WO2022010220A1 - 면역원성이 감소된 신규한 이식용 세포 - Google Patents

면역원성이 감소된 신규한 이식용 세포 Download PDF

Info

Publication number
WO2022010220A1
WO2022010220A1 PCT/KR2021/008554 KR2021008554W WO2022010220A1 WO 2022010220 A1 WO2022010220 A1 WO 2022010220A1 KR 2021008554 W KR2021008554 W KR 2021008554W WO 2022010220 A1 WO2022010220 A1 WO 2022010220A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
seq
protein
hla
cell
Prior art date
Application number
PCT/KR2021/008554
Other languages
English (en)
French (fr)
Inventor
김현아
김승민
허정현
조성림
김효진
임호용
조성유
황유경
Original Assignee
주식회사 지씨쎌
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 지씨쎌 filed Critical 주식회사 지씨쎌
Priority to CN202180048711.4A priority Critical patent/CN115803436A/zh
Priority to US18/004,241 priority patent/US20230242894A1/en
Priority to EP21837627.5A priority patent/EP4177344A1/en
Priority to JP2022578885A priority patent/JP2023532645A/ja
Publication of WO2022010220A1 publication Critical patent/WO2022010220A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A61K39/4613—Natural-killer cells [NK or NK-T]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/70539—MHC-molecules, e.g. HLA-molecules
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0646—Natural killers cells [NK], NKT cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to a novel cell therapeutic agent with suppressed immunogenicity using gene editing for efficient allograft.
  • Natural killer cells account for about 10% of blood cells and are lymphoid cells that play an important role in immune response. NK cells perform several functions, but in particular, they have the ability to kill cancer cells or cells infected with exogenous pathogens, thereby removing abnormal cells that can become lesioned.
  • NK cells present in the body exist in an inactivated state in a normal state, but since activated NK cells are required to use them for therapeutic purposes, a study to activate NK cells from normal blood or patient blood is being actively pursued.
  • NK cells exhibit high cytotoxicity and thus can be applied as immune cell therapy.
  • the therapeutic effect of NK cells activated in vitro was administered after allogeneic bone marrow transplantation to patients with various cancers, particularly blood cancer such as leukemia ( Blood Cells Molecules & Disease , 33: p261-266, 2004).
  • NK cell inhibitory receptors by blocking the function of an inhibitory receptor that suppresses NK cell activity, it is intended to enhance the activity of NK cells.
  • methods using allogeneic NK cells from a donor that do not match the recipient's major histocompatibility complex (MHC) or blocking the function of inhibitory receptors with antibodies are mainly used. Allogeneic NK cells do not undergo activation inhibition because the donor's and recipient's MHC Class I genotypes are different, so the donor NK cell's inhibitory receptors (such as KIR) do not recognize the recipient's MHC Class I.
  • MHC major histocompatibility complex
  • allogeneic NK cells can be free from the inhibition of MHC Class I activity, which may still exist in cancer cells, and thus can be expected to exhibit more effective anticancer activity than the patient's own NK cells.
  • HSCT allogeneic hematopoietic stem cell transplantation
  • IL-2 can be a big problem because it can amplify regulatory T cells (Tregs) that suppress the anticancer immune response in addition to NK cells (Romagne F, Vivier E., F1000 Med Rep, 3:9, 2011; Waldmann TA., Nat Rev Immunol, 6:595-601, 2006).
  • the present inventors have made intensive research efforts to develop an effective cell therapeutic agent that maintains long-term activity while minimizing immune rejection in the body of a patient.
  • a gene editing means targeting a specific part of the type II HLA gene or its activating protein, specifically CIITA, and a specific part of the B2M gene, which is one of the immunogenicity-inducing factors is introduced into therapeutic cells, immunogenicity is suppressed.
  • the present invention was completed by discovering that the efficiency was maximized and it could be used as an excellent cell therapy for allogeneic transplantation.
  • an object of the present invention is to provide a composition for inhibiting immunogenicity of mammalian cells and low immunogenicity mammalian cells prepared using the same.
  • Another object of the present invention is to provide a method for producing a hypoimmunogenic mammalian cell.
  • composition for inhibiting the immunogenicity of mammalian cells comprising a nucleic acid molecule that inhibits the expression of type II HLA protein as an active ingredient.
  • the present inventors have made intensive research efforts to develop an effective cell therapeutic agent that maintains long-term activity while minimizing immune rejection in the body of a patient.
  • a gene editing means targeting a specific part of the type II HLA gene or its activating protein, specifically CIITA, and a specific part of the B2M gene, which is one of the immunogenicity-inducing factors is introduced into therapeutic cells, immunogenicity is suppressed. It was found that the efficiency is maximized and it can be used as an excellent cell therapy for allogeneic transplantation.
  • nucleic acid molecule has a meaning comprehensively including DNA (gDNA and cDNA) and RNA molecules. Analogs are also included (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews , 90:543-584 (1990)).
  • the term “inhibition of expression” means to cause a decrease in the activity or expression of the target gene, thereby making the target gene undetectable or present at an insignificant level, as well as the target gene. It means to reduce the activity or expression to the extent that the biological function of the drug can be significantly reduced.
  • the nucleic acid molecule for suppression of expression of the present invention is specifically a nucleic acid molecule complementary to the sequence of a target gene, and includes, for example, shRNA, siRNA, miRNA, gRNA (guideRNA) and antisense oligonucleotide, but is not limited thereto. Nucleic acid molecules, which are known means for inhibiting the expression of all genes, may be used.
  • the nucleic acid molecule is a guide RNA (gRNA) that specifically recognizes a nucleotide sequence encoding the type II HLA protein or an activating protein thereof or a nucleotide encoding the gRNA.
  • gRNA guide RNA
  • gRNA guideRNA
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • gRNA can be selectively hybridized by having a sequence complementary to a target nucleotide sequence.
  • complementary means that the gRNA is sufficiently complementary to selectively hybridize to a target sequence under certain annealing or hybridization conditions, and is substantially complementary and perfectly complementary. It is meant to encompass all of them, and preferably means a completely complementary case.
  • substantially complementary sequence is meant to include not only a completely identical sequence, but also a sequence that is partially mismatched with a sequence to be compared within the range that can function as a gRNA by annealing to a specific sequence.
  • the nucleotides to specifically recognize and suppress expression are interpreted to include sequences showing substantial identity to the known sequence of the type II HLA gene.
  • the substantial identity is at least 70% when the sequence of the known gene and any other sequence are aligned to match as much as possible, and the aligned sequence is analyzed using an algorithm commonly used in the art. It means a sequence that exhibits homology, specifically 80% homology, more specifically 90% homology, and most specifically 95% homology.
  • Alignment methods for sequence comparison are known in the art. Various methods and algorithms for alignment are described in Huang et al., Comp. Appl. BioSci. 8:155-65 (1992) and Pearson et al., Meth. Mol. Biol.
  • NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403-10(1990)) is accessible from the National Center for Biological Information (NBCI), etc. It can be used in conjunction with sequencing programs such as blastx, tblastn and tblastx.
  • the activating protein of the type II HLA protein is a transactivator for the type II HLA protein, and more specifically, a Class II Major Histocompatibility Complex Transactivator (CIITA) protein.
  • CIITA Class II Major Histocompatibility Complex Transactivator
  • the composition further comprises RNA-induced endonuclease or RNA-induced endonuclease encoding nucleotides.
  • RNA-induced endonuclease is an enzyme that cuts a target gene by being induced by gRNA that recognizes a target gene site, and this RNA-induced endonuclease may be delivered in the form of mRNA or protein, It can also be delivered to a target cell by transforming it with a vector loaded with the coding DNA.
  • RNP complex bonucleoprotein complex
  • RNP complex refers to comprising the guide RNA and RNA-induced endonuclease as active ingredients, and the complex recognizes and binds to a target sequence, and selectively nicking or can be cut
  • the RNA complex may be, for example, a Cas9-gRNA complex, but is not limited thereto.
  • the RNA-induced endonuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas 13a, Cas 13b, Cas 13c, Cas 13d, Cpf1, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr4, Cmr4 , Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4 and MAD
  • nucleotide has a meaning inclusive of DNA (gDNA and cDNA) and RNA molecules.
  • the nucleotide which is the basic structural unit of a nucleic acid molecule, includes not only natural nucleotides, but also analogs in which sugar or base regions are modified. It is clear to those skilled in the art that the nucleotide sequence encoding the gRNA or RNA-induced endonuclease in the present invention is not limited to the nucleotide sequence described in the accompanying sequence listing.
  • a mutation in a nucleotide does not result in a change in a protein (eg, an endonuclease), but such a nucleic acid is a functionally equivalent codon, a codon encoding the same amino acid by degeneracy of the codon, or a biologically equivalent It encompasses all nucleic acid molecules having codons encoding one amino acid.
  • the gRNA is SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: A nucleotide sequence selected from the group consisting of sequence 40 and SEQ ID NO: 44 of SEQ ID NO: or a complementary sequence thereof is specifically recognized.
  • the composition of the present invention further comprises a nucleic acid molecule that inhibits the expression of ⁇ 2-microglobulin protein.
  • the nucleic acid molecule is a guide RNA (gRNA) that specifically recognizes a nucleotide sequence encoding the ⁇ 2-microglobulin protein or a nucleotide encoding the gRNA.
  • gRNA guide RNA
  • the guide RNA is a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 14, or a complementary sequence thereof to specifically recognize
  • the composition further comprises a nucleic acid molecule encoding a type I HLA protein.
  • the type I HLA protein is an HLA-E protein.
  • cytokines such as IL-2 can amplify regulatory T cells (Tregs) that suppress anticancer immune responses. Therefore, an adverse effect may occur in anticancer treatment (Romagne F, Vivier E., F1000 Med Rep, 3:9, 2011; Waldmann TA., Nat Rev Immunol, 6:595-601, 2006). Accordingly, the present inventors tried to introduce HLA-E, which can prevent cell death by stimulating the inhibitory receptor CD94/NKG2A on therapeutic cells such as immune cells or stem cells.
  • the term “express” means that a gene is transferred into a cell of a subject by artificially introducing it using a gene delivery system to allow a subject cell to express an exogenous gene or to increase the natural expression level of an endogenous gene. It means that replication becomes possible as an extrachromosomal factor in in or by the completion of chromosomal integration.
  • expression is synonymous with “transformation”, “transfection” or “transduction”.
  • gene delivery system refers to any means of delivering a gene into a cell, and gene delivery has the same meaning as intracellular transduction of a gene. At the tissue level, the term gene transfer has the same meaning as the spread of a gene. Accordingly, the gene delivery system of the present invention can be described as a gene penetration system and a gene diffusion system.
  • the nucleotide sequence of the present invention is preferably present in a suitable expression construct.
  • the nucleotide sequence of the present invention is preferably operably linked to a promoter.
  • operably linked refers to a functional association between a nucleic acid expression control sequence (eg, a promoter, signal sequence, or an array of transcriptional regulator binding sites) and another nucleic acid sequence, whereby the Regulatory sequences will control the transcription and/or translation of said other nucleic acid sequences.
  • the promoter bound to the nucleotide sequence of the present invention is specifically capable of regulating the transcription of the HLA-E gene by operating in animal cells, more specifically mammalian cells, and a promoter derived from a mammalian virus and a mammalian cell.
  • CMV mammalian cytomegalovirus
  • the nucleotide sequence of the HLA-E gene can be applied to any gene delivery system used for conventional gene introduction, preferably a plasmid, adenovirus (Lockett LJ, et al., Clin. Cancer Res. 3:2075-2080 ( 1997)), adeno-associated viruses (AAV, Lashford LS., et al., Gene Therapy Technologies, Applications and Regulations Ed. A. Meager, 1999), retroviruses (Gunzburg WH, et al., Retroviral vectors. Gene Therapy Technologies, Applications and Regulations Ed. A. Meager, 1999), Lentivirus (Wang G. et al., J. Clin. Invest.
  • adenovirus Lickett LJ, et al., Clin. Cancer Res. 3:2075-2080 ( 1997)
  • adeno-associated viruses AAV, Lashford LS., et al., Gene Therapy Technologies, Applications and Regulations Ed. A. Meager, 1999
  • the gene delivery system of the present invention can be prepared by applying the nucleotide molecule of the present invention to a lentivirus.
  • the contacting step is carried out according to a viral infection method known in the art. Infection of host cells with viral vectors is described in the references cited above.
  • the cells into which the composition of the present invention is introduced are allogeneic or autologous cells for transplantation, and more specifically, allogeneic cells for transplantation.
  • the cells are stem cells or immune cells.
  • stem cells refers to undifferentiated cells in the stage before differentiation into each cell constituting a tissue, and refers to cells having the ability to differentiate into specific cells under a specific differentiation stimulus (environment). .
  • Stem cells unlike differentiated cells in which cell division is stopped, can produce the same cells as themselves by cell division (self-renewal), and when a differentiation stimulus is applied, they can be differentiated into various cells depending on the nature of the stimulus. , is characterized by the flexibility of differentiation (plasticity).
  • the stem cells to which the present invention is applied are not limited, and the characteristics of stem cells, that is, cells having undifferentiated, indefinite proliferation and differentiation ability into specific cells, are cells to which the present invention can be applied.
  • the stem cells used in the present invention are mesenchymal stem cells or totipotent stem cells.
  • meenchymal stem cells refers to stem cells having multipotency capable of differentiation into adipocytes, osteocytes, chondrocytes, muscle cells, nerve cells, and cardiomyocytes. Mesenchymal stem cells are identified through their vortex shape and expression levels of the basic cell surface markers CD73(+), CD105(+), CD34(-), and CD45(-). One of the important characteristics of mesenchymal stem cells is that they also have the function of regulating the immune response.
  • Mesenchymal stem cells have the ability to differentiate into bone tissue, central nervous system tissue, skin tissue, and muscle tissue, and thus can be used for regeneration of these tissues physically lost through appropriate differentiation inducers, as well as T-cells, B-cells , it has been reported that it exerts a strong immunomodulatory effect by inhibiting the proliferation, function and activity of natural killer cells (NK-cells) and dendritic cells, causing unwanted or excessive immune responses. It can also be applied to the treatment of various diseases such as transplant rejection, autoimmune diseases, inflammatory diseases and allergic diseases. Accordingly, when the present invention is applied to mesenchymal stem cells, it can be applied to regenerative treatment in various degenerative diseases or treatment of autoimmune/inflammatory diseases.
  • the term "pluripotent stem cell (pluripotent stem cell)” refers to a stem cell capable of differentiating into cells constituting endoderm, mesenchymal, and ectoderm as a cell in a more advanced state than a fertilized egg.
  • the totipotent stem cells used in the present invention are embryonic stem cells (Embryonic Stem Cell, ESC), embryonic germ cells, embryonic tumor cells (Embryonic Carcinoma Cell) or induced pluripotent stem cells. Cells (induced pluripotent stem cells, iPSCs), more specifically, induced pluripotent stem cells.
  • induced pluripotent stem cell is one of pluripotent stem cells artificially derived by inserting a specific gene related to an undifferentiated or pluripotent phenotype into a non-pluripotent cell (eg, a somatic cell).
  • Inducible pluripotent stem cells are natural, such as embryonic stem cells, in that they have stem cell gene and protein expression, chromosome methylation, doubling time, embryoid body formation, teratoma formation, viable chimera formation, hybridization and differentiation. It is considered in the art to have the same phenotypic, physiological and developmental characteristics as those of pluripotent stem cells.
  • immune cell refers to any cell involved in the initiation or promotion of an immune response, and more specifically refers to an immune effector cell.
  • Immune cells include, but are not limited to, for example, T cells, B cells, natural killer (NK) cells, natural killer T (NKT) cells, and mast cells. More specifically, the immune cells are natural killer cells.
  • the present invention When the present invention is applied to immune cells, it can be applied to the treatment of tumors and infectious diseases.
  • the NK cells prepared by the method according to the present invention can be applied to all types of tumors including solid cancer and blood cancer.
  • solid cancer refers to cancer formed by forming a lump in an organ, and cancer occurring in most organs corresponds to this cancer.
  • Tumors that can be treated using the NK cells according to the present invention are not particularly limited, and gastric cancer, liver cancer, lung cancer, colorectal cancer, breast cancer, prostate cancer, ovarian cancer, pancreatic cancer, cervical cancer, thyroid cancer, laryngeal cancer, acute myeloid leukemia, brain tumor, Neuroblastoma, retinoblastoma, head and neck cancer, salivary gland cancer, lymphoma, etc., but is not limited thereto.
  • Infectious diseases that can be treated using the immune cells of the present invention are diseases caused by virus or pathogen infection, and include all diseases that can be transmitted and infected through respiratory, blood, and skin contact. Such infectious diseases include, but are not limited to, for example, hepatitis B and C, human papilloma virus (HPV) infection, cytomegalovirus infection, viral respiratory disease, influenza. .
  • the term “treatment” refers to (a) inhibiting the development of a disease, disorder or condition; (b) alleviation of the disease, condition or condition; or (c) eliminating the disease, condition or symptom.
