WO2020101361A1 - 형질전환된 t세포를 이용한 제대혈 유래 자연살해세포의 배양방법 - Google Patents

형질전환된 t세포를 이용한 제대혈 유래 자연살해세포의 배양방법 Download PDF

Info

Publication number
WO2020101361A1
WO2020101361A1 PCT/KR2019/015469 KR2019015469W WO2020101361A1 WO 2020101361 A1 WO2020101361 A1 WO 2020101361A1 KR 2019015469 W KR2019015469 W KR 2019015469W WO 2020101361 A1 WO2020101361 A1 WO 2020101361A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
gene
natural killer
mbil
seq
Prior art date
Application number
PCT/KR2019/015469
Other languages
English (en)
French (fr)
Inventor
김유선
김은지
박경민
양빛나
민보경
조성유
황유경
Original Assignee
주식회사 녹십자랩셀
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 녹십자랩셀 filed Critical 주식회사 녹십자랩셀
Priority to AU2019381526A priority Critical patent/AU2019381526B2/en
Priority to EP19885404.4A priority patent/EP3892721A4/en
Priority to CN201980075094.XA priority patent/CN113383069A/zh
Priority to CA3120085A priority patent/CA3120085A1/en
Priority to US17/293,835 priority patent/US20240084256A1/en
Priority to SG11202104662UA priority patent/SG11202104662UA/en
Priority to JP2021526674A priority patent/JP7179986B2/ja
Priority claimed from KR1020190145068A external-priority patent/KR102338957B1/ko
Publication of WO2020101361A1 publication Critical patent/WO2020101361A1/ko
Priority to IL283176A priority patent/IL283176A/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0646—Natural killers cells [NK], NKT cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/17—Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C12N2501/23—Interleukins [IL]
    • C12N2501/2302—Interleukin-2 (IL-2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/50—Cell markers; Cell surface determinants
    • C12N2501/515—CD3, T-cell receptor complex
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/11—Coculture with; Conditioned medium produced by blood or immune system cells
    • C12N2502/1114—T cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells

