 각각의 야생형 Cas 단백질은 하나 이상의 폴리뉴클레오티드 (가장 전형적으로 가이드 RNA)와 상호작용하여 Cas 단백질-RNA 혼성체를 형성할 수 있다.
상기 Cas 단백질은 Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, 또는 이의 상동체 또는 변형물일 수 있으나, 이에 제한되지 않는 CRISPR-연합 단백질을 지칭할 수 있다.
일 구체예에 따르면, 상기 Cas 단백질은 Cas9 단백질 (CRISPR associated protein 9)일 수 있다. 상기 Cas9 단백질은 Cas9 기능과 관련된 서열을 최소 서열로 포함하며 다른 서열을 추가적으로 포함할 수 있고, 바람직하게는 당업계에 공지된 서열로 구성될 수 있다.
용어, "가이드 RNA (guide RNA)"는 표적 DNA 특이적인 RNA (예컨대, DNA의 표적 부위와 혼성화 가능한 RNA)를 의미하고, Cas 단백질과 혼성체를 형성할 수 있고, Cas 단백질을 표적 DNA에 가져오는 RNA를 지칭한다.
상기 가이드 RNA는, 목적하는 유전자 교정을 위하여, 두 개의 가이드 RNA, 즉, 유전자의 표적 부위와 혼성화 가능한 뉴클레오티드 서열을 갖는 CRISPR RNA (crRNA)와 추가적인 trans-activating crRNA (tracrRNA)를 포함할 수 있고, crRNA와 tracrRNA가 부분적으로 결합된 crRNA-tracrRNA 복합체인 이중 가이드 RNA (dual guide RNA) 형태, 또는 상기 이중 가이드 RNA처럼 crRNA-tracrRNA 복합체를 형성하면서 동시에 crRNA의 말단과 tracrRNA의 말단이 연결된 단일 가이드 RNA (single guide RNA: sgRNA)의 형태일 수 있다.
상기 가이드 RNA는 표적 유전자와 상보적인 염기서열을 가지는 것으로, 표적 유전자에 따라 다양한 가이드 RNA가 사용될 수 있다.
상기 엑소좀은 상기 목적 물질이 엑소좀 내부에 삽입되어 있는 것일 수 있다. 본 명세서에서 상기 삽입은 봉입, 도입, 형질감염, 또는 형질도입의 용어와 상호교환적으로 사용될 수 있다.
상기 엑소좀 내부에 상기 목적 물질을 삽입하기 위한 방법은 당업계에 공지된 방법에 따라 수행될 수 있다. 예컨대, 전기천공법 (electroporation), 리포펙션 (lipofection), 또는 미량주입 (microinjection) 등의 방법에 따라 상기 엑소좀 내부에 상기 목적 물질이 삽입될 수 있으나, 이에 제한되지 않는다.
일 구체예에 따르면, 상기 목적 물질이 내부에 삽입되어 있는 상기 엑소좀은, 생식세포 내로 상기 목적 물질을 고효율로 전달할 수 있다. 따라서, 상기 목적 물질이 내부에 삽입되어 있는 상기 엑소좀은, 생식세포로 상기 목적 물질을 전달하기 위한 용도를 가진다.
수여자 세포인 상기 생식세포는 인간 또는 인간을 제외한 동물의 생식세포일 수 있고, 구체적으로는, 상기 생식세포는 원시생식세포, 정원줄기세포, 난원줄기세포, 정원세포, 난원세포, 정모세포, 난모세포, 정세포, 난포세포, 정자, 난자, 또는 이들의 조합일 수 있으나, 이에 제한되지 않는다. 상기 인간을 제외한 동물은 포유류, 조류, 파충류, 양서류, 어류 등을 포함할 수 있으나, 이에 제한되지 않고, 상기 조류는 닭, 오리, 거위, 메추리, 꿩, 또는 칠면조 등을 포함할 수 있고, 이에 제한되지 않는다.
용어, "수여자 세포"는 상기 목적 물질 (예컨대, 핵산)이 내부에 삽입되어 있는 엑소좀이 도입되는 세포로서, 상기 목적 물질 (예컨대, 핵산)을 세포 내로 전달받거나, 이로 인해 유전자 편집되는 세포를 의미할 수 있다.
수여자 세포인 상기 생식세포는, 시험관 내 (in vitro), 생체 외 (ex vivo), 또는 생체 내 (in vivo)의 생식세포일 수 있다. 일 구체예에 따르면, 상기 목적 물질이 내부에 삽입되어 있는 상기 엑소좀은, 시험관 내 또는 생체 외에 존재하는 분리된 생식세포 내로 상기 목적 물질을 고효율로 전달할 수 있을 뿐만 아니라 생체 내로 주입되는 것에 의해 생체 내에 존재하는 생식세포로도 상기 목적 물질을 고효율로 전달할 수 있다.
또한 일 구체예에 따르면, 수여자 세포인 상기 시험관 내 또는 생체 외의 생식세포는, 배아 (또는 배자)로부터 분리된 생식세포 (예컨대, 원시생식세포)이거나 성체 (인간 또는 인간을 제외한 동물 (성축))로부터 분리된 생식세포 (예컨대, 정원줄기세포, 난원줄기세포, 정원세포, 난원세포, 정모세포, 난모세포, 정세포, 난포세포, 정자, 또는 난자 등)일 수 있고, 이에 제한되지 않는다.
용어, "성체"는 개체발생이 완성되어 생식이 가능하게 된 개체 (인간 또는 인간을 제외한 동물)를 의미하고, 상기 개체가 인간을 제외한 동물인 경우 상기 성체는 “성축”으로 불려질 수 있다.
또한 일 구체예에 따르면, 수여자 세포인 상기 생체 내의 생식세포는, 배아 (또는 배자) (embryo) 또는 성체 (또는 성축) 내의 생식세포일 수 있다. 구체적으로는, 수여자 세포인 상기 생체 내의 생식세포는, 배아 (또는 배자) 또는 성체 (또는 성축)의 생식선 내의 생식세포일 수 있다. 상기 배아 (또는 배자)는 갓 수정된 수정란, 발생 초기 배아, 또는 수용체 배자 (recipient embryo)를 포함하고, 이에 제한되는 것은 아니다.
다른 양상은 핵산이 내부에 삽입되어 있는 엑소좀을 포함하는 생식세포 내 유전자 편집용 조성물을 제공한다.
상기 핵산은 유전자 편집에 이용되는 핵산일 수 있다. 구체적으로, 상기 핵산은 CRISPR 뉴클레아제 시스템에 이용되는 구성 성분을 포함하는 것일 수 있다.
상기 엑소좀, 핵산, 삽입, CRISPR 뉴클레아제 시스템에 이용되는 구성 성분, 및 유전자 편집의 대상이 되는 생식세포 (즉, 수여자 세포인 생식세포)는 상술한 바와 같다.
일 구체예에 따르면, 상기 핵산이 내부에 삽입되어 있는 엑소좀에 있어서, 상기 핵산이 특정한 유전자를 표적하는 상기 CRISPR 뉴클레아제 시스템에 이용되는 구성 성분인 경우, 상기 엑소좀은, 상기 CRISPR 뉴클레아제 시스템에 이용되는 구성 성분을 생체 외 또는 생체 내의 생식세포 내로 전달할 수 있고, 상기 생식세포 내로 전달된 상기 CRISPR 뉴클레아제 시스템에 이용되는 구성 성분은 상기 생식세포 내 표적 유전자를 편집할 수 있다 (도 1). 즉, 상기 핵산이 내부에 삽입되어 있는 엑소좀은 생체 외 또는 생체 내의 생식세포 내 유전자를 고효율로 편집할 수 있다. 따라서, 상기 핵산이 내부에 삽입되어 있는 엑소좀은 생체 외 또는 생체 내의 생식세포 내 유전자를 편집하기 위한 용도를 가진다.
용어, "유전자 편집"은 유전자를 재배합하거나, 돌연변이를 일으켜서 유전자의 성질을 바꾸어 놓는 일을 총칭하고, 구체적으로는, 유전자 조작 기술을 총칭한다. 상세하게는, 생물의 유전체에서 특정 유전자 (예컨대, 표적 유전자)를 편집하는 것으로, 특정 염기 또는 염기서열을 인식하여 절단하고, 그 부위에 새로운 염기 또는 염기서열을 더하거나 기존의 염기 또는 염기서열을 빼거나 교체하는 방법 (즉, 유전자의 결실, 삽입, 대체, 또는 변형하는 유전자 조작 방법)으로 특정 유전자를 편집하는 것을 의미할 수 있다. 또한 생물의 유전체에서 특정 유전자 (예컨대, 표적 유전자)를 편집하는 것에 의해서 기존 유전체의 특정 부위에서 수정 또는 변경이 발생하는 것이므로, 용어 "유전자 편집"은 용어 “유전체 편집”과 상호교환적으로 사용될 수 있다.