  • the stem cells into which the immunogenicity-suppressing composition of the present invention is introduced are administered to a subject, it serves to inhibit, eliminate, or alleviate the development of symptoms due to excessive or unwanted immune responses, and the immunogenicity-suppressing composition of the present invention
  • the introduced immune cells are administered to a subject, by inducing apoptosis of cancer cells or infected cells, they also serve to suppress, eliminate, or alleviate the development of symptoms due to tumors or infectious diseases.
  • composition of the present invention may be a cell therapeutic composition for a disease itself, or may be administered together with other pharmacological ingredients to be applied as a therapeutic adjuvant for the disease.
  • treatment or “therapeutic agent” includes the meaning of “therapeutic adjuvant” or “therapeutic adjuvant”.
  • administering refers to directly administering a therapeutically effective amount of the composition of the present invention to a subject so that the same amount is formed in the subject's body.
  • the term “therapeutically effective amount” refers to the content of the composition contained in an amount sufficient to provide a therapeutic or prophylactic effect to an individual to whom the composition of the present invention is to be administered, which includes a “prophylactically effective amount”. it means
  • the term “subject” includes, without limitation, a human, mouse, rat, guinea pig, dog, cat, horse, cow, pig, monkey, chimpanzee, baboon or rhesus monkey. Specifically, the subject of the present invention is a human.
  • the present invention provides a low immunogenic mammalian cell prepared using the above-described composition of the present invention.
  • composition for inhibiting immunogenicity of the present invention and the target cell into which the composition is to be introduced have already been described above, description thereof will be omitted to avoid excessive overlap.
  • a method for producing a hypoimmunogenic mammalian cell comprising the steps of:
  • the immunogenicity-inducing gene is first suppressed, and then the attack from the recipient's NK cells. It was found that when the process of introducing a gene for suppressing the cells is sequentially performed, excellent growth characteristics, viability, and activity of cells appear.
  • HLA-E when HLA-E is introduced first, even if the B2M gene is removed, the expression of HLA-E continues, so that in the culture process, NK cells having the HLA-ABC - /HLA-E + phenotype. Contrary to the expectation that survival and growth could be maintained, the yield of cells with HLA-ABC - /HLA-E + characteristics was very low. Until now, it was confirmed that the optimal process sequence for preparing the low-immunogenic mammalian cells of the present invention was high, showing a high yield in which 96% or more of cells having the HLA-ABC - /HLA-E + properties were present.
  • step (a) may be performed using a nucleic acid molecule for inhibiting expression of each of the above-described proteins and an endonuclease. Since these nucleic acid molecules and endonucleases have already been described above, their description is omitted to avoid excessive duplication.
  • the step (b) is performed 1 to 5 days after the completion of the step (a), more specifically 2 to 5 days later, and most specifically It is done after 3 days.
  • the present invention provides a composition for inhibiting immunogenicity of mammalian cells and a method for producing low-immunogenicity mammalian cells using the same.
  • the present invention is useful as an efficient cell therapeutic agent that maintains long-term activity while minimizing immune rejection in the recipient's body in allogeneic transplantation of cells for the treatment of diseases such as stem cells or immune cells can be
  • FIG. 1 is a diagram showing the results of measuring the HLA-ABC expression level by FACS 3 days after gRNA treatment for the B2M gene.
  • FIG. 2 is a diagram showing the results of measuring the knock-out efficiency of the B2M gene according to the concentration of the shuttle used for delivery of the gene editing system of the present invention.
  • Figure 3 is a diagram showing the change in the HLA-ABC expression ratio according to the culture of the B2M gene knock-out NK cells.
  • FIG. 4 is a diagram showing the results of increasing the viability of B2M- NK cells by HLA-E transduction.
  • FIG. 5 is a diagram showing the viability and growth rate of B2M knock-out or HLA-E transformed NK cells.
  • FIG. 6 is a diagram showing the Log-NK phenotype and production efficiency according to the production method.
  • FIG. 7 is a diagram showing the expression levels of HLA-ABC and HLA-E according to the incubation time of Log-NK.
  • FIG. 8 is a diagram showing the expression level of NK characteristic markers at the end of Log-NK culture.
  • FIG. 9 is a diagram showing the cell viability and growth rate according to the culture of Log-NK.
  • FIG. 10 is a diagram showing the results of evaluating the cancer cell line killing ability of Log-NK, the degree of dissolution of the K562 cancer cell line by wild-type NK cells or Log-NK cells ( FIG. 10a ), and wild-type NK cells and K562 target cells when in contact The changes in the cytokine expression level of Log-NK cells (FIG. 10b) are respectively shown.
  • Figure 11a shows the ratio of wild-type NK cells lysed by CD8(+) T cells using calcein AM
  • Figure 11b shows the ratio of wild-type NK cells and Log-NK cells lysed by CD8(+) cells using CFSE. The long-term observation results of each are shown.
  • FIG. 12 is a diagram showing the results of confirming the suppression of the expression of type II HLA gene by CIITA gene knock-out in NK cells through flow cytometry.
  • FIG. 13 is a diagram showing the results of confirming the suppression of the expression of the type II HLA gene according to the culture time point after knock-out of the CIITA gene in NK cells through flow cytometry.
  • FIG. 14a is a schematic diagram summarizing a process for preparing NK cells in which B2M and CIITA genes have been simultaneously removed
  • FIG. 14b is a double knock-out efficiency of B2M and CIITA in NK cells prepared by each method of FIG. 14a.
  • 14c and 14f are diagrams showing sequences of on-target and off-target predicted regions of gRNA in B2M and CIITA genes, respectively.
  • 14d and 14e are diagrams showing that indels/indels did not occur in the three off-target predicted sites of B2M.
  • 14G and 14H are diagrams showing that insertion/deletion did not occur at two off-target predicted sites of CIITA.
  • FIG. 15 is a diagram showing the proliferation rate and survival rate of Log-NK-CIITA KO cells prepared by the production method 1 ( FIG. 15a ) and the production method 2 ( FIG. 15b ) of FIG. 14a , respectively.
  • FIG. 16 is a diagram showing the results of confirming the phenotype of Log-NK-CIITA KO cells during the culture period, and suppression of expression of HLA-ABC and HLA-DR/DP/DQ ( FIG. 16a ) and expression of HLA-E ( FIG. 16A ) 16b) respectively.
  • FIG. 17 shows the results of measuring the cancer cell killing ability of Log-NK-CIITA KO cells using Calcein-AM (FIG. 17a) and CFSE (FIG. 17b) cell staining methods, respectively.
  • FIG. 18 is a diagram showing the results of confirming the knock-out efficiency of B2M (FIG. 18a) and CIITA (FIG. 18b) genes by various gRNA delivery methods.
  • FIG. 19 is a result of confirming whether the Log-NK-CIITA KO cells of the present invention can evade the attack of the recipient's CD8(+) T cells (FIG. 19A) and CD4(+) T cells (FIG. 19B) It is a picture that shows
  • NK cord blood natural killer, CBNK
  • ⁇ 2m which is common to HLA-A, HLA-B, and HLA-C, which are human leukocyte antigens (HLA) present on the cell surface, is created by expression from the B2M gene.
  • HLA-ABC human leukocyte antigens
  • RNA reaction solution a complex of gRNA and nuclease
  • RNP ribonucleoprotein
  • Cpf1 nuclease (Feldan Therapeutics) of 3.32 ⁇ L in 26.84 ⁇ L of 1 X PBS or 4 ⁇ L of MAD7 nuclease (Feldan Therapeutics) in 26 ⁇ L of 1 X PBS and various sequences of gRNA (IDT) cleaving the B2M gene Synthesized by Co., Ltd., 10 ⁇ M) 20 ⁇ L of each was mixed and reacted at room temperature for at least 5 minutes to obtain an RNP reaction solution.
  • IDT gRNA
  • the prepared RNP reaction solution has a capacity that can be used up to the number of cells in the range of 1 to 4 X 10 6 , and in this example, after measuring the number of cells using an ADAM cell counter system (Nano Entec), 2 X 10 6 NK cells were used. 2 X 10 6 NK cells were put in a separate 1.5 mL centrifuge tube, and the supernatant was removed after centrifugation at 2000 rpm for 3 minutes. After adding 500 ⁇ L of 1 X PBS, centrifugation was performed at 2000 rpm for 3 minutes to remove the supernatant, leaving only the cells.
  • gRNA guide RNA
  • benchling ttps://benchling.com
  • CRISPR RGEN Tools www.rgenome.net
  • HLA-ABC expression was confirmed by FACS to evaluate the knock-out efficiency of each gRNA.
  • Antibodies for FACS analysis of NK cell phenotypes marker Antibody information (fluorescence/manufacturer/product number) Antibody usage human CD56 APC/BD Bioscience/555518 5 ⁇ L Human HLA-ABC BV421 / BD Bioscience / 565332 0.5 ⁇ L human CD3 FITC / BD Bioscience / 555332 5 ⁇ L 7-AAD PerCp-Cy5.5 / Beckmen Coulter / A07704 5 ⁇ L
  • gRNA candidate sequences targeting B2M SEQ ID NO: order length (bp) nuclease cut position B2M knock-out % (FACS) note One ATCCATCCGACATTGAAGTT 20 Cpf1 exon 2 23 2 ATCCATCCGACATTGAAGTTG 21 Cpf1 exon 2 9 SEQ ID NO:1+1nt 3 ATCCATCCGACATTGAAGTTGAC 23 Cpf1 exon 2 0.8 sequence 1+2nt 4 TTAGAGTCTCGTGATGTTTAAG 22 Cpf1 promoter 0.5 5 CCGAUAUUCCUCAGGUACUCCA 22 Cpf1 exon 2 5 6 ATATAAGTGGAGGCGTCGCGC 21 Cpf1 exon 1 1.1 7 ATATAAGTGGAGGCGTCGCGCTG 23 Cpf1 exon 1 0.6 SEQ ID NO:6+2nt 8 AGTGGGGGTGAATTCAGTGTA 21 Cpf1/ MAD7 exon 2 69.5 9 AGTGGGGGTGAATTCAGTGTAGT 23
  • genomic DNA was isolated and whole genome sequencing was performed.
  • a genomic DNA sequence having 4 or less nucleic acid sequences mismatched with the gRNA sequence was assumed to be a site with potential off-target, and it was checked whether insertion/deletion by off-target actually occurred.
  • three off-target predicted sites were identified, and by checking the sequencing results for gene insertion/deletion, it was confirmed that insertion/deletion did not occur in the two expected sites, and insertion/deletion was not observed at chromosome 4 It was found, but it was an indel/deletion seen at the same position as the control NK.
  • B2M knock-out using #8 and #9 gRNA did not cause mutation in the off-target predicted site (Appendix 1).
  • the RNP reaction solution was delivered into the cell using the peptide delivery agent Shuttle (Feldan therapeutics), but electroporation, lipofectamine, cationic polymer (eg poly arginine), etc.
  • peptide delivery agent Shuttle Feldan therapeutics
  • lipofectamine eg poly arginine
  • cationic polymer eg poly arginine
  • Knock-out of the B2M gene was performed using the shuttle protein.
  • the sequence of the shuttle used is shown in Table 3, and knock-out of the B2M gene was performed in the same manner as described in Example 1.
  • B2M KO NK A group in which only NK cells were isolated (B2M KO NK), a group in which scHLA-E was transduced into wild-type CBNK (HLA-E TD NK), and only NK cells in which the B2M gene was knocked out were isolated and transduced with scHLA-E.
  • HLA-E TD NK a group in which scHLA-E was transduced into wild-type CBNK
  • B2M gene was knocked out were isolated and transduced with scHLA-E.
  • Each group (B2M KO/HLA-E TD NK) was prepared and an in vitro apoptosis assay was performed.
  • HLA-E gene it is known to suppress the recipient, the foreign cells attacked by the host's NK cells this B2M gene knock-introduced to the out (knock-out) of NK cells, and thus B2M - / the HLA-E + expression characteristics
  • Eggplant as an allogeneic hypoimmunogenic NK cell was expected to be able to evade attack by the host's CD8(+) T cells and NK cells when injected into the body.
  • NK cells in which the B2M gene was knocked out were isolated.
  • the B2M gene knock-out and NK cells were removed and the supernatant was collected the cells by centrifugation, and the 1X10 7/100 MACS buffer (0.5% FBS (GIBCO), 2 mM EDTA (Invitrogen into ⁇ L concentrations) dissolved in PBS ( Lonza)), add 10 ⁇ g of biotin-conjugated B2M antibody (Invitrogen, MA1-19506) per 100 ⁇ L and stain at 4°C for 15 minutes, then add 2 mL of MACS buffer, 1200 rpm, 5 minutes During centrifugation, the supernatant was removed.
  • NK cells were suspended in 80 ⁇ L of MACS buffer, mixed with 20 ⁇ L of anti-biotin microbeads (Miltenyi Biotec, 130-090-485) and reacted at 4° C. for 15 minutes, 2 mL of washing buffer (Miltenyi Biotec, 130-091-222) was added, centrifuged at 1200 rpm for 10 minutes, and then the supernatant was removed. NK cells were suspended in 500 ⁇ L of wash buffer. An LS column (Miltenyi Biotec) was fixed on a QuadroMACSTM Separator (Miltenyi Biotec), washed with 2 mL of washing buffer, and the suspended NK cells were flowed through the column.
  • washing buffer was flowed twice to recover B2M knock-out cells not bound to the column.
  • the cells were suspended in NK cell medium at a concentration of 1 x 10 6 /ml, and then cultured in a well plate culture vessel of an appropriate size.
  • a lentiviral vector was used to express single-chain HLA-E triplex (scHLA-E) in NK cells.
  • the single-stranded HLA-E triplet used in the present invention uses the amino acid sequence disclosed in US20050196404A1, and its coding nucleic acid sequence was used by performing codon optimization (SEQ ID NO: 46).
  • a lentiviral vector expressing a codon-optimized single-stranded triplex sequence was produced by Flash Therapeutics (France).
  • scHLA-E To transduce scHLA-E into NK cells, a complex of 50 MOI (Multiplicity of Infection) scHLA-E lentiviral vector and 10 ⁇ g/mL Protransduzin-A (immundiagnostik /A 2115AG.1) was prepared and incubated at room temperature for at least 5 minutes. After leaving, the NK cells contained in the culture vessel were treated. 6 ⁇ M of 5Z-7-Oxozeaenol (TOCRIS #360420) and 20 ng/mL of IL-21 (Biolegend / 571204) were co-treated in the medium to promote the introduction and expression of the lentiviral vector into cells.
  • MOI Multiplicity of Infection
  • Protransduzin-A immunodiagnostik /A 2115AG.1
  • 6 ⁇ M of 5Z-7-Oxozeaenol TOCRIS #360420
  • 20 ng/mL of IL-21 Biolegend / 571204
  • Antibodies for FACS analysis of NK cell phenotypes marker Antibody information (fluorescence/manufacturer/product number) Antibody usage human CD56 APC/BD Bioscience/555518 5 ⁇ L Human HLA-ABC BV421 / BD Bioscience / 565332 0.5 ⁇ L human CD3 FITC / BD Bioscience / 555332 5 ⁇ L Human HLA-E PE / Biolegend / 342604 1 ⁇ L 7-AAD PerCp-Cy5.5 / Beckmen Coulter / A07704 5 ⁇ L
  • Example 4 Hypoimmunogenic NK cells in vitro characterization
  • NK cells wild-type CBNK, B2M - NK, HLA-E + NK, B2M - /HLA-E + NK
  • assay medium which is RPMI 1640 medium (Gibco, 11875093) with added, and float at a concentration of 1 X 10 6 /ml, 30 ⁇ L Calcein-AM (Molecular probe, C34852) was added, and then CO at 37°C for 1 hour. 2 was reacted in an incubator.
  • PBNK NK cells derived from donor peripheral blood
  • CBNK NK cells derived from donor cord blood
  • a round-bottom 96-well plate 100 ⁇ L of effector cells prepared in a ratio of 30:1 or 10:1 were put into 3 wells each, and then 100 ⁇ L of target cells at a concentration of 1 x 10 5 /mL were put into each well.
  • Span (spontaneous release) wells and max (maximum release) wells were prepared to calculate the cell killing ability by a formula.
  • 100 ⁇ L of stained target cells were added to the span wells, and 100 ⁇ L of assay medium was added each.
  • max (maximum release) wells 100 ⁇ L of stained target cells were put into each well, and 100 ⁇ L of 2% Triton-X 100 solution was put into each well.
  • the medium value by adding 200 ⁇ L of the assay medium, and add 100 ⁇ L of the 2% Triton-X 100 solution to 100 ⁇ L of the assay medium.
  • the value of the mixed solution was prepared.
  • the difference (A) obtained by subtracting the value of the mixed solution from the value of the medium was added to the max value to correct the autofluorescence value. After blocking the light and reacting in a CO 2 incubator at 37° C. for 4 hours, the plate was centrifuged at 2,000 rpm for 3 minutes.
  • Cell killing capacity (%) (Sample well average fluorescence value - span well average fluorescence value)/
  • NKG2A and NKG2C expression in effector cells effector cell NKG2A expression (%) NKG2C expression (%) PBNK (donor A) 31 48 PBNK (donor B) 76 17 CBNK (donor 1) 96 17
  • the B2M gene was knocked out to suppress HLA-ABC expression, and Log-NK cells prepared by transducing the HLA-E gene were prepared by four methods as shown in Table 6.
