WO2023167575A1 - 저면역원성 줄기세포, 줄기세포로부터 분화되거나 유래된 저면역원성 세포 및 이의 제조방법 - Google Patents

저면역원성 줄기세포, 줄기세포로부터 분화되거나 유래된 저면역원성 세포 및 이의 제조방법 Download PDF

Info

Publication number
WO2023167575A1
WO2023167575A1 PCT/KR2023/003055 KR2023003055W WO2023167575A1 WO 2023167575 A1 WO2023167575 A1 WO 2023167575A1 KR 2023003055 W KR2023003055 W KR 2023003055W WO 2023167575 A1 WO2023167575 A1 WO 2023167575A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
cell
stem cells
differentiated
derived
Prior art date
Application number
PCT/KR2023/003055
Other languages
English (en)
French (fr)
Inventor
이재영
이강인
손영주
고난영
신은지
유환열
Original Assignee
주식회사 툴젠
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 툴젠 filed Critical 주식회사 툴젠
Priority to KR1020237009539A priority Critical patent/KR20230131816A/ko
Publication of WO2023167575A1 publication Critical patent/WO2023167575A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0696—Artificially induced pluripotent stem cells, e.g. iPS
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/48—Reproductive organs
    • A61K35/54—Ovaries; Ova; Ovules; Embryos; Foetal cells; Germ cells
    • A61K35/545—Embryonic stem cells; Pluripotent stem cells; Induced pluripotent stem cells; Uncharacterised stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells

Definitions

  • Low-immunogenic stem cells capable of suppressing immune rejection during transplantation by increasing the expression or activity level of immunosuppressive factors, hypo-immunogenic cells differentiated or derived from stem cells, a method for producing the same, and cell therapy using the same do.
  • Induced pluripotent stem cells are dedifferentiated somatic cells isolated from the human body through artificial stimulation into pluripotent stem cells capable of differentiating into all cells of the body. It is attracting attention as a regenerative cell therapy for regenerating damaged cells, tissues, and organs.
  • an allogenic cell therapy derived from another person can be an alternative, rather than an autologous cell therapy, which is the patient's own cell. Recognized by cells in charge of immunity, immune rejection may occur.
  • Natural killer cells combine their ligands expressed on abnormal cells such as cancer cells and virus-infected cells through various activating and inhibitory receptors on the cell surface. Thus, its activity is regulated by the balance between the signals induced by it.
  • the immune system has a suppression mechanism called the immune checkpoint to prevent excessive activation of T cells that can directly attack cells and attack normal cells. Activation of T cells begins when a T cell receptor (TCR) present on the cell surface recognizes an antigen bound to an MHC molecule of an antigen presenting cell (APC).
  • TCR T cell receptor
  • APC antigen presenting cell
  • CD80 and CD40, etc. expressed in APC, simultaneously bind to CD28 and CD40L, which correspond to ligands on the T cell surface, to activate T cells.
  • immune checkpoint receptors such as CTLA-4 and PD-1 on T cells bind to immune checkpoint ligands such as CD80, CD86, and PD-L1 on abnormal cells such as cancer cells to send inhibitory signals that inactivate T cells.
  • KIR3DL3 is an inhibitory receptor for HHLA2 that mediates an alternative immunoinhibitory pathway to PD1
  • An object of the present invention is to provide low-immunogenic stem cells capable of suppressing immune rejection during cell, tissue, organ transplantation, low-immunogenic cells differentiated or derived from stem cells, a method for preparing the same, and a cell therapy using the same. .
  • the present invention is a gene encoding one or more immunosuppressive factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2 in the stem cell genome.
  • LGALS9 Gal-9
  • CLEC4G LSECtin
  • PD-L1 HHLA2
  • HHLA2 HHLA2
  • the present invention is a gene encoding one or more immunosuppressive factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2 in the genome of cells differentiated or derived from stem cells.
  • LGALS9 Gal-9
  • CLEC4G LSECtin
  • PD-L1 HHLA2
  • HHLA2 HHLA2
  • the present invention relates to the expression or activity of one or more immunosuppressive factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2, differentiated or derived from the artificially engineered stem cells described above. provides these increased cells.
  • the present invention provides a guide nucleic acid capable of targeting a target sequence located within the genome of stem cells or cells differentiated or derived from stem cells, or a nucleic acid encoding the same;
  • a gene donor encoding one or more immunosuppressive factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2, or a nucleic acid encoding the same, and an editor protein or a gene comprising a nucleic acid encoding the same.
  • an immunogenic stem cell or a composition for preparing low-immunogenic cells differentiated from or derived from stem cells are provided.
  • the present invention comprises the steps of introducing a low-immunogenic stem cell or composition for preparing low-immunogenic cells differentiated from or derived from the above-described low-immunogenic stem cells or stem cells into cells differentiated from or derived from the isolated stem cells; and
  • a gene encoding one or more immunosuppressive factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2 is differentiated from or derived from the stem cell or stem cell genome knock-in step
  • It provides a method for producing low-immunogenic stem cells or low-immunogenic cells derived from or differentiated from stem cells.
  • the present invention provides a composition for cell transplantation or living tissue regeneration comprising the artificially engineered stem cells as an active ingredient.
  • the present invention provides a composition for cell transplantation or living tissue regeneration comprising, as an active ingredient, artificially engineered stem cells differentiated or derived from the above stem cells.
  • the present invention relates to the expression or activity of one or more immunosuppressive factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2, differentiated or derived from the artificially engineered stem cells described above.
  • one or more immunosuppressive factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2, differentiated or derived from the artificially engineered stem cells described above.
  • a composition for cell transplantation or biological tissue regeneration comprising the increased cells as an active ingredient.
  • stem cells or cells differentiated or derived from stem cells of the present invention exhibit low immunogenicity to avoid immune rejection during cell, tissue, or organ transplantation, they are differentiated into various cells and immune rejection in an autologous or allogeneic environment. It can be used as a cell therapy that does not cause a reaction.
  • Figure 1 shows the insertion of three genes, LGALS9 (Gal-9), CLEC4G (LSECtin) and HHLA2, between the left and right homology arms based on a specific site of AAVS1, one of the safe harbor sites. It shows a schematic diagram.
  • Figure 2 shows the results of PCR reaction from DNA of cells in order to select single clones from iPSCs in which three genes prepared in Example 1 were knocked-in (KI), and the PCR obtained above It shows the result of performing Sanger sequencing using the product.
  • Figure 3 shows the results of confirming the mRNA level (level) change for the three genes knocked-in in Example 1 by real time PCR method.
  • Figure 5 shows the results of measuring the HHLA2 expression level of the AAVS1-ALC3#11 clone prepared in Example 1 through flow cytometry in Experimental Example 4.
  • FIG. 6 (a) shows the results of flow cytometry analysis using anti-CD31 antibody after differentiating wild-type (WT) iPSC and iPSC knocked-in (KI) iPSC into endothelial cells (EC) with three genes prepared in Example 1
  • FIG. 6 (b) shows the result of confirming that the HLA-ABC antigen appears on the surface of endothelial cells (EC) differentiated from iPSC.
  • FIG. 7(a) shows K562 cells, endothelial cells differentiated from wild-type (WT) iPSCs (WT-iPSC_EC), and endothelial cells differentiated from iPSCs knocked-in (KI) three genes prepared in Example 1 (KI-iPSC_EC).
  • iPSC EC is a graph showing the results of confirming cytotoxicity by culturing NK cells, which are effector cells, at various ratios
  • FIG. 7(b) is an endothelial cell differentiated from wild-type (WT) iPSCs in which HLA-ABC is expressed at 98% or more.
  • WT-iPSC_EC, Fig. 6(b) and three genes prepared in Example 1 knocked-in (KI) iPSC differentiated endothelial cells (KI-iPSC EC) cytotoxicity of NK cells was evaluated is a graph showing
  • LGALS9 (Gal-9) / CLEC4G (LSECtin) / HHLA-2 (SEQ ID NO: 23), LGALS9 (Gal-9) (SEQ ID NO: 24), CLEC4G (LSECtin) (SEQ ID NO: 25), LGALS9 (Gal-9) 9) / CLEC4G (LSECtin) (SEQ ID NO: 26), LGALS9 (Gal-9) / CLEC4G (LSECtin) / PD-L1 (SEQ ID NO: 27) is a diagram showing an example of a lentivirus for inserting each gene sequence. .
  • FIG. 9(a) shows K562 cells, endothelial cells differentiated from wild-type (WT) iPSCs (WT-iPSC_EC), and endothelial cells differentiated from iPSCs into which the Gal-9 gene of SEQ ID NO: 24 was inserted (Gal-9_EC).
  • Endothelial cells into which the CLEC4G gene of SEQ ID NO: 25 was inserted into endothelial cells differentiated from iPSC (CLEC4G_EC)
  • endothelial cells into which the Gal-9/CLEC4G gene of SEQ ID NO: 26 was inserted into endothelial cells differentiated from iPSC (Gal-9+ CLEC4G_EC)
  • endothelial cells (Gal-9+CLEC4G+ PD-L1_EC) into which the Gal-9/CLEC4G/PD-L1 gene of SEQ ID NO: 27 has been inserted into endothelial cells differentiated from iPSCs are cultured at various ratios with NK cells, which are effector cells.
  • FIG. 9 (b) is effector cells (effector, NK cells): target cells (EC, endothelial cells) were co-cultured at a ratio of 1: 1 to obtain 7-AAD + cells This is a graph showing the measured results.
  • stem cell refers to a broad concept that collectively refers to undifferentiated cells having the ability to differentiate into various types of body tissue cells, that is, stem cell properties (stemness).
  • stem cells may be induced pluripotent stem cells, embryonic stem cells, somatic cell nuclear transfer-PSC, or adult stem cells.
  • the cells may be of human origin, but are not limited thereto.
  • differentiation refers to a phenomenon in which a cell divides and proliferates, and the structure or function of a cell is specialized during the growth of an entire object. In other words, it refers to the process by which cells, tissues, etc. of living organisms change into a form and function suitable for performing the role given to each. etc.) and the process of changing into endoderm cells, as well as the process of changing hematopoietic stem cells into red blood cells, leukocytes, platelets, etc., that is, progenitor cells expressing specific differentiation traits, can all be included in differentiation.
  • “increased expression” means that a higher degree of expression than the expression level of the protein measured in the wild type is indicated.
  • the increase is about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 30% or more, about 50% or more, about 60% or more, It may be increased by about 70% or more, or about 100% or more.
  • the increase in expression may be caused by an increase in gene copy number or increased transcription or translation.
  • the term “increase in activity” or “increased activity” can refer to a detectable increase in protein or enzyme activity. "Increase in activity”, or “increased activity” means a higher level of activity of a protein, or enzyme, relative to a given parental or wild-type cell.
  • immunoactivity suppressor specifically binds to an immune checkpoint receptor or an immunosuppressive receptor expressed in immune responsible cells such as T cells and NK cells, thereby suppressing immune cells. It refers to a ligand capable of inhibiting activity.
  • low immunogenicity means that when cells are transplanted to another individual, they exhibit a reduced or eliminated immune rejection response compared to wild-type cells. Immune rejection is greater than 20%, greater than about 30%, greater than about 40%, greater than about 50%, greater than about 55%, greater than about 60%, greater than about 70%, greater than about 75%, greater than about 80%, greater than about 85% % or greater, about 90% or greater, about 95% or greater, or about 100% reduction.
  • hypoimmunogenic stem cells or hypoimmunogenic cells differentiated from or derived from stem cells capable of suppressing immune rejection during transplantation by increasing the expression or activity level of immunosuppressive factors are provided.
  • the stem cells have the expression or activity of ligands that bind to immune checkpoint receptors that inhibit the activation of immune cells such as T cells and NK cells, and the expression or activity of ligands that bind to immunosuppressive receptors. increased, and when used as a cell therapy in an autologous or allogeneic environment, immune rejection is suppressed, resulting in a state of immune tolerance.
  • the stem cells or cells differentiated or derived from the stem cells are compared with wild-type stem cells or wild-type cells to LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2.
  • LGALS9 Gal-9
  • CLEC4G LSECtin
  • PD-L1 HHLA2
  • HHLA2 HHLA2
  • the expression or activity of one or more immunosuppressive factors selected from the group consisting of may be increased.
  • Galectin-9 (Gal-9) or LGALS9 is a known ligand for T-cell immunoglobulin and mucin domain protein 3 (TIM-3), a lectin, galactoside-binding, soluble, 9 (lectin, galactoside-binding, soluble, 9); tumor antigen HOM-HD-21; Ecalectin; Gal-9; urate transporter/channel proteins; LGALS9A; and HUAT.
  • TIM-3 is an immunosuppressive receptor and is expressed on T cells, regulatory T cells, B cells, dendritic cells, NK cells, and macrophages. activity is inhibited.
  • LSECtin liver and lymph node sinusoidal endothelial cell C-type lectin is a ligand for lymphocyte activation gene 3 (LAG-3).
  • LAG-3 is one of several immune checkpoint proteins such as TIM3, CTLA-4, PD-1, and PD-L1, and is expressed in helper T cells, cytotoxic T cells, regulatory T cells, some NK cells, and B cells.
  • Immune evasion occurs as immune checkpoint proteins located on the surface of T cells, etc., and specific ligands present on abnormal cells bind to incapacitate T cells and NK cells.
  • PD-L1 Programmed cell death ligand-1
  • PD-1 programmed cell death protein 1
  • PD-1 programmed cell death protein 1
  • Activated T cells CD8 and/or CD4 or dendritic cells ( By binding to PD-L1 (programmed cell death ligand 1) or B7.1 (CD80) expressed on the cell surface such as dendritic cells, it inhibits T cell proliferation and reduces cytokine expression. It can act to inhibit cell function.
  • PD-L1 programmed cell death ligand 1
  • B7.1 B7.1
  • HHLA2 Human endogenous retrovirus-H long terminal repeatassociating protein 2
  • TIGD2 transmembrane and immunoglobulin domain containing 2
  • HHLA2 also inhibits T cell activation by binding to KIR3DL3 (killer cell immunoglobulin-like receptor, three immunoglobulin domains and long cytoplasmic tail 3), a receptor on T and NK cells.
  • the stem cells encode one or more immunosuppressive factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2 in the stem cell genome. It is an artificially engineered stem cell that has an artificially engineered gene into which a gene is inserted.
  • the cell differentiated or derived from the stem cell has LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2 in the cell genome differentiated or derived from the stem cell. It is an artificially engineered cell differentiated or derived from stem cells having an artificially engineered gene into which a gene encoding one or more immunosuppressive factors selected from the group consisting of is inserted.
  • cells differentiated or derived from the stem cells are human vascular endothelial cells, pancreatic cells, bone cells, chondrocytes, cardiomyocytes, muscle cells, epidermal cells, fibroblasts, nerve cells, hepatocytes, It is one species selected from the group consisting of intestinal cells, gastric cells, skin cells, fat cells, blood cells, immune cells, cells, spheroids, and organoids.
  • the sequence of the gene of the artificially engineered stem cell is different from the gene sequence of the wild-type stem cell, compared to the wild-type stem cell, LGALS9 (Gal-9), CLEC4G (LSECtin), Genes encoding one or more immunosuppressive factors selected from the group consisting of PD-L1 and HHLA2 or one or more immunosuppressive factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2 expression or activity may be increased.
  • the sequence of the gene of the artificially engineered cell differentiated or derived from the stem cell is different from the gene sequence of the wild-type cell, compared to the wild-type stem cell, LGALS9 (Gal-9), Genes encoding one or more immunosuppressive factors selected from the group consisting of CLEC4G (LSECtin), PD-L1 and HHLA2 or one or more genes encoding immunosuppressive factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2
  • the expression or activity of immunosuppressive factors may be increased.
  • “increased expression or activity” may mean a high level of expression compared to wild-type stem cells or wild-type cells, or a high activity even if the protein is expressed.
  • the expression or activity of one or more immunosuppressive factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2 in stem cells or cells differentiated or derived from stem cells is a wild-type stem cell.
  • LGALS9 Gal-9
  • CLEC4G LSECtin
  • PD-L1 and HHLA2 in stem cells or cells differentiated or derived from stem cells is a wild-type stem cell.
  • artificial alteration of the nucleic acid sequence of a gene can be achieved through modification of a nucleic acid constituting a gene. This may be due to mutation, substitution, or deletion of a part or all of the gene, or insertion of one or more bases into the gene, and may be performed using genetic scissors technology. For example, it may be achieved by non-homologous end joining (NHEJ) or homology directed repair (HDR) mechanisms.
  • NHEJ non-homologous end joining
  • HDR homology directed repair
  • the stem cells or cells differentiated or derived from the stem cells have one or more immunosuppressive factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2.
  • the coding gene can be knocked-in.
  • knock-in means inserting a specific nucleic acid or gene into a target gene or nucleic acid on an animal genome in a cell.
  • DNA double-strand break (DSB) repair mechanisms are classified into non-homologous end joining (NHEJ) and homologous recombination (HR).
  • Homologous directed repair is a method that can be corrected without errors by using homologous sequences as templates to repair or repair damaged genes or nucleic acids.
  • HDR Homologous directed repair
  • information on a complementary nucleotide sequence that is not modified or information on sister chromatids is used to repair or repair damaged DNA.
  • a double-strand or single-strand of a target gene or nucleic acid is cleaved using a CRISPR complex, and a nucleic acid template comprising a nucleotide sequence complementary to a nucleotide sequence close to the cleavage site is provided to a cell to cleavage the target gene or nucleic acid.
  • Nucleotide sequences can be repaired or repaired by HDR methods.
  • Homology-independent targeted integration HITI
  • HITI Homology-independent targeted integration
  • HITI uses CRISPR/Cas9 to target the insertion site, supplying a donor containing a specific nucleotide sequence, and placing it between the cleaved target DNA ends through non-homologous end joining (NHEJ). Allows the donor's specific nucleotide sequence to be inserted.
  • NHEJ non-homologous end joining
  • a donor containing a specific nucleotide sequence by cleaving a target gene using CRISPR/Cas9 can be knocked in through the HITI method.
  • the gene encoding one or more immunosuppressive factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2 is differentiated from or derived from stem cells or stem cells. It may be inserted into a safe harbor site in the genome of a cell having been treated, but is not limited thereto. In one embodiment, the gene encoding the immunosuppression factor may be inserted into the AAVS1 locus, the CCR5 locus, the CLYBL locus, the ROSA26 locus, and the SHS231 locus (chromosome 4 'safe harbor site' 231) of the genome.
  • the present invention increases the expression or activity of one or more immunosuppressive factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2 in stem cells or cells differentiated or derived from stem cells It provides a method for producing low-immunogenic stem cells or low-immunogenic cells differentiated from or derived from stem cells.
  • the increase in the expression or activity of the immunosuppressive factor/protein can be achieved by artificially modifying the corresponding gene, and for example, gene editing technology can be used.
  • the genetic editing technology is a transcription activator-like effector nuclease (TALEN) in which a transcription activator-like effector (TALE) domain and a cleavage domain are fused, zinc-finger nuclease (zinc-finger nuclease), or microbial immunity
  • TALEN transcription activator-like effector nuclease
  • TALE transcription activator-like effector
  • Z-finger nuclease zinc-finger nuclease
  • microbial immunity A CRISPR enzyme system derived from CRISPR, which is a system, is possible, but is not limited thereto.
  • TALEN refers to a nuclease capable of recognizing and cleaving a target region of DNA.
  • the TALEN is a fusion protein comprising a TALE domain and a nucleotide cleavage domain.
  • TAL effectors are known as proteins secreted through their type secretion system when Xanthomonas bacteria infect various plant species.
  • the protein can bind to promoter sequences in the host plant and activate the expression of plant genes that aid bacterial infection.
  • the protein recognizes plant DNA sequences through a central repeat domain consisting of repeats of varying numbers of amino acids up to 34.
  • a "TALE domain” or “TALE” is a polypeptide comprising one or more TALE repeat domains/units.
  • This repeat domain is involved in the binding of TALE to its cognate target DNA sequence.
  • a single "repeat unit is typically 33-35 amino acids in length and exhibits at least some sequence homology to other TALE repeat sequences in naturally occurring TALE proteins.
  • the TALE domains are sequence-specifically linked via one or more TALE-repeat modules. It is a protein domain that binds to nucleotides.
  • the TALE DNA binding domain includes at least one TALE-repeat module, more specifically 1 to 30 TALE-repeat modules, but is not limited thereto.
  • the TALE DNA binding domain may include half of a TALE-repeat module.
  • the entire content disclosed in International Publication No. WO2012/093833 or US Patent Publication No. 2013-0217131 is incorporated herein by reference.
  • a “zinc finger DNA binding protein” (or binding domain) is a protein that binds DNA in a sequence-specific manner through one or more zinc fingers, which are regions of amino acid sequences within the binding domain whose structure is stabilized through coordination of zinc ions, or It is a domain within a larger protein.
  • the term “zinc finger DNA binding protein” is often abbreviated to zinc finger protein or ZFP.
  • the zinc-finger nuclease includes a target gene and a zinc-finger protein engineered to bind to a target site of a cleavage domain or cleavage half-domain.
  • the ZFN may be an artificial restriction enzyme containing a zinc-finger DNA binding domain and a DNA cleavage domain.
  • the zinc-finger DNA binding domain may be engineered to bind to a selected sequence.
  • Beerli et al. (2002) Nature Biotechnol. 20:135-141; Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340; Isalan et al, (2001) Nature Biotechnol. 19: 656-660; Segal et al.
  • Manipulation methods include, but are not limited to, rational design and various types of selection. Rational design includes, for example, the use of a database containing triple (or quadruple) nucleotide sequences, and individual zinc finger amino acid sequences, where each triple or quadruple nucleotide sequence is a sequence of zinc fingers that bind a particular triple or quadruplet sequence. Associated with one or more sequences.
  • zinc finger domains and/or multi-finger zinc finger proteins can be linked by any suitable linker sequence, for example, a linker comprising a linker of at least 5 amino acids in length. can be linked together.
  • linker sequences of 6 or more amino acids in length are described in US Pat. No. 6,479,626; 6,903,185; See 7,153,949.
  • the proteins described herein may include any combination of suitable linkers between each zinc finger of the protein.
  • Nucleases such as the ZFNs include a cleavage domain and/or a cleavage half-domain that is a nuclease active portion.
  • the cleavage domain may be a cleavage domain derived from a nuclease different from the zinc-finger DNA binding domain, that is, a heterologous cleavage domain.
  • the cleavage half-domain may be a fusion protein derived from any nuclease or part thereof that requires dimerization for cleavage activity. If the fusion protein contains a cleavage half-domain, generally two fusion proteins may be required for cleavage. Alternatively, a single protein comprising two truncated half-domains may be used. The two cleavage half-domains may be from the same endonuclease (or functional fragments thereof), or each cleavage half-domain may be from a different endonuclease (or functional fragments thereof). there is.
  • the target sites of the two fusion proteins are positioned so that the cleavage-half domains are spatially oriented with respect to each other by binding of the two fusion proteins to their respective target sites, so that the cleavage half-domains, for example, are dimer. It is preferably placed in a relationship that enables the formation of functional cleavage domains by embodying.
  • the “CRISPR-enzyme system” is composed of guide nucleic acids and/or editor proteins.
  • Guide nucleic acid refers to a nucleotide sequence capable of recognizing a target nucleic acid, target gene or target chromosome and interacting with an editor protein.
  • the guide nucleic acid may form a complementary bond with a target nucleic acid, target gene, or some nucleotide in the target chromosome.
  • the guide nucleic acid may be in the form of a target DNA-specific guide RNA, DNA encoding the guide RNA, or a DNA/RNA mixture.
  • the guide nucleic acid may be a guide RNA.
  • Guide RNA may be transcribed in vitro, in particular, an oligonucleotide duplex or transcribed from a plasmid template, but is not limited thereto.
  • the guide nucleic acid may include a scaffold sequence portion and a guide sequence portion.
  • the scaffold sequence part is a part that interacts with the Cas protein, and allows the Cas protein and the guide nucleic acid to bind to form a complex (ribonucleoprotein, RNP).
  • RNP ribonucleoprotein
  • the scaffold sequence portion includes tracrRNA and some sequence portions of crRNA, and the scaffold sequence is determined depending on which Cas protein is used.
  • the guide sequence portion is a portion that can complementarily bind with a nucleotide sequence portion of a certain length in the target gene, and is a base portion that can be artificially modified, and is determined by the target nucleotide sequence (or target sequence) of interest .
  • the guide sequence has at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90% or 95% or more complementarity with the guide nucleic acid binding sequence of the target gene or target nucleic acid, or complete It may be a nucleotide sequence having complementarity. It may be a sequence included in the guide domain of the guide sequence.
  • the guide sequence portion may be included in crRNA.
  • the guide nucleic acid may be a dual RNA comprising two RNAs, that is, crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) as components.
  • the guide nucleic acid may be a single-chain guide RNA (sgRNA) in which main parts of crRNA and tracrRNA are linked.
  • sgRNA single-chain guide RNA
  • the target sequence is a nucleotide sequence of a certain length present in a target gene or target nucleic acid, specifically, a regulatory region, a coding region (or CDS, coding sequence), or a non-coding region (non-coding region) of a target gene. -coding region; or UTR, untranslated region), or a partial nucleotide sequence within a target region, or one or more partial nucleotide sequences selected from a combination of the target regions.
  • the target sequence may be a target of a guide nucleic acid editor protein complex (RNP).
  • the target sequence may be a safe harbor site, but is not limited thereto.
  • the safe harbor site may be one selected from the group consisting of AAVS1 locus, CCR5 locus, CLYBL locus, ROSA26 locus, and SHS231 locus.
  • the target sequence is a nucleotide sequence adjacent to a protospacer-adjacent motif (PAM) sequence recognized by the editor protein, and may include all or part of the PAM, but is not limited thereto.
  • PAM protospacer-adjacent motif
  • a target sequence may be used as a term meaning both sequence information of two nucleotides.
  • the target sequence may mean sequence information of a transcribed strand of the target gene DNA, or nucleotide sequence information of a non-transcribed strand.
  • the target sequence includes a guide nucleic acid binding sequence or a guide nucleic acid non-binding sequence.
  • the guide nucleic acid binding sequence is a nucleotide sequence having partial or complete complementarity with the guide sequence included in the guide domain of the guide nucleic acid, and can be complementary to the guide sequence included in the guide domain of the guide nucleic acid.
  • the target sequence and the guide nucleic acid binding sequence are nucleotide sequences that may vary depending on the target gene or nucleic acid, that is, the object to be genetically engineered or corrected, and the guide nucleic acid may be designed in various ways depending on the target gene or target nucleic acid.
  • Guide nucleic acid non-binding sequence is a nucleotide sequence having partial or complete homology with the guide sequence included in the guide domain of the guide nucleic acid, and cannot complementarily bind with the guide sequence included in the guide domain of the guide nucleic acid.
  • the guide nucleic acid non-binding sequence is a nucleotide sequence having complementarity with the guide nucleic acid binding sequence, and may be complementary to the guide nucleic acid binding sequence.
  • the guide nucleic acid binding sequence is a partial nucleotide sequence of the target sequence, and may be a nucleotide sequence having two different sequence sequences of the target sequence, that is, one nucleotide sequence of two nucleotide sequences capable of complementary binding to each other. .
  • the guide nucleic acid non-binding sequence may be a nucleotide sequence other than the guide nucleic acid binding sequence in the target sequence.
  • the guide nucleic acid binding sequence may be a nucleotide sequence selected from among the same nucleotide sequence as the target sequence, that is, the same nucleotide sequence as the transcribed strand and the same nucleotide sequence as the non-transcribed strand.
  • the guide nucleic acid non-binding sequence may be a nucleotide sequence other than a guide nucleic acid binding sequence among the target sequences, that is, a nucleotide sequence identical to a nucleotide sequence identical to a transcribed strand and a nucleotide sequence selected from a nucleotide sequence identical to a non-transcribed strand.
  • the guide nucleic acid binding sequence may have the same length as the target sequence.
  • the guide nucleic acid non-binding sequence may be the same length as the target sequence or the guide nucleic acid binding sequence.
  • the guide nucleic acid binding sequence may be a sequence of 5 to 50 nucleotides.
  • the guide nucleic acid binding sequence is a sequence of 16 nucleotides, a sequence of 17 nucleotides, a sequence of 18 nucleotides, a sequence of 19 nucleotides, a sequence of 20 nucleotides, a sequence of 21 nucleotides, a sequence of 22 nucleotides, a sequence of 23 nucleotides sequence, a sequence of 24 nucleotides or a sequence of 25 nucleotides.
  • the guide nucleic acid non-binding sequence may be a sequence of 5 to 50 nucleotides.
  • the guide nucleic acid non-binding sequence includes 16 nucleotide sequences, 17 nucleotide sequences, 18 nucleotide sequences, 19 nucleotide sequences, 20 nucleotide sequences, 21 nucleotide sequences, 22 nucleotide sequences, 23 It may be a sequence of 24 nucleotides, a sequence of 24 nucleotides or a sequence of 25 nucleotides.
  • the guide nucleic acid binding sequence may partially or completely complement the guide sequence included in the guide domain of the guide nucleic acid, and the length of the guide nucleic acid binding sequence may be the same as that of the guide sequence.
  • the guide nucleic acid binding sequence may be a nucleotide sequence complementary to the guide sequence included in the guide domain of the guide nucleic acid, for example, at least 70%, 75%, 80%, 85%, 90% or 95% or more complementary, or or a completely complementary nucleotide sequence.
  • the guide nucleic acid binding sequence may have or include 1 to 8 nucleotide sequences that are not complementary to the guide sequence included in the guide domain of the guide nucleic acid.
  • the guide nucleic acid non-binding sequence may have partial or complete homology with the guide sequence included in the guide domain of the guide nucleic acid, and the guide nucleic acid non-binding sequence may have the same length as the guide sequence.
  • the guide sequence may be designed based on a sequence homologous to a guide nucleic acid non-binding sequence.
  • the guide nucleic acid non-binding sequence may be a nucleotide sequence homologous to the guide sequence included in the guide domain of the guide nucleic acid, for example, at least 70%, 75%, 80%, 85%, 90% or 95% It may be a nucleotide sequence having more than one homology or a complete homology.
  • the guide nucleic acid non-binding sequence may have or include 1 to 8 nucleotide sequences that are not homologous to the guide sequence included in the guide domain of the guide nucleic acid.
  • the guide nucleic acid non-binding sequence may be complementary to the guide nucleic acid binding sequence, and the guide nucleic acid non-binding sequence may have the same length as the guide nucleic acid binding sequence.
  • the guide nucleic acid non-binding sequence may be a nucleotide sequence complementary to the guide nucleic acid binding sequence, for example, at least 90% or 95% complementary or completely complementary nucleotide sequence.
  • the guide nucleic acid non-binding sequence may have or include 1 to 2 nucleotide sequences that are not complementary to the guide nucleic acid binding sequence.
  • the guide nucleic acid binding sequence may be a nucleotide sequence located close to a sequence complementary to a nucleotide sequence (PAM sequence) recognized by the editor protein.
  • the guide nucleic acid binding sequence may be a sequence of 5 to 50 consecutive nucleotides located adjacent to the 5' end or/and 3' end of a sequence complementary to a nucleotide sequence (PAM sequence) recognized by the editor protein.
  • PAM sequence nucleotide sequence
  • the guide nucleic acid non-binding sequence may be a nucleotide sequence located close to a nucleotide sequence (PAM sequence) that can be recognized by the editor protein.
  • PAM sequence nucleotide sequence
  • the guide nucleic acid non-binding sequence may be a sequence of 5 to 50 consecutive nucleotides positioned adjacent to the 5' end or/and 3' end of a nucleotide sequence (PAM sequence) recognized by the editor protein.
  • PAM sequence nucleotide sequence
  • Editor protein refers to a peptide, polypeptide or protein that binds directly to, or does not bind directly to, but is capable of interacting with a nucleic acid.
  • the editor protein is also conceptually referred to as “artificially engineered nuclease” or RNA-Guided Endonuclease (RGEN).
  • the editor protein may be a CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) enzyme.
  • CRISPR enzyme is a major protein component of the CRISPR-enzyme system, also referred to as "Cas protein", and refers to a nuclease that can recognize a target sequence and cut DNA by mixing or forming a complex with guide RNA. .
  • CRISPR enzymes are known to those skilled in the art, and refer to Korean Patent Registrations 10-1656236, 10-1656237, 10-1706085, 10-2052286, and 10-2182847.
  • the CRISPR enzyme is used herein as a concept that includes all mutants that can act as an endonuclease or nickase activated in cooperation with a guide RNA in addition to native proteins.
  • target DNA cleavage can be brought about, and genome editing can be brought about using this.
  • inactivated variant it can be used to regulate transcription or separate the desired DNA.
  • the CRISPR enzyme is a nucleic acid or polypeptide (or protein) having a sequence encoding the CRISPR enzyme.
  • a Type II CRISPR enzyme or a Type V CRISPR enzyme is widely used, and the Type II CRISPR enzyme is Cas9 (CRISPRassociated protein 9). ) has protein.
  • the Cas9 protein is Streptococcus pyogenes , Streptococcus thermophilus , Streptococcus genus (Streptococcus sp . ) , Streptomyces pristinaespiralis , Streptomyces virion Gasromogenes ( Streptomyces viridochromogenes ), Streptosporangium roseum ( Streptosporangium roseu m), Streptosporangium roseum ( Streptosporangium roseum ), Campylobacter jejuni , and Staphylococcus auricularis .
  • the Cas9 protein recognizes a Protospacer Adjacent Motif (PAM) sequence, which is a nucleotide sequence of a certain length, and part of the guide RNA (the guide sequence above). portion) must bind complementary to the complementary strand of the single strand of DNA on which the target sequence is located.
  • PAM Protospacer Adjacent Motif
  • This PAM sequence is a sequence determined according to the type or origin of the Cas9 protein.
  • the Cas9 protein derived from Streptococcus pyogenes can recognize the 5'-NGG-3' sequence in the target nucleic acid.
  • N is one of adenosine (A), thymidine (T), cytidine (C), and guanosine (G).
  • the Type V CRISPR enzyme includes Cpf1, and the Cpf1 is Streptococcus, Campylobacter, Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Sphaerochaeta, Lactobacillus, Eubacterium, Corynebacter, Carnobacterium, Rhodobacter, Listeria, Paludibacter, Cpf from Clostridium, Lachnospiraceae, Clostridiaridium, Leptotrichia, Francisella, Legionella, Alicyclobacillus, Methanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatronum, Opitutaceae, uberibacillus, Bacillus, Brevibacilus, Methylobacterium or
  • the CRISPR enzyme such as the Cas9 or Cpf1 protein, may be isolated from a microorganism that exists in nature or produced non-naturally by a recombinant or synthetic method.
  • the Cas protein may also be in a form that is easy to introduce into cells.
  • the Cas protein may be linked to a cell penetrating peptide or protein transduction domain.
  • the protein transduction domain may be poly-arginine or HIV-derived TAT protein, but is not limited thereto. Since various types of cell penetrating peptides or protein transduction domains are known in the art despite the exceptions described above, those skilled in the art can apply various examples to the present specification without being limited to the above examples.
  • the Cas protein may be fused with a functional domain such as a nuclear localization sequence or signal (NLS).
  • the present invention provides a guide nucleic acid capable of targeting a target sequence located in the genome of stem cells or cells differentiated or derived from stem cells, or a nucleic acid encoding the same; A gene donor encoding one or more immunosuppressive factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2, or a nucleic acid encoding the same, and an editor protein or a gene comprising a nucleic acid encoding the same.
  • a composition for genetic manipulation for preparing immunogenic stem cells or low-immunogenic cells differentiated from or derived from stem cells.
  • the target sequence may be a safe harbor site, but is not limited thereto.
  • the safe harbor site may be one selected from the group consisting of AAVS1 locus, CCR5 locus, CLYBL locus, ROSA26 locus, and SHS231 locus.
  • composition for genetic manipulation may optionally further include a donor including a specific nucleotide sequence to be inserted or a nucleic acid encoding the same.
  • the donor refers to an exogenous nucleotide sequence capable of expressing a specific peptide or protein, and can be inserted into genomic DNA through homology directed repair (HDR).
  • the nucleic acid sequence to be inserted may be a partial nucleotide sequence of a gene encoding one or more immunosuppressive factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2.
  • the donor may be a double-stranded nucleic acid or a single-stranded nucleic acid.
  • the donor may be linear or circular.
  • the donor may be a virus or a non-viral vector (eg a plasmid).
  • the virus may be a DNA virus or an RNA virus.
  • the DNA virus may be a double-stranded DNA (dsDNA) virus or a single-stranded DNA (ssDNA) virus.
  • the RNA virus may be a single-stranded RNA (ssRNA) virus.
  • the viral vectors include retrovirus, lentivirus, adenovirus, adenoassociated virus (AAV), vaccinia virus, poxvirus and herpes simplex virus (Herpes simplex virus, HSV) may be one or more viral vectors selected from the group consisting of.
  • the target sequence may be a target of the guide nucleic acid-editor protein complex, and the target sequence may include a protospacer-adjacent motif (PAM) sequence recognized by the editor protein, but is not limited thereto.
  • PAM protospacer-adjacent motif
  • the guide nucleic acid, editor protein or guide nucleic acid-editor protein complex and/or donor may be delivered or introduced into a subject in various forms.
  • subject is an organism into which guide nucleic acid, editor protein or guide nucleic acid-editor protein complex is introduced; organisms in which guide nucleic acids, editor proteins or guide nucleic acid-editor protein complexes operate; or a specimen or sample obtained from an organism.
  • the target may be an organism containing a target gene, a target nucleic acid, or a target chromosome of the guide nucleic acid-editor protein complex.
  • the organism may be an animal, an animal tissue or an animal cell.
  • the tissue may be eye, skin, liver, kidney, heart, lung, brain, muscle, or blood.
  • the cells may be stem cells, hepatocytes, cardiomyocytes, endothelial cells or pancreatic cells.
  • the sample or sample includes saliva, blood, liver tissue, brain tissue, hepatocytes, nerve cells, phagocytes, macrophages, T cells, B cells, astrocytes, cancer cells, or stem cells, etc., target genes, target nucleic acids, or target chromosomes. It may be acquired from organisms.
  • the guide nucleic acid, editor protein, or guide nucleic acid-editor protein complex may be delivered or introduced into a subject in the form of DNA, RNA, or a mixture thereof.
  • DNA, RNA, or a mixture thereof encoding the guide nucleic acid and/or editor protein may be delivered or introduced into the subject by a method known in the art.
  • DNA, RNA, or a mixture thereof encoding the guide nucleic acid and/or editor protein may be delivered or introduced into a subject by a vector, non-vector, or a combination thereof.
  • the vectors may be viral or non-viral vectors (eg plasmids).
  • the virus may be a DNA virus or an RNA virus.
  • the DNA virus may be a double-stranded DNA (dsDNA) virus or a single-stranded DNA (ssDNA) virus.
  • the RNA virus may be a single-stranded RNA (ssRNA) virus.
  • the viral vector may be at least one selected from the group consisting of retrovirus, lentivirus, adenovirus, adeno-associated virus (AAV), vaccinia virus, poxvirus, and herpes simplex virus.
  • the non-vector may be naked DNA, DNA complex or mRNA.
  • the nucleic acid encoding the guide nucleic acid and/or the editor protein may be delivered or introduced into a subject by a vector.
  • the vector may include a nucleic acid sequence encoding a guide nucleic acid and/or an editor protein.
  • the vector may simultaneously include a nucleic acid sequence encoding a guide nucleic acid and an editor protein.
  • the vector may include a nucleic acid sequence encoding a guide nucleic acid.
  • the nucleic acid sequence encoding the guide nucleic acid may be all included in one vector, or the nucleic acid sequence encoding the guide nucleic acid may be divided and included in several vectors.
  • the vector may include a nucleic acid sequence encoding an editor protein.
  • the nucleic acid sequence encoding the editor protein may be included in one vector, or the nucleic acid sequence encoding the editor protein may be divided and included in several vectors.
  • the editor protein may be delivered or introduced into a subject in the form of a peptide, polypeptide or protein.
  • the editor protein may be delivered or introduced into a subject in the form of a peptide, polypeptide or protein by a method known in the art.
  • the guide nucleic acid and editor protein may be delivered or introduced into a subject in the form of a nucleic acid-protein mixture.
  • the guide nucleic acid and editor protein may be delivered or introduced into a subject in the form of a guide nucleic acid-editor protein complex.
  • the guide nucleic acid may be DNA, RNA or a mixture thereof.
  • the editor protein may be in the form of a peptide, polypeptide or protein.
  • the guide nucleic acid and the editor protein may be delivered or introduced into the target in the form of a guide nucleic acid-editor protein complex, that is, a ribonucleoprotein (RNP), in which the guide nucleic acid in the form of RNA and the editor protein in the form of protein are formed.
  • RNP ribonucleoprotein
  • the present invention is to contact the stem cells and the low-immunogenic stem cell composition for the production of one or more immune activation inhibitory factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2 of the stem cells
  • one or more immune activation inhibitory factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2
  • a hypoimmunogenic stem comprising editing a gene encoding one or more immunosuppressive factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2 to increase expression or activity.
  • a method for producing cells is provided.
  • the low-immunogenic stem cells or the method for producing low-immunogenic cells differentiated or derived from stem cells is a low-immunogenic stem cell or a cell differentiated from or derived from the isolated stem cell.
  • LGALS9 to increase the expression or activity of one or more immunosuppressive factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2 in the stem cells or cells differentiated or derived from the stem cells.
  • Gal-9 LGALS9
  • CLEC4G LSECtin
  • PD-L1 HHLA2
  • a gene encoding one or more immunosuppressive factors selected from the group consisting of stem cells or cells differentiated from or derived from stem cells is incorporated into the genome.
  • a knock-in step may be included.
  • the artificially engineered stem cells of the present invention cells differentiated or derived therefrom, or artificially engineered cells differentiated or derived from stem cells are LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2.
  • LGALS9 Gal-9
  • CLEC4G LSECtin
  • PD-L1 HHLA2
  • HHLA2 HHLA2
  • the expression or activity of one or more immunosuppressive factors selected from the group consisting of is increased to inhibit immune rejection when transplanted to a mammal having a disease or condition, and is used as a composition for cell transplantation or living tissue regeneration to treat various diseases can be used as
  • the artificially engineered stem cells of the present invention are human vascular endothelial cells, pancreatic cells, bone cells, chondrocytes, cardiomyocytes, muscle cells, epidermal cells, fibroblasts, nerve cells, and hepatocytes.
  • Intestinal cells, gastric cells, skin cells, fat cells, blood cells, immune cells, cells, differentiated into spheroids and organoids, or cultured to be used as cell transplantation or biological tissue regeneration compositions for restoring damaged cells or tissues can be used as cell transplantation or biological tissue regeneration compositions for restoring damaged cells or tissues.
  • the biological tissue is a tissue formed with an ulcer or bedsore, brain tissue damaged by cell degeneration, brain tissue damaged by surgical operation, brain tissue damaged by traumatic brain disease, inflammatory brain disease It may be a damaged tissue selected from brain tissue damaged by, damaged bone tissue, damaged periodontal tissue, tissue damaged by central nervous system disease and tissue damaged by intractable dermatitis, and biological tissue regeneration is restoration of the damaged tissue, epidermal regeneration, Reproduction of glands or hair follicles, microvascular formation in dermal tissue, wound healing, soft tissue defect correction, bone healing or bone regeneration, cartilage regeneration, etc. may be performed, but are not limited thereto.
  • the composition for cell transplantation or biological tissue regeneration may be a cell therapy composition, a gene therapy composition, a tissue engineering therapy composition, an immunotherapeutic composition, or a composition for preventing or treating cancer.
  • cell therapy is a drug (US FDA regulation) used for the purpose of treatment, diagnosis, and prevention with cells and tissues manufactured through isolation, culture, and special manipulation from a subject, and is a cell or tissue function. It refers to medicines used for the purpose of treatment, diagnosis, and prevention through a series of actions, such as proliferating and selecting living autologous, allogeneic, or heterogeneous cells in vitro or changing the biological characteristics of cells in other ways to restore them.
  • gene therapy is administered to affect the expression of genetic material, and means a drug containing cells into which genetic material has been modified or introduced.
  • the disease or condition in a mammal is myocardial infarction, heart failure, ischemic cardiomyopathy, myocarditis, ischemic enteritis, inflammatory bowel disease, ulcerative colitis, Crohn's disease, acute cholecystitis, acute cholangitis, chronic cholecystitis , acute pancreatitis, chronic pancreatitis, acute nephritis, chronic nephritis, acute renal failure, chronic renal failure, pneumonia, interstitial pneumonia, idiopathic interstitial pneumonia, exfoliative interstitial pneumonia, acute interstitial pneumonia, nonspecific interstitial pneumonia, drug-induced lung Diseases, acute respiratory distress syndrome, chronic obstructive pulmonary disease, cerebral palsy syndromes including pediatric cerebral palsy, amyotrophic lateral sclerosis (ALS), polyneuropathy, spinal muscular atrophy, acute transverse myelitis, stroke, multiple Sclerosis, peripheral artery disease (PAD), throm
  • the administration route of the composition for cell transplantation or biological tissue regeneration of the present invention may be administered through any general route as long as it can reach the target tissue.
  • Parenteral administration for example, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, or intradermal administration may be administered, but is not limited thereto.
  • composition for cell transplantation or biological tissue regeneration may be formulated in a suitable form together with a pharmaceutical carrier generally used for cell therapy.
  • a pharmaceutical carrier generally used for cell therapy.
  • “Pharmaceutically acceptable” refers to a composition that is physiologically acceptable and does not usually cause an allergic reaction such as gastrointestinal disorder, dizziness, or similar reaction when administered to humans.
  • Pharmaceutically acceptable carriers include, for example, carriers for parenteral administration such as water, suitable oil, saline, aqueous glucose and glycol, and the like, and may further contain a stabilizer and a preservative. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite or ascorbic acid.
  • Suitable preservatives include benzalkonium chloride, methyl-paraben or propyl-paraben and chlorobutanol.
  • benzalkonium chloride methyl-paraben or propyl-paraben and chlorobutanol.
  • the composition may be administered by any device capable of transporting a cellular therapeutic agent to a target cell.
  • composition for cell transplantation or biological tissue regeneration of the present invention may contain a therapeutically effective amount of cells for the treatment of diseases.
  • “Therapeutically effective amount” means the amount of an active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue system, animal or human, as thought by a researcher, veterinarian, physician or other clinician. , which includes an amount that induces relief of the symptoms of the disease or disorder being treated.
  • the optimal cell content can be easily determined by a person skilled in the art, and depends on the type of disease, the severity of the disease, the amount of other components contained in the composition, the type of formulation, and the patient's age, weight, general health condition, sex and diet, It can be adjusted according to various factors, including administration time, administration route and secretion rate of the composition, treatment period, and concurrently used drugs. It is important to include the amount that can obtain the maximum effect with the minimum amount without side effects in consideration of all the above factors.
  • the daily dose of the stem cells of the present invention is 1.0 ⁇ 10 5 to 1.0 ⁇ 10 30 cells/kg body weight, preferably 1.0 ⁇ 10 10 to 1.0 ⁇ 10 20 cells/kg body weight, which may be administered once or several times.
  • the actual dosage of the active ingredient should be determined in light of various related factors such as the disease to be treated, the severity of the disease, the route of administration, the weight, age and sex of the patient, and therefore, the dosage is It does not limit the scope of the present invention in any way.
  • the composition comprising the cells of the present invention as an active ingredient is rectal, intravenous (intravenous therapy, i.v), intraarterial, intraperitoneal, intramuscular, intrasternal, transdermal, topical, intraocular or It can be administered in a conventional manner via the intradermal route.
  • the present invention provides a method of treatment comprising administering to a mammal having a disease or condition a therapeutically effective amount of the artificially engineered stem cells or cells differentiated or derived therefrom.
  • the term mammal refers to a mammal that is a subject of treatment, observation, or experimentation, and preferably refers to a human.
  • the present invention is directed to administering a therapeutically effective amount of the artificially engineered stem cells, cells differentiated or derived therefrom, or artificially engineered cells differentiated or derived from stem cells to a mammal having a disease or condition. It provides a cell therapy method (Cell therapy method) using stem cells, including the step.
  • Cell therapy method Cell therapy method
  • the method artificially increases the expression or activity level of one or more immunosuppressive factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2.
  • immunosuppressive factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2.
  • Administration of engineered stem cells, cells differentiated or derived from artificially engineered stem cells, or artificially engineered cells differentiated or derived from stem cells suppresses immune rejection when used as a cell therapy in an autologous or allogeneic environment may become immune tolerant.
  • Example One AAVS1 Gene inserted into the site (knock-in, Knock-In) iPSCs Preparation of (induced pluripotent stem cell) cells
  • iPSCs were cultured according to the manufacturer's manual. In a culture dish coated with Vitronectin XF TM (STEMCELL Technologies) at RT (room temperature) for 1 hour, the culture was performed using TeSR TM -E8 TM (STEMCELL Technologies) medium.
  • sgRNA SEQ ID NO: 1: gtcaccaatcctgtccctag
  • sgRNA SEQ ID NO: 1: gtcaccaatcctgtccctag
  • LGALS9 Gal-9
  • CLEC4G LSECtin
  • HHLA2 gene donors The donor complex was introduced into iPSCs by electroporation (Amaxa 4D nucleofector).
  • the above sgRNA, Cas9 protein, and gene donor complexes were electroporated according to the manufacturer's (Lonza, 4D nucleofector) protocol using nucleofector program (CA-137) with 4x10 5 iPSC treated with 20ul primary P3 buffer.
  • iPSC induced pluripotent stem cell
  • the gene primers used the primers in Table 1 below after confirming the base sequence, and the PCR reaction was performed by first denaturation at 98 ° C for 1 minute, denaturation at 98 ° C for 20 seconds, annealing at 62 ° C for 30 seconds, The process of extension (extension) for 3 minutes at 72 °C was repeated a total of 40 times, and finally extended at 72 °C for 5 minutes to stabilize the PCR product.
  • Figure 2 shows the results of PCR reaction from DNA of cells and the PCR products obtained above in order to select single clones from iPSCs in which three genes prepared in Example 1 were knocked-in (KI). It shows the result of performing Sanger sequencing using SEQ ID Nos. 10 to 13 are sequence information confirmed from the PCR reaction, and as shown in FIG. 2, compared to WT-iPSC without gene knock-in (KI), KI-iPSC (AAVS1-ALC3#11) inserted in a single clone A specific size band of the affected gene could be identified.
  • mRNA was extracted from iPSCs using the RNeasy mini kit (Qiagen) according to the manufacturer's protocol. Then, 100ng mRNA was reverse transcribed using a cDNA reverse transcription kit (Thermo Fisher Scientific). qRT-PCR was performed with 100 ng of PowerUp TM SYBR TM Green Master Mix using QuantStudio 3 (Thermo Fisher Scientific) according to the manufacturer's protocol. Gene expression levels were calculated using CT values, and GAPDH was used as an endogenous control.
  • Figure 3 shows the results of confirming the mRNA level (level) change for the three genes knocked-in in Example 1 by real time PCR method. As shown in FIG. 3, it was confirmed that the mRNA levels of Galectin-9, CLEC4G, and HHLA2 were higher than those of Mock (WT).
  • ddPCR was performed as follows to confirm the copy number of the knocked-in gene in Example 1.
  • Figure 4 is a graph showing the results of confirming the copy number (Copy Number) of knock-in (KI) genes using the ddPCR method. It was confirmed that 2 copies of the gene were knocked-in (KI) in the KI-iPSC clone.
  • the AAVS1-ALC3#11 clone prepared in Example 1 was analyzed using a flow cytometry method to confirm the transgene expression of the knocked-in (KI) genes.
  • the cells After washing the cultured cells twice with phosphate buffer saline (PBS), the cells were detached using 0.05% trypsin-EDTA and centrifuged at 1,000 rpm for 5 minutes. The cells were suspended with 100ul of FACS staining buffer, mixed with antibodies, reacted at 4 degrees for 1 hour, washed twice with PBS, suspended in 500ul of PBS, and subjected to FACS analysis.
  • PBS phosphate buffer saline
  • Figure 5 shows the results of measuring the HHLA expression level of the AAVS1-ALC3#11 clone prepared in Example 1 through flow cytometry in Experimental Example 4, and 98% of HHLA2+ in the AAVS1-ALC3#11 clone compared to the isotype. was able to confirm
  • KI-iPSC induced pluripotent stem cell
  • EC Endothelial Cell
  • WT and KI-iPSCs were differentiated into endothelial cells (EC, Endothelial Cell) as follows. Differentiated endothelial cells were co-cultured with immune cells to confirm immunogenicity.
  • Cells were incubated for 3 days after switching to N2B27 medium containing ethanol (Gibco), 8 ⁇ M CHIR99021 (Cayman Chemical) and 25 ng/ml BMP-4 (Peprotech). The medium was then replaced with StemPro-34 SFM (Thermo Fisher Scientific) supplemented with 100 ng/ml vascular endothelial growth factor (Peprotech), 50 ng/ml basic fibroblast growth factor (Peprotech), and 2 ⁇ M forskolin (Abcam) and the cells were incubated for 2 days. Cell populations were then enriched for CD144+ cells using MACS cell separation (Miltenyi Biotec).
  • CD144+ cells were plated and maintained in matrigel coated plates containing endothelial cell growth medium (EGMTM-2blletKitTM) (Lonza) for at least 7 days for further differentiation. Endothelial cells were analyzed by flow cytometry using an anti-CD31 antibody (1:25, Clone WM-59, eBioscience).
  • EMMTM-2blletKitTM endothelial cell growth medium
  • Figure 6 shows the results of flow cytometry analysis using anti-CD31 antibody after differentiating wild-type (WT) iPSC and iPSC knocked-in (KI) iPSC into endothelial cells (EC) with three genes prepared in Example 1 , it was observed that about 98% or more of the cells expressed the EC marker CD31+.
  • WT wild-type
  • KI iPSC knocked-in
  • Figure 6 (b) shows the results of flow cytometry analysis of wild-type (WT) iPSC and iPSC in which three genes prepared in Example 1 were knocked-in (KI) differentiated into endothelial cells (EC). It was confirmed that the HLA-ABC antigen appeared on the surface of EC cells, and the level was observed to increase higher after treatment with interferon gamma at a concentration of 100 ng/ml for 48 hr.
  • WT wild-type
  • KI knocked-in
  • Cytotoxicity Assays ( NK In vitro fluorescence cytotoxicity assay to measure cellular effects)
  • NK cells The effect of NK cells on KI clones (target cells) and K562 cells (ATCC) was evaluated by flow cytometry. After labeling the target cells with CellTraceViolet (Thermo Fisher Scientific) for 15 minutes at room temperature, they were incubated with NK cells at various ratios in a 37° C. 5% CO 2 incubator.
  • washed cells were stained with 7-Amino-Actinomycin (7-AAD, BD Bioscience) according to the manufacturer's instructions and analyzed with Attune Flow Cytometers (Thermo Fisher Scientific).
  • FIG. 7(a) shows K562 cells, endothelial cells differentiated from wild-type (WT) iPSCs (WT-iPSC_EC), and endothelial cells differentiated from iPSCs knocked-in (KI) three genes prepared in Example 1 (KI-iPSC_EC). It is a graph showing the results of confirming cytotoxicity by culturing iPSC EC) with NK cells, which are effector cells, at various ratios.
  • Apoptotic cells were detected as 7-AAD+ cells, and at this time, it was confirmed that endothelial cells (WT-iPSC_EC) differentiated from K562 tumor cells and wild-type (WT) iPSCs that do not express HLA were very vulnerable to NK cell cytotoxicity. .
  • Figure 7 (b) shows endothelial cells (WT-iPSC_EC, Figure 6 (b)) differentiated from wild-type (WT) iPSCs in which HLA-ABC is expressed at 98% or more and three genes prepared in Example 1 are knocked-in ( It is a graph showing the results of evaluating the cytotoxicity of NK cells in endothelial cells (KI-iPSC EC) differentiated from KI) iPSCs.
  • effector cells NK cells
  • target cells EC, endothelial cells
  • 7-AAD+ cells were measured.
  • KI-iPSC_EC Compared to WT-iPSC_EC, the percentage of apoptotic cells was small, and as the cell ratio of effector cells (effector, NK cells): target cells (EC, endothelial cells) increased, the percentage of 7-AAD + cells increased.
  • lentivirus used from iPSCs differentiated overexpression EC cells manufacturing
  • Figure 8 is LGALS9 (Gal-9) / CLEC4G (LSECtin) / HHLA-2 (SEQ ID NO: 23), LGALS9 (Gal-9) (SEQ ID NO: 24), CLEC4G (LSECtin) (SEQ ID NO: 25), LGALS9 (Gal-9) 9) / CLEC4G (LSECtin) (SEQ ID NO: 26), LGALS9 (Gal-9) / CLEC4G (LSECtin) / PD-L1 (SEQ ID NO: 27) is a diagram showing an example of a lentivirus for each gene insertion. In this case, the gene may be inserted into a target sequence on the EC cell genome.
  • the lentivirus described in FIG. 8 was delivered to EC cells differentiated from WT-iPSC.
  • the day before delivery of the lentivirus 500,000 cells were cultured in a culture dish, and 24 hours later, the cells were infected with lentiviral particles at an MOI of 100. After infection, the medium was replaced with fresh medium and the cells were maintained at 37°C for 48 hours as indicated.
  • the four lentiviruses used were produced by VectorBuilder (Vector Builder Inc, China).
  • FIG. 9(a) shows K562 cells, endothelial cells differentiated from wild-type (WT) iPSCs (WT-iPSC_EC), endothelial cells differentiated from iPSC into which the Gal-9 gene of SEQ ID NO: 24 was inserted (Gal-9_EC), SEQ ID NO: 24 Endothelial cells (CLEC4G_EC) differentiated from iPSC into which the CLEC4G gene of SEQ ID NO: 25 was inserted (CLEC4G_EC), endothelial cells differentiated from iPSC into which the Gal-9/CLEC4G gene of SEQ ID NO: 26 was inserted (Gal-9+CLEC4G_EC), and Gal-9+CLEC4G_EC of SEQ ID NO: 27.
  • WT-iPSC_EC wild-type iPSCs
  • 9(b) is a graph showing the results of measuring 7-AAD+ cells by co-culturing effector cells (NK cells):target cells (EC, endothelial cells) at a ratio of 1:1.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Immunology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Reproductive Health (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Transplantation (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