Definitions

  • the present invention relates to a method for culturing natural killer cells derived from umbilical cord blood using transformed T cells.
  • an immunotherapy method using a patient's immune function has been developed.
  • immunotherapies using natural killer cells capable of mass production and freezing are being studied.
  • Natural killer cells are lymphocyte cells that account for about 15% of peripheral blood lymphocytes and play an important role in the innate immune response.
  • natural killer cells activate dendritic cells and induce cytotoxic T lymphocytes (CTLs) to specifically respond to tumors, thereby removing tumor cells.
  • CTLs cytotoxic T lymphocytes
  • Natural killer cells directly kill malignant tumors such as sarcoma, myeloma, carcinoma, lymphomas and leukemia.
  • malignant tumors such as sarcoma, myeloma, carcinoma, lymphomas and leukemia.
  • most natural killer cells present in the normal human body exist in an inactive state, and activated natural killer cells are required to remove the tumor.
  • natural killer cells in order to use natural killer cells as a therapeutic agent, it is very important to activate natural killer cells.
  • the number of natural killer cells present in the body is limited, it is essential to develop a technique for proliferating and freezing natural killer cells in normal human blood or patient blood in large quantities.
  • In vitro expansion method is used as a method for multiplying natural killer cells, and peripheral blood lymphocyte (PBMC), cord blood (CB), or human-induced pluripotent stem cell) is being studied for mass cultivation of natural killer cells.
  • PBMC peripheral blood lymphocyte
  • CB cord blood
  • human-induced pluripotent stem cell human-induced pluripotent stem cell
  • umbilical cord blood can be obtained through simple procedures from umbilical cord blood that is discarded during delivery, unlike bone marrow.
  • the storage industry of cord blood has been activated, and it is easy to obtain a donor, and research into a method for culturing natural killer cells using cord blood has been actively conducted.
  • in vitro expansion culture methods of umbilical cord blood-derived natural killer cells include proliferation using mononuclear cells (MNC) as source cells, and proliferation using hematopoietic progenitor cells (CD34 + cells) as source cells.
  • MNC mononuclear cells
  • CD34 + cells hematopoietic progenitor cells
  • the method of using mononuclear cells as a source cell is to use interleukin-2 (IL-2), interleukin-15 (IL-15), or FLT-3L alone or in combination to help spawn natural killer cells, but proliferation rate and purity.
  • IL-2 interleukin-2
  • IL-15 interleukin-15
  • FLT-3L alone or in combination to help spawn natural killer cells, but proliferation rate and purity.
  • the method using hematopoietic progenitor cells as a raw material has a high proliferation rate and high purity, but has a long incubation period and needs to be mixed with various cytokines and growth factors, making it difficult to commercialize in terms of cost (Fias AM et al ., Experimental Hematology 36 (1): 61-68, 2008).
  • PBMC In vitro expansion culture of natural killer cells, PBMC, CD3- cells, CD3-CD56 + cells, and CD56 + cells are used as raw cells, and IL-2, IL-12, IL-15, IL-21 are natural killer cell proliferation factors.
  • Cytokines and LPS Goodier et al ., J. Immunol . 165 (1): 139-147, 2000
  • CD3 stimulating OKT-3 antibody Condiotti et al., Experimental Hematol. 29 (1) : 104-113, 2001.
  • Natural killer cells can be proliferated about 3 to 10 times only with the aforementioned growth factors. However, the proliferation rate is difficult to commercialize natural killer cells as therapeutic agents.
  • Peripheral blood mononuclear cells, EBV-LCL, and K562 cell lines are typical cell lines used as support cells.
  • the K562 cell line is a blood cancer-derived cell line that lacks HLA and is a representative target cell line that natural killer cells can easily attack.
  • Most supporting cells that cultivate natural killer cells express and proliferate by expressing 4-1BBL and membrane-bound IL-15 in the K562 cell line ( Fujisaki et al ., Cancer Res. 69 (9): 4010 -4017, 2009), MICA, 4-1BBL, and a method of expressing and proliferating IL-15 (Gong et al.
  • the present inventors proliferate in vitro by co-culturing CD4 + T cells expressing co-stimulatory factor and growth factor and natural killer cells derived from umbilical cord blood to efficiently proliferate natural killer cells from umbilical cord blood.
  • the method was developed.
  • the present inventors have produced transformed CD4 (+) T cells to increase the efficiency of the natural killer cell culture method using the CD4 (+) T cells as support cells.
  • the transformed CD4 (+) T cells and umbilical cord blood-derived monocytes were co-cultured, and the present invention was completed by confirming that the proliferation rate and apoptosis ability of natural killer cells were increased through the co-culture.
  • One aspect of the present invention provides a method for culturing natural killer cells comprising the step of co-culturing the transformed CD4 + T cells and the source cells.
  • Another aspect of the present invention provides a natural killer cell prepared by the culture method.
  • the method for culturing natural killer cells using the transformed T cells of the present invention can be produced by effectively proliferating natural killer cells from a small amount of raw cells derived from umbilical cord blood.
  • the natural killer cells prepared as described above have improved cell killing ability. Therefore, the method for culturing natural killer cells using the transformed T cells of the present invention can be usefully used for commercialization of cell therapy products.
  • natural killer cells produced by the culture method of the present invention can be usefully used as a cell therapy agent.
  • 1A is a diagram confirming whether a gene is expressed in a Hut78 cell line through FACS.
  • Figure 1b is a diagram confirming whether the expression of a single gene introduced into the Hut78 cell line through FACS.
  • Figure 1c is a diagram confirming whether the expression of mTNF- ⁇ / OX40L and mTNF- ⁇ / 4-1BBL dual genes introduced into the Hut78 cell line through FACS.
  • Figure 1d is a diagram confirming whether the expression of the mbIL-21 / OX40L and mbIL-21 / 4-1BBL dual genes introduced into the Hut78 cell line through FACS.
  • Figure 1e is a diagram confirming whether the expression of the triple gene introduced into the Hut78 cell line through FACS.
  • Figure 1f is a diagram confirming whether or not the expression of the quadruple gene introduced into the Hut78 cell line through FACS.
  • Figure 2a is a diagram showing the proliferation rate of natural killer cells produced by co-culturing the CD3 (-) mononuclear cells derived from umbilical cord blood and the Hut78 cell line into which the gene has been introduced by each gene.
  • Figure 2b is a diagram showing the proliferation rate of natural killer cells prepared by co-culturing the gene-introduced H9 cell line and umbilical cord-derived CD3 (-) mononuclear cells for each introduced gene.
  • Figure 2c is a diagram showing the proliferation rate of natural killer cells prepared by co-culturing the gene-introduced Jurkat cell line and umbilical cord-derived CD3 (-) mononuclear cells for each introduced gene.
  • Figure 2d is a diagram showing the proliferation rate of spontaneous killer cells prepared by co-culturing a CD3 (-) mononuclear cell derived from cord blood with a Peer cell line into which the gene has been introduced, by introduction gene.
  • Figure 2e is a diagram showing the proliferation rate of natural killer cells prepared by re-stimulation at intervals of 14 or 16 days when co-culturing CD3 (-) monocytes derived from umbilical cord blood and Hut78 cell line in which the triple gene is introduced.
  • Figure 3a is a diagram showing the survival rate of natural killer cells produced by co-culturing the CD3 (-) monocytes derived from umbilical cord blood and the Hut78 cell line with the gene introduced by each gene.
  • Figure 3b is a diagram showing the survival rate of natural killer cells prepared by co-culturing the gene-introduced H9 cell line and umbilical cord-derived CD3 (-) monocytes by gene.
  • Figure 3c is a diagram showing the survival rate of natural killer cells prepared by co-culturing the gene-introduced Jurkat cell line and umbilical cord-derived CD3 (-) mononuclear cells for each gene.
  • Figure 3d is a diagram showing the survival rate of spontaneous killer cells prepared by co-culturing CD3 (-) mononuclear cells derived from umbilical cord blood and the introduced Peer cell line by gene.
  • Figure 3e is a diagram showing the survival rate of natural killer cells prepared by re-stimulation at intervals of 14 or 16 days when co-culturing CD3 (-) monocytes derived from umbilical cord blood and Hut78 cell line with triple gene introduction.
  • FIG. 4A is a diagram showing the purity (CD3-CD56 +) of natural killer cells prepared by co-culturing a gene-introduced Hut78 cell line and umbilical cord-derived CD3 (-) mononuclear cells for each introduced gene.
  • 4B is a diagram showing the purity (CD3-CD56 +) of natural killer cells prepared by co-culturing a gene-introduced H9 cell line and umbilical cord-derived CD3 (-) mononuclear cells for each introduced gene.
  • Figure 4c is a diagram showing the purity (CD3-CD56 +) of the natural killer cells prepared by co-culturing the gene-introduced Jurkat cell line and umbilical cord-derived CD3 (-) mononuclear cells for each introduced gene.
  • Figure 4d is a diagram showing the purity (CD3-CD56 +) of the natural killer cells prepared by co-culturing CD3 (-) mononuclear cells derived from umbilical cord blood and the introduced Peer cell line.
  • Figure 4e is a diagram showing the purity (CD3-CD56 +) of natural killer cells prepared by re-stimulation at intervals of 14 or 16 days when co-culturing CD3 (-) monocytes derived from umbilical cord blood and Hut78 cell line with triple gene introduction to be.
  • FIG. 5A is a diagram showing the activity (CD16 + CD56 +) of natural killer cells produced by co-culturing a gene-introduced Hut78 cell line and umbilical cord-derived CD3 (-) mononuclear cells for each introduced gene.
  • 5B is a diagram showing the expression level of the NKG2D phenotypic marker of natural killer cells produced by co-culturing a gene-introduced Hut78 cell line and umbilical cord-derived CD3 (-) mononuclear cells for each introduced gene.
  • Figure 5c is a diagram showing the expression level of the NKp30 phenotype marker of natural killer cells prepared by co-culturing the gene-introduced Hut78 cell line and umbilical cord-derived CD3 (-) mononuclear cells for each introduced gene.
  • 5D is a diagram showing the expression level of the NKp44 phenotype marker of natural killer cells produced by co-culturing the gene-introduced Hut78 cell line and umbilical cord blood-derived CD3 (-) monocytes by gene.
  • Figure 5e is a diagram showing the expression level of the NKp46 phenotype marker of natural killer cells prepared by co-culturing the gene-introduced Hut78 cell line and umbilical cord-derived CD3 (-) mononuclear cells for each introduced gene.
  • Figure 5f is a diagram showing the expression level of the DNAM-1 phenotypic marker of natural killer cells produced by co-culturing the gene-introduced Hut78 cell line and umbilical cord-derived CD3 (-) mononuclear cells for each introduced gene.
  • Figure 5g is a diagram showing the expression level of the CXCR3 phenotype markers of natural killer cells prepared by co-culturing a gene-introduced Hut78 cell line and umbilical cord-derived CD3 (-) mononuclear cells for each introduced gene.
  • FIG. 6A is a diagram showing the activity (CD16 + CD56 +) of natural killer cells produced by co-culturing a gene-introduced H9 cell line and umbilical cord blood-derived CD3 (-) mononuclear cells for each introduced gene.
  • FIG. 6B is a diagram showing the expression level of the NKG2D phenotype marker of natural killer cells prepared by co-culturing the gene-introduced H9 cell line and umbilical cord-derived CD3 (-) monocytes by gene.
  • 6c is a diagram showing the expression level of the NKp30 phenotype marker of natural killer cells prepared by co-culturing the gene-introduced H9 cell line and umbilical cord-derived CD3 (-) mononuclear cells for each introduced gene.
  • 6D is a diagram showing the expression level of the NKp44 phenotype marker of natural killer cells produced by co-culturing the gene-introduced H9 cell line and umbilical cord blood-derived CD3 (-) monocytes for each gene.
  • 6E is a diagram showing the expression level of the NKp46 phenotype marker of natural killer cells prepared by co-culturing the gene-introduced H9 cell line and umbilical cord-derived CD3 (-) mononuclear cells for each introduced gene.
  • 6F is a diagram showing the expression level of the DNAM-1 phenotype marker of natural killer cells prepared by co-culturing the gene-introduced H9 cell line and umbilical cord-derived CD3 (-) mononuclear cells for each introduced gene.
  • Figure 6g is a diagram showing the expression level of the CXCR3 phenotype markers of natural killer cells prepared by co-culturing the gene-introduced H9 cell line and umbilical cord blood-derived CD3 (-) monocytes by gene.
  • Figure 7a shows the activity (CD16 + CD56 +) and NKG2D phenotype of natural killer cells prepared by re-stimulation at intervals of 14 or 16 days when co-cultured with CD3 (-) monocytes derived from umbilical cord and Hut78 cell line with triple gene introduction It is a figure showing the expression level of a marker.
  • Figure 7b is a NKp30, NKp44, NKp46, DNAM-1 of natural killer cells prepared by re-stimulation at intervals of 14 or 16 days when co-cultured with CD3 (-) monocytes derived from umbilical cord blood and Hut78 cell line with triple gene introduction , It is a diagram showing the expression level of the CXCR3 phenotype marker.
  • 8A is a diagram showing the tumor cell killing capacity of natural killer cells prepared by co-culturing a gene-introduced Hut78 cell line and umbilical cord-derived CD3 (-) mononuclear cells by gene.
  • 8B is a diagram showing the tumor cell killing ability of natural killer cells prepared by co-culturing a gene-introduced H9 cell line and umbilical cord-derived CD3 (-) monocytes by gene.
  • Figure 8c is a diagram showing the tumor cell killing ability of the natural killer cells prepared by co-culturing the gene-introduced Jurkat cell line and umbilical cord-derived CD3 (-) monocytes by gene.
  • Figure 8d is a diagram showing the tumor cell killing ability of natural killer cells prepared by co-culturing a gene-introduced Peer cell line and umbilical cord-derived CD3 (-) monocytes by gene.
  • Figure 8e is a diagram showing the tumor cell killing ability of natural killer cells prepared by re-stimulation at intervals of 14 or 16 days when co-cultured with CD3 (-) monocytes derived from umbilical cord blood and the Hut78 cell line with the triple gene introduced.
  • 9A is a diagram showing a dosing schedule for efficacy evaluation using a Raji mouse animal model.
  • Figure 9b is a diagram showing the results of measuring the survival rate to confirm the efficacy of NK cells, RTX and combination administration in the Raji animal model.
  • 10A is a diagram showing a dosing schedule for efficacy evaluation using a Ramos mouse animal model.
  • Figure 10b is a diagram showing the results of measuring the survival rate to confirm the efficacy of NK cells, RTX and combination administration in a Ramos animal model.
  • One aspect of the present invention provides a method for culturing natural killer cells comprising the step of co-culturing the transformed CD4 + T cells and the source cells.
  • the transformed CD4 + T cells may be expressed by at least one gene selected from the group consisting of 4-1BBL gene, mbIL-21 gene, OX40L gene and mTNF- ⁇ gene.
  • the gene when a single gene is introduced into the transformed CD4 + T cell, the gene may be 4-1BBL, mbIL-21, OX40L or mTNF- ⁇ .
  • the gene combination when two genes are introduced into the transformed CD4 + T cells, the gene combination is mbIL-21 / 4-1BBL, 4-1BBL / OX40L, mTNF- ⁇ / 4-1BBL, mbIL-21 / OX40L, mbIL-21 / mTNF- ⁇ or mTNF- ⁇ / OX40L.
  • genes of mbIL-21 / 4-1BBL, mTNF- ⁇ / OX40L, mTNF- ⁇ / 4-1BBL and mbIL-21 / OX40L combinations were introduced into T cells.
  • the gene combination is 4-1BBL / mbIL-21 / OX40L, mbIL-21 / OX40L / mTNF- ⁇ , mTNF- ⁇ / mbIL-21 / It may be 4-1BBL or 4-1BBL / OX40L / mTNF- ⁇ .
  • the gene of mTNF- ⁇ / mbIL-21 / 4-4BBL combination was introduced into T cells.
  • the gene combination may be mTNF- ⁇ / mbIL-21 / OX40L / 4-1BBL.
  • a gene of mTNF- ⁇ / mbIL-21 / OX40L / 4-1BBL combination was introduced into T cells.
  • '4-1BBL' used in the present invention is one of TNFSF (TNFSF) called CD137L, and refers to a ligand that forms a trimer and binds to the receptor 4-1BB.
  • TNFSF TNFSF
  • the 4-1BBL gene may be derived from humans.
  • the 4-1BBL gene may be NCBI Reference Sequence: NM_003811, but is not limited thereto.
  • the 4-1BBL gene may be a nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 1.
  • the base sequence encoding the amino acid sequence represented by SEQ ID NO: 1 may be a base sequence represented by SEQ ID NO: 2.
  • mbIL-21' used in the present invention may be IL-21 designed to bind to a cell membrane.
  • mbIL-21 may be a fusion protein in which IL-21 and a transmembrane protein are combined.
  • the transmembrane protein may be CD8 ⁇ . Specifically, it may be a transmembrane domain of CD8 ⁇ .
  • the IL-21 gene may be NCBI Reference Sequence: NM_021803.3, but is not limited thereto.
  • the CD8 ⁇ gene may be NCBI Reference Sequence: NM_001768, but is not limited thereto.
  • the mbIL-21 is expressed in the form of IL-21 bound to the cell membrane.
  • the mbIL-21 gene may be a nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 3.
  • the amino acid sequence represented by SEQ ID NO: 3 may be a nucleotide sequence represented by SEQ ID NO: 4.
  • the term 'OX40L' used in the present invention is also called TNFSF4, gp34, TXGP1, CD252 and CD134L, and refers to a ligand that binds to OX40.
  • the OX40L gene may be NCBI Reference Sequence: NM_003326, but is not limited thereto.
  • the OX40L gene may be a nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 5.
  • the nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 5 may be a nucleotide sequence represented by SEQ ID NO: 6.
  • 'mTNF- ⁇ ' used in the present invention refers to alanine-Valine, a recognition site for tumor necrosis factor-alpha-converting enzyme (TACE) in the amino acid sequence of tumor necrosis factor-alpha.
  • TACE tumor necrosis factor-alpha-converting enzyme
  • the mTNF- ⁇ gene may be a nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 8.
  • the nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 8 may be a nucleotide sequence represented by SEQ ID NO: 9.
  • the 4-1BBL gene, mbIL-21 gene, OX40L gene or mTNF- ⁇ gene may be introduced through a recombinant lentivirus, but is not limited thereto.
  • a biochemical method As a method for transducing the gene into cells, a biochemical method, a physical method, or a virus-mediated transduction method may be used.
  • FuGene6 Roche, USA
  • Lipofectamine 2000, Invitrogen, USA
  • ExGen 500 MBI Fermentas International Inc. CANADA
  • a lipid mediating method using lipofectamine can be used.
  • vector used in the present invention is an expression vector capable of expressing a target gene in a cell into which the vector is introduced, a gene construct comprising essential regulatory elements operably linked to express a gene insert introduced into the vector.
  • the expression vector containing the gene can be used any expression vector that can be expressed in the CD4 + cell line, in a specific embodiment of the present invention pCDH-CMV-MCS-EF1-Puro (SBI, CD510B-1) or pCDH -CMV-MCS-EF1-Neo (SBI, CD514B-1) lenti virus vector was used.
  • the lentivirus refers to a virus of the retroviral family characterized by a long incubation period. Lenti virus can transmit genetic information into the DNA of the host cell. It is one of the most effective methods of gene transfer vectors that can replicate in non-dividing cells.
  • the CD4 + T cells may be CD4 + T cells isolated in vitro, CD4 + T cells expanded in vitro or a CD4 + cell line (T lymphoma cell line).
  • the CD4 + T cells may be auxiliary T cells, or may be hybridomas obtained by fusion of CD4 + T cells and cancer cells.
  • CD4 + T cells may be any one selected from the group consisting of Hut78, H9, Jurkat, Loucy, Molt-3, Molt-13, Peer, RPMI8402 and TALL-01 cells. Preferably it can be Hut78, H9, Jurkat or Peer cells.
  • the term 'feeder cell' used in the present invention is also referred to as a culture auxiliary cell, and does not proliferate, but has metabolic activity and means a cell that produces various metabolites and helps proliferation of target cells.
  • the support cell may be a transformed CD4 + T cell expressing at least one gene selected from the group consisting of 4-1BBL gene, mbIL-21 gene, OX40L gene and mTNF- ⁇ gene.
  • the T cell used as the support cell may be an inactivated cell or an inactivated cell in which mitosis is suppressed, and preferably, safety may be secured by inactivating.
  • a conventional method known in the art may be used, and for example, a method of irradiating gamma-rays may be used.
  • T cells that are not inactivated are used, they are mostly tumor cells, so they can be killed in culture by activated natural killer cells.
  • seed cell used in the present invention means a cell that can proliferate into natural killer cells through appropriate culture.
  • the source cells may be cord blood-derived mononuclear cells, or cord blood-derived natural killer cells. It is not limited thereto, and preferably, the source cells may be CD3 (-) cells from which CD3 (+) cells have been removed.
  • the method for culturing the natural killer cells may be cultured by mixing the ratio of the supporting cells and the source cells to 0.1 or more.
  • the ratio of the supporting cells and the source cells may be 0.1: 1 to 50: 1. More specifically, it may be 0.5: 1 to 40: 1. More specifically, it may be 1: 1 to 30: 1. Most specifically, it may be 2: 1 to 20: 1.
  • the ratio of the supporting cells to the source cells may be a ratio of 2.5: 1, and is not particularly limited.
  • the "ratio" means a ratio based on the number of cells.
  • the source cells can be cultured for 5 to 60 days by mixing once with the support cells, or by mixing with the support cells two or more times for more than 60 days.
  • the source cells can be cultured for 14 to 21 days by mixing once with the support cells, but are not limited thereto.
  • the natural killer cell culture method is co-cultured with natural killer cells and T lymphoma cell lines in common animal cell culture media such as AIM-V media, RPMI1640, CellGro SCGM, X-VIVO20, IMDM, and DMEM.
  • common animal cell culture media such as AIM-V media, RPMI1640, CellGro SCGM, X-VIVO20, IMDM, and DMEM.
  • T cells have low affinity and can be cultured by adding antibodies and interleukins that stimulate T cells, but are not limited thereto.
  • the term 'antibody having low affinity to T cells and stimulating T cells' used in the present invention specifically refers to CD3 antigen, a group of molecules that form an antigen recognition complex in association with T cell receptors (TCR). It means the protein to react.
  • CD3 molecule has a longer intracellular region than TCR and is responsible for delivering an antigen recognition signal into the cell.
  • Antibodies that have low affinity to T cells that can be used in the present invention and stimulate T cells may be preferably anti-CD3 antibodies.
  • the anti-CD3 antibody may be OKT-3, UCHT1 or HIT3a.
  • IL Interleukin
  • IL-2 IL-15
  • IL-12 IL-18
  • IL-21 IL-21
  • OKT-3 antibody and IL-2 were added to culture.
  • the concentration of the OKT-3 antibody added may be 0.1 ng / ml to 1,000 ng / ml.
  • the concentration of the OKT-3 antibody may be 10 ng / ⁇ l.
  • the concentration of IL-2 can be from 10 U / ml to 2,000 U / ml.
  • the concentration of IL-2 may be 1,000 U / ml.
  • it can be cultured by adding an additional proliferation factor supporting the growth of serum or plasma and lymphocytes.
  • the type of serum or plasma added to the medium is not particularly limited, and various commercially available animal-derived serum or plasma can be used.
  • human-derived serum or plasma can be used.