  • the region in the second quadrant of the graph (bold solid line) represents Log-NK cells.
  • B2M gRNA was treated on the 7th day, the initial point of NK cell culture, and 3 days later, only B2M- cells were isolated and then scHLA-E was introduced and expressed. As a result, 96% or more until the end of the culture It was confirmed that Log-NK cells were present.
  • scHLA-E was first introduced and expressed on the 14th day, which is the 1/3 point of the entire culture, and B2M was removed after 3 days to separate B2M-cells. Since cells expressing HLA-E can evade attack by other NK cells, it was expected that even if the B2M gene was removed, the expression of HLA-E would continue and the survival and growth of cells could be maintained.
  • the NK cell production efficiency was low (about 13%) and the existing Log-NK cells decreased with the passage of culture time, so there were no remaining Log-NK cells at the time of termination.
  • CBNK or Log-NK was cultured with restimulation using support cells on the start day of culture, on the 14th day of culture, and on the 28th day of culture.
  • Supportive cells used for culture were CD4+ T cells transformed with 4-1BBL, mbIL-21 (membrane bound IL-21) and mTNF- ⁇ (membrane TNF- ⁇ ) genes. Restimulation using support cells is possible at intervals of 14 to 16 days.
  • Log-NK cells that have been stationary cultured in an appropriate culture vessel are cultured for up to 39 days, then frozen, and can be cultured for up to 42 days depending on the cell growth rate. If culture for more than 42 days is required, continuous culture is possible by restimulation with support cells on the 42nd day of culture.
  • NK or Log-NK cells are stained with the antibody of Table 7 to determine whether the Log-NK (HLA-ABC - /HLA-E + ) phenotype is maintained in CD3 - /CD56 + NK cells with purity until the end of the culture. Confirmed. As a result, it was confirmed that Log-NK cells maintained HLA-ABC gene expression below 5%, and HLA-E expression level (mean fluorescence intensity, MFI) of each cell was maintained stronger than that of wild-type NK cells ( Fig. 7).
  • MFI mean fluorescence intensity
  • Log-NK cells prepared by Preparation Method 1 showed similar cell viability compared to wild-type NK cells from the 10th day of culture, when the production process was completed, to the 39th, the end of the culture.
  • the decrease in the survival rate and growth rate of Log-NK cells between the 10th and 14th days of culture is a phenomenon that appears temporarily due to the death of the B2M-NK cells remaining untransformed with the HLA-E lentiviral vector, 14 After restimulation of the primary support cells, it was confirmed that both the culture rate and the viability were recovered (FIG. 9).
  • the K562 hematological cancer cell line was used as a target cell. After washing K562 cells with 1X PBS, remove the supernatant, add 10% FBS-added RPMI 1640 medium, assay medium, and float at a concentration of 1X10 6 /ml 30 ⁇ L Calcein-AM (Molecular probe, C34852) was added, and reacted in a CO 2 incubator at 37° C. for 1 hour. Then, after washing twice with 10 mL of assay medium, cells were suspended in 10 mL of assay medium to prepare a concentration of 1 x 10 5 /ml.
  • CD107a, IFN- ⁇ , and TNF- ⁇ which are major cytokines secreted by NK cells to kill cancer cells.
  • ICS intracellular cytokine staining
  • Antibody usage list by cell staining method antibody Neon (-), target well iso well surface dyeing PerCP-cy5.5 7AAD/CD3 APC-Cy7 CD56 APC CD107a IgG1k intracellular staining FITC IFN- ⁇ IgG1k PE-Cy7 TNF- ⁇ IgG1k
  • the target cell, K562 is also suspended in the assay medium at 2.5x10 6 /ml.
  • a 96-well round-bottom plate was prepared, and APC-CD107a antibody was added to (-) and target wells, and APC-IgG1k antibody was added to iso wells.
  • 100 ⁇ L of RPMI 1640 medium supplemented with 10% FBS was added to (-) wells, and 100 ⁇ L of target cells were added to the target and iso wells each. After putting 100 ⁇ L of effector cells into all wells, they were reacted for 4 hours in a 37° C. CO 2 incubator.
  • the plate was centrifuged (2000 rpm, 3 min, 4°C) and washed twice with 200 ⁇ L of Perm/Wash buffer (BD, 554723), and then 200 ⁇ L of fixation/permeabilization solution (BD, 554655) was added to all wells 4
  • the reaction was carried out at °C for 30 minutes.
  • the plate is centrifuged (2000 rpm, 3 minutes, 4°C) and washed twice with 200 ⁇ L of Perm/Wash buffer (BD, 554723), and then 100 ⁇ L of Perm/Wash buffer (BD, 554723) is added to all wells.
  • IFN- ⁇ and TNF- ⁇ antibodies were added to ( ⁇ ) and target wells, and FITC-IgG1k and PE-Cy7-IgG1k antibodies were added to iso wells, and then reacted at 4° C. for 30 minutes. 100 ⁇ L of 1X Perm/Wash buffer was added, and the plate was centrifuged (2000 rpm, 3 min, 4°C), and the supernatant was discarded.
  • the plate was centrifuged (2000 rpm, 3 min, 4°C) and washed twice with 200 ⁇ L of Perm/Wash buffer (BD, 554723), 200 ⁇ L of 1X Perm/Wash buffer was added each, and the cell pellet was transferred to a FACS tube (BD falcon, 352052) and analyzed cytokine expression by flow cytometry.
  • BD Perm/Wash buffer
  • 1X Perm/Wash buffer was added each, and the cell pellet was transferred to a FACS tube (BD falcon, 352052) and analyzed cytokine expression by flow cytometry.
  • an in vitro mixed lymphocyte reaction (MLR) test was performed.
  • MLR mixed lymphocyte reaction
  • Biotin-antibody cocktail was added to the suspension to a concentration of 1 x 10 7 /10 ⁇ L, mixed well, and reacted at 4° C. for 5 minutes.
  • 1 x 10 7 is added an MACS buffer at a concentration of cells based on 30 ⁇ L, and put into 1 x 10 7 cells, CD8 (+) T cells added to the microbeads cocktail of standard 20 ⁇ L, in the 4 °C 10 reacted for a minute.
  • the cell suspension was passed through an LS column (Miltenyi Biotec) to separate only CD8-expressing T cells.
  • PBMCs donated from another donor were irradiated with 2,000 cGy, mixed with CD8(+) T cells in a 1:1 ratio, and cultured for 7 days.
  • Example 3 using CD8(+) T cells cultured for a total of 14 days as effector cells and using NK or Log-NK as target cells, whether Log-NK can evade CD8(+) T cell attack It was confirmed by measuring apoptosis in the same way. As shown in FIG. 11a , the ratio of cells lysed by CD8(+) T cells was 3 times higher in NK than Log-NK, and from this result, Log-NK could evade the attack of CD8(+) T cells. was confirmed.
  • the HLA-A, B, and C types of CD8(+) T cells and NK or Log-NK cells are 100% mismatched, and the irradiated PBMCs used for CD8(+) T cell culture are NK Alternatively, the conditions were consistent with HLA-A, B, and C types of Log-NK cells by 83%.
  • RPMI 1640 (10% FBS, 1000 IU IL-2) medium to a 30:1 CD8(+) T: NK or Log-NK ratio 100 ⁇ L of 1.2x10 6 /mL CD8(+) T cells and 100 ⁇ L each of 4x10 4 /mL NK or Log-NK were put into a 96-well plate in 3 wells each. Plates were analyzed using IncuCyte®S3 equipment (Sartorius) installed inside a cell culture incubator to store well images in a live state every hour, and then only count cells positive for CFSE fluorescence in the images.
  • IncuCyte®S3 equipment (Sartorius) installed inside a cell culture incubator to store well images in a live state every hour, and then only count cells positive for CFSE fluorescence in the images.
  • Example 10 Selection of optimal gRNA sequence for CIITA gene knock-out
  • Human MHC (major histocompatitibility complex) class II gene consists of HLA-DR, HLA-DQ, and HLA-DP.
  • Class II transactivator CIITA
  • RFXANK RFX
  • CIITA Class II transactivator
  • RFXANK RFX
  • an RNP reaction solution was prepared in the same manner as in Example 1, and the reaction solution was used within 60 minutes after reaction at room temperature for 5 minutes or more.
  • the prepared RNP reaction solution has a capacity that can be used up to the number of cells 1 to 4 x 10 6 , and 2 X 10 6 cells were used after measuring the number of NK cells using an ADAM cell counter system (Nano Entec). . Subsequent experimental procedures and cell culture were performed in the same manner as in Example 1.
  • NK cells treated with CIITA RNP reaction solution in Example 10-1) were stained and then flow cytometric analysis was performed.
  • 2 x 10 5 NK cells were suspended in 2 mL of FACS buffer containing 2% FBS, centrifuged at 2,000 rpm for 3 minutes, suspended cells with 100 ⁇ L FACS buffer, and antibody containing fluorescent substance After adding (Table 11), incubated for 30 minutes at 4 °C.
  • HLA-DR The degree of knock-out of HLA class II was confirmed by the expression of HLA-DR.
  • NK cells treated with Cpf1-1 gRNA compared to the control wild-type NK cells showed 28.2% CIITA gene knock-out. Out efficiency was shown, and NK cells treated with Cpf1-#5 gRNA were 17.7%, and NK cells treated with Cpf1-#8 gRNA showed knock-out efficiency of 19.9%. And, 15.5% of NK cells treated with MAD7-#21 gRNA, and 40.1% of knock-out efficiency of NK cells treated with MAD7-#25 gRNA.
  • MAD7 nuclease and #25 gRNA having the best CIITA gene knock-out efficiency were selected and subsequent experiments were carried out.
  • FIG. 13 as a result of confirming the knock-out efficiency of CIITA on days 3-7 of culture after delivery of the RNP reaction solution, it increased from 21.3% to 50.4% on day 7 of culture compared to control NK cells on day 3 of culture.
  • Example 11 Optimization of conditions for producing NK cells from which B2M and CIITA genes have been removed
  • NK cells In order to prepare NK cells in which B2M and CIITA genes were simultaneously removed, two methods were used as shown in FIG. 14a , and the double knock-out efficiencies of B2M and CIITA genes were compared.
  • Preparation Method 1 mix 13 ⁇ L of 1X PBS, 2 ⁇ L of 3.2 ⁇ M MAD7, and 10 ⁇ L of 10 ⁇ M B2M gRNA in a 1.5 mL centrifuge tube, and then react at room temperature for at least 5 minutes to prepare RNP reaction tube 1.
  • RNP reaction solution tube 2 In another 1.5 mL centrifuge tube, prepare RNP reaction solution tube 2 by reacting 13 ⁇ L of 1X PBS, 2 ⁇ L of 3.2 ⁇ M MAD7, and 10 ⁇ L of 10 ⁇ M CIITA gRNA at room temperature for at least 5 min. Prepared RNP reaction solution tubes 1 and 2 were mixed to make a total of 50 ⁇ L of RNP reaction solution. Subsequent experimental procedures were carried out in the same manner as in Example 10 on the 7th day NK cells in 2 x 10 6 culture.
  • CIITA was knocked out in 2 x 10 6 NK cells on the 7th day of culture and cultured for 4 days, and then B2M was sequentially knocked out in 2 x 10 6 NK cells on the 11th day of culture.
  • Specific experimental procedures and cell culture were performed in the same manner as in Example 1. After knock-out, cultured NK cells were stained with FACS antibody in the same manner as in Example 10-2), and then knock-out efficiency of B2M and CIITA genes was confirmed using flow cytometry.
  • NK cells isolated from three donors As can be seen in FIG. 14b , as a result of testing with the above production method on NK cells isolated from three donors, the double knock-out efficiency of B2M and CIITA of the NK cells prepared by production method 1 from donor 1 was the control NK It was 32.4% compared to cells, and the efficiency of NK cells prepared by method 2 was 17%. NK cells isolated from the other two donors also showed higher double knock-out efficiency in Preparation Method 1 than in Preparation Method 2.
  • Genomic DNA was isolated from NK cells in which B2M and CIITA were double-knocked out according to Preparation Method 1, and whole genome sequencing was performed. It is assumed that a genomic DNA sequence having 4 or less nucleic acid sequences that are mismatched with the gRNA sequence of each of B2M and CIITA is a site likely to be off-target, and whether insertion/deletion by off-target has actually occurred. Confirmed. As a result, three off-target predicted sites were identified in the B2M gRNA sequence (FIG. 14c), and two off-target predicted sites were identified in the CIITA gRNA sequence (FIG. 14F).
  • Example 12 Construction of Log-NK-CIITA KO cells (B2M-/CIITA-/HLA-E+ NK cells)
  • HLA-ABC which also suppressed the expression of HLA-DR/DP/DQ, a type II HLA protein, by knocking out the CIITA gene in Log-NK with B2M-/HLA-E+ expression - /HLA-DR/DP/DQ - NK cells having the /HLA-E + phenotype were prepared by Production Method 1 or Production Method 2 of FIG. 14A and named “Log-NK-CIITA KO” cells. Allogeneic hypoimmunogenic NK cells, in which the expression of type I HLA and type II HLA were simultaneously suppressed, stimulated the immune response by the host's CD8(+) T cells, CD4(+) T cells and NK cells when injected into the body. expected to be avoided.
  • NK cells that do not express B2M were isolated and again HLA-DR Cells that do not express were sequentially isolated.
  • biotin-labeled B2M antibody Invitrogen
  • 2 mL of MACS buffer (0.5% FBS, PBS in which 2 mM EDTA was dissolved
  • the recovered cells were again centrifuged at 1,200 rpm for 10 minutes to remove the supernatant, then 80 ⁇ L of washing buffer was added to the pelleted cells, 20 ⁇ L of anti-HLA-DR microbeads (Miltenyi Biotec) were mixed, and then 4°C After reacting for 15 minutes, 2 mL of washing buffer was added, and centrifugation was performed at 1,200 rpm for 10 minutes.
  • NK cells were suspended in a medium at a concentration of 1 x 10 6 /mL and cultured in a well plate of an appropriate size.
  • Example 13 Culture of Log-NK-CIITA KO cells and confirmation of phenotypic expression
  • the NK cells prepared by the method of Example 11 were stained and flow cytometry Expression was confirmed by analyzer. After adding 2 mL of FACS buffer containing 2% FBS to 2 x 10 5 NK cells, centrifuge at 2,000 rpm for 3 minutes, and then remove the supernatant. Cells were suspended with 100 ⁇ L FACS buffer, and the antibodies listed in Table 12 were added, followed by reaction at 4°C for 30 minutes.
  • donor 1 had 69.1%, donor 2 72.3%, and donor 3, 53.8% HLA-E compared to control NK cells. It was confirmed that the expression is increased (Fig. 16b).
  • cancer cells K562 chronic myeloid leukemia
  • DU145 prostate cancer
  • HepG2 liver cancer
  • HCC1954 breast cancer
  • MDA-MB-231 breast cancer
  • MDA-MB-468 breast cancer
  • SKOV3 ovarian cancer
  • 1 mL of assay medium which is RPMI 1640 medium supplemented with 10% FBS
  • the reaction was carried out in a CO 2 incubator at 37°C.
  • the cells are washed twice with assay medium and prepared at a concentration of 1 x 10 5 /mL.
  • the effector cells NK or Log-NK-CIITA KO, were used for an effector:target cell ratio of 3:1. 3 to X 10 6 / mL were suspended in assay medium and 1: Activation of 1: suspended in assay medium at 1 x 10 6 / mL for the target cell ratio.
  • the prepared effector cells were put into 3 wells of a round-bottom 96-well plate by 100 ⁇ L, respectively, and then 100 ⁇ L of target cells at a concentration of 1 x 10 5 /mL were put into each well.
  • the subsequent experimental process and measurement value calculation method are the same as in Example 4.
  • Log-NK-CIITA KO cells showed similar or increased cancer cell killing ability than control NK cells for various cancer cell lines.
  • Cancer cells DU145, HepG2, HCC1954, MDA-MB-231, MDA-MB-468, and SKOV3 were suspended in assay medium, which is RPMI 1640 medium supplemented with 10% FBS at a concentration of 4 x 10 4 /mL, and then 96-well Put 100 ⁇ L into each well of the plate, incubate for 18-22 hours, and then add effector cells. Effector NK or Log-NK-CIITA KO cells were used for a 2:1 effector:target cell ratio. After suspending in RPMI 1640 medium in which 10% FBS and 1000 IU IL-2 are dissolved at 8 X 10 4 /mL, 100 ⁇ L of target cells are put into 3 wells of a 96-well plate in culture.
  • Example 15 Knock-out of B2M and CIITA genes using various gRNA delivery methods
  • the knock-out efficiency of each gene was evaluated by delivering B2M gRNA or CIITA gRNA and RNP of MAD7 nuclease to NK cells in various ways. Confirmed. #8 gRNA (SEQ ID NO: 8) was used for the B2M gene, and #25 gRNA (SEQ ID NO: 44) was used for the CIITA gene. 1 X 10 6 equal numbers of NK cells were used for each delivery method.
