WO2014142433A1 - 바이러스 생산능이 증가된 세포주 및 그 제조방법 - Google Patents

바이러스 생산능이 증가된 세포주 및 그 제조방법 Download PDF

Info

Publication number
WO2014142433A1
WO2014142433A1 PCT/KR2013/012263 KR2013012263W WO2014142433A1 WO 2014142433 A1 WO2014142433 A1 WO 2014142433A1 KR 2013012263 W KR2013012263 W KR 2013012263W WO 2014142433 A1 WO2014142433 A1 WO 2014142433A1
Authority
WO
WIPO (PCT)
Prior art keywords
virus
bst
cell line
gene
cells
Prior art date
Application number
PCT/KR2013/012263
Other languages
English (en)
French (fr)
Inventor
박세호
이은비
Original Assignee
고려대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020130026767A external-priority patent/KR20140112255A/ko
Priority claimed from KR1020130117325A external-priority patent/KR101722529B1/ko
Application filed by 고려대학교산학협력단 filed Critical 고려대학교산학협력단
Priority to CN201380075430.3A priority Critical patent/CN105121634B/zh
Priority to EP13877775.0A priority patent/EP2975119B1/en
Priority to US14/773,741 priority patent/US9650613B2/en
Publication of WO2014142433A1 publication Critical patent/WO2014142433A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
    • C12N2760/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
    • C12N2760/16151—Methods of production or purification of viral material
    • C12N2760/16152—Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles

Definitions

  • the present invention relates to a cell line with increased virus production capacity and a method for producing the same, and more particularly, to a cell line with a loss of Bst-2 ( Tedrin , Tetherin) gene function and increased virus production capacity and a method for producing the same.
  • Bst-2 Tedrin , Tetherin
  • Influenza is an acute fever disease caused by influenza virus respiratory infections. Influenza viruses are classified into types A, B, and C according to differences in structural proteins, and there are some differences in host, epidemiology and clinical features. Influenza viruses are spherical viruses with a diameter of 80-120 nm. Subtypes are determined by the types of hemagglutinin (HA) and neuraminidase (NA) glycoproteins attached to the surface. Subtypes are mainly classified as influenza A. Currently, 16 HAs and 9 NAs from N1 to N9 are found from H1 to H16, and according to simple calculations, a total of 144 subtypes (eg, H1N1 and H1N2) are A type. Distributed within influenza (Treanor JJ et al., In Principles and Practice of Infectious Diseases, 2060-85, 2005).
  • HA hemagglutinin
  • NA neuraminidase
  • Influenza vaccines include inactivated and live vaccines.
  • Inactivated vaccines are made by purifying viruses grown in embryonated eggs and inactivating them with formalin.
  • Whole virus vaccines that use the entire inactivated virus, split vaccines that crush the virus envelope with ether, and subunit vaccines that are purified from hemagglutinin and neuraminidase components.
  • live attenuated influenza vaccine LAIV
  • component vaccines such as divided vaccines and subunit vaccines, are very safe and effective and are used most frequently.
  • vaccines containing an adjuvant such as MF-59 or virosome vaccines that form virus-like vesicles have been developed and used in some countries to enhance immune responses (Bridges CB et. Al., In Vaccines, 259). -290, 2008; Belshe RB et. Al., In Vaccines , 291-309, 2008).
  • the cultured virus After incubation of the virus for 3 days after inoculation, the cultured virus is recovered and enters a separate purification step. In some cases, the virus prepared through this process is inactivated (inactivation) after the addition of an adjuvant, stabilizer (preservative), etc. to induce an effective immune response is made into a vaccine.
  • the vaccine thus produced is filled with individual vials or syringes, tested, packaged and placed on the market.
  • the brains of suckling mice are inoculated with the virus and cultured.
  • This traditional vaccine manufacturing method has difficulty in expanding production facilities. For example, in order to expand the production process using fertilized eggs, additional supply of fertilized eggs, which are raw materials, needs to be provided. Chickens raised in these establishments are immunologically weak and therefore difficult to rear up compared to regular chickens and require thorough care. Therefore, there are many spatial and economic limitations to continue to expand these facilities. In addition, if bird flu epidemic such as bird flu (AI) or Newcastle disease (ND) is outbreak, there will be a big obstacle in supplying stable sterile eggs.
  • AI bird flu
  • ND Newcastle disease
  • the field which has long been interested in overcoming these traditional problems is the manufacture of vaccines through animal cell culture (Korean Patent Publication No. 10-2012-0033334). After culturing a large amount of animal cells in a sterile state, the virus is infected with animal cells to produce a vaccine or genetic engineering methods to produce only antigens that induce antibody production in pathogens.
  • the biggest advantage of vaccine production through animal cell culture is the scale of production. Animal cells, which are the raw materials for vaccine production, can be expanded as desired depending on the culture size.
  • Examples of representative cell lines for the production of current viral vaccines include, but are not limited to, genetically mutated by inserting into MDC (cells derived from Madin-Darby dog kidneys), PerC6 (human adenovirus type 5) developed in CRUCELL (Netherlands). Cells derived from human embryonic retinal cells), VERO (cells derived from renal epithelial cells of African green monkeys (Cercopithecus aethiops) isolated from Chiba University in Chiba, Japan) and BHK21 (cells immortalized from baby hamster kidney cells) have.
  • Bst-2 has a site that binds to the cell membrane at both N- and C-terminals, so it is expressed in the form of a center lifted like a leg on the cell membrane.
  • the function of the C-terminal moiety immobilized on the lipid raft site is not known to date.
  • Bst-2 inhibits the virus particles from penetrating the cell membrane through the site fixed to the non-lipid raft site.
  • some viruses bypass the host cell's inhibitory function by producing proteins that promote the breakdown of the Bst-2 gene as a mechanism to avoid this. This paradoxically suggests that the function of the Bst-2 gene strongly contributes to the inhibition of virus production.
  • viruses have acquired this function, and some virus types, such as the typical HIV virus, have a function of promoting the degradation of the Bst-2 gene through the Vpu gene. Most other viruses still have Bst-2. It does not have an evasion mechanism that targets the gene.
  • the function of the Bst-2 gene may be lost or inhibited in animal cells that culture the virus. Skill development is needed.
  • the present inventors have made intensive efforts to develop a method for increasing the viral production capacity of the host cell, and as a result, when the function of the Bst-2 gene is inhibited, extracellular release of the virus is promoted, and cell death of the host cell is suppressed. It was confirmed that virus-producing cell lines with increased virus production capacity were completed, and the present invention was completed.
  • An object of the present invention is to provide a method for producing a virus-producing mutant cell line in which apoptosis is suppressed.
  • Another object of the present invention is to provide a virus producing mutant cell line with increased virus production capacity.
  • Another object of the present invention to provide a method for producing a virus using a mutant cell line with the increased virus production capacity.
  • Still another object of the present invention is to provide a method for preparing a vaccine against viral diseases using the mutant cell line with increased virus production.
  • the present invention provides a method for producing a virus production-mutant cell line suppressed apoptosis, characterized in that the Bst-2 gene is mutated in the virus-producing cell line.
  • the present invention also provides a virus producing mutant cell line in which the Bst-2 gene function is lost in the cell line having a virus producing ability, thereby increasing the virus producing ability.
  • the present invention also provides a mutant cell line with increased virus production capacity in which a mutated Bst-2 gene is introduced into a virus producing cell line that does not express Bst-2 .
  • the present invention also comprises the steps of (a) infecting the virus of interest to the mutant cell line with increased virus production capacity; And (b) culturing the cell line infected with the target virus, and then centrifuging the supernatant to obtain the target virus.
  • the present invention also comprises the steps of infecting the virus of interest to the cell line with increased virus production capacity;
  • Figure 1 shows the results confirmed by electrophoresis of the reaction of the MDCK cell line mutated Bst-2 gene polymerized chain reaction.
  • Figure 2 shows the results confirmed by electrophoresis of the reaction of the VERO cell line mutated Bst-2 gene polymerase chain reaction.
  • Figure 3 shows the titer measured by plaque assay using the supernatant obtained after the virus infected the MDCK cell line mutated wild type MDCK cells and Bst-2 gene.
  • Figure 4 shows the titer measured by plaque assay using the supernatant obtained after the virus infected VERO cell line mutated wild type VERO cells and Bst-2 gene.
  • Figure 5 shows the result of culturing after infecting the virus by diluting the MDCK cell line mutated wild type MDCK cells and Bst-2 gene.
  • Figure 6 shows the result of culturing after infecting the virus by diluting the VERO cell line mutated wild type VERO cells and Bst-2 gene.
  • Figure 7 is a diagram showing a decrease in intracellular signaling in Bst-2 deficient cells (A: nitric oxide production according to LPS treatment by concentration, B: phosphorylation of NF ⁇ B according to LPS treatment).
  • FIG. 8 is a photograph showing the appearance of apoptosis in the Bst-2 deficient cells after virus infection (A: Vero cell line infected with H1N1, B: Vero cell line infected with H3N2).
  • FIG. 9 is a diagram showing a decrease in apoptosis (apoptosis) in Bst-2 deficient cells after virus infection (Phosphatidylserine staining, an indicator of apoptosis) (A: Vero cell line infected with H1N1, B: H3N2 Infected Vero cell line).
  • Figure 11 shows that the apoptosis is reduced in the Bst-2 mutant Vero cell line significantly increased virus production capacity.
  • Figure 12 shows the increase in virus production when additional expression of Bst-2 cytoplasmic sites removed in the normal NIH / 3T3 cell line.
  • Figure 13 shows the results of using B2K cells that the increase in virus production of Bst-2 deficient cell lines is due to apoptosis inhibition.
  • the function of the Bst-2 gene was lost to allow the virus to be released extracellularly without interfering with the host, and to suppress the cell death, it was confirmed that the cell line with increased virus production capacity could be prepared.
  • productivity means that the virus propagated in the cell is released into the culture medium during the survival of the production cell line, thereby increasing the viral titer of the culture solution.
  • loss of function means mutating a part of the base of the Bst-2 gene to release the intracellular virus into the culture medium.
  • deletion, insertion, knock-out, and gene silencing of the base of the exon1 site are performed. it means.
  • virus means a virus that can cause disease in humans or animals, and preferably means influenza virus, and more preferably selected from the group consisting of P / H1N1, A / H1N1 and A / H3N2. Can be used.
  • the "virus” is not limited to the influenza virus, but may include other disease-causing viruses, and may preferably include herpes virus.
  • apoptosis refers to a process in which a cell actively dies while actively consuming ATP, a bioenergy, and a typical cell death process is cell shrinkage, regular cleavage of DNA, and fragmentation of cell membranes. Proceed by. Apoptosis can be induced when cells fail to maintain their normal function due to abnormal cell division, radiation, ultraviolet light, bacterial infection, or viral infection.
  • the present invention relates to a virus-producing mutant cell line in which Bst-2 gene function is lost in virus-producing cell lines, thereby increasing viral production.
  • the cell line having the virus production ability can be used regardless of the type of cell line used for influenza vaccine development, preferably animal-derived cell line, more preferably MDCK cells, VERO cells or fibroblasts can be used. .
  • the MDCK (Madin-Darby, canine kideney) cell line used in the present invention is epithelial-like cells established in the kidneys of dogs, and VERO cell lines are cells established in the lining of monkeys. The two are the most commonly used cell lines for viral research because of their susceptibility to hepatitis, vaccinia and flu viruses.
  • the variant cell line may be characterized in that a part of the Bst-2 gene is inserted, deleted, overlapped, inverted, substituted or translocated, or the whole is removed or gene silencing.
  • the variant cell line may be characterized in that 1 to 15 bases are deleted at the exon1 site of the Bst-2 gene, or 1 to 15 bases are inserted at the exon1 site.
  • the mutant cell line may be characterized in that 1 to 4 bases of the 45th to 50th bases are deleted or 1 to 3 bases are inserted at the exon1 region of the Bst-2 gene.
  • the mutant cell line may be characterized in that 1 to 12 bases of the 116th to 130th bases are deleted in the exon1 region of the Bst-2 gene.
  • the mutant cell line may be characterized in that the entire 4 th to 90 th bases are deleted at the exon1 site of the Bst-2 gene.
  • a mutant cell line was prepared by inserting or deleting 1 to 15 bases in the exon1 region of the Bst-2 gene represented by SEQ ID NO: 1 or 2.
  • a mutant cell line having increased virus production capacity including the mutated allele was prepared.
  • producing a 45 times to 50 times the base is 1 to 4 deletions to, or to insert one to three mutant cell line
  • the function of the Bst-2 gene is lost from exon1 site of Bst-2 gene of the present invention It may include a cell line having the base sequence of SEQ ID NO: 3 to 8, preferably K-E4, J-C10, J-D10, D-E2, K-G3, J-E2 and H-G5 Can be.
  • SEQ ID NO: 8 ATGGCACCTACGCTTTACCACTACTGGCCTGTGCCCATAACTGACGACGAGTCAGAGTCAATGTCATCAAGTCAGAAGCTGAGCTGGCTGGAGTGGCTGGGCATCTTGGGGATCCCAGTGGTGATGGGTCTGTCTGTGTGGCTCTGATCATCTTTGTTGTCAAGACCAACAGCAAAGCCTGCGGGGATGGCCTCCTAGTAGAGCAGGAGTGTCACAATGTCACCAGCCTCCTGGAGCGCCAACTAACCCAAACCCGGCAAGCGTTACAGGGGACCATGGACCAGGCTACCACCTGCAACAAGACTGTG
  • a mutant cell line having an increased virus production capacity including a mutated allele was prepared by deleting the exon1 base of the Bst-2 gene of the VERO cell line represented by SEQ ID NO: 2.
  • the "translational frame mutation” means that the genetic code can read three bases of a gene as a single frame, and the base code is deleted or inserted in a non-multiple of one, two, or three to read the genetic code. It means a mutation that can change the reading frame.
  • J-D10 of the mutant cells was deposited with accession number KCLRF-BP-00285.
  • the present invention relates to a method for producing a virus-produced mutant cell line with apoptosis suppressed by mutating the Bst-2 gene in a virus-producing cell line.
  • a VERO cell line is used to prepare D-D8 and G-D5 cell lines in which 1 to 12 bases of the Bst-2 gene exon1 region is deleted, and then infected with H1N1 or H3N2 virus. It was confirmed that apoptosis was suppressed in the mutant cell line.
  • the virus-producing mutant cell line with suppressed apoptosis may be characterized in that it is an animal cell line.
  • the animal cell line may be used irrespective of the type of cell line used for influenza vaccine development, and may be preferably selected from the group consisting of MDCK, VERO and mouse fibroblasts.
  • the mutation may be characterized by inserting, deleting, overlapping, inverting, replacing or translocating a part of the exon1 region of the Bst-2 gene, or removing or gene silencing the entire exon1.
  • the exon1 region of the Bst-2 gene may be characterized by encoding the cytoplasmic domain of the Bst-2 protein.
  • wild-type Vero cells kill cells after influenza virus infection and exhibit low virus production
  • Bst-2 mutant Vero cells inhibit cell death and produce up to 50-fold more virus after 3 days It confirmed that it shows the ability.
  • the expression of the Bst-2 gene in which the cytoplasmic site involved in apoptosis was removed in the normal mouse fibroblasts was further inhibited, resulting in an increase in virus production.
  • the virus production capacity was maintained even if the Bst-2 lacking Bst-2 gene with increased viral production capacity was expressed in the cytoplasmic Bst-2 gene.
  • the present invention also relates in another aspect, the increased ability mutant cell line Bst-2 gene is mutated Bst-2 mutant virus that produce the gene is introduced by a virus production cell lines that do not express Bst-2.
  • the Bst-2 mutant gene may be characterized by inserting, deleting, overlapping, inverting, replacing or translocating a part of the exon1 region of the wild type Bst-2 gene, or removing or gene silencing the entire exon1.
  • the present invention infecting the target virus to the mutant cell line with increased virus production capacity; And (b) culturing the cell line infected with the target virus, and then centrifuging the supernatant to obtain the target virus.
  • the cells in which the translation frame shift mutation occurred were placed on a 6-well plate and cultured for 24 to 48 hours, and then inoculated in a culture solution containing influenza virus.
  • the number of cells may be 1 ⁇ 10 4 to 1 ⁇ 10 7 , preferably 5 ⁇ 10 4 to 5 ⁇ 10 6 , and more preferably 1 ⁇ 10 5 to 1 ⁇ 10 6 .
  • the virus inoculated into the culture is preferably infected in 37 ° C. 5% CO 2 incubator for 30 minutes to 2 hours.
  • Infected virus can be cultured for 50-70 hours in a new culture solution, and then the culture medium can be harvested and centrifuged under appropriate conditions to obtain a supernatant. Preferably, 5 minutes to 1500 rpm to 5000 rpm at 4 ° C to 15 ° C. The supernatant can be obtained by centrifugation for 15 minutes.
  • the virus having increased virus production capacity may be used in the manufacture of a vaccine for preventing or treating influenza virus-induced diseases.
  • the present invention provides a method for treating a mutant cell line with increased virus production capacity; (b) culturing the cell line infected with the target virus and then centrifuging the supernatant to obtain the target virus; And (c) attenuating or inactivating the obtained virus of interest.
  • the vaccine composition may additionally include a pharmaceutically acceptable adjuvant or excipient.
  • a pharmaceutically acceptable adjuvant or excipient any one can be used as long as it can achieve the object in the present invention by promoting the formation of antibodies in the body, especially aluminum salts (Al (OH) 3 , ALPO 4 ), squalene (squalene)
  • Al (OH) 3 , ALPO 4 ) aluminum salts
  • squalene squalene
  • At least one selected from sorbitane, sorbitane, polysorbate 80, CpG, liposomes, cholesterol, monophosphoryl lipid A (MPL), and glucopyranosyl lipid A (GLA) is not limited thereto.
  • a pair of TALEN vectors capable of binding to the exon 1 site of the Bst-2 gene represented by SEQ ID NO: 1 after 24 hours of incubation in DMEM complete (GIBCO, USA) medium with / ml streptomycin, and a reporter vector ( A total of 15 ⁇ g of ToolGen, Korea) and a Turbofect reagent (Thermo, USA) were added to the incubating cells and incubated at 37 ° C. with 5% CO 2 for 48 hours.
  • the cultured reactions were divided into 96-wells of 500 cells selectively picked from both GFP and RFP positive cells using FACS Aria (BD Bioscience, USA) to obtain monoclonal cells.
  • lysis buffer 50 mM Tris-Cl, pH8.0, 50 mM EDTA, 1% SDS, 10 mM NaCl, 100 ⁇ g / ml proteinase K
  • 300 ⁇ l was added to the monoclonal cells.
  • 300 ⁇ l of a solution of 1: 1 mixed phenol and chloroform was added to the reaction mixture, followed by centrifugation at 1700 xg for 10 minutes.
  • the supernatant (300 ⁇ l) was transferred to a new tube to resemble and 100% ethanol (600 ⁇ l) and 90 ⁇ l of 3M sodium acetate were added and centrifuged at 1700 ⁇ g for 10 minutes. The supernatant was removed, 1 ml of 70% ethanol was added, and centrifuged at 1700 xg for 2 minutes. After removing the supernatant, the remaining genomic DNA was dried for 3 minutes and then dissolved in 50 ⁇ l of DW. 95 ° C. 5 min, 94 ° C. 30 sec, 60 ° C. 30 sec, 72 ° C.
  • reaction was diluted to 10-3 and 95 ° C. 5 min, 94 ° C. 30 sec, 60 ° C. 30 using NdBst-2-F primer represented by SEQ ID NO: 13 and NdBst-2-R primer represented by SEQ ID NO: 14 Second, polymerase chain reaction was performed once again by repeating 25 cycles under conditions of 72 ° C. for 1 minute and 72 ° C. for 10 minutes.
  • SEQ ID NO: 12 AACCTGACAGGGTCACCTGG
  • the reaction was dropped at 95 ° C. for 5 minutes, 95 ° C. to 85 ° C., at 2 ° C. in 1 second, and then at 0.3 ° C. at 85 ° C. to 25 ° C. in 1 second.
  • the melting / annealing reaction was performed using PCR under the condition of stopping at 16 ° C.
  • the reaction was treated with T7E1 enzyme (ToolGen, Korea) for 15 minutes at 37 ° C., followed by electrophoresis to confirm the size of the reaction product.
  • Cell lines confirmed that mutations occurred due to the addition of a normal PCR reactant size and two bands cut internally by endonuclase (FIG. 1).
  • the PCR reaction was cut using BglII-XbaI, ligation with pUC18 vector, and cultured in a medium containing ampicillin and X-gal-IPTG. White colonies were obtained. The resulting white colonies were selected by sequencing 6 clones for each clone.
  • the cultured reactants were divided into 500-cells selectively selected for both GFP and RFP positive cells in 96-well using FACS Aria (BD Bioscience, USA) to obtain monoclonal cells.
  • lysis buffer 50 mM Tris-Cl, pH8.0, 50 mM EDTA, 1% SDS, 10 mM NaCl, 100 ⁇ g / ml proteinase K
  • 300 ⁇ l was added to the monoclonal cells.
  • 300 ⁇ l of a solution in which phenol and chloroform were mixed 1: 1 was added to the reaction mixture, followed by centrifugation at 1700 xg for 10 minutes.
  • the supernatant (300 ⁇ l) was transferred to a new tube and 100% ethanol (600 ⁇ l) and 90 ⁇ l of 3M sodium acetate were added, followed by centrifugation at 1700 ⁇ g for 10 minutes. The supernatant was removed, and 1 ml of 70% ethanol was added and centrifuged at 1700xg for 2 minutes. After removing the supernatant, the genomic DNA remaining at the bottom was dried for 3 minutes and then dissolved in 50 ⁇ l of DW.
  • the reaction was diluted to 10 -3 and 95 ° C. 5 minutes, 94 ° C. 30 seconds, 60 ° C. 30 seconds, 72 ° C. using an AGM-F primer represented by SEQ ID NO: 15 and an AGM-R primer represented by SEQ ID NO: 16.
  • the polymerase chain reaction was performed once again by repeating 25 cycles under conditions of 1 minute and 72 ° C for 10 minutes.
  • SEQ ID NO: 16 CTTCTCTGCATCCAGGGAAG
  • the reaction was subjected to melting / annealing reaction using PCR under the condition that the reaction temperature was dropped at 2 ° C. at 95 ° C. for 3 minutes and 85 ° C. to 25 ° C. in 1 sec. Let. The resultant was treated with T7E1 enzyme (ToolGen, Korea) for 15 minutes at 37 ° C. for 15 minutes, followed by electrophoresis to confirm the size of the reaction product.
  • Cell line 2 estimated to have had mutations in exon 1 of SEQ ID NO: 2 The dog was confirmed that mutations occurred due to the addition of a normal PCR reactant size and two bands cut internally by endonuclase (FIG. 2). Subsequently, single cells whose Bst-2 mutations were identified were named D-D8 and G-D5.
  • 6-well MDCK wild type cell line and the mutant cell line prepared by Example 1 were seeded at 5 ⁇ 10 4 cells / well and after 48 hours P / H1N1 was infected with 0.01 MOI. After 72 hours, the supernatant was rolled up to measure the titer of the supernatant.
  • the virus production of K-E4 was increased three times to 5 ⁇ 10 4 pfu / ml compared to the virus production of wild type MDCK, 1.8 ⁇ 10 4 pfu / ml, and the virus production of J-C10 was 3 times.
  • Virus production of MDCK increased by 1.2 times to 2.2 ⁇ 10 4 pfu / ml compared to 1.8 ⁇ 10 4 pfu / ml
  • J-D10 virus production was 25 ⁇ 10 4 compared to MDCK virus production of 1.8 ⁇ 10 4 pfu / ml. It was confirmed that 14 times increased to pfu / ml.
  • the cell lines of J-C10 and J-D10 were diluted to 10-3, 10-4, and 10-5 to infect the P / H1N1 virus, and then cultured for 48 hours to confirm that plaques formed by the virus were identified in FIG. 5. Indicated.
  • Example 2 In order to confirm the viral production capacity of the mutant cell line in which the Bst-2 gene is not expressed, the virus production of the wild type VERO cell line and the cell lines D-D8 and G-D5 mutated to the Bst-2 gene exon1 site obtained in Example 2 The ability was compared.
  • VERO wild type cell lines and mutant cell lines prepared by Example 2 were seeded at 5 ⁇ 10 5 cells / well in 12-well and infected with H3N2 at 0.1 MOI after 24 hours. After 60 hours, the supernatant was rolled up to measure the titer of the supernatant.
  • the virus production of D-D8 increased about 3 times from 2.5 ⁇ 10 5 pfu / ml of wild type VERO to 6.5 ⁇ 10 5 pfu / ml, and the virus production of G-D5 Viral production of VERO was increased approximately 8-fold from 2.5 ⁇ 10 5 pfu / ml to 1.9 ⁇ 10 6 pfu / ml.
  • the cell lines of D-D8 and G-D5 were diluted to 10 -2 , 10 -3 and 10 -4 to infect the H3N2 virus, and then cultured for 60 hours to confirm that plaques formed by the virus were shown in FIG. 6. .
  • the cell line mutated so that the Bst-2 gene is not expressed was confirmed that the virus production capacity is increased compared to the wild-type cell line.
  • Bst-2 knockout mice (Isuepgeis, Korea) were crossed with wild type B6 mice (Orientbio, Korea) to prepare Bst-2 hetero mice. Macrophages were obtained from the abdominal cavity of the Bst-2 hetero mice and the knockout mice, and 1 ⁇ 10 6 cells were placed in a 96-well flat bottom plate and treated with LPS (Lipopolysaccharide) at concentrations of 0, 0.01, 0.1 and 1 ⁇ g / ml. Then incubated for 24 hours. Nitrite concentration in the culture was measured using the Griess technique. As a result, the macrophages obtained from Bst-2 knockout mice showed about 60% reduction in nitric oxide production compared to the macrophages obtained from Bst-2 hetero mice (FIG. 7A).
  • LPS Lipopolysaccharide
  • Macrophages were obtained from the abdominal cavity of Bst-2 hetero mice and knockout mice, and 5 ⁇ 10 6 cells were inoculated into 6-well. After 2 hours, cells were attached to a culture dish and treated with LPS at a concentration of 100 ng / ml. After 30 and 90 minutes, protein of cells was obtained using M-PER buffer (Pierce Biotechnology, USA). For each sample, 30 ⁇ g of total protein was separated by size by SDS-PAGE electrophoresis and proteins were attached to PVDF membrane.
  • Anti-Phosphorylated-NF ⁇ B Antibody (Clone 93H1), Anti-NF ⁇ B Antibody (Clone C22B4), Anti-I ⁇ B ⁇ (Clone L35A5) Antibodies were manufactured using Cell Signaling (Cell Signaling Technology, USA). IgG (Goma Biotech, Korea) was used. After antibody reaction, the signal was photosensitized using ECL plus or ELC fempto (Pierce Biotechnology, USA) and photographed with LAS 3000. As a result, it was confirmed that the ratio of phosphorylated NF- ⁇ B in the total NF- ⁇ B decreased by about 90% (FIG. 7B). Thus, it was observed that mutating Bst-2 reduces cell-signaling in cells.
  • Wild-type (WT) Vero cell lines, Bst-2 hetero (D-D8) Vero cell lines, and Bst-2 knockout (G-D5) cell lines were attached to 6-wells each 1 ⁇ 10 6 , and 20 h after seasonal H1N1 ( 8A) or H3N2 (FIG. 8B) influenza were infected with 0.1 MOI, respectively.
  • the appearance of the modified cells was analyzed 48 hours and 72 hours after infection. As a result, most of the normal cells were killed on the first or second day after the virus infection, but the Bst-2 deficient cells maintained the normal cell morphology even on the second day. That is, Bst-2 knockout cell lines (G-D5) maintained normal cell appearance in most cells at 48 and 72 hours, while wild-type cells showed a typical appearance of the apoptosis process in which cell membranes were distorted (FIG. 8). The Bst-2 hetero cell line (D-D8) showed moderate apoptosis between wild type and knockout.
  • phosphatidylserine (PS) present in the intracellular membrane is transferred to the extracellular membrane, which allows detection by staining. Therefore, cells were stained with annexin-V, which recognizes the marker PS, to compare the degree of apoptosis.
  • PS phosphatidylserine
  • Wild-type (WT) Vero cell lines, Bst-2 hetero (D-D8) Vero cell lines, and Bst-2 knockout (G-D5) cell lines were attached to 6-wells each at 1 ⁇ 10 6 , followed by seasonal H1N1 or 20 hours later.
  • H3N2 influenza was infected with 0.1 MOI each. Cells were removed at 48 hours or 72 hours after infection, and PBS was added thereto, followed by centrifugation at 1250 rpm for 4 minutes at room temperature to remove supernatant.
  • Annexin V-FITC BD Biosciences, USA
  • Annexin V attachment buffer were mixed and placed in cells and stained for 15 minutes in the dark.
  • wild-type cells strongly expressed PS on the cell surface 72 hours after H1N1 virus infection, while knockout cell lines (G-D5) still maintained low expression of PS (FIG. 9A).
  • the Bst-2 hetero cell line (D-D8) expresses PS in the midpoint between wild type and knockout cell lines.
  • a mouse fibroblast cell line (B2K) lacking Bst-2 100 ⁇ g of MCA (3-methyl cholanthrene) was injected into the thigh of a 24-week - old Bst-2 knockout mouse (Isuepgezi, Korea). After about four months, the thigh was removed, rinsed in 70% ethanol to remove bacteria, and transferred to a dish containing 10% FBS and RPMI medium, which was then chopped with surgical scissors. 13 ml of digestion solution (500 Unit / ml collagenase IV, 150 Unti / ml DNase I) and 50 pieces of cancer were added to a 50 ml conical tube, and the shaker was run at 250 rpm 37 ° C.
  • MCA 3-methyl cholanthrene
  • MCA 3-methyl cholanthrene
  • MB19 wild-type cancer cell line
  • the thigh was removed, rinsed in 70% ethanol to remove bacteria, and transferred to a dish containing 10% FBS and RPMI medium, which was then chopped with surgical scissors.
  • 13 ml of digestion solution 500 Unit / ml collagenase IV, 150 Unti / ml DNase I
  • 50 pieces of cancer were added to a 50 ml conical tube, and the shaker was run at 250 rpm 37 ° C. for 1 hour and 30 minutes.
  • 1 ⁇ 10 6 B2K cells and MB19 cells were dissolved in 50 ⁇ l of FACS buffer, and 20 ⁇ g / ml of 2.4G2 antibody was added and allowed to react on ice for 20 minutes to block the Fc ⁇ Receptor on the cell surface.
  • Bst-2 biotin (1 ⁇ g / ml) was added to the ice for 30 minutes, 500 ⁇ l FACS buffer was added and centrifuged for 4 minutes at 1250rpm 4 °C to remove the supernatant to remove the residual antibody. And the rest of the antibodies KbDb-APC (0.1 ⁇ g / ml), CD1d-PE (1.5 ⁇ g / ml) or LFA-1 (1 ⁇ g / ml), Streptavidin-PE (0.5 ⁇ g / ml) was added to block the ice Attached from above. After 30 minutes, 500 ⁇ l of FACS buffer was added to remove residual antibody, and centrifuged at 1250 rpm 4 ° C. for 4 minutes.
  • Bst-2 wild-type gene (Flag WT: SEQ ID NO: 17), a cytoplasmic domain (Flag ⁇ CT: SEQ ID NO: 18), or an empty vector were added to the established B2K cells (B2K empty). Introduced.
  • B2K-Flag WT and B2K-Flag V5 ⁇ CT cells were attached to 6-well and 20 hours later, MHV-68 virus was infected with 0.1 MOI. After 1 day (24 hours) or 2 days (48 hours), cell-shaped pictures were taken. As a result, the re-introduction of introducing a Bst-2 gene, remove the cytoplasmic region are determined to be involved in the cell (B2K-Flag WT) in the signal transmission, while the apoptosis is induced at a high speed to the wild-type Bst-2 gene as shown in Figure 10B It was confirmed that apoptosis was still delayed in cells (B2K-FlagV5 ⁇ CT).
  • virus production of the wild type VERO cell line and the cell lines D-D8 and G-D5 mutated to the Bst-2 gene exon1 site obtained in Example 2 The ability was compared.
  • the 6-well VERO wild type cell line and the mutant cell line prepared by Example 2 were seeded at 1 ⁇ 10 6 cells / well and after 24 hours H3N2 was infected with 0.1 MOI. And after 48 hours, 60 hours, or 72 hours, the supernatant was rolled up to measure the titer of the supernatant.
  • the wild-type cell line showed a low virus titer in the culture medium by apoptosis after influenza virus infection, while the mutant cell line was suppressed apoptosis, showing up to 50 times more virus production capacity up to 72 hours Observed, this effect was superior to G-D5 cells G-D8 cells.
  • B2K cells were infected with herpes virus in the same manner as in Example 6-3, and virus production capacities were compared.
  • B2K cells lacking Bst-2 empty
  • B2K cells (Flag-WT) re-introduced wild type Bst-2 gene reduced viral production by approximately 50%. Cell level was shown.
  • B2K cells (V5- ⁇ CT) re-introduced the wild type Bst-2 gene from which the cytoplasmic site was removed did not show such a decrease in virus production capacity, proving that apoptosis suppression is very important for increasing virus production capacity.
  • the cell line with increased virus production capacity of the present invention was proved to be useful not only in the influenza of the above examples but also in the production of other infectious viruses.
  • the cell line in which the function of the Bst-2 gene is lost is superior to the wild-type cell line, so when used as a virus-producing cell line, the virus production yield can be increased, and the prevention and treatment of viral diseases It can be used for the manufacture and study of the desired vaccine.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