면역활성 억제 인자의 발현 또는 활성 수준이 증가되어 이식 시 면역 거부 반응을 억제할 수 있는 저면역원성 줄기세포, 줄기세포로부터 분화하거나 유래된 저면역원성 세포, 이의 제조방법 및 이를 이용한 세포 치료제가 제공된다.

Description

저면역원성 줄기세포, 줄기세포로부터 분화되거나 유래된 저면역원성 세포 및 이의 제조방법
면역활성 억제인자의 발현 또는 활성 수준이 증가되어 이식 시 면역 거부 반응을 억제할 수 있는 저면역원성 줄기세포, 줄기세포로부터 분화되거나 유래된 저면역원성 세포, 이의 제조방법 및 이를 이용한 세포 치료제가 제공된다.
유도 만능줄기세포(induced pluripotent stem cells, 이하 'iPSC') 는, 인체에서 분리된 체세포를 인위적인 자극을 통해 우리 몸의 모든 세포로 분화 가능한 만능줄기세포로 역분화한 것으로, 이의 전분화능을 이용하여 손상된 세포, 조직, 장기를 재생하기 위한 재생 세포 치료제로 주목받고 있다.
환자 자신의 세포에서 유도 만능줄기세포를 만들어 필요한 세포, 오가노이드, 장기 등으로 분화시켜 환자 자신의 치료에 사용하는 경우 면역거부 반응 이 적기 때문에 자가유래 세포 치료에 사용될 수 있다. 그러나, 이러한 맞춤형 줄기세포 치료의 경우 재생 치료를 위한 세포, 조직 등으로 제조하는데 시간과 인력 이 소요되어 상용화에 제한점이 있다.
이에 환자 본인의 세포인 자가유래(autologous) 세포 치료제가 아닌 타인으로부터 유래한 동종유래(allogenic) 세포 치료제가 대안이 될 수 있으나, 인간의 체내에서 중요한 면역 메커니즘을 담당하는 NK 세포, T 세포 등의 면역 담당 세포에 인식되어 면역거부반응이 발생할 수 있다.
자연살해세포(Natural Killer Cell, NK 세포)는 세포표면의 다양한 활성화 수용체(activating receptor)와 억제성 수용체(inhibitory receptor)를 통해 암세포, 바이러스 감염 세포 등 비정상적인 세포에 발현되는 그들의 리간드(ligands)와 결합하여 이로써 유도되는 신호간의 균형에 의해 그 활성이 조절된다. 또한 면역체계는 세포를 직접적으로 공격할 수 있는 T 세포가 과도하게 활성화되어 정상세포를 공격하는 것을 막기 위해 면역 관문(immune checkpoint)라고 불리는 억제기전을 가지고 있다. T 세포의 활성화는 그 세포 표면에 존재하는 T 세포 항원수용체(T cell receptor, TCR)가 항원제시세포(Antigen Presenting cell, APC)의 MHC 분자에 결합된 항원을 인지하는 것으로부터 시작된다. TCR-MHC 결합을 통해 항원을 인지한 후 APC에서 발현하는 CD80, CD40 등이 T 세포 표면의 리간드에 해당하는 CD28, CD40L 등과 동시에 결합함으로써 T세포의 활성화가 이루어진다. 반면에 T 세포 상의 CTLA-4, PD-1 등의 면역 관문 수용체는 암세포 등 비정상세포 상의 CD80, CD86, PD-L1 등의 면역 관문 리간드와의 결합을 통하여 T 세포를 비활성화하는 억제 신호를 보낸다.
따라서, 생체 내 이러한 면역 활성화 및 억제 관련 수용체와 작용하는 리간드를 유전적으로 조작하는 것은 면역 거부반응을 피할 수 있는 바람직한 대안이 될 수 있다.
(선행기술문헌)
(특허문헌)
일본공개특허 2018-515139
대한민국공개특허 10-2020-0120939
(비특허문헌)
Nayoung Kim, HunSik Kim, Front. Immunol., 10 September 2018, Targeting Checkpoint Receptors and Molecules for Therapeutic Modulation of Natural Killer Cells
Rupal S. Bhatt et al., November 23, 2020, Cancer Immunology Research. KIR3DL3 is an inhibitory receptor for HHLA2 that mediates an alternative immunoinhibitory pathway to PD1
본 발명의 과제는 세포, 조직, 장기이식 시 면역 거부 반응을 억제할 수 있는 저면역원성 줄기세포, 줄기세포로부터 분화되거나 유래된 저면역원성 세포, 이의 제조방법 및 이를 이용한 세포 치료제를 제공하는 것이다.
상기한 과제를 달성하기 위해, 본 발명은 줄기세포 유전체(genome)에 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자를 코딩하는 유전자가 삽입된 인위적으로 조작된 유전자를 갖는, 인위적으로 조작된 줄기세포를 제공한다.
또한 본 발명은 줄기세포로부터 분화하거나 유래된 세포의 유전체(genome)에 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자를 코딩하는 유전자가 삽입된 인위적으로 조작된 유전자를 갖는, 줄기세포로부터 분화하거나 유래된 인위적으로 조작된 세포를 제공한다.
또한 본 발명은 상기한 인위적으로 조작된 줄기세포로부터 분화되거나 유래한, LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자의 발현 또는 활성이 증가한 세포를 제공한다.
또한 본 발명은 줄기세포 또는 줄기세포로부터 분화하거나 유래된 세포의 유전체(genome) 내에 위치한 표적 서열을 표적화할 수 있는 가이드 핵산 또는 이를 암호화하는 핵산; LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자를 코딩하는 유전자 도너 또는 이를 암호화하는 핵산 및 에디터단백질 또는 이를 암호화하는 핵산을 포함하는 저면역원성 줄기세포 또는 줄기세포로부터 분화하거나 유래된 저면역원성 세포 제조용 조성물을 제공한다.
또한 본 발명은 분리된 줄기세포 또는 분리된 줄기세포로부터 분화하거나 유래된 세포에 상기한 저면역원성 줄기세포 또는 줄기세포로부터 분화하거나 유래된 저면역원성 세포 제조용 조성물을 도입하는 단계; 및
상기 줄기세포 또는 분리된 줄기세포로부터 분화하거나 유래된 세포의 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자의 발현 또는 활성을 증가시키도록 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자를 코딩하는 유전자를 상기 줄기세포 또는 줄기세포로부터 분화하거나 유래된 세포 유전체(genome)에 넉-인(knock-in)하는 단계
를 포함하는 저면역원성 줄기세포 또는 줄기세포로부터 분화하거나 유래된 저면역원성 세포의 제조방법을 제공한다.
또한 본 발명은 상기한 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 세포 이식 또는 생체 조직 재생용 조성물을 제공한다.
또한 본 발명은 상기한 줄기세포로부터 분화하거나 유래된 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 세포 이식 또는 생체 조직 재생용 조성물을 제공한다.
또한 본 발명은 상기한 인위적으로 조작된 줄기세포로부터 분화되거나 유래한, LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자의 발현 또는 활성이 증가한 세포를 유효성분으로 포함하는 세포 이식 또는 생체 조직 재생용 조성물을 제공한다.
본 발명의 줄기세포 또는 줄기세포로부터 분화하거나 유래한 세포는 세포, 조직, 장기이식 시 면역 거부 반응을 회피하는 저면역원성을 나타내므로, 이를 다양한 세포로 분화하여, 자가 또는 동종 유래 환경에서 면역 거부반응을 일으키지 않는 세포 치료제로 이용될 수 있다.
도 1은 세이프 하버(Safe harbor) 사이트 중 하나인 AAVS1의 특정 사이트를 기준으로 상동성 아암(homology arm) 왼쪽과 오른쪽 사이에 3가지 유전자 LGALS9(Gal-9), CLEC4G(LSECtin) 및 HHLA2를 삽입한 모식도를 나타낸 것이다.
도 2는 실시예 1에서 제조한 유전자 3개가 넉-인(KI)된 iPSC로부터 다단일 클론(single Clone)들을 선별하기 위해, 세포의 DNA로부터 PCR반응을 수행한 결과 및 하고, 상기에서 얻은 PCR 산물을 사용하여 생어 서열분석 (Sanger sequencing)을 수행한 결과를 나타낸 것이다.
도 3은 실시예 1에서 넉-인한 3가지 유전자에 대한 mRNA 레벨(level) 변화를 Real time PCR 방법으로 확인한 결과를 나타낸 것이다.
도 4는 실험예 3에서 ddPCR 방법을 이용하여 넉-인(KI)된 유전자들의 카피 수(Copy Number)를 확인한 결과를 나타낸 그래프이다.
도 5는 실험예 4에서 유세포 분석을 통해 실시예 1에서 제조한 AAVS1-ALC3#11 clone의 HHLA2 발현량을 측정한 결과를 나타낸 것이다.
도 6(a)는 야생형(WT) iPSC 및 실시예 1에서 제조한 유전자 3개가 넉-인(KI)된 iPSC를 내피세포(EC)로 분화시킨 후 항-CD31 항체를 이용하여 유세포 분석한 결과를 나타낸 것이고, 도 6(b)는 iPSC로부터 분화된 내피세포(EC)의 표면에서 HLA-ABC항원이 나타나는 것을 확인한 결과를 나타낸 것이다.
도 7(a)는 K562 세포, 야생형(WT) iPSC를 분화시킨 내피세포(WT-iPSC_EC), 실시예 1에서 제조한 유전자 3개가 넉-인(KI)된 iPSC를 분화시킨 내피세포(KI-iPSC EC)를 효과기 세포인 NK 세포와 다양한 비율로 배양하여 세포독성을 확인한 결과를 나타낸 그래프이고, 도 7(b)는 HLA-ABC가 98%이상 발현되는 야생형(WT) iPSC를 분화시킨 내피세포(WT-iPSC_EC, 도 6(b))와 실시예 1에서 제조한 유전자 3개가 넉-인(KI)된 iPSC를 분화시킨 내피세포(KI-iPSC EC)에서 NK 세포의 세포독성을 평가한 결과를 나타낸 그래프이다.
도 8은 LGALS9(Gal-9)/CLEC4G(LSECtin)/HHLA-2(서열번호 23), LGALS9(Gal-9)(서열번호 24), CLEC4G(LSECtin)(서열번호 25), LGALS9(Gal-9)/CLEC4G(LSECtin)(서열번호 26), LGALS9(Gal-9)/ CLEC4G(LSECtin)/PD-L1(서열번호 27)의 각각의 유전자 서열 삽입을 위한 렌티바이러스의 일 예시를 나타내는 도이다.
도 9(a)는 K562 세포, 야생형(WT) iPSC를 분화시킨 내피세포(WT-iPSC_EC), iPSC로부터 분화된 내피세포에 서열번호 24의 Gal-9 유전자가 삽입된 내피세포(Gal-9_EC), iPSC로부터 분화된 내피세포에 서열번호 25의 CLEC4G 유전자가 삽입된 내피세포(CLEC4G_EC), iPSC로부터 분화된 내피세포에 서열번호 26의 Gal-9/CLEC4G 유전자가 삽입된 내피세포(Gal-9+CLEC4G_EC), iPSC로부터 분화된 내피세포에 서열번호 27의 Gal-9/CLEC4G/PD-L1 유전자가 삽입된 내피세포(Gal-9+CLEC4G+ PD-L1_EC)를 효과기 세포인 NK 세포와 다양한 비율로 배양하여 세포독성을 확인한 결과를 나타낸 그래프이고, 도 9(b)는 효과기 세포(effector, NK 세포) : 표적 세포(EC, 내피세포)를 1:1의 비율로 공배양하여 7-AAD+한 세포를 측정한 결과를 나타낸 그래프이다.
이하 본 발명을 상세히 설명한다.
본 명세서에 있어서, "줄기세포(stem cell)"란 여러 종류의 신체 조직 세포로 분화할 수 있는 능력, 즉, 줄기세포성(stemness)을 가진 미분화 세포를 총칭하는 광의의 개념을 말한다. 이때 상기 줄기세포는 유도 만능줄기세포, 배아줄기세포, 체세포 핵치환 배아줄기세포(Somatic cell nuclear transfer-PSC) 또는 성체 줄기세포일 수 있다. 또한, 상기 세포는 인간 유래일 수 있으나, 이에 제한되는 것은 아니다.
본 명세서에 있어서, "분화"는 세포가 분열하여 증식하며 전체 개체가 성장하는 동안에 세포의 구조나 기능이 특수화되는 현상을 의미한다. 즉, 생물의 세포, 조직 등이 각각에게 주어지는 역할을 수행하기 위해 적합한 형태 및 기능으로 변하는 과정을 말하며, 예를 들어, 만능 줄기세포가 외배엽(대뇌 피질, 중뇌, 시상하부 등), 중배엽(난황낭 등) 및 내배엽 세포로 변하는 과정뿐 아니라 조혈모세포가 적혈구, 백혈구, 혈소판 등으로 변하는 과정, 즉 전구세포가 특정 분화형질을 발현하게 되는 것도 모두 분화에 포함될 수 있다.
본 명세서에 있어서, "발현 증가"는 야생형에서 측정된 단백질의 발 현 수준보다 높은 정도의 발현이 나타내는 것을 의미한다. 상기 증가는 유전적 변형을 갖지 않은 세포 또는 야생형 세포에 비하여 약 5% 이상, 약 10% 이상, 약 15% 이상, 약 20% 이상, 약 30% 이상, 약 50% 이상, 약 60% 이상, 약 70% 이상, 또는 약 100% 이상 증가된 것일 수 있다. 상기 발현의 증가는 유전자 카피 수의 증가 또는 증가된 전사 또는 번역에 의하여 야기될 수 있다.
본 명세서에서 사용된 용어 "활성 증가(increase in activity)", 또는 "증가된 활성 (increased activity)"은 단백질 또는 효소 활성의 검출 가능한 증가를 나타낼 수 있다. "활성 증가 (increase in activity)", 또는 "증가된 활성(increased activity)"은 주어진 모세포 또는 야생형 세포에 비해 더 높은 수준의 단백질, 또는 효소의 활성을 의미한다.
본 명세서에 있어서, "면역활성 억제인자"는 T 세포, NK 세포 등의 면역 담당 세포에서 발현되는 면역관문 수용체(immune checkpoint receptor) 또는 면역억제성 수용체(inhibitory receptor)와 특이적으로 결합하여 면역 세포 활성을 억제할 수 있는 리간드를 의미한다.
본 명세서에 있어서, "저면역원성"은 세포가 다른 개체에게 이식 시, 야생형과 비교할 때 감소하거나 제거된 면역 거부 반응을 나타내는 것을 의미 한다. 면역 거부 반응은 20% 이상, 약 30% 이상, 약 40% 이상, 약 50% 이상, 약 55% 이상, 약 60% 이상, 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85% 이상, 약 90% 이상, 약 95% 이상, 또는 약 100% 감소된 것일 수 있다.
면역억제인자의 발현 또는 활성 수준이 증가되어 이식 시 면역 거부 반응을 억제할 수 있는 저면역원성 줄기세포 또는 줄기세포로부터 분화하거나 유래한 저면역원성 세포가 제공된다.
상기 줄기세포는 T세포, NK 세포 등의 면역세포 활성화를 억제하는 면역관문(immune checkpoint) 수용체와 결합하는 리간드의 발현 또는 활성, 면역억제성 수용체(inhibitory receptor)와 결합하는 리간드의 발현 또는 활성이 증가되어, 자가 또는 동종유래 환경에서 세포 치료제로 사용시 면역 거부반응이 억제되어 면역관용 상태가 될 수 있다.
본 발명의 일 구현예에 따르면, 상기 줄기세포 또는 줄기세포로부터 분화하거나 유래한 세포는 야생형 줄기세포 또는 야생형 세포와 비교하여, LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하 나 이상의 면역활성 억제 인자의 발현 또는 활성이 증가할 수 있다.
갈렉틴-9(Gal-9) 또는 LGALS9는 TIM-3(T-cell immunoglobulin and mucin domain protein 3)에 대한 알려진 리간드로, 렉틴, 갈락토사이드-결합, 가용성, 9(lectin, galactoside-binding, soluble, 9); 종양 항원 HOM-HD-21; 에칼렉틴 (Ecalectin); Gal-9; 요산염 수송체/채널 단백질; LGALS9A; 및 HUAT와 같은 많은 다른 명칭으로 알려져 있다. TIM-3는 면역억제성 수용체로, T세포와 조절T세포, B 세포, 수지상세포, NK세포, 대식세포에 발현되며, TIM-3의 리간드인 갈렉틴-9과 결합시 T 세포, NK 세포 등의 활성이 억제된다.
LSECtin(liver and lymph node sinusoidal endothelial cell C-type lectin)는 LAG-3(lymphocyte activation gene 3)에 대한 리간드이다. LAG-3는 TIM3, CTLA-4, PD-1, PD-L1과 같은 여러 면역관문 단백질 중 하나로, 도움 T 세포와 세포독성 T 세포, 조절T 세포, 일부 NK세포, B세포 등에서 발현된다. T 세포 등의 표면에 위치한 면역관문 단백질과 비정상세포 등에 존재하는 특이적 리간드가 결합하여 T 세포, NK 세포가 무력화됨으로써 면역회피(immune evasion)가 나타난다.
PD-L1(Programmed cell Death Ligand-1)는 정상 세포에 존재하는 막 횡단 단백질로 T 세포의 Programmed cell death protein 1(PD-1)과 결합하는 PD-1에 대한 리간드로서 PD-1과 결합하여 면역 공격 회피를 유도한다. 한편, T 세포가 활성화되기 위해서는 T 세포 수용체(receptor)와 항원의 1차 신호자극 이외에 2차 신호자극(co-stimulation)이 동시에 필요하다. 이때, 둘 중 하나의 신호라도 없으면 T 세포는 비활성화 상태가 된다. PD-1(programmed death-1)은 T 세포의 2차 신호 활성을 조절하는 2차 신호자극인자(immune check point 또는 immune modulator)로서, 활성화된 T 세포(CD8 및/또는 CD4)나 수지상 세포(dendritic cell)와 같이 세포 표면에서 발현하는 PD-L1(programmed cell death ligand 1) 또는 B7.1 (CD80) 등과 결합함으로써, T 세포의 증식을 억제하고, 사이토카인(cytokine) 발현을 감소시키는 등 T 세포의 기능을 억제하는 작용을 할 수 있다.
HHLA2(human endogenous retrovirus-H long terminal repeatassociating protein 2)는 T 세포의 기능을 조절하는 새롭게 확인된 B7 패밀리 구성원이다. HHLA2는 TMIGD2(transmembrane and immunoglobulin domain containing 2)에 대한 특이적 리간드로 확인되었고 HHLA2/TMIGD2 상호작용은 AKT-의존성 신호전달 케스케이드를 통해 인간 T-세포 성장 및 사이토카인 생산을 선택적으로 공동자극한다. 또한 HHLA2는 T 및 NK 세포 상의 수용체인 KIR3DL3(killer cell immunoglobulin-like receptor, three immunoglobulin domains and long cytoplasmic tail 3)와 결합하여 또한 T 세포 활성화도 저해한다.
본 발명의 일 구현예에 따르면, 상기 줄기세포는 줄기세포 유전체(genome)에 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자를 코딩하는 유전자가 삽입된 인위적으로 조작된 유전자를 갖는, 인위적으로 조작된 줄기세포이다.
본 발명의 일 구현예에 따르면, 상기 줄기세포로부터 분화하거나 유래된 세포는 줄기세포로부터 분화하거나 유래된 세포 유전체(genome)에 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자를 코딩하는 유전자가 삽입된, 인위적으로 조작된 유전자를 갖는, 줄기세포로부터 분화하거나 유래된 인위적으로 조작된 세포이다.
본 발명의 일 구현예에 따르면, 상기 줄기세포로부터 분화하거나 유래된 세포는 인간혈관내피세포, 췌장세포, 골세포, 연골세포, 심근세포, 근육세포, 표피세포, 섬유아세포, 신경세포, 간세포, 장세포, 위세포, 피부세포, 지방세포, 혈액세포, 면역세포,　세포　스페로이드 및 오가노이드로 이루어진 군에서 선택된 1종이다.
본 발명의 일 구현예에 따르면, 상기 인위적으로 조작된 줄기세포의 유전자의 서열은 상기 야생형 줄기세포의 유전자 서열과 다르고, 야생형 줄기세포와 비교하여, LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자를 코딩하는 유전자 또는 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자의 발현 또는 활성이 증가할 수 있다.
본 발명의 일 구현예에 따르면, 상기 줄기세포로부터 분화하거나 유래된 인위적으로 조작된 세포의 유전자의 서열은 상기 야생형 세포의 유전자 서열과 다르고, 야생형 줄기세포와 비교하여, LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자를 코딩하는 유전자 또는 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자의 발현 또는 활성이 증가할 수 있다.
본 명세서에 있어서, "발현 또는 활성 증가"는 야생형 줄기세포 또는 야생형 세포에 비하여 높은 수준으로 발현되거나, 또는 단백질이 발현이 되더라도 그 활성이 높은 것을 의미할 수 있다.
즉, 줄기세포 또는 줄기세포로부터 분화하거나 유래된 세포에 있어서 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자의 발현 또는 활성이 야생형 줄기세포 또는 야생형 세포의 발현 또는 활성보다 약 20% 이상, 약 30% 이상, 약 40% 이상, 약 50% 이상, 약 55% 이상, 약 60% 이상, 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85% 이상, 약 90% 이상, 약 95% 이상, 또는 약 100% 증가된 것일 수 있다.
본 발명에서, 유전자 핵산 서열 인위적인 변경은 유전자를 구성하는 핵산의 변형을 통해 이루어질 수 있다. 이는 유전자의 일부 또는 전부가 변이, 치환, 삭제되거나 상기 유전자에 하나 이상의 염기가 삽입되는 것에 의한 것일 수 있으며, 유전자 가위 기술을 이용하여 이루어질 수 있다. 일 예로, 비-상동적인 말단 연결(non-homologous end joining, NHEJ) 또는 상동 재조합 수리(homology directed repair, HDR) 기작에 의해 이루어질 수 있다.
본 발명의 일 구현예에서, 상기 줄기세포 또는 줄기세포로부터 분화하거나 유래된 세포는 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제인자를 코딩하는 유전자가 넉-인(knock-in)될 수 있다.
본 명세서에 있어서, "넉-인(knock-in)"은 특정 핵산 또는 유전자를 세포 내 동물 유전체(animal genome) 상 표적 유전자 또는 핵산에 삽입(insertion) 하는 것을 의미한다.
세포는 임의의 이중 가닥 또는 단일 가닥 DNA 손상을 복구하기 위해 고유의 기전을 가지고 있다. DNA 이중가닥 절단(DNA double-strand break, DSB) 복구 기전은 비-상동적인 말단 연결(non-homologous end joining, NHEJ)과 상동 재조합(homologous recombination, HR)으로 분류된다.
상동 재조합 수리(homology directed repair, HDR)는 손상된 유전자 또는 핵산을 수선 또는 수복하기 위해 상동성을 가진 서열을 주형으로 이용하는 방 식으로 오류 없이 교정할 수 있는 방법이다. 일반적으로, 파손된 DNA을 수선 또는 수복하기 위해, 변형이 이루어지지 않은 상보적인 뉴클레오타이드 서열의 정보를 이용하거나 자매 염색분체의 정보를 이용하여 파손된 DNA를 수선 또는 수복한다.
HDR을 이용한 손상된 DNA 수선 또는 수복을 위해, 세포가 본래 가지는 상보적인 뉴클레오타이드 서열 또는 자매 염색분체를 이용하는 대신에, 상보적인 뉴클레오타이드 서열 또는 상동성 뉴클레오타이드 서열 정보를 이용한 인공적으로 합성한 DNA 주형, 즉, 상보적인 뉴클레오타이드 서열 또는 상동성 뉴클레오타이드 서열을 포함하는 핵산 주형을 세포에 제공하여 파손된 DNA를 수선 또는 수복할 수 있다. 이때, 상기 핵산 주형에 추가로 핵산 서열 또는 핵산 조각을 포함시켜 파손된 DNA를 수선 또는 수복할 때, 파손된 DNA에 추가로 포함시킨 핵산 서열 또는 핵산 조각을 넉-인(knock-in)할 수 있다.
일 예로, CRISPR 복합체를 이용하여 표적 유전자 또는 핵산의 이중 가닥 또는 단일 가닥을 절단하고, 절단 위치와 근접한 뉴클레오타이드 서열과 상보적인 뉴클레오타이드 서열을 포함하는 핵산 주형을 세포에 제공하여 표적 유전자 또는 핵산의 절단된 뉴클레오타이드 서열을 HDR 방법으로 수선 또는 수복할 수 있다. 상동성-독립 표적화된 삽입(homology-independent targeted integration, HITI)은 증식 및 비 증식 세포에서 이식 유전자(transgene)의 삽입을 가능하게 한다(Suzuki et al., Nature, 2016, 540(7631):144-149). HITI는 CRISPR/Cas9를 이용하여 삽입 부위를 표적으로 하고, 특정 뉴클레오타이드 서열을 포함하는 도너를 공급하여 비-상동성 말단-결합(Non-homologous end joining, NHEJ)를 통해 절단된 표적 DNA 끝 사이에 도너의 특정 뉴클레오타이드 서열이 삽입 될 수 있도록 한다.
일 예로, CRISPR/Cas9을 이용하여 표적 유전자를 절단하여 특정 뉴클레오타이드 서열을 포함하는 도너를 HITI 방법을 통해 넉-인(knock-in)할 수 있다.
본 발명의 일 구현예에서, LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자를 코딩하는 유전자는 줄기세포 또는 줄기세포로부터 분화하거나 유래된 세포의 유전체 중 세이프 하버 부위에 삽입될 수 있으나, 이에 제한되는 것은 아니다. 일 구체예에서, 상기 면역활성 억제 인자를 코딩하는 유전자는 상기 유전체 중 AAVS1 유전자좌, CCR5 유전자좌, CLYBL 유전자좌, ROSA26 유전자좌, 및 SHS231 유전자좌(chromosome 4 'safe harbor site' 231)에 삽입될 수 있다.
본 발명은 줄기세포 또는 줄기세포로부터 분화하거나 유래된 세포의 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자의 발현 또는 활성을 증가시키는 단계의 저면역원성 줄기세포 또는 줄기세포로부터 분화하거나 유래된 저면역원성 세포의 제조방법을 제공한다.
상기 면역활성 억제 인자/단백질의 발현 또는 활성의 증가는 해당 유전자의 인위적인 변형에 의해 이루어질 수 있으며, 일 예로 유전자 가위 기 술을 이용할 수 있다.
일 예로, 상기 유전자 가위 기술은 TAL 이펙터(transcription activator-like effector 또는 TALE) 도메인과 절단 도메인이 융합된 TALEN(transcription activatorlike effctor nuclease), 징크-핑거 뉴클레아제 (zinc-finger nuclease), 또는 미생물 면역체계인 CRISPR에서 유래한 CRISPR enzyme system 이 가능하며, 이에 제한되는 것은 아니다.
"TALEN"은 DNA의 타겟 영역을 인식 및 절단할 수 있는 뉴클레아제를 말한다. 상기 TALEN은 TALE 도메인 및 뉴클레오타이드 절단 도메인을 포함하는 융합 단백질이다. TAL 이펙터는 잔토모나스(Xanthomonas) 박테리아가 다양한 식물 종에 감염될 때 이들의 타입 분비 시스템을 통해 분비되는 단백질로 알려져 있다. 상기 단백질은 숙주 식물 내의 프로모터 서열과 결합하여 박테리아 감염을 돕는 식물 유전자의 발현을 활성화시킬 수 있다. 상기 단백질은 34 개 이하의 다양한 수의 아미노산 반복으로 구성된 중심 반복 도메인을 통해 식물 DNA 서열을 인식한다. "TALE 도메인" 또는 "TALE"는 하나 이상의 TALE 반복 도메인/단위를 포함하는 폴리펩타이드이다. 이 반복 도메인은 TALE과 그것의 동족 표적 DNA 서열의 결합과 관련된다. 단일 "반복 유닛은 전형적으로 33-35 아미노산 길이이며, 자연 발생한 TALE 단백질 내의 다른 TALE 반복 서열과 적어도 일부 서열 상동성을 나타낸다. 상기 TALE 도메인은 하나 이상의 TALE-반복 모듈을 통해 서열-특이적 방식으로 뉴클레오타이드에 결합하는 단백질 도메인이다.
상기 TALE DNA 결합 도메인은 적어도 하나의 TALE-반복 모듈, 보다 구체적으로 1 내지 30개의 TALE-반복 모듈을 포함하나 이에 한정되지 않는다. 상기 TALE DNA 결합 도메인은 TALE-반복 모듈의 절반을 포함할 수 있다. 상기 TALE과 관련하여 국제공개특허 WO2012/093833호 또는 미국공개특허 2013-0217131호에 개시된 내용 전문이 본 명세서에 참고자료로서 포함된다.