  • Method 1 prepares an RNP reaction solution by mixing 26 ⁇ L of PBS, 4 ⁇ L of 40 ⁇ M MAD7 nuclease, and 2 ⁇ L of 100 ⁇ M B2M or CIITA gRNA, followed by reaction at room temperature for at least 5 minutes, and 48 ⁇ L of ⁇ -MEM After adding 2 ⁇ L of 5 ⁇ M FSD64d1 shuttle to the medium, it was mixed with 50 ⁇ L of the RNP reaction solution, treated with NK cells, and reacted at room temperature for 1 minute and 30 seconds. The detailed delivery method was carried out in the same manner as described in Example 1.
  • gRNA was delivered to NK cells by electroporation, and Nucleofector (Lonza) equipment and Human Natural Killer Cell Nucleofector Kit (Lonza, VPA-1005) were used.
  • Nucleofector (Lonza) equipment and Human Natural Killer Cell Nucleofector Kit LiNaCl, KCl, KCl, KCl, KCl, KCl, KCl, KCl, KCl, CRISPR-1005
  • 100 ⁇ L of the solution provided in the kit the same amount of gRNA, MAD7 nuclease, and NK cells as in Method 1 were mixed and placed in a cuvette, followed by electroporation using the U-01 program.
  • Method 3 used Lipofectamine CRISPRMAX transfection reagent (Invitrogen, CMAX00008).
  • 1 x 10 6 pieces in 12-well plate Prepared by pre-suspending NK cells, prepared tube 1 by mixing the same amount of gRNA as in Method 1 , 2.5 ⁇ L of MAD7 nuclease and Cas9 plus reagent, and 25 ⁇ L of opti-MEM in a 1.5 mL tube, and reacted at room temperature.
  • 1.5 ⁇ L of CRISPRMAX reagent and 25 ⁇ L of opti-MEM were mixed to prepare tube 2, and then the reaction solution prepared in tube 1 was mixed and reacted at room temperature for 5 minutes, and then treated with NK cells.
  • Method 4 used Lipofectamine2000 Transfection reagent (Invitrogen, 11668027). 1 x 10 6 pieces in 12-well plate Prepared by pre-suspending NK cells, tube 1 was prepared by mixing the same amount of gRNA as in method 1, MAD7 nuclease, and 25 ⁇ L of opti-MEM in a 1.5 mL tube. In another 1.5 mL tube, mix 2.5 ⁇ L of Lipofectamine2000 and 25 ⁇ L of opti-MEM to prepare tube 2, mix the reaction solution prepared in tube 1, and react at room temperature for 5 minutes, and then treat NK cells.
  • NK cells in which the B2M gene was knocked out were confirmed by flow cytometry analysis using a B2M antibody after 3 days of culture, and NK cells in which the CIITA gene was knocked out after 7 days in culture were confirmed by flow cytometry. .
  • the expression level of NK cells knocked out of the B2M or CIITA gene was calculated as a ratio to NK cells to confirm the gene expression reduction efficiency.
  • FIG. 18a when the B2M expression level of the control NK cells was 1, Method 1 was 0.46, Method 2 was 0.74, Method 3 was 0.89, and Method 4 was 0.74. The difference in values showed no statistical significance.
  • FIG. 18a when the B2M expression level of the control NK cells was 1, Method 1 was 0.46, Method 2 was 0.74, Method 3 was 0.89, and Method 4 was 0.74. The difference in values showed no statistical significance. As shown in FIG.
  • Log-NK-CIITA KO cells are NK cells with suppressed expression of type I HLA and type II HLA on their surface, they were expected to have low immunogenicity.
  • An in vitro mixed lymphocyte reaction test (MLR assay) was performed to determine whether the recipient's CD4(+) T cells and CD8(+) T cells could survive for a long time when injected into the body by avoiding attack.
  • the HLA-A, B, C, and DRB1 types of CD8(+) T cells or CD4(+) T cells and wild-type NK or Log-NK-CIITA KO cells are 100% mismatch so that the MLR response can occur well
  • Irradiated PBMCs used for culturing CD8(+) T cells or CD4(+) T cells were 37.5% consistent with HLA-A, B, C, and DRB1 types of wild-type NK or Log-NK-CIITA KO cells.
  • CD8(+) T cells from PBMC is the same as the procedure described in Example 9, and in order to isolate CD4(+) T cells, a CD4(+) T cell isolation kit (Miltenyi Biotec, 130-096-) 533) was used, and the method is as follows. After PBMC were washed once with MACS buffer, the cell pellet was suspended to 1 x 10 7 /40 ⁇ L, and 1 x 10 7 cells/10 ⁇ L of biotin-antibody cocktail was added and reacted at 4° C. for 5 minutes.
  • PBMCs were prepared and mixed with CD4(+) T cells and CD8(+) T cells cultured for 7 days in a 1:1 ratio, cultured for 7 more days, and then used for the final 14 days of culture.
  • CD8(+) T cells or CD4(+) T cells were used in the same method as in Example 9 to make a 10:1 ratio of effector cells: target cells. was diluted to 96 well-plate and put into it.
  • Log-NK-CIITA KO cells had more than 1.6 times the number of cells compared to control NK after 4 days of co-culture with CD4(+) T cells and irradiated PBMCs ( FIG. 19b ). These results show that Log-NK-CIITA KO cells can evade the attacks of CD4(+) T cells and CD8(+) T cells with significantly higher efficiency than wild-type NK cells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Transplantation (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 포유류 세포의 면역원성 저해용 조성물 및 이를 이용한 저면역원성 포유류 세포의 제조방법에 관한 것이다. 본 발명은 줄기세포나 면역세포 등 질환의 치료 목적으로 동종이식(allogeneic transplantation)되는 세포에 있어서, 수혜자의 체내에서 면역거부반응이 최소화되면서도 장기간 활성이 유지되는 효율적인 세포 치료제로 유용하게 이용될 수 있다.

Description

면역원성이 감소된 신규한 이식용 세포
본 발명은 효율적인 동종 이식을 위해 유전자 편집을 이용하여 면역원성이 억제된 신규한 세포 치료제에 관한 것이다.
자연살해세포(Natural Killer cell)는 혈구세포의 약 10% 정도를 차지하고, 면역반응에 중요한 역할을 하는 림프구계 세포이다. NK 세포는 여러 기능을 수행하나, 특히 암세포나 외인성 병원균에 감염된 세포를 사멸시키는 능력을 가져 병변화될 수 있는 비정상 세포를 제거하는 역할을 수행한다.
체내에 존재하는 대부분의 NK 세포는 정상상태에서 비활성화 상태(inactivated state)로 존재하지만, 이를 치료 용도로 이용하기 위해서는 활성화된 NK 세포가 필요하기 때문에, 정상 혈액 또는 환자 혈액으로부터 NK 세포를 활성화시키는 연구가 활발히 진행되고 있다. 체외에서 NK 세포를 활성화시키는 경우, NK 세포는 높은 세포 독성(cytotoxicity)을 나타내어 면역세포 치료로 적용될 수 있음이 확인되었다. 체외에서 활성화된 NK 세포를 다양한 암, 특히 백혈병 등의 혈액암 환자를 대상으로 동종 골수이식 후에 투여하여 그 치료 효과가 확인되기도 하였다(Blood Cells Molecules & Disease, 33: p261-266, 2004).
한편, 현재 NK 세포를 이용한 항암면역치료의 경우 NK 세포 억제 수용체에 초점이 맞추어져 있다. 즉 NK 세포 활성을 억제하는 억제 수용체(inhibitory receptor)의 기능을 차단함으로써 NK 세포의 활성을 증진시키고자 하는 것이다. 이를 위해 수혜자(recipient)의 MHC(major histocompatibility complex)와 일치하지 않는 기증자의 동종 자연살해세포(allogeneic NK cell)를 사용하거나 억제 수용체의 기능을 항체로 차단하는 방법이 주로 사용되고 있다. 동종 NK 세포는 기증자와 수혜자의 MHC Class I 유전형이 다르기 때문에 기증자 NK 세포의 억제 수용체(KIR 등)가 수혜자 MHC Class I을 인식하지 못함으로써 활성억제를 받지 않는다. 따라서 동종 NK 세포의 경우 암세포에 여전히 존재할 수 있는 MHC Class I에 의한 활성억제에 자유로울 수 있어 그렇지 못한 환자 자신의 NK 세포보다 좀 더 효과적인 항암 활성을 나타낼 것으로 예상할 수 있다. 실제로 동종 NK 세포가 항암치료에 많은 장점을 가진다는 것은 처음 혈액암 환자 치료에 동종 조혈줄기세포이식(hematopoietic stem cell transplantation, HSCT)이 효과적이라는 사실로부터 알려지게 되었다. 추가적인 연구를 통해 이러한 동종 조혈줄기세포이식에서 이식편대백혈병(graftversus-leukemia, GVL) 반응의 많은 부분이 NK 세포에 의한 것임이 알려지게 되었다. 이에 근거하여 실제로 건강한 기증자의 순수 분리된 동종 NK 세포를 체외에서 대량으로 배양하고 활성화시켜 암환자에 투여하는 많은 시도가 이루어지고 있으며 급성 골수성 백혈병(acute myeloid leukemia, AML), 다발성 골수종(multiple myeloma, MM) 등에서 효과적인 항암활성을 나타내었다. 하지만 MHC Class I이 완전히 불일치하는 동종 조혈줄기세포이식의 경우 환자에 따라 기대했던 항암활성이 나타나지 않는 경우가 많고 더불어 'conditioning regimen'에 포함된 면역억제제에 의한 감염 등 심각한 부작용들이 보고되었다. 더욱이 NK 세포의 경우 최근 연구들을 통해 NK 세포의 분화 시 충분한 항암활성 획득에 억제 수용체와 표적세포 MHC Class I의 상호작용('education' 혹은 'licensing' 과정)이 필요하다는 것이 알려지게 되었다. 따라서 충분한 항암활성을 갖는 성숙한 NK 세포를 얻기 위해서는 기증자와 수혜자의 MHC Class I이 어느 정도 일치해야 할 것으로 예상되고 있다. 따라서 이러한 영향으로 현재 여러 MHC Class I 중 하나가 일치하는 반일치(haploidentical) 조혈줄기세포이식과 NK 세포를 혈액암 치료에 많이 시도하고 있으며 그에 따른 임상적 예후가 상대적으로 뛰어나다는 사실이 확인되고 있다. 또한 동종 면역세포를 세포 치료제로 사용할 경우 수혜자 자신의 세포를 공격하는 이식편대숙주병(graft-versus-host disease, GVHD)등의 부작용이 필연적으로 발생하는데 반해 동종 NK 세포의 경우 그러한 문제점이 거의 보고되지 않았다. 이는 암세포와 달리 정상세포는 NK 세포 활성화 수용체에 대한 리간드를 거의 발현하지 않아 NK 세포 활성화를 유도하지 않는 것으로 이해되고 있다. 현재 동종 NK 세포를 혈액암 외에 다른 고형암들에도 세포치료제로 사용하고자 하는 연구들이 활발히 시도되고 있다(Kim, HS, Hanyang Med Rev, 33:59-64, 2013).
동종 NK 세포 이식에 의한 또 하나의 문제는 이식된 NK 세포가 수혜자에서 오랫동안 지속되지 않는다는 점이다. 이를 극복하기 위해 이식 후에 NK 세포 증식을 유도할 수 있는 사이토카인 IL-2를 주기적으로 넣어주는 방법이 시도되었다. 그러나 IL-2는 NK 세포 외에도 항암면역 반응을 억제하는 조절 T 세포(Treg)를 증폭할 수 있기 때문에 큰 문제점이 될 수 있다(Romagne F, Vivier E.,F1000 Med Rep, 3:9, 2011; Waldmann TA., Nat Rev Immunol, 6:595-601, 2006).
본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 발명자들은 환자의 체내에서 면역거부반응이 최소화되면서도 장기간 활성이 유지되는 효율적인 세포 치료제를 개발하기 위하여 예의 연구 노력하였다. 그 결과, 면역원성 유발 인자 중 하나인 Ⅱ형 HLA 유전자 또는 이의 활성화 단백질, 구체적으로는 CⅡTA의 특정 부분과, B2M 유전자의 특정 부분을 타겟팅하는 유전자 편집 수단을 치료용 세포에 도입할 경우 면역원성 억제 효율이 극대화되어 우수한 동종이식(allogeneic transplantation)용 세포치료제로 이용될 수 있음을 발견함으로써, 본 발명을 완성하게 되었다.
따라서 본 발명의 목적은 포유류 세포의 면역원성 저해용 조성물 및 이를 이용하여 제조된 저면역원성 포유류 세포를 제공하는 데 있다.
본 발명의 다른 목적은 저면역원성 포유류 세포의 제조방법을 제공하는 데 있다.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
본 발명의 일 양태에 따르면, 본 발명은 Ⅱ형 HLA 단백질의 발현을 억제하는 핵산 분자를 유효성분으로 포함하는 포유류 세포의 면역원성 저해용 조성물을 제공한다.
본 발명자들은 환자의 체내에서 면역거부반응이 최소화되면서도 장기간 활성이 유지되는 효율적인 세포 치료제를 개발하기 위하여 예의 연구 노력하였다. 그 결과, 면역원성 유발 인자 중 하나인 Ⅱ형 HLA 유전자 또는 이의 활성화 단백질, 구체적으로는 CⅡTA의 특정 부분과, B2M 유전자의 특정 부분을 타겟팅하는 유전자 편집 수단을 치료용 세포에 도입할 경우 면역원성 억제 효율이 극대화되어 우수한 동종이식(allogeneic transplantation)용 세포 치료제로 이용될 수 있음을 발견하였다.
본 명세서에서, 용어 “핵산 분자”는 DNA(gDNA 및 cDNA) 그리고 RNA 분자를 포괄적으로 포함하는 의미를 가지며, 핵산 분자에서 기본 구성 단위인 뉴클레오타이드는 자연의 뉴클레오타이드뿐만 아니라, 당 또는 염기 부위가 변형된 유사체 (analogue)도 포함한다(Scheit, Nucleotide Analogs, John Wiley, New York(1980); Uhlman 및 Peyman, Chemical Reviews, 90:543-584(1990)).
본 명세서에서 용어“발현의 억제”는 목적 유전자의 활성 또는 발현의 저하를 야기시키는 것을 의미하며, 이에 의해 목적 유전자의 활성 또는 발현이 탐지 불가능해지거나 무의미한 수준으로 존재하게 되는 경우 뿐 아니라, 목적 유전자의 생물학적 기능이 유의하게 저하될 수 있을 정도로 활성 또는 발현을 저하시키는 것을 의미한다. 본 발명의 발현 억제용 핵산 분자는 구체적으로는 목적 유전자의 서열에 상보적인 핵산분자로서, 예를 들어 shRNA, siRNA, miRNA, gRNA(guideRNA) 및 안티센스 올리고뉴클레오타이드를 포함하나, 이에 제한되지 않고 당업계에 공지된 모든 유전자의 발현 억제수단인 핵산분자가 이용될 수 있다.
본 발명의 구체적인 구현 예에 따르면, 상기 핵산 분자는 상기 Ⅱ형 HLA 단백질 또는 이의 활성화 단백질을 인코딩하는 뉴클레오타이드 서열을 특이적으로 인식하는 유도 RNA(gRNA) 또는 상기 gRNA를 인코딩하는 뉴클레오타이드이다.
본 명세서에서 용어“gRNA(guideRNA)”는 타겟 유전자를 인식하여 핵산분해효소(nuclease)를 유도함으로써 인식된 부위를 특이적으로 절단하는 유전자 편집 시스템에 사용되는 RNA 분자를 의미한다. 이러한 유전자 편집 시스템에는 대표적으로 CRISPR(Clustered Regularly Interspaced Short Palindromic Repeats) 시스템이 있다.
본 명세서에서“특이적으로 인식한다”고 함은 gRNA가 타겟 염기서열과 상보적인 서열을 가짐으로써 선택적으로 혼성화 될 수 있음을 의미한다. 용어“상보적”은 소정의 어닐링 또는 혼성화 조건하에서 gRNA가 타겟 서열에 선택적으로 혼성화 할 정도로 충분히 상보적인 것을 의미하며, 실질적으로 상보적(substantially complementary)인 경우 및 완전히 상보적(perfectly complementary)인 경우를 모두 포괄하는 의미이며, 바람직하게는 완전히 상보적인 경우를 의미한다. 본 명세서에서 용어“실질적으로 상보적인 서열”은 완전히 일치되는 서열뿐만 아니라, 특정 서열에 어닐링하여 gRNA 역할을 할 수 있는 범위 내에서, 비교 대상의 서열과 부분적으로 불일치되는 서열도 포함되는 의미이다.