  • culture of the present invention means a method for growing cells under environmental conditions that are artificially controlled appropriately.
  • the method of culturing the transformed CD4 + T cells can be performed using methods well known in the art. Specifically, the culture may be continuously cultured in a batch process, a fed batch, or a repeated fed batch process.
  • precursors suitable for the culture medium may be used.
  • the above-mentioned raw materials may be added in a batchwise, fed-batch, or continuous manner in an appropriate manner to the culture in the culture process, but are not particularly limited thereto.
  • the pH of the culture can be adjusted by using a basic compound such as sodium hydroxide, potassium hydroxide or ammonia or an acid compound such as phosphoric acid or sulfuric acid in an appropriate manner.
  • the culture method using the T cell as a support cell induces the cultivation of natural killer cells selectively from the source cells, and stably without the difference according to the donor when proliferating the natural killer cells than when using the donor PBMC support cells. Can be cultured. Also, when the donor's MNC is used as a support cell, it is difficult to culture the umbilical cord blood source cells in vitro. Therefore, the culture method using T cells as support cells can efficiently and stably secure a therapeutic agent for natural killer cells for a large amount of treatment.
  • Another aspect of the present invention provides a natural killer cell prepared by the natural killer cell culture method.
  • the natural killer cells cultured according to the natural killer cell culturing method can be frozen and the function of the cells is not impaired even when thawed again.
  • an activating receptor such as NKp46
  • the killing ability and cytokine secretion to the tumor cell line are increased, and thus an excellent anticancer effect can be expected. Therefore, it is possible to manufacture a cell therapy agent effective for tumor treatment using a large amount of activated natural killer cells that can be clinically applied.
  • composition for preventing or treating infectious diseases comprising natural killer cells prepared by the natural killer cell culture method as an active ingredient.
  • the composition for preventing or treating an infectious disease of the present invention may further include one or more active ingredients having the same or similar function in addition to the active ingredients.
  • the pharmaceutical composition for preventing or treating infectious diseases may be formulated into a pharmaceutical composition including one or more pharmaceutically acceptable carriers in addition to the active ingredients described above for administration.
  • the dosage of the pharmaceutical composition for the prevention or treatment of infectious diseases is the type of disease, the severity of the disease, the type and content of active ingredients and other ingredients contained in the composition, the type of formulation and the patient's age, weight, and general health status , Gender and diet, time of administration, route of administration and composition, secretion rate, duration of treatment, and drugs to be used simultaneously.
  • the dose of NK cells according to the invention 0.01x10 7 cells / kg to may be 1.0x10 9 cells / kg, be 0.5x10 7 cells / kg to 1.0x10 8 cells / kg have.
  • the administration may be administered once a day, or may be divided into multiple administrations.
  • the pharmaceutical composition for preventing or treating the infectious disease may be administered to an individual by various methods known in the art.
  • the administration route may be appropriately selected by a person skilled in the art in consideration of the administration method, the volume of body fluids, viscosity, and the like.
  • Another aspect of the present invention provides a composition for culturing natural killer cells comprising transformed CD4 + T cells as an active ingredient. Since CD4 + T cells used in the present invention and genes introduced into the cells have already been described above, the description thereof is omitted to avoid excessive duplication.
  • Example 1.1 Recombinant lentivirus vector production
  • pCDH-CMV-MCS-EF1-Puro SBI, CD510B-1
  • pCDH-CMV-MCS-EF1-Neo SBI, CD514B-1
  • Genes introduced 4-1BBL TNF superfamily member 9, TNFSF9
  • mbIL-21 membrane bound IL-21
  • OX40L TNF superfamily member 4 (TNFSF4) transcript variant 1
  • mTNF- ⁇ membrane bound TNF alpha
  • 4-1BBL gene a 4-1BBL gene expression vector (Origene, RC211160) was used.
  • mbIL-21 gene SEQ ID NO: 4
  • a pcDNA3.1 vector Genscript, US
  • OX40L gene SEQ ID NO: 6
  • the mTNF- ⁇ gene (SEQ ID NO: 9) extracted RNA from peripheral blood mononuclear cells (PBMC), and then CDS was obtained by RT (Reverse transcriptase) -PCR. In order for TNF- ⁇ to be secreted, it is cut by TACE (tumor necrosis factor-alpha-converting enzyme). DNA in the TNF- ⁇ amino acid sequence turns the TACE recognition site AV (Alanine-Valine) into PV (Proline-Valine) In the phase, a point mutation was caused to maintain the state attached to the cell membrane. The point mutation is performed by replacing 226th base guanine with cytosine and 228th base adenine with guanine in the human mTNF- ⁇ gene represented by SEQ ID NO: 7. Did.
  • CDS Coding Sequence
  • Table 1 above shows the primers used in the experiment.
  • the introduced gene and lentiviral vector were treated with EcoRI and BamHI restriction enzymes. Then, it was ligated using an In-Fusion HD cloning kit (Clontech, 639649). The ligated lentiviral vector was transformed into DH5 ⁇ soluble cells and cultured. Plasmid DNA was obtained from the transformed DH5 ⁇ soluble cells using a plasmid mini-prep kit (MACHEREY-NAGEL / 740422.50). All plasmid DNAs were subjected to sequencing by an external company to confirm that the DNA sequences matched.
  • cLV-CMV-MCS-IRES-Puro puromycin
  • cLV-CMV-MCS-IRES-Neo was confirmed by a subcontractor. (neomycin), cLV-CMV-MCS-IRES-Bsd (blasticidin) was inserted with the desired introduction gene in the same manner as above.
  • 293T cell lines were inoculated into 75T flasks (Nunc, 156499) with 1.5x10 6 to 2x10 6 cells 2 days before transfection and cultured in an incubator at a temperature of 5% CO 2 and 37 ° C.
  • the medium was replaced with 6 mL OPTI-MEM (Gibco, 31985-088) and incubated for 30 minutes at 37 ° C under 5% CO 2 conditions.
  • a DNA mixture and a lipofectamine (lipofectamine 2000, Life technologies, 11668500) mixture were prepared (Table 2).
  • Table 2 shows the DNA mixture and lipofectamine (lipofectamine 2000, Life technologies, 11668500) mixture.
  • the components of each mixture were well mixed using a vortexer and left at room temperature for 3 minutes. Thereafter, the two mixtures were mixed and left at room temperature for 20 minutes or more.
  • 2 ml of the solution in which DNA and lipofectamine were mixed were treated with 293T cells cultured in 6 ml OPTI-MEM medium. After 4 hours, the medium was replaced with DMEM (Gibco, 11995073) medium to which 10% (v / v) FBS was added, and incubated with 5% CO 2 at 37 ° C. for 48 hours.
  • DMEM Gibco, 11995073
  • 0.5x10 6 in culture Cell line and 1 ml OPTI-MEM medium, 50 ⁇ l lentiviral thaw solution, 10 ⁇ g / ml polybrene (polybrene, Santa Cruz, C2013) were mixed and placed in a 6-well plate (6-well plate, Nunc, 140675) and 1800 Spinoculation was performed for 90 minutes at a temperature of ⁇ g and 32 ° C. Then, after incubating in an incubator at a temperature condition of 5% CO 2 and 37 ° C. for 2 hours, it was replaced with an existing culture medium and cultured for 48 hours.
  • the Hut78 cell line (ATCC, TIB-161 TM) was cultured in IMDM (ATCC, 30-2005) medium containing 20% (v / v) FBS. When subcultured cell concentration was kept at 1.5x10 5 cells / ml to 2.0x10 5 cells / ml.
  • H9 cell line (ATCC, HTB-176 TM) and Jurkat cell line (ATCC, TIB-152 TM) were cultured in RPMI1640 (ATCC, 30-2001) medium containing 10% (v / v) FBS.
  • Table 3 shows antibiotics used in the cell line into which the gene has been introduced.
  • Example 2.1 To confirm the expression of the introduced gene through flow cytometry, the cell lines passaged in Example 2.1. Were collected and centrifuged at 1,200 rpm for 5 minutes. Then, the culture solution was removed by suction. FACS buffer was prepared by adding 2% (v / v) FBS to PBS. Cell number was measured by diluting with 1 ml of FACS buffer and diluted with FACS buffer to a concentration of 5x10 6 cells / ml. 100 ⁇ l of the diluted cell solution was added to a 5 ml FACS tube (Falcon, 352052).
  • Anti-human TNF-a (membrane) -PE R & D systems, FAB210P
  • anti-human OX40L-PE BD, 558184
  • anti-human 4-1BBL-PE BD, 559446
  • anti-human IL-21 -PE eBioscience, 12-7219-42
  • 7-AAD Beckman coulter, IM3630c
  • PE mouse IgG1 ⁇ isotype control BD Pharmingen, 555749
  • PerCP-Cy5.5 mouse IgG1 ⁇ isotype control BD, 550795)
  • RT-qPCR Real time qPCR
  • the cell lines passaged in Example 2.1 Were collected and centrifuged at 1,200 rpm for 5 minutes. Then, the culture solution was removed by suction. Cell number was measured by dilution with PBS, and 1x10 6 cells were separated and quantified using an RNA prep kit.
  • cDNA was synthesized using the cDNA synthesis kit.
  • RT-qPCR was performed using the synthesized cDNA. Primers used for RT-qPCR are shown in Table 4 below.
  • Table 4 above shows the primers used in the RT-qPCR experiment.
  • the expression level of the gene introduced into the cell line is shown in Table 5 below.
  • the research cord blood was placed in a 50 ml tube and centrifuged for 10 minutes at 1,500 rpm.
  • the upper plasma was removed and PBS (phosphate buffered saline, LONZA, 17-516Q) was added in a 1: 1 ratio.
  • PBS phosphate buffered saline
  • the umbilical cord blood mononuclear cells were separated through a ficoll density gradient centrifugation method (Ficoll-Paque Plus, GE Healthcare, 17-1440-03), followed by an ADAM cell counter system. (ADAM cell counter system, Nano Entec) was used to measure the number of cells.
  • Cells were separated by mounting a CS column (column, Miltenyi Biotech, 130-041-305) to VarioMACS (Miltenyi Biotech). The cells were recovered by washing the column until the final 20 ml. The collected cells were placed in a new 50 ml tube, centrifuged for 5 minutes at 1,200 rpm and 4 ° C, and suspended in a frozen medium. The number of cells was measured using an ADAM cell counter system to freeze 5x10 6 cells per vial in liquid nitrogen.
  • CD3 (-) umbilical cord blood mononuclear cells 1 was thawed in a 37 ° C water bath and transferred to a 50 ml tube, 0.6% (v / v) ACD (Citrate-dextrose solution, Sigma-Aldrich, C3821) ), 0.2% (v / v) suspended in PBS containing FBS (Fetal serum bovine) and 2 mM EDTA, and centrifuged at 1,500 rpm and 4 ° C for 10 minutes.
  • CD3 (-) cord blood mononuclear cells were suspended in CellGro medium (Cellgenix, 20802-0500), and the cell number was measured using an ADAM cell counter system.
  • CD3 (-) cord blood mononuclear cells were suspended in CellGro medium to a concentration of 1x10 6 cells / ml.
  • Example 3.2 Co-culture of CD3 (-) cord blood mononuclear cells and transgenic T cells
  • the transgenic T cells prepared in Example 2 were recovered from the culture flask and centrifuged at 1,200 rpm and 4 ° C for 5 minutes. Thereafter, it was suspended in CellGro medium and the cell number was measured using an ADAM cell counter system. The transgenic T cells were suspended in CellGro medium at a concentration of 2.5x10 6 cells / ml, and then irradiated with 20,000 cGy in a gamma-ray irradiator to prepare them.
  • IL-2 Proleukin, Novartis Korea
  • OKT-3 eBioscience, 16-0037-85
  • CD3 (-) umbilical cord blood mononuclear cells and transgenic T cells were added at a ratio of 1: 2.5 at 0.25 ml each, and 0.25 ml of CellGro medium containing 2% (v / v) human plasma was added, followed by an incubator at a temperature of 37 ° C. Incubation was continued for 4 days.
  • CellGro medium containing 1% (v / v) human plasma and 1,000 IU / mL of IL-2 was added in the same amount, followed by static culture. Thereafter, the cell number was measured at intervals of 2 to 3 days to add 1% (v / v) human plasma, and CellGro medium containing 1,000 IU / mL of IL-2 to a concentration of 1x10 6 cells / mL. It was suspended and cultured. Suspended culture was performed until day 21 to obtain proliferated natural killer cells. At this time, when the Jurkat cell line or Peer cell line was used as a support cell, the cells were suspended and cultured until 11 days. When the gene was introduced into the H9 and Hut78 cell lines and used as support cells, the cells were suspended and cultured until 21 days.
  • CD3 (-) cells isolated from umbilical cord blood mononuclear cells are cultured for 21 days with support cells into which genes have been introduced, and that natural killer cells can be cultured, and have higher proliferation rates than non-gene-supported support cells.
  • Example 3.3 Re-stimulation of natural killer cell culture using HuT78 cells introduced with mTNF- ⁇ / mbIL-21 / 4-1BBL gene
  • the transgenic T cells prepared in Example 2 were recovered from the culture flask and centrifuged at 1,200 rpm and 4 ° C for 5 minutes. Thereafter, it was suspended in CellGro medium and the cell number was measured using an ADAM cell counter system. The transgenic T cells were suspended in CellGro medium at a concentration of 2.5x10 6 cells / ml, and then irradiated with 20,000 cGy in a gamma-ray irradiator to prepare them.
  • CellGro medium containing 1% (v / v) human plasma and 1,000 IU / mL of IL-2 was added in the same amount, followed by static culture. Subsequently, the cell number was measured at intervals of 2 to 3 days, and cultured by adding CellGro medium containing 1% (v / v) human plasma and 1,000 IU / mL of IL-2 to a concentration of 1x10 6 cells / mL.
  • HuT78 cells into which mTNF- ⁇ / mbIL-21 / 4-1BBL gene was introduced on day 0 of culture were used at the same rate. On the 16th day of culture, the first re-stimulation was given. First, the number of natural killer cells in culture was measured using an ADAM cell counter system, diluted with CellGro medium to be 1.5x10 6 cells / ml, and 0.25 ml was prepared in a culture plastic plate.
  • HuT78 cells into which mTNF- ⁇ / mbIL-21 / 4-1BBL gene was introduced were suspended in CellGro medium to be 2.5x10 6 cells / ml, and then irradiated with 10,000 cGy in a gamma-ray irradiator to prepare.
  • HuT78 cells into which the inactivated mTNF- ⁇ / mbIL-21 / 4-1BBL gene was introduced were placed in a culture plate of 0.25 ml. 1000 IU / mL of IL-2 and 10 ng / mL of OKT-3, 1% (v / v) human plasma were placed in a culture plastic plate and cultured for 3 days in an incubator at a temperature of 37 ° C. Thereafter, the cell number was measured at intervals of 2 to 3 days, and cultured by adding CellGro medium containing 1% (v / v) human plasma and 1000 IU / mL IL-2 to 1x10 6 cells / mL. After the first re-stimulation, re-stimulation through support cells was performed on the 32nd, 46th, and 60th days of culture in the same manner every 14 days, and the culture was continued until 70th.
  • the proliferation rate of natural killer cells on the 32nd day after the first restimulation was 6.9x10 4 times
  • the second restimulation was 3.7x10 6 times
  • the culture was 2.3x10 8 times, the fourth time.
  • continuous proliferation was maintained at 5.9x10 9 fold on the 70th day of culture to show a high proliferation rate (Table 10, FIG. 2e).
  • an ADAM cell counter system one of the cell counters using a PI staining solution capable of binding to the intracellular nucleus, was used. After subtracting the number of dead cells from the measured total cell number, the number of viable cells was calculated, and then cell viability was calculated using Equation I below.
  • the survival rate of natural killer cells cultured in the cell line introduced with the mbIL-21 / 4-1BBL gene and the cell line introduced with the mTNF- ⁇ / mbIL-21 / 4-1BBL gene is 21. Survival rate of 90% or more was observed in day culture (H9) and 11 day culture (Jurkat, Peer) (Table 12 to Table 14, FIGS. 3B to 3D).
  • Natural killer cells cultured on the 21st or natural killer cells cultured by repeated re-stimulation were collected, centrifuged at 1,200 rpm for 5 minutes, and the culture solution was aspirated and removed. Cell number was measured by diluting with 1 mL of FACS buffer, and diluted with FACS buffer to 5x10 6 cells / mL. 100 ⁇ l of the diluted cell solution was added to a 5 ml FACS tube (Falcon, 352052), and the phenotype was analyzed with the following antibody:
  • Tube 1 anti-human CD3-FITC (BD Pharmingen, 555332), anti-human CD16-PE (BD Pharmingen, 555407), anti-human CD56-BV421 (BD Pharmingen, 562751)
  • Tube 2 anti-human CD14-FITC (BD Pharmingen, 555397), anti-human CD19-PE (BD Pharmingen, 555413), anti-human CD3-BV421 (BD Pharmingen, 562438)
  • Tube 3 anti-human CD3-FITC, anti-human NKG2D-PE (R & D system, FAB139P), anti-human CD56-BV421
  • Tube 4 anti-human CD3-FITC, anti-human NKp30-PE (BD Pharmingen, 558407), anti-human CD56-BV421
  • Tube 5 anti-human CD3-FITC, anti-human NKp44-PE (BD Pharmingen, 558563), anti-human CD56-BV421
  • Tube 6 anti-human CD3-FITC, anti-human NKp46-PE (BD Pharmingen, 557991), anti-human CD56-BV421
  • Tube 7 anti-human CD3-FITC, anti-human DNAM-1-PE (BD Pharmingen, 559789), anti-human CD56-BV421
  • Tube 8 anti-human CD3-FITC, anti-human CXCR3-PE (BD Pharmingen, 557185), anti-human CD56-BV421
  • Tube 9 anti-human CD3-FITC, PE mouse IgG1 ⁇ isotype control (BD Pharmingen, 555749), anti-human CD56-BV421
  • Tube 10 FITC mouse IgG1 ⁇ isotype control (BD Pharmingen, 555748), PE mouse IgG1 ⁇ isotype control, BV421 mouse IgG1 ⁇ isotype control (BD Pharmingen, 562438)
  • the anti-human CD56 in the tube 1 was performed by selecting one of three fluorescences, and accordingly, the fluorescence of the CD3 of tube 2, the CD56 of tubes 3 to 9, and the isotype control of tube 10 was performed. I chose the same thing.
  • the tubes were dyed at refrigeration temperature for 30 minutes. Thereafter, 2 ml FACS buffer was added to the stained cells, and centrifugation was performed at 1,500 rpm for 3 minutes. The supernatant was removed, 2 ml of FACS buffer was added again, and centrifugation was performed at 2,000 rpm for 3 minutes. After removing the supernatant again, 200 ⁇ l cytofix buffer (fixation buffer, BD, 554655) was added and suspended, and the cell was identified and purified using FACS LSRII Fortessa (BD Biosciences) and various phenotypes.
  • FACS LSRII Fortessa BD Biosciences
  • mTNF- ⁇ / mbIL-21 / 4-1BBL is a cell line in which three genes are introduced, and natural killer cells cultured by increasing the number of re-stimulation have a high content of natural killer cells (CD3-CD56 +) of 90% or more until 60 days of culture. It was confirmed (Table 20, Figure 4e)
  • CD16 When co-cultured with the HuT78 cell line, CD16 was highly expressed, and the dual marker transduction support cells were compared to the conditions in which the active markers NKG2D, NKp30, NKp44, NKp46, and DNAM-1 did not introduce genes or single transduction support cell conditions. In the conditions, all were highly expressed without variation between donors (FIGS. 5A to 5G).
  • mTNF- ⁇ / mbIL-21 / 4-1BBL was confirmed by co-culturing the natural killer cell phenotype by re-stimulation using Hut78 cell line in which three genes were introduced.
  • the expression of active markers such as NKG2D, NKp44, NKp46, DNAM-1, and CXCR3 tended to decrease. Through this, it was confirmed that as the number of times of re-stimulation increased, the expression period of some active markers could be influenced as the incubation period became longer (FIGS. 7A and 7B).
  • the tumor cell line was washed with 10 ml to 15 ml of RPMI1640 medium containing 10% (v / v) FBS, centrifuged, and the pellet was added to 10 ml of 10% (v / v) FBS. It was suspended in the added RPMI1640 medium to make a concentration of 1x10 5 cells / ml.
  • Natural killer cells were centrifuged by placing 1x10 6 cells in a 15 ml tube, and the pellet was suspended in RPMI1640 medium to which 10% (v / v) FBS was added at a desired ratio (1: 1) compared to the K562 cancer cell line.
  • the prepared K562 cancer cell line and natural killer cell line were mixed and dispensed in 100 ⁇ l in a round-bottom 96-well U-bottom plate (Nunc, 163320), and each well was prepared in triplicates to obtain an average value.
  • the plate After blocking the light to react for 4 hours in an incubator at a temperature of 37 ° C., the plate was centrifuged at 2,000 rpm for 3 minutes. The supernatant was dispensed at 100 ⁇ l in a 96-well black plate (96 well black plate, Nunc, 237108). The fluorescence value (OD 480/535 nm) was measured using a fluorescence plate reader (Perkin Elmer, VICTOR X3), and the tumor cell killing capacity of natural killer cells was calculated using Equation II below.
  • % of killing (Sample well average fluorescence value-Spon well average fluorescence value) / ⁇ (Max well average fluorescence value + A)-Spon well average fluorescence value ⁇ x 100
  • Direct killing ability was measured by reacting natural killer cells cultured with various support cells with the K562 cancer cell line.
  • the cell killing ability of natural killer cells cultured under the condition of introducing the mbIL-21 / 4-1BBL gene and mTNF- ⁇ / mbIL-21 / 4-1BBL gene was higher than that of the condition in which no gene was introduced for all support cells. Increased (FIGS. 8A to 8D).
  • the cell killing ability of natural killer cells according to the number of re-stimulation of HuT78 cell line into which mTNF- ⁇ / mbIL-21 / 4-1BBL gene was introduced showed high killing ability up to 60 days in culture without significant difference (FIG. 8E).
  • Example 4.1 Culture of natural killer cells using transgenic T support cells
  • the transgenic T support cells were re-stimulated at a ratio of 1: 2.5 and cultured in CellGro medium containing 1 V / V% human plasma and OKT3, IL-2. Thereafter, the cell number was measured at intervals of 2-3 days to add 1 V / V% human plasma and CellGro medium containing 1000 IU / mL of IL-2 to 1 x 10 6 cells / mL, and further cultured for 14 days. The cells were cultured for a total of 28 days.
  • the culture of natural killer cells derived from peripheral blood was as follows: On the 4th day of culture, the same amount of CellGro medium containing 1 V / V% human plasma and 500 IU / mL of IL-2 was added, followed by static culture. Thereafter, cell counts were measured at intervals of 2 to 3 days to add 1 V / V% human plasma and 500 IU / mL of IL-2 CellGro medium to 1 x 10 6 cells / mL, and cultured until 11 days. . On day 11 of culture, the transgenic T support cells were re-stimulated at a ratio of 1: 2.5 and cultured in CellGro medium containing 1 V / V% human plasma and OKT3, IL-2.
  • the cell number was measured at intervals of 2 to 3 days to add 1 V / V% human plasma and 1000 IU / mL of IL-2 CellGro medium to 1 x 10 6 cells / mL.
  • the cells were further cultured to culture the cells for a total of 19 to 21 days.
  • the cultured cells are suspended in a freezing medium to be 1 x 10 6 cells / mL, frozen using a temperature-controlled cell freezer and stored in liquid nitrogen.
  • the Raji-luci cell line was collected on the last day of culture, and the cell concentration was adjusted to 5 x 10 5 cells / mL using PBS, and then injected into the tail vein at a rate of 0.2 mL (1 x 10 5 cells / mouse) per mouse.
  • Natural killer cells were injected into the tail vein at 2 x 10 7 cells / 200 ⁇ L, and rituxan (hereinafter RTX, Mab Terraju, Roche, Korea) was diluted with PBS to a concentration of 0.01 ⁇ g / 100 ⁇ L to weaken the area between the mouse shoulder and chest wall. Injected subcutaneously 100 ⁇ L.
  • the NK cells were administered to the tail vein a total of 6 times using the immobilizer the next day after cancer cell transplantation, and RTX was administered subcutaneously once (Table 22, FIG. 9A).
  • Ramos cell line was collected cancer cells on the last day of culture, the cell concentration was adjusted to 5 x 10 6 cells / mL using PBS, and 0.2 mL (1 x 10 6 cells / mouse) per mouse was injected into the tail vein.
  • Natural killer cells were injected into the tail vein at 2 x 10 7 cells / 200 ⁇ L, and RTX was diluted with PBS to a concentration of 0.3 ⁇ g / 100 ⁇ L and injected 100 ⁇ L subcutaneously at the weakened area between the mouse shoulder and chest wall. Natural killer cells were administered to the tail vein a total of 6 times from the fourth day of cancer cell transplantation, and RTX was administered to the ring vein 6 times from the third day of cancer cell transplantation (Table 24, FIG. 10A).