또한 용어, "유전자 편집"은 특정 유전자를 편집하는 의미 뿐만 아니라, 재조합 유전자 기술 등을 이용하여 외래 유전자를 삽입하거나 기존의 유전자를 삭제 또는 변형시키는 유전자 조절, 유전자 조작, 유전자 교정, 유전자 재배열, 유전자 재조합 등의 의미를 모두 포함하며, 본 명세서에서 상기 용어들과 상호교환적으로 사용될 수 있다.
일 구체예에 따르면, 상기 목적 물질 (예컨대, 핵산)이 내부에 삽입되어 있는 엑소좀은, 상기 엑소좀이 조류의 세포 (구체적으로, 조류의 체세포 (예컨대, 간세포) 또는 생식세포 (예컨대, 원시생식세포))로부터 분리된 엑소좀인 경우, 상기 엑소좀이 다른 세포 유래 엑소좀인 경우 대비 더욱 우수한 효율로 생식세포로 목적 물질을 전달하거나, 더욱 우수한 효율로 생식세포 내 유전자를 편집할 수 있다.
상기 조성물은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 대상체에게 투여하기에 적절한 조성물로 제조될 수 있다. 구체적으로 상기 조성물은 약학적으로 허용가능한 캐리어를 포함할 수 있다. 상기 약학적으로 허용가능한 캐리어에는 생리학적으로 양립될 수 있는 임의의 모든 용매, 분산매질, 코팅, 항박테리아제 및 항진균제, 등장성 및 흡수 지연 제제 등이 포함된다. 상기 약학적으로 허용가능한 캐리어의 예에는 하나 이상의 물, 염류액, 인산완충식염수, 덱스트로스, 글리세롤, 에탄올 등 뿐만 아니라 이들의 조합이 포함된다. 또한 상기 조성물은 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화 됨으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
또한 상기 조성물을 개체에 투여하는 방식으로 사용하는 경우, 상기 조성물은 예를 들면, 경구 투여 제형 (예, 분말, 정제, 캡슐, 시럽, 알약, 또는 과립), 또는 비경구 제형 (예, 주사제)으로 제형화될 수 있다. 또한, 상기 조성물은 전신 제형 또는 국부 제형으로 제조될 수 있다.
상기 조성물은 일 양상에 따른 목적 물질 (예컨대, 핵산)이 내부에 삽입되어 있는 엑소좀을 유효한 양으로 포함할 수 있다. 용어 "유효한 양"은 상기 목적 물질이 투여되는 세포 또는 개체에게 상기 목적 물질의 효과 (예컨대, 예방 또는 치료, 또는 유전자 편집 효과)를 나타내기에 충분한 양을 말한다. 상기 유효한 양은 당업자가 선택되는 세포 또는 개체에 따라 적절하게 선택할 수 있다. 예를 들어, 질환의 중증도, 개체의 연령, 체중, 건강, 성별, 개체의 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료 기간, 사용된 조성물과 배합 또는 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 상기 유효한 양은 상기 조성물 당 약 0.0001 ㎍ 내지 약 2 g, 약 0.001 ㎍ 내지 약 1 g, 약 0.01 ㎍ 내지 약 500 mg, 약 0.1 ㎍ 내지 약 100 mg, 또는 약 1 ㎍ 내지 약 50 mg일 수 있으나, 이에 제한되지 않는다.
또한 상기 조성물을 개체에 투여하는 방식으로 사용하는 경우, 상기 조성물은 경구, 정맥내, 종양내, 근육내, 경피, 점막, 코안, 기관내, 피하, 또는 이들의 조합으로 투여될 수 있다. 이 경우, 상기 조성물의 투여량은 예를 들어, 개체 무게를 기준으로 약 0.00001 ㎎/kg 내지 약 100 ㎎/kg, 약 0.001 ㎎/kg 내지 약 10 ㎎/kg, 또는 약 0.1 ㎎/kg 내지 약 1 ㎎/kg의 범위 내 일 수 있으나, 이에 제한되지 않는다. 상기 투여는 1일 1회, 1일 다회, 또는 1주일에 1회, 2주일에 1회, 3주일에 1회, 또는 4주일에 1회 내지 1년에 1회 투여될 수 있다.
상기 개체는 인간 또는 인간을 제외한 동물일 수 있다. 상기 인간을 제외한 동물은 포유류, 조류, 파충류, 양서류, 어류 등을 포함할 수 있으나, 이에 제한되지 않고, 상기 조류는 닭, 오리, 거위, 메추리, 꿩, 또는 칠면조 등을 포함할 수 있고, 이에 제한되지 않는다.
또 다른 양상은 목적 물질이 내부에 삽입되어 있는 엑소좀을 분리된 생식세포 또는 유기체에 투여하는 단계를 포함하는, 분리된 생식세포 또는 유기체 내 생식세포로 목적 물질을 전달하는 방법을 제공한다.
또 다른 양상은 핵산이 내부에 삽입되어 있는 엑소좀을 분리된 생식세포 또는 유기체에 투여하는 단계를 포함하는, 분리된 생식세포 또는 유기체 내 생식세포의 유전자를 편집하는 방법을 제공한다.
또 다른 양상은 핵산이 내부에 삽입되어 있는 엑소좀 또는 상기 엑소좀이 도입 (예컨대, 형질도입 또는 형질감염)된 생식세포를 인간을 제외한 동물의 배자 (embryo) (또는 배자 내 혈관)에 주입하는 단계를 포함하는 유전자 편집 동물을 제조하는 방법을 제공한다.
상기 엑소좀, 상기 목적 물질, 상기 핵산, 상기 삽입, 상기 목적 물질이 내부에 삽입되어 있는 엑소좀, 상기 핵산이 내부에 삽입되어 있는 엑소좀, 상기 생식세포 (즉, 수여자 세포인 생식세포), 및 상기 유전자 편집은 상술한 바와 같다.
상기 유기체는 인간 또는 인간을 제외한 동물 개체, 또는 배아 (또는 배자)를 포함할 수 있다.
상기 인간을 제외한 동물은 포유류, 조류, 파충류, 양서류, 어류 등을 포함할 수 있으나, 이에 제한되지 않고, 상기 조류는 닭, 오리, 거위, 메추리, 꿩, 또는 칠면조 등을 포함할 수 있고, 이에 제한되지 않는다.
상기 배아 (또는 배자)는 갓 수정된 수정란, 발생 초기 배아, 또는 수용체 배자 (recipient embryo)를 포함하고, 이에 제한되는 것은 아니다.
바람직하게는, 상기 유기체는 조류 또는 조류의 배자 (예컨대, 수용체 배자)일 수 있다.
상기 투여는 처리, 접촉, 주입, 도입 등의 의미를 포함한다.
상기 목적 물질이 내부에 삽입되어 있는 엑소좀 또는 상기 핵산이 내부에 삽입되어 있는 엑소좀을 분리된 생식세포 또는 유기체에 투여하는 방식은 당업계에 공지된 일반적인 방식에 의해 수행될 수 있고 특별히 제한되지 않는다. 예컨대, 상기 목적 물질이 내부에 삽입되어 있는 엑소좀 또는 상기 핵산이 내부에 삽입되어 있는 엑소좀을 분리된 생식세포 또는 유기체에 투여하는 경우, 상기 엑소좀은 추가적인 인위적 과정을 거치지 않고도 상기 분리된 생식세포 또는 상기 유기체 내의 생식세포로 자발적 또는 자연적으로 도입 또는 흡수될 수 있다. 이로 인해, 상기 엑소좀은 상기 분리된 생식세포 또는 상기 유기체 내의 생식세포로 목적 물질 또는 핵산을 고효율로 전달할 수 있고, 그 결과 상기 분리된 생식세포 또는 상기 유기체 내의 생식세포의 유전자를 고효율로 편집할 수 있다.