생물학적 균등 활성을 갖는 변이를 고려한다면, 본 발명에서 특이적으로 인식하여 발현을 억제하고자 하는 뉴클레오타이드는 Ⅱ형 HLA 유전자의 공지된 서열과 실질적인 동일성(substantial identity)을 나타내는 서열도 포함하는 것으로 해석된다. 상기의 실질적인 동일성은, 상기 공지된 유전자의 서열과 임의의 다른 서열을 최대한 대응되도록 얼라인하고, 당업계에서 통상적으로 이용되는 알고리즘을 이용하여 얼라인된 서열을 분석한 경우에, 최소 70%의 상동성, 구체적으로는 80%의 상동성, 보다 구체적으로는 90%의 상동성, 가장 구체적으로는 95%의 상동성을 나타내는 서열을 의미한다. 서열비교를 위한 얼라인먼트 방법은 당업계에 공지되어 있다. 얼라인먼트에 대한 다양한 방법 및 알고리즘은 Huang et al., Comp. Appl. BioSci. 8:155-65(1992) and Pearson et al., Meth. Mol. Biol. 24:307-31(1994)에 개시되어 있다. NCBI Basic Local Alignment Search Tool(BLAST)(Altschul et al., J. Mol. Biol. 215:403-10(1990))은 NBCI(National Center for Biological Information) 등에서 접근 가능하며, 인터넷 상에서 blastp, blasm, blastx, tblastn 및 tblastx와 같은 서열 분석 프로그램과 연동되어 이용할 수 있다.
보다 구체적으로는, 상기 Ⅱ형 HLA 단백질의 활성화 단백질은 Ⅱ형 HLA 단백질에 대한 트랜스 활성인자(transactivator)이며, 보다 구체적으로는 CⅡTA(Class Ⅱ Major Histocompatibility Complex Transactivator) 단백질이다.
본 발명의 구체적인 구현예에 따르면, 상기 조성물은 RNA-유도 엔도뉴클레아제 또는 RNA-유도 엔도뉴클레아제 인코딩 뉴클레오타이드를 추가적으로 포함한다. “RNA-유도 엔도뉴클레아제”는 타겟 유전자 부위를 인식한 gRNA에 의해 유도되어 타겟 유전자를 절단하는 효소로서, 이러한 RNA-유도 엔도뉴클레아제는 mRNA 형태 또는 단백질 형태로 전달될 수도 있고, 이를 코딩하는 DNA가 탑재된 벡터로 형질전환함으로써 목적 세포에 전달될 수도 있다. 단백질 형태의 엔도뉴클레아제가 이용될 경우, 가이드 RNA와 복합체를 이루는 RNP 복합체(Ribonucleoprotein complex)로서 기능할 수 있다.
본 명세서에서 사용된 용어 "RNP 복합체"란, 상기 가이드 RNA 및 RNA-유도 엔도뉴클레아제를 유효성분으로 포함하는 것으로, 상기 복합체는 표적 서열을 인식하여 결합하고, 이를 선택적으로 니킹(nicking) 또는 절단할 수 있다. 상기 RNA 복합체는 예를 들어, Cas9-gRNA 복합체일 수 있으나, 이에 제한되지는 않는다.
본 발명의 일 구체예에서, 상기 RNA-유도 엔도뉴클레아제는 Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas 13a, Cas 13b, Cas 13c, Cas 13d, Cpf1, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4 및 MAD7으로 이루어진 군으로부터 선택되는 어느 하나일 수 있으며, 구체적으로는 Cas9(CRISPR associated protein 9), Cpf1(CRISPR from Prevotella and Francisella 1) 또는 MAD7이다.
본 명세서에서 용어“뉴클레오타이드”는 DNA(gDNA 및 cDNA) 그리고 RNA 분자를 포괄적으로 포함하는 의미를 가진다. 핵산 분자의 기본 구성단위인 뉴클레오타이드는 자연의 뉴클레오타이드 뿐만 아니라, 당 또는 염기 부위가 변형된 유사체 (analogue)도 포함한다. 본 발명에서 gRNA 또는 RNA-유도 엔도뉴클레아제를 인코딩하는 뉴클레오타이드 서열은 첨부한 서열목록에 기재된 뉴클레오타이드 서열에 한정되지 않음은 당업자에게 명확하다. 뉴클레오타이드에서의 변이는 단백질(예를 들어 엔도뉴클레아제)에서 변화를 가져오지 않는 것도 있는데, 이러한 핵산은 기능적으로 균등한 코돈, 코돈의 축퇴성에 의해 동일한 아미노산을 코딩하는 코돈, 또는 생물학적으로 균등한 아미노산을 코딩하는 코돈을 가지는 핵산분자를 모두 포괄한다.
본 발명의 구체적인 구현예에 따르면, 상기 gRNA는 서열목록 제20서열, 서열목록 제22서열, 서열목록 제24서열, 서열목록 제27서열, 서열목록 제29서열, 서열목록 제30서열, 서열목록 제40서열 및 서열목록 제44서열로 구성된 군으로부터 선택되는 뉴클레오타이드 서열 또는 이들의 상보적인 서열을 특이적으로 인식한다.
본 발명의 구체적인 구현 예에 따르면, 본 발명의 조성물은 β2-마이크로글로불린 단백질의 발현을 억제하는 핵산 분자를 추가적으로 포함한다.
보다 구체적으로는, 상기 핵산 분자는 상기 β2-마이크로글로불린 단백질을 인코딩하는 뉴클레오타이드 서열을 특이적으로 인식하는 유도 RNA(gRNA) 또는 상기 gRNA를 인코딩하는 뉴클레오타이드이다.
보다 더 구체적으로는, 상기 유도 RNA(gRNA)는 서열목록 제1서열, 서열목록 제8서열, 서열목록 제9서열 및 서열목록 제14서열로 구성된 군으로부터 선택되는 뉴클레오타이드 서열 또는 이들의 상보적인 서열을 특이적으로 인식한다.
본 발명의 구체적인 구현 예에 따르면, 상기 조성물은 I형 HLA 단백질을 인코딩하는 핵산 분자를 추가적으로 포함한다. 보다 구체적으로는, 상기 I형 HLA 단백질은 HLA-E 단백질이다.
동종 세포 이식의 또 하나의 문제는 이식된 치료용 세포가 수혜자에서 오랫동안 지속되지 못한다는 점이다. 이를 극복하기 위해 이식 후에 세포 증식을 유도할 수 있는 특정 사이토카인을 주기적으로 주입하는 방법이 제안되었지만 IL-2와 같은 사이토카인은 항암 면역반응을 억제하는 조절 T 세포(Treg)를 증폭할 수 있기 때문에 항암 치료에서 역효과가 발생할 수 있다(Romagne F, Vivier E.,F1000 Med Rep, 3:9, 2011; Waldmann TA., Nat Rev Immunol, 6:595-601, 2006). 이에, 본 발명자들은 면역세포나 줄기세포 등의 치료용 세포 상에서 억제성 수용체 CD94/NKG2A를 자극하여 세포 사멸을 예방할 수 있는 HLA-E를 도입하고자 하였다. 하기 실시 예에서 보는 바와 같이 이를 통해 수혜자의 면역 반응에 의해 본 발명의 치료용 이식 세포가 사멸되는 것을 막을 수 있으며, 이를 통해 수혜자의 체내에서 오래 유지되면서 약리효과를 발휘할 수 있음을 확인하였다.
본 명세서에서 용어“발현시키다”는 대상 세포가 외래(exogenous) 유전자를 발현하게 하거나 또는 내인성(endogenous) 유전자의 자연적 발현량을 증가시키기 위해 유전자 전달체를 이용하여 인위적으로 이를 도입함으로써 유전자가 대상체 세포 내에서 염색체외 인자로서 또는 염색체 통합 완성에 의해 복제 가능하게 되는 것을 의미한다. 따라서, 용어“발현”은“형질전환(transformation)”, "형질주입(transfection)" 또는 "형질도입(transduction)"과 동일한 의미이다.
본 명세서에서, 용어“유전자 전달 시스템(gene delivery system)”은 유전자를 세포 내로 운반하는 모든 수단을 의미하며, 유전자 전달은 유전자의 세포내 침투(transduction)와 동일한 의미를 가진다. 조직 수준에서, 상기 용어 유전자 전달은 유전자의 확산(spread)과 동일한 의미를 가진다. 따라서, 본 발명의 유전자 전달 시스템은 유전자 침투 시스템 및 유전자 확산 시스템으로 기재될 수 있다.
본 발명의 유전자 전달체를 제조하기 위해, 본 발명의 뉴클레오타이드 서열은 적합한 발현 컨스트럭트(expression construct) 내에 존재하는 것이 바람직하다. 상기 발현 컨스트럭트에서, 본 발명의 뉴클레오타이드 서열은 프로모터에 작동적으로 연결되는 것이 바람직하다. 본 명세서에서, 용어 “작동적으로 결합된”은 핵산 발현 조절 서열 (예: 프로모터, 시그널 서열, 또는 전사조절인자 결합 위치의 어레이)과 다른 핵산 서열사이의 기능적인 결합을 의미하며, 이에 의해 상기 조절 서열은 상기 다른 핵산 서열의 전사 및/또는 해독을 조절하게 된다. 본 발명의 뉴클레오타이드 서열에 결합된 프로모터는, 구체적으로는 동물세포, 보다 구체적으로는 포유동물 세포에서 작동하여 HLA-E 유전자의 전사를 조절할 수 있는 것으로서, 포유동물 바이러스로부터 유래된 프로모터 및 포유동물 세포의 지놈으로부터 유래된 프로모터를 포함하며, 예컨대 CMV(포유동물 사이토 메갈로 바이러스) 프로모터, 아데노바이러스 후기 프로모터, 백시니아 바이러스 7.5K 프로모터, SV40 프로모터, HSV의 tk 프로모터, RSV 프로모터, EF1 알파 프로모터, 메탈로티오닌 프로모터, 베타-액틴 프로모터, 인간 IL-2 유전자의 프로모터, 인간 IFN 유전자의 프로모터, 인간 IL-4 유전자의 프로모터, 인간 림포톡신 유전자의 프로모터 및 인간 GM-CSF 유전자의 프로모터를 포함하나, 이에 제한되는 것은 아니다.
HLA-E 유전자의 뉴클레오타이드 서열은 통상적인 유전자 도입에 이용되는 모든 유전자 전달 시스템에 적용될 수 있으며, 바람직하게는 플라스미드, 아데노바이러스(Lockett LJ, et al., Clin. Cancer Res. 3:2075-2080(1997)), 아데노-관련 바이러스(Adeno-associated viruses: AAV, Lashford LS., et al., Gene Therapy Technologies, Applications and Regulations Ed. A. Meager, 1999), 레트로바이러스(Gunzburg WH, et al., Retroviral vectors. Gene Therapy Technologies, Applications and Regulations Ed. A. Meager, 1999), 렌티바이러스(Wang G. et al., J. Clin. Invest. 104(11):R55-62(1999)), 헤르페스 심플렉스 바이러스(Chamber R., et al., Proc. Natl. Act . Sci USA 92:1411-1415(1995)), 백시니아 바이러스(Puhlmann M. et al., Human Gene Therapy 10:649-657(1999)), 리포좀(Methods in Molecular Biology, 199, S.C. Basu and M. Basu (Eds.), Human Press 2002) 또는 니오좀에 적용될 수 있다. 구체적으로는, 본 발명의 유전자 전달체는 본 발명의 뉴클레오타이드 분자를 렌티바이러스에 적용하여 제조될 수 있다.
본 발명에서, 유전자 전달체가 바이러스 벡터에 기초하여 제작된 경우에는, 상기 접촉시키는 단계는 당업계에 공지된 바이러스 감염 방법에 따라 실시된다. 바이러스 벡터를 이용한 숙주 세포의 감염은 상술한 인용문헌에 기재되어 있다.
본 발명의 구체적인 구현 예에 따르면, 본 발명의 조성물이 도입되는 세포는 이식용 동종(Allogenic) 또는 자가(Autologous) 세포이며, 보다 구체적으로는, 이식용 동종세포이다.
보다 구체적으로는, 상기 세포는 줄기세포 또는 면역세포이다.
본 명세서에서, 용어“줄기세포”는 조직을 구성하는 각 세포로 분화(differentiation)되기 전 단계의 미분화 세포로서, 특정 분화 자극(환경) 하에서특정 세포로 분화할 수 있는 능력을 가지는 세포들을 총칭한다. 줄기세포는 세포분열이 정지된 분화된 세포와는 달리 세포분열에 의해 자신과 동일한 세포를 생산(self-renewal)할 수 있고, 분화 자극이 가해지면 자극의 성격에 따라 다양한 세포로 분화될 수 있는, 분화의 유연성(plasticity)을 가지고 있는 것이 특징이다.
본 발명이 적용되는 줄기세포는 제한이 없으며, 줄기세포의 특성, 즉 미분화, 무한정 증식 및 특정세포로의 분화능을 갖는 세포는 본 발명이 적용될 수 있는 세포이다. 구체적으로는, 본 발명에서 이용되는 줄기세포는 중간엽 줄기세포 또는 전능성 줄기세포이다.
본 명세서에서 용어“중간엽 줄기세포”는 지방세포, 골세포, 연골세포, 근육세포, 신경세포, 심근세포로의 분화가 가능한 다분화능(multipotency)을 가진 줄기세포를 의미한다. 중간엽 줄기세포는 소용돌이 모양의 형태와 기본적인 세포표면 표식자 CD73(+), CD105(+), CD34(-), CD45(-)의 발현 정도를 통하여 식별된다. 증간엽 줄기세포의 중요한 특성 중 하나는 면역 반응을 조절하는 기능도 가지고 있다는 것이다. 중간엽 줄기세포는 골조직, 중추신경계 조직, 피부조직 및 근육 조직 등으로의 분화능을 가져 적절한 분화 유도인자를 통해 물리적으로 소실된 이들 조직의 재생에 사용될 수 있을 뿐 아니라, T-세포, B-세포, 자연살해세포(NK-cell) 및 수지상 세포(dendritic cell)의 증식, 기능 및 활성을 억제함으로써 강력한 면역조절 효과를 발휘함이 보고되어, 원치 않거나(undesired) 과도한(excessive) 면역반응을 원인으로 하는 이식거부, 자가면역 질환, 염증 질환 및 알레르기성 질환 등의 다양한 질환의 치료에 적용될 수도 있다. 이에, 본 발명이 중간엽 줄기세포에 적용될 경우, 다양한 퇴행성 질환에서의 재생 치료 또는 자가면역/염증 질환의 치료에 적용될 수 있다.
본 명세서에서 용어“전능성 줄기세포(pluripotent stem cell)”는 수정란보다 발생이 진행된 상태의 세포로서 내배엽, 중간엽 및 외배엽을 구성하는 세포로 모두 분화할 수 있는 줄기세포를 의미한다. 본 발명의 구체적인 구현 예에 따르면, 본 발명에서 이용되는 전능성 줄기세포는 배아줄기세포(Embryonic Stem Cell, ESC), 배아생식세포(Embryonic Germ Cell), 배아종양세포(Embryonic Carcinoma Cell) 또는 유도만능 줄기세포(induced Pluripotent Stem Cell, iPSC)이며, 보다 구체적으로는 유도만능 줄기세포이다.
본 명세서에서 용어“유도만능 줄기세포”는 비-전분화능 세포(예를 들면, 체세포)에 미분화 또는 전분화능 표현형과 관련된 특정 유전자를 삽입하여 인공적으로 유래된 전분화능 줄기세포의 하나이다. 유도만능 줄기세포는 줄기세포 유전자 및 단백질 발현, 염색체 메틸화, 배가시간(doubling time), 배아체 형성, 테라토마 형성, 생존성 키메라 형성, 교잡성 및 분화성을 가진다는 점에서 배아줄기세포와 같은 천연의 전분화능 줄기세포와 동일한 표현형, 생리학적 특성 및 발생학적 특성을 가지는 것으로 당업계에서 간주되고 있다.
본 명세서에서 용어“면역세포”는 면역 반응의 개시 또는 촉진 과정에 관여하는 모든 세포를 의미하며, 보다 구체적으로는 면역 작동세포(immune effector cell)를 의미한다. 면역세포는 예를 들어 T 세포, B 세포, 자연살해(NK)세포, 자연살해 T(NKT) 세포 및 비만 세포(mast cell)을 포함하나, 이에 제한되는 것은 아니다. 보다 구체적으로는, 상기 면역세포는 자연살해세포이다.
본 발명이 면역세포에 적용될 경우, 종양 및 감염성 질환의 치료에 적용될 수 있다. 본 발명에 따른 방법으로 제조된 NK 세포는 고형암(solid cancer) 및 혈액암을 포함한 모든 종류의 종양에 적용이 가능하다. 고형암이란 혈액암과는 달리 장기(organ)에서 덩어리를 이루어 형성된 암을 의미하며, 대부분의 장기에서 발생하는 암이 이에 해당된다. 본 발명에 따른 NK 세포를 이용하여 치료 가능한 종양은 특별한 제한은 없으며, 위암, 간암, 폐암, 대장암, 유방암, 전립선암, 난소암, 췌장암, 자궁경부암, 갑상선암, 후두암, 급성 골수성 백혈병, 뇌종양, 신경모세포종, 망막모세포종, 두경부암, 침샘암, 림프종 등일 수 있지만, 이에 제한되는 것은 아니다. 본 발명의 면역세포를 이용하여 치료될 수 있는 감염성 질환은 바이러스 또는 병원균의 감염에 의해 발생하는 질환으로, 호흡기 및 혈액, 피부접촉 등을 통해 전염되어 감염될 수 있는 질환을 모두 포함하는 개념이다. 이러한 감염성 질환은 예를 들어 B형 및 C형 간염, 인간 파필로마 바이러스(human papilloma virus:HPV) 감염, 사이토메갈로바이러스(cytomegalovirus) 감염, 바이러스성 호흡기 질환, 인플루엔자를 포함하나, 이에 제한되는 것은 아니다.