본 발명은 바이러스 생산능이 증가된 세포주 및 그 제조방법에 관한 것으로, 더욱 상세하게는, Bst-2(테드린, Tetherin) 유전자 기능이 상실되어 바이러스 생산능이 증가된 세포주 및 그 제조방법에 관한 것이다. 본 발명에 따르면, Bst-2 유전자의 기능이 상실된 세포주는 야생형 세포주에 비해 바이러스 생산능이 우수하므로, 이를 바이러스 생산 세포주로 이용하는 경우, 바이러스 생산 수율을 증가시킬 수 있고, 바이러스성 질병의 예방 및 치료를 목적으로 하는 백신의 제조 및 연구에 사용할 수 있다.

Description

바이러스 생산능이 증가된 세포주 및 그 제조방법
본 발명은 바이러스 생산능이 증가된 세포주 및 그 제조방법에 관한 것으로, 더욱 상세하게는, Bst-2(테드린, Tetherin) 유전자 기능이 상실되어 바이러스 생산능이 증가된 세포주 및 그 제조방법에 관한 것이다.
인플루엔자는 인플루엔자 바이러스 호흡기 감염으로 발생하는 급성 발열성 질환이다. 인플루엔자 바이러스는 구조단백질의 차이에 따라 A, B, C형으로 분류되며 각각에 따라 숙주, 역학과 임상양상에 다소 차이가 있다. 인플루엔자 바이러스는 직경 80~120nm 크기의 구형바이러스로 표면에 부착된 hemagglutinin(HA)와 neuraminidase(NA) 당단백질의 종류에 따라 아형(subtype)이 결정된다. 아형은 주로 A형 인플루엔자를 중심으로 구분하는데 현재 H1~H16까지 16가지의 HA와 N1~N9의 9가지 NA가 발견되어 단순 계산에 의하면 총 144종 (예, H1N1, H1N2)의 아형이 A형 인플루엔자 내에 분포하게 된다(Treanor J.J. et al., In Principles and Practice of Infectious Diseases, 2060-85, 2005).
인플루엔자 백신에는 비활성화백신과 생백신이 있으며, 비활성화백신은 부화란(embryonated egg)에서 배양한 바이러스를 정제하여 포르마린 등으로 비활성화시켜서 만든다. 비활성화시킨 바이러스 전체를 사용하는 전바이러스백신(whole virus vaccine), 에테르 등으로 바이러스 외피(envelope)를 분쇄시킨 분할 백신(split vaccine), hemagglutinin과 neuraminidase 성분을 정제한 아단위 백신(subunit vaccine) 등이 있고, 생백신은 약독화 생백신(live attenuated influenza vaccine, LAIV)이 개발되어 사용되고있다. 전바이러스 백신은 소아에서 부작용을 유발하므로 현재 국내를 비롯하여 세계적으로 잘 사용되지 않으며, 일부 국가에서만 이용되는 실정이다. 반면, 분할백신이나 아단위백신과 같은 성분백신은 매우 안전하며 효과가 인정되어 가장 많이 사용되고 있다. 이외에 면역반응을 증강시키기 위하여 MF-59와 같은 면역 보강제가 포함된 백신이나 바이러스 유사 형태의 소포를 형성하는 virosome 백신 등이 개발되어 일부 국가에서 사용되고 있다(Bridges C.B. et. al., In Vaccines, 259-290, 2008; Belshe R.B. et. al., In Vaccines, 291-309, 2008).
지금까지 인플루엔자에 대한 백신 제조를 위한 바이러스의 생산은 유정란에 바이러스 종균을 접종하여 증식시키는 방법(대한민국 공개특허 제10-2012-0103737A)을 사용하였으나 이는 유정란의 공급 안정성, 알러지 유발 및 바이러스 전파등의 문제점으로 매우 효율이 떨어지는 방법이었다. 백신생산에 쓰이는 무균유정란(Specific pathogen free egg)을 얻기 위해선 외부와 철저히 격리된 무균시설에서 항생제와 백신을 투약하지 않은 상태로 닭을 키우고, 그 닭으로부터 유정란을 생산해야 한다. 이렇게 생산한 무균유정란을 부화장에서 약 10일간 부화시킨 후에 주사기 바늘 등을 이용하여 유정란 내의 배아(embryo) 혹은 요막액(allantoic fluid)에 바이러스를 접종한다. 접종 후 3일간 바이러스를 배양하고 난 후, 배양한 바이러스를 회수하여 분리정제 공정에 들어간다. 이런 과정을 통해 준비된 바이러스는 경우에 따라 불활화(inactivation) 과정을 거친 후에 효과적인 면역반응을 유도하기 위한 면역증강제(adjuvant), 안정제(stabilizer), 보존제(preservative) 등이 첨가되어 백신으로 만들어진다. 이렇게 만들어진 백신은 개별 바이얼 (vial)이나 주사기로 충진(filling)된 후에 검사를 거치고 포장되어 시장에 출시된다. 일본뇌염 바이러스의 경우엔 유정란 외에 젖먹이 쥐(suckling mice)의 뇌에 바이러스를 접종하여 배양하기도 한다.
이런 전통적인 백신 제조 방법은 생산설비를 확장하는 데에 어려움이 따른다. 예를 들어 유정란을 이용한 생산공정을 확장하기 위해선 원재료가 되는 유정란의 추가 공급이 필요하고 이를 위해선 무균시설의 양계장이 확충 되어야만 한다. 이들 시설에서 자란 닭은 면역학적으로 매우 약하기 때문에 일반 닭에 비해 양육하기가 어렵고 철저한 관리가 요구된다. 따라서 이런 시설을 계속 확장하기 위해선 공간적으로나 경제적으로 제한사항이 많다. 또한 조류독감(AI)이나 뉴캐슬병(ND)과 같은 조류 전염병이 창궐할 경우 안정적인 무균유정란 공급에 큰 차질이 생기게 된다.
이런 전통적인 문제점들을 극복하기 위해 오래 전부터 관심을 받아 온 분야가 바로 동물세포배양을 통한 백신의 제조이다(대한민국 공개특허 제10-2012-0033334호). 무균상태에서 동물세포를 대량으로 배양한 후에 바이러스를 동물세포에 감염시켜 백신을 생산하거나 혹은 유전공학적인 방법을 이용해 병원체에서 항체생성을 유도하는 항원 만을 생산하는 방법 등이 여기에 속한다. 동물세포배양을 통한 백신 제조의 가장 큰 장점은 생산규모의 확장성에 있다. 백신생산의 원재료가 되는 동물세포는 배양 규모에 따라 원하는 만큼 확장이 가능하다.
그러나 이런 많은 장점이 있음에도 동물세포배양을 통한 백신생산이 쉽게 이뤄지기 어려운 것은 초기 투자 비용이 너무 크다는 것과 이를 원활하게 운용할 인적 인프라가 부족하다는 것, 그리고 유정란이나 동물을 이용했을 때보다 다소 낮은 단위부피당 수율 때문이다. 동물세포를 이용하여 백신을 생산할 때, 낮은 단위부피당 수율을 극복하기 위해 유전공학기법을 이용하여 우수한 숙주 동물세포주를 개발하려는 시도가 일부 있었지만(Jang J. et al., Appl. Microbiol. Biotechnol, 85:1509-1520, 2010) 아직까지는 걸음마 수준에 불과하다. 따라서 바이러스 생산을 최적화 하기 위한 생산 세포주 탐색, 배양조건의 개선 및 감염조건의 개선 등이 필요하다.
현재 바이러스 백신의 생산을 위한 대표적인 세포주의 예로는, MDCK (Madin-Darby 개 신장에서 유래된 세포), CRUCELL (네델란드)에서 개발된 PerC6 (인간 아데노바이러스 종류 5의 E1 유전자에 삽입하여 유전적으로 변이된 인간 배아 망막세포에서 유래된 세포), VERO(일본, Chiba 내의 Chiba 대학에서 분리한 아프리카 녹색 원숭이 (Cercopithecus aethiops)의 신장 상피 세포에서 유래된 세포), BHK21 (아기 햄스터 신장 세포에서 불멸화시킨 세포)가 있다.
한편, 바이러스가 체내에 감염되면 감염세포에서 바이러스의 증식이 일어나고 증식된 바이러스 입자들은 다시 세포막을 통해 방출(budding out) 되어 주변의 다른 세포들을 재감염시킨다. 바이러스의 감염에 대응하는 세포의 생체 방어 메카니즘의 일환으로 세포막에 Bst-2 유전자가 발현되고 있다. Bst-2는 N말단과 C말단 양쪽에 세포막과 결합하는 부위를 가지고 있어서 마치 세포막에 다리처럼 가운데가 들려진 형태로 발현되는데, C말단은 세포막 중 lipid raft 부위에 위치하고 N말단은 비lipid raft 부위에 존재한다.
Lipid raft 부위에 고정된 C말단 부위의 기능은 현재까지 알려진 바가 없다. 한편, 바이러스가 세포 내부로부터 세포외부로 출아하기 위해 lipid raft 부위에서 빠져나갈 때 Bst-2는 비lipid raft 부위에 고정된 부위를 통해 바이러스 입자가 세포막을 뚫고 나가는 것을 억제한다. 포유동물 세포의 이러한 방어 기작에 대해 일부의 바이러스들은 이를 회피하기 위한 기작으로 Bst-2 유전자의 분해를 촉진하는 단백질을 생산하여 숙주세포의 억제 기능을 우회하기도 한다. 이런 점은 역설적으로 Bst-2 유전자의 기능이 바이러스의 생산 억제에 강력하게 기여함을 보여주고 있다. 그러나 모든 바이러스들이 이러한 기능을 획득한 것은 아니어서 일부의 바이러스 종류, 대표적인 HIV 바이러스의 경우 Vpu 유전자를 통해 Bst-2 유전자의 분해를 촉진하는 기능을 가지고 있을뿐 그 외 대부분의 바이러스들은 아직 Bst-2 유전자를 표적화하는 회피기작을 가지고 있지 않다.
따라서 바이러스를 효율적으로 대량 생산하여, 백신 제조 등에의 응용을 위해서는 Bst-2 유전자의 분해를 촉진하지 않는 바이러스의 경우, 바이러스를 배양하는 동물 세포 등에서 Bst-2 유전자의 기능을 상실 또는 억제할 수 있는 기술 개발이 필요하다.
이에, 본 발명자들은 숙주세포의 바이러스 생산능을 증가시키는 방법을 개발하고자 예의 노력한 결과, Bst-2 유전자의 기능을 억제하는 경우, 바이러스의 세포외 방출이 촉진되고, 숙주세포의 세포사멸이 억제되어 바이러스 생산능이 증가된 바이러스 생산 세포주를 제조할 수 있다는 것을 확인하고, 본 발명을 완성하게 되었다.
본 배경기술 부분에 기재된 상기 정보는 오직 본 발명의 배경에 대한 이해를 향상시키기 위한 것이며, 이에 본 발명이 속하는 기술분야에서 통상의 지식을 가지는 자에게 있어 이미 알려진 선행기술을 형성하는 정보를 포함하지 않을 수 있다.
발명의 요약
본 발명의 목적은 세포사멸(apoptosis)이 억제된 바이러스 생산 변이 세포주의 제조방법을 제공하는데 있다.
본 발명의 다른 목적은 바이러스 생산능이 증가된 바이러스 생산 변이 세포주를 제공하는데 있다.
본 발명의 또 다른 목적은 상기 바이러스 생산능이 증가된 변이 세포주를 이용한 바이러스의 제조방법을 제공하는데 있다.
본 발명의 또 다른 목적은 상기 바이러스 생산량이 증가된 변이 세포주를 이용한 버이러스성 질병에 대한 백신의 제조방법을 제공하는데 있다.
상기 목적을 달성하기 위하여, 본 발명은 바이러스 생산 세포주에서 Bst-2 유전자를 돌연변이 시키는 것을 특징으로 하는 세포사멸(apoptosis)이 억제된 바이러스 생산 변이 세포주의 제조방법.을 제공한다.
본 발명은 또한, 바이러스 생산능이 있는 세포주에서 Bst-2 유전자 기능이 상실되어 바이러스 생산능이 증가된 바이러스 생산 변이 세포주를 제공한다.
본 발명은 또한, Bst-2를 발현하지 않는 바이러스 생산 세포주에 변이된 Bst-2 유전자가 도입되어 있는 바이러스 생산능이 증가된 변이 세포주를 제공한다.
본 발명은 또한, (a) 상기 바이러스 생산능이 증가된 변이 세포주에 목적 바이러스를 감염시키는 단계; 및 (b) 목적 바이러스가 감염된 세포주를 배양한 다음, 상등액을 원심분리하여 목적 바이러스를 수득하는 단계를 포함하는 목적 바이러스의 제조방법을 제공한다.
본 발명은 또한, 상기 바이러스 생산능이 증가된 세포주에 목적 바이러스를 감염시키는 단계;
(b) 목적 바이러스가 감염된 세포주를 배양한 다음, 상등액을 원심분리하여 목적 바이러스를 수득하는 단계; 및 (c) 상기 수득된 목적 바이러스를 약독화 또는 비활성화 하는 단계를 포함하는 바이러스성 질병에 대한 백신의 제조방법을 제공한다.
본 발명의 다른 특징 및 구현예는 다음의 상세한 설명 및 첨부된 특허청구범위로부터 더욱 명백해 질 것이다.
도 1은 중합효소 연쇄 반응시킨 Bst-2 유전자를 돌연변이 시킨 MDCK 세포주의 반응물을 전기영동하여 확인한 결과를 나타낸 것이다.
도 2는 중합효소 연쇄 반응시킨 Bst-2 유전자를 돌연변이 시킨 VERO 세포주의 반응물을 전기영동하여 확인한 결과를 나타낸 것이다.
도 3은 야생형 MDCK 세포와 Bst-2 유전자를 돌연변이 시킨 MDCK 세포주에 바이러스를 감염시킨 후 수득된 상층액을 이용하여 plaque assay를 통해 역가를 측정한 것이다.
도 4는 야생형 VERO 세포와 Bst-2 유전자를 돌연변이 시킨 VERO 세포주에 바이러스를 감염시킨 후 수득된 상층액을 이용하여 plaque assay를 통해 역가를 측정한 것이다.
도 5는 야생형 MDCK 세포와 Bst-2 유전자를 돌연변이 시킨 MDCK 세포주를 희석하여 바이러스를 감염시킨 후 배양한 결과를 나타낸 것이다.
도 6은는 야생형 VERO세포와 Bst-2 유전자를 돌연변이 시킨 VERO 세포주를 희석하여 바이러스를 감염시킨 후 배양한 결과를 나타낸 것이다.
도 7는 Bst-2가 결핍된 세포에서 세포 내 신호전달이 감소하는 것을 나타낸 그림이다(A: 농도별 LPS 처리에 따른 산화질소 생산 비교, B: LPS처리에 따른 NFκB의 인산화 비교).
도 8는 바이러스 감염 후 Bst-2가 결핍된 세포에서 외형적으로 세포사멸(아폽토시스)의 양상이 감소한 것을 나타낸 사진이다(A: H1N1을 감염시킨 Vero 세포주, B: H3N2를 감염시킨 Vero 세포주).
도 9는 바이러스 감염 후 Bst-2가 결핍된 세포에서 세포사멸(아폽토시스)이 감소하는 현상을 아폽토시스의 지표물질인 Phosphatidylserine 염색을 통해 확인한 그림이다(A: H1N1을 감염시킨 Vero 세포주, B: H3N2를 감염시킨 Vero 세포주).
도 10은 Bst-2를 재도입 실험을 통하여 세포질부위(cytoplasmic domain)가 세포사멸에 관여하는 것을 증명한 것이다(A: Bst-2 재도입 후 FACS로 Bst-2 발현 확인, B: MHV68 virus 감염 후 세포사멸 비교).
도 11은 Bst-2 돌연변이 Vero 세포주에서 세포사멸이 감소하여 바이러스 생산능이 매우 유의적으로 증가함을 나타낸 결과이다.
도 12은 정상 NIH/3T3 세포주에 세포질부위가 제거된 Bst-2를 추가 발현시키는 경우 바이러스 생산량이 증가함을 나타낸 결과이다.
도 13은 Bst-2 결핍 세포주의 바이러스 생산량 증가가 세포사멸 억제에 의한 것임을 B2K 세포를 사용하여 증명한 결과이다.
발명의 상세한 설명 및 바람직한 구현예