또한, 상기 목적 물질이 내부에 삽입되어 있는 엑소좀 또는 상기 핵산이 내부에 삽입되어 있는 엑소좀을 분리된 생식세포에 투여 (예컨대 처리)하는 경우, 상기 엑소좀의 상기 분리된 생식세포로의 도입 또는 흡수 효율을 높이기 위해 당업계에 알려진 일반적인 트렌스펙션 과정 (예컨대, 전기천공법 (electroporation), 리포펙션 (lipofection), 미량주입 (microinjection) 등)을 추가로 수행할 수 있다.
또한, 상기 목적 물질이 내부에 삽입되어 있는 엑소좀 또는 상기 핵산이 내부에 삽입되어 있는 엑소좀을 유기체에 투여하는 경우, 상기 투여는 혈관내, 정맥내, 종양내, 경구, 경피, 피하, 직장, 동맥내, 복강내, 근육내, 흉골내, 국소, 피내, 또는 이들의 조합의 경로로 투여되는 것일 수 있다.
상기 유전자 편집 동물을 제조하는 방법에서, 상기 핵산이 내부에 삽입되어 있는 엑소좀이 도입된 생식세포는, 상술한 바와 같이, 상기 엑소좀을 분리된 생식세포에 투여 (예컨대 처리)함으로써 (또는 처리 후 상술한 당업계에 알려진 일반적인 트렌스펙션 과정을 추가로 거침으로써) 상기 생식세포 내로 상기 엑소좀을 트렌스펙션 (transfection)시키는 방식에 의해 제조될 수 있다.
상기 유전자 편집 동물을 제조하는 방법에서, 상기 배자는 구체적으로 수용체 배자일 수 있으나, 이에 제한되지 않는다. 상기 수용체 배자는 원시생식세포가 혈관을 따라 이동하는 발달 시기의 배자를 의미할 수 있다.
상기 유전자 편집 동물을 제조하는 방법에서, 상기 핵산이 내부에 삽입되어 있는 엑소좀 또는 상기 엑소좀이 도입된 생식세포를 인간을 제외한 동물의 배자 (또는 배자 내 혈관)에 주입하는 단계는, 당업계에 알려진 일반적인 주입 방식 (예컨대, 미량주입 (microinjection) 등)에 의해 수행될 수 있다.
상기 유전자 편집 동물을 제조하는 방법에서, 상기 핵산이 내부에 삽입되어 있는 엑소좀을 인간을 제외한 동물의 배자 (또는 배자 내 혈관)에 주입하는 경우, 상기 엑소좀은 배자 내 생식세포로 상기 핵산을 전달하고, 전달된 핵산에 의해서 배자 내 생식세포의 유전자가 편집되며, 유전자 편집된 배자로부터 유전자 편집된 동물이 발생될 수 있다.
일 구체예에 따르면, 상기 유전자 편집 동물을 제조하는 방법은 유전자 편집 조류를 제조하는 방법일 수 있다. 이 경우, 상기 유전자 편집 조류를 제조하는 방법은 상기 핵산이 내부에 삽입되어 있는 엑소좀 또는 상기 엑소좀이 도입된 생식세포를 조류의 배자 (또는 배자 내 혈관)에 주입하는 단계 후에, 상기 핵산이 내부에 삽입되어 있는 엑소좀 또는 상기 엑소좀이 도입된 생식세포가 주입된 배자를 포함하는 난을 배양 및 부화하여 유전자 편집 조류를 생산하는 단계를 더 포함하는 것일 수 있다.
상기 유전자 편집 조류를 생산하는 단계는 예를 들어, 상기 배자를 포함하는 난을 밀봉한 다음 적절한 시간 동안 배양하여 실시될 수 있다. 그런 다음, 상기 배자를 포함하는 난을 배양 및 부화하고, 성성숙에 이른 수용체를 검정교배를 통해 유전자 편집된 조류를 생산할 수 있다. 또한, 상기 유전자 편집 조류를 생산하는 단계는 당업계에 알려진 일반적인 방식에 의해 수행될 수 있다. 추가로, 유전자 편집 조류의 확인은 예를 들어, 혈액으로부터 얻은 유전체 DNA를 주형으로 이용하여 PCR (polymerase-chain reaction), 실시간 PCR 방법, 또는 염기서열분석법으로 서열이 편집되어 있는 지 여부를 검사하여 실시할 수 있다.
상기 유전자 편집 동물에는 형질전환 동물도 포함되며, 용어 “유전자 편집 동물”은, 용어 “형질전환 동물”과 상호교환적으로 사용될 수 있다.
상기 방법에서 언급된 용어 또는 요소 중 상기 조성물에 대한 설명에서 언급된 것과 같은 것은, 앞에서 상기 조성물에 대한 설명에서 언급된 바와 같은 것으로 이해된다.
또 다른 양상은 생식세포로 목적 물질을 전달하기 위한 목적 물질이 내부에 삽입되어 있는 엑소좀의 용도를 제공한다.
또 다른 양상은 생식세포 내 유전자를 편집하기 위한 핵산이 내부에 삽입되어 있는 엑소좀의 용도를 제공한다.
또 다른 양상은 생식세포로의 목적 물질 전달용 조성물을 제조하기 위한 목적 물질이 내부에 삽입되어 있는 엑소좀의 용도를 제공한다.
또 다른 양상은 생식세포 내 유전자 편집용 조성물을 제조하기 위한 핵산이 내부에 삽입되어 있는 엑소좀의 용도를 제공한다.
상기 용도에서 언급된 용어 또는 요소 중 상기 조성물 또는 상기 방법에 대한 설명에서 언급된 것과 같은 것은, 앞에서 상기 조성물 또는 상기 방법에 대한 설명에서 언급된 바와 같은 것으로 이해된다.
일 양상에 따른 목적 물질 (예컨대, 외래 유전자 등)이 내부에 삽입된 엑소좀은, 생체 외 및 생체 내의 생식세포 내 목적 물질 전달 및 유전자 편집을 가능하게 하므로, 동물로부터 원시생식세포 등의 생식세포를 분리하고 배양하는 과정 없이 형질전환 또는 유전자 편집 동물을 제조하기 위한 시스템에 활용될 수 있다.
따라서, 일 양상에 따른 목적 물질 (예컨대, 외래 유전자 등)이 내부에 삽입된 엑소좀에 따르면, 형질전환 또는 유전자 편집 동물 생산을 위한 리포좀 및 바이러스 매개 생식세포 내 유전자 전달 기술의 낮은 효율을 극복하고, 원시생식세포 등의 생식세포의 분리 및 배양의 한계가 있었던 기존 기술의 문제점을 해소하여, 형질전환 또는 유전자 편집 동물 (예컨대, 형질전환 또는 유전자 편집 조류)을 효율적으로 제조할 수 있으므로, 야생종 및 멸종 위기 종을 보존 및 복원하는 데 이바지할 수 있다.
또한, 일 양상에 따른 목적 물질 (예컨대, 외래 유전자 등)이 내부에 삽입된 엑소좀은, 인간의 생식세포를 대상으로 하는 치료 목적의 전달체 또는 유전자 편집 도구로서 활용될 수 있다.
도 1은 일 실시예에 따른 세포 유래 엑소좀 내부에 목적 물질 (예컨대, CRISPR/Cas9 발현 플라스미드 DNA)이 삽입된 복합체의 제조 과정, 및 상기 복합체를 이용한 체외 배양된 생식세포 및 동물 생체 내 목적 물질 전달 및 유전자 편집 과정을 개략적으로 나타내는 모식도이다.
도 2는 일 실시예에 따른 조류 원시생식세포 유래 엑소좀에 대하여 Cryo-EM 이미징을 수행한 결과를 나타내는 이미지이다.
도 3은 일 실시예에 따른 조류 원시생식세포 유래 엑소좀에 대하여 western blot 분석을 수행한 결과를 나타내는 이미지이다.
도 4는 일 실시예에 따른 조류 간세포를 현미경으로 관찰한 이미지 (A) 및 일 실시예에 따른 조류 간세포 유래 엑소좀을 Cryo-EM으로 관찰한 이미지 (B)를 나타내는 도이다.
도 5는 일 실시예에 따른 조류 간세포 유래 엑소좀에 대하여 NTA 분석을 수행한 결과로서 엑소좀의 사이즈 분포를 나타내는 그래프이다.
도 6은 일 실시예에 따른 조류 간세포로부터 엑소좀을 분리하는 방법에 의해 수득된 최종 농축물 (즉, 엑소좀을 포함하는 총 단백질)에 포함된 엑소좀 입자의 농도를 분석한 NTA 분석 결과를 나타내는 그래프이다.
도 7은 일 실시예에 따른 조류 간세포 유래 엑소좀에 대하여 western blot 분석을 수행한 결과를 나타내는 이미지이다.