본 명세서에서 용어“치료”는 (a) 질환, 질병 또는 증상의 발전의 억제; (b) 질환, 질병 또는 증상의 경감; 또는 (c) 질환, 질병 또는 증상을 제거하는 것을 의미한다. 본 발명의 면역원성 억제 조성물이 도입된 줄기세포가 대상체에 투여되면 과도하거나 원치 않는 면역반응으로 인한 증상의 발전을 억제하거나, 이를 제거하거나 또는 경감시키는 역할을 하며, 본 발명의 면역원성 억제 조성물이 도입된 면역세포가 대상체에 투여되면 암세포나 감염 세포의 사멸을 유도함으로써 역시 종양 또는 감염질환으로 인한 증상의 발전을 억제하거나, 이를 제거하거나 또는 경감시키는 역할을 한다. 따라서, 본 발명의 조성물은 그 자체로 질환의 세포 치료제 조성물이 될 수도 있고, 혹은 다른 약리성분과 함께 투여되어 상기 질환에 대한 치료 보조제로 적용될 수도 있다. 이에, 본 명세서에서 용어“치료”또는“치료제”는“치료 보조”또는“치료 보조제”의 의미를 포함한다.
본 명세서에서 용어“투여”또는“투여하다”는 본 발명의 조성물의 치료적 유효량을 대상체에 직접적으로 투여함으로써 대상체의 체내에서 동일한 양이 형성되도록 하는 것을 말한다.
본 발명에서 용어“치료적 유효량”은 본 발명의 조성물을 투여하고자 하는 개체에게 치료적 또는 예방적 효과를 제공하기에 충분한 정도로 함유된 조성물의 함량을 의미하며, 이에“예방적 유효량”을 포함하는 의미이다.
본 명세서에서 용어“대상체”는 제한 없이 인간, 마우스, 래트, 기니아 피그, 개, 고양이, 말, 소, 돼지, 원숭이, 침팬지, 비비 또는 붉은털 원숭이를 포함한다. 구체적으로는, 본 발명의 대상체는 인간이다.
본 발명의 다른 양태에 따르면, 본 발명은 상술한 본 발명의 조성물을 이용하여 제조된 저면역원성 포유류 세포를 제공한다.
본 발명의 면역원성 저해용 조성물 및 상기 조성물이 도입될 대상 세포에 대해서는 이미 상술하였으므로, 과도한 중복을 피하기 위해 그 기재를 생략한다.
본 발명의 또 다른 양태에 따르면, 본 발명은 다음 단계를 포함하는 저면역원성 포유류 세포의 제조방법을 제공한다:
(a) 포유류 개체로부터 분리된 세포에서 β2-마이크로글로불린 단백질, Ⅱ형 HLA 단백질, Ⅱ형 HLA 단백질의 활성화 단백질 및 이들의 조합으로 구성된 군으로부터의 선택되는 단백질의 발현을 억제하는 단계; 및
(b) 상기 세포에 HLA-E 유전자를 도입하는 단계.
본 발명에 따르면, 감소된 면역원성을 가지면서 활성이 장기간 유지될 수 있는 본 발명의 치료용 동종이식 세포를 제조함에 있어서, 면역원성 유발 유전자를 먼저 억제한 뒤, 이어서 수혜자의 NK 세포로부터의 공격을 억제시키기 위한 유전자를 도입하는 과정이 순차적으로 이루어지는 경우 세포의 우수한 성장 특성, 생존성 및 활성이 나타남을 발견하였다.
후술하는 실시예에서 보는 바와 같이, HLA-E의 도입을 먼저 수행할 경우 B2M 유전자를 제거하더라도 HLA-E의 발현이 지속되어 배양 과정에서 HLA-ABC-/HLA-E+ 표현형을 가지는 NK 세포의 생존 및 성장이 유지될 수 있을 것이라는 예상과 달리 HLA-ABC-/HLA-E+ 특성을 가지는 세포의 수율이 매우 낮았으며, 오히려 면역원성 유전자 제거 후 순차적으로 HLA-E를 도입하는 공정이 배양 종료시까지 HLA-ABC-/HLA-E+ 특성을 가지는 세포가 96% 이상 존재하는 높은 수율을 보여줌으로써 본 발명의 저면역원성 포유류 세포를 제조하는 최적의 공정 순서임을 확인하였다.
본 발명의 구체적인 구현예에 따르면, 상기 단계 (a)는 상술한 각 단백질에 대한 발현 억제용 핵산분자를 및 엔도뉴클레아제를 이용하여 수행될 수 있다. 이들 핵산 분자 및 엔도뉴클레아제에 대해서는 이미 상술하였으므로, 과도한 중복을 피하기 위해 그 기재를 생략한다.
본 발명의 구체적인 구현예에 따르면, 상기 단계 (b)는 상기 단계 (a)가 완료된 후 1 내지 5일 경과 후 이루어지며, 보다 구체적으로는 2일 내지 5일 경과 후 이루어지고, 가장 구체적으로는 3일 경과 후 이루어진다.
본 발명의 특징 및 이점을 요약하면 다음과 같다:
(a) 본 발명은 포유류 세포의 면역원성 저해용 조성물 및 이를 이용한 저면역원성 포유류 세포의 제조방법을 제공한다.
(b) 본 발명은 줄기세포나 면역세포 등 질환의 치료 목적으로 동종이식(allogeneic transplantation)되는 세포에 있어서, 수혜자의 체내에서 면역거부반응이 최소화되면서도 장기간 활성이 유지되는 효율적인 세포 치료제로 유용하게 이용될 수 있다.
도 1은 B2M 유전자에 대한 gRNA 처리 3일 후 HLA-ABC 발현량을 FACS로 측정한 결과를 보여주는 그림이다.
도 2는 본 발명의 유전자 편집 시스템의 전달을 위해 사용한 셔틀의 농도에 따른 B2M 유전자의 녹-아웃 효율을 측정한 결과를 나타내는 그림이다.
도 3은 B2M 유전자가 녹-아웃된 NK 세포의 배양에 따른 HLA-ABC 발현 비율의 변화를 보여주는 그림이다.
도 4는 HLA-E 형질도입에 의한 B2M- NK 세포의 생존능력 증가 결과를 나타내는 그림이다.
도 5는 B2M 녹-아웃 또는 HLA-E 형질 전환된 NK 세포의 생존율 및 성장률을 보여주는 그림이다.
도 6은 제조 방법에 따른 Log-NK 표현형 및 제조 효율을 나타낸 그림이다.
도 7은 Log-NK 의 배양 시점에 따른 HLA-ABC 및 HLA-E 발현량을 보여주는 그림이다.
도 8은 Log-NK의 배양 종료 시점의 NK 특성마커 발현량을 보여주는 그림이다.
도 9는 Log-NK의 배양에 따른 세포 생존율 및 성장률을 보여주는 그림이다.
도 10은 Log-NK의 암세포주 살해능을 평가한 결과를 보여주는 그림으로, 야생형 NK 세포 또는 Log-NK 세포에 의한 K562 암세포주의 용해 정도(도 10a) 및 K562 타겟 세포와 접촉 시 야생형 NK 세포와 Log-NK 세포의 사이토카인 발현량의 변화(도 10b)를 각각 보여준다.
도 11a는 calcein AM을 이용하여 CD8(+) T 세포에 의해 용해되는 야생형 NK 세포 비율을, 도 11b는 CFSE를 이용하여 CD8(+) 세포에 의해 용해되는 야생형 NK 세포 및 Log-NK 세포의 비율을 장기 관찰한 결과를 각각 나타낸다.
도 12는 유세포 분석을 통해 NK 세포에서 CⅡTA 유전자 녹-아웃에 의한 Ⅱ형 HLA 유전자의 발현 억제를 확인한 결과를 보여주는 그림이다.
도 13은 유세포 분석을 통해 NK 세포에서 CⅡTA 유전자의 녹-아웃 이후 배양 시점에 따라 Ⅱ형 HLA 유전자의 발현 억제를 확인한 결과를 보여주는 그림이다.
도 14a는 B2M과 CⅡTA 유전자가 동시에 제거된 NK 세포를 제작하기 위한 과정을 요약한 모식도이고, 도 14b는 도 14a의 각 제작방법으로 제작된 NK 세포에서 B2M과 CⅡTA의 더블 녹-아웃 효율을 보여주는 그림이다. 도 14c 및 14f는 B2M과 CⅡTA 유전자 내 gRNA의 온-타겟 및 오프-타겟 예상 부위의 서열을 각각 나타내는 그림이다. 도 14d 및 14e는 B2M의 3개 오프-타겟 예상부위에서 삽입/결실이 일어나지 않았음을 보여주는 그림이다. 도 14g 및 14h는 CⅡTA의 2개 오프-타겟 예상부위에서 삽입/결실이 일어나지 않았음을 보여주는 그림이다.
도 15는 도 14a의 제작방법 1(도 15a) 및 제작방법 2(도 15b)로 제작한 Log-NK-CⅡTA KO 세포의 증식률 및 생존율을 각각 나타내는 그림이다.
도 16은 배양 기간 동안의 Log-NK-CⅡTA KO 세포의 표현형을 확인한 결과를 보여주는 그림으로, HLA-ABC와 HLA-DR/DP/DQ의 발현억제(도 16a) 및 HLA-E의 발현(도 16b)을 각각 보여준다.
도 17은 Calcein-AM(도 17a) 및 CFSE(도 17b) 세포 염색 방법을 각각 이용하여 Log-NK-CⅡTA KO 세포의 암세포 살상력을 측정한 결과를 나타낸다.
도 18은 다양한 gRNA 전달 방법에 의한 B2M(도 18a) 및 CⅡTA(도 18b) 유전자의 녹-아웃 효율을 확인한 결과를 보여주는 그림이다.
도 19는 본 발명의 Log-NK-CⅡTA KO 세포가 수여자의 CD8(+) T 세포(도 19a) 및 CD4(+) T 세포(도 19b)의 공격을 회피할 수 있는지 여부를 확인한 결과를 보여주는 그림이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
실시예 1: 유전자 가위를 이용한 B2M 유전자의 녹-아웃(knock-out)
저면역원성 NK 세포는 공여자에게 기증받은 제대혈로부터 분리한 NK(cord blood natural killer, CBNK) 세포를 사용하여 제작하였다.
세포 표면에 존재하는 사람백혈구항원(human leukocyte antigen, HLA)인 HLA-A, HLA-B 및 HLA-C에 공통으로 존재하는 β2m은 B2M 유전자로부터 발현되어 만들어진다. HLA-ABC를 발현하지 않는 NK 세포의 제작을 위하여 유전자 가위 기술로 NK 세포의 게놈에서 B2M 유전자의 원하는 부분을 아래의 방법으로 절단하여 β2m의 발현을 억제하였다.
먼저, 1.5 mL 원심분리 튜브에 아래와 같이 gRNA와 뉴클레아제의 복합체인 RNP(ribonucleoprotein) 반응액을 제조하여 상온에서 5분 이상 반응시킨 후 60분 이내로 사용하였다.
26.84μL의 1 X PBS에 40μM의 Cpf1 뉴클레아제(Feldan Therapeutics) 3.32μL 또는 26μL의 1 X PBS에 40μM의 MAD7 뉴클레아제(Feldan Therapeutics) 4 μL와 B2M 유전자를 절단하는 다양한 서열의 gRNA(IDT社 합성, 10μM) 20μL를 각각 섞어준 뒤 상온에서 5분 이상 반응시켜 RNP 반응액을 수득하였다. 제조한 RNP 반응액은 세포수 1~4 X 106 까지 사용 가능한 용량이며, 본 실시예 에서는 ADAM 세포 계수기(ADAM cell counter system, 나노엔텍)를 사용하여 세포 수를 측정한 뒤 2 X 106 개의 NK 세포를 사용하였다. 별도의 1.5 mL 원심분리 튜브에 2 X 106 개의 NK 세포를 넣어주고, 2000 rpm, 3분 동안 원심분리한 후 상층액을 제거하였다. 500 μL의 1 X PBS를 넣어준 뒤 2000 rpm, 3분 동안 원심분리하여 상층액을 제거하고 세포만 남겼다. 또 다른 1.5 mL 원심분리 튜브에 48 μL의 αlpha MEM 배지(Sigma, M8042)에 2 μL의 Feldan 셔틀(Feldan Therapeutics, 5μM)을 첨가한 후, 상기 반응시켰던 50 μL의 RNP 반응액을 혼합하였다. 그 다음, 상층액을 제거한 NK 세포에 혼합액을 넣어 1분 30초 동안 상온에서 정치 상태로 반응시킨 후, 1%(v/v)의 인간 혈장과 1000 IU hIL-2(프로류킨 주, 한국노바티스)를 포함하는 Cellgro 배지(Cellgenix, 20802-0500) 2 mL을 넣어주어 NK 세포를 부유시킨 후 6-웰 플레이트에 옮겨 배양하였다.
이후 72시간을 정치배양한 뒤 2 X 105 개의 NK 세포를 수거하여 1,200 rpm으로 5분간 원심분리하고 배지를 제거한 후 2 mL의 2% FBS가 첨가된 FACS 완충액에 부유시키고 2000 rpm, 3분 동안 원심분리하여 상층액을 제거하여 NK 세포만 남겼다. 다음으로, 100 μL FACS 완충액을 넣어준 후 표 1과 같이 분석할 항체를 첨가하고 4℃에서 30분간 반응시켰다. 2 mL의 FACS 완충액을 가하여 2000 rpm, 3분 동안 원심분리한 후 상층액을 제거하고, 300 μL Fixation (BD,554655)용액을 넣어주어 NK 세포를 고정시켰다. 그 다음, 유세포 분석기인 LSRFortessa(BD Bioscience)를 사용하여 염색한 NK 세포 표면의 발현을 분석하였다.
B2M 유전자를 Cpf1 또는 MAD7 뉴클레아제를 이용하여 절단할 수 있는 가이드 RNA(gRNA)로서 benchling(ttps://benchling.com), CRISPR RGEN Tools(www.rgenome.net) 프로그램을 이용하여 선정한 gRNA 후보 서열은 표 2에 나열하였다. HLA-ABC 발현을 FACS로 확인하여 각각의 gRNA의 녹-아웃 효율을 평가하였다 .
NK 세포 표현형에 대한 FACS 분석용 항체
마커 항체정보(형광/ 제조사/ 제품번호) 항체 사용량
인간 CD56 APC / BD Bioscience / 555518 5μL
인간 HLA-ABC BV421 / BD Bioscience / 565332 0.5μL
인간 CD3 FITC / BD Bioscience / 555332 5μL
7-AAD PerCp-Cy5.5 / Beckmen Coulter / A07704 5μL
B2M을 타겟팅하는 gRNA 후보 서열
서열번호 서열 길이 (bp) 뉴클레아제 절단위치 B2M 녹-아웃
% (FACS)		 비고
1 ATCCATCCGACATTGAAGTT 20 Cpf1 엑손2 23
2 ATCCATCCGACATTGAAGTTG 21 Cpf1 엑손2 9 서열1+1nt
3 ATCCATCCGACATTGAAGTTGAC 23 Cpf1 엑손2 0.8 서열1+2nt
4 TTAGAGTCTCGTGATGTTTAAG 22 Cpf1 프로모터 0.5
5 CCGAUAUUCCUCAGGUACUCCA 22 Cpf1 엑손2 5
6 ATATAAGTGGAGGCGTCGCGC 21 Cpf1 엑손1 1.1
7 ATATAAGTGGAGGCGTCGCGCTG 23 Cpf1 엑손1 0.6 서열6+2nt
8 AGTGGGGGTGAATTCAGTGTA 21 Cpf1/ MAD7 엑손2 69.5
9 AGTGGGGGTGAATTCAGTGTAGT 23 Cpf1 엑손2 77 서열8+2nt
10 CTGAATTGCTATGTGTCTGGG 21 Cpf1 엑손2 3
11 CTGAATTGCTATGTGTCTGGGTT 23 Cpf1 엑손2 0.5 서열10+2nt
12 CTCACGTCATCCAGCAGAGAA 21 Cpf1 엑손2 5
13 CTCACGTCATCCAGCAGAGAATG 23 Cpf1 엑손2 0.8 서열12+2nt
14 AGCAAGGACTGGTCTTTCTAT 21 Cpf1 엑손2 32
15 AGCAAGGACTGGTCTTTCTATCT 23 Cpf1 엑손2 0.2 서열14+2nt
16 CATTCTCTGCTGGATGACGTGAG 23 Cpf1 엑손2 0.9
17 TCAGTGGGGGTGAATTCAGTGTA 23 Cpf1 엑손2 0.5
18 CAGTGGGGGTGAATTCAGTGTAG 23 Cpf1 엑손2 0.4
19 TCACAGCCCAAGATAGTTAAGTG 23 Cpf1 엑손2 0.3
그 결과 19개 서열 중 #1(ATCCATCCGACATTGAAGTT), #8(AGTGGGGGTGAATTCAGTGTA), #9(AGTGGGGGTGAATTCAGTGTAGT) 및 #14(AGCAAGGACTGGTCTTTCTAT)의 4개 gRNA 서열에서 가장 높은 비율로 B2M 유전자가 녹-아웃 되었음을 확인하였고(도 1), 이 중에서도 가장 높은 효율을 가진 #9 gRNA를 선정하여 Cpf1으로 B2M 유전자 녹-아웃을 수행하였다. Cpf1을 이용할 경우 gRNA의 서열 길이는 19-23bp 범위에서 적용 가능하며, 동일 부위를 타겟팅 할 경우 서열의 길이가 길수록 오프-타겟(off-target) 현상을 최소화 할 수 있다. 한편, MAD7 뉴클레아제의 경우는 21 bp의 gRNA를 사용하기 때문에 #9 gRNA 서열과 같은 부위를 절단하면서 길이가 2 bp 짧은 #8 gRNA를 사용하였다.