달리 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로, 본 명세서에서 사용된 명명법 및 이하에 기술하는 실험 방법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
본 발명에서는 Bst-2 유전자의 기능을 상실시켜 바이러스가 숙주의 방해를 받지 않고 세포외 방출될 수 있도록 하고 세포사멸을 억제하여 바이러스 생산능이 증가된 세포주를 제조할 수 있다는 것을 확인하고자 하였다.
본 발명에서 “생산능”이란, 생산 세포주의 생존기간 동안 세포내에서 증식된 바이러스가 배양액으로 방출되어 배양액의 바이러스 역가가 증가한 것을 의미한다.
본 발명에서 “기능 상실”이란, Bst-2 유전자의 염기 일부를 돌연변이 시켜 세포내 바이러스를 배양액으로 방출시키는 것을 의미하며 바람직하게는 exon1 부위의 염기를 결실, 삽입, knock-out 및 gene silencing하는 것을 의미한다.
본 발명에서 “바이러스”란, 사람이나 동물에 질병을 유발할 수 있는 바이러스를 의미하며 바람직하게는 인플루엔자 바이러스를 의미하며 더욱 바람직하게는 P/H1N1, A/H1N1 및 A/H3N2로 구성된 군으로부터 선택되는 것을 사용할 수 있다.
본 발명에서 “바이러스”는 상기 인플루엔자 바이러스에 국한되는 것은 아니며, 다른 질병유발 바이러스를 포함할 수 있고 바람직하게는 헤르페스바이러스를 포함할 수 있다.
본 발명에서 "세포사멸(apoptosis)"이란 세포가 능동적으로 생체에너지인 ATP를 적극적으로 소모하면서 죽음에 이르는 과정을 의미하며, 전형적인 세포사멸과정은 세포의 축소, DNA의 규칙적인 절단 그리고 세포막의 단편화에 의하여 진행된다. 비정상적인 세포분열, 방사선, 자외선, 세균 감염 또는 바이러스 감염 등의 원인으로 세포가 정상적인 기능을 유지하지 못하게 될 경우 세포사멸이 유도될 수 있다.
본 발명은 일 관점에서, 바이러스 생산능이 있는 세포주에서 Bst-2 유전자 기능이 상실되어 바이러스 생산능이 증가된 바이러스 생산 변이 세포주에 관한 것이다.
상기 바이러스 생산능이 있는 세포주는 인플루엔자 백신 개발에 사용되는 세포주를 종류에 상관없이 사용할 수 있으며, 바람직하게는 동물유래 세포주를 사용할 수 있고, 더욱 바람직하게는 MDCK 세포, VERO 세포 또는 섬유아세포를 사용할 수 있다.
본 발명에서 사용된 MDCK(Madin-Darby, canine kideney) 세포주는 개의 신장에서 수립한 상피유사세포이며, VERO 세포주는 원숭이 신장 내막에서 수립한 세포이다. 이 둘은 간염바이러스, 백시니아바이러스 및 독감바이러스 등에 감수성을 나타내므로 바이러스연구에 가장 흔하게 사용되는 세포주이다.
상기 변이 세포주는 Bst-2 유전자의 일부가 삽입, 결실, 중복, 역위, 치환 또는 전좌 되거나, 전체가 제거 또는 gene silencing 되어 있는 것임을 특징으로 할 수 있다.
상기 변이 세포주는 Bst-2 유전자의 exon1 부위에서 1개 내지 15개의 염기가 결실되어 있거나, 상기 exon1 부위에 1개 내지 15개의 염기가 삽입되어 있는 것을 특징으로 할 수 있다.
상기 변이 세포주는 Bst-2 유전자의 exon1 부위에서 45번째 내지 50번째 염기 중 1개 내지 4개의 염기가 결실되어 있거나, 1개 내지 3개의 염기가 삽입되어 있는 것을 특징으로 할 수 있다.
상기 변이 세포주는 Bst-2 유전자의 exon1 부위에서 116번째 내지 130번째 염기 중 1개 내지 12개의 염기가 결실되어 있는 것을 특징으로 할 수 있다.
상기 변이 세포주는 Bst-2 유전자의 exon1 부위에서 부위에서 4번째 내지 90번째 염기 전체가 결실되어 있는 것을 특징으로 할 수 있다.
본 발명에서는 서열번호 1 또는 2로 표시되는 Bst-2 유전자의 exon1 부위의 염기를 1개 내지 15개 삽입 또는 결실시켜 돌연변이 세포주를 제조하고자 하였다.
본 발명의 일 실시예에서는 서열번호 1로 표시되는 MDCK 세포주의 Bst-2 유전자의 exon1 염기를 결실 또는 삽입시켜 돌연변이된 대립유전자를 포함하는 바이러스 생산능이 증가된 돌연변이 세포주를 제조하였다.
서열번호 1:
ATGGCACCTACGCTTTACCACTACTACTGGCCTGTGCCCATAACTGACGAGTCAGAGTCAATGTCATCAAGTCAGAAGCTGAGCTGGCTGGAGTGGCTGGGCATCTTGGGGATCCCAGTGGTGATGGGTCTGTCTGTGGCTCTGATCATCTTTGTTGTCAAGACCAACAGCAAAGCCTGCGGGGATGGCCTCCTAGTAGAGCAGGAGTGTCACAATGTCACCAGCCTCCTGGAGCGCCAACTAACCCAAACCCGGCAAGCGTTACAGGGGACCATGGACCAGGCTACCACCTGCAACAAGACTGTG
본 발명의 다른 실시예에서는 Bst-2 유전자의 exon1 부위에서 45번 내지 50번의 염기가 1개 내지 4개 결실시키거나, 1개 내지 3개 삽입시켜 Bst-2 유전자의 기능이 상실된 돌연변이 세포주를 제조하고자 하였으며 하기 서열번호 3 내지 8의 염기서열을 갖는 세포주를 포함할 수 있고, 바람직하게는 K-E4, J-C10, J-D10, D-E2, K-G3, J-E2 및 H-G5일 수 있다.
서열번호 3:
ATGGCACCTACGCTTTACCACTACTACTGGCCTGTGCCCATAACTGAAGTCAGAGTCAATGTCATCAAGTCAGAAGCTGAGCTGGCTGGAGTGGCTGGGCATCTTGGGGATCCCAGTGGTGATGGGTCTGTCTGTGGCTCTGATCATCTTTGTTGTCAAGACCAACAGCAAAGCCTGCGGGGATGGCCTCCTAGTAGAGCAGGAGTGTCACAATGTCACCAGCCTCCTGGAGCGCCAACTAACCCAAACCCGGCAAGCGTTACAGGGGACCATGGACCAGGCTACCACCTGCAACAAGACTGTG
서열번호 4:
ATGGCACCTACGCTTTACCACTACTACTGGCCTGTGCCCATAACACGAGTCAGAGTCAATGTCATCAAGTCAGAAGCTGAGCTGGCTGGAGTGGCTGGGCATCTTGGGGATCCCAGTGGTGATGGGTCTGTCTGTGGCTCTGATCATCTTTGTTGTCAAGACCAACAGCAAAGCCTGCGGGGATGGCCTCCTAGTAGAGCAGGAGTGTCACAATGTCACCAGCCTCCTGGAGCGCCAACTAACCCAAACCCGGCAAGCGTTACAGGGGACCATGGACCAGGCTACCACCTGCAACAAGACTGTG
서열번호 5:
ATGGCACCTACGCTTTACCACTACTACTGGCCTGTGCCCATAACTAGTCAGAGTCAATGTCATCAAGTCAGAAGCTGAGCTGGCTGGAGTGGCTGGGCATCTTGGGGATCCCAGTGGTGATGGGTCTGTCTGTGGCTCTGATCATCTTTGTTGTCAAGACCAACAGCAAAGCCTGCGGGGATGGCCTCCTAGTAGAGCAGGAGTGTCACAATGTCACCAGCCTCCTGGAGCGCCAACTAACCCAAACCCGGCAAGCGTTACAGGGGACCATGGACCAGGCTACCACCTGCAACAAGACTGTG
서열번호 6:
ATGGCACCTACGCTTTACCACTACTACTGGCCTGTGCCCATAACTGAGTCAGAGTCAATGTCATCAAGTCAGAAGCTGAGCTGGCTGGAGTGGCTGGGCATCTTGGGGATCCCAGTGGTGATGGGTCTGTCTGTGGCTCTGATCATCTTTGTTGTCAAGACCAACAGCAAAGCCTGCGGGGATGGCCTCCTAGTAGAGCAGGAGTGTCACAATGTCACCAGCCTCCTGGAGCGCCAACTAACCCAAACCCGGCAAGCGTTACAGGGGACCATGGACCAGGCTACCACCTGCAACAAGACTGTG
서열번호 7:
ATGGCACCTACGCTTTACCACTACTACTGGCCTGTGCCCATAACGAGTCAGAGTCAATGTCATCAAGTCAGAAGCTGAGCTGGCTGGAGTGGCTGGGCATCTTGGGGATCCCAGTGGTGATGGGTCTGTCTGTGGCTCTGATCATCTTTGTTGTCAAGACCAACAGCAAAGCCTGCGGGGATGGCCTCCTAGTAGAGCAGGAGTGTCACAATGTCACCAGCCTCCTGGAGCGCCAACTAACCCAAACCCGGCAAGCGTTACAGGGGACCATGGACCAGGCTACCACCTGCAACAAGACTGTG
서열번호 8: ATGGCACCTACGCTTTACCACTACTACTGGCCTGTGCCCATAACTGACGACGAGTCAGAGTCAATGTCATCAAGTCAGAAGCTGAGCTGGCTGGAGTGGCTGGGCATCTTGGGGATCCCAGTGGTGATGGGTCTGTCTGTGGCTCTGATCATCTTTGTTGTCAAGACCAACAGCAAAGCCTGCGGGGATGGCCTCCTAGTAGAGCAGGAGTGTCACAATGTCACCAGCCTCCTGGAGCGCCAACTAACCCAAACCCGGCAAGCGTTACAGGGGACCATGGACCAGGCTACCACCTGCAACAAGACTGTG
본 발명의 또 다른 실시예에서는 서열번호 2로 표시되는 VERO 세포주의 Bst-2 유전자의 exon1 염기를 결실시켜 돌연변이된 대립유전자를 포함하는 바이러스 생산능이 증가된 돌연변이 세포주를 제조하였다.
서열번호 2:
ATGGCACCTATTTTGTATGACTATTGCAAAATGCCCATGGATGACATTTGCAAGGAAGACAGGGACAAGTGCTGTAAACTGGCCGTAGGAATTCTGGGGCTCCTGGTCATAGTGCTTCTGGGGGTGCCCCTGATTTTCTTCATCATCAAGGCCAACAGCGAGGCCTGCCAGGATGGCCTCCGGGCAGTGATGGAGTGTCACAATGTCACCTATCTCCTGCAACAAGAGCTGGCCGAGGCCCAGCGGGGCTTTCGGGACGCAGAGGCCCAGGCTGTCACCTGCAACCAGACTGTG
본 발명의 또다른 실시예에서는 Bst-2 유전자의 exon1 부위에서 116번 내지 130번의 염기를 1개 내지 12개 결실시켜 Bst-2 유전자의 기능이 상실된 돌연변이 세포주를 제조하고자 하였으며 하기 서열번호 9 및 10의 염기서열을 갖는 세포주를 포함할 수 있고, 바람직하게는 D-D8 및 G-D5일 수 있다.
서열번호 9:
ATGGCACCTATTTTGTATGACTATTGCAAAATGCCCATGGATGACATTTGCAAGGAAGACAGGGACAAGTGCTGTAAACTGGCCGTAGGAATTCTGGGGCTCCTGGTCATAGTGCCCCTGATTTTCTTCATCATCAAGGCCAACAGCGAGGCCTGCCAGGATGGCCTCCGGGCAGTGATGGAGTGTCACAATGTCACCTATCTCCTGCAACAAGAGCTGGCCGAGGCCCAGCGGGGCTTTCGGGACGCAGAGGCCCAGGCTGTCACCTGCAACCAGACTGTG
서열번호 10:
ATGGCACCTATTTTGTATGACTATTGCAAAATGCCCATGGATGACATTTGCAAGGAAGACAGGGACAAGTGCTGTAAACTGGCCGTAGGAATTCTGGGGCTCCTGGTCATAGTGCTTCTGGGGGTGCCCTGATTTTCTTCATCATCAAGGCCAACAGCGAGGCCTGCCAGGATGGCCTCCGGGCAGTGATGGAGTGTCACAATGTCACCTATCTCCTGCAACAAGAGCTGGCCGAGGCCCAGCGGGGCTTTCGGGACGCAGAGGCCCAGGCTGTCACCTGCAACCAGACTGTG
본 발명에서는 제조된 돌연변이 세포주의 염기서열을 분석한 결과, MDCK 세포의 K-E4, J-C10 및 J-D10 세포에서 대립유전자 모두에 해독틀 이동 돌연변이가 발생된 것을 확인할 수 있었다.
본 발명에서 “해독틀 이동 돌연변이”란, 유전 암호는 유전자의 염기 3개를 하나의 틀로서 읽을 수 있는데, 염기가 1개, 2개 또는 3의 배수가 아닌 수로 결실 또는 삽입되어 유전암호를 읽을 수 있는 해독틀이 달라지는 돌연변이를 의미한다.
상기 돌연변이 세포중 J-D10은 기탁번호 KCLRF-BP-00285로 기탁되었다.
본 발명은 다른 관점에서, 바이러스 생산세포주에서 Bst-2 유전자를 돌연변이시키는 것을 특징으로 하는 세포사멸(apoptosis)이 억제된 바이러스 생산 변이 세포주의 제조방법에 관한 것이다.
본 발명의 일 실시예에서는, VERO 세포주를 사용하여 Bst-2 유전자 exon1 부위의 염기를 1개 내지 12개 결실시킨 D-D8 및 G-D5세포주를 제조한 다음, H1N1 또는 H3N2 바이러스로 감염시키는 경우 돌연변이 세포주에서 세포사멸이 억제되는 것을 확인하였다.
상기 세포사멸이 억제된 바이러스 생산 변이 세포주는 동물세포주인 것을 특징으로 할 수 있다.
상기 동물세포주는 인플루엔자 백신 개발에 사용되는 세포주를 종류에 상관없이 사용할 수 있으며, 바람직하게는 MDCK, VERO 및 생쥐 섬유아세포로 구성된 군에서 선택되는 것을 특징으로 할 수 있다.
상기 돌연변이는 Bst-2 유전자의 exon1 부위 일부를 삽입, 결실, 중복, 역위, 치환 또는 전좌 시키거나, exon1 전체를 제거 또는 gene silencing 시키는 것을 특징으로 할 수 있다.
상기 Bst-2 유전자의 exon1 부위는 Bst-2 단백질의 세포질부위(cytoplasmic domain)를 암호화하고 있는 것을 특징으로 할 수 있다.
본 발명의 또 다른 실시예에서는, Bst가 결여된 생쥐 섬유아세포에 야생형 Bst-2 유전자를 도입하는 경우 야생형세포주와 유사한 세포사멸이 나타나지만, 세포질부위(cytoplasmic domain)를 제거한 Bst-2 유전자를 도입하는 경우 Bst-2 결여 세포주처럼 세포사멸이 억제되는 것을 확인하였다.
본 발명의 또 다른 실시예에서는, 야생형 Vero 세포는 인플루엔자바이러스 감염 후 세포가 사멸되어 낮은 바이러스 생산능을 보이는 반면, Bst-2 변이 Vero 세포는 세포사멸이 억제되어 3일 후 최대 50배 이상의 바이러스 생산능을 나타내는 것을 확인하였다.
본 발명의 또 다른 실시예에서는, 정상 생쥐 섬유아세포에 세포사멸에 관여하는 세포질부위가 제거된 Bst-2 유전자를 추가로 발현시켜 정상유전자의 기능을 방해한 결과, 바이러스 생산능이 증가함을 관찰하였고, 바이러스 생산능이 증대된 Bst-2 결여 B2K 세포주에 세포질부위가 제가된 Bst-2 유전자를 발현시켜도 바이러스 생산능이 유지되는 것을 관찰하여 바이러스 생산능의 증가가 세포사멸의 억제에 의한 것임을 증명하였다.