Abstract

본 발명은 형질전환된 T세포를 이용한 제대혈 유래 자연살해세포의 배양방법에 관한 것이다. 본 발명의 형질전환된 T세포를 이용한 자연살해세포의 배양방법은 소량의 원료세포로부터 자연살해세포를 효과적으로 증식시켜 제조할 수 있다. 또한, 자연살해세포의 세포살해능도 향상시킨다. 따라서, 본 발명의 형질전환된 T세포를 이용한 자연살해세포의 배양방법은 세포치료제 상용화에 유용하게 사용될 수 있다. 나아가, 본 발명의 배양방법으로 제조된 자연살해세포는 세포치료제로서 유용하게 사용될 수 있다.

Description

형질전환된 T세포를 이용한 제대혈 유래 자연살해세포의 배양방법
본 발명은 형질전환된 T세포를 이용한 제대혈 유래 자연살해세포의 배양방법에 관한 것이다.
암환자들의 치료 및 재발 방지를 위한 치료법으로 환자의 면역기능을 이용한 면역치료법이 개발되고 있다. 특히, 대량 생산 및 동결이 가능한 자연살해세포를 이용한 면역치료법이 연구되고 있다. 자연살해세포는 말초혈 림프구(peripheral blood lymphocyte)의 약 15% 정도를 차지하는 림프구계 세포로서, 선천성 면역반응에 중요한 역할을 한다.
구체적으로, 자연살해세포는 수지상세포를 활성화시키고 세포독성 T 임파구(cytotoxic T lymphocyte, CTL)를 종양에 특이적으로 반응하도록 유도하여 종양세포를 제거한다. 자연살해세포는 육종(sarcoma), 골수종(myeloma), 암종(carcinoma), 림프종(lymphomas) 및 백혈병(leukemia)과 같은 악성 종양을 직접적으로 사멸시킨다. 하지만, 정상인의 체내에 존재하는 대부분의 자연살해세포는 비활성화 상태로 존재하며, 종양을 제거하기 위해서는 활성화된 자연살해세포가 필요하다. 또한, 암환자의 체내에 존재하는 자연살해세포의 경우 암세포의 면역회피 기전에 의해 자연살해세포의 기능적 결함이 존재한다.
따라서, 자연살해세포를 치료제로서 이용하기 위해서는 자연살해세포를 활성화 시키는 것이 매우 중요하다. 또한, 체내에 존재하는 자연살해세포의 세포수는 한정되어 있으므로, 정상인의 혈액 또는 환자의 혈액의 자연살해세포를 대량으로 증식시키고 동결하는 기술의 개발이 필수적이다.
자연살해세포를 대량으로 증식시키기 위한 방법으로는 체외 확장 방법을 이용하고 있으며, 말초혈 림프구(peripheral blood lymphocyte, PBMC), 제대혈(cord blood, CB) 또는 사람유도 만능줄기세포(human-induced pluripotent stem cell)를 원료로 이용한 자연살해세포의 대량 배양방법에 대해 연구되고 있다.
특히, 제대혈은 골수와는 달리 분만과정에서 버려지는 제대혈로부터 간단한 시술을 통해 얻을 수 있다. 또한, 제대혈의 보관산업이 활성화되어 있고, 공여자를 구하는 것도 용이하여 제대혈을 이용한 자연살해세포의 배양방법에 대한 연구가 활발히 연구되고 있다.
구체적으로, 제대혈 유래 자연살해세포의 체외 확장 배양방법은 단핵세포(MNC)를 원료세포로 사용하여 증식하는 방법 및 조혈전구세포(hematopoietic progenitor cell, CD34+ 세포)를 원료세포로 하여 증식하는 방법이 있다. 단핵세포를 원료세포로 사용하는 방식은 인터루킨-2(IL-2), 인터루킨-15(IL-15), FLT-3L 등을 단독 혹은 혼합 사용하여 자연살해세포를 증식을 돕지만, 증식률 및 순도가 낮은 문제가 있다(Biossel L. et al., Biology of Blood and Marrow Transplantation, 14, 1031-1038, 2008). 또한, 조혈전구세포를 원료로 사용하는 방식은 증식률이 좋고 순도가 높지만, 배양기간이 길고 다양한 사이토카인과 성장인자를 혼합하여 사용해야 하므로 비용 측면에서 상업화에 어려움이 있다(Fias A.M. et al., Experimental Hematology 36(1):61-68, 2008).
자연살해세포의 체외 확장 배양에는 PBMC, CD3- 세포, CD3-CD56+ 세포, CD56+ 세포 등이 원료세포로 사용되며, 자연살해세포 증식 인자로 IL-2, IL-12, IL-15, IL-21 등의 사이토카인들과 LPS(Goodier et al., J. Immunol. 165(1):139-147, 2000), CD3을 자극하는 OKT-3 항체(Condiotti et al., Experimental Hematol. 29(1):104-113, 2001)를 이용하고 있다. 상기 언급된 증식인자만으로 자연살해세포를 3배 내지 10배 정도 증식시킬 수 있다. 하지만, 상기 증식율 정도로는 자연살해세포를 치료제로 상업화시키기 어렵다.
최근 여러가지 형태의 지지세포(feeder cell)를 이용하여 자연살해세포를 대량 증식시키는 방법에 대해 연구되고 있다. 지지세포로 이용되고 있는 세포주로는 말초혈 단핵구, EBV-LCL, K562 세포주가 대표적이다. K562 세포주는 HLA가 결여된 혈액암 유래 세포주로 자연살해세포가 쉽게 공격할 수 있는 대표적인 타겟 세포주이다. 자연살해세포를 배양하는 대부분의 지지세포는 K562 세포주에 4-1BBL과 막 고정된(membrane-bound) IL-15를 발현시켜 증식시키는 방법(Fujisaki et al., Cancer Res. 69(9):4010-4017, 2009), MICA, 4-1BBL, 및 IL-15를 발현시켜 증식시키는 방법(Gong et al., Tissue Antigens, 76(6):467-475, 2010), 및 4-1BBL과 막에 고정된 IL-21을 발현시켜 증식시키는 방법(Cecele JD et al, PloSONE, 7(1):e30264, 2012) 등이 알려져 있다.
이에, 본 발명자들은 제대혈로부터 자연살해세포를 효율적으로 증식시키기 위해, 자연살해세포의 증식을 높일 수 있는 보조자극인자 및 성장인자를 발현시킨 CD4+ T세포와 제대혈 유래 자연살해세포를 공동배양하여 체외 증식시키는 방법을 개발하였다.
구체적으로, 본 발명자들은 상기 CD4(+) T세포를 지지세포로 이용한 자연살해세포 배양방법의 효율을 증가시키기 위해, 형질전환된 CD4(+) T세포를 제작하였다. 상기 형질전환된 CD4(+) T세포와 제대혈 유래 단핵구 세포와 공동배양 하였고, 이러한 공동배양을 통해 자연살해세포의 증식율 및 세포살해능이 증가됨을 확인함으로써 본 발명을 완성하였다.
본 발명의 일 측면은, 형질전환된 CD4+ T세포와 원료세포를 공동배양하는 단계를 포함하는 자연살해세포 배양방법을 제공한다.
본 발명의 다른 측면은, 상기 배양방법에 의해 제조된 자연살해세포를 제공한다.
본 발명의 형질전환된 T세포를 이용한 자연살해세포의 배양방법은 소량의 제대혈 유래의 원료세포로부터 자연살해세포를 효과적으로 증식시켜 제조할 수 있다. 또한, 이와 같이 제조된 자연살해세포는 세포살해능도 향상되었다. 따라서, 본 발명의 형질전환된 T세포를 이용한 자연살해세포의 배양방법은 세포치료제 상용화에 유용하게 사용될 수 있다. 나아가, 본 발명의 배양방법으로 제조된 자연살해세포는 세포치료제로서 유용하게 사용될 수 있다.
도 1a는 Hut78 세포주에 유전자의 발현 여부를 FACS를 통해 확인한 도면이다.
도 1b는 Hut78 세포주에 도입한 단일 유전자의 발현 여부를 FACS를 통해 확인한 도면이다.
도 1c는 Hut78 세포주에 도입한 mTNF-α/OX40L 및 mTNF-α/4-1BBL 이중 유전자의 발현 여부를 FACS를 통해 확인한 도면이다.
도 1d는 Hut78 세포주에 도입한 mbIL-21/OX40L 및 mbIL-21/4-1BBL 이중 유전자의 발현 여부를 FACS를 통해 확인한 도면이다.
도 1e는 Hut78 세포주에 도입한 삼중 유전자의 발현 여부를 FACS를 통해 확인한 도면이다.
도 1f는 Hut78 세포주에 도입한 사중 유전자의 발현 여부를 FACS를 통해 확인한 도면이다.
도 2a는 유전자가 도입된 Hut78 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 증식률을 도입 유전자별로 나타낸 도면이다.
도 2b는 유전자가 도입된 H9 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 증식률을 도입 유전자별로 나타낸 도면이다.
도 2c는 유전자가 도입된 Jurkat 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 증식률을 도입 유전자별로 나타낸 도면이다.
도 2d는 유전자가 도입된 Peer 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 증식률을 도입 유전자별로 나타낸 도면이다.
도 2e는 삼중 유전자가 도입된 Hut78 세포주와 제대혈 유래 CD3(-) 단핵구 세포를 공동배양할 때, 14일 혹은 16일 간격으로 재자극하여 제조한 자연살해세포의 증식률을 나타낸 도면이다.
도 3a는 유전자가 도입된 Hut78 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 생존률을 도입 유전자별로 나타낸 도면이다.
도 3b는 유전자가 도입된 H9 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 생존률을 도입 유전자별로 나타낸 도면이다.
도 3c는 유전자가 도입된 Jurkat 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 생존률을 도입 유전자별로 나타낸 도면이다.
도 3d는 유전자가 도입된 Peer 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 생존률을 도입 유전자별로 나타낸 도면이다.
도 3e는 삼중 유전자가 도입된 Hut78 세포주와 제대혈 유래 CD3(-) 단핵구 세포를 공동배양할 때, 14일 혹은 16일 간격으로 재자극하여 제조한 자연살해세포의 생존률을 나타낸 도면이다.
도 4a는 유전자가 도입된 Hut78 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 순도(CD3-CD56+)를 도입 유전자별로 나타낸 도면이다.
도 4b는 유전자가 도입된 H9 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 순도(CD3-CD56+)를 도입 유전자별로 나타낸 도면이다.
도 4c는 유전자가 도입된 Jurkat 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 순도(CD3-CD56+)를 도입 유전자별로 나타낸 도면이다.
도 4d는 유전자가 도입된 Peer 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 순도(CD3-CD56+)를 도입 유전자별로 나타낸 도면이다.
도 4e는 삼중 유전자가 도입된 Hut78 세포주와 제대혈 유래 CD3(-) 단핵구 세포를 공동배양할 때, 14일 혹은 16일 간격으로 재자극하여 제조한 자연살해세포의 순도(CD3-CD56+)를 나타낸 도면이다.
도 5a는 유전자가 도입된 Hut78 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 활성(CD16+CD56+)을 도입 유전자별로 나타낸 도면이다.
도 5b는 유전자가 도입된 Hut78 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 NKG2D 표현형 마커의 발현량을 도입 유전자별로 나타낸 도면이다.
도 5c는 유전자가 도입된 Hut78 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 NKp30 표현형 마커의 발현량을 도입 유전자별로 나타낸 도면이다.
도 5d는 유전자가 도입된 Hut78 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 NKp44 표현형 마커의 발현량을 도입 유전자별로 나타낸 도면이다.
도 5e는 유전자가 도입된 Hut78 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 NKp46 표현형 마커의 발현량을 도입 유전자별로 나타낸 도면이다.
도 5f는 유전자가 도입된 Hut78 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 DNAM-1 표현형 마커의 발현량을 도입 유전자별로 나타낸 도면이다.
도 5g는 유전자가 도입된 Hut78 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 CXCR3 표현형 마커의 발현량을 도입 유전자별로 나타낸 도면이다.
도 6a는 유전자가 도입된 H9 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 활성(CD16+CD56+)을 도입 유전자별로 나타낸 도면이다.
도 6b는 유전자가 도입된 H9 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 NKG2D 표현형 마커의 발현량을 도입 유전자별로 나타낸 도면이다.
도 6c는 유전자가 도입된 H9 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 NKp30 표현형 마커의 발현량을 도입 유전자별로 나타낸 도면이다.
도 6d는 유전자가 도입된 H9 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 NKp44 표현형 마커의 발현량을 도입 유전자별로 나타낸 도면이다.
도 6e는 유전자가 도입된 H9 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 NKp46 표현형 마커의 발현량을 도입 유전자별로 나타낸 도면이다.
도 6f는 유전자가 도입된 H9 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 DNAM-1 표현형 마커의 발현량을 도입 유전자별로 나타낸 도면이다.
도 6g는 유전자가 도입된 H9 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 CXCR3 표현형 마커의 발현량을 도입 유전자별로 나타낸 도면이다.
도 7a는 삼중 유전자가 도입된 Hut78 세포주와 제대혈 유래 CD3(-) 단핵구 세포를 공동배양할 때, 14일 혹은 16일 간격으로 재자극하여 제조한 자연살해세포의 활성(CD16+CD56+) 및 NKG2D 표현형 마커의 발현량을 나타낸 도면이다.
도 7b는 삼중 유전자가 도입된 Hut78 세포주와 제대혈 유래 CD3(-) 단핵구 세포를 공동배양할 때, 14일 혹은 16일 간격으로 재자극하여 제조한 자연살해세포의 NKp30, NKp44, NKp46, DNAM-1, CXCR3 표현형 마커의 발현량을 나타낸 도면이다.
도 8a는 유전자가 도입된 Hut78 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 종양세포 살해능을 도입 유전자별로 나타낸 도면이다.
도 8b는 유전자가 도입된 H9 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 종양세포 살해능을 도입 유전자별로 나타낸 도면이다.
도 8c는 유전자가 도입된 Jurkat 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 종양세포 살해능을 도입 유전자별로 나타낸 도면이다.
도 8d는 유전자가 도입된 Peer 세포주와 제대혈 유래 CD3(-) 단핵세포를 공동배양하여 제조한 자연살해세포의 종양세포 살해능을 도입 유전자별로 나타낸 도면이다.
도 8e는 삼중 유전자가 도입된 Hut78 세포주와 제대혈 유래 CD3(-) 단핵구 세포를 공동배양할 때, 14일 혹은 16일 간격으로 재자극하여 제조한 자연살해세포의 종양세포 살해능을 나타낸 도면이다.
도 9a는 Raji 마우스 동물모델을 이용한 효능 평가를 위한 투여 일정을 나타낸 도면이다.
도 9b는 Raji 동물모델에서 NK 세포, RTX 및 병용 투여의 효능을 확인하기 위해 생존율을 측정한 결과를 보여주는 도면이다.
도 10a는 Ramos 마우스 동물모델을 이용한 효능 평가를 위한 투여 일정을 나타낸 도면이다.
도 10b는 Ramos 동물모델에서 NK 세포, RTX 및 병용 투여의 효능을 확인하기 위해 생존율을 측정한 결과를 보여주는 도면이다.
이하 본 발명을 상세히 설명한다.
본 발명의 일 측면은, 형질전환된 CD4+ T세포와 원료세포를 공동배양하는 단계를 포함하는 자연살해세포 배양방법을 제공한다.
상기 형질전환된 CD4+ T세포는 4-1BBL 유전자, mbIL-21 유전자, OX40L 유전자 및 mTNF-α 유전자로 구성된 군으로부터 선택되는 적어도 하나의 유전자가 발현되는 것일 수 있다.
구체적으로, 상기 형질전환된 CD4+ T세포에 하나의 유전자가 도입된 경우, 상기 유전자는 4-1BBL, mbIL-21, OX40L 또는 mTNF-α일 수 있다. 또한, 상기 형질전환된 CD4+ T세포에 두 개의 유전자가 도입된 경우, 상기 유전자 조합은 mbIL-21/4-1BBL, 4-1BBL/OX40L, mTNF-α/4-1BBL, mbIL-21/OX40L, mbIL-21/mTNF-α 또는 mTNF-α/OX40L일 수 있다. 본 발명의 일 실시예에서는 mbIL-21/4-1BBL, mTNF-α/OX40L, mTNF-α/4-1BBL 및 mbIL-21/OX40L 조합의 유전자를 T세포에 도입하였다.
또한, 상기 형질전환된 CD4+ T세포에 세 개의 유전자가 도입된 경우, 상기 유전자 조합은 4-1BBL/mbIL-21/OX40L, mbIL-21/OX40L/mTNF-α, mTNF-α/ mbIL-21 /4-1BBL 또는 4-1BBL/OX40L/mTNF-α일 수 있다. 본 발명의 일 실시예에서는, mTNF-α/ mbIL-21 /4-1BBL 조합의 유전자를 T세포에 도입하였다.
또한, 상기 형질전환된 CD4+ T세포에 네 개의 유전자가 도입된 경우, 상기 유전자 조합은 mTNF-α/mbIL-21/OX40L/4-1BBL 일 수 있다. 본 발명의 일실시예에서는 mTNF-α/mbIL-21/OX40L/4-1BBL 조합의 유전자를 T세포에 도입하였다.
본 발명에서 사용하는 용어 '4-1BBL'이란, CD137L로 불리는 TNFSF(TNF superfamily) 중 하나로, 삼중합체(trimer)를 형성하여 수용체인 4-1BB와 결합하는 리간드를 의미한다. 상기 4-1BBL 유전자는 인간으로부터 유래된 것일 수 있다.
구체적으로, 상기 4-1BBL 유전자는 NCBI Reference Sequence: NM_003811일 수 있으나, 이에 제한하는 것은 아니다. 상기 4-1BBL 유전자는 서열번호 1로 표시되는 아미노산 서열을 코딩하는 염기서열일 수 있다. 상기 서열번호 1로 표시되는 아미노산 서열을 코딩하는 염기서열은 서열번호 2로 표시되는 염기서열일 수 있다.
본 발명에서 사용하는 용어 'mbIL-21'은 세포막에 결합될 수 있도록 고안된 IL-21일 수 있다. 이때, mbIL-21은 IL-21과 막통과단백질이 결합된 융합 단백질일 수 있다. 상기 막통과단백질은 CD8α일 수 있다. 구체적으로는, CD8α의 트랜스멤브레인 도메인(transmembrane domain)일 수 있다.
구체적으로, 상기 IL-21 유전자는 NCBI Reference Sequence: NM_021803.3일 수 있으나, 이에 제한하는 것은 아니다. 또한, 상기 CD8α 유전자는 NCBI Reference Sequence: NM_001768일 수 있으나, 이에 제한하는 것은 아니다. 상기 mbIL-21은 세포막에 결합된 IL-21 형태로 발현한다. 또한, 상기 mbIL-21 유전자는 서열번호 3으로 표시되는 아미노산 서열을 코딩하는 염기서열일 수 있다. 상기 서열번호 3으로 표시되는 아미노산 서열을 코딩하는 염기서열 서열번호 4로 표시되는 염기서열일 수 있다.
본 발명에서 사용하는 용어 'OX40L'은 TNFSF4, gp34, TXGP1, CD252 및 CD134L로도 불리며, OX40에 결합하는 리간드를 의미한다. 구체적으로, 상기 OX40L 유전자는 NCBI Reference Sequence: NM_003326일 수 있으나, 이에 제한되는 것은 아니다. 상기 OX40L 유전자는 서열번호 5로 표시되는 아미노산 서열을 코딩하는 염기서열일 수 있다. 상기 서열번호 5로 표시되는 아미노산 서열을 코딩하는 염기서열은 서열번호 6로 표시되는 염기서열일 수 있다.
본 발명에서 사용하는 용어 'mTNF-α'는 종양 괴사 인자-알파(tumor necrosis factor-alpha)의 아미노산 서열에서 TACE(tumor necrosis factor-alpha-converting enzyme) 인식부위인 알라닌-발린(Alanine-Valine)을 프롤린-발린(Proline-Valine)이 되도록 DNA 상에서 점 돌연변이(point mutation) 시킨 유전자를 의미한다. 알라닌을 프롤린으로 돌연변이시킨 것은 랜덤하게 선택한 것이다.
구체적으로, 상기 mTNF-α 유전자는 서열번호 8로 표시되는 아미노산 서열을 코딩하는 염기서열일 수 있다. 상기 서열번호 8로 표시되는 아미노산 서열을 코딩하는 염기서열은 서열번호 9로 표시되는 염기서열일 수 있다.
상기 4-1BBL 유전자, mbIL-21 유전자, OX40L 유전자 또는 mTNF-α 유전자는 재조합 렌티 바이러스를 통해 도입될 수 있지만, 이에 한정되는 것은 아니다.
상기 유전자를 세포 내로 형질도입 시키는 방법은 생화학적 방법, 물리적 방법 또는 바이러스를 매개로 하는 형질도입 방법이 사용될 수 있다. 또한, 생화학적 방법으로 FuGene6(Roche, USA), 리포펙타민(LipofectamineTM 2000, Invitrogen, USA) 또는 ExGen 500(MBI Fermentas International Inc. CANADA)를 이용할 수 있다. 또한, 리포펙타민을 이용한 지질 매개법을 사용할 수 있다.
본 발명에서 사용하는 용어 "벡터"란, 상기 벡터가 도입된 세포에서 목적 유전자를 발현할 수 있는 발현벡터로서, 벡터 내에 도입된 유전자 삽입물이 발현되도록 작동 가능하게 연결된 필수적인 조절요소를 포함하는 유전자 제작물을 말한다.
또한, 상기 유전자를 포함하는 발현벡터는 CD4+ 세포주에서 발현시킬 수 있는 모든 발현벡터를 사용할 수 있으며, 본 발명의 구체적인 실시예에서는 pCDH-CMV-MCS-EF1-Puro(SBI, CD510B-1) 또는 pCDH-CMV-MCS-EF1-Neo(SBI, CD514B-1) 렌티 바이러스 벡터를 사용하였다.
상기 렌티 바이러스는 장기간의 잠복기를 특징으로 하는 레트로 바이러스과의 바이러스를 의미한다. 렌티 바이러스는 숙주세포의 DNA 내에 유전정보를 전달할 수 있다. 비분열 세포에서 복제할 수 있는 유전자 전달 벡터의 가장 효과적인 방법 중 하나이다.
*상기 CD4+ T세포는 체외로 분리된 CD4+ T세포, 체외 확장 배양된 CD4+ T세포 또는 CD4+ 세포주(T 림포마 세포주)일 수 있다. 또한, 상기 CD4+ T세포는 보조 T세포일 수 있으며, CD4+ T세포와 암세포를 융합하여 얻은 하이브리도마(hybridoma)일 수 있다. 구체적으로, CD4+ T세포는 Hut78, H9, Jurkat, Loucy, Molt-3, Molt-13, Peer, RPMI8402 및 TALL-01 세포로 이루어진 군으로부터 선택되는 어느 하나일 수 있다. 바람직하게는 Hut78, H9, Jurkat 또는 Peer 세포일 수 있다.
본 발명에서 사용하는 용어 '지지세포(feeder cell)'란, 배양보조세포로도 불리며, 증식하지는 못하지만 대사활성이 있어 여러 가지 대사물질을 생산하여 목적세포의 증식을 도와주는 세포를 의미한다. 상기 지지세포는 4-1BBL 유전자, mbIL-21 유전자, OX40L 유전자 및 mTNF-α 유전자로 구성된 군으로부터 선택되는 적어도 하나의 유전자가 발현되는 형질전환된 CD4+ T세포일 수 있다.
상기 지지세포로 이용되는 T세포는 분열증식이 억제된 불활성화 세포 또는 불활성화시키지 않은 것일 수 있으며, 바람직하게는 불활성화시킴으로써 안전성을 확보할 수 있다. 불활성화시키는 방법으로는 당업계에 공지된 통상의 방법을 사용하여도 무방하며, 예를 들어 감마선(gamma-ray)을 조사하는 방법을 사용할 수 있다. 불활성화를 시키는 않은 T세포를 사용할 경우 대부분 종양세포들이므로 활성화된 자연살해세포에 의해 배양 중 사멸될 수 있다.
본 발명에서 사용하는 용어 "원료세포(seed cell)"란, 적절한 배양을 통해 자연살해세포로 증식될 수 있는 세포를 의미한다. 구체적으로, 상기 원료세포는 제대혈(cord blood) 유래 단핵세포일 수 있으며, 제대혈 유래의 자연살해세포일 수 있다. 이에 제한되는 것은 아니며, 바람직하게는, 상기 원료세포는 CD3(+) 세포를 제거시킨 CD3(-) 세포일 수 있다.
상기 자연살해세포의 배양방법은 지지세포와 원료세포의 비율을 0.1 이상으로 혼합하여 배양할 수 있다. 구체적으로, 지지세포와 원료세포의 비율은 0.1:1 내지 50:1 일 수 있다. 보다 구체적으로 0.5:1 내지 40:1 일 수 있다. 보다 더 구체적으로는 1:1 내지 30:1 일 수 있다. 가장 구체적으로는 2:1 내지 20:1 일 수 있다. 일구체예로, 지지세포와 원료세포의 비율은 2.5:1의 비율일 수 있으며, 특별히 이에 제한하지 않는다. 상기 "비율"은 세포수를 기준으로 한 비율을 의미한다.
상기 자연살해세포의 배양방법에서 원료세포는 지지세포와 1회 혼합하여 5일 내지 60일간 배양하거나, 지지세포와 2회 이상 혼합하여 60일 이상 배양할 수 있다. 바람직하게, 원료세포는 지지세포와 1회 혼합하여 14일 내지 21일간 배양할 수 있으며, 이에 한정되는 것은 아니다.