도 8은 일 실시예에 따른 조류 원시생식세포 유래 엑소좀 (PGC-Exo) 및 조류 간세포 유래 엑소좀 (LMH-Exo)의 조류 원시생식세포 내로의 흡수능을 분석한 결과를 나타내는 그래프이다 (Mock: 미처리군; Dio-labeled PGC-Exo: Dio lipophilic dye가 부착된 조류 원시생식세포 유래 엑소좀 처리군; Dio-labeled LMH-Exo: Dio lipophilic dye가 부착된 조류 간세포 유래 엑소좀 처리군; x축: 형광 세기; y축: 세포의 개수).
도 9는 일 실시예에 따른 조류 원시생식세포 유래 엑소좀 내부에 목적 물질 (구체적으로는, EGFP 발현 플라스미드 DNA)이 삽입된 복합체를 체외 배양된 조류 원시생식세포에 처리한 후, EGFP를 발현하여 형광을 나타내는 조류 원시생식세포를 촬영한 결과를 나타내는 이미지이다.
도 10은 도 9의 촬영 이미지를 바탕으로 EGFP를 발현하여 형광을 나타내는 조류 원시생식세포의 비율 (%)을 수치적으로 분석한 결과를 나타내는 그래프이다.
도 11은 일 실시예에 따른 조류 간세포 유래 엑소좀 내부에 목적 물질 (구체적으로는, EGFP 발현 플라스미드 DNA)이 삽입된 복합체를 체외 배양된 조류 성축 유래 생식세포에 처리한 후, EGFP를 발현하여 형광을 나타내는 조류 성축 유래 생식세포를 촬영한 결과를 나타내는 이미지이다 (NC: 미처리군; LIPO: Lipofectamine 2000 (Invitrogen) 시약 및 목적 물질의 처리군; EXO: 조류 간세포 유래 엑소좀 내부에 목적 물질이 삽입된 복합체 처리군).
도 12는 도 11의 촬영 이미지를 바탕으로 EGFP를 발현하여 형광을 나타내는 조류 성축 유래 생식세포의 비율 (%)을 수치적으로 분석한 결과를 나타내는 그래프이다 (NC: 미처리군; LIPO: Lipofectamine 2000 (Invitrogen) 시약 및 목적 물질의 처리군; EXO: 조류 간세포 유래 엑소좀 내부에 목적 물질이 삽입된 복합체 처리군).
도 13은 일 실시예에 따른 조류 원시생식세포 유래 엑소좀 내부에 목적 물질 (구체적으로는, CRISPR/Cas9 발현 플라스미드 DNA)이 삽입된 복합체를 체외 배양된 조류 원시생식세포에 처리한 후, 상기 처리된 원시생식세포에서의 유전자 편집 결과를 나타내는 도이다 (A: 조류 원시생식세포에서의 유전자 편집을 위한 표적 부위 (Hoxb13 유전자의 엑손 2 부위) 및 프라이머의 결합 부위를 나타냄; B: 상기 표적 부위에서의 유전자 편집 결과를 나타냄 (B의 Edited sequence에서 서열 아래에 줄이 표시된 부위는 상기 표적 부위를 의미하고, 서열 문자를 관통하는 줄이 표시된 부위는 삭제된 서열을 의미함)).
도 14는 일 실시예에 따른 조류 원시생식세포 유래 엑소좀 내부에 목적 물질 (구체적으로는, EGFP 발현 플라스미드 DNA)이 삽입된 복합체를 조류 수용체 배자의 혈관 내로 주입한 후, 상기 배자의 생식선 내에서 EGFP를 발현하여 형광을 나타내는 세포를 촬영한 이미지이다.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1. 조류 세포로부터 엑소좀의 분리 및 분리된 엑소좀의 특성 확인
조류의 세포 배양액으로부터 엑소좀을 분리하고, 분리된 엑소좀의 특성을 확인하고자 하였다.
구체적으로, 조류 (구체적으로, 닭)의 원시생식세포 (primordial germ cell)를 혈청과 항생제가 제거된 배지에서 배양한 후, ExoQuick® ULTRA EV Isolation Kit를 사용하여 키트 제조사의 지시에 따라 세포 배양액으로부터 엑소좀을 분리하였다. 구체적으로, 조류 원시생식세포를 20% FBS, 2% chicken serum, 1× nucleosides, 2 mM l-glutamine, 1× nonessential amino acids, β-mercaptoethanol, 10 mM sodium pyruvate, 1× antibiotic-antimycotic, human basic fibroblast growth factor (10 ng/ml)을 보충한 knockout DMEM 배지 (Gibco)에서 배양하였다. 그 후, 배양된 조류 원시생식세포를 FBS가 없는 배지에서 배양하여 세포 배양액을 수확하였고, 상기 세포 배양액을 300 xg의 속도로 5분 동안 원심분리한 후, 상층액을 0.45 ㎛ 필터와 0.22 ㎛ 필터 (Merck Millipore)를 이용하여 차례로 여과하여 마이크로베지클을 제거하였다. 그 후, 마이크로베지클이 제거된 상층액을 ExoQuick® ULTRA EV Isolation Kit (System Biosciences)을 사용하여 제조사의 지시에 따라 원심분리하여 펠렛을 수득하였고, 수득된 펠렛을 PBS에 재현탁하고, Amicon Ultra-15 Centrifugal Filter (100 kDa)를 사용하여 순수한 엑소좀으로 농축시켜 조류 원시생식세포로부터 분리된 엑소좀을 수득하였다.
또한, 조류 (구체적으로, 닭)의 간세포 (Hepatocellular carcinoma cell line, LMH; 도 4의 A)를 10% FBS를 보충한 Waymouth's Medium (Gibco)에서 배양하였고, 이때 상기 배양은 0.1% gelatin으로 코팅한 culture dish에서 수행되었다. 상기 배양된 조류 간세포를 FBS가 없는 배지에서 배양한 후 세포 배양액을 수확하였고, 상기 세포 배양액을 300 xg의 속도로 5분 동안 원심분리한 후, 상층액을 0.45 ㎛ 필터와 0.22 ㎛ 필터 (Merck Millipore)를 이용하여 차례로 여과하여 마이크로베지클을 제거하였다. 그 후, 마이크로베지클이 제거된 상층액을 ExoQuick-TC™ Exosome Precipitation Solution (System Biosciences)을 사용하여 제조사의 지시에 따라 원심분리하여 펠렛을 수득하였고, 수득된 펠렛을 PBS에 재현탁하고, Amicon Ultra-15 Centrifugal Filter (100 kDa)를 사용하여 순수한 엑소좀으로 농축시켜 조류 간세포로부터 분리된 엑소좀을 수득하였다.
분리된 조류 원시생식세포 유래 엑소좀의 형태 및 크기를 확인하기 위하여 Cryogenic Electron Microscopy (Cryo-EM) 이미징을 수행하였고, 엑소좀 특이적 마커를 이용하여 western blot 분석을 수행하여 분리된 엑소좀의 특성을 확인하였다. 더하여 분리된 조류 간세포 유래 엑소좀에 대하여도 엑소좀의 형태 및 크기를 확인하기 위하여 Cryogenic Electron Microscopy (Cryo-EM) 이미징을 수행하였고, Nanoparticle Tracking Analysis (NTA) 분석을 수행하여 엑소좀의 사이즈 분포 및 농도를 확인하였으며, 엑소좀 특이적 마커를 이용한 western blot 분석을 수행하여 분리된 엑소좀의 특성을 확인하였다.
그 결과, 도 2 및 도 3에 나타낸 바와 같이, 조류 원시생식세포로부터 분리된 엑소좀은, 세포막의 구조와 동일 또는 유사한 인지질 이중막을 가지며 직경의 길이는 약 50 내지 150 nm 또는 약 80 내지 120 nm (구체적으로는, 약 100 nm)이며 (도 2), Beta (β)-actin (ACTB) 단백질 및 CD9 단백질을 포함함을 확인하였다 (도 3).