따라서 본 발명은 또 다른 관점에서, Bst-2를 발현하지 않는 바이러스 생산 세포주에 Bst-2 유전자가 변이된 Bst-2 변이 유전자가 도입되어 있는 바이러스 생산능이 증가된 변이 세포주에 관한 것이다.
상기 Bst-2 변이 유전자는 야생형(Wild type) Bst-2 유전자의 exon1 부위 일부를 삽입, 결실, 중복, 역위, 치환 또는 전좌 시키거나, exon1 전체를 제거 또는 gene silencing 시키는 것을 특징으로 할 수 있다.
본 발명은 또 다른 관점에서, (a) 상기 바이러스 생산능이 증가된 변이 세포주에 목적 바이러스를 감염시키는 단계; 및 (b) 목적 바이러스가 감염된 세포주를 배양한 다음, 상등액을 원심분리하여 목적 바이러스를 수득하는 단계를 포함하는 목적 바이러스의 제조방법에 관한 것이다.
본 발명에서는 상기 해독틀 이동 돌연변이가 일어난 세포를 6-well plate에 깔고 24시간 내지 48시간동안 배양 후, 인플루엔자 바이러스가 들어있는 배양액에 접종하였다.
세포의 수는 1×104 내지 1×107 일 수 있으며, 바람직하게는 5×104 내지 5×106 일수 있고, 더욱 바람직하게는 1×105 내지 1×106 일 수 있다.
상기 배양액에 접종된 바이러스는 30분 내지 2시간 동안 37℃ 5% CO2 인큐베이터에서 감염시키는 것이 바람직하다.
감염시킨 바이러스는 새로운 배양액을 넣어 50~70시간 동안 배양한 후, 배양액을 걷어 적절한 조건으로 원심분리하여 상층액을 수득할 수 있고, 바람직하게는 4℃ 내지 15℃에서 1500rpm 내지 5000rpm으로 5분 내지 15분간 원심분리하여 상층액을 수득할 수 있다.
본 발명에서는 Bst-2 유전자가 발현되지 않는 돌연변이 세포주에 바이러스를 감염시 형성되는 플라그를 확인하고자 하였다.
상기 세포주를 배양액에 희석하고 바이러스를 감염시켜 배양한 결과 돌연변이 세포주의 바이러스 생산능이 증가함을 알 수 있었다.
상기 바이러스 생산능이 증가된 바이러스는 인플루엔자 바이러스 유발 질병을 예방 혹은 치료하기 위한 백신의 제조에 사용할 수 있다.
따라서, 본 발명은 또 다른 관점에서, (a) 상기 바이러스 생산능이 증가된 변이 세포주에 목적 바이러스를 감염시키는 단계; (b) 목적 바이러스가 감염된 세포주를 배양한 다음, 상등액을 원심분리하여 목적 바이러스를 수득하는 단계; 및 (c) 상기 수득된 목적 바이러스를 약독화 또는 비활성화 하는 단계를 포함하는 바이러스성 질병에 대한 백신의 제조방법에 관한 것이다.
상기 백신 조성물에는 약학적으로 허용가능한 면역보조제(adjuvant) 또는 부형제가 추가적으로 포함될 수 있다. 면역보조제로는 체내에 주입시 항체 형성을 증진시키는 역할을 하여 본 발명에서의 목적 달성이 가능한 것이라면 어떤 것이라도 사용가능하며, 특히 알루미늄염(Al(OH)3, ALPO4), 스쿠알렌(squalene), 소르비탄(sorbitane), 폴리소르베이트 80(polysorbate 80), CpG, 리포좀, 콜레스테롤, MPL(monophosphoryl lipid A) 및 GLA(glucopyranosyl lipid A)에서 선택된 하나 이상이 바람직하지만, 이에 한정되는 것은 아니다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는 것은 당 업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1. Bst-2가 돌연변이된 MDCK 세포주의 제조 및 돌연변이 확인
100φ 배양접시에 고려대 송문정교수님 실험실에서 분양받은 5×105개의 야생형 MDCK 세포주를 10% FBS, 2 mM L-glutamine, 5 μM β-mercaptoethanol, 10 ㎍/ml gentamicine, 50 U/ml penicillin, 50 ㎍/ml streptomycin 가 첨가된 DMEM complete (GIBCO, 미국) 배지에서 24시간 배양후, 서열번호 1로 표시되는 Bst-2 유전자의 exon 1 부위와 결합 가능한 TALEN 벡터(ToolGen, 한국)1쌍, 리포터 벡터(ToolGen, 한국)1개 및 Turbofect reagent(Thermo, 미국)를 섞은 총 15㎍을 배양중인 세포에 넣고 48시간 동안 37℃ 5% CO2의 조건으로 배양하였다.
상기 배양된 반응물을 FACS Aria(BD Bioscience, 미국)를 이용하여 GFP와 RFP에 모두 양성인 세포를 선택적으로 고른 500개의 세포를 96-well에 분주하여 단일 클론 세포를 수득하였다.
상기 수득된 단일 클론 세포의 돌연변이 여부를 확인하기 위하여, 단일 클론 세포에 lysis 버퍼(50mM Tris-Cl, pH8.0, 50mM EDTA, 1% SDS, 10mM NaCl, 100㎍/ml proteinase K)(300㎕)를 추가하여 54℃에서 16시간 반응시켰다. 그리고 반응물에 페놀과 클로로폼이 1:1로 섞인 용액 300㎕을 추가하여 섞은후 1700 xg에서 10분간 원심분리하였다. 상층액 (300㎕)을 새 튜브에 옮겨 닮고 100% 에탄올(600㎕)와 3M 아세트산나트륨 90㎕을 첨가한 후 1700xg에서 10분간 원심분리하였다. 상층액은 제거하고 70% 에탄올 1㎖을 넣어 1700 xg에서 2분간 원심분리하고 상층액을 제거한 후 바닥에 남아있는 genomic DNA를 3분간 말린 후 DW 50㎕에 다시 녹였다. 상기 추출한 Genomic DNA에 서열번호 11로 표시되는 dBst-2-F primer 및 서열번호 12로 표시되는 dBst-2-R primer를 이용하여 95℃ 5분, 94℃ 30초, 60℃ 30초, 72℃ 1분, 72℃ 10분의 조건으로 25사이클을 반복하여 중합효소 연쇄반응을 실시하였다.
상기 반응물을 10-3으로 희석하여 서열번호 13으로 표시되는 NdBst-2-F primer 및 서열번호 14로 표시되는 NdBst-2-R primer를 이용하여 95℃ 5분, 94℃ 30초, 60℃ 30초, 72℃ 1분, 72℃ 10분의 조건으로 25사이클을 반복하여 다시 한번 중합효소 연쇄반응을 실시하였다.
서열번호 11: GGTCAGGATGGCTCCTATGC
서열번호 12: AACCTGACAGGGTCACCTGG
서열번호 13: GTAGCCCCAGCCAAAGGTTTC
서열번호 14: AGGCCTCCCCATGCCCAAAC
상기 반응물의 표적부위에 돌연변이를 확인하기 위하여 반응물을 95℃ 5분, 95℃에서 85℃까지 1초에 2℃씩 온도를 떨어뜨린 후 85℃에서 25℃까지 1초에 0.3℃씩 떨어뜨린 후 16℃에서 정지하는 조건으로 PCR을 이용하여 melting/annealing 반응을 시켰다. 그리고 수득된 반응물에 T7E1 효소(ToolGen, 한국)를 처리하여 37℃에서 15분간 반응 시킨 후 전기영동하여 반응물의 사이즈를 확인한 결과, 서열번호 2로 표시되는 exon 1부위에 돌연변이가 일어났을 것으로 추정되는 세포주들은 정상적인 PCR 반응물 사이즈와 핵산내가수분해효소(endonuclase)에 의해 내부가 절단된 2개의 밴드가 추가로 생겨 돌연변이가 일어났음을 확인하였다(도 1).
상기 돌연변이가 확인된 세포주들의 염기서열을 분석하기 위해, 상기 PCR 반응물을 BglII-XbaI을 이용하여 자르고, pUC18 벡터와 결찰(ligation)한 후, ampicillin과 X-gal-IPTG가 들어었는 배지에 배양하여 흰색 콜로니를 수득하였다. 수득된 흰색 콜로니를 각 클론별로 6개씩 선택하여 염기서열 분석하였다.
그 결과, Bst-2의 exon 1 부위의 염기가 결실 또는 삽입된 돌연변이 세포주 7개(K-E4, J-C10, J-D10, D-E2, K-G3, J-E2 및 H-G5)중 3개(K-E4, J-C10, J-D10)는 한 쌍의 대립유전자 모두에서 해독틀 이동 돌연변이가 발생된 것을 확인하였다.
실시예 2: Bst-2가 돌연변이된 VERO 세포주의 제조 및 돌연변이 확인
100φ 배양접시에 University of Southern California, Chengyu Liang 실험실에서 분양받은 5×105 개의 야생형 VERO 세포주를 10% FBS, 2 mM L-glutamine, 5 μM β-mercaptoethanol, 10 ㎍/ml gentamicine, 50 U/ml penicillin, 50 ㎍/ml streptomycin 가 첨가된 DMEM complete (GIBCO, 미국) 배지에서 24시간 배양 후, 서열번호 2로 표시되는 Bst-2 유전자의 exon 1 부위와 결합 가능한 L1-DAW 및 R1-RR로 구성된 TALEN 벡터(ToolGen, 한국)1쌍, 리포터 벡터(ToolGen, 한국)1개 및 Turbofect reagent(Thermo, 미국)를 섞은 총 12㎍을 배양중인 세포에 넣고 48시간 동안 37℃ 5% CO2의 조건으로 배양하였다.
상기 배양된 반응물을 FACS Aria(BD Bioscience, 미국)를 이용하여 GFP와 RFP에 모두 양성인 세포를 선택적으로 고른 500개의 세포를 96-well에 분주하여 단일 클론세포를 수득하였다.
상기 수득된 단일 클론 세포의 돌연변이 여부를 확인하기 위하여, 단일 클론세포에 lysis 버퍼(50mM Tris-Cl, pH8.0, 50mM EDTA, 1% SDS, 10mM NaCl, 100㎍/ml proteinase K)(300㎕)를 추가하여 54℃에서 16시간 반응시켰다. 그리고 반응물에 페놀과 클로로폼이 1:1로 섞인 용액 300㎕을 추가하여 섞은 후 1700 xg 에서 10분간 원심분리하였다. 상층액 (300㎕)을 새 튜브에 옮겨 담고 100% 에탄올(600㎕)와 3M 아세트산나트륨 90㎕을 첨가한후 1700 xg 에서 10분간 원심분리하였다. 상층액은 제거하고 70% 에탄올 1㎖을 넣어 1700xg에서 2분간 원심분리하고 상층액을 제거한 후 바닥에 남아있는 genomic DNA를 3분간 말린 후 DW 50㎕에 다시 녹였다. 상기 추출한 Genomic DNA에 서열번호 11로 표시되는 dBst-2-F primer 및 서열번호 16으로 표시되는 AGM-R primer를 이용하여 95℃ 5분, 94℃ 30초, 60℃ 30초, 72℃ 1분, 72℃ 10분의 조건으로 25사이클을 반복하여 중합효소 연쇄반응을 실시하였다.
상기 반응물을 10-3으로 희석하여 서열번호 15로 표시되는 AGM-F primer 및 서열번호 16으로 표시되는 AGM-R primer를 이용하여 95℃ 5분, 94℃ 30초, 60℃ 30초, 72℃ 1분, 72℃ 10분의 조건으로 25사이클을 반복하여 다시 한번 중합효소 연쇄반응을 실시하였다.
서열번호 15: GAGGGGGAGATCTGGATGG
서열번호 16: CTTCTCTGCATCCAGGGAAG
상기 반응물의 표적부위에 돌연변이를 확인하기 위하여 반응물을 95℃ 3분, 85℃에서 25℃까지 1초에 2℃씩 온도를 떨어뜨린 후 16℃에서 정지하는 조건으로 PCR을 이용하여 melting/annealing 반응을 시켰다. 그리고 수득된 반응물에 T7E1 효소(ToolGen, 한국)를 처리하여 37℃에서 15분간 반응 시킨 후 전기영동하여 반응물의 사이즈를 확인한 결과, 서열번호 2의 exon 1부위에 돌연변이가 일어났을 것으로 추정되는 세포주 2개는 정상적인 PCR 반응물 사이즈와 핵산내가수분해효소(endonuclase)에 의해 내부가 절단된 2개의 밴드가 추가로 생겨 돌연변이가 일어났음을 확인하였다(도2). 이 후 Bst-2 돌연변이가 확인된 단일세포의 이름을 D-D8 및 G-D5라고 명명하였다.
실시예 3: Bst-2 가 돌연변이된 MDCK 세포주의 바이러스 생산능
Bst-2 유전자가 발현되지 않는 돌연변이 세포주의 바이러스 생산능을 확인하기 위해, 야생형 MDCK 세포주와 실시예 1에서 수득된 Bst-2 유전자 exon1 부위에 해독틀 이동 돌연변이가 일어난 세포주 K-E4, J-C10, J-D10의 바이러스 생산능을 비교하였다.
6-well에 MDCK 야생형 세포주 및 실시예 1에 의해 제조된 돌연변이 세포주를 5×104 cells/well로 seeding하고 48시간 후 P/H1N1을 0.01 MOI로 감염시켰다. 그리고 72시간 후 상층액을 걷어 상층액의 역가를 측정하였다.
그 결과, 도 3에 나타낸 바와 같이 K-E4의 바이러스 생산량은 야생형 MDCK의 바이러스 생산량 1.8×104 pfu/ml에 비해 5×104 pfu/ml로 3배 증가하였고, J-C10의 바이러스 생산량은 MDCK의 바이러스 생산량 1.8×104 pfu/ml에 비해 2.2×104 pfu/ml로 1.2배 증가하였으며, J-D10의 바이러스 생산량은 MDCK의 바이러스 생산량 1.8×104pfu/ml에 비해 25×104 pfu/ml로 14배 증가한 것을 확인할 수 있었다.
또한, J-C10, J-D10의 세포주를 10-3, 10-4 및 10-5 로 희석하여 P/H1N1 바이러스를 감염시킨 후 48시간동안 배양하여 바이러스가 형성하는 플라그를 확인한 것을 도5에 나타내었다.
따라서, Bst-2 유전자가 발현되지 않도록 해독틀 이동 돌연변이가 일어난 세포주는 야생형 세포주에 비해 바이러스 생산능이 증가됨을 확인할 수 있었다.
실시예 4: Bst-2 가 돌연변이된 VERO 세포주의 바이러스 생산능
Bst-2 유전자가 발현되지 않는 돌연변이 세포주의 바이러스 생산능을 확인하기 위해, 야생형 VERO 세포주와 실시예 2에서 수득된 Bst-2 유전자 exon1 부위에 돌연변이가 일어난 세포주 D-D8 및 G-D5의 바이러스 생산능을 비교하였다.
12-well에 VERO 야생형 세포주 및 실시예 2에 의해 제조된 돌연변이 세포주를 5×105 cells/well로 seeding하고 24시간 후 H3N2를 0.1 MOI로 감염시켰다. 그리고 60시간 후 상층액을 걷어 상층액의 역가를 측정하였다.
그 결과, 도 4에 나타낸 바와 같이 D-D8의 바이러스 생산량은 야생형 VERO의 바이러스 생산량 2.5×105 pfu/ml에서 6.5×105 pfu/ml로 약 3배 증가하였고, G-D5의 바이러스 생산량은 VERO의 바이러스 생산량 2.5×105 pfu/ml에서 1.9×106 pfu/ml로 약 8배 증가한 것을 확인할 수 있었다.