상기 자연살해세포 배양방법은 AIM-V media, RPMI1640, CellGro SCGM, X-VIVO20, IMDM, DMEM과 같은 통상의 동물세포배양용 배지에 자연살해세포 및 T 림포마 세포주를 공동배양한다. 공동배양 시 T세포에 저친화성을 가지며 T세포를 자극하는 항체 및 인터루킨을 첨가하여 배양할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에서 사용하는 용어 'T세포에 저친화성(low affinity)을 가지며 T세포를 자극하는 항체'란, T세포 수용체(TCR)와 회합하여 항원인식복합체를 형성하는 분자군인 CD3 항원에 특이적으로 반응하는 단백질을 의미한다. 상기 CD3 분자는 TCR과 비교하여 세포 내 영역이 길고 항원인식신호를 세포 내에 전달하는 역할을 담당하고 있다.
본 발명에서 사용할 수 있는 T세포에 저친화성(low affinity)을 가지며 T세포를 자극하는 항체는, 바람직하게는 항-CD3 항체일 수 있다. 구체적으로, 항-CD3 항체는 OKT-3, UCHT1 또는 HIT3a일 수 있다.
본 발명에서 사용하는 용어 '인터루킨(Interleukin, IL)'이란, 사이토카인(cytokine) 내 하나의 군으로, 림프구나 단핵구 및 대식세포 등 면역담당세포가 생산하는 단백질성 생물 활성물질을 의미한다. 상기 인터루킨은 IL-2, IL-15, IL-12, IL-18 또는 IL-21일 수 있다.
본 발명의 일실시예에서는 OKT-3 항체와 IL-2를 첨가하여 배양하였다. 첨가하는 OKT-3 항체의 농도는 0.1 ng/㎖ 내지 1,000 ng/㎖일 수 있다. 바람직하게, OKT-3 항체의 농도는 10 ng/㎕일 수 있다. IL-2의 농도는 10 U/㎖ 내지 2,000 U/㎖일 수 있다. 바람직하게, IL-2의 농도는 1,000 U/ml일 수 있다. 또한, 혈청 또는 혈장과 림프구의 증식을 지지하는 추가의 증식인자를 첨가하여 배양할 수 있다. 배지에 첨가하는 혈청 또는 혈장의 종류는 특별히 한정되지 않으며, 시판되는 각종 동물 유래의 혈청 또는 혈장을 사용할 수 있다. 바람직하게는 인간 유래로서 본인 유래의 혈청 또는 혈장을 사용할 수 있다.
본 발명의 용어 "배양"이란, 세포를 적당히 인공적으로 조절한 환경조건에서 생육시키는 방법을 의미한다. 상기 형질전환된 CD4+ T세포를 배양하는 방법은 당업계에 널리 알려져 있는 방법을 이용하여 수행할 수 있다. 구체적으로 상기 배양은 배치 공정 또는 주입 배치(fed batch) 또는 반복 주입 배치 공정(repeated fed batch process)에서 연속식으로 배양할 수 있다.
또한, 배양배지에 적절한 전구체들이 사용될 수 있다. 상기된 원료들은 배양과정에서 배양물에 적절한 방식에 의해 회분식, 유가식 또는 연속식으로 첨가될 수 있으나, 특별히 이에 제한되지는 않는다. 수산화나트륨, 수산화칼륨, 암모니아와 같은 기초 화합물 또는 인산 또는 황산과 같은 산 화합물을 적절한 방식으로 사용하여 배양물의 pH를 조절할 수 있다.
상기 T세포를 지지세포로 사용하는 배양방법은 원료세포에서 선택적으로 자연살해세포의 배양을 유도하고, 공여자의 PBMC 지지세포를 사용하는 경우보다 자연살해세포의 증식 시 공여자에 따른 차이가 없이 안정적으로 배양할 수 있다. 또한 공여자의 MNC를 지지세포로 사용 시 제대혈 원료세포는 체외 배양이 어렵다. 따라서, T세포를 지지세포로 사용하는 배양방법이 많은 양의 치료용 자연살해세포 치료제를 효율적이고 안정적으로 확보할 수 있다.
본 발명의 또 다른 측면은, 상기 자연살해세포 배양방법에 의해 제조된 자연살해세포를 제공한다.
상기 자연살해세포 배양방법에 따라 배양된 자연살해세포는 동결이 가능하고 다시 해동할 경우에도 세포의 기능이 손상되지 않는다. 또한, NKp46과 같은 활성화 수용체(activating receptor)의 발현이 높아 종양 세포주에 대한 살해능 및 사이토카인 분비가 증가하므로, 탁월한 항암 효과를 기대할 수 있다. 따라서, 임상 적용이 가능한 다량의 활성화된 자연살해세포를 이용하여 종양치료에 유효한 세포치료제를 제조할 수 있다.
또한, 상기 자연살해세포 배양방법에 의해 제조된 자연살해세포를 유효성분으로 포함하는 감염성 질환의 예방 또는 치료용 조성물의 총 중량에 대하여 10 내지 95 중량%로 포함할 수 있다. 또한, 본 발명의 또는 감염성 질환의 예방 또는 치료용 조성물은 상기 유효성분 외에 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1종 이상 추가로 포함할 수 있다.
상기 감염성 질환의 예방 또는 치료용 약학적 조성물은 투여를 위해 상기 기재한 유효성분 이외에 추가로 약학적으로 허용가능한 담체를 1종 이상 포함하여 약학적 조성물로 제제화할 수 있다.
상기 감염성 질환의 예방 또는 치료용 약학적 조성물의 투여량은 질환의 종류, 질환의 중증도, 조성물에 포함된 유효성분 및 다른 성분의 종류 및 함량, 제형의 종류 및 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료기간, 동시 사용되는 약물을 비롯한 다양한 인자에 따라 조절될 수 있다. 그러나, 바람직한 효과를 위해서, 본 발명에 따른 자연살해세포의 투여량은 0.01x107 cells/㎏ 내지 1.0x109 cells/㎏일 수 있고, 0.5x107 cells/㎏ 내지 1.0x108 cells/㎏일 수 있다. 이때 투여는 하루에 한 번 투여할 수 있고, 수회에 나누어 투여할 수도 있다.
또한, 상기 감염성 질환의 예방 또는 치료용 약학적 조성물은 당업계에 공지된 다양한 방법으로 개체에 투여될 수 있다. 상기 투여 경로는 투여 방법, 체액의 부피, 점성도 등을 고려하여 통상의 기술자가 적절히 선택할 수 있다.
본 발명의 또 다른 측면은, 형질전환된 CD4+ T세포를 유효성분으로 포함하는 자연살해세포 배양용 조성물을 제공한다. 본 발명에서 이용되는 CD4+ T세포 및 상기 세포에 도입되는 유전자에 대해서는 이미 상술하였으므로, 과도한 중복을 피하기 위해 그 기재를 생략한다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐, 본 발명이 하기 실시예로 한정되는 것은 아니다.
실시예 1. 재조합 렌티 바이러스 제작
실시예 1.1. 재조합 렌티 바이러스 벡터 제작
렌티 바이러스 벡터는 pCDH-CMV-MCS-EF1-Puro(SBI, CD510B-1) 또는 pCDH-CMV-MCS-EF1-Neo(SBI, CD514B-1)를 사용하였다. 유전자는 4-1BBL(TNF superfamily member 9, TNFSF9), mbIL-21(membrane bound IL-21), OX40L(TNF superfamily member 4(TNFSF4) transcript variant 1) 및 mTNF-α(membrane bound TNF alpha)를 도입 유전자로 사용하였다.
구체적으로, 4-1BBL 유전자(서열번호 2)는 4-1BBL 유전자 발현벡터(Origene, RC211160)를 사용하였다. mbIL-21 유전자(서열번호 4)는 코돈-최적화(codon-optimization)된 mbIL-21 유전자 서열이 삽입된 pcDNA3.1 벡터(Genscript, US)를 사용하였다. OX40L 유전자(서열번호 6)는 바이오니아(Bioneer)에 합성을 의뢰하였다.
mTNF-α 유전자(서열번호 9)는 말초혈 단핵구 세포(peripheral blood mononuclear cell, PBMC)에서 RNA를 추출한 후, RT(Reverse transcriptase)-PCR로 CDS를 얻었다. TNF-α가 분비되기 위해서 TACE(tumor necrosis factor-alpha-converting enzyme)에 의해 잘리게 되는데, TNF-α 아미노산 서열에서 TACE 인식 부위인 A-V(Alanine-Valine)을 P-V(Proline-Valine)가 되도록 DNA 상에서 점 돌연변이(point mutation)를 일으켜서 세포막에 부착된 상태를 유지하게 하였다. 상기 점 돌연변이는 서열번호 7로 표시되는 인간 mTNF-α 유전자에서 226번째 염기인 구아닌(guanine)을 시토신(cytosine)으로 치환하고, 228번째 염기인 아데닌(adenine)을 구아닌(guanine)으로 치환하여 수행하였다.
각각의 도입 유전자에 맞는 프라이머를 사용하여 도입 유전자의 CDS(Coding Sequence)를 PCR을 통해 증폭시켰다(표 1).
유전자 프라이머 서열정보 (5'->3') 서열번호
4-1BBL 4-1BBL Forward TCTAGAGCTAGCGAATTCGCCACCATGGAATACGCCTCTGACGCTT 서열번호 10
4-1BBL Reverse TTCGCGGCCGCGGATCCTTATTCCGACCTCGGTGAAGG 서열번호 11
mbIL-21 mbIL-21 Forward TAGAGCTAGCGAATTCGCCACCGCCACCATGGCTCTGCCC 서열번호 12
mbIL-21 Reverse TCGCGGCCGCGGATCCTCAATACAGGGTGATGACC 서열번호 13
OX40L OX40L Forward TAGAGCTAGCGAATTCGCCACCATGGAACGGGTGCAAC 서열번호 14
OX40L Reverse TCGCGGCCGCGGATCCTCACAAGACACAGAACTCCCC 서열번호 15
mTNF-α mTNF-α Forward TAGAGCTAGCGAATTCGCCACCGCCACCATGGCTCTGCCC 서열번호 16
mTNF-α Reverse TCGCGGCCGCGGATCCTCACAGGGCAATGATCCC 서열번호 17
상기 표 1은 실험에 사용된 프라이머들을 나타낸 것이다. 도입 유전자와 렌티 바이러스 벡터에 EcoRI과 BamHI 제한효소를 처리하였다. 그 후, In-Fusion HD cloning kit(Clontech, 639649)를 이용하여 라이게이션시켰다. 라이게이션시킨 렌티 바이러스 벡터를 DH5α 수용성 세포(competent cell)에 형질전환시켜 배양하였다. 형질전환시킨 DH5α 수용성 세포로부터 plasmid mini-prep kit(MACHEREY-NAGEL/740422.50)을 이용하여 플라스미드 DNA를 수득하였다. 모든 플라스미드 DNA는 외부 업체에 시퀀싱(sequencing)을 의뢰하여 DNA 서열이 일치하는 것을 확인하였다.또한, 외주 제작사에서 cLV-CMV-MCS-IRES-Puro(puromycin) 또는 cLV-CMV-MCS-IRES-Neo(neomycin), cLV-CMV-MCS-IRES-Bsd(blasticidin)에 원하는 도입 유전자를 상기와 동일한 방법으로 삽입하였다.
실시예 1.2. 농축된 렌티 바이러스 제작
재조합 렌티 바이러스 생산을 위해 293T 세포주를 형질도입(transfection) 2일 전에 1.5x106 내지 2x106 cells로 75T 플라스크(Nunc, 156499)에 접종하여 5% CO2, 37℃ 온도 조건의 인큐베이터에서 배양하였다. 293T 세포의 세포 포화도가 80% 내지 90% 정도가 되었을 때, 6 ㎖ OPTI-MEM(Gibco, 31985-088)으로 배지를 교체하여 37℃ 온도에서 5% CO2 조건으로 30분 동안 배양하였다. DNA 혼합액과 리포펙타민(lipofectamine 2000, Life technologies, 11668500) 혼합액을 준비하였다(표 2).
구 분 성 분
DNA 혼합액 6 ㎍ 타겟 DNA, 6 ㎍ Gag, 6 ㎍ REV, 3 ㎍ VSVG, 1 ㎖ OPTI-MEM
리포펙타민 혼합액 36 ㎕ lipofectamine 2000, 1 ㎖ OPTI-MEM
상기 표 2는 DNA 혼합액과 리포펙타민(lipofectamine 2000, Life technologies, 11668500) 혼합액을 나타낸 것이다. 상기 각각의 혼합액 성분을 볼텍서(vortexer)를 이용해 잘 섞고 상온에서 3분간 방치하였다. 그 후, 두 혼합액을 섞어 상온에서 20분 이상 방치하였다. DNA와 리포펙타민이 혼합된 용액 2 ㎖를 배지를 6 ㎖ OPTI-MEM 배지에서 배양중인 293T 세포에서 처리하였다. 4시간 후, 10%(v/v) FBS가 첨가된 DMEM(Gibco, 11995073) 배지로 교체하고 48시간 동안 37℃ 온도에서 5% CO2 조건으로 배양하였다. 48시간 동안 배양한 293T 세포의 배양액 8 ㎖를 수거하여 0.45 ㎛ 필터(Millipore, SLHP033RS)로 걸러주었다. 걸러진 배양액을 Amicon Ultra-15 Centrifugal Filter Unit with Ultracel-100 membrane(Merckmillipore, UFC910096)을 이용하여 250 ㎕ 이하로 농축하였다. 농축된 바이러스는 적당량으로 분주하여 -80℃ 온도에 보관하였다.
실시예 2. 유전자 도입 T세포 제작
실시예 2.1. 렌티 바이러스 감염
배양중인 0.5x106 개의 세포주와 1 ㎖ OPTI-MEM 배지, 50 ㎕ 렌티 바이러스 해동액, 10 ㎍/㎖ 폴리브렌(polybrene, Santa Cruz, C2013)을 혼합하여 6-웰 플레이트(6-well plate, Nunc, 140675)에 넣고 1800×g, 32℃ 온도에서 90분간 회전접종(spinoculation)을 진행하였다. 그 후, 2시간 동안 5% CO2, 37℃ 온도 조건의 인큐베이터에서 배양한 후, 기존 배양배지로 교체해주고 48시간 동안 배양하였다.
Hut78 세포주(ATCC, TIB-161™)는 20%(v/v) FBS를 포함하는 IMDM(ATCC, 30-2005)배지에서 배양하였다. 계대배양시 세포 농도는 1.5x105 cells/㎖ 내지 2.0x105 cells/㎖로 유지하였다. H9 세포주(ATCC, HTB-176™)와 Jurkat 세포주(ATCC, TIB-152™)는 10%(v/v) FBS를 포함하는 RPMI1640(ATCC, 30-2001) 배지에서 배양하였다. 계대 배양 시 세포 농도는 각각 1.0x105 cells/㎖ 내지 1.5x105 cells/㎖과 0.5x105 cells/㎖ 내지 1.0x105 cells/㎖로 유지하였다. Peer 세포주는 20%(v/v) FBS를 포함하는 RPMI1640 배지에서 배양하였다. 계대배양시 세포 농도는 3.0x105 내지 5.0 x105 cells/㎖로 유지하였다. 모든 세포주의 계대배양은 2일 내지 3일 간격으로 진행하였다. 배양용기는 75T 플라스크를 사용하였고, 배지량은 15 ㎖ 내지 20 ㎖을 유지하였다.
재조합 렌티 바이러스에 감염된 세포주는 항생제를 이용하여 선별하였다(표 3).
도입 유전자 조합 사용한 vector 세포주 항생제 사용 농도
단일 유전자 발현 mTNF-ambIL-21 pCDH(System Biosciences, SBI) Hut78 0.5 ㎍/㎖ puromycin (Life technologies, A1113802)
OX40L4-1BBL pCDH(System Biosciences, SBI) Hut78 1 ㎎/㎖ G148(Sigma Aldrich, A1720-5G)
이중 유전자 발현 mTNF-a/OX40LmbIL-21/OX40LmTNF-a/4-1BBL pCDH(System Biosciences, SBI) Hut78 0.5 ㎍/㎖ puromycin1 ㎎/㎖ G418
mbIL-21/4-1BBL cLV (Sirion) Hut78H9JurkatPeer 6 ㎍/㎖ Blasticidin(Invitrogen, R210-01)1 ㎎/㎖G418
삼중 유전자 발현 mTNF-a/mbIL-21/4-1BBL cLV (Sirion) Hut78H9Jurkat 0.5 ㎍/㎖ puromycin6 ㎍/㎖ Blasticidin1 ㎎/㎖ G418
사중 유전자 발현 mTNF-a/mbIL-21/OX40L/4-1BBL mTNF-a/mbIL-21/4-1BBL: cLVOx40L: pCDH Hut78 0.5 ㎍/㎖ puromycin6 ㎍/㎖ Blasticidin1 ㎎/㎖ G418
상기 표 3은 유전자가 도입된 세포주에 사용된 항생제를 나타낸 것이다.
실시예 2.2. 도입 유전자 발현 확인
유세포 분석을 통해 도입 유전자의 발현을 확인하기 위해, 상기 실시예 2.1.에서 계대배양한 세포주를 수거하여 1,200 rpm으로 5분간 원심분리하였다. 그 후, 배양액을 흡입(suction)하여 제거하였다. PBS에 2%(v/v) FBS를 첨가하여 FACS 버퍼를 만들었다. 1 ㎖의 FACS 버퍼로 희석하여 세포수를 측정하고, 5x106 cells/㎖ 농도가 되도록 FACS 버퍼로 희석하였다. 5 ㎖ FACS 튜브 (Falcon, 352052)에 희석한 세포용액을 100 ㎕씩 넣었다. 항-인간 TNF-a(membrane)-PE(R&D systems, FAB210P), 항-인간 OX40L-PE(BD, 558184), 항-인간 4-1BBL-PE(BD, 559446), 항-인간 IL-21-PE(eBioscience, 12-7219-42), 7-AAD(Beckman coulter, IM3630c), PE 마우스 IgG1 κ 아이소타입 컨트롤(BD Pharmingen, 555749), PerCP-Cy5.5 마우스 IgG1 κ 아이소타입 컨트롤(BD, 550795) 항체로 염색한 후 FACS 장비를 이용하여 각 유전자의 발현율을 분석하였다(도 1a 내지 도 1f).
또한, RT-qPCR(Real time qPCR)을 통해 도입 유전자의 발현을 확인하기 위해, 상기 실시예 2.1.에서 계대배양한 세포주를 수거하여 1,200 rpm으로 5분간 원심분리하였다. 그 후, 배양액을 흡입(suction)하여 제거하였다. PBS로 희석하여 세포 수를 측정하고, 1x106 cells을 RNA prep kit를 이용하여 RNA를 분리하고 정량하였다. 또한, cDNA synthesis kit를 이용하여 cDNA를 합성하였다. 합성된 cDNA를 이용하여 RT-qPCR을 수행하였다. RT-qPCR에 사용된 프라이머는 하기 표 4와 같다.
프라이머 서열정보 (5'->3') 서열번호
4.1BBL Forward primer TCTGAGACAGGGCATGTTTG 서열번호 18
Reverse primer CCACCAGTTCTTTGGTGTCC 서열번호 19
mTNF-α Forward primer AACCTCCTCTCTGCCATCAA 서열번호 20
Reverse primer ATAGTCGGGCCGATTGATCT 서열번호 21
mbIL-21 Forward primer TGGAAACAATGAGCGAATCA 서열번호 22
Reverse primer AACCGCTCCAGGAACTCTTT 서열번호 23
hTOP1 Forward primer CCAGACGGAAGCTCGGAAAC 서열번호 24
Reverse primer GTCCAGGAGGCTCTATCTTGAA 서열번호 25
상기 표 4는 RT-qPCR 실험에 사용된 프라이머들을 나타낸 것이다. 세포주 내 도입 유전자의 발현량을 하기 표 5에 나타내었다.
Ct value TOP1 mTNF-α mbIL-21 4.1BBL
H9 20.3 21.5 n.d n.d
H9-mbIL-21-4.1BBL 20.0 22.2 19.5 19.4
H9-mTNF-α-mbIL-21-4.1BBL 19.9 18.2 18.1 18.2
Jurkat 20.1 30.7 n.d n.d
Jurkat-mbIL-21-4.1BBL 27.4 37.0 36.4 34.1
Jurkat-mTNF-α-mbIL-21-4.1BBL 20.4 19.8 19.2 19.8
Peer 21.4 26.2 34.2 34.9
Peer-mbIL-21-4.1BBL 26.8 33.8 29.0 25.6
* n.d: not detected
상기 표 5에 나타난 바와 같이 세포주에 도입시킨 유전자의 발현량이 증가하는 것을 확인하였다.
실시예 3. CD3(-) PBMC 및 유전자 도입 T세포 공동배양
실시예 3.1. 제대혈 유래 CD3(-) PBMC 원료세포의 준비
연구용 제대혈을 50 ㎖ 튜브에 담아 1,500 rpm 조건으로 10분간 원심분리하였다. 상층의 혈장을 제거하고 PBS(phosphate buffered saline, LONZA, 17-516Q)를 1:1 비율로 추가하였다. 그 후, 피콜(Ficoll-Paque Plus, GE Healthcare, 17-1440-03) 밀도 구배 원심분리(ficoll density gradient centrifugation) 방법을 통해 제대혈 단핵세포(mononuclear cell, MNC)를 분리한 후, ADAM 세포 계수기 시스템(ADAM cell counter system, 나노엔텍)을 이용하여 세포수를 측정하였다.
CD3(+) 세포를 제거시킨 원료세포를 수득하기 위해, 5x107 개의 제대혈 단핵세포를 새로운 50 ㎖ 튜브로 옮긴 후 1,200 rpm, 4℃ 온도에서 5분간 원심분리 하였다. PBS에 2%(v/v) FBS와 2 mM 농도의 EDTA가 포함된 MACS 러닝버퍼를 제조하였다. 원심분리가 끝난 후, 펠렛에 400 ㎕의 MACS 러닝버퍼와 100 ㎕의 CD3 자기비드(Miltenyi biotech, 130-050-101)를 넣고 4℃ 온도에서 20분간 반응시켰다. 10 ㎖ MACS 러닝버퍼를 넣어 세척한 뒤 13,500 rpm, 4℃ 온도에서 8분간 원심분리하고 0.5 ㎖의 MACS 러닝버퍼에 현탁하였다.
VarioMACS(Miltenyi Biotech)에 CS 컬럼(column, Miltenyi Biotech, 130-041-305)을 장착하여 세포를 분리하였다. 최종 20 ㎖이 될 때까지 컬럼을 세척하여 세포를 회수하였다. 회수한 세포를 새로운 50 ㎖ 튜브에 담아 1,200 rpm, 4℃ 온도에서 5분간 원심분리하고 동결배지에 현탁하였다. ADAM 세포 계수기 시스템을 이용하여 세포수를 측정하여 1 바이알(vial)당 5x106개의 세포를 액체 질소에 동결하였다.
동결된 CD3(-) 제대혈 단핵세포 1 바이알을 37℃ 온도의 항온수조(water bath)에서 해동하여 50 ㎖ 튜브로 옮기고, 0.6%(v/v) ACD(Citrate-dextrose solution, Sigma-Aldrich, C3821), 0.2%(v/v) FBS(Fetal serum bovine)와 2 mM EDTA를 포함하는 PBS로 현탁하여 1,500 rpm, 4℃ 온도에서 10분간 원심분리하였다. CD3(-) 제대혈 단핵세포를 CellGro 배지(Cellgenix, 20802-0500)에 현탁하고, ADAM 세포 계수기 시스템을 이용하여 세포수를 측정하였다. CD3(-) 제대혈 단핵세포를 1x106 cells/㎖ 농도에 맞춰 CellGro 배지에 현탁하였다.
실시예 3.2. CD3(-) 제대혈 단핵세포와 유전자 도입 T세포 공동배양
실시예 2에서 제조한 유전자 도입 T세포를 배양 플라스크에서 회수하여 1,200 rpm, 4℃ 온도에서 5분간 원심분리하였다. 그 후, CellGro 배지에 현탁하고, ADAM 세포 계수기 시스템을 이용하여 세포수를 측정하였다. 유전자 도입 T세포를 2.5x106 cells/㎖ 농도에 맞춰 CellGro 배지에 현탁한 뒤, 감마선 조사기에서 20,000 cGy로 조사하여 불활성화시켜 준비하였다.
자연살해세포 배양시 1,000 IU의 IL-2(프로류킨 주, 한국노바티스)와 10 ng/㎖의 OKT-3(eBioscience, 16-0037-85)를 배양 플라스틱 플레이트에 넣어주었다. 배양 0일째 CD3(-) 제대혈 단핵세포와 유전자 도입 T세포를 1:2.5의 비율로 각각 0.25 ㎖ 넣고 2%(v/v) 인간 혈장이 포함된 CellGro 배지를 0.25 ㎖ 넣어 37℃ 온도 조건의 인큐베이터에서 4일 동안 정치 배양하였다.
배양 4일째에 1%(v/v) 인간 혈장, 1,000 IU/㎖의 IL-2가 포함된 CellGro 배지를 동량으로 넣어준 뒤, 다시 정치 배양하였다. 이후 2일 내지 3일 간격으로 세포수를 측정하여 1x106 cells/㎖ 농도가 되도록 1%(v/v) 인간 혈장, 1,000 IU/㎖의 IL-2가 포함된 CellGro 배지를 추가하며 21일까지 부유 배양하였다. 21일까지 부유 배양하여 증식된 자연살해세포를 수득하였다. 이때, Jurkat 세포주 또는 Peer 세포주를 지지세포로 사용한 경우, 11일까지 부유 배양하였다. H9 및 Hut78 세포주에 유전자를 도입하여 지지세포로 사용한 경우, 21일까지 부유 배양하였다.
배양된 자연살해세포의 증식률을 비교한 결과, 총 세포수(Total nucleated cells, TNC)를 기준으로 유전자가 도입되지 않은 Hut78 세포주와 공동배양하였을 때 93배 증식하였다. 하나 이상의 유전자(mTNF-α, mbIL-21, 4-1BBL)가 도입된 Hut78 세포주와 공동배양 하였을 때 월등하게 자연살해세포의 증식률이 높아지는 것을 확인하였다. 특히, mbIL-21/4-1BBL의 유전자가 도입된 Hut78 세포주와 공동배양하였을 때 957배 증식하였다. 또한, mTNF-α/mbIL-21/4-1BBL가 도입된 Hut78 세포주와 공동배양하였을 때 1,138배 증식하였다(표 6, 도 2a).
HuT78 + 도입유전자　 Average STDEV
HuT78 parental 92.7 90.4
mTNF-α 112.3 67.2
mbIL-21 448.1 251.4
OX40L 50.5 30.7
4.1BBL 274.9 189.6
mTNF-α+OX40L 204.5 123.2
mTNF-α+4.1BBL 389.1 352.1
mbIL-21+OX40L 372.0 189.2
mbIL-21+4.1BBL 957.0 537.4
mTNF-α+mbIL21+4.1BBL 1138.5 192.0
mTNF-α+OX40L+mbIL21+4.1BBL 823.1 330.0
또한, 유전자가 도입되지 않은 H9 세포주와 공동배양하였을 때 13배 증식하였지만, mbIL-21/4-1BBL 또는 mTNF-α/mbIL-21/4-1BBL가 도입된 H9 세포주와 공동배양하였을 때, 각각 367배, 979배 증식하였다(표 7 및 도 2b).
H9 + 도입유전자 Average STDEV
H9 parental 12.6 4.3
mbIL21+4.1BBL 367.4 80.1
mTNF-α+mbIL21+4.1BBL 978.8 287.7