또한, 도 4 내지 도 7에 나타낸 바와 같이, 조류 간세포로부터 분리된 엑소좀은, 세포막의 구조와 동일 또는 유사한 인지질 이중막을 가지며 (도 4의 B), 직경의 길이는 약 50 내지 250 nm, 약 60 내지 200 nm, 약 70 내지 150 nm, 약 80 내지 130 nm, 또는 약 90 내지 110 nm 이고 (도 5), 상술한 조류 간세포로부터 엑소좀을 분리하는 방법에 의해 수득된 최종 농축물 (즉, 엑소좀을 포함하는 총 단백질)에 포함된 엑소좀 입자의 농도는 약 6x107 particles/μg protein 이며 (도 6), CD81 (Cluster of Differentiation 81) 단백질 및 Hsp70 (70 kilodalton heat shock proteins) 단백질을 포함함을 확인하였다 (도 7).
실시예 2. 조류 세포 유래 엑소좀의 동물 생식세포 내 흡수능 확인
상기 실시예 1에서 제조된 조류 원시생식세포 유래 엑소좀 및 조류 간세포 유래 엑소좀 각각에 대하여, 체외 배양된 동물 (예컨대, 조류) 생식세포 내로의 흡수 여부를 확인하였다.
구체적으로, 상기 실시예 1에서 제조된 조류 원시생식세포 유래 엑소좀 및 조류 간세포 유래 엑소좀 각각에 녹색 형광 염료인 Dio lipophilic dye를 부착하고, 상기 형광 염료가 부착된 2종의 엑소좀 각각을 체외 배양된 조류 (닭) 원시생식세포에 처리한 후 3시간 동안 배양하였다. 그 후, 유세포 분석 (Flow cytometry)을 통해 상기 2종 엑소좀 각각의 조류 (닭) 원시생식세포 내 흡수를 확인하였다. 또한, 엑소좀을 처리하지 않은 조류 (닭) 원시생식세포를 대조군 (Mock)으로 사용하였다. 구체적으로, 상기 엑소좀 미처리 대조군 (Mock)에서 형광 발현 세포의 비율이 0%인 형광 세기 범위 (도 8의 그래프의 중앙에 bar로 표시된 형광 세기 구간)을 도출하고, Dio lipophilic dye가 부착된 상기 2종의 엑소좀 각각을 처리한 조류 (닭) 원시생식세포에서 형광 세기가 상기 도출된 범위에 속하는 형광을 나타내는 조류 (닭) 원시생식세포의 비율을 측정하여, 상기 2종의 엑소좀 각각의 조류 (닭) 원시생식세포 내로의 흡수능을 분석하였다 (도 8 참고).
그 결과, 도 8에 나타낸 바와 같이, 상기 실시예 1에서 제조된 조류 원시생식세포 유래 엑소좀 및 조류 간세포 유래 엑소좀은 유사한 수준으로 체외 배양된 조류 원시생식세포 내로 고효율로 흡수됨을 확인하였다 (조류 원시생식세포 유래 엑소좀의 흡수능: 약 10.5%; 조류 간세포 유래 엑소좀의 흡수능: 약 10.3%).
본 실시예를 통해, 조류 원시생식세포, 간세포 등과 같은 조류 세포 유래 엑소좀은 동물 (예컨대, 조류) 생식세포 내로 고효율로 흡수되므로, 상기 조류 세포 유래 엑소좀 내부에 목적 물질 (예컨대, 외래 유전자 등)을 삽입하여 이용하는 경우 목적 물질을 동물 (예컨대, 조류) 생식세포 내로 고효율로 전달할 수 있음을 알 수 있었다.
실시예 3. 조류 세포 유래 엑소좀 및 목적 물질의 복합체 제조
조류 세포 유래 엑소좀 내부에 목적 물질 (구체적으로는, 플라스미드 DNA)이 삽입된 복합체를 제조하였다. 본 명세서에서 사용된 용어 “복합체”는 엑소좀 내부에 목적 물질이 삽입되어 있는 상태의 엑소좀을 의미한다.
구체적으로, Exofect™ 용액 (System Biosciences), 상기 실시예 1에서 제조된 조류 원시생식세포 유래 엑소좀 또는 조류 간세포 유래 엑소좀, 목적 물질인 EGFP (Enhanced green fluorescent protein) 발현 플라스미드 DNA, 그리고 PBS를 상기 Exofect™ 용액 제조사의 지시에 따라 혼합한 후 37℃ 온도에서 10분간 배양하여 조류 원시생식세포 유래 엑소좀 또는 조류 간세포 유래 엑소좀 내부에 EGFP 발현 플라스미드 DNA가 삽입된 복합체를 수득하였다.
또한, Exofect™ 용액 (System Biosciences), 상기 실시예 1에서 제조된 조류 원시생식세포 유래 엑소좀 또는 조류 간세포 유래 엑소좀, 목적 물질인 CRISPR/Cas9 발현 플라스미드 DNA, 그리고 PBS를 상기 Exofect™ 용액 제조사의 지시에 따라 혼합한 후 37℃ 온도에서 10분간 배양하여 조류 원시생식세포 유래 엑소좀 또는 조류 간세포 유래 엑소좀 내부에 CRISPR/Cas9 발현 플라스미드 DNA가 삽입된 복합체를 수득하였다. 상기 CRISPR/Cas9 발현 플라스미드 DNA는, Hoxb13 유전자의 엑손 2를 표적하는 CRISPR/Cas9 시스템 (가이드 RNA 및 Cas9 단백질)을 발현하고 서열번호 1의 염기서열을 포함한다. 즉, 상기 CRISPR/Cas9 발현 플라스미드 DNA는, Hoxb13 유전자의 엑손 2를 표적으로 하는 가이드 RNA를 암호화하는 염기서열 (서열번호 2) 및 Cas9 단백질을 암호화하는 염기서열 (서열번호 3)을 포함한다.
실시예 4. 조류 세포 유래 엑소좀 및 목적 물질의 복합체의 동물 생식세포로의 목적 물질 전달 효과 확인
조류 세포 유래 엑소좀 내부에 목적 물질 (구체적으로는, 플라스미드 DNA)이 삽입된 복합체의 체외 배양된 동물 (예컨대, 조류) 생식세포로의 목적 물질 전달 효과를 확인하였다.
구체적으로, 상기 실시예 3에서 제조된, 조류 원시생식세포 유래 엑소좀 내부에 목적 물질인 EGFP 발현 플라스미드 DNA가 삽입된 복합체를 약 15 μg/2x105 cells 또는 약 30 μg/2x105 cells의 농도로, 체외 배양된 조류 (닭) 원시생식세포에 처리한 후 2일 뒤에 EGFP를 발현하는 세포를 형광현미경 하에서 관찰하였고, 유세포 분석 (Flow cytometry)을 통해 상기 엑소좀 복합체가 처리된 전체 세포 중에서 EGFP를 발현하는 세포의 비율을 측정하였다.
그 결과, 도 9 및 도 10에 나타낸 바와 같이, 조류 원시생식세포 유래 엑소좀 내부에 EGFP 발현 플라스미드 DNA가 삽입된 복합체의 처리 농도가 증가할수록 농도 의존적으로 체외 배양된 조류 원시생식세포에서 EGFP의 발현 수준이 증가함을 확인하였고, 이를 통해, 조류 원시생식세포 유래 엑소좀 내부에 목적 물질인 플라스미드 DNA가 삽입된 복합체는, 체외 배양된 조류 원시생식세포에 고효율로 트렌스펙션되어 목적 물질인 플라스미드 DNA를 고효율로 전달함을 확인하였다.
또한, 상기 실시예 3에서 제조된, 조류 간세포 유래 엑소좀 내부에 목적 물질인 EGFP 발현 플라스미드 DNA가 삽입된 복합체를 약 1 μg/1x105 cells, 약 5 μg/1x105 cells, 또는 약 10 μg/1x105 cells의 농도로, 체외 배양된 조류 (닭) 성축 유래 생식세포 (구체적으로는, 정원줄기세포 (Spermatogonial stem cells))에 처리한 후 4일 뒤에 EGFP를 발현하는 세포를 형광현미경 하에서 관찰하였고, 유세포 분석 (Flow cytometry)을 통해 상기 엑소좀 복합체가 처리된 전체 세포 중에서 EGFP를 발현하는 세포의 비율을 측정하였다. 또한, 상기 엑소좀 복합체를 처리하지 않은 조류 (닭) 성축 유래 생식세포 (NC) 및 Lipofectamine 2000 (Invitrogen) 시약과 함께 EGFP 발현 플라스미드 DNA를 처리한 조류 (닭) 성축 유래 생식세포 (LIPO)를 대조군으로 사용하였다.