또한, D-D8 및 G-D5의 세포주를 10-2, 10-3 및 10-4 로 희석하여 H3N2 바이러스를 감염시킨 후 60시간동안 배양하여 바이러스가 형성하는 플라그를 확인한 것을 도6에 나타내었다.
따라서, Bst-2 유전자가 발현되지 않도록 돌연변이가 일어난 세포주는 야생형 세포주에 비해 바이러스 생산능이 증가됨을 확인할 수 있었다.
실시예 5: Bst-2 가 세포 내 신호전달에 미치는 효과
Bst-2 녹아웃 생쥐(이수엡지스, 한국)를 야생형 B6 생쥐(오리엔트바이오, 한국)와 교배하여 Bst-2 헤테로 생쥐를 제조하였다. 상기 Bst-2 헤테로 생쥐와 녹아웃 생쥐의 복강에서 대식세포를 얻어 96-well flat bottom plate에 1×106 개의 세포를 넣고 LPS (Lipopolysaccharide)를 0, 0.01, 0.1 그리고 1 ㎍/ml의 농도로 처리한 다음 24시간 동안 배양하였다. 배양액 속의 Nitrite의 농도는 Griess 기법을 이용하여 측정하였다. 그 결과 Bst-2 헤테로 생쥐에서 얻은 대식세포에 비해 Bst-2 녹아웃 생쥐에서 얻은 대식세포는 약 60%의 산화질소 생산 감소가 나타났다(도 7A).
Bst-2 헤테로 생쥐와 녹아웃 생쥐의 복강에서 대식세포를 얻어 6-well에 5×106 개를 접종하고 2시간을 기다려 세포를 배양접시에 부착시킨 후 LPS를 100 ng/㎖ 농도로 처리하였다. 30분, 90분 후에 세포의 단백질을 M-PER 버퍼(Pierce Biotechnology, USA)를 이용해 얻었다. 각 샘플마다 전체 단백질 30㎍을 SDS-PAGE 전기영동을 걸어 크기별로 분리하고 PVDF membrane에 단백질을 부착시켰다. 항 인산화-NFκB 항체(클론 93H1), 항 NFκB 항체(클론 C22B4), 항 IκBα(클론 L35A5) 항체는 Cell Signaling(Cell Signaling Technology, USA) 제품을 사용하였고, 2차 항체는 HRP가 붙어있는 항 토끼 IgG (고마바이오텍, 한국)를 사용하였다. 항체반응 후 ECL plus 또는 ELC fempto (Pierce Biotechnology, USA)사용하여 신호를 감광시킨 후 LAS 3000로 사진을 찍었다. 그 결과 전체 NF-κB 중 인산화된 NF-κB의 비율이 약 90% 감소하는 것을 확인하였다(도 7B). 따라서, Bst-2를 돌연변이시킬 경우 세포내의 세포-신호전달이 감소되는 것을 관찰하였다.
실시예 6: Bst-2가 결여된 세포주의 아폽토시스 지연
6-1. 바이러스를 감염시킨 세포주의 세포사멸(apoptosis) 관찰
야생형 (WT) Vero 세포주, Bst-2 헤테로 (D-D8) Vero 세포주, Bst-2 녹아웃 (G-D5) 세포주를 6-well에 각각 1×106 개씩 부착시키고, 20시간 후에 계절형 H1N1(도 8A) 또는 H3N2(도 8B) 인플루엔자를 각각 0.1 MOI로 감염시켰다.
감염 48시간 72시간 뒤 변형된 세포의 외형을 분석하였다. 그 결과 정상세포는 대부분이 바이러스 감염 후 제 1일차 혹은 2일차에서 사멸되었지만, Bst-2 결핍 세포들은 2일차에서도 상당수가 정상적인 세포형태를 유지하고 있었다. 즉, 야생형 세포들이 세포막이 일그러지는 아폽토시스 과정의 전형적인 외형을 보여주는 반면 Bst-2 녹아웃 세포주(G-D5)는 48시간 및 72시간에서 대부분의 세포에서 정상적인 세포외형을 유지하고 있었다(도 8). Bst-2 헤테로 세포주(D-D8)의 경우는 야생형과 녹아웃의 중간정도의 아폽토시스를 보였다.
6-2. 바이러스를 감염시킨 세포주의 Phosphatidylserine 발현 관찰
아폽토시스가 진행되면 세포내막에 존재하는 phosphatidylserine(PS)이 세포외막으로 이동하기 때문에 염색에 의한 검출이 가능하다. 따라서 아폽토시스의 정도를 비교하기 위하여 지표물질인 PS를 인식하는 annexin-V로 세포를 염색하였다.
야생형 (WT) Vero 세포주, Bst-2 헤테로 (D-D8) Vero 세포주, Bst-2 녹아웃 (G-D5) 세포주를 6-well에 각각 1×106 개씩 부착시키고, 20시간 후에 계절형 H1N1 또는 H3N2 인플루엔자를 각각 0.1 MOI로 감염시켰다. 감염 48시간 또는 72시간에 세포를 떼어내고, PBS를 넣어 1250rpm, 4분, 실온의 조건으로 원심분리하여 상층액을 제거했다. Annexin V-FITC (BD Biosciences, USA)와 Annexin V 부착 버퍼를 섞어 세포에 넣고 어두운 곳에서 15분간 두어 염색하였다.
그 결과 야생형 세포가 H1N1 바이러스 감염 후 72시간째에 PS를 세포표면에 강하게 발현하는 반면 녹아웃 세포주(G-D5)는 여전히 PS의 발현을 낮은 수준으로 유지하고 있었다(도 9A). Bst-2 헤테로 세포주(D-D8)은 야생형과 녹아웃 세포주의 중간정도로 PS를 발현하고 있었다.
한편, H3N2 바이러스 감염시에도 동일한 양상을 나타내는 것을 관찰하였다(도 9B). 즉, Bst-2 유전자의 발현 정도가 억제될수록 아폽토시스의 진행을 나타내는 Annexin V의 발현 또한 감소하는 것으로 나타났다.
6-3. Bst-2 재도입 세포주의 아폽토시스 증가
Bst-2가 결여된 생쥐 fibroblast 세포주 (B2K)를 생산하기 위하여 24주령의 Bst-2 녹아웃 생쥐(이수엡지스, 한국)의 허벅지에 MCA (3-methyl cholanthrene) 100㎍을 주사하였다. 약 4개월 후 허벅지에 생긴 암을 떼어낸 후 70% 에탄올에 헹궈 박테리아를 제거하고, 10% FBS와 RPMI 배지가 담긴 dish로 옮겨 수술용 가위로 잘게 잘랐다. 50㎖ conical tube에 digestion solution (500 Unit/㎖ collagenase IV, 150 Unti/㎖ DNase I) 13㎖과 암 조각들을 넣고 shaker에서 250 rpm 37℃에서 1시간 30분 동안 돌렸다. 10㎖ 피펫으로 3~5차례 피펫팅하여 조각들을 더 풀어준 후 새로운 50㎖ conical tube에 nylon mesh로 필터 하여 담았다. 1250 rpm 으로 5분간 원심분리하여 상층액은 제거한 후 펠렛은 새로운 배지로 풀어 nylon mesh에 필터하고 상기와 같은 조건으로 원심분리 하였다. 상층액을 제거한 뒤 펠렛을 풀어 10cm dish당 2.4×107 cells를 접종하고 배양하여 녹아웃 암 세포주(B2K)로 유지하였다.
한편, 야생형 암세포주(MB19) 세포주를 생산하기 위하여 24주령의 B6 야생형 생쥐(오리엔트바이오, 한국)의 허벅지에 MCA (3-methyl cholanthrene) 100㎍을 주사하였다. 약 4개월 후 허벅지에 생긴 암을 떼어낸 후 70% 에탄올에 헹궈 박테리아를 제거하고, 10% FBS와 RPMI 배지가 담긴 dish로 옮겨 수술용 가위로 잘게 잘랐다. 50㎖ conical tube에 digestion solution (500 Unit/㎖ collagenase IV, 150 Unti/㎖ DNase I) 13㎖과 암 조각들을 넣고 shaker에서 250 rpm 37℃에서 1시간 30분 동안 돌렸다. 10㎖ 피펫으로 3~5차례 피펫팅하여 조각들을 더 풀어준 후 새로운 50㎖ conical tube에 nylon mesh로 필터 하여 담았다. 1250 rpm 으로 5분간 원심분리하여 상층액은 제거한 후 펠렛은 새로운 배지로 풀어 nylon mesh에 필터하고 상기와 같은 조건으로 원심분리 하였다. 상층액을 제거한 뒤 펠렛을 풀어 10cm dish당 2.4×107 cells를 접종하고 배양하여 야생형 암 세포주(MB19)로 유지하였다.
Bst-2 녹아웃 암 세포주(B2K) 와 Bst-2 야생형 암 세포주 (MB19)의 MHC class (KbDb(R1.21.2)-APC, CD1d(1B1)-PE), LFA-1(207)-Cyc 그리고 Bst-2(e.Bio927)biotin + Streptavidin-PE를 형광 염색하여 발현 정도를 비교하였다. B2K 세포와 MB19 세포 1×106 개를 FACS buffer 50㎕에 풀고 2.4G2 항체 20 ㎍/ml을 넣어 얼음위에서 20분간 반응 시켜 세포 표면의 FcγReceptor를 blocking 하였다. Bst-2 biotin (1 ㎍/㎖)를 넣고 얼음 위에서 30분간 부착시킨 뒤 FACS buffer 500 ㎕를 넣고 1250rpm 4℃에서 4분간 원심분리하여 상층액을 제거하여 잔여 항체를 제거하였다. 그리고 나머지 항체들 KbDb-APC (0.1 ㎍/㎖), CD1d-PE (1.5 ㎍/㎖) 또는 LFA-1 (1 ㎍/㎖), Streptavidin-PE (0.5 ㎍/㎖)를 넣고 빛을 차단하여 얼음위에서 부착시켰다. 30분 후 잔여 항체 제거를 위해 FACS buffer 500 ㎕를 넣고 1250rpm 4℃에서 4분간 원심분리하였다. 분석은 FACS calibur(Becton Dickinson, 독일) 를 이용하였다. 그 결과, MB19이 정상적으로 Bst-2를 발현하는 반면 B2K 암세포주는 Bst-2를 발현하지 않는 것을 확인하고 실시예에 사용하였다.
확립된 B2K 세포(B2K empty)에 Bst-2 야생형 유전자(Flag WT: 서열번호 17), 세포질부위(cytoplasmic domain)가 제거된 유전자(Flag △CT: 서열번호 18) 또는 공 벡터를 각각의 실험군에 도입하였다.
서열번호 17:
ATGGCGCCCTCTTTCTATCACTATCTGCCCGTGCCCATGGATGAGATGGGGGGGAAGCAAGGATGGGGCAGCCACCGGCAGTGGCTGGGGTACCGCGGGAGAAAGATAGTGATAGACGGGAACGGGTACCTACTCTACCCCCCCTTCGTTCCTACCCCGTCGGTGGCCGTCACCGACCCC
서열번호 18:
ATGTACCGCGGGAGAAAGATAGTGATAGACGGGAACGGGTACCTACTCTACCCCCCCTTCGTTCCTACCCCGTCGGTGGCCGTCACCGACCCC
이 유전자들은 N-말단기에 Flag 또는 V5 단백질이 붙어있는 형태이고, 이들의 발현은 항 Bst-2 항체 (PDCA-1, eBio927: Ebioscience, 미국)을 통해 확인하였다(도 10A). FACS 분석 결과, B2K empty는 Bst-2가 억제되어 Bst-2 단백질이 발현하지 않아 Q2영역과 Q3영역에 도트(dot)이 나타나지 않았다. B2K empty에 Bst-2 야생형 유전자를 도입한 Flag WT의 경우 56%이상의 세포가 Q2 및 Q3 영역에 존재하였다.
B2K empty, B2K-Flag WT 그리고 B2K-Flag V5 ΔCT 세포 2×106 개를 각각 6-well에 부착시키고 20시간 뒤 MHV-68 바이러스를 0.1 MOI로 감염시켰다. 1일(24시간) 또는 2일(48시간)후 세포 모양의 사진을 찍었다. 그 결과 도 10B와 같이 야생형 Bst-2 유전자를 재도입한 세포(B2K-Flag WT)에서는 빠른 속도로 아폽토시스가 유도되는 반면 신호전달에 관여할 것으로 판단되는 세포질 부위를 제거한 Bst-2 유전자를 도입한 세포(B2K-FlagV5 ΔCT)에서는 여전히 아폽토시스가 지연되고 있음을 확인하였다.
즉, 상기의 Bst-2 재도입실험을 통하여 세포질부위가 바이러스 감염세포의 아폽토시스를 유발하는 신호전달에 중요한 역할을 하는 것을 최초로 증명하였다. 이러한 사실은 특정 바이러스에 국한되지 않고 감염세포의 생존기간을 연장함으로써 바이러스의 생산지속 및 생산증가 효과를 이끌어 낼 수 있음을 보여주고 있다.
6-4. Bst-2 변이 세포주에서의 바이러스 생산능 증가
세포사멸이 억제된 Bst-2 변이 세포주의 바이러스 생산능을 확인하기 위해, 야생형 VERO 세포주와 실시예 2에서 수득된 Bst-2 유전자 exon1 부위에 돌연변이가 일어난 세포주 D-D8 및 G-D5의 바이러스 생산능을 비교하였다.
6-well에 VERO 야생형 세포주 및 실시예 2에 의해 제조된 돌연변이 세포주를 1X106 cells/well로 seeding하고 24시간 후 H3N2를 0.1 MOI로 감염시켰다. 그리고 48시간, 60시간 또는 72시간 후 상층액을 걷어 상층액의 역가를 측정하였다.
그 결과, 도 11에 나타내었듯이, 야생형 세포주는 인플루엔자 바이러스 감염 후 세포사멸에 의하여 배양액 내 바이러스 역가가 낮게 나타난 반면, 돌연변이 세포주는 세포사멸이 억제되어 72시간까지 최대 50배 이상의 바이러스 생산능을 나타내는 것을 관찰하였으며, 이러한 효과는 G-D5 세포가 G-D8세포보다 뛰어났다.
6-5. Bst-2 변이세포주에서의 헤르페스바이러스 생산능력 증가
상기 실시예 6-3과 동일한 방법으로, 정상적으로 Bst-2를 발현하는 생쥐섬유아세포(NIH/3T3)에 세포질부위가 제거된 Bst-2 유전자를 도입(ΔCT)하였다. 대조군 정상세포는 Bst-2 유전자를 함유하지 않은 공벡터(empty vector)를 도입하여 바이러스 생산능을 비교하였다. 그 결과, 도 12에 나타내었듯이 Bst-2 변이 유전자가 도입되어 Bst-2 정상 유전자의 기능이 억제된 변이세포주의 바이러스 생산능이 약 1.5배 증가하는 것을 관찰 할 수 있었다.
다른 세포주에서 동일한 결과를 재현하고자 상기 실세예 6-3과 동일한 방법으로, B2K 세포에 헤르페스바이러스를 감염시켜 바이러스 생산능을 비교하였다. 그 결과, Bst-2가 결여된 B2K 세포(empty)는 증가된 바이러스 생산능을 보이는 반면, 야생형 Bst-2 유전자를 재도입한 B2K 세포(Flag-WT)는 바이러스 생산능이 약 50% 감소되어 야생형 세포 수준을 나타내었다. 한편, 세포질 부위가 제거된 야생형 Bst-2 유전자를 재도입한 B2K 세포(V5- ΔCT)는 이러한 바이러스 생산능의 감소가 나타나지 않아, 바이러스 생산능 증대에 세포사멸억제가 매우 중요함을 증명하였다. 또한, 상기 실시예의 인플루엔자뿐만 아니라 다른 감염성 바이러스의 생산에 있어서도 본 발명의 바이러스 생산능이 증대된 세포주가 유용함을 입증하였다.
본 발명에 따르면, Bst-2 유전자의 기능이 상실된 세포주는 야생형 세포주에 비해 바이러스 생산능이 우수하므로, 이를 바이러스 생산 세포주로 이용하는 경우, 바이러스 생산 수율을 증가시킬 수 있고, 바이러스성 질병의 예방 및 치료를 목적으로 하는 백신의 제조 및 연구에 사용할 수 있다.
이상으로 본 발명의 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
전자파일 첨부하였음.