"징크 핑거 DNA 결합 단백질"(또는 결합 도메인)은 아연 이온의 배위를 통해 그 구조가 안정화된 결합 도메인 내의 아미노산 서열 영역인 하나 이상의 징크 핑거를 통해서 서열-특이적 방식으로 DNA와 결합하는 단백질, 또는 더 큰 단백질 내의 도메인이다. 용어 "징크 핑거 DNA 결합 단백질"은 주로 징크 핑거 단백질 또는 ZFP로 약기된다.
상기 징크-핑거 뉴클레아제(zinc-finger nuclease, ZFN)는 표적 유전자 및 절단 도메인 또는 절단 하프-도메인의 표적 부위에 결합하도록 조작된 징크-핑거 단백질을 포함한다. 상기 ZFN은 징크-핑거 DNA 결합 도메인 및 DNA 절단 도메인을 포함하는 인공적인 제한효소일 수 있다. 여기서, 징크-핑거 DNA 결합 도메인은 선택된 서열에 결합하도록 조작된 것일 수 있다. 예를 들면, Beerli et al. (2002) Nature Biotechnol. 20:135-141; Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340; Isalan et al, (2001) Nature Biotechnol. 19: 656-660; Segal et al. (2001) Curr. Opin. Biotechnol. 12:632-637; Choo et al. (2000) Curr. Opin. Struct. Biol.10:411-416이 본 명세서 참고자료로서 포함될 수 있다. 자연 발생된 징크 핑거 단백질과 비교하여, 조작된 징크 핑거 결합 도메인은 신규한 결합 특이성을 가질 수 있다. 조작 방법은 합리적 설계 및 다양한 타입의 선택을 포함하나 이에 국한되지는 않는다. 합리적 설계는, 예를 들어 삼중 (또는 사중) 뉴클레오티드 서열, 및 개별 징크 핑거 아미노산 서열을 포함하는 데이터베이스의 이용을 포함하며, 이때 각 삼중 또는 사중 뉴클레오티드 서열은 특정 삼중 또는 사중 서열에 결합하는 징크 핑거의 하나 이상의 서열과 연합된다.
상기 ZFN에서 표적 유전자 및 표적 서열의 선택, 융합단백질 또는 이를 암호화하는 폴리뉴클레오타이드의 설계 및 구성은 당업자에게 공지되어 있으며, 참고자료로 미국특허등록 7,888,121 및 8,409,861 전문에 상세하게 설명되며, 상기 공개특허의 전문이 본 발명의 참고자료로서 본 명세서에 포함된다. 또한, 이러한 참고 문헌 및 당업계의 다른 문헌에 개시된 대로, 징크 핑거 도메인 및/또는 다중-핑거 징크 핑거 단백질들이 임의의 적절한 링커 서열, 예를 들면 5개 이상의 아미노산 길이의 링커를 포함하는 링커에 의해 함께 연결될 수 있다.
6개 이상의 아미노산 길이의 링커 서열의 예는 미국등록특허 6,479,626; 6,903,185; 7,153,949을 참고한다. 여기 설명된 단백질들은 단백질의 각 징크 핑거 사이에 적절한 링커의 임의의 조합을 포함할 수 있다.
상기 ZFN과 같은 뉴클레아제는 뉴클레아제 활성 부분인 절단 도메인 및/또는 절단 하프-도메인을 포함한다. 일 예로, 상기 절단 도메인은 징크-핑거 DNA 결합 도메인과는 상이한 뉴클레아제로부터 유래한 절단 도메인, 즉 이종성 절단 도메인일수 있다.
또 다른 예로, 상기 절단 하프-도메인은 절단 활성을 위하여 이량체화를 필요로 하는 임의의 뉴클레아제 또는 그것의 일부로부터 유래된 융합 단백질일 수 있다. 융합 단백질이 절단 하프-도메인을 포함하는 경우, 일반적으로 2개의 융합 단백질이 절단에 필요할 수 있다. 또는, 2개의 절단 하프-도메인을 포함하는 단일 단백질이 이용될 수 있다. 2개의 절단 하프-도메인은 동일한 엔도뉴클레아제 (또는 그것의 기능적 단편들)로부터 유래할 수도 있고, 또는 각 절단 하프-도메인이 상이한 엔도뉴클레아제 (또는 그것의 기능적 단편들)로부터 유래할 수도 있다. 또한, 2개의 융합 단백질의 표적 부위는, 2 개의 융합 단백질과 그것의 각 표적 부위의 결합에 의해 절단-하프 도메인들이 서로에 대해 공간적으로 배향되어 위치됨으로써, 절단 하프-도메인이, 예를 들어 이량체화에 의해 기능성 절단 도메인을 형성할 수 있도록 하는 관계로 배치되는 것이 바람직하다.
상기 "CRISPR-enzyme system"은 가이드 핵산 및/또는 에디터단백질로 구성된다. "가이드 핵산"은 표적 핵산, 표적 유전자 또는 표적 염색체를 인지 하고, 에디터 단백질과 상호작용할 수 있는 뉴클레오타이드 서열을 의미한다. 이때, 상기 가이드 핵산은 표적 핵산, 표적 유전자 또는 표적 염색체 내의 일부 뉴클레오타이드와 상보적인 결합을 형성할 수 있다. 상기 가이드 핵산은 표적 DNA 특이적 가이드 RNA, 상기 가이드 RNA를 코딩하는 DNA 또는 DNA/RNA 혼합의 형태 일 수 있다.
상기 가이드 핵산은 가이드 RNA일 수 있다. "가이드 RNA"는 생체 외 (in vitro) 전사된 것일 수 있고, 특히 올리고뉴클레오타이드 이중가닥, 또는 플라스미드 주형으로부터 전사된 것일 수 있으나, 이에 제한되지 않는다.
상기 가이드 RNA의 설계 및 구성은 당업자에게 공지되어 있으며, 한국등록특허 10-1656236, 10-1656237, 10-1706085, 10-2052286, 10-2182847에 상세하게 설명되며, 상기 등록특허 전문이 본 발명의 참고자료로서 본 명세서에 포함된다.
상기 가이드 핵산은 스캐폴드 서열 부분과 가이드 서열 부분을 포함할 수 있다. 상기 스캐폴드 서열 부분은 Cas 단백질과 상호작용하는 부분으로, Cas 단백질과 가이드 핵산이 결합하여 복합체(ribonucleoprotein, RNP)를 이룰 수 있도록 한다. 일반적으로, 상기 스캐폴드 서열 부분은 tracrRNA와 crRNA의 일부 서열 부분을 포함하며, 상기 스캐폴드 서열은 어떤 Cas 단백질을 사용하느냐에 따라서 결정된다.
상기 가이드 서열 부분은, 표적 유전자 내 일정 길이의 뉴클레오타이드 서열 부분과 상보적으로 결합할 수 있는 부분이며, 인위적으로 변형할 수 있는 염기 부분으로, 관심 있는 표적 뉴클레오타이드 서열(또는 표적 서열)에 의해 결정된다. 이때 상기 가이드 서열은 표적 유전자 또는 표적 핵산의 가이드 핵산 결합 서열과 최소한 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90% 또는 95% 이상의 상보성을 가지거나 또는 완전한 상보성을 가지는 뉴클레오타이드 서열일 수 있다. 상기 가이드 서열의 가이드 도메인에 포함된 서열일 수 있다.
상기 가이드 서열 부분은 crRNA에 포함될 수 있다. 일 예로, 상기 가이드 핵산은 두 개의 RNA, 즉, crRNA(CRISPR RNA) 및 tracrRNA(trans-activating crRNA)를 구성요소로 포함하는 이중 RNA(dual RNA) 일 수 있다.
다른 일 예로, 상기 가이드 핵산은 crRNA 및 tracrRNA의 주요 부분이 연결된 형태인 sgRNA(single-chain guide RNA) 일 수 있다.
상기 표적 서열은 표적 유전자 또는 표적 핵산 내에 존재하는 일정 길이의 뉴클레오타이드 서열로, 구체적으로는 표적 유전자의 조절 영역(regulatory region), 암호화 영역(coding region; 또는 CDS, coding sequence) 또는 비 암호화 영역(non-coding region; 또는 UTR, untranslated region)으로 구분되는 표적 영역 내의 일부 뉴클레오타이드 서열이거나, 상기 표적 영역들의 조합에서 선택되는 하나 이상의 일부 뉴클레오타이드 서열들일 수 있다. 상기 표적 서열은 가이드 핵산에디터단백질 복합체(RNP)의 타겟이 될 수 있다.
본 발명의 일 구현예에서, 상기 표적서열은 세이프 하버 부위(safe harbor site)일 수 있으나, 이에 제한되는 것은 아니다. 일 구체예에서, 상기 세이프 하버 부위(safe harbor site)는 AAVS1 유전자좌, CCR5 유전자좌, CLYBL 유전자좌, ROSA26 유전자좌, 및 SHS231 유전자좌로 이루어진 군에서 선택된 하나 일 수 있다.
상기 표적 서열은 에디터 단백질이 인식하는 프로토스페이서 인접 모티프 (protospacer-adjacent motif, PAM) 서열과 인접한 주변의 뉴클레오타이드 서열로, PAM의 전체 또는 일부를 포함할 수 있으나, 이에 제한되지 않는다.
표적서열이라 함은 두 가지의 뉴클레오타이드의 서열 정보를 모두 의미하는 용어로 사용될 수 있다. 예를 들어, 표적 유전자의 경우, 표적 서열은 표적 유전자 DNA의 transcribed strand의 서열 정보를 의미하는 것일 수도 있고, 또는 non-transcribed strand의 뉴클레오타이드 서열 정보를 의미하는 것일 수 도 있다.
표적서열은 가이드 핵산 결합 서열 또는 가이드 핵산 비결합 서열을 포함한다. 가이드핵산 결합 서열은 가이드핵산의 가이드 도메인에 포함되는 가이드 서열과 일부 또는 완전한 상보성을 가지는 뉴클레오타이드 서열로, 가이드핵산의 가이드 도메인에 포함되는 가이드 서열과 상보적인 결합을 할 수 있다. 표적 서열 및 가이드핵산 결합 서열은 표적 유전자 또는 핵산에 따라, 즉 유전자 조작 또는 교정하고자 하는 대상에 따라 달라질 수 있는 뉴클레오타이드 서열로, 가이드 핵산은 표적 유전자 또는 표적 핵산에 따라 다양하게 설계될 수 있다.
"가이드핵산 비결합 서열"은 가이드핵산의 가이드 도메인에 포함되는 가이드 서열과 일부 또는 완전한 상동성을 가지는 뉴클레오타이드 서열로, 가이 드 핵산의 가이드 도메인에 포함되는 가이드 서열과 상보적인 결합을 할 수 없다. 또한, 가이드핵산 비결합 서열은 가이드핵산 결합 서열과 상보성을 가지는 뉴클레오타이드 서열로, 가이드핵산 결합 서열과 상보적인 결합을 할 수 있다. 가이드핵산 결합 서열은 표적 서열 중 일부 뉴클레오타이드 서열로, 표적 서열의 두 가지 서로 다른 서열순서를 가지는 뉴클레오타이드 서열, 즉, 서로 상보적인 결합을 할 수 있는 두 가지의 뉴클레오타이드 서열 중 한 가지 뉴클레오타이드 서열일 수 있다. 이때, 가이드핵산 비결합 서열은 표적 서열 중 가이드핵산 결합 서열을 제외한 나머지 뉴클레오타이드 서열일 수 있다.
가이드핵산 결합 서열은 표적 서열, 즉, transcribed strand와 동일한 뉴클레오타이드 서열 및 non-transcribed strand와 동일한 뉴클레오타이드 서열 중 선택된 하나의 뉴클레오타이드 서열일 수 있다. 이때, 가이드핵산 비결합 서열은 표적 서열 중 가이드핵산 결합 서열, 즉, transcribed strand와 동일한 뉴클레오타이드 서열 및 non-transcribed strand와 동일한 뉴클레오타이드 서열 중 선택된 하나의 뉴클레오타이드 서열을 제외한 나머지 뉴클레오타이드 서열일 수 있다.
가이드핵산 결합 서열은 표적 서열의 길이와 동일할 수 있다. 가이 드핵산 비결합 서열은 표적 서열 또는 가이드핵산 결합 서열의 길이와 동일할 수 있다. 가이드핵산 결합 서열은 5 내지 50개의 뉴클레오타이드 서열일 수 있다.
일 구체예로서 상기 가이드핵산 결합 서열은 16개의 뉴클레오타이드 서열, 17개의 뉴클레오타이드 서열, 18개의 뉴클레오타이드 서열, 19개의 뉴클레오 타이드 서열, 20개의 뉴클레오타이드 서열, 21개의 뉴클레오타이드 서열, 22개의 뉴클레오타이드 서열, 23개의 뉴클레오타이드 서열, 24개의 뉴클레오타이드 서열 또는 25개의 뉴클레오타이드 서열일 수 있다. 가이드핵산 비결합 서열은 5 내지 50 개의 뉴클레오타이드 서열일 수 있다.
일 구체예로서 상기 가이드핵산 비결합 서열은 16개의 뉴클레오타이 드 서열, 17개의 뉴클레오타이드 서열, 18개의 뉴클레오타이드 서열, 19개의 뉴클레오타이드 서열, 20개의 뉴클레오타이드 서열, 21개의 뉴클레오타이드서열, 22개의 뉴클레오타이드 서열, 23개의 뉴클레오타이드 서열, 24개의 뉴클레오타이드 서열 또는 25개의 뉴클레오타이드 서열일 수 있다.
가이드핵산 결합 서열은 가이드핵산의 가이드 도메인에 포함된 가이드 서열과 일부 또는 완전한 상보적인 결합을 할 수 있으며, 상기 가이드핵산 결합 서열의 길이는 가이드 서열의 길이와 동일할 수 있다.
상기 가이드핵산 결합 서열은 가이드핵산의 가이드 도메인에 포함된 가이드 서열에 상보적인 뉴클레오타이드 서열일 수 있으며, 예를 들어 최소한 70%, 75%, 80%, 85%, 90% 또는 95% 이상의 상보적이거나 또는 완전하게 상보적인 뉴클레오타이드 서열일 수 있다.
일 예로, 상기 가이드핵산 결합 서열은 가이드핵산의 가이드 도메인 에 포함된 가이드 서열에 상보적이지 않은 1 내지 8개의 뉴클레오타이드 서열을 가 지거나 또는 포함할 수 있다.
가이드핵산 비결합 서열은 가이드핵산의 가이드 도메인에 포함된 가이드 서열과 일부 또는 완전한 상동성을 가질 수 있으며, 상기 가이드핵산 비결합 서열의 길이는 가이드 서열의 길이와 동일할 수 있다. 일 예로, 상기 가이드 서열은 가이드 핵산 비결합 서열과 상동성을 가지는 서열을 기반으로 설계될 수 있다.
상기 가이드핵산 비결합 서열은 가이드핵산의 가이드 도메인에 포함된 가이드 서열에 상동성을 가진 뉴클레오타이드 서열일 수 있으며, 예를 들어 최 소한 70%, 75%, 80%, 85%, 90% 또는 95% 이상의 상동성을 가지거나 또는 완전하게 상동성을 가지는 뉴클레오타이드 서열일 수 있다.
일 예로, 상기 가이드핵산 비결합 서열은 가이드핵산의 가이드 도메인에 포함된 가이드 서열에 상동적이지 않은 1 내지 8개의 뉴클레오타이드 서열을 가 지거나 포함할 수 있다. 가이드핵산 비결합 서열은 가이드핵산 결합 서열과 상보적 결합을 할 수 있으며, 상기 가이드핵산 비결합 서열은 가이드핵산 결합 서열의 길이와 동일할 수 있다.
상기 가이드핵산 비결합 서열은 가이드핵산 결합서열에 상보적인 뉴 클레오타이드 서열일 수 있으며, 예를 들어 최소한 90% 또는 95% 이상의 상보적이거나 또는 완전하게 상보적인 뉴클레오타이드 서열일 수 있다.
일 예로, 상기 가이드핵산 비결합 서열은 가이드핵산 결합 서열에 상보적이지 않은 1 내지 2개의 뉴클레오타이드 서열을 가지거나 포함할 수 있다. 또한, 상기 가이드핵산 결합 서열은 에디터 단백질이 인식할 수 있는 뉴클레오타이드 서열(PAM 서열)과 상보적인 서열에 근접한 위치의 뉴클레오타이드 서열일 수 있다.
일 예로, 상기 가이드핵산 결합 서열은 에디터단백질이 인식할 수 있는 뉴클레오타이드 서열(PAM 서열)과 상보적인 서열의 5' 말단 또는/및 3' 말단에 인접하여 위치하는 연속하는 5 내지 50개의 뉴클레오타이드 서열일 수 있다.
또한, 상기 가이드핵산 비결합 서열은 에디터단백질이 인식할 수 있는 뉴클레오타이드 서열(PAM 서열)에 근접한 위치의 뉴클레오타이드 서열일 수 있 다.
일 예로, 상기 가이드핵산 비결합 서열은 에디터단백질이 인식할 수 있는 뉴클레오타이드 서열(PAM 서열)의 5' 말단 또는/및 3' 말단에 인접하여 위치 하는 연속하는 5 내지 50개의 뉴클레오타이드 서열일 수 있다.
"에디터 단백질"은 핵산과 직접적으로 결합하거나, 또는 직접 결합 하지는 않지만 상호작용할 수 있는 펩타이드, 폴리펩타이드 또는 단백질을 의미한다. 상기 에디터 단백질에 대해서 개념적으로 "인위적으로 조작된 뉴클레아제" 또는 RGEN(RNA-Guided Endonuclease)으로 칭하기도 한다.
일 구체예에서, 상기 에디터 단백질은 CRISPR(Clustered Regularly Interspaced Short Palindromic Repeats) 효소일 수 있다. "CRISPR 효소"는 CRISPR-enzyme 시스템의 주요 단백질 구성 요소로, "Cas 단백질"이라 칭하기도 하며, 가이드RNA와 혼합 또는 복합체를 형성하여 표적서열을 인지하고 DNA를 절단할 수 있는 뉴클레아제를 말한다.
CRISPR 효소는 당업자에 공지되어 있으며, 한국등록특허 10- 1656236, 10-1656237, 10-1706085, 10-2052286, 10-2182847을 참고한다. 상기 CRISPR 효소는 천연형 단백질 외에도 가이드 RNA와 협동하여 활성화된 엔도뉴클레아제(endonuclease) 또는 니카아제(nickase)로 작용할 수 있는 변이체를 모두 포함하는 개념으로 본 명세서에서 사용된다. 활성화된 엔도뉴클레아제 또는 니카아제인 경우, 표적 DNA절단을 가져올 수 있고, 이를 이용하여 유전체 교정을 가지고 올 수 있다. 또한, 불활성화된 변이체인 경우, 이를 이용하여 전사 조절 혹은 목적하는 DNA의 분리를 가져올 수 있다.
상기 CRISPR 효소는 CRISPR 효소를 암호화하는 서열을 가지는 핵산 또는 폴리펩타이드(또는 단백질)로, 대표적으로 Type II CRISPR 효소 또는 Type V CRISPR 효소가 많이 사용되며, 상기 Type II CRISPR 효소로는 Cas9(CRISPRassociated protein 9) 단백질이 있다.
상기 Cas9 단백질은 스트렙토코커스 피오게네스(Streptococcus pyogenes), 스트렙토코커스 써모필러스(Streptococcus thermophilus), 스트렙토코커스 속(Streptococcus sp.), 스트렙토마이세스 프리스티네스피랄리스(Streptomyces pristinaespiralis), 스트렙토마이세스 비리도크로모게네스(Streptomyces viridochromogenes), 스트렙토스포랑기움 로세움(Streptosporangium roseum), 스트렙토스포랑기움 로세움(Streptosporangium roseum), 캄필로박터 제주 니(Campylobacter jejuni), 스타필로코커스 아우리쿨라리스(Staphylococcus Auricularis) 등 다양한 미생물 유래일 수 있다.
Cas9 단백질이 이중 가닥 DNA 절단(double stranded DNA break)을 유도하기 위해서는 Cas9 단백질이 일정 길이의 뉴클레오타이드 서열인 프로토스페이서 인접 모티프(Protospacer Adjacent Motif, PAM) 서열을 인식하고, 가이드 RNA의 일부(상기 가이드 서열 부분)가 표적 서열이 위치하는 DNA 단일 가닥의 상보적인 가닥과 상보적으로 결합해야 한다.
이 PAM 서열은 Cas9 단백질의 종류나 기원에 따라 결정되는 서열로, 예를 들어 스트렙토코커스 피오게네스(Streptococcus pyogenes) 유래 Cas9 단백질은 표적 핵산 내 5'-NGG-3' 서열을 인식할 수 있다. 이때, 상기 N은 아데 노신(A), 티미딘(T), 사이티딘(C), 구아노신(G)중 하나이다.
또한, 상기 Type V CRISPR 효소로는 Cpf1이 있으며, 상기 Cpf1은 Streptococcus, Campylobacter, Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Sphaerochaeta, Lactobacillus, Eubacterium, Corynebacter, Carnobacterium, Rhodobacter, Listeria, Paludibacter, Clostridium, Lachnospiraceae, Clostridiaridium, Leptotrichia, Francisella, Legionella, Alicyclobacillus, Methanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatronum, Opitutaceae, uberibacillus, Bacillus, Brevibacilus, Methylobacterium 또는 Acidaminococcus 유래의 Cpf1일 수 있다.
상기 Cas9 또는 Cpf1 단백질 등의 CRISPR 효소는 자연상태에서 존재 하는 미생물에서 분리된 것 또는 재조합적 방법 또는 합성적 방법으로 비자연적으로 생산된 것일 수 있다. 상기 Cas 단백질은 또한 세포 내로 도입되기에 용이한 형태일 수 있다. 그 예로 Cas 단백질은 세포 침투 펩타이드 또는 단백질 전달 도메인 (protein transduction domain)과 연결될 수 있다. 상기 단백질 전달 도메인은 폴리-아르기닌 또는 HIV 유래의 TAT 단백질일 수 있으나, 이에 제한되지 않는다. 세포 침투 펩타이드 또는 단백질 전달 도메인은 상기 기술된 예외에도 다양한 종류가 당업계에 공지되어 있으므로, 당업자는 상기 예에 제한되지 않고 다양한 예를 본 명세서에 적용할 수 있다. 또한 상기 Cas 단백질은 NLS(nuclear localization sequence or signal)과 같은 기능적 도메인과 융합될 수 있다.
본 발명은 줄기세포 또는 줄기세포로부터 분화하거나 유래된 세포의 유전체(genome) 내에 위치한 표적 서열을 표적화할 수 있는 가이드 핵산 또는 이를 암호화하는 핵산; LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자를 코딩하는 유전자 도너 또는 이를 암호화하는 핵산 및 에디터단백질 또는 이를 암호화하는 핵산을 포함하는 저면역원성 줄기세포 또는 줄기세포로부터 분화하거나 유래된 저면역원성 세포 제조를 위한 유전자 조작용 조성물을 제공한다.
본 발명의 일 구현예에서, 상기 표적서열은 세이프 하버 부위(safe harbor site)일 수 있으나, 이에 제한되는 것은 아니다. 일 구체예에서, 상기 세이프 하버 부위(safe harbor site)는 AAVS1 유전자좌, CCR5 유전자좌, CLYBL 유전자좌, ROSA26 유전자좌, 및 SHS231 유전자좌로 이루어진 군에서 선택된 하나 일 수 있다.
또한, 상기 유전자 조작용 조성물은 삽입을 원하는 특정 뉴클레오타이드 서열을 포함하는 도너 또는 이를 암호화하는 핵산을 선택적으로 더 포함 할 수 있다.
상기 도너(donor)는 특정 펩타이드 또는 단백질을 발현시킬 수 있는, 외인성 뉴클레오타이드 서열(exogenous nucleotide sequences)를 의미하며, 상동 재조합 수리(homology directed repair, HDR)을 통해 게놈 DNA로 삽입될 수 있다. 이때, 상기 삽입을 원하는 핵산서열은 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자를 코딩하는 유전자의 일부 뉴클레오타이드 서열일 수 있다.
상기 도너는 이중가닥 핵산 또는 단일가닥 핵산일 수 있다. 상기 도너는 선형 또는 원형일 수 있다.
상기 도너는 바이러스 또는 비바이러스 벡터(예를 들어, 플라스미드)일 수 있다. 상기 바이러스는 DNA 바이러스 또는 RNA 바이러스일 수 있다. 이때, 상기 DNA 바이러스는 이중가닥 DNA(dsDNA) 바이러스 또는 단일가닥 DNA(ssDNA) 바이러스 일 수 있다. 이때, 상기 RNA 바이러스는 단일가닥 RNA(ssRNA) 바이러스일 수 있다. 상기 바이러스 벡터는 레트로바이러스(Retrovirus), 렌티바이러스 (Lentivirus), 아데노바이러스(Adenovirus), 아데노-연관 바이러스(Adenoassociated virus, AAV), 백시니아바이러스(Vaccinia virus), 폭스바이러스 (Poxvirus) 및 단순포진 바이러스(Herpes simplex virus, HSV)로 구성된 군에서 선택되는 하나 이상의 바이러스 벡터일 수 있다.
상기 표적 서열은 가이드핵산-에디터단백질 복합체의 타겟이 될 수 있고, 상기 표적 서열은 에디터단백질이 인식하는 PAM(protospacer-adjacent motif) 서열을 포함할 수 있으나, 이에 제한되지 않는다.
본 명세서에서, 가이드 핵산, 에디터단백질 또는 가이드핵산-에디터 단백질 복합체 및/또는 도너는 다양한 형태로 대상 내로 전달 또는 도입될 수 있다.
이때 "대상"은 가이드핵산, 에디터단백질 또는 가이드핵산-에디터단백질 복합체가 도입되는 유기체; 가이드핵산, 에디터단백질 또는 가이드핵산-에디터단백질 복합체가 작동하는 유기체; 또는 유기체로부터 획득한 검체 또는 시료를 의미한다.
상기 대상은 가이드핵산-에디터단백질 복합체의 표적 유전자, 표적 핵산 또는 표적 염색체를 포함하는 유기체일 수 있다.
상기 유기체는 동물, 동물의 조직 또는 동물 세포일 수 있다. 이때 상기 조직은 안구, 피부, 간, 신장, 심장, 폐, 뇌, 근육 또는 혈액일 수 있다.
상기 세포는 줄기세포, 간세포, 심근세포, 내피세포 또는 췌장세포 일 수 있다. 상기 검체 또는 시료는 침, 혈액, 간조직, 뇌조직, 간세포, 신경세포, 식세포, 대식세포, T 세포, B 세포, 성상 교세포, 암세포 또는 줄기세포 등 표적 유전자, 표적 핵산 또는 표적 염색체를 포함하는 유기체에서 획득한 것 일 수 있다. 상기 가이드핵산, 에디터단백질 또는 가이드핵산-에디터단백질 복합체는 DNA, RNA 또는 이의 혼합의 형태로 대상 내로 전달 또는 도입될 수 있다.
이때, 가이드핵산 및/또는 에디터단백질을 암호화하는 DNA, RNA 또는 이의 혼합의 형태는 당업계에 공지된 방법에 의해 대상 내로 전달 또는 도입될 수 있다. 또는, 가이드핵산 및/또는 에디터단백질을 암호화하는 DNA, RNA 또는 이의 혼합의 형태는 벡터, 비벡터 또는 이들의 조합에 의해 대상 내로 전달 또 는 도입될 수 있다.
상기 벡터는 바이러스 또는 비바이러스 벡터(예를 들어, 플라스미드)일 수 있다. 상기 바이러스는 DNA 바이러스 또는 RNA 바이러스일 수 있다. 이때, 상기 DNA 바이러스는 이중가닥 DNA(dsDNA) 바이러스 또는 단일가닥 DNA(ssDNA) 바이러스일 수 있다. 이때, 상기 RNA 바이러스는 단일가닥 RNA(ssRNA) 바이러스일 수 있다. 상기 바이러스 벡터는 레트로바이러스, 렌티바이러스, 아데노바이러스, 아데노-연관 바이러스(AAV), 백시니아바이러스, 폭스바이러스 및 단순포진 바이러스로 구성된 군에서 선택되는 1이상일 수 있다.
상기 비벡터는 네이키드 DNA, DNA 복합체 또는 mRNA일 수 있다.
본 발명의 일 구현예로, 상기 가이드핵산 및/또는 에디터단백질을 암호화하는 핵산은 벡터에 의해 대상 내로 전달 또는 도입될 수 있다.
상기 벡터는 가이드핵산 및/또는 에디터단백질을 암호화하는 핵산서열을 포함할 수 있다. 일 예로, 상기 벡터는 가이드핵산과 에디터단백질을 암호화 하는 핵산서열을 동시에 포함할 수 있다. 다른 일 예로, 상기 벡터는 가이드 핵산을 암호화하는 핵산서열을 포함할 수 있다. 예를 들어, 상기 가이드 핵산을 암호화하는 핵산서열은 하나의 벡터에 모두 포함되거나 또는 가이드 핵산을 암호화하는 핵산서열이 분할되어 여러 개의 벡터에 포함시킬 수 있다. 다른 일 예로, 상기 벡터는 에디터단백질을 암호화하는 핵산서열을 포함할 수 있다. 예를 들어, 상기 에디터 단백질의 경우, 에디터단백질을 암호화하는 핵산서열은 하나의 벡터에 포함되거나 또는 에디터단백질을 암호화하는 핵산서열이 분할되어 여러 개의 벡터에 포함될 수 있다.
상기 에디터 단백질은 펩타이드, 폴리펩타이드 또는 단백질의 형태로 대상 내로 전달 또는 도입될 수 있다.
상기 에디터 단백질은 펩타이드, 폴리펩타이드 또는 단백질의 형태로 당업계에 공지된 방법에 의해 대상 내로 전달 또는 도입될 수 있다.
상기 가이드핵산 및 에디터단백질은 핵산-단백질 혼합의 형태로 대상 내로 전달 또는 도입될 수 있다.
상기 가이드핵산 및 에디터단백질은 가이드핵산-에디터단백질 복합 체의 형태로 대상 내로 전달 또는 도입될 수 있다. 예를 들어, 상기 가이드핵산은 DNA, RNA 또는 이의 혼합 형태일 수 있다. 상기 에디터단백질은 펩타이드, 폴리펩타이드 또는 단백질의 형태일 수 있다. 일 예로, 가이드핵산 및 에디터단백질은 RNA 형태의 가이드핵산과 단백질 형태의 에디터단백질이 가이드핵산-에디터단백질 복합체, 즉 ribonucleoprotein(RNP)의 형태로 대상 내로 전달 또는 도입될 수 있다. 또한 본 발명은 줄기세포와 상기 저면역원성 줄기세포 제조용 조성물을 접촉시켜 줄기세포의 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자의 발현 또는 활성을 증가시키도록 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자를 코딩하는 유전자를 편집하는 단계를 포함하는 저면역원성 줄기세포의 제조방법을 제공한다.
본 발명의 일 구현예에서, 상기 저면역원성 줄기세포 또는 줄기세포로부터 분화하거나 유래된 저면역원성 세포의 제조방법은 분리된 줄기세포 또는 분리된 줄기세포로부터 분화하거나 유래된 세포에 상기한 저면역원성 줄기세포 또는 줄기세포로부터 분화하거나 유래된 저면역원성 세포 제조용 조성물을 도입하는 단계; 및