다른 세포주인 Jurkat 세포주 또는 Peer 세포주와 공동배양하였을 때 배양 11일차까지 배양이 가능하였다. mbIL-21/4.1BBL 유전자가 도입된 세포주나, mTNF- α/mbIL-21/4-1BBL 유전자가 도입된 세포주에서 상대적으로 높은 증식률을 보였다. (표 8 및 표 9, 도 2c 및 도 2b)
Jurkat + 도입유전자 Average (11일 배양) STDEV
Jurkat Parental 0.9 0.7
mbIL21+4.1BBL 36.3 4.8
mTNF-α+mbIL21+4.1BBL 43.6 6.6
Peer + 도입유전자 Average (11일 배양) STDEV
Peer Parental 1.6 0.7
mbIL21+4.1BBL 14.3 4.1
상기 결과는 제대혈 단핵세포로부터 분리된 CD3(-) 세포를 유전자가 도입된 지지세포로 21일간 배양하여, 자연살해세포 배양이 가능함을 보여주며, 유전자 비도입 지지세포보다 높은 증식률을 보였다.
실시예 3.3. mTNF-α/mbIL-21/4-1BBL 유전자가 도입된 HuT78 세포를 이용한 자연살해세포 배양의 재자극
실시예 2에서 제조한 유전자 도입 T세포를 배양 플라스크에서 회수하여 1,200 rpm, 4℃ 온도에서 5분간 원심분리하였다. 그 후, CellGro 배지에 현탁하고, ADAM 세포 계수기 시스템을 이용하여 세포수를 측정하였다. 유전자 도입 T세포를 2.5x106 cells/㎖ 농도에 맞춰 CellGro 배지에 현탁한 뒤, 감마선 조사기에서 20,000 cGy로 조사하여 불활성화시켜 준비하였다.
자연살해세포 배양시 1,000 IU의 IL-2와 10 ng/㎖의 OKT-3를 배양 플라스틱 플레이트에 넣어주었다. 배양 0일째 CD3(-) 제대혈 단핵세포와 유전자 도입 T세포를 1:2.5의 비율로 각각 0.25 ㎖ 내지 1 ㎖ 넣고 2%(v/v) 인간 혈장이 포함된 CellGro 배지를 0.25 ㎖ 내지 1 ㎖ 넣어 37℃ 온도 조건의 인큐베이터에서 4일 동안 정치 배양하였다.
배양 4일째에 1%(v/v) 인간 혈장, 1,000 IU/㎖의 IL-2가 포함된 CellGro 배지를 동량으로 넣어준 뒤, 다시 정치 배양하였다. 이후 2일 내지 3일 간격으로 세포수를 측정하여 1x106 cells/㎖ 농도가 되도록 1%(v/v) 인간 혈장, 1,000 IU/㎖의 IL-2가 포함된 CellGro 배지를 추가하며 배양하였다.
재자극은 배양 0일째 mTNF-α/mbIL-21/4-1BBL 유전자가 도입된 HuT78 세포를 같은 비율로 사용하였다. 배양 16일째 첫 번째 재자극을 주었다. 먼저, ADAM 세포 계수기 시스템을 이용하여 배양중인 자연살해세포의 수를 측정하고, 1.5x106 cells/㎖이 되도록 CellGro 배지로 희석하여 0.25 ㎖을 배양 플라스틱 플레이트에 준비하였다. mTNF-α/mbIL-21/4-1BBL 유전자가 도입된 HuT78 세포는 2.5x106 cells/㎖이 되도록 CellGro 배지에 현탁한 뒤, 감마선 조사기에서 10,000 cGy로 조사하여 불활성화시켜 준비하였다.
불활성화시킨 mTNF-α/mbIL-21/4-1BBL 유전자가 도입된 HuT78 세포를 배양 플라스틱 플레이트에 0.25 ㎖을 넣어주었다. 1000 IU/㎖의 IL-2와 10 ng/㎖의 OKT-3, 1%(v/v) 인간 혈장을 배양 플라스틱 플레이트에 넣고 37℃ 온도의 인큐베이터에서 3일간 정치 배양하였다. 이후 2일 내지 3일 간격으로 세포수를 측정하여 1x106 cells/㎖이 되도록 1%(v/v) 인간 혈장 과 1000 IU/㎖의 IL-2가 포함된 CellGro 배지를 추가하며 배양하였다. 첫 번째 재자극 후 14일마다 동일한 방법으로 각각 배양 32일째, 46일째, 60일째에 지지세포를 통한 재자극을 진행하였고, 70일까지 배양 진행하였다.
그 결과, 첫 번재 재자극 후 배양 32일째 자연살해세포의 증식률은 6.9x104 배, 두 번째 재자극 후에는 3.7x106 배였고, 세 번째 재자극 후인 배양 60일째에는 2.3x108 배, 네 번째 재자극을 준 후 배양 70일째 5.9x109 배로 지속적인 증식이 유지되어 높은 증식률을 보였다(표 10, 도 2e).
배양일차　 Average STDEV
32일 6.9x104 3.2x103
46일 3.7x106 3.1x105
60일 2.3x108 1.4x108
70일 5.9x109 1.1x108
이를 통해 mTNF-α/mbIL-21/4-1BBL 유전자가 도입된 HuT78 세포주로 주기적인 재자극을 주었을 때, 증식배수가 계속적으로 증가하여 우수한 지지세포로 사용될 수 있음을 확인하였다.
실험예 1. 도입 유전자에 따른 자연살해세포의 세포생존율 확인
인-비트로(in-vitro) 세포생존율을 비교, 평가하기 위하여 세포내 핵과 결합할 수 있는 PI 염색액을 사용하는 세포계수기(Cell counter) 중에 하나인 ADAM cell counter system 사용하였다. 측정된 총 세포수에서 사멸 세포수를 감하여 생존 세포수를 계산한 후, 하기 수학식 I을 이용하여 세포생존율(Cell viability)을 계산하였다.
[수학식 I]
세포생존율 (%) = (생존 세포수/총 세포수) x 100
유전자가 도입된 HuT78 세포주와 공동배양한 자연살해세포의 경우, 유전자 도입 유무와 관계없이, 90% 내외의 생존율을 보였다(표 11, 도 3a).
HuT78 + 도입유전자 Average STDEV
Parental 91 2.6
mTNF-α 92.8 2.1
mbIL-21 92.8 1.5
OX40L 90.3 1.3
4.1BBL 91.3 1.3
mTNF-α+OX40L 93.5 1.7
mTNF-α+4.1BBL 92.5 1.7
mbIL-21+OX40L 89 2.4
mbIL-21+4.1BBL 89.8 2.6
mTNF-α+mbIL-21+4.1BBL 89 3.4
QD 88.5 3.4
그 외 H9, Jurkat 또는 Peer 세포주의 경우, mbIL-21/4-1BBL 유전자가 도입된 세포주, mTNF-α/mbIL-21/4-1BBL 유전자가 도입된 세포주에서 배양된 자연살해세포의 생존율은 21일 배양(H9), 11일 배양(Jurkat, Peer) 시 90% 이상의 생존율을 보였다(표 12 내지 표 14, 도 3b 내지 도 3d).
H9 +도입유전자 Average STDEV
Parental 86 6.1
mbIL21+4.1BBL 91 3.1
mTNF-α+mbIL21+4.1BBL 94 0.6
Jurkat +도입유전자 Average STDEV
Parental 80 6.1
mbIL21+4.1BBL 91 0.6
mTNF-α+mbIL21+4.1BBL 92 2.0
Peer +도입유전자 Average STDEV
Parental 83.5 6.1
mbIL21+4.1BBL 91 0.6
또한, mTNF-α/mbIL-21/4-1BBL 유전자가 도입된 HuT78 세포주로 재자극 횟수를 늘려가며 배양한 결과, 자연살해세포의 생존율은 재자극 횟수가 많아져도 약 90%이상의 높은 생존율을 보였다(표 15, 도 3e).
배양일차 32일 42일 60일 70일
Average 96.0 93.5 97.5 91.5
STDEV 1.4 0.7 0.7 4.9
이를 통해, 장기간 배양이 지속되어도 자연살해세포는 높은 생존율을 유지하므로, 자연살해세포의 장기간 확장 배양이 가능함을 확인하였다.
실험예 2. 자연살해세포의 순도 확인
21일 배양된 자연살해세포 또는 반복적인 재자극으로 배양된 자연살해세포를 수거하여 1,200 rpm으로 5분간 원심분리하고, 배양액을 흡입하여 제거하였다. 1 ㎖의 FACS 버퍼로 희석하여 세포 수를 측정하고, 5x106 cells/㎖이 되도록 FACS 버퍼로 희석하였다. 5 ㎖ FACS 튜브(Falcon, 352052)에 희석한 세포 용액을 100 ㎕씩 넣고, 하기 항체로 표현형을 분석하였다:
튜브 1: 항-인간 CD3-FITC(BD Pharmingen, 555332), 항-인간 CD16-PE(BD Pharmingen, 555407), 항-인간 CD56-BV421(BD Pharmingen, 562751)
튜브 2: 항-인간 CD14-FITC(BD Pharmingen, 555397), 항-인간 CD19-PE(BD Pharmingen, 555413), 항-인간 CD3-BV421(BD Pharmingen, 562438)
튜브 3: 항-인간 CD3-FITC, 항-인간 NKG2D-PE(R&D system, FAB139P), 항-인간 CD56-BV421
튜브 4: 항-인간 CD3-FITC, 항-인간NKp30-PE(BD Pharmingen, 558407), 항-인간 CD56-BV421
튜브 5: 항-인간 CD3-FITC, 항-인간 NKp44-PE(BD Pharmingen, 558563), 항-인간 CD56-BV421
튜브 6: 항-인간 CD3-FITC, 항-인간 NKp46-PE(BD Pharmingen, 557991), 항-인간 CD56-BV421
튜브 7: 항-인간 CD3-FITC, 항-인간 DNAM-1-PE(BD Pharmingen, 559789), 항-인간 CD56-BV421
튜브 8: 항-인간 CD3-FITC, 항-인간 CXCR3-PE(BD Pharmingen, 557185), 항-인간 CD56-BV421
튜브 9: 항-인간 CD3-FITC, PE 마우스 IgG1 κ 아이소타입 컨트롤(BD Pharmingen, 555749), 항-인간 CD56-BV421
튜브 10: FITC 마우스 IgG1 κ 아이소타입 컨트롤(BD Pharmingen, 555748), PE 마우스 IgG1 κ 아이소타입 컨트롤, BV421 마우스 IgG1 κ 아이소타입 컨트롤(BD Pharmingen, 562438)
상기 튜브 1에서 항-인간(anti-human) CD56은 세 가지 형광 중에 한 가지를 선택하여 진행하였고, 그에 따라 튜브 2의 CD3와 튜브 3부터 9까지의 CD56, 튜브 10의 아이소타입 컨트롤의 형광을 같은 것으로 선택하였다.
상기 튜브들을 30분간 냉장 온도에서 염색하였다. 그 후, 염색이 끝난 세포에 2 ㎖ FACS 버퍼를 넣고, 1,500 rpm으로 3분간 원심분리하였다. 상층액을 제거하고 다시 2 ㎖ FACS 버퍼를 넣고 2,000 rpm으로 3분간 원심분리하였다. 다시 상층액을 제거하고, 200 ㎕ cytofix 버퍼(fixation buffer, BD, 554655)를 넣어 현탁한 후 FACS LSRII Fortessa(BD Biosciences)를 이용하여 세포의 확인 및 순도와 여러 표현형을 조사하였다.
제대혈 단핵세포로부터 분리된 CD3(-) 세포를 유전자를 도입한 HuT78 세포주와 21일간 공동배양 후, 자연살해세포의 확인 및 순도를 분석한 결과, 유전자 도입 유무 관계없이 모든 조건에서 90% 이상의 높은 자연살해세포(CD3-CD56+) 함량을 확인하였다(표 16, 도 4a).
HuT78 + 도입유전자 Average STDEV
Parental 92.4 9.6
mTNF-α 96.8 2.5
mbIL-21 98.6 0.9
OX40L 95.7 3.6
4.1BBL 98 1.8
mTNF-α+OX40L 97.2 2.5
mTNF-α+4.1BBL 98.6 1
mbIL-21+OX40L 98.4 1.3
mbIL-21+4.1BBL 98.5 0.9
mTNF-α+mbIL-21+4.1BBL 98.7 0.9
QD 99.3 0.5
그 외 H9, Jurkat 또는 Peer 세포주의 경우도 유전자를 도입하지 않은 조건보다 mbIL-21/4-1BBL 유전자 또는 mTNF-α/mbIL-21/4-1BBL 유전자를 도입한 세포주와 공동배양한 자연살해세포의 확인 및 순도가 더 높게 유지되는 것을 확인하였다(표 17 내지 표 19, 도 4b 내지 도 4d).
H9 +도입유전자 Average STDEV
Parental 91.5 4.1
mbIL21+4.1BBL 98.5 0.7
mTNF-α+mbIL21+4.1BBL 99 0.3
Jurkat +도입유전자 Average STDEV
Parental 88.6 6.9
mbIL21+4.1BBL 97.6 1.3
mTNF-α+mbIL21+4.1BBL 97.5 0.8
Peer +도입유전자 Average STDEV
Parental 79.2 14.6
mbIL21+4.1BBL 94.9 2.1
또한, mTNF-α/mbIL-21/4-1BBL 세가지 유전자가 도입된 세포주로 재자극 횟수를 늘려가며 배양된 자연살해세포는 배양 60일까지 90% 이상의 높은 자연살해세포(CD3-CD56+) 함량을 확인하였다(표 20, 도 4e)
배양일차 32일차 60일차
Avergage 99.7 97.8
STDEV 0.1 0.8
실험예 3. 자연살해세포의 활성마커 분석또한, 제대혈 단핵세포로부터 분리된 CD3(-) 세포를 유전자가 도입된 지지세포와 21일간 공동배양한 후, 대표적인 자연살해세포의 수용체(receptor) 발현을 분석하였다.
HuT78 세포주와 공동배양한 경우, CD16은 모두 높게 발현하였고, 활성 마커 인 NKG2D, NKp30, NKp44, NKp46, DNAM-1이 유전자를 도입하지 않은 조건이나 단일 유전자 도입 지지세포 조건에 비해 이중 유전자 도입 지지세포 조건에서 공여자 간 편차(variation)없이 모두 높게 발현하였다(도 5a 내지 도 5g).
또한, H9 세포주와 공동배양한 경우, 유전자를 도입하지 않은 조건보다 mbIL-21/4-1BBL 유전자와 mTNF-α/mbIL-21/4-1BBL 세 가지 유전자가 도입된 지지세포와 공동배양한 경우에 CD16 및 NKG2D, DNAM-1, CXCR3의 발현도가 더 높아지는 것을 확인하였다. 다른 활성 마커인 NKp30, NKp44, NKp46의 발현은 공여자간 편차 없이 높게 발현되었다. 따라서, 이중 및 삼중 유전자 도입 지지세포는 NK 세포의 활성 및 종양 타겟팅을 높일 수 있는 유용한 지지세포임을 확인하였다(도 6a 내지 도 6g).
또한, mTNF-α/mbIL-21/4-1BBL 세 가지 유전자가 도입된 Hut78 세포주를 이용해 재자극 하여 공동배양한 자연살해세포 표현형을 확인한 결과, 재자극 1회 조건보다 4회 조건으로 배양한 경우에 NKG2D, NKp44, NKp46, DNAM-1, CXCR3 등 활성 마커의 발현이 감소하는 경향을 보였다. 이를 통해, 재자극 횟수가 늘어날수록 배양 기간이 길어지면서 일부 활성 마커의 발현도에 영향을 줄 수 있음을 확인하였다(도 7a 및 도 7b).
실험예 4. T세포의 도입 유전자 및 공동배양에 따른 자연살해세포의 세포살해능 확인
1x106 개의 K562 암세포주를 15 ㎖ 튜브에 담아 원심분리하였다. 세포 펠렛을 1 ㎖의 10%(v/v) FBS가 첨가된 RPMI1640 배지로 현탁하였다. 그 후, 1 mM의 Calcein-AM(Molecular probe, C34852)을 30 ㎕ 넣은 다음 은박지로 빛을 차단하여 37℃ 온도 조건의 인큐베이터에서 한 시간 동안 염색했다.
Calcein-AM 염색이 끝난 종양 세포주는 10 ㎖ 내지 15 ㎖의 10%(v/v) FBS가 첨가된 RPMI1640 배지를 넣어 세척하고 원심 분리한 뒤 펠렛을 10 ㎖의 10%(v/v) FBS가 첨가된 RPMI1640 배지로 현탁하여 1x105 cells/㎖의 농도가 되도록 하였다. 자연살해세포는 1x106 cells를 15 ㎖ 튜브에 담아 원심분리하고, 펠렛을 K562 암세포주에 대비하여 원하는 비율(1:1)로 10%(v/v) FBS가 첨가된 RPMI1640 배지에 현탁하였다. 준비된 K562 암세포주와 자연살해 세포주를 둥근 바닥 96-웰 플레이트(96-well U-bottom plate, Nunc, 163320)에 100 ㎕씩 섞어서 분주하고, 각 웰을 3 개씩(triplicate) 준비하여 평균값을 얻었다.
스판(Spontaneous release) 웰에는 염색된 K562 암세포주를 100 ㎕씩 넣고 10%(v/v) FBS가 첨가된 RPMI1640 배지를 100 ㎕씩 넣어주었다. 맥스(Maximum release) 웰에는 염색된 K562 암세포주를 100 ㎕씩 넣고 2%(v/v) Triton-X 100이 첨가된 3차 증류수를 100 ㎕씩 넣어주었다.
10%(v/v) FBS가 첨가된 RPMI1640 배지 및 2%(v/v) Triton-X 100이 첨가된 RPMI1640 배지에 존재하는 자가 형광값(auto-fluorescence)을 보정하기 위해 10%(v/v) FBS가 첨가된 RPMI1640 배지 200 ㎕를 넣어 배지값을 준비하고, 10%(v/v) FBS가 첨가된 RPMI1640 배지 100 ㎕에 2%(v/v) Triton-X 100이 첨가된 RPMI1640 배지 100 ㎕를 넣어 두 용액의 혼합액의 값을 준비하였다. 배지값에서 혼합액의 값을 뺀 차(A)를 맥스(Maximum release)값에 더하여 자가 형광값을 보정하였다.
빛을 차단하여 37℃ 온도 조건의 인큐베이터에서 4시간 동안 반응시킨 후, 플레이트를 2,000 rpm에서 3분간 원심분리하였다. 상층액을 96-웰 블랙 플레이트(96 well black plate, Nunc, 237108)에 100 ㎕씩 분주하였다. 형광 플레이트 리더기(Perkin Elmer, VICTOR X3)를 이용하여 형광값(OD480/535 nm)을 측정하고, 자연살해세포의 종양 세포살해능은 하기 수학식 II를 이용하여 계산하였다.
[수학식 II]
% of killing = (Sample well 평균 형광값 - Spon well 평균 형광값)/{(Max well 평균 형광값 + A) - Spon well 평균형광값} x 100
다양한 지지세포로 배양된 자연살해세포들을 K562 암세포주와 반응시켜 직접적인 세포살해능을 측정하였다. 그 결과, 모든 지지세포에 대해 유전자를 도입하지 않은 조건보다 mbIL-21/4-1BBL 유전자와 mTNF-α/mbIL-21/4-1BBL 유전자를 도입한 조건에서 배양된 자연살해세포의 세포살해능이 증가하였다(도 8a 내지 도 8d).
mTNF-α/mbIL-21/4-1BBL 유전자가 도입된 HuT78 세포주의 재자극 횟수에 따른 자연살해세포의 세포살해능은 큰 차이 없이 배양 60일까지 높은 살해능을 나타내었다(도 8e).
이를 통해, 유전자 미도입 지지세포보다 mbIL-21/4-1BBL 유전자 또는 mTNF-α/mbIL-21/4-1BBL 유전자가 도입된 지지세포는 높은 활성과 더불어 우수한 세포살해능을 갖는 고순도 자연살해세포를 체외 확장 배양하는데 유용하게 사용될 수 있음을 확인하였다.
실시예 4. 동물 실험
실시예 4.1. 유전자 도입 T 지지세포를 이용한 자연살해세포의 배양
자연살해세포 배양 시 500 혹은 1000 IU/mL의IL-2 (프로류킨 주, 한국노바티스)와 10ng/mL의OKT-3 (eBioscience, 16-0037-85)를 배양 플라스틱 플레이트에 넣어주었으며, 배양 0일째 CD3(-) 제대혈 단핵세포 혹은 말초혈액 단핵세포와 유전자 도입 T 지지세포를 1:2.5의 비율로 넣고 2v/v% 인간 혈장이 포함된 CellGro 배지를 넣어 37℃ 인큐베이터에서 4일간 정치 배양하였다. IL-2는 제대혈 단핵세포의 경우, 1000 IU/mL, 말초혈액 단핵세포의 경우, 500 IU/ml을 사용하였다.
이후 제대혈 유래 자연살해세포의 배양은 다음과 같은 절차로 수행하였다: 배양 4일째에 1 v/v% 인간 혈장, 1000 IU/mL의 IL-2가 포함된 CellGro 배지를 동량으로 넣어준 뒤 다시 정치 배양하였다. 이후 2~3일 간격으로 세포수를 측정하여 1 x 106cells/mL이 되도록 1 V/V% 인간 혈장과 1000 IU/mL의IL-2가 포함된 CellGro 배지를 추가하여 14일까지 배양하였다. 배양 14일차 유전자 도입 T 지지세포를 1:2.5의 비율로 재자극하고 1 V/V% 인간 혈장과 OKT3, IL-2가 포함된 CellGro 배지에 배양하였다. 이후 2-3일 간격으로 세포수를 측정하여 1 x 106cells/mL이 되도록 1 V/V% 인간 혈장과 1000 IU/mL의IL-2가 포함된 CellGro 배지를 추가하여 14일 동안 추가 배양하여 총 28일 동안 세포를 배양하였다.
이후 말초혈액 유래 자연살해세포의 배양은 다음과 같다: 배양 4일째에 1 V/V% 인간 혈장, 500 IU/mL의 IL-2가 포함된 CellGro 배지를 동량으로 넣어준 뒤 다시 정치 배양하였다. 이후 2 - 3일 간격으로 세포수를 측정하여 1 x 106cells/mL이 되도록 1 V/V% 인간 혈장과 500 IU/mL의 IL-2가 포함된 CellGro 배지를 추가하여 11일까지 배양하였다. 배양 11일차 유전자 도입 T 지지세포를 1:2.5의 비율로 재자극하고 1 V/V% 인간 혈장과 OKT3, IL-2가 포함된 CellGro 배지에 배양하였다. 이후 2 - 3일 간격으로 세포수를 측정하여 1 x 106cells/mL이 되도록 1 V/V% 인간 혈장과 1000 IU/mL의 IL-2가 포함된 CellGro 배지를 추가하여 8 - 10일 동안 추가 배양하여 총 19 ~ 21일 동안 세포를 배양하였다.
배양된 세포는 1 x 106cells/mL이 되도록 동결배지에 부유하여, 온도제어 세포동결기를 이용하여 동결 후 액체질소에 보관한다.
배양된 자연살해세포의 증식률을 비교한 결과, CB-enFeeder는 약 80,000배, PBMC-enFeeder는 55,000배 증식하여 큰 차이는 없었다(표 21).
　 평균 STDEV
CB-enFeeder 79288.3 37381.0
PBMC-enFeeder 53649.3 16827.9
실시예 4.2. Raji 동물모델 효능평가
Raji-luci 세포주는 배양 최종일 암세포를 수거하고 PBS를 이용하여 세포 농도를 5 x 105cells/mL로 맞춘 후, 마우스당 0.2 mL (1 x 105cells/mouse)씩 꼬리 정맥에 주사하였다. 자연살해세포는 2 x 107cells/200μL로 꼬리 정맥에 주사하였고, 리툭산(이하 RTX, 맙테라주, 한국로슈)은 PBS를 이용하여 0.01μg/ 100μL농도로 희석하여 마우스 견갑부와 흉벽 사이의 약화 부위 피하에 100μL 주사하였다. NK세포는 암세포 이식 다음날 고정기를 이용하여 꼬리 정맥에 총 6회 투여하였고 RTX는 피하에 1회 투여하였다(표 22, 도 9a)
군 용량 투여경로 액량(μl) 마리수
1 동결배지+IgG 0.01 μg /head i.v+s.c 200+100 10
2 RTX 0.01 μg /head s.c 100 10
3 PBMC-enFeeder NK 2x107cells/head i.v 200 10
4 CB-eFeeder NK 2x107cells/head i.v 200 10
5 PB-eFeeder NK +RTX i.v+s.c 200+100 10
6 CB-eFeeder NK +RTX i.v+s.c 200+100 10
모든 동물의 관찰은 하루 2회 일반증상 및 사망동물을 관찰하였으며, 사망 여부를 관찰한 뒤 동결배지 대조군 및 자연살해세포 및 RTX 처리군의 중앙 생존기간(Median survival time)을 계산하여 생존율 연장효과를 평가하였다. Raji-luci 세포주 이식 후 2종의 자연살해세포 및 RTX 단독 및 병용 투여군에서는 26 - 122일에 걸쳐 사망동물이 관찰되었으며, 최종일(122일차)까지 중앙생존기간은 동결배지 대조군의 30일과 비교하여 RTX, PBMC-enFeeder, CB-enFeeder 단독 투여군에서는 48.5일, 43일 및 47일이었다. PBMC-enFeeder + RTX, CB-enFeeder + RTX 병용 투여군에서의 중앙생존기간은 55일 및 75.5일 이상으로 나타났다(표 23, 도 9b)
Raji-luci 모델 동결배지 RTX PBMC-enFeeder CB-enFeeder RTX +PBMC-enFeeder RTX +CB-enFeeder
평균생존율 29.5 48.5 43 47 55 75.5
실시예 4.3. Ramos 동물모델 효능평가
Ramos 세포주는 배양 최종일 암세포를 수거하고 PBS를 이용하여 세포 농도를 5 x 106cells/mL로 맞춘 후, 마우스당 0.2 mL(1 x 106cells/mouse)씩 꼬리 정맥에 주사하였다. 자연살해세포는 2 x 107cells/200μL로 꼬리 정맥에 주사하였고, RTX는 PBS를 이용하여 0.3μg/100μL 농도로 희석하여 마우스 견갑부와 흉벽 사이의 약화 부위 피하에 100μL 주사하였다. 자연살해세포는 암세포 이식 넷째 날부터 고정기를 이용하여 꼬리 정맥에 총 6회 투여하였고 RTX는 암세포 이식 셋째 날부터 고리 정맥에 6회 투여하였다(표 24, 도 10a).
군 용량 투여경로 액량(μl) 마리수
1 동결배지+IgG 0.3 μg /head i.v+i.v 200+100 10
2 RTX 0.3 μg /head i.v 100 10
3 PBMC-enFeeder NK 2x107cells/head i.v 200 10
4 CB-eFeeder NK 2x107cells/head i.v 200 10
5 PB-eFeeder NK +RTX i.v+i.v 200+100 10
6 CB-eFeeder NK +RTX i.v+i.v 200+100 10
모든 동물의 관찰은 하루 2회 일반증상 및 사망동물을 관찰하였으며, 사망 여부를 관찰한 뒤 동결배지 대조군 및 자연살해세포 및 RTX 처리군의 중앙 생존기간을 계산하여 생존율 연장 효과를 평가하였다. Ramos 세포주 이식 후 2종의 자연살해세포 및 RTX 단독 및 병용 투여군에서는 34 - 110일에 걸쳐 사망동물이 관찰되었으며, 최종일(124일차)까지 중앙생존기간은 동결배지 대조군의 31일과 비교하여 RTX, PBMC-enFeeder, CB-enFeeder 단독 투여군에서는 49.5일, 42일 및 42.5일이었다. PBMC-enFeeder + RTX, CB-enFeeder + RTX 병용 투여군에서의 중앙생존기간은 63.5일 및 87.5일로 나타났다(표 25, 도 10b)
Ramos 모델 동결배지 RTX PBMC-enFeeder CB-enFeeder RTX +PBMC-enFeeder RTX + CB-enFeeder
평균생존율 31 49.5 42 42.5 63.5 87.5
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.