#8과 #9 gRNA와 Cpf1 또는 MAD7을 이용하여 NK 세포의 B2M 유전자를 절단한 뒤 지놈 DNA를 분리하여 전장 유전체 시퀀싱(Whole Genome Sequencing)을 수행하였다. gRNA 서열과 불일치(mismatch) 되는 핵산 서열이 4개 이하로 존재하는 지놈 DNA 서열을 오프-타겟 가능성이 있는 부위로 가정하고 실제 오프-타겟에 의한 삽입/결실이 발생하였는지 여부를 확인하였다. 그 결과, 3개의 오프-타겟 예상 부위가 확인되었고 유전자 삽입/결실에 대한 서열분석 결과를 확인하여 2개 예상부위에서는 삽입/결실이 일어나지 않았음을 확인하였고, 4번 염색체 부위에서는 삽입/결실이 발견되었으나 대조군 NK와 동일한 위치에서 보여지는 삽입/결실이었다. 결과적으로 #8과 #9 gRNA를 이용한 B2M 녹-아웃은 오프-타겟 예상 부위에서 변이가 일어나지 않음을 확인하였다(첨부 1).
본 실시예에서는 펩타이드 전달체인 셔틀(Shuttle, Feldan therapeutics)을 사용해서 RNP 반응액을 세포내로 전달했으나, 전기천공(electroporation), 리포펙타민(lipofectamine), 양이온성 중합체(예를 들어 폴리 아르기닌) 등의 다양한 전달방법을 사용할 수도 있다.
실시예 2: B2M 유전자 녹-아웃을 위한 셔틀 효율 평가
셔틀 단백질을 이용하여 B2M 유전자의 녹-아웃을 수행하였다. 사용한 셔틀의 서열은 표 3에 나타내었으며, B2M 유전자의 녹-아웃은 실시예 1에 기술한 과정과 동일한 방법으로 수행하였다.
사용된 셔틀의 서열
셔틀 아미노산 서열
FSD64d1 LLKIWSRLIKIWTQGRRLGGSGGGSARAARQAR (서열목록 제45서열)
셔틀을 5 μM과 10 μM로 사용하여 CBNK 세포 내 B2M 유전자의 녹-아웃 효율을 확인한 결과, 5 μM 의 FSD64d1 셔틀이 B2M의 녹-아웃 효율 및 세포 생존율 측면에서 10 μM 보다 우수한 것으로 확인 되었으므로 (도 2), 이후 실시예에서 B2M 녹-아웃은 5 μM 의 FSD64d1 셔틀을 이용하여 수행하였다.
실시예 3: 저면역원성 NK 세포의 제작 및 인 비트로 평가
B2M 유전자를 녹-아웃시킨 NK 세포를 배양하며 B2M과 HLA-ABC 발현을 확인한 결과 전체 세포에서 B2M 과 HLA-ABC를 동시에 발현하지 않는 세포의 비율이 시간이 지날수록 감소되는 것을 확인하였다(도 3). 도 3의 결과가 B2M 유전자가 녹-아웃되어 HLA-ABC 발현이 억제된 NK 세포가 HLA-ABC를 발현하는 NK 세포에 의해 공격받았기 때문인지를 확인하기 위해 야생형 CBNK, B2M 유전자를 녹-아웃시킨 NK 세포만 분리한 그룹(B2M KO NK), scHLA-E를 야생형 CBNK에 형질도입한 그룹(HLA-E TD NK), B2M 유전자가 녹-아웃된 NK 세포만 분리하여 scHLA-E를 형질도입한 그룹(B2M KO/HLA-E TD NK)을 각각 제작하여 인 비트로 세포사멸 어세이를 수행하였다. HLA-E 유전자는 외래 세포가 숙주의 NK 세포로부터 공격받는 것을 억제하는 것으로 알려져 있어 이를 B2M 유전자 녹-아웃(knock-out) NK 세포에 도입하였으며, 이와 같이 B2M-/HLA-E+ 발현 특성을 가지는 동종이계(allogeneic) 저면역원성 NK 세포로서 체내에 주입시 숙주의 CD8(+) T세포 및 NK 세포에 의한 공격을 회피할 수 있을 것으로 예상하였다.
3-1) B2M KO NK 세포 제작 (B2M- NK)
HLA-ABC를 발현하지 않는 세포의 비율이 가장 높게 유지되는 녹-아웃 3일째에 B2M 유전자가 녹-아웃된 NK 세포를 분리하였다. B2M 유전자를 녹-아웃한 NK 세포는 원심분리로 세포를 모은 후 상층액을 제거하고 1X107/100 μL 농도로 MACS 완충액 (0.5% FBS(GIBCO), 2 mM EDTA(Invitrogen)가 용해된 PBS(Lonza))으로 재부유시킨 후 100 μL 당 바이오틴이 접합된 B2M 항체(Invitrogen, MA1-19506) 10 μg을 넣어 4℃에서 15분 동안 염색한 후 2 mL의 MACS 완충액을 넣어주고 1200 rpm, 5분 동안 원심분리하여 상층액을 제거하였다. 그 다음, 펠렛 상태의 NK 세포를 80 μL의 MACS 완충액으로 부유시키고, 20 μL의 항-바이오틴 마이크로비드(Miltenyi Biotec, 130-090-485)를 섞어주어 4℃에서 15분 동안 반응시킨 후, 2 mL의 세척완충액(Miltenyi Biotec, 130-091-222)을 넣고 1200 rpm, 10 분 동안 원심분리한 다음 상층액을 제거하였다. 500 μL의 세척완충액으로 NK 세포를 부유시켰다. LS 컬럼(Miltenyi Biotec)을 QuadroMACS™ Separator(Miltenyi Biotec)에 고정시키고 2 mL의 세척완충액으로 세척한 후 부유시킨 NK 세포를 컬럼에 흘려주었다. 그 다음, 3 mL의 세척완충액을 두 번 흘려주어 컬럼에 결합되지 않은 B2M 녹-아웃 세포들을 회수하였다. 세포 수 측정 후 NK 세포 배지에 1 x 106/ml 농도로 부유시킨 다음 적합한 크기의 웰 플레이트 배양용기에 담아 배양하였다.
3-2) HLA-E TD NK 세포 제작 (HLA-E+ NK)
단일쇄 HLA-E 삼중체(scHLA-E)를 NK 세포에서 발현시키기 위해 렌티바이러스 벡터를 이용하였다. 본 발명에서 이용된 단일쇄 HLA-E 삼중체는 US20050196404A1에서 개시된 아미노산 서열을 사용하되, 이의 코딩 핵산 서열은 코돈 최적화를 수행하여 사용하였다(서열목록 제46서열). 코돈을 최적화한 단일쇄 삼중체 서열을 발현하는 렌티바이러스 벡터는 Flash Therapeutics(프랑스)에서 제작하였다.
scHLA-E를 NK 세포에 형질도입하기 위해 50 MOI(Multiplicity of infection)의 scHLA-E 렌티바이러스 벡터와 10 μg/mL Protransduzin-A (immundiagnostik /A 2115AG.1) 복합체를 제조하여 5 분 이상 상온에 방치한 후 배양 용기에 담겨있는 NK 세포에 처리하였다. 렌티바이러스 벡터의 세포 내 도입 및 발현을 촉진할 수 있도록 배지에 6 μM의 5Z-7-Oxozeaenol(TOCRIS #360420), 20 ng/mL의 IL-21(Biolegend / 571204)을 함께 처리하였다.
3-3) B2M KO/HLA-E TD NK 세포(B2M-/HLA-E+ NK)의 제작
상기 1)과 같이 제작된 B2M KO NK 세포를 배양 용기에 담은 후 상기 2)와 같이 scHLA-E를 형질 도입하였다. 최종적으로 HLA-ABC-/ HLA-E+ 또는 HLA-ABC-/ HLA-E+ 표현형을 가지도록 이와 같이 유전자 조작이 완료된 저면역원성의 NK 세포를 본 발명자들은 “Log-NK”(Log-lasting NK)라고 명명하였다. 제작된 NK 세포들은 표 4의 항체를 이용하여 FACS 분석을 수행하였다.
NK 세포 표현형에 대한 FACS 분석용 항체
마커 항체정보(형광/ 제조사/ 제품번호) 항체 사용량
인간 CD56 APC / BD Bioscience / 555518 5 μL
인간 HLA-ABC BV421 / BD Bioscience / 565332 0.5 μL
인간 CD3 FITC / BD Bioscience / 555332 5 μL
인간 HLA-E PE / Biolegend / 342604 1 μL
7-AAD PerCp-Cy5.5 / Beckmen Coulter / A07704 5 μL
실시예 4: 저면역원성 NK 세포의 인 비트로 특성 평가
4개 그룹의 NK 세포(야생형 CBNK, B2M- NK, HLA-E+ NK, B2M-/HLA-E+ NK)는 타겟 세포로 사용되며 1X PBS로 세척한 후 상층액을 제거하고, 10% FBS가 첨가된 RPMI 1640 배지(Gibco, 11875093)인 assay 배지를 1mL 넣어 1 X 106/ml의 농도로 부유시킨 후 30 μL Calcein-AM(Molecular probe, C34852)을 가한 다음 37℃에서 1 시간 동안 CO2 배양기에서 반응시켰다. 이후, assay 배지로 2회 세척 후, assay 배지 10 mL로 세포를 부유시켜 1 x 105/ml의 농도로 제조하였다. 작동(effector) 세포로 사용할 PBNK(공여자의 말초혈 유래 NK 세포) 또는 CBNK (공여자 제대혈 유래 NK 세포) 역시 1x PBS로 세척한 후 상층액을 제거하고, assay 배지를 넣어 30:1의 작동:타겟 세포 비율을 위해 3 X 106/ml 또는 10:1의 작동:타겟 세포 비율을 위해 1 x 106/ml 비율로 제조하였다. 둥근바닥 96 웰 플레이트에 30:1 또는 10:1 비율로 제조된 작동 세포를 3개 웰에 각각 100 μL씩 넣어준 뒤, 1 x 105/mL의 농도의 타겟 세포를 100 μL씩 넣어주었다. 세포 살상능을 수식으로 계산하기 위해 스판(spontaneous release) 웰과 맥스(maximum release) 웰을 준비하였다. 스판 웰에는 염색된 타겟 세포를 100 μL씩 넣고 assay 배지를 100 μL씩 넣어 주었다. 맥스(maximum release) 웰에는 염색된 타겟 세포를 100 μL씩 넣고 2% Triton-X 100 용액을 100 μL씩 넣어 주었다. assay 배지 및 2% Triton-X 100 용액에 존재하는 자가형광값을 보정하기 위해 assay 배지 200μL를 넣어 배지값을 준비하고, assay 배지 100 μL에 2% Triton-X 100 용액 100 μL를 넣어 두 용액의 혼합액의 값을 준비하였다. 배지값에서 혼합액의 값을 뺀 차(A)를 맥스값에 더 하여 자가 형광값을 보정하였다. 빛을 차단하여 37℃에서 4시간 동안 CO2 배양기에서 반응시킨 후 플레이트를 2,000 rpm에서 3분간 원심 분리하였다. 상층액을 96-웰 블랙 플레이트에 100 μL씩 넣고 형광 플레이트 리더기(Perkin Elmer, VICTOR Nivo)를 이용하여 형광값(OD480/535nm)을 측정하여, 작동 세포의 타겟 세포에 대한 세포살상능을 하기의 식을 이용하여 계산하였다:
세포살상능(%) = (샘플 웰 평균 형광값 - 스판 웰 평균 형광값)/
{(맥스 웰 평균 형광값 + A) - 스판 웰 평균 형광값} x 100
B2M을 녹-아웃한 B2M KO NK 그룹(공여자 1)은 다른 공여자에서 유래된 PBNK 세포(공여자 A 또는 공여자 B) 또는 동일 공여자의 wild type NK 세포(공여자 1)에 의해 쉽게 공격받는 것을 확인하였다. 반면 HLA-E를 발현하는 HLA-E TD NK 또는 B2M KO/HLA-E TD NK 그룹에서는 공격받는 정도가 현저히 감소함을 관찰하여 HLA-E를 발현시킨 NK 세포는 다른 공여자로 유래하거나 HLA-ABC를 발현하는 야생형 NK 세포의 공격을 효율적으로 회피할 수 있음을 확인하였다(도 4). 표 5는 작동 세포의 표면에 발현하고 있는 HLA-E 결합 수용체인 NKG2A 및 NKG2C 발현을 FACS 분석으로 측정한 결과이다.
작동 세포의 NKG2A 및 NKG2C 발현
작동 세포 NKG2A 발현 (%) NKG2C 발현 (%)
PBNK (공여자 A) 31 48
PBNK (공여자 B) 76 17
CBNK (공여자 1) 96 17
또한 제작된 유전자 조작 NK 세포 그룹을 각각 배양할 경우 각 그룹간 생존에 큰 차이가 없었으나 생장성에 있어서는 B2M KO NK 그룹이 다른 그룹에 비해 매우 낮은 결과를 보였다(도 5a 및 5b).
실시예 5: Log-NK 세포(B2M-/HLA-E+ NK 세포)의 제작방법 최적화
B2M 유전자가 녹-아웃되어 HLA-ABC 발현이 억제되고, HLA-E 유전자를 형질도입하여 제작한 Log-NK 세포는 표 6에 나타난 바와 같이 4가지 방법으로 제작하였다.
Log-NK 제조방법
7일 10일 12일 14일 21일 29일 39~42일
제조방법 1 B2M KO B2M- 분리,
scHLA-E TD		 FACS
발현확인		 배양종료
(FACS 발현확인)
제조방법 2 scHLA-E TD B2M KO FACS
발현확인		 배양종료
(FACS 발현확인)
제조방법 3 scHLA-E TD B2M KO B2M- 분리 FACS
발현확인		 배양종료
(FACS 발현확인)
제조방법 4 B2M KO 배양종료
(FACS 발현확인)		 ㅡ
*KO: Knock-out, TD: Transduction
각 과정의 상세 실험방법 및 발현특성의 FACS 분석방법은 실시예 1과 3에 기술된 바와 같다. 도 6에서 그래프의 2사분면 영역(굵은 실선)이 Log-NK 세포를 나타낸다. 제조방법 1의 경우, NK 세포 배양 초기시점인 7일차에 B2M gRNA를 처리하고 3일이 지난 후 B2M- 세포만 분리한 뒤 scHLA-E를 도입하여 발현시켰으며, 그 결과 배양 종료시까지 96% 이상의 Log-NK 세포가 존재함을 확인하였다.
제조방법 2의 경우, 전체 배양의 배양 1/3 지점 시점인 14일 차에 scHLA-E를 먼저 도입하여 발현시키고 3일 후 B2M을 제거하여 B2M- 세포를 분리하는 과정은 진행하지 않았다. HLA-E를 발현하는 세포는 다른 NK 세포의 공격을 회피할 수 있으므로 B2M 유전자를 제거하더라도 HLA-E의 발현이 지속되어 세포의 생존 및 성장이 유지될 수 있을 것이라 예상하였으나, 실제 결과는 Log-NK 세포 제작 효율이 낮고(약 13%) 배양 시간이 지남에 따라 존재하는 Log-NK 세포가 감소되어 종료 시점에서는 남아있는 Log-NK 세포가 존재하지 않았다.
제조방법 3의 경우 제조방법 1과 같이 배양 7일차에 제조 과정을 시작하였으며 B2M 제거 및 HLA-E 도입의 순서만 반대로 진행한 후 B2M- 세포를 분리하는 과정을 포함하여 Log-NK 세포를 제조하였다. 그 결과 제조방법 2와 비교하여 높은 Log-NK 세포 제작 효율(87%)을 보였으나 배양 종료 시점에서 Log-NK 세포가 약 20%로 감소되어 수율이 매우 낮아진 것을 확인하였다.