상기 줄기세포 또는 줄기세포로부터 분화하거나 유래된 세포의 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자의 발현 또는 활성을 증가시키도록 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자를 코딩하는 유전자를 상기 줄기세포 또는 줄기세포로부터 분화하거나 유래된 세포의 유전체(genome)에 넉-인(knock-in)하는 단계를 포함할 수 있다.
본 발명의 인위적으로 조작된 줄기세포, 이로부터 분화되거나 유래한 세포, 또는 줄기세포로부터 분화하거나 유래된 인위적으로 조작된 세포는 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자의 발현 또는 활성이 증가하여 질병 또는 병태를 갖는 포유동물에게 이식 시 면역 거부 반응이 억제되어, 세포 이식 또는 생체 조직 재생용 조성물로 이용되어 여러 가지 질환의 치료로 이용될 수 있다.
본 발명의 일 구현에에 있어서, 본 발명의 인위적으로 조작된 줄기세포는, 인간혈관내피세포, 췌장세포, 골세포, 연골세포, 심근세포, 근육세포, 표피세포, 섬유아세포, 신경세포, 간세포, 장세포, 위세포, 피부세포, 지방세포, 혈액세포, 면역세포,　세포　스페로이드 및 오가노이드 등으로 분화되거나 배양되어 손상된 세포나 조직을 복원하기 위한 세포 이식 또는 생체 조직 재생용 조성물로 이용될 수 있다.
본 발명의 일 구현예에 있어서, 상기 생체 조직은 궤양 또는 욕창이 형성된 조직, 세포의 변성에 의해 손상된 뇌 조직, 수술 조작에 의해 결손된 뇌 조직, 외상성 뇌 질환에 의해 손상된 뇌 조직, 염증성 뇌 질환에 의해 손상된 뇌 조직, 손상된 뼈 조직, 손상된 치주 조직, 중추 신경계 질환에 의해 손상된 조직 및 난치성 피부염에 의해 손상된 조직에서 선택되는 손상 조직일 수 있고, 생체 조직 재생은 상기 손상 조직의 복원, 표피 재생, 분비선 또는 모낭의 재현, 진피 조직의 미세혈관 형성, 상처 치유, 연부 조직의 결함 보정, 골 치유 또는 골 재생, 연골 재생 등일 수 있으나, 이로 제한되지 않는다.
본 발명의 일 구현예에 있어서, 상기 세포 이식 또는 생체 조직 재생용 조성물은 세포치료제 조성물, 유전자치료제 조성물, 조직공학치료제 조성물, 면역 치료제 조성물 또는 암의 예방 또는 치료제 조성물일 수 있다.
본 명세서에 있어서, "세포 치료제"는 개체로부터 분리, 배양 및 특수한 조작을 통해 제조된 세포 및 조직으로 치료, 진단 및 예방의 목적으로 사용되는 의약품(미국 FDA 규정)으로서, 세포 혹은 조직의 기능을 복원시키기 위하여 살아있는 자가, 동종, 또는 이종 세포를 체외에서 증식 선별하거나 다른 방법으로 세포의 생물학적 특성을 변화시키는 등의 일련의 행위를 통하여 치료, 진단 및 예방의 목적으로 사용되는 의약품을 의미한다.
본 명세서에 있어서, "유전자 치료제"는 유전물질의 발현에 영향을 주기 위하여 투여하는 것으로서 유전물질이 변형ㆍ도입된 세포를 함유한 의약품을 의미한다.
본 발명의 일 구현예에 있어서, 상기 질병 또는 병태는 포유동물에서 심근경색, 심부전, 허혈성 심근병증, 심근염, 허혈성 장염, 염증성 장질환, 궤양성 대장염, 크론병, 급성 담낭염, 급성 담관염, 만성 담낭염, 급성 췌장염, 만성 췌장염, 급성 신장염, 만성 신장염, 급성 신부전, 만성 신부전, 폐렴, 간질성 폐렴, 특발성 간질성 폐렴, 박리성 간질성 폐렴, 급성 간질성 폐렴, 비특이적 간질성 폐렴, 약물 유발성 폐질환, 급성 호흡 곤란 증후군, 만성 폐색성 폐질환, 소아 뇌성 마비를 포함한 뇌성 마비 증후군, 근위축성 측삭 경화증(amyotrophic lateral sclerosis(ALS)), 다발성 신경병증, 척수성 근위축증, 급성 횡단 척수염, 뇌졸중, 다발성 경화증, 말초동맥질환(peripheral artery disease(PAD)), 폐색성 혈전 혈관염(버거병), 가와사키병(Kawasaki disease(KD)), 이식편대 숙주질환(Graft versus Host Disease(GVHD)), 파킨슨병, 치매, 알츠하이머 질환, 헌팅턴 질환, 근위축성 측색 경화증, 기억력 저하, 중증근무력증, 진행성 핵상마비, 다계통 위축증, 본태성 진전증, 피질-기저핵 퇴행증, 미만성 루이소체 질환 및 픽병으로 이루어진 군에서 선택된 1종의 질환일 수 있고, 본 발명은 이들 질환을 치료하고 예방하는데 사용될 수 있으며, 이에 한정되는 것은 아니다.
본 발명의 세포 이식 또는 생체 조직 재생용 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여 투여될 수 있다. 비경구 투여, 예를 들어, 복강 내 투여, 정맥 내 투여, 근육 내 투여, 피하 투여, 피내 투여될 수 있으나, 이에 제한되지는 않는다.
상기 세포 이식 또는 생체 조직 재생용 조성물은 세포 치료에 일반적으로 사용되는 약제학적 담체와 함께 적합한 형태로 제형화될 수 있다. "약학적으로 허용되는"이란 생리학적으로 허용되고 인간에게 투여될 때, 통상적으로 위장 장애, 현기증 등과 같은 알레르기 반응 또는 이와 유사한 반응을 일으키지 않는 조성물을 말한다. 약학적으로 허용되는 담체로는 예를 들면, 물, 적합한 오일, 식염수, 수성 글루코스 및 글리콜 등과 같은 비경구 투여용 담체 등이 있으며 안정화제 및 보존제를 추가로 포함할 수 있다. 적합한 안정화제로는 아황산수소나트륨, 아황산나트륨 또는 아스코르브산과 같은 항산화제가 있다. 적합한 보존제로는 벤즈알코늄 클로라이드, 메틸-파라벤 또는 프로필-파라벤 및 클로로부탄올이 있다. 그 밖의 약학적으로 허용되는 담체로는 다음 의 문헌에 기재되어 있는 것을 참고로 할 수 있다(Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995). 또한, 상기 조성물은 세포 치료제가 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수도 있다.
본 발명의 세포 이식 또는 생체 조직 재생용 조성물은 질환의 치료를 위하여 치료학적으로 유효한 양의 세포를 포함할 수 있다. "치료학적으로 유효한 양 (therapeutically effective amount)"은 연구자, 수의사, 의사 또는 기타 임상에 의해 생각되는 조직계, 동물 또는 인간에서 생물학적 또는 의학적 반응을 유도하는 유효 성분 또는 약학적 조성물의 양을 의미하는 것으로, 이는 치료되는 질환 또는 장애의 증상의 완화를 유도하는 양을 포함한다.
본 발명의 조성물에 포함되는 세포는 원하는 효과에 따라 변화될 것임은 당업자에게 자명하다. 그러므로 최적의 세포 함량은 당업자에 의해 쉽게 결정될 수 있으며, 질환의 종류, 질환의 중증도, 조성물에 함유된 다른 성분의 함량, 제형의 종류, 및 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료기간, 동시 사용되는 약물을 비롯한 다양한 인자에 따라 조절될 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 포함하는 것이 중요하다. 예컨대, 본 발명의 줄기세포의 1일 투여량은 1.0Х105 내지 1.0Х1030 세포/kg 체중, 바람직 하게는 1.0Х1010 내지 1.0Х1020 세포/kg 체중을 1회 또는 수회로 나누어 투여할 수 있다. 그러나, 유효성분의 실제 투여량은 치료하고자 하는 질환, 질환의 중증도, 투여경로, 환자의 체중, 연령 및 성별 등의 여러 관련 인자에 비추어 결정되어야 하는 것으로 이해되어야 하며, 따라서, 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
또한, 본 발명의 치료 방법에서 본 발명의 세포를 유효성분으로 포함하는 조성물은 직장, 정맥내 (intravenous therapy, i.v), 동맥내, 복강 내, 근육내, 흉골내, 경피, 국소, 안구내 또는 피내 경로를 통해 통상적인 방식으로 투여할 수 있다. 본 발명은 질병 또는 병태를 갖는 포유동물에게 치료학적으로 유효한 양의 상기 인위적으로 조작된 줄기세포 또는 이로부터 분화되거나 유래한 세포를 투여하는 것을 포함하는 치료방법을 제공한다. 여기에서 사용된 용어 포유동물은 치료, 관찰 또는 실험의 대상인 포유동물을 말하며, 바람직하게는 인간을 말한다.
또한 본 발명은 질병 또는 병태를 갖는 포유동물에게 치료학적으로 유효한 양의 상기한 인위적으로 조작된 줄기세포, 이로부터 분화되거나 유래한 세포 또는 줄기세포로부터 분화되거나 유래한 인위적으로 조작된 세포를 투여하는 단계를 포함하는, 줄기 세포를 사용하는 세포 요법 방법(Cell therapy method)를 제공한다.
본 발명의 일 구현예에 있어서, 상기 방법은 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자의 발현 또는 활성 수준이 증가된 인위적으로 조작된 줄기세포, 인위적으로 조작된 줄기세포로부터 분화되거나 유래한 세포, 또는 줄기세포로부터 분화되거나 유래한 인위적으로 조작된 세포가 투여됨으로써, 자가 또는 동종유래 환경에서 세포 치료제로 사용시 면역 거부반응이 억제되어 면역관용 상태가 될 수 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다.
이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에 있어 자명할 것이다.
실시예 1: AAVS1 사이트에 유전자가 삽입(넉-인, Knock-In)된 iPSC (induced pluripotent stem cell) 세포의 제조
Cell culture(세포배양)
iPSC는 제조사의 매뉴얼에 따라 배양하였다. Vitronectin XFTM(STEMCELL Technologies)을 이용하여 RT(room temperature)에서 1시간 코팅한 배양접시에서 TeSRTM-E8TM(STEMCELL Technologies) 배지를 사용하여 배양하였다.
유전자를 삽입(Knock-In, KI )
유전자를 삽입(Knock-In, KI) 하기 위하여 특정 AAVS1 site를 타겟으로 하는 가이드 RNA(sgRNA, 서열번호 1:gtcaccaatcctgtccctag)와 Cas9 단백질, 그리고 LGALS9(Gal-9), CLEC4G(LSECtin) 및 HHLA2 유전자 도너(donor)의 복합체(complex)를 전기천공법(Electroporation, Amaxa 4D nucleofector)으로 iPSC에 도입하였다.
위 sgRNA, Cas9 단백질, 유전자 도너(donor) 복합체는 20ul primary P3 buffer 처리된 4x105 iPSC와 함께 nucleofector program (CA-137)을 이용하여 제조사(Lonza, 4D nucleofector) 프로토콜에 따라 전기천공을 수행하였다.
실험예 1: iPSC (induced pluripotent stem cell) 세포의 유전자 넉-인(knock-in) 확인
상기 실시예 1에서 제조한 AAVS1 사이트에 유전자가 삽입(넉-인, Knock-In)된 iPSC(induced pluripotent stem cell) 세포에 유전자가 삽입되었는지 PCR을 통해 확인하였다.
PCR (Polymerase chain reaction)
유전자 프라이머는 염기서열을 확인한 후 아래 표 1의 프라이머를 이용하였으며, PCR 반응은 98℃에서 1분간 1차 변성 후, 98℃에서 20초간 변성(denaturation), 62℃에서 30초간 어닐링(annealing), 72℃에서 3분간 연장(extension)의 과정을 총 40회 반복하여 수행 후 최종적으로 PCR 산물의 안정화를 위하여 72℃에서 5분간 연장하였다.
Figure PCTKR2023003055-appb-img-000001
도 2는 실시예 1에서 제조한 유전자 3개가 넉-인(KI)된 iPSC로부터 다단일 클론(single Clone)들을 선별하기 위해, 세포의 DNA로부터 PCR반응을 수행한 결과 및 상기에서 얻은 PCR 산물을 사용하여 생어 서열분석 (Sanger sequencing)을 수행한 결과를 나타낸 것이다. 서열번호 10 내지 13은 PCR 반응으로부터 확인한 서열정보이고, 도 2에 나타낸 바와 같이 유전자를 넉-인(KI)하지 않은 WT-iPSC와 비교하여 KI-iPSC(AAVS1-ALC3#11) 단일 클론에서 삽입된 유전자의 특정 사이즈 밴드를 확인할 수 있었다.
실험예 2: 유전자 삽입( KI ) 세포의 mRNA 발현 확인
상기 실시예 1에서 넉-인(knock-in)한 3가지 유전자들의 mRNA 레벨 변화를 아래와 같이 확인하였다.
Real time PCR ( qRT - PCR )
RNeasy mini kit(Qiagen)을 이용해 제조사의 프로토콜에 따라 iPSC에서 mRNA를 추출하였다. 그 후, 100ng mRNA는 cDNA reverse transcription kit(Thermo Fisher Scientific)를 이용하여 역전사시켰다. qRT-PCR은 QuantStudio 3(Thermo Fisher Scientific)를 이용해 제조사의 프로토콜에 따라 PowerUpTM SYBRTM Green Master Mix 100ng으로 수행하였다. 유전자 발현 수준은 CT 값을 이용해 계산하였고, GAPDH로 내인성 대조군(endogenous control)으로 사용하였다.
도 3은 실시예 1에서 넉-인(knock-in)한 3가지 유전자에 대한 mRNA 레벨(level) 변화를 Real time PCR 방법으로 확인한 결과를 나타낸 것이다. 도 3에 나타낸 바와 같이, Galectin-9, CLEC4G 및 HHLA2 모두 Mock(WT)와 비교하여 mRNA 레벨이 높은 것을 확인할 수 있었다.
실험예 3 : 넉- 인(knock-in)된 유전자 카피 수 확인
ddPCR을 아래와 같이 수행하여 상기 실시예 1에서 넉-인(knock-in)된 유전자의 카피 수를 확인하였다.
ddPCR
배양된 세포를 phosphate buffer saline (PBS)로 2회 세척 후 0.05% trypsin-EDTA 를 사용해 세포를 떼어내고 1,000 rpm에서 5분간 원심분리하였다. 세포에서 gDNA를 추출한 뒤 제한효소 처리를 수행하였다. 아래 표 2 및 표 3의 QX200 ddPCR Supermix for probes(Biorad), forward primer(100pmole/ul), reverse primer(100pmole/ul), taqman probe(10pmole/ul)를 상온에 꺼내어 준비하였다. Biorad 매뉴얼에 따라 ddPCR marster mix를 제작하였다. 제작된 master mix와 제한효소 처리한 template gDNA를 ddPCR 96 웰 플레이트에 분주하였다. PX1 PCR plate sealer(Biorad)에 plate를 sealing 한 후 QX200 Auto DG droplet digital PCR system에 장착하여 droplet을 generation 하였다. Droplet generation 완료 후 매뉴얼 프로토콜에 따라 PCR 증폭을 수행하였다. PCR 증폭완료 후 QX200 Droplet reader에서 형광값을 읽고 분석하였다.
Figure PCTKR2023003055-appb-img-000002
Probe name sequence
SV40-HA-R_probe_3 5’-CAGCTTTCTTGTACAAAGTGGGGACAGG-3’
(서열번호 20)
HHLA2_SV40_probe 5’-tcccagtgcacccgataatggc-3’
(서열번호 21)
AAVS1_HA-L_Probe2 5’-tgtcccctccaccccacagtg-3’
(서열번호 22)
도 4는 ddPCR 방법을 이용하여 넉-인(KI)진 유전자들의 카피 수(Copy Number)를 확인한 결과를 나타낸 그래프이다. KI-iPSC clone에서 유전자 2 카피(copy)가 넉-인(KI)된 것을 확인할 수 있었다.
실험예 4: 유세포 분석을 통한 넉-인( KI )한 유전자의 발현량 측정
넉-인(KI)한 유전자들의 이식 유전자 발현(Transgene expression)을 확인하기 위해 유세포 분석 방법을 이용하여 상기 실시예 1에서 제조한 AAVS1-ALC3#11 clone을 분석하였다.
Flow cytometry analysis ( 유세포 분석법)
배양된 세포를 phosphate buffer saline (PBS)로 2회 세척 후 0.05% trypsin-EDTA 를 사용해 세포를 떼어내고 1,000 rpm에서 5분간 원심분리하였다. 100ul의 FACS staining buffer로 cell을 suspension 시키고 antibody 를 혼합하여 1시간동안 4도에서 반응 후 PBS로 2회 washing 하고, 500ul의 PBS로 부유시켜 FACS analysis 하였다.
도 5는 실험예 4에서 유세포 분석을 통해 실시예 1에서 제조한 AAVS1-ALC3#11 clone의 HHLA 발현량을 측정한 결과를 나타낸 것으로, Isotype과 비교하여 AAVS1-ALC3#11 Clone에서 98%의 HHLA2+ 을 확인할 수 있었다.
실험예 5: 면역원성 확인
상기 실시예 1에서 제조된 유전자가 삽입(넉-인, Knock-In)된 iPSC(induced pluripotent stem cell) 세포(KI-iPSC), iPSC로 분화된 내피세포(EC, Endothelial Cell)에 도 8에 개시된 렌티바이러스를 이용하여 각각의 유전자가 삽입(넉-인, Knock-In)된 내피세포의 면역원성을 평가하기 위해서 WT 및 KI-iPSC을 아래와 같이 내피세포(EC, Endothelial Cell)로 분화하였다. 분화된 내피세포는 면역세포와 공배양하여 면역원성을 확인하였다.
Endothelial Cell Differentiation(내피세포 분화)
인간 ESC를 6-웰 플레이트(Thermo Fisher Scientific)에 시딩하고 10mM ROCK 억제제, Y-27632(Tocris)를 함유하는 TeSR™-E8™ 배지(STEMCELL Technologies)에서 1일 동안 배양하였다. 다음날 배지를 46.9%(v/v) DMEM/F12(Gibco), 50%(v/v) Neurobasal medium(Gibco), 0.97% N2(Gibco), 1.94% B27(Gibco), 0.97% β-메르캅토에탄올(Gibco), 8μM CHIR99021(Cayman Chemical) 및 25ng/ml BMP-4(Peprotech)를 함유하는 N2B27 배지로 교체한 후 세포를 3일 동안 인큐베이션하였다. 그런 다음 배지를 100 ng/ml 혈관 내피 성장 인자(Peprotech), 50 ng/ml 염기성 섬유아세포 성장 인자(Peprotech), 및 2 μM forskolin(Abcam)이 보충된 StemPro-34 SFM(Thermo Fisher Scientific)으로 교체하고 세포를 2일 동안 인큐베이션하였다. 그런 다음 MACS 세포 분리(Miltenyi Biotec)를 사용하여 세포 집단을 CD144+ 세포로 강화했다. CD144+ 세포는 플레이팅되어 추가 분화를 위해 적어도 7일 동안 내피 세포 성장 배지(EGM™-2blletKit™)(Lonza)를 포함하는 매트리겔 코팅된 플레이트에서 유지시켰다. 내피 세포는 항-CD31 항체(1:25, Clone WM-59, eBioscience)를 사용하여 유세포 분석법으로 분석되었다.
도 6(a)는 야생형(WT) iPSC 및 실시예 1에서 제조한 유전자 3개가 넉-인(KI)된 iPSC를 내피세포(EC)로 분화시킨 후 항-CD31 항체를 이용하여 유세포 분석한 결과를 나타낸 것으로, 약 98%이상의 세포가 EC마커인 CD31+을 발현하는 것을 관찰할 수 있었다.
도 6(b)는 야생형(WT) iPSC 및 실시예 1에서 제조한 유전자 3개가 넉-인(KI)된 iPSC를 내피세포(EC)로 분화시킨 유세포 분석한 결과를 나타낸 것으로, iPSC에서 분화된 EC 세포의 표면에(surface)에서 HLA-ABC항원이 나타나는 것을 확인하였으며, 그 level은 interferon gamma를 100ng/ml 농도로 48hr 처리한후 더 높게 증가한 것을 관찰하였다.
Cytotoxicity Assays( NK 세포 효과를 측정하기 위한 체외 형광 측정 세포독성 분석)
KI 클론(표적 세포) 및 K562 세포(ATCC)에 대한 NK 세포의 영향을 유동 세포측정법으로 평가하였다. 표적 세포를 실온에서 15분 동안 CellTraceViolet(Thermo Fisher Scientific)으로 표지한 후 37 ℃ 5% CO2인큐베이터에서 NK 세포와 다양한 비율로 배양하였다.
세포 사멸 표적 세포의 수를 측정하기 위해 세척된 세포를 제조업체의 지침에 따라 7-Amino-Actinomycin(7-AAD, BD Bioscience)으로 염색하고 Attune Flow Cytometers(Thermo Fisher Scientific)로 분석했다.
도 7(a)는 K562 세포, 야생형(WT) iPSC를 분화시킨 내피세포(WT-iPSC_EC), 실시예 1에서 제조한 유전자 3개가 넉-인(KI)된 iPSC를 분화시킨 내피세포(KI-iPSC EC)를 효과기 세포인 NK 세포와 다양한 비율로 배양하여 세포독성을 확인한 결과를 나타낸 그래프이다. 세포사멸 세포는 7-AAD+ 세포로 검출하였으며, 이때 HLA가 발현하지 않는 K562 종양세포와 야생형(WT) iPSC를 분화시킨 내피세포(WT-iPSC_EC)가 NK 세포 세포독성에 상당히 취약함을 확인할 수 있었다.
도 7(b)는 HLA-ABC가 98%이상 발현되는 야생형(WT) iPSC를 분화시킨 내피세포(WT-iPSC_EC, 도 6(b))와 실시예 1에서 제조한 유전자 3개가 넉-인(KI)된 iPSC를 분화시킨 내피세포(KI-iPSC EC)에서 NK 세포의 세포독성을 평가한 결과를 나타낸 그래프이다. 도 7(b)를 참고하면, 효과기 세포(effector, NK 세포) : 표적 세포(EC, 내피세포)를 1:1의 비율로 공배양하여 7-AAD+한 세포를 측정한 결과, KI-iPSC_EC가 WT-iPSC_EC와 비교하여 세포 사멸된 세포의 %가 적었고, 효과기 세포(effector, NK 세포) : 표적 세포(EC, 내피세포)의 세포 비율이 커질수록 7-AAD+한 세포의 %가 증가하는 것을 확인할 수 있었다.
lentivirus을 이용한 iPSC로부터 분화된 과발현 EC세포 제조
도 8은 LGALS9(Gal-9)/CLEC4G(LSECtin)/HHLA-2(서열번호 23), LGALS9(Gal-9) (서열번호 24), CLEC4G(LSECtin) (서열번호 25), LGALS9(Gal-9)/CLEC4G(LSECtin) (서열번호 26), LGALS9(Gal-9)/ CLEC4G(LSECtin)/PD-L1(서열번호 27)의 각각의 유전자 삽입을 위한 렌티바이러스의 일 예시를 나타내는 도이다. 이때 상기 유전자는 EC 세포 유전체 상 표적서열에 삽입될 수 있다.
아래 표 4 내지 표 8에 삽입되는 유전자를 나타내었다.
ALC3(서열번호 23)
tgctttctctgacctgcattctctcccctgggcctgtgccgctttctgtctgcagcttgtggcctgggtcacctctacggctggcccagatccttccctgccgcctccttcaggttccgtcttcctccactccctcttccccttgctctctgctgtgttgctgcccaaggatgctctttccggagcacttccttctcggcgctgcaccacgtgatgtcctctgagcggatcctccccgtgtctgggtcctctccgggcatctctcctccctcacccaaccccatgccgtcttcactcgctgggttcccttttccttctccttctggggcctgtgccatctctcgtttcttaggatggccttctccgacggatgtctcccttgcgtcccgcctccccttcttgtaggcctgcatcatcaccgtttttctggacaaccccaaagtaccccgtctccctggctttagccacctctccatcctcttgctttctttgcctggacaccccgttctcctgtggattcgggtcacctctcactcctttcatttgggcagctcccctaccccccttacctctctagtctgtgctagctcttccagccccctgtcatggcatcttccaggggtccgagagctcagctagtcttcttcctccaacccgggcccctatgtccacttcaggacagcatgtttgctgcctccagggatcctgtgtccccgagctgggaccaccttatattcccagggccggttaatgtggctctggttctgggtacttttatctgtcccctccaccccacagtggggccacta(HA-L)
tgtgcgcgaggggagcgcggccgggggcggtgccccgcggtgcggggggggctgcgaggggaacaaaggctgcgtgcggggtgtgtgcgtgggggggtgagcagggggtgtgggcgcgtcggtcgggctgcaaccccccctgcacccccctccccgagttgctgagcacggcccggcttcgggtgcggggctccgtacggggcgtggcgcggggctcgccgtgccgggcggggggtggcggcaggtgggggtgccgggcggggcggggccgcctcgggccggggagggctcgggggaggggcgcggcggcccccggagcgccggcggctgtcgaggcgcggcgagccgcagccattgccttttatggtaatcgtgcgagagggcgcagggacttcctttgtcccaaatctgtgcggagccgaaatctgggaggcgccgccgcaccccctctagcgggcgcggggcgaagcggtgcggcgccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcgccgccgtccccttctccctctccagcctcggggctgtccgcggggggacggctgccttcgggggggacggggcagggcggggttcggcttctggcgtgtgaccggcggctctagagcctctgctaaccatgttcatgccttcttctttttcctacagctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattc(CAG)
atccacacagtgcatgtagaaccgagccaagaaacagcttcccataacaaaggcttatggattttggtgccctctgcgattttggcagcttttctgctgatttggagcgtaaaatgttgcagagcccagctagaagccaggaggagcagacaccctgctgatggagcccaacaagaaagatgttgtgtccctcctggtgagcgctgtcccagtgcacccgataatggcgaagaaaatgtgcctctttcaggaaaagta
(Gal-9/CLEC4G/HHLA2)
tagaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttagtcgacagtactaagcttacccagctttcttgtacaaagtgg(SV40)
Ggacaggattggtgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgggtctaacccccacctcctgttaggcagattccttatctggtgacacacccccatttcctggagccatctctctccttgccagaacctctaaggtttgcttacgatggagccagagaggatcctgggagggagagcttggcagggggtgggagggaagggggggatgcgtgacctgcccggttctcagtggccaccctgcgctaccctctcccagaacctgagctgctctgacgcggccgtctggtgcgtttcactgatcctggtgctgcagcttccttacacttcccaagaggagaagcagtttggaaaaacaaaatcagaataagttggtcctgagttctaactttggctcttcacctttctagtccccaatttatattgttcctccgtgcgtcagttttacctgtgagataaggccagtagccagccccgtcctggcagggctgtggtgaggaggggggtgtccgtgtggaaaactccctttgtgagaatggtgcgtcctaggtgttcaccaggtcgtggccgcctctactccctttctctttctccatccttctttccttaaagagtccccagtgctatctgggacatattcctccgcccagagcagggtcccgcttccctaaggccctgctctgggcttctgggtttgagtccttggcaagcccaggagaggcgctcaggcttccctgtcccccttcctcgtccaccatctcatgcccctggctctcctgccccttccctacaggggttcctggctctgctct(HA-R)
Gal9(서열번호 24)