그 결과, 도 11 및 도 12에 나타낸 바와 같이, 조류 간세포 유래 엑소좀 내부에 EGFP 발현 플라스미드 DNA가 삽입된 복합체의 처리에 의해 체외 배양된 조류 성축 유래 생식세포에서 EGFP의 발현 수준이 증가함을 확인하였고, 특히 상기 복합체의 처리 농도가 약 2 내지 9 μg/1x105 cells, 약 3 내지 7 μg/1x105 cells, 약 4 내지 6 μg/1x105 cells, 또는 약 5 μg/1x105 cells인 경우, 체외 배양된 조류 성축 유래 생식세포에서 EGFP의 발현 수준이 현저히 증가함을 확인하였다. 이를 통해, 조류 간세포 유래 엑소좀 내부에 목적 물질인 플라스미드 DNA가 삽입된 복합체는, 체외 배양된 조류 성축 유래 생식세포에 고효율로 트렌스펙션되어 목적 물질인 플라스미드 DNA를 고효율로 전달함을 확인하였다. 또한, Lipofectamine 2000 (Invitrogen) 시약 및 EGFP 발현 플라스미드 DNA를 함께 체외 배양된 조류 성축 유래 생식세포에 처리한 경우 (대조군; LIPO), 상기 성축 유래 생식세포에서 EGFP가 거의 발현되지 않음을 확인하였다. 상기 Lipofectamine 2000 (Invitrogen) 시약은 당업계에서 일반적으로 사용되는 형질감염 시약으로서, 목적 물질 (핵산)을 리포좀화하여 세포내로 전달하는 기능을 한다. 따라서, 목적 물질 (예컨대, 플라스미드 DNA)을 생식세포 내로 전달함에 있어서, 당업계에서 가장 일반적으로 사용되는 리포좀화 방식은 그 전달 효율이 현저히 낮음을 알 수 있었다.
본 실시예를 통해, 조류 세포 유래 엑소좀 내부에 목적 물질 (예컨대, 외래 유전자)이 삽입된 복합체는, 동물 (예컨대, 조류) 생식세포로 목적 물질 (예컨대, 외래 유전자)을 고효율로 전달할 수 있음을 확인하였다. 특히, 조류 세포 유래 엑소좀 내부에 외래 유전자가 삽입된 복합체는, 기존의 리포좀화 방식 대비 현저히 우수한 효율로 동물 (예컨대, 조류) 생식세포로 외래 유전자를 전달할 수 있어, 생식세포로 외래 유전자를 전달하는데 한계가 있었던 기존 기술의 문제점을 해소할 수 있음을 알 수 있었다.
실시예 5. 조류 세포 유래 엑소좀 및 CRISPR/Cas9 발현 플라스미드 DNA의 복합체의 동물 생식세포에서의 유전자 편집 효과 확인
조류 세포 유래 엑소좀 내부에 목적 물질 (예컨대, CRISPR/Cas9 발현 플라스미드 DNA)이 삽입된 복합체의 체외 배양된 동물 (예컨대, 조류) 생식세포에서의 유전자 편집 효과를 확인하였다.
구체적으로, 상기 실시예 3에서 제조된, 조류 원시생식세포 유래 엑소좀 내부에 목적 물질 (Hoxb13 유전자의 엑손 2를 표적하는 가이드 RNA (도 13의 A) 및 Cas9 단백질을 발현하는 CRISPR/Cas9 발현 플라스미드 DNA)가 삽입된 복합체를, 체외 배양된 조류 (닭) 원시생식세포에 처리한 후 2일 뒤에, 상기 엑소좀 복합체가 처리된 세포로부터 genomic DNA를 추출하여 유전자 편집 여부를 확인하였다. Genomic DNA PCR을 위해, Hoxb13 유전자의 인트론 1과 엑손 2에 각각 결합하는 프라이머를 디자인하였다 (Forward primer: CCTCACGTTGGTGGTCGTTA (서열번호 4); Reverse primer; CACCCTCCTGTTCTGGAACC (서열번호 5); 도 13의 A). 상기 프라이머를 이용하여 상기 추출된 genomic DNA에 대하여 PCR을 수행한 후 증폭된 PCR 산물을 T vector에 삽입하여 DNA 시퀀싱을 통해 유전자 편집 여부를 분석하였다.
그 결과, 도 13에 나타낸 바와 같이, 조류 원시생식세포 유래 엑소좀 내부에 상기 CRISPR/Cas9 발현 플라스미드 DNA가 삽입된 복합체는, 체외 배양된 조류 원시생식세포 내로 트렌스펙션되어 상기 CRISPR/Cas9 발현 플라스미드 DNA를 전달하고, 이로 인해 체외 배양된 조류 원시생식세포 내 표적 유전자인 Hoxb13 유전자의 엑손 2 부위의 일부 염기 또는 일부 염기서열이 삭제됨으로써 표적 부위의 유전자가 편집되었음을 확인하였다 (도 13의 B).
본 실시예를 통해, 조류 세포 유래 엑소좀 내부에 CRISPR/Cas9 발현 플라스미드 DNA가 삽입된 복합체는, 동물 (예컨대, 조류) 생식세포에서 표적 유전자를 고효율로 편집할 수 있음을 알 수 있었다.
실시예 6. 조류 세포 유래 엑소좀 및 목적 물질의 복합체의 동물 생체 내 (in vivo) 생식세포로의 목적 물질 전달 효과 확인
조류 세포 유래 엑소좀 내부에 목적 물질 (구체적으로는, 플라스미드 DNA)이 삽입된 복합체의 동물 (예컨대, 조류) 생체 내 (in vivo) 생식세포로의 목적 물질 전달 효과를 확인하였다.
구체적으로, 원시생식세포가 혈관을 따라 이동하는 발달 시기의 조류 (닭) 수용체 배자 (recipient embryo)를 수득한 후, 상기 실시예 3에서 제조된 조류 원시생식세포 유래 엑소좀 내부에 목적 물질인 EGFP 발현 플라스미드 DNA가 삽입된 복합체를 마이크로인젝션 (microinjection)을 통해 상기 수용체 배자의 혈관 내로 주입하였다. 그 후, 3 내지 4일 뒤에 상기 수용체 배자로부터 생식선 조직을 수확하여 형광현미경 하에서 생식선 조직 내 형광 발현 세포를 확인하였다.
그 결과, 도 14에 나타낸 바와 같이, 조류 원시생식세포 유래 엑소좀 내부에 EGFP 발현 플라스미드 DNA가 삽입된 복합체를 조류 수용체 배자의 혈관 내로 주입하는 경우, 상기 복합체는 조류 수용체 배자의 혈관 내에 존재하는 원시생식세포 내로 도입되어 EGFP 발현 플라스미드 DNA를 전달하고, 상기 플라스미드 DNA가 도입된 원시생식세포는 조류 수용체 배자의 생식선 내로 이동하여 EGFP를 발현하는 것임을 확인하였다.
본 실시예를 통해, 조류 세포 유래 엑소좀 내부에 목적 물질 (예컨대, 외래 유전자)이 삽입된 복합체는, 동물 (예컨대, 조류) 생체 (예컨대, 배자) 내 생식세포로 목적 물질을 고효율로 전달할 수 있음을 확인하였고, 이로 인해, 동물 (예컨대, 조류) 생체 (예컨대, 배자) 내 생식세포에서 유전자 편집 또한 가능할 수 있음을 알 수 있었다. 이를 통해, 조류 세포 유래 엑소좀 내부에 목적 물질 (예컨대, 외래 유전자)이 삽입된 복합체는, 동물 (예컨대, 조류) 생체 (예컨대, 배자) 내로 바로 주입되는 것에 의하여 동물 생체 내의 생식세포 내 목적 물질 전달 및 유전자 편집을 가능하게 하므로, 동물로부터 원시생식세포 등의 생식세포를 분리하고 배양하는 과정 없이 형질전환 또는 유전자 편집 동물 (예컨대, 형질전환 또는 유전자 편집 조류)을 제조하기 위한 시스템에 활용될 수 있음을 알 수 있었다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.