제조방법 4의 경우 배양 7일차에 B2M을 제거하고 B2M- 세포를 분리하는 과정 없이 HLA-E를 도입한 후 배양한 결과 앞의 3가지 제조방법과 비교하여 Log-NK 세포가 거의 수득되지 못함(약 3%)을 확인하였다.
상기 결과로부터 HLA-ABC 발현을 억제하여 면역원성을 제거하기 위해 B2M 유전자 발현을 억제하고, 다른 NK 세포에 의한 공격을 회피하기 위해 HLA-E를 발현시키는 본 발명의 Log-NK 세포는 상기 제조방법 1에 의할 때 가장 잘 구현되는 것으로 확인되었다.
실시예 6: NK 또는 Log-NK 세포의 배양 및 특성평가
CBNK 또는 Log-NK는 배양시작일, 배양 14 일차, 배양 28 일차에 지지세포를 이용하여 재자극을 주며 배양하였다. 배양에 사용한 지지세포는 4-1BBL, mbIL-21(membrane bound IL-21) 및 mTNF-α(membrane TNF-α) 유전자로 형질전환된 CD4+ T 세포이다. 지지세포를 이용한 재자극은 14~16일 간격 범위에서 가능하다. 적절한 배양 용기에 넣어 정치 배양한 Log-NK 세포는 39일까지 배양 후 동결하며 세포 성장 속도에 따라 최대 42일까지 배양 가능하다. 42일 이상 배양이 필요한 경우 배양 42일 차에 지지세포로 재자극하여 지속 배양이 가능하다. NK 또는 Log-NK 세포는 표 7의 항체로 염색하여 CD3-/CD56+ 순도를 가지는 NK 세포 내에서 Log-NK(HLA-ABC-/HLA-E+) 표현형이 유지되고 있는지를 배양 종료시점까지 확인하였다. 그 결과, Log-NK 세포는 HLA-ABC 유전자의 발현이 5% 이하로 유지되었으며, 야생형 NK 세포보다 각 세포의 HLA-E 발현 정도(mean fluorescence intensity, MFI)가 강하게 유지되고 있음을 확인하였다(도 7). 배양 종료 시점에 NK 세포 특성 마커를 확인하기 위하여 표 4의 인간 CD56, 인간 CD3, 7AAD 항체와 함께 표 7에 나열된 각각의 마커에 해당하는 항체를 넣어 총 14개의 염색 튜브를 만든 후 실시예 3과 같은 방법으로 유세포 분석으로 발현을 확인하였다. 그 결과, 야생형 NK 세포와 비교하여 유의하게 활성마커가 감소하거나 저해마커가 증가하는 현상은 보이지 않았다(도 8).
제조방법 1로 제작한 Log-NK 세포는 제작 과정이 종료되는 배양 10일차부터 배양 종료시점인 39일차까지 야생형 NK 세포와 비교하여 유사한 세포 생존율을 보였다. 배양 10일차에서부터 14일차 사이에 나타나는 Log-NK 세포의 생존율 및 성장률 감소는 HLA-E 렌티바이러스 벡터가 형질전환되지 않은 채 남아있는 B2M- NK 세포가 사멸하는 과정에 의해 일시적으로 나타나는 현상으로, 14일차 지지세포 재자극 이후에는 배양속도 및 생존율이 모두 회복되는 것을 확인할 수 있었다(도 9).
NK 특성 FACS 분석용 항체 목록
마커 (인간) 항체정보 (형광/ 제조사/ 제품번호) 항체 사용량
인간 CD16 PE / BD Bioscience / 555407 5 μL
인간 NKG2A PE / Miltenyi Biotec / 130-113-566 1 μL
인간 NKG2C PE / R&D Systems / FAB138P 1 μL
인간 NKG2D PE / BD Bioscience / 557940 1 μL
인간 NKp30 PE / BD Bioscience / 557940 1 μL
인간 NKp44 PE / BD Bioscience / 558563 5 μL
인간 NKp46 PE / BD Bioscience / 557991 5 μL
인간 DNAM1 PE / BD Bioscience / 559789 5 μL
인간 CD25 PE / BD Bioscience / 555432 5 μL
인간 CD62L PE /Invitrogen / 12-0629-42 1 μL
인간 CD69 PE / R&D Systems / FAB23591P 1 μL
인간 CXCR3 PE / BD Bioscience / 557185 5 μL
인간 CD57 PE / BD Bioscience / 560844 1 μL
마우스 IgG1k PE / BD Bioscience / 555749 5 μL
실시예 7: Log-NK 세포의 종양세포 독성 평가
야생형 NK 세포 또는 Log-NK 세포의 종양세포 살상능을 평가하기 위해 K562 혈액암 세포주를 타겟 세포로 사용하였다. K562 세포를 1X PBS로 세척한 후 상층액을 제거하고, 10% FBS가 첨가된 RPMI 1640 배지인 assay 배지를 넣어 1X106 /ml의 농도로 부유시킨 후 30 μL Calcein-AM(Molecular probe, C34852)을 가하고, 37℃에서 1시간 동안 CO2 배양기에서 반응시켰다. 그 다음, 10 mL의 assay 배지로 2회 세척 후, 10 mL의 assay 배지로 세포를 부유시켜 1 x 105/ml의 농도로 제조하였다. 야생형 NK 세포 또는 Log-NK 세포를 1 x PBS로 세척한 후 상층액을 제거하고, assay 배지를 넣어 10:1의 작동: 타겟 세포 비율을 위해 1x106 /ml로, 3:1의 작동: 타겟 세포 비율을 위해 3X105 /ml로, 1:1의 작동: 타겟 비율을 위해 1x105/ml로, 0.3:1 의 작동: 타겟 비율을 위해 3x104/ml로 제조하였다. 둥근바닥 96 웰 플레이트에 4가지 비율로 제조된 작동 세포를 3개 웰에 각각 100 μL씩 넣어준 뒤, 1x105/ml의 농도의 타겟 세포를 100 μL씩 넣어주었다. 이후의 실험 과정 및 종양세포 살해능 계산은 실시예 4와 동일한 방법으로 수행하였다. K562 암세포주 세포살해능 평가 결과 높은 E:T 비율에서 NK 세포가 Log-NK 세포 사이의 암세포 살해능에 유의한 차이가 없음을 확인하였으며, E:T 비율이 낮아질수록 NK 세포와 Log-NK 세포 사이의 차이는 완전히 사라졌다(도 10a).
실시예 8: Log-NK 세포의 사이토카인 분비 확인
NK 세포가 암세포 살상을 위해 분비하는 주요 사이토카인인 CD107a, IFN-γ, TNF-α의 분비량을 세포 내 cytokine 염색(intracellular cytokine staining, ICS) 시험방법으로 확인하였다. ICS 실험에서 사용하는 항체는 표 8에 명시하였으며, 세포 염색 방법에 따라 사용하는 항체 종류는 표 9에 명시하였다.
ICS용 항체 목록
항체 항체정보(형광/ 제조사/ 제품번호) 항체 사용량
인간 IFN-γ FITC / BD Bioscience / 554700 1 μL
인간 TNF-α PE-CY7 / eBioscience / 25-7349-82 1 μL
인간 CD3 PerCP-Cy5.5 / eBioscience / 45-0036-42 5 μL
인간 CD56 APC-Cy6 / eBioscience / 47-0567-42 1 μL
인간 CD107a APC / BD Bioscience / 560664 1 μL
7-AAD PerCp-Cy5.5 / Beckmen Coulter / A07704 5 μL
마우스 IgG1k FITC / BD Bioscience / 555748 5 μL
마우스 IgG1k PE-Cy7 / BD Bioscience / 557872 5 μL
마우스 IgG1k APC / BD Bioscience / 555751 5 μL
세포 염색방법 별 항체 사용 목록
항체
형광 (-), target 웰 iso 웰
표면 염색 PerCP-cy5.5 7AAD/CD3
APC-Cy7 CD56
APC CD107a IgG1k
세포내 염색 FITC IFN-γ IgG1k
PE-Cy7 TNF-α IgG1k
작동세포인 야생형 NK 세포 또는 Log-NK 세포를 1x PBS로 세척한 후 상층액을 제거하고, 1:1의 작동: 타겟 세포비율을 위해 2.5x106/mL로 10% FBS가 첨가된 RPMI 1640 배지인 assay 배지를 넣어 현탁한 뒤 1.2 mL을 새로운 튜브에 취하여 Golgi-stop(BD, 554724) 1.56μL와 Golgi-plug(BD, 555029) 2.4μL를 넣어준다.
타겟 세포인 K562 또한 2.5x106/ml로 assay 배지를 넣어 현탁한다. 96 웰 둥근바닥 플레이트를 준비하여 (-)와 타겟 웰에는 APC-CD107a 항체를, iso 웰에는 APC-IgG1k 항체를 넣어주었다. (-)웰에는 10% FBS가 첨가된 RPMI 1640 배지 100 μL 를, 타겟과 iso 웰에는 타겟 세포 100 μL 씩을 넣어주었다. 모든 웰에 작동 세포 100 μL를 넣은 후 37℃ CO2 배양기에서 4시간 동안 반응시켰다. 플레이트를 원심분리(2000 rpm, 3분, 4℃)하여 Perm/Wash 완충액(BD, 554723) 200 μL 로 2회 세척해준 후 모든 웰에 고정/투과화 용액(BD, 554655) 200 μL를 넣어 4℃ 에서 30분간 반응시켰다. 플레이트를 원심분리(2000 rpm, 3분, 4℃)하여 Perm/Wash 완충액(BD, 554723) 200 μL 로 2회 세척해준 후 모든 웰에 Perm/Wash 완충액(BD, 554723) 100 μL를 넣어준다. (-)와 타겟 웰에는 IFN-γ와 TNF-α 항체를, iso 웰에는 FITC-IgG1k 와 PE-Cy7-IgG1k 항체를 넣어준 후 4℃ 에서 30 분간 반응시켰다. 1X Perm/Wash 완충액을 100 μL 씩 넣어주고 플레이트를 원심분리(2000 rpm, 3 min, 4℃)한 후 상층액을 버렸다. 플레이트를 원심분리(2000 rpm, 3 분, 4℃)하여 Perm/Wash 완충액(BD, 554723) 200 μL로 2회 세척 후 1X Perm/Wash 완충액을 200μL씩 넣어주고 세포 펠렛을 FACS 튜브(BD falcon, 352052)로 옮겨 유세포분석기로 사이토카인 발현을 분석하였다. 그 결과 K562 타겟 세포와 접촉하였을 때 NK 세포와 Log-NK 세포의 주요 사이토카인인 CD107a, IFN-γ, TNF-α 모두 60% 이상 증가했으며, NK 세포와 Log-NK 세포 두 그룹 사이의 유의한 차이는 없었다(도 10b).
실시예 9: Log-NK 세포의 인 비트로 저면역원성 평가
제작된 Log-NK의 체내 저면역원성을 평가하기 위하여 인 비트로 혼합림프구반응(mixed lymphocyte reaction, MLR) 시험을 수행하였다. CD8(+) T 세포 분리 킷(Miltenyi Biotec, 130-096-495)을 사용하여 다음과 같이 CD8(+) T 세포를 분리하였다. 공여자의 혈액으로부터 얻은 PBMC를 MACS 완충액(PBS (Lonza)에 용해된 0.5% FBS (GIBCO), 2 mM EDTA (Invitrogen))으로 1회 세척한 후에 얻어진 세포 펠렛을 1 x 107/10μL가 되도록 MACS 완충액으로 현탁시켰다. 상기현탁액에 바이오틴-항체 칵테일을 1 x 107/10 μL의 농도가 되게 첨가하여 잘 섞어주고 4℃ 에서 5분간 반응시켰다. 반응이 끝나면 다시 1 x 107 세포 기준 30 μL의 농도로 MACS 완충액을 첨가하고, 1 x 107 세포 기준 20 μL의 CD8(+) T 세포 마이크로비드 칵테일을 추가로 넣어 준 후에, 4℃에서 10분간 반응하였다. 반응이 끝난 세포 현탁액을 LS 컬럼(Miltenyi Biotec)에 통과시켜 CD8을 발현하는 T 세포만을 분리했다.
분리된 CD8(+) T 세포를 배양하기 위해서 또 다른 공여자로부터 공여 받은 PBMC를 2,000 cGy로 방사선조사(irradiation)해준 뒤 CD8(+) T 세포와 1:1 비율로 섞고 7일간 배양하였다. 같은 방법으로 PBMC를 준비하여 7일간 배양해놓은 CD4(+) T 세포와 CD8(+) T 세포를 1:1 비율로 섞고 항-CD3 (1 ㎍/mL, Invitrogen), IL-2 (100 U/mL), 10% BBS가 포함된 RPMI 1640 배지에서 7일간 배양하였다. 7일간 더 배양하여 최종 14일 배양 후 실험에 사용하였다. 앞에서 사용한 동일한 공여자 유래 PBMC를 2000 cGy에서 다시 방사선 조사한 뒤 배양된 CD8(+) T 세포와 1:1로 섞어 주고 일주일간 더 배양해주었다. 총 14일 간 배양한 CD8(+) T세포를 작동 세포로 사용하고 NK 또는 Log-NK를 타겟 세포로 사용하여 Log-NK가 CD8(+) T세포 공격을 회피할 수 있는지를 실시예 3에서와 같은 방법으로 세포사멸능 측정을 통해 확인하였다. 도 11a에서 보는 바와 같이 CD8(+) T 세포에 의해 용해되는 세포 비율이 Log-NK보다 NK가 3배 이상 높았으며 이 결과로부터 Log-NK가 CD8(+) T 세포의 공격을 회피할 수 있음을 확인하였다. MLR 반응이 잘 일어날 수 있도록 CD8(+) T세포와 NK 또는 Log-NK 세포의 HLA-A, B, C 타입은 100% 불일치되고 CD8(+) T 세포 배양에 사용하는 방사선 조사된 PBMC는 NK 또는 Log-NK 세포의 HLA-A, B, C 타입과 83% 일치되는 조건으로 진행하였다.
또한, NK와 Log-NK를 CFSE(Thermo scientific, C34554)로 염색한 후 30:1 CD8(+) T : NK 또는 Log-NK 비율이 되도록 RPMI 1640 (10% FBS, 1000 IU IL-2) 배지에 1.2x106/mL의 CD8(+) T 세포 100 μL와 4x104/mL의 NK 또는 Log-NK를 각각 100 μL씩 96 평면웰 플레이트에 3웰 씩 넣어주었다. 플레이트는 세포 배양 인큐베이터 내부에 설치된 IncuCyte®S3 장비(Sartorius)를 이용하여 살아있는 상태로 매 시간 웰 이미지를 저장한 후 이미지에서 CFSE 형광 양성의 세포만 계수하는 분석을 실시하였다. 그 결과, NK는 CD8(+) T세포와 공배양 할 경우시간이 지날수록 처음 웰에 넣어준 세포 대비 그 비율이 감소하는 반면, Log-NK는 처음 웰에 넣어 준 세포수를 유지하는 결과를 확인할 수 있었다(도 11b).
실시예 10: CⅡTA 유전자 녹-아웃을 위한 최적 gRNA 서열의 선정
10-1) 유전자 가위를 이용한 CⅡTA 및 RFXANK 유전자의 녹-아웃(knock-out)
인간의 MHC(major histocompatitibility complex) classⅡ 유전자는 HLA-DR, HLA-DQ, HLA-DP 로 구성되어 있다. HLA-DR/DQ/DP 를 발현하지 않는 NK 세포를 제작하기 위해 유전자 가위 기술을 이용하여 주요 조절인자(master controller)로 알려진 Class Ⅱ transactivator(CⅡTA) 또는 전사인자인(transcription factor)인 RFXANK(RFX-associated ankyrin-contaning protein) 유전자의 원하는 부분을 아래의 방법으로 전달하여 CⅡTA 또는 RFXANK 의 발현을 억제하였다.
표 10에 나열된 CⅡTA 또는 RFXANK를 타겟하는 gRNA 후보 서열은 각각 실시예 1과 동일한 방법으로 RNP 반응액을 제조하였으며, 반응액은 상온에서 5분 이상 반응 후 60분 이내로 사용하였다.
제조한 RNP 반응액은 세포 수 1~4 x 106 까지 사용 가능한 용량이며 ADAM 세포 계수기(ADAM cell counter system, 나노엔텍)를 사용하여 NK 세포 수를 측정한 뒤 2 X 106 개의 세포를 사용하였다. 이후의 실험 과정 및 세포 배양은 실시예 1과 동일한 방법으로 수행하였다.
CⅡTA 또는 RFXANK를 타겟하는 gRNA 후보 서열
No.　 서열
번호		 뉴클레아제 gRNA
-엑손 위치		 서열 길이
(bp)		 녹-아웃 후 NK 세포 배양기간
(KO % of HLA-DR)
1 20 Cpf1 CⅡTA-ex1A CCTTGGGGCTCTGACAGGTAGGA 23 D4 (29.7) D8 (28.2) 　 　
2 21 Cpf1 CⅡTA