tgctttctctgacctgcattctctcccctgggcctgtgccgctttctgtctgcagcttgtggcctgggtcacctctacggctggcccagatccttccctgccgcctccttcaggttccgtcttcctccactccctcttccccttgctctctgctgtgttgctgcccaaggatgctctttccggagcacttccttctcggcgctgcaccacgtgatgtcctctgagcggatcctccccgtgtctgggtcctctccgggcatctctcctccctcacccaaccccatgccgtcttcactcgctgggttcccttttccttctccttctggggcctgtgccatctctcgtttcttaggatggccttctccgacggatgtctcccttgcgtcccgcctccccttcttgtaggcctgcatcatcaccgtttttctggacaaccccaaagtaccccgtctccctggctttagccacctctccatcctcttgctttctttgcctggacaccccgttctcctgtggattcgggtcacctctcactcctttcatttgggcagctcccctaccccccttacctctctagtctgtgctagctcttccagccccctgtcatggcatcttccaggggtccgagagctcagctagtcttcttcctccaacccgggcccctatgtccacttcaggacagcatgtttgctgcctccagggatcctgtgtccccgagctgggaccaccttatattcccagggccggttaatgtggctctggttctgggtacttttatctgtcccctccaccccacagtggggccacta(HA-L)
tgtgcgcgaggggagcgcggccgggggcggtgccccgcggtgcggggggggctgcgaggggaacaaaggctgcgtgcggggtgtgtgcgtgggggggtgagcagggggtgtgggcgcgtcggtcgggctgcaaccccccctgcacccccctccccgagttgctgagcacggcccggcttcgggtgcggggctccgtacggggcgtggcgcggggctcgccgtgccgggcggggggtggcggcaggtgggggtgccgggcggggcggggccgcctcgggccggggagggctcgggggaggggcgcggcggcccccggagcgccggcggctgtcgaggcgcggcgagccgcagccattgccttttatggtaatcgtgcgagagggcgcagggacttcctttgtcccaaatctgtgcggagccgaaatctgggaggcgccgccgcaccccctctagcgggcgcggggcgaagcggtgcggcgccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcgccgccgtccccttctccctctccagcctcggggctgtccgcggggggacggctgccttcgggggggacggggcagggcggggttcggcttctggcgtgtgaccggcggctctagagcctctgctaaccatgttcatgccttcttctttttcctacagctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattc(CAG)
tcaacagactggaagtggggggcgacatccagctgacccatgtgcagaca(Gal-9)
tagaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttagtcgacagtactaagcttacccagctttcttgtacaaagtgg(SV40)
Ggacaggattggtgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgggtctaacccccacctcctgttaggcagattccttatctggtgacacacccccatttcctggagccatctctctccttgccagaacctctaaggtttgcttacgatggagccagagaggatcctgggagggagagcttggcagggggtgggagggaagggggggatgcgtgacctgcccggttctcagtggccaccctgcgctaccctctcccagaacctgagctgctctgacgcggccgtctggtgcgtttcactgatcctggtgctgcagcttccttacacttcccaagaggagaagcagtttggaaaaacaaaatcagaataagttggtcctgagttctaactttggctcttcacctttctagtccccaatttatattgttcctccgtgcgtcagttttacctgtgagataaggccagtagccagccccgtcctggcagggctgtggtgaggaggggggtgtccgtgtggaaaactccctttgtgagaatggtgcgtcctaggtgttcaccaggtcgtggccgcctctactccctttctctttctccatccttctttccttaaagagtccccagtgctatctgggacatattcctccgcccagagcagggtcccgcttccctaaggccctgctctgggcttctgggtttgagtccttggcaagcccaggagaggcgctcaggcttccctgtcccccttcctcgtccaccatctcatgcccctggctctcctgccccttccctacaggggttcctggctctgctct(HA-R)
CLEC4G(서열번호 25)
tgctttctctgacctgcattctctcccctgggcctgtgccgctttctgtctgcagcttgtggcctgggtcacctctacggctggcccagatccttccctgccgcctccttcaggttccgtcttcctccactccctcttccccttgctctctgctgtgttgctgcccaaggatgctctttccggagcacttccttctcggcgctgcaccacgtgatgtcctctgagcggatcctccccgtgtctgggtcctctccgggcatctctcctccctcacccaaccccatgccgtcttcactcgctgggttcccttttccttctccttctggggcctgtgccatctctcgtttcttaggatggccttctccgacggatgtctcccttgcgtcccgcctccccttcttgtaggcctgcatcatcaccgtttttctggacaaccccaaagtaccccgtctccctggctttagccacctctccatcctcttgctttctttgcctggacaccccgttctcctgtggattcgggtcacctctcactcctttcatttgggcagctcccctaccccccttacctctctagtctgtgctagctcttccagccccctgtcatggcatcttccaggggtccgagagctcagctagtcttcttcctccaacccgggcccctatgtccacttcaggacagcatgtttgctgcctccagggatcctgtgtccccgagctgggaccaccttatattcccagggccggttaatgtggctctggttctgggtacttttatctgtcccctccaccccacagtggggccacta(HA-L)
tgtgcgcgaggggagcgcggccgggggcggtgccccgcggtgcggggggggctgcgaggggaacaaaggctgcgtgcggggtgtgtgcgtgggggggtgagcagggggtgtgggcgcgtcggtcgggctgcaaccccccctgcacccccctccccgagttgctgagcacggcccggcttcgggtgcggggctccgtacggggcgtggcgcggggctcgccgtgccgggcggggggtggcggcaggtgggggtgccgggcggggcggggccgcctcgggccggggagggctcgggggaggggcgcggcggcccccggagcgccggcggctgtcgaggcgcggcgagccgcagccattgccttttatggtaatcgtgcgagagggcgcagggacttcctttgtcccaaatctgtgcggagccgaaatctgggaggcgccgccgcaccccctctagcgggcgcggggcgaagcggtgcggcgccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcgccgccgtccccttctccctctccagcctcggggctgtccgcggggggacggctgccttcgggggggacggggcagggcggggttcggcttctggcgtgtgaccggcggctctagagcctctgctaaccatgttcatgccttcttctttttcctacagctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattc(CAG)
gccaccatggacaccaccaggtacagcaagtggggcggcagctccgaggaggtccccggagggccctggggacgctgggtgcactggagcaggagacccctcttcttggccctggctgtcctggtcaccacagtcctttgggctgtgattctgagtatcctattgtccaaggcctccacggagcgcgcggcgctgcttgacggccacgacctgctgaggacaaacgcctcgaagcagacggcggcgctgggtgccctgaaggaggaggtcggagactgccacagctgctgctcggggacgcaggcgcagctgcagaccacgcgcgcggagcttggggaggcgcaggcgaagctgatggagcaggagagcgccctgcgggaactgcgtgagcgcgtgacccagggcttggctgaagccggcaggggccgtgaggacgtccgcactgagctgttccgggcgctggaggccgtgaggctccagaacaactcctgcgagccgtgccccacgtcgtggctgtccttcgagggctcctgctactttttctctgtgccaaagacgacgtgggcggcggcgcaggatcactgcgcagatgccagcgcgcacctggtgatcgttgggggcctggatgagcagggcttcctcactcggaacacgcgtggccgtggttactggctgggcctgagggctgtgcgccatctgggcaaggttcagggctaccagtgggtggacggagtctctctcagcttcagccactggaaccagggagagcccaatgacgcttgggggcgcgagaactgtgtcatgatgctgcacacggggctgtggaacgacgcaccgtgtgacagcgagaaggacggctggatctgtgagaaaaggcacaactgc(CLEC4G)
tagaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttagtcgacagtactaagcttacccagctttcttgtacaaagtgg(SV40)
Ggacaggattggtgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgggtctaacccccacctcctgttaggcagattccttatctggtgacacacccccatttcctggagccatctctctccttgccagaacctctaaggtttgcttacgatggagccagagaggatcctgggagggagagcttggcagggggtgggagggaagggggggatgcgtgacctgcccggttctcagtggccaccctgcgctaccctctcccagaacctgagctgctctgacgcggccgtctggtgcgtttcactgatcctggtgctgcagcttccttacacttcccaagaggagaagcagtttggaaaaacaaaatcagaataagttggtcctgagttctaactttggctcttcacctttctagtccccaatttatattgttcctccgtgcgtcagttttacctgtgagataaggccagtagccagccccgtcctggcagggctgtggtgaggaggggggtgtccgtgtggaaaactccctttgtgagaatggtgcgtcctaggtgttcaccaggtcgtggccgcctctactccctttctctttctccatccttctttccttaaagagtccccagtgctatctgggacatattcctccgcccagagcagggtcccgcttccctaaggccctgctctgggcttctgggtttgagtccttggcaagcccaggagaggcgctcaggcttccctgtcccccttcctcgtccaccatctcatgcccctggctctcctgccccttccctacaggggttcctggctctgctct(HA-R)
ALC2(서열번호 26)
tgctttctctgacctgcattctctcccctgggcctgtgccgctttctgtctgcagcttgtggcctgggtcacctctacggctggcccagatccttccctgccgcctccttcaggttccgtcttcctccactccctcttccccttgctctctgctgtgttgctgcccaaggatgctctttccggagcacttccttctcggcgctgcaccacgtgatgtcctctgagcggatcctccccgtgtctgggtcctctccgggcatctctcctccctcacccaaccccatgccgtcttcactcgctgggttcccttttccttctccttctggggcctgtgccatctctcgtttcttaggatggccttctccgacggatgtctcccttgcgtcccgcctccccttcttgtaggcctgcatcatcaccgtttttctggacaaccccaaagtaccccgtctccctggctttagccacctctccatcctcttgctttctttgcctggacaccccgttctcctgtggattcgggtcacctctcactcctttcatttgggcagctcccctaccccccttacctctctagtctgtgctagctcttccagccccctgtcatggcatcttccaggggtccgagagctcagctagtcttcttcctccaacccgggcccctatgtccacttcaggacagcatgtttgctgcctccagggatcctgtgtccccgagctgggaccaccttatattcccagggccggttaatgtggctctggttctgggtacttttatctgtcccctccaccccacagtggggccacta(HA-L)
tgtgcgcgaggggagcgcggccgggggcggtgccccgcggtgcggggggggctgcgaggggaacaaaggctgcgtgcggggtgtgtgcgtgggggggtgagcagggggtgtgggcgcgtcggtcgggctgcaaccccccctgcacccccctccccgagttgctgagcacggcccggcttcgggtgcggggctccgtacggggcgtggcgcggggctcgccgtgccgggcggggggtggcggcaggtgggggtgccgggcggggcggggccgcctcgggccggggagggctcgggggaggggcgcggcggcccccggagcgccggcggctgtcgaggcgcggcgagccgcagccattgccttttatggtaatcgtgcgagagggcgcagggacttcctttgtcccaaatctgtgcggagccgaaatctgggaggcgccgccgcaccccctctagcgggcgcggggcgaagcggtgcggcgccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcgccgccgtccccttctccctctccagcctcggggctgtccgcggggggacggctgccttcgggggggacggggcagggcggggttcggcttctggcgtgtgaccggcggctctagagcctctgctaaccatgttcatgccttcttctttttcctacagctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattc(CAG)
tcaacagactggaagtggggggcgacatccagctgacccatgtgcagacaggaagcggagagggcaggggaagtcttctaacatgcggggacgtggaggaaaatcccggccccatggacaccaccaggtacagcaagtggggcggcagctccgaggaggtccccggagggccctggggacgctgggtgcactggagcaggagacccctcttcttggccctggctgtcctggtcaccacagtcctttgggctgtgattctgagtatcctattgtccaaggcctccacggagcgcgcggcgctgcttgacggccacgacctgctgaggacaaacgcctcgaagcagacggcggcgctgggtgccctgaaggaggaggtcggagactgccacagctgctgctcggggacgcaggcgcagctgcagaccacgcgcgcggagcttggggaggcgcaggcgaagctgatggagcaggagagcgccctgcgggaactgcgtgagcgcgtgacccagggcttggctgaagccggcaggggccgtgaggacgtccgcactgagctgttccgggcgctggaggccgtgaggctccagaacaactcctgcgagccgtgccccacgtcgtggctgtccttcgagggctcctgctactttttctctgtgccaaagacgacgtgggcggcggcgcaggatcactgcgcagatgccagcgcgcacctggtgatcgttgggggcctggatgagcagggcttcctcactcggaacacgcgtggccgtggttactggctgggcctgagggctgtgcgccatctgggcaaggttcagggctaccagtgggtggacggagtctctctcagcttcagccactggaaccagggagagcccaatgacgcttgggggcgcgagaactgtgtcatgatgctgcacacggggctgtggaacgacgcaccgtgtgacagcgagaaggacggctggatctgtgagaaaaggcacaactgc
(Gal-9/CLEC4G)
tagaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttagtcgacagtactaagcttacccagctttcttgtacaaagtgg(SV40)
Ggacaggattggtgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgggtctaacccccacctcctgttaggcagattccttatctggtgacacacccccatttcctggagccatctctctccttgccagaacctctaaggtttgcttacgatggagccagagaggatcctgggagggagagcttggcagggggtgggagggaagggggggatgcgtgacctgcccggttctcagtggccaccctgcgctaccctctcccagaacctgagctgctctgacgcggccgtctggtgcgtttcactgatcctggtgctgcagcttccttacacttcccaagaggagaagcagtttggaaaaacaaaatcagaataagttggtcctgagttctaactttggctcttcacctttctagtccccaatttatattgttcctccgtgcgtcagttttacctgtgagataaggccagtagccagccccgtcctggcagggctgtggtgaggaggggggtgtccgtgtggaaaactccctttgtgagaatggtgcgtcctaggtgttcaccaggtcgtggccgcctctactccctttctctttctccatccttctttccttaaagagtccccagtgctatctgggacatattcctccgcccagagcagggtcccgcttccctaaggccctgctctgggcttctgggtttgagtccttggcaagcccaggagaggcgctcaggcttccctgtcccccttcctcgtccaccatctcatgcccctggctctcctgccccttccctacaggggttcctggctctgctct(HA-R)
ALC2+PDL1(서열번호 27)
Gcattctctcccctgggcctgtgccgctttctgtctgcagcttgtggcctgggtcacctctacggctggcccagatccttccctgccgcctccttcaggttccgtcttcctccactccctcttccccttgctctctgctgtgttgctgcccaaggatgctctttccggagcacttccttctcggcgctgcaccacgtgatgtcctctgagcggatcctccccgtgtctgggtcctctccgggcatctctcctccctcacccaaccccatgccgtcttcactcgctgggttcccttttccttctccttctggggcctgtgccatctctcgtttcttaggatggccttctccgacggatgtctcccttgcgtcccgcctccccttcttgtaggcctgcatcatcaccgtttttctggacaaccccaaagtaccccgtctccctggctttagccacctctccatcctcttgctttctttgcctggacaccccgttctcctgtggattcgggtcacctctcactcctttcatttgggcagctcccctaccccccttacctctctagtctgtgctagctcttccagccccctgtcatggcatcttccaggggtccgagagctcagctagtcttcttcctccaacccgggcccctatgtccacttcaggacagcatgtttgctgcctccagggatcctgtgtccccgagctgggaccaccttatattcccagggccggttaatgtggctctggttctgggtacttttatctgtcccctccaccccacagtggggcaagtttgtacaaaaaagcaggct(HA-L)
gggcggtgccccgcggtgcggggggggctgcgaggggaacaaaggctgcgtgcggggtgtgtgcgtgggggggtgagcagggggtgtgggcgcgtcggtcgggctgcaaccccccctgcacccccctccccgagttgctgagcacggcccggcttcgggtgcggggctccgtacggggcgtggcgcggggctcgccgtgccgggcggggggtggcggcaggtgggggtgccgggcggggcggggccgcctcgggccggggagggctcgggggaggggcgcggcggcccccggagcgccggcggctgtcgaggcgcggcgagccgcagccattgccttttatggtaatcgtgcgagagggcgcagggacttcctttgtcccaaatctgtgcggagccgaaatctgggaggcgccgccgcaccccctctagcgggcgcggggcgaagcggtgcggcgccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcgccgccgtccccttctccctctccagcctcggggctgtccgcggggggacggctgccttcgggggggacggggcagggcggggttcggcttctggcgtgtgaccggcggctctagagcctctgctaaccatgttcatgccttcttctttttcctacagctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattcacccagctttcttgtacaaagtgg(CAG)
aaagcaagcaggagatgttgaagaaaaccccgggcctatgaggatatttgctgtctttatattcatgacctactggcatttgctgaacgcatttactgtcacggttcccaaggacctatatgtggtagagtatggtagcaatatgacaattgaatgcaaattcccagtagaaaaacaattagacctggctgcactaattgtctattgggaaatggaggataagaacattattcaatttgtgcatggagaggaagacctgaaggttcagcatagtagctacagacagagggcccggctgttgaaggaccagctctccctgggaaatgctgcacttcagatcacagatgtgaaattgcaggatgcaggggtgtaccgctgcatgatcagctatggtggtgccgactacaagcgaattactgtgaaagtcaatgccccatacaacaaaatcaaccaaagaattttggttgtggatccagtcacctctgaacatgaactgacatgtcaggctgagggctaccccaaggccgaagtcatctggacaagcagtgaccatcaagtcctgagtggtaagaccaccaccaccaattccaagagagaggagaagcttttcaatgtgaccagcacactgagaatcaacacaacaactaatgagattttctactgcacttttaggagattagatcctgaggaaaaccatacagctgaattggtcatcccagaactacctctggcacatcctccaaatgaaaggactcacttggtaattctgggagccatcttattatgccttggtgtagcactgacattcatcttccgtttaagaaaagggagaatgatggatgtgaaaaaatgtggcatccaagatacaaactcaaagaagcaaagtgatacacatttggaggagacgtaa(Gal9/CLEC4G/PDL1)
tagaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttagtcgacagtactaagcttacccagctttcttgtacaaagtgg(SV40)
agggacaggattggtgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgggtctaacccccacctcctgttaggcagattccttatctggtgacacacccccatttcctggagccatctctctccttgccagaacctctaaggtttgcttacgatggagccagagaggatcctgggagggagagcttggcagggggtgggagggaagggggggatgcgtgacctgcccggttctcagtggccaccctgcgctaccctctcccagaacctgagctgctctgacgcggccgtctggtgcgtttcactgatcctggtgctgcagcttccttacacttcccaagaggagaagcagtttggaaaaacaaaatcagaataagttggtcctgagttctaactttggctcttcacctttctagtccccaatttatattgttcctccgtgcgtcagttttacctgtgagataaggccagtagccagccccgtcctggcagggctgtggtgaggaggggggtgtccgtgtggaaaactccctttgtgagaatggtgcgtcctaggtgttcaccaggtcgtggccgcctctactccctttctctttctccatccttctttccttaaagagtccccagtgctatctgggacatattcctccgcccagagcagggtcccgcttccctaaggccctgctctgggcttctgggtttgagtccttggcaagcccaggagaggcgctcaggcttccctgtcccccttcctcgtccaccatctcatgcccctggctctcctgccccttccctacaggggttcctggctctgctct(HA-R)
유전자를 안정적으로 과발현시키기 위해, WT-iPSC에서 분화된 EC세포에 도 8에 개시된 렌티바이러스를 전달하였다. 렌티바이러스를 전달하기 전날 500,000개의 세포를 배양 접시에 배양하였고, 24시간 후 MOI 100의 렌티바이러스 입자로 세포를 감염시켰다. 감염 후, 새로운 배지로 교체하고 표시된 대로 세포를 37°C에서 48시간동안 유지하였다. 사용된 4가지의 렌티바이러스는 VectorBuilder(Vector Builder Inc, China)에 의해 제작되었다.
도 9(a)는 K562 세포, 야생형(WT) iPSC를 분화시킨 내피세포(WT-iPSC_EC), 서열번호 24의 Gal-9 유전자가 삽입된 iPSC로부터 분화된 내피세포(Gal-9_EC), 서열번호 25의 CLEC4G 유전자가 삽입된 iPSC로부터 분화된 내피세포 (CLEC4G_EC), 서열번호 26의 Gal-9/CLEC4G 유전자가 삽입된 iPSC로부터 분화된 내피세포(Gal-9+CLEC4G_EC), 서열번호 27의 Gal-9/CLEC4G/PD-L1 유전자가 삽입된 iPSC로부터 분화된 내피세포(Gal-9+CLEC4G+ PD-L1_EC)를 효과기 세포인 NK 세포와 다양한 비율로 배양하여 세포독성을 확인한 결과를 나타낸 그래프이고, 도 9(b)는 효과기 세포(effector, NK 세포) : 표적 세포(EC, 내피세포)를 1:1의 비율로 공배양하여 7-AAD+한 세포를 측정한 결과를 나타낸 그래프이다.
도 9에서 보듯이, iPSC로부터 분화된 내피세포에 서열번호 24의 Gal-9 유전자가 삽입된 내피세포(Gal-9_EC), iPSC로부터 분화된 내피세포에 서열번호 25의 CLEC4G 유전자가 삽입된 내피세포(CLEC4G_EC), iPSC로부터 분화된 내피세포에 서열번호 26의 Gal-9/CLEC4G 유전자가 삽입된 내피세포(Gal-9+CLEC4G_EC), iPSC로부터 분화된 내피세포에 서열번호 27의 Gal-9/CLEC4G/PD-L1 유전자가 삽입된 내피세포(Gal-9+CLEC4G+ PD-L1_EC)는 야생형(WT) iPSC를 분화시킨 내피세포(WT-iPSC_EC) 보다 세포 사멸된 세포의 %가 적었으며, 효과기 세포(effector, NK 세포) : 표적 세포(EC, 내피세포)의 세포 비율이 커질수록 7-AAD+한 세포의 %가 증가하는 것을 확인할 수 있었다.