Claims (15)

  1. 목적 물질이 내부에 삽입되어 있는 엑소좀을 포함하는 생식세포로의 목적 물질 전달용 조성물.
  2. 청구항 1에 있어서, 상기 엑소좀은 조류 세포로부터 분리된 것인, 생식세포로의 목적 물질 전달용 조성물.
  3. 청구항 1에 있어서, 상기 엑소좀은 줄기세포, 체세포, 생식세포, 또는 암세포로부터 분리된 것인, 생식세포로의 목적 물질 전달용 조성물.
  4. 청구항 1에 있어서, 상기 엑소좀은 원시생식세포 (primordial germ cell) 또는 간세포 (hepatocyte)로부터 분리된 것인, 생식세포로의 목적 물질 전달용 조성물.
  5. 청구항 1에 있어서, 상기 엑소좀은 50 내지 250 nm의 직경을 가지는 것인, 생식세포로의 목적 물질 전달용 조성물.
  6. 청구항 1에 있어서, 상기 엑소좀은 Beta (β)-actin (ACTB), CD9, CD81, 및 Hsp70으로 구성된 군으로부터 선택된 하나 이상의 단백질을 발현하는 것인, 생식세포로의 목적 물질 전달용 조성물.
  7. 청구항 1에 있어서, 상기 목적 물질은 핵산, 단백질, 항체, 및 약물로 구성된 군으로부터 선택된 하나 이상을 포함하는 것인, 생식세포로의 목적 물질 전달용 조성물.
  8. 청구항 1에 있어서, 상기 목적 물질은 CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) 뉴클레아제 시스템에 이용되는 구성 성분을 포함하는 것인, 생식세포로의 목적 물질 전달용 조성물.
  9. 청구항 1에 있어서, 상기 생식세포는 원시생식세포, 정원줄기세포, 난원줄기세포, 정원세포, 난원세포, 정모세포, 난모세포, 정세포, 난포세포, 정자, 난자, 또는 이들의 조합인 것인, 생식세포로의 목적 물질 전달용 조성물.
  10. 청구항 1에 있어서, 상기 생식세포는 시험관 내 (in vitro), 생체 외 (ex vivo), 또는 생체 내 (in vivo)의 생식세포인 것인, 생식세포로의 목적 물질 전달용 조성물.
  11. 핵산이 내부에 삽입되어 있는 엑소좀을 포함하는 생식세포 내 유전자 편집용 조성물.
  12. 청구항 11에 있어서, 상기 핵산은 CRISPR 뉴클레아제 시스템에 이용되는 구성 성분을 포함하는 것인, 생식세포 내 유전자 편집용 조성물.
  13. 목적 물질이 내부에 삽입되어 있는 엑소좀을 분리된 생식세포 또는 유기체에 투여하는 단계를 포함하는, 분리된 생식세포 또는 유기체 내 생식세포로 목적 물질을 전달하는 방법.
  14. 핵산이 내부에 삽입되어 있는 엑소좀을 분리된 생식세포 또는 유기체에 투여하는 단계를 포함하는, 분리된 생식세포 또는 유기체 내 생식세포의 유전자를 편집하는 방법.
  15. 핵산이 내부에 삽입되어 있는 엑소좀 또는 상기 엑소좀이 도입된 생식세포를 인간을 제외한 동물의 배자 (embryo)에 주입하는 단계를 포함하는 유전자 편집 동물을 제조하는 방법.
PCT/KR2023/012305 2022-08-19 2023-08-18 엑소좀을 이용한 생식세포 내 물질 전달 및 유전자 편집 시스템 WO2024039236A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2022-0104274 2022-08-19
KR20220104274 2022-08-19