Claims (26)

  1. 형질전환된 CD4+ T세포와 원료세포를 공동배양하는 단계를 포함하는 자연살해세포 배양방법.
  2. 제 1항에 있어서, 상기 형질전환된 CD4+ T세포는 4-1BBL 유전자, mbIL-21 유전자, OX40L 유전자 및 mTNF-α 유전자로 구성된 군으로부터 선택되는 적어도 하나의 유전자가 발현되는 것인, 자연살해세포 배양방법.
  3. 제 2항에 있어서, 상기 4-1BBL 유전자는 서열번호 1로 표시되는 아미노산 서열을 코딩하는 염기서열인 것인, 자연살해세포 배양방법.
  4. 제 3항에 있어서, 상기 서열번호 1로 표시되는 아미노산 서열을 코딩하는 염기서열은 서열번호 2로 표시되는 염기서열인, 자연살해세포 배양방법.
  5. 제 2항에 있어서, 상기 mbIL-21 유전자는 서열번호 3으로 표시되는 아미노산 서열을 코딩하는 염기서열인 것인, 자연살해세포 배양방법.
  6. 제 5항에 있어서, 상기 서열번호 3으로 표시되는 아미노산 서열을 코딩하는 염기서열은 서열번호 4로 표시되는 염기서열인, 자연살해세포 배양방법.
  7. 제 2항에 있어서, 상기 OX40L 유전자는 서열번호 5로 표시되는 아미노산 서열을 코딩하는 염기서열인 것인, 자연살해세포 배양방법.
  8. 제 7항에 있어서, 상기 서열번호 5로 표시되는 아미노산 서열을 코딩하는 염기서열은 서열번호 6으로 표시되는 염기서열인, 자연살해세포 배양방법.
  9. 제 2항에 있어서, 상기 mTNF-α 유전자는 서열번호 8로 표시되는 아미노산 서열을 코딩하는 염기서열인 것인, 자연살해세포 배양방법.
  10. 제 9항에 있어서, 상기 서열번호 8로 표시되는 아미노산 서열을 코딩하는 염기서열은 서열번호 9로 표시되는 염기서열인, 자연살해세포 배양방법.
  11. 제 2항에 있어서, 상기 유전자는 재조합 렌티 바이러스를 통해 도입된 것인, 자연살해세포 배양방법.
  12. 제 1항에 있어서, 상기 CD4+ T세포는 4-1BBL 유전자 또는 mbIL-21 유전자가 발현되는 것인, 자연살해세포 배양방법.
  13. 제 1항에 있어서, 상기 CD4+ T세포는 4-1BBL 유전자 및 mbIL-21 유전자가 발현되는 것인, 자연살해세포 배양방법.
  14. 제 1항에 있어서, 상기 CD4+ T세포는 4-1BBL 유전자, mbIL-21 유전자 및 mTNF-α 유전자가 발현되는 것인, 자연살해세포 배양방법.
  15. 제 1항에 있어서, 상기 CD4+ T세포는 4-1BBL 유전자, mbIL-21 유전자, OX40L 유전자 및 mTNF-α 유전자가 발현되는 것인, 자연살해세포 배양방법.
  16. 제 1항에 있어서, 상기 CD4+ T세포가 Hut78, H9, Jurkat, Loucy, Molt-3, Molt-13, Peer, RPMI8402 및 TALL-01 세포로 이루어진 군으로부터 선택되는 어느 하나인 것을 특징으로 하는, 자연살해세포 배양방법.
  17. 제 1항에 있어서, 상기 원료세포는 제대혈(cord blood) 유래 단핵세포인 것을 특징으로 하는, 자연살해세포 배양방법.
  18. 제 1항에 있어서, 상기 원료세포는 CD3(+) 세포가 제거된 세포인 것을 특징으로 하는, 자연살해세포 배양방법.
  19. 제 1항에 있어서, 형질전환된 CD4+ T세포와 원료세포의 비율을 0.1:1 내지 50:1로 혼합하여 배양하는 것을 특징으로 하는, 자연살해세포 배양방법.
  20. 제 1항에 있어서, 상기 원료세포는 지지세포와 1회 혼합하여 5일 내지 60일간 배양하거나, 지지세포와 2회 이상 혼합하여 60일 이상 배양하는 것을 특징으로 하는, 자연살해세포의 배양방법.
  21. 제 1항에 있어서, 항-CD3 항체 및 인터루킨 단백질이 함유된 배지에서 배양하는 것을 특징으로 하는, 자연살해세포 배양방법.
  22. 제 21항에 있어서, 상기 항-CD3 항체는 OKT3, UCHT1 및 HIT3a로 이루어진 군으로부터 선택되는 어느 하나를 포함하는 것을 특징으로 하는, 자연살해세포 배양방법.
  23. 제 21항에 있어서, 상기 인터루킨 단백질은 IL-2, IL-12, IL-15, IL-18 및 IL-21로 이루어진 군으로부터 선택되는 어느 하나를 포함하는 것을 특징으로 하는, 자연살해세포 배양방법.
  24. 제1항의 자연살해세포 배양방법에 의해 제조된 자연살해세포.
  25. 형질전환된 CD4+ T세포를 유효성분으로 포함하는 자연살해세포 배양용 조성물.
  26. 제 25항에 있어서,
    상기 형질전환된 CD4+ T세포는 4-1BBL 유전자, mbIL-21 유전자, OX40L 유전자 및 mTNF-α 유전자로 구성된 군으로부터 선택되는 적어도 하나의 유전자가 발현되는 것인, 조성물.
PCT/KR2019/015469 2018-11-14 2019-11-13 형질전환된 t세포를 이용한 제대혈 유래 자연살해세포의 배양방법 WO2020101361A1 (ko)