Claims (27)

  1. 줄기세포 유전체(genome)에 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자를 코딩하는 유전자가 삽입된 인위적으로 조작된 유전자를 갖는, 인위적으로 조작된 줄기세포.
  2. 제1항에 있어서,
    상기 인위적으로 조작된 줄기세포의 유전자의 서열은 야생형 줄기세포의 유전자 서열과 다르고,
    상기 인위적을 조작된 줄기세포는 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자를 코딩하는 유전자 또는 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자의 발현 또는 활성이 증가하는 것인 인위적으로 조작된 줄기세포.
  3. 제1항에 있어서, 상기 인위적으로 조작된 줄기세포 내에서,
    상기 인위적으로 조작된 유전자로부터 전사되는 mRNA는, 야생형 줄기세포 내에서 야생형 줄기세포의 유전자로부터 전사되는 mRNA의 발현수준과 비교하여, 그 mRNA 발현수준이 더 높거나, 또는 서열이 상이한 것을 특징으로 하는 인위적으로 조작된 줄기세포.
  4. 제1항에 있어서, 상기 줄기세포는 유도만능줄기세포(iPSC), 배아줄기세포, 체세포 핵치환 배아줄기세포(Somatic cell nuclear transfer-PSC) 또는 성체줄기세포인 것인 인위적으로 조작된 줄기세포.
  5. 제1항에 있어서, 상기 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자를 코딩하는 유전자는 상기 줄기세포 유전체(genome)에 넉-인(knock in)된 것 또는 유전체에 삽입된 것인 인위적으로 조작된 줄기세포.
  6. 줄기세포로부터 분화하거나 유래된 세포의 유전체(genome)에 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자를 코딩하는 유전자가 삽입된 인위적으로 조작된 유전자를 갖는, 줄기세포로부터 분화하거나 유래된 인위적으로 조작된 세포.
  7. 제6항에 있어서,
    상기 줄기세포로부터 분화하거나 유래된 인위적으로 조작된 세포의 유전자의 서열은 야생형 세포의 유전자 서열과 다르고,
    상기 줄기세포로부터 분화하거나 유래된 인위적으로 조작된 세포는 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자를 코딩하는 유전자 또는 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자의 발현 또는 활성이 증가하는 것인 줄기세포로부터 분화하거나 유래된 인위적으로 조작된 세포.
  8. 제6항에 있어서, 상기 줄기세포로부터 분화하거나 유래된 인위적으로 조작된 세포 내에서,
    상기 인위적으로 조작된 유전자로부터 전사되는 mRNA는, 야생형 세포 내에서 야생형 세포의 유전자로부터 전사되는 mRNA의 발현수준과 비교하여, 그 mRNA 발현수준이 더 높거나, 또는 서열이 상이한 것을 특징으로 하는 줄기세포로부터 분화하거나 유래된 인위적으로 조작된 세포.
  9. 제6항에 있어서, 상기 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자를 코딩하는 유전자는 상기 줄기세포로부터 분화하거나 유래된 세포 유전체(genome)에 넉-인(knock in)된 것 또는 유전체에 삽입된 것인 줄기세포로부터 분화하거나 유래된 인위적으로 조작된 세포.
  10. 제6항에 있어서, 상기 줄기세포로부터 분화하거나 유래된 세포는 인간혈관내피세포, 췌장세포, 골세포, 연골세포, 심근세포, 근육세포, 표피세포, 섬유아세포, 신경세포, 간세포, 장세포, 위세포, 피부세포, 지방세포, 혈액세포, 면역세포,　세포　스페로이드 및 오가노이드로 이루어진 군에서 선택된 1종인 것인 줄기세포로부터 분화하거나 유래된 인위적으로 조작된 세포.
  11. 제6항에 있어서, 상기 줄기세포는 유도만능줄기세포(iPSC), 배아줄기세포, 체세포 핵치환 배아줄기세포(Somatic cell nuclear transfer-PSC) 또는 성체줄기세포인 것인 줄기세포로부터 분화하거나 유래된 인위적으로 조작된 세포.
  12. 제1항 내지 제5항 중 어느 한 항에 따른 인위적으로 조작된 줄기세포로부터 분화되거나 유래한, LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자의 발현 또는 활성이 증가한 세포.
  13. 제12항에 있어서, 상기 세포는 인간혈관내피세포, 췌장세포, 골세포, 연골세포, 심근세포, 근육세포, 표피세포, 섬유아세포, 신경세포, 간세포, 장세포, 위세포, 피부세포, 지방세포, 혈액세포, 면역세포,　세포　스페로이드 및 오가노이드로 이루어진 군에서 선택된 1종인 것인 세포.
  14. 줄기세포 또는 줄기세포로부터 분화하거나 유래된 세포의 유전체(genome) 내에 위치한 표적 서열을 표적화할 수 있는 가이드 핵산 또는 이를 암호화하는 핵산;
    LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자를 코딩하는 유전자 도너 또는 이를 암호화하는 핵산 및
    에디터단백질 또는 이를 암호화하는 핵산
    을 포함하는 저면역원성 줄기세포 또는 줄기세포로부터 분화하거나 유래된 저면역원성 세포 제조용 조성물.
  15. 제14항에 있어서, 상기 조성물은
    상기 에디터 단백질 및 상기 가이드 핵산을 리보뉴클레오프로테인(RNP) 형태로 포함하는 것인 저면역원성 줄기세포 또는 줄기세포로부터 분화하거나 유래된 저면역원성 세포 제조용 조성물.
  16. 제14항에 있어서, 상기 조성물은
    상기 에디터 단백질을 암호화하는 핵산 및 상기 가이드 핵산을 암호화하는 핵산을 1 이상의 벡터 형태로 포함하는 것인 저면역원성 줄기세포 제조용 또는 줄기세포로부터 분화하거나 유래된 저면역원성 세포 조성물.
  17. 제16항에 있어서, 상기 벡터는 플라스미드, 레트로바이러스, 렌티바이러스, 아데노바이러스, 아데노-연관 바이러스, 백시니아바이러스, 폭스바이러스 및 단순포진 바이러스로 구성된 군에서 선택된 것인 저면역원성 줄기세포 또는 줄기세포로부터 분화하거나 유래된 저면역원성 세포 제조용 조성물.
  18. 분리된 줄기세포 또는 분리된 줄기세포로부터 분화하거나 유래된 세포에 제14항의 저면역원성 줄기세포 또는 줄기세포로부터 분화하거나 유래된 저면역원성 세포 제조용 조성물을 도입하는 단계; 및
    상기 줄기세포 또는 분리된 줄기세포로부터 분화하거나 유래된 세포의 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자의 발현 또는 활성을 증가시키도록 LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자를 코딩하는 유전자를 상기 줄기세포 또는 줄기세포로부터 분화하거나 유래된 세포 유전체(genome)에 넉-인(knock-in)하는 단계
    를 포함하는 저면역원성 줄기세포 또는 분리된 줄기세포로부터 분화하거나 유래된 저면역원성 세포의 제조방법.
  19. 제18항에 있어서, 상기 조성물은 상기 에디터 단백질을 암호화하는 핵산 및 상기 가이드 핵산을 암호화하는 핵산을 1 이상의 벡터 형태로 포함하는, 저면역원성 줄기세포 또는 분리된 줄기세포로부터 분화하거나 유래된 저면역원성 세포의 제조방법.
  20. 제18항에 있어서, 상기 줄기세포 또는 줄기세포로부터 분화하거나 유래된 세포의 유전체(genome) 내에 위치한 표적서열에, 스트렙토코커스 피오게네스(Streptococcus pyogenes) 유래 Cas9 단백질 및 표적서열을 표적화 할 수 있는 가이드 RNA를 포함하는 CRISPR/Cas9 복합체를 접촉시킴으로써, 상기 표적 서열 내에 인델이 발생되는 것을 특징으로 하는 저면역원성 줄기세포 또는 줄기세포로부터 분화하거나 유래된 저면역원성 세포의 제조방법.
  21. 제1항 내지 제5항 중 어느 한 항에 따른 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 세포 이식 또는 생체 조직 재생용 조성물.
  22. 제21항에 있어서, 상기 세포 이식 또는 생체 조직 재생용 조성물은 세포치료제 조성물, 유전자치료제 조성물, 조직공학치료제 조성물, 면역 치료제 조성물 또는 암의 예방 또는 치료제 조성물인 것인, 세포 이식 또는 생체 조직 재생용 조성물.
  23. 제6항 내지 제11항 중 어느 한 항에 따른 줄기세포로부터 분화하거나 유래된 인위적으로 조작된 세포를 유효성분으로 포함하는 세포 이식 또는 생체 조직 재생용 조성물.
  24. 제23항에 있어서, 상기 세포 이식 또는 생체 조직 재생용 조성물은 세포치료제 조성물, 유전자치료제 조성물, 조직공학치료제 조성물, 면역 치료제 조성물 또는 암의 예방 또는 치료제 조성물인 것인, 세포 이식 또는 생체 조직 재생용 조성물.
  25. 제1항 내지 제5항 중 어느 한 항에 따른 인위적으로 조작된 줄기세포로부터 분화되거나 유래한, LGALS9(Gal-9), CLEC4G(LSECtin), PD-L1 및 HHLA2로 이루어진 군에서 선택된 하나 이상의 면역활성 억제 인자의 발현 또는 활성이 증가한 세포를 유효성분으로 포함하는 세포 이식 또는 생체 조직 재생용 조성물.
  26. 제25항에 있어서, 상기 세포는 인간혈관내피세포, 골세포, 연골세포, 심근세포, 근육세포, 표피세포, 섬유아세포, 신경세포, 간세포, 장세포, 위세포, 피부세포, 지방세포, 혈액세포, 면역세포,　세포　스페로이드 및 오가노이드로 이루어진 군에서 선택된 1종인 것인 세포 이식 또는 생체 조직 재생용 조성물.
  27. 제25항에 있어서, 상기 세포 이식 또는 생체 조직 재생용 조성물은 세포치료제 조성물, 유전자치료제 조성물, 조직공학치료제 조성물, 면역 치료제 조성물 또는 암의 예방 또는 치료제 조성물인 것인, 세포 이식 또는 생체 조직 재생용 조성물.
PCT/KR2023/003055 2022-03-04 2023-03-06 저면역원성 줄기세포, 줄기세포로부터 분화되거나 유래된 저면역원성 세포 및 이의 제조방법 WO2023167575A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020237009539A KR20230131816A (ko) 2022-03-04 2023-03-06 저면역원성 줄기세포, 줄기세포로부터 분화되거나 유래된 저면역원성 세포및 이의 제조방법