Publications (1)

Publication Number Publication Date
WO2024039236A1 true WO2024039236A1 (ko) 2024-02-22

Family

ID=89941953

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/012305 WO2024039236A1 (ko) 2022-08-19 2023-08-18 엑소좀을 이용한 생식세포 내 물질 전달 및 유전자 편집 시스템

Country Status (2)

Country Link
KR (1) KR20240026435A (ko)
WO (1) WO2024039236A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015089465A1 (en) * 2013-12-12 2015-06-18 The Broad Institute Inc. Delivery, use and therapeutic applications of the crispr-cas systems and compositions for hbv and viral diseases and disorders
WO2016187717A1 (en) * 2015-05-26 2016-12-01 Exerkine Corporation Exosomes useful for genome editing
KR20190083237A (ko) * 2018-01-03 2019-07-11 한국과학기술연구원 세포 유래 엑소좀을 포함하는 핵산 전달용 조성물, 키트, 및 이를 이용한 방법
KR20190093171A (ko) * 2018-01-31 2019-08-08 서울대학교산학협력단 CRISPR/Cas9 시스템을 통한 닭 백혈병 바이러스(Avian Leukosis Virus, ALV) 저항성 조류의 제조방법
KR20210089109A (ko) * 2020-01-07 2021-07-15 서울대학교산학협력단 조류인플루엔자 바이러스에 저항성을 갖는 유전자 편집 조류의 제조방법

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015089465A1 (en) * 2013-12-12 2015-06-18 The Broad Institute Inc. Delivery, use and therapeutic applications of the crispr-cas systems and compositions for hbv and viral diseases and disorders
WO2016187717A1 (en) * 2015-05-26 2016-12-01 Exerkine Corporation Exosomes useful for genome editing
KR20190083237A (ko) * 2018-01-03 2019-07-11 한국과학기술연구원 세포 유래 엑소좀을 포함하는 핵산 전달용 조성물, 키트, 및 이를 이용한 방법
KR20190093171A (ko) * 2018-01-31 2019-08-08 서울대학교산학협력단 CRISPR/Cas9 시스템을 통한 닭 백혈병 바이러스(Avian Leukosis Virus, ALV) 저항성 조류의 제조방법
KR20210089109A (ko) * 2020-01-07 2021-07-15 서울대학교산학협력단 조류인플루엔자 바이러스에 저항성을 갖는 유전자 편집 조류의 제조방법

Also Published As

Publication number Publication date
KR20240026435A (ko) 2024-02-28

Similar Documents

Publication Publication Date Title
JP4741189B2 (ja) 増殖した細胞系およびその使用方法
McBurney et al. Isolation of male embryonal carcinoma cells and their chromosome replication patterns
Takagi et al. Reversal of X-inactivation in female mouse somatic cells hybridized with murine teratocarcinoma stem cells in vitro
JP4841777B2 (ja) トリ始原生殖細胞を使用して、未分化のトリ細胞培養物を取得する方法
Gurdon The Croonian Lecture, 1976-Egg cytoplasm and gene control in development
KR20030088022A (ko) 단리된 동종접합 간세포, 그로부터 유래된 분화 세포 및이들을 제조 및 사용하기 위한 물질 및 방법
KR20040031101A (ko) 테일러-메이드 다관능 줄기세포 및 그의 이용
JP2004520046A (ja) ヒト胚性幹細胞のトランスフェクション
Franěk et al. Production and use of triploid zebrafish for surrogate reproduction
JPH11507230A (ja) 細胞の不死化及び脱不死化
Shang et al. Testicular germ line cell identification, isolation, and transplantation in two North American catfish species
EP3962545A1 (en) Compositions and methods for the treatment of retinal degeneration
WO2018030630A1 (ko) Sox 유전자가 이입된 비바이러스성 미니써클 벡터 및 이의 제조방법
WO2011049329A9 (ko) 지렁이의 생식소 재생능력을 이용한 형질전환 지렁이의 제조방법, 이에 의해 제조된 형질전환 지렁이, 및 형질전환 지렁이의 체액으로부터 재조합 단백질의 생산방법
CN1307632A (zh) 室管膜神经干细胞及其分离方法
WO2024039236A1 (ko) 엑소좀을 이용한 생식세포 내 물질 전달 및 유전자 편집 시스템
CN108866100A (zh) 一种高效率的基因编辑方法
Ren et al. Production of donor-derived offsprings by allogeneic transplantation of oogonia in the adult Japanese flounder (Paralichthys olivaceus)
CN113166763B (zh) 靶向cyp4v2基因突变位点的核酸分子及其用途
KR100305715B1 (ko) 유전자전이방법을이용한형질전환조류의생산방법
CN108300737A (zh) 一种表型高度一致的恶性淋巴瘤模型的建立方法及其用途
WO2022094410A1 (en) Compositions and methods for cellular component transfer therapy
WO2014119893A1 (ko) 식물 줄기세포 또는 식물 역분화 줄기 세포의 추출물을 이용한 맞춤형 만능줄기세포의 유도 방법 및 상기 방법에 의해 제조된 만능줄기세포
WO2019190175A9 (ko) 편도 유래 중간엽 줄기세포로부터 운동신경세포의 분화방법
WO2011037367A2 (ko) 고효율 유도만능줄기세포 제조방법 및 상기 방법에 의해 제조된 유도만능줄기세포

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23855202

Country of ref document: EP

Kind code of ref document: A1