Priority Applications (8)

Application Number Priority Date Filing Date Title
AU2019381526A AU2019381526B2 (en) 2018-11-14 2019-11-13 Method for culturing cord blood-derived natural killer cells using transformed T-cells
EP19885404.4A EP3892721A4 (en) 2018-11-14 2019-11-13 METHOD FOR CULTIVATING NATURAL KILLER CELLS DERIVED FROM UMBILICAL CORD BLOOD USING TRANSFORMED T LYMPHOCYTES
CN201980075094.XA CN113383069A (zh) 2018-11-14 2019-11-13 使用转化的t细胞培养脐带血来源的自然杀伤细胞的方法
CA3120085A CA3120085A1 (en) 2018-11-14 2019-11-13 Method for culturing cord blood-derived natural killer cells using transformed t-cells
US17/293,835 US20240084256A1 (en) 2018-11-14 2019-11-13 Method for culturing cord blood-derived natural killer cells using transformed t-cells
SG11202104662UA SG11202104662UA (en) 2018-11-14 2019-11-13 Method for culturing cord blood-derived natural killer cells using transformed t-cells
JP2021526674A JP7179986B2 (ja) 2018-11-14 2019-11-13 形質転換されたｔ細胞を用いた臍帯血由来のナチュラルキラー細胞の培養方法
IL283176A IL283176A (en) 2018-11-14 2021-05-13 A method for growing blood-derived natural killer cells in culture using transduced T cells

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2018-0139722 2018-11-14
KR20180139722 2018-11-14
KR1020190145068A KR102338957B1 (ko) 2018-11-14 2019-11-13 형질전환된 t세포를 이용한 제대혈 유래 자연살해세포의 배양방법
KR10-2019-0145068 2019-11-13

Publications (1)

Publication Number Publication Date
WO2020101361A1 true WO2020101361A1 (ko) 2020-05-22

Family

ID=70730529

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/015469 WO2020101361A1 (ko) 2018-11-14 2019-11-13 형질전환된 t세포를 이용한 제대혈 유래 자연살해세포의 배양방법

Country Status (1)

Country Link
WO (1) WO2020101361A1 (ko)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11066644B2 (en) 2018-02-01 2021-07-20 Nkmax Co., Ltd. Method of producing natural killer cells and composition for treating cancer
WO2022216826A1 (en) * 2021-04-08 2022-10-13 Artiva Biotherapeutics, Inc. Treatment of cancer with nk cells and a cd38-targeted antibody
US11649294B2 (en) 2017-11-14 2023-05-16 GC Cell Corporation Anti-HER2 antibody or antigen-binding fragment thereof, and chimeric antigen receptor comprising same
US11766456B2 (en) 2014-11-26 2023-09-26 GC Cell Corporation Method for culturing natural killer cells using T cells

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102911918A (zh) * 2011-12-29 2013-02-06 上海交通大学医学院 一种基因工程细胞及其在nk细胞扩增中的应用
EP2856876A1 (en) * 2007-03-30 2015-04-08 Memorial Sloan-Kettering Cancer Center Constitutive expression of costimulatory ligands on adoptively transferred T lymphocytes
KR101520534B1 (ko) * 2012-05-07 2015-05-21 고려대학교 산학협력단 말초혈액단핵구 유래 자연 살해세포의 유도 및 증식 방법
KR20160063114A (ko) * 2014-11-26 2016-06-03 주식회사 녹십자랩셀 T 세포를 이용한 자연살해세포의 배양방법

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2856876A1 (en) * 2007-03-30 2015-04-08 Memorial Sloan-Kettering Cancer Center Constitutive expression of costimulatory ligands on adoptively transferred T lymphocytes
CN102911918A (zh) * 2011-12-29 2013-02-06 上海交通大学医学院 一种基因工程细胞及其在nk细胞扩增中的应用
KR101520534B1 (ko) * 2012-05-07 2015-05-21 고려대학교 산학협력단 말초혈액단핵구 유래 자연 살해세포의 유도 및 증식 방법
KR20160063114A (ko) * 2014-11-26 2016-06-03 주식회사 녹십자랩셀 T 세포를 이용한 자연살해세포의 배양방법

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
BIOSSEL L. ET AL., BIOLOGY OF BLOOD AND MARROW TRANSPLANTATION, vol. 14, 2008, pages 1031 - 1038
CONDIOTTI ET AL., EXPERIMENTAL HEMATOL., vol. 29, no. 1, 2001, pages 104 - 113
FIAS A.M. ET AL., EXPERIMENTAL HEMATOLOGY, vol. 36, no. 1, 2008, pages 61 - 68
FUJISAKI ET AL., CANCER RES., vol. 69, no. 9, 2009, pages 4010 - 4017
GONG ET AL., TISSUE ANTIGENS, vol. 76, no. 6, 2010, pages 467 - 475
GOODIER ET AL., J. IMMUNOL., vol. 165, no. 1, 2000, pages 139 - 147
MIN, BOKYUNG: "Identification of NK cell costimulatory receptors for large-scale expansion of NK cells for adoptive immunotherapy in cancer patients", PH.D. THESIS, May 2018 (2018-05-01), Korea Advanced Institute of Science and Technology, pages 1 - 143, XP055942600 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11766456B2 (en) 2014-11-26 2023-09-26 GC Cell Corporation Method for culturing natural killer cells using T cells
US11649294B2 (en) 2017-11-14 2023-05-16 GC Cell Corporation Anti-HER2 antibody or antigen-binding fragment thereof, and chimeric antigen receptor comprising same
US11970547B2 (en) 2017-11-14 2024-04-30 GC Cell Corporation Anti-HER2 antibody or antigen-binding fragment thereof, and chimeric antigen receptor comprising same
US11066644B2 (en) 2018-02-01 2021-07-20 Nkmax Co., Ltd. Method of producing natural killer cells and composition for treating cancer
WO2022216826A1 (en) * 2021-04-08 2022-10-13 Artiva Biotherapeutics, Inc. Treatment of cancer with nk cells and a cd38-targeted antibody

Similar Documents

Publication Publication Date Title
WO2018217064A2 (ko) 형질전환된 t세포를 이용한 자연살해세포의 배양방법
WO2020101361A1 (ko) 형질전환된 t세포를 이용한 제대혈 유래 자연살해세포의 배양방법
AU2016231061B2 (en) Methods for engineering allogeneic T cell to increase their persistence and/or engraftment into patients
WO2019182425A1 (ko) 신규 키메라 항원 수용체 암호화 유전자가 형질도입된 유전자 변형 nk 세포주 및 그의 용도
WO2021054789A1 (ko) 신규 키메라 항원 수용체 암호화 유전자가 형질도입된 유전자 변형 nk 세포주 및 그의 용도
WO2016048107A1 (ko) 인터페론-감마 또는 인터류킨-1베타를 처리한 줄기세포 또는 그 배양물을 포함하는 면역질환 또는 염증질환의 예방 또는 치료용 약학조성물
WO2020197318A1 (ko) Car 유전자가 도입된 nk 세포의 제조방법 및 그의 용도
WO2018056736A1 (ko) 신규 자연살해 세포주 및 그의 용도
JP2021519107A (ja) 膜結合型ＩＬ−１０を発現する遺伝子的にリプログラミングされたＴｒｅｇ
JP2022512450A (ja) Ｇｐｃ３を標的とする免疫エフェクター細胞およびその応用
WO2017146538A1 (ko) 조절 t 세포 매개성 질환의 예방 또는 치료용 약학적 조성물
WO2022025638A1 (ko) 면역시냅스를 안정화시키는 키메라 항원 수용체(car) t 세포
KR102338957B1 (ko) 형질전환된 t세포를 이용한 제대혈 유래 자연살해세포의 배양방법
WO2017003153A1 (ko) 제대혈 단핵세포 또는 이로부터 유래된 세포로부터 자연살해세포를 제조하는 방법
WO2016117960A1 (ko) 면역질환 치료 효능을 갖는 grim19이 과발현된 중간엽줄기세포 및 이의 용도
WO2022255793A1 (ko) 배양보조세포를 포함하는 자연살해세포 증식용 조성물
WO2021107635A1 (ko) Il-2 단백질 및 cd80 단백질을 포함하는 융합단백질 및 nk 세포를 포함하는 항암 치료용 조성물
Liu et al. Retrogenic ICOS expression increases differentiation of KLRG-1hiCD127loCD8+ T cells during Listeria infection and diminishes recall responses
WO2019059713A2 (ko) 자연살해세포의 제조방법 및 그의 용도
WO2021101270A1 (ko) 자연살해세포 배양용 조성물 및 이를 이용한 자연살해세포 제조방법
WO2023027471A1 (ko) 기능이 강화된 신규 키메라 항원 수용체(car)
WO2022158800A1 (ko) 면역세포 관용성 조절인자 과발현 줄기세포 및 이의 용도
WO2023167575A1 (ko) 저면역원성 줄기세포, 줄기세포로부터 분화되거나 유래된 저면역원성 세포 및 이의 제조방법
WO2022220648A1 (ko) Hla-dr 특이적 키메라 항원 수용체 및 이의 용도
WO2022010220A1 (ko) 면역원성이 감소된 신규한 이식용 세포

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19885404

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2021526674

Country of ref document: JP

Kind code of ref document: A

Ref document number: 3120085

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019381526

Country of ref document: AU

Date of ref document: 20191113

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2019885404

Country of ref document: EP

Effective date: 20210614