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20220027931 2022-03-04
KR10-2022-0027931 2022-03-04

Publications (1)

Publication Number Publication Date
WO2023167575A1 true WO2023167575A1 (ko) 2023-09-07

Family

ID=87884084

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/003055 WO2023167575A1 (ko) 2022-03-04 2023-03-06 저면역원성 줄기세포, 줄기세포로부터 분화되거나 유래된 저면역원성 세포 및 이의 제조방법

Country Status (2)

Country Link
KR (1) KR20230131816A (ko)
WO (1) WO2023167575A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160272999A1 (en) * 2013-05-29 2016-09-22 Cellectis Methods for engineering t cells for immunotherapy by using rna-guided cas nuclease system
WO2016183041A2 (en) * 2015-05-08 2016-11-17 President And Fellows Of Harvard College Universal donor stem cells and related methods
KR20180066262A (ko) * 2015-11-04 2018-06-18 페이트 세러퓨틱스, 인코포레이티드 만능 세포의 유전자 조작
KR20180123445A (ko) * 2017-05-08 2018-11-16 주식회사 툴젠 인위적으로 조작된 조작면역세포
KR20210075086A (ko) * 2018-09-07 2021-06-22 크리스퍼 테라퓨틱스 아게 범용 공여자 세포

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019161271A1 (en) 2018-02-16 2019-08-22 Kite Pharma, Inc. Modified pluripotent stem cells and methods of making and use

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160272999A1 (en) * 2013-05-29 2016-09-22 Cellectis Methods for engineering t cells for immunotherapy by using rna-guided cas nuclease system
WO2016183041A2 (en) * 2015-05-08 2016-11-17 President And Fellows Of Harvard College Universal donor stem cells and related methods
KR20180066262A (ko) * 2015-11-04 2018-06-18 페이트 세러퓨틱스, 인코포레이티드 만능 세포의 유전자 조작
KR20180123445A (ko) * 2017-05-08 2018-11-16 주식회사 툴젠 인위적으로 조작된 조작면역세포
KR20210075086A (ko) * 2018-09-07 2021-06-22 크리스퍼 테라퓨틱스 아게 범용 공여자 세포

Also Published As

Publication number Publication date
KR20230131816A (ko) 2023-09-14

Similar Documents

Publication Publication Date Title
US11977073B2 (en) HLA G-modified cells and methods
WO2016021972A1 (en) Immune-compatible cells created by nuclease-mediated editing of genes encoding hla
JP2017537611A (ja) 持続的エピジェネティック遺伝子サイレンシング
WO2018217064A2 (ko) 형질전환된 t세포를 이용한 자연살해세포의 배양방법
US20230272429A1 (en) Modification of blood type antigens
WO2019231266A1 (ko) Hla 유전자가 제거된 인간 유도만능줄기세포 유래 중간엽줄기세포 및 그의 제조 방법
WO2018208067A1 (ko) 인위적으로 조작된 조작면역세포
WO2018030874A1 (ko) 조작된 면역조절요소 및 이에 의해 변형된 면역 활성
WO2020101361A1 (ko) 형질전환된 t세포를 이용한 제대혈 유래 자연살해세포의 배양방법
WO2023282688A1 (ko) 산화스트레스 저항성을 갖는 중간엽 줄기세포, 이의 제조방법 및 용도
WO2023167575A1 (ko) 저면역원성 줄기세포, 줄기세포로부터 분화되거나 유래된 저면역원성 세포 및 이의 제조방법
WO2016117960A1 (ko) 면역질환 치료 효능을 갖는 grim19이 과발현된 중간엽줄기세포 및 이의 용도
WO2023008933A1 (ko) 혈액 적합성을 갖는 중간엽 줄기세포, 이의 제조방법 및 용도
WO2021107234A1 (ko) Hiv 감염 치료 또는 예방을 위한 ccr5/cxcr4 유전자 동시 넉아웃 환자맞춤형 조혈모세포 및 이의 제조방법
WO2022018884A1 (ja) 栄養障害型表皮水疱症の治療薬
WO2022010220A1 (ko) 면역원성이 감소된 신규한 이식용 세포
WO2023219434A1 (ko) 혈액 적합성을 갖는 혈관 내 이식용 세포, 이의 제조방법 및 용도
WO2022211604A1 (ko) Fe-fviii 변이 유전자로 교정된 줄기세포, 이로부터 분화된 내피 세포 및 이를 포함하는 혈우병 예방 또는 치료용 약제학적 조성물
WO2023008918A1 (ko) B2m 유전자의 발현이 저해된 유전적으로 조작된 줄기세포 및 이의 이용방법
WO2022075784A1 (ko) T 세포 수용체, t 세포 수용체를 포함하는 면역 세포 및 이를 이용하는 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23763772

Country of ref document: EP

Kind code of ref document: A1