Claims (19)

  1. 바이러스 생산세포주에서 Bst-2 유전자를 돌연변이시키는 것을 특징으로 하는 세포사멸(apoptosis)이 억제된 바이러스 생산 변이 세포주의 제조방법.
  2. 제1항에 있어서, 상기 바이러스 생산세포주는 동물세포주인 것을 특징으로 하는 세포사멸(apoptosis)이 억제된 바이러스 생산 변이 세포주의 제조방법.
  3. 제2항에 있어서, 상기 동물세포주는 MDCK, VERO 및 생쥐 섬유아세포로 구성된 군에서 선택되는 것을 특징으로 세포사멸(apoptosis)이 억제된 바이러스 생산 변이 세포주의 제조방법.
  4. 제1항에 있어서, 상기 바이러스는 인플루엔자 바이러스인 것을 특징으로 하는 세포사멸(apoptosis)이 억제된 바이러스 생산 변이 세포주의 제조방법.
  5. 제1항에 있어서, 상기 바이러스는 헤르페스바이러스(herpesvirus)인 것을 특징으로 하는 세포사멸(apoptosis)이 억제된 바이러스 생산 변이 세포주의 제조방법.
  6. 제4항에 있어서, 인플루엔자 바이러스는 Pandemic/H1N1, A/H1N1 및 A/H3N2로 구성된 군으로부터 선택되는 것을 특징으로 하는 세포사멸(apoptosis)이 억제된 바이러스 생산 변이 세포주의 제조방법.
  7. 제1항에 있어서, 상기 돌연변이는 Bst-2 유전자의 exon1 부위 일부를 삽입, 결실, 중복, 역위, 치환 또는 전좌 시키거나, exon1 전체를 제거 또는 gene silencing 시키는 것을 특징으로 하는 세포사멸(apoptosis)이 억제된 바이러스 생산 변이 세포주의 제조방법.
  8. 제7항에 있어서, 상기 Bst-2 유전자의 exon1 부위는 Bst-2의 세포질부위(cytoplasmic domain)를 암호화하고 있는 것을 특징으로 하는 세포사멸(apoptosis)이 억제된 바이러스 생산 변이 세포주의 제조방법.
  9. 바이러스 생산능이 있는 세포주에서 Bst-2 유전자 기능이 상실되어 바이러스 생산능이 증가된 바이러스 생산 변이 세포주.
  10. 제9항에 있어서, Bst-2 유전자의 일부가 삽입, 결실, 중복, 역위, 치환 또는 전좌 되거나, 전체가 제거 또는 gene silencing 되어 있는 것임을 특징으로 하는 바이러스 생산 변이 세포주.
  11. 제10항에 있어서, Bst-2 유전자의 exon1 부위에서 1개 내지 15개의 염기가 결실되어 있거나, 상기 exon1 부위에 1개 내지 15개의 염기가 삽입되어 있는 것을 특징으로 하는 바이러스 생산 변이 세포주.
  12. 제11항에 있어서, Bst-2 유전자의 exon1 부위에서 45번째 내지 50번째 염기 중 1개 내지 4개의 염기가 결실되어 있거나, 1개 내지 3개의 염기가 삽입되어 있는 것을 특징으로 하는 바이러스 생산 변이 세포주.
  13. 제11항에 있어서, Bst-2 유전자의 exon1 부위에서 116번째 내지 130번째 염기 중 1개 내지 12개의 염기가 결실되어 있는 것을 특징으로 하는 바이러스 생산 변이 세포주.
  14. 제11항에 있어서, Bst-2 유전자의 exon1 부위에서 4번째 내지 90번째 염기 전체가 결실되어 있는 것을 특징으로 하는 바이러스 생산 변이 세포주.
  15. Bst-2를 발현하지 않는 바이러스 생산 세포주에 변이된 Bst-2 유전자가 도입되어 있는 바이러스 생산능이 증가된 변이 세포주.
  16. 제15항에 있어서, 상기 변이된 Bst-2 유전자는 야생형(Wild type) Bst-2 유전자의 exon1 부위 일부가 삽입, 결실, 중복, 역위, 치환 또는 전좌되거나, exon1 전체가 제거 또는 gene silencing 되어 있는 것임을 특징으로 하는 바이러스 생산능이 증가된 변이 세포주.
  17. 다음 단계를 포함하는 목적 바이러스의 제조방법:
    (a) 제8항 내지 15항 중 어느 한 항의 바이러스 생산능이 증가된 변이 세포주에 목적 바이러스를 감염시키는 단계; 및
    (b) 목적 바이러스가 감염된 세포주를 배양한 다음, 상등액을 원심분리하여 목적 바이러스를 수득하는 단계.
  18. 제17항에 있어서, 상기 (a) 단계는 목적 바이러스를 0.005~0.05 MOI로 감염시키는 것을 특징으로 하는 목적 바이러스의 제조방법.
  19. 다음 단계를 포함하는 바이러스성 질병에 대한 백신의 제조방법:
    (a) 제8항 내지 15항 중 어느 한 항의 바이러스 생산능이 증가된 변이 세포주에 목적 바이러스를 감염시키는 단계;
    (b) 목적 바이러스가 감염된 세포주를 배양한 다음, 상등액을 원심분리하여 목적 바이러스를 수득하는 단계; 및
    (c) 상기 수득된 목적 바이러스를 약독화 또는 비활성화 하는 단계.
PCT/KR2013/012263 2013-03-13 2013-12-27 바이러스 생산능이 증가된 세포주 및 그 제조방법 WO2014142433A1 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN201380075430.3A CN105121634B (zh) 2013-03-13 2013-12-27 具有提高的病毒生产能力的细胞系及其生产方法
EP13877775.0A EP2975119B1 (en) 2013-03-13 2013-12-27 Cell strain having increased virus production ability and production method therefor
US14/773,741 US9650613B2 (en) 2013-03-13 2013-12-27 Cell strain having increased virus production ability and production method therefor

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2013-0026767 2013-03-13
KR1020130026767A KR20140112255A (ko) 2013-03-13 2013-03-13 바이러스 생산능이 증가된 세포주 및 그 제조방법
KR10-2013-0117325 2013-10-01
KR1020130117325A KR101722529B1 (ko) 2013-10-01 2013-10-01 세포사멸이 억제된 바이러스 생산 변이 세포주 및 그 제조방법

Publications (1)

Publication Number Publication Date
WO2014142433A1 true WO2014142433A1 (ko) 2014-09-18

Family

ID=51537040

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2013/012263 WO2014142433A1 (ko) 2013-03-13 2013-12-27 바이러스 생산능이 증가된 세포주 및 그 제조방법

Country Status (3)

Country Link
EP (1) EP2975119B1 (ko)
CN (1) CN105121634B (ko)
WO (1) WO2014142433A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017088018A1 (en) * 2015-11-24 2017-06-01 Commonwealth Scientific And Industrial Research Organisation Production of viruses in cell culture
US10907133B2 (en) 2015-11-24 2021-02-02 Commonwealth Scientific And Industrial Research Organisation Production of viruses in avian eggs

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10526393B2 (en) 2014-06-18 2020-01-07 Immunomax Co., Ltd. Method for promoting virus infection and increasing virus production, by using cell line having lost BST2 gene functions
CN108893450B (zh) * 2018-08-13 2022-04-19 江苏省农业科学院 先天性免疫系统重构的bhk21细胞群及其细胞克隆增毒应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110029181A (ko) * 2006-06-20 2011-03-22 이수앱지스 주식회사 Ｂｓｔ2 억제제의 효과
KR20120033334A (ko) 2009-07-16 2012-04-06 크루셀 홀란드 비.브이. 백신 제조를 위한 고역가 폴리오바이러스의 제조
KR20120103737A (ko) 2003-02-25 2012-09-19 메디뮨 엘엘씨 인플루엔자 백신 조성물의 제조 방법

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120083035A1 (en) * 2010-09-30 2012-04-05 Dharmacon, Inc. Modified Cell Lines for Increasing Lentiviral Titers

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120103737A (ko) 2003-02-25 2012-09-19 메디뮨 엘엘씨 인플루엔자 백신 조성물의 제조 방법
KR20110029181A (ko) * 2006-06-20 2011-03-22 이수앱지스 주식회사 Ｂｓｔ2 억제제의 효과
KR20120033334A (ko) 2009-07-16 2012-04-06 크루셀 홀란드 비.브이. 백신 제조를 위한 고역가 폴리오바이러스의 제조

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
BELSHE R.B., VACCINES, 2008, pages 291 - 309
BRIDGES C.B., VACCINES, 2008, pages 259 - 290
HONG NA ET AL.: "Interactions between human immunodeficiency virus (HIV)-1 Vpr expression and innate immunity influence neurovirulence.", RETROVIROLOGY., vol. 8, no. 44, 2011, pages 1 - 17, XP021100907 *
JANG J. ET AL., APPL. MICROBIOL. BIOTECHNOL, vol. 85, 2010, pages 1509 - 1520
NANETTE VAN DAMME ET AL.: "The interferon-induced protein BST-2 restricts HIV-1 release and is downregulated from the cell surface by the viral Vpu protein.", CELL HOST MICROBE., vol. 3, no. 4, 2008, pages 245 - 252, XP055277457 *
PHILIP H JONES ET AL.: "Bone marrow stromal cell antigen 2 (BST-2) restricts mouse mammary tumor virus (MMTV) replication in vivo.", RETROVIROLOGY., vol. 9, no. 10, 2012, pages 1 - 12, XP021131521 *
RIE WATANABE ET AL.: "Influenza virus is not restricted by tetherin whereas influenza VLP production is restricted by tetherin.", VIROLOGY., vol. 417, no. 1, 2011, pages 50 - 56, XP028252077 *
See also references of EP2975119A4 *
TREANOR J.J. ET AL., PRINCIPLES AND PRACTICE OF INFECTIOUS DISEASES, 2005, pages 2060 - 85
XIAO-BEN PAN ET AL.: "BST2/Tetherin Inhibits Dengue Virus Release from Human Hepatoma Cells.", PLOS ONE., vol. 7, no. 12, 2012, pages 1 - 7, XP055277452 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017088018A1 (en) * 2015-11-24 2017-06-01 Commonwealth Scientific And Industrial Research Organisation Production of viruses in cell culture
US10626379B2 (en) 2015-11-24 2020-04-21 Commonwealth Scientific And Industrial Research Organisation Production of viruses in cell culture
US10907133B2 (en) 2015-11-24 2021-02-02 Commonwealth Scientific And Industrial Research Organisation Production of viruses in avian eggs
US11118166B2 (en) 2015-11-24 2021-09-14 Commonwealth Scientific And Industrial Research Organisation Production of viruses in avian eggs
US11174466B2 (en) 2015-11-24 2021-11-16 Commonwealth Scientific And Industrial Research Organisation Production of viruses in cell culture

Also Published As

Publication number Publication date
EP2975119B1 (en) 2020-03-11
CN105121634B (zh) 2019-07-26
EP2975119A1 (en) 2016-01-20
EP2975119A4 (en) 2016-09-21
CN105121634A (zh) 2015-12-02

Similar Documents

Publication Publication Date Title
US10537621B2 (en) Vaccine comprising beta-herpesvirus
WO2012033328A2 (en) Mdck-derived cell lines adapted to serum-free culture and suspension culture and method for preparing vaccine virus using the cells
WO2014142433A1 (ko) 바이러스 생산능이 증가된 세포주 및 그 제조방법
CN110628730B (zh) 表达猪繁殖与呼吸综合征病毒gp蛋白的重组猪伪狂犬病病毒及应用
KR20200083571A (ko) 지카 바이러스를 비활성화시키기 위한, 그리고 비활성화의 완결도를 결정하기 위한 방법
CA3084605A1 (en) Method for inactivating zika virus and related methods
KR102277763B1 (ko) 개선된 바이러스 생산을 위한 조류 세포
WO2021091279A1 (ko) Ｈ５ｎ８ 재조합 인플루엔자 바이러스, 이의 제조용 조성물, 및 이를 포함하는 백신 조성물
Hilleman History, precedent, and progress in the development of mammalian cell culture systems for preparing vaccines: safety considerations revisited
JPS637754B2 (ko)
US9650613B2 (en) Cell strain having increased virus production ability and production method therefor
EP1500699A1 (en) Production of vaccinia virus with adherent or non adherent avian cell lines
RU2004126695A (ru) Непрерывная клеточная линия для получения вакцин
WO2021141421A1 (ko) 조류인플루엔자 바이러스에 저항성을 갖는 유전자 편집 조류의 제조방법
WO2021221311A1 (ko) 항생제 저항성 유전자를 포함하는 테라토마 제거용 dna 구조체
WO2019212123A1 (ko) 수지상세포의 이동능을 증가시키는 방법 및 이의 용도
WO2015149386A1 (zh) 狂犬病病毒ctn鸡胚细胞适应株
KR101722529B1 (ko) 세포사멸이 억제된 바이러스 생산 변이 세포주 및 그 제조방법
WO2015194770A1 (ko) Bst2 유전자의 기능이 상실된 세포주를 이용한 바이러스 감염 촉진 및 생산 증진 방법
WO2023244048A1 (ko) 한국 분리주 gh 계통 사스코로나바이러스2 유래의 리포터 유전자 발현 사스코로나바이러스2 재조합 벡터 및 이의 제조방법
WO2022231402A1 (ko) 바이러스 백신 생산용 조류 세포 제조용 조성물 및 바이러스 저항성 조류 세포 제조용 조성물
WO2021153873A1 (ko) 돼지유행성설사병바이러스 약독화 생백신주, 이를 포함하는 조성물, 및 이의 제조방법
WO2018147630A1 (ko) 어류 바이러스의 생산 방법
WO2022203404A1 (ko) 뉴캐슬병 바이러스 벡터를 이용한 고역가 조류메타뉴모바이러스 백신
WO2023204559A1 (ko) 고역가 일본뇌염 바이러스 유전형 5형 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13877775

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 14773741

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2013877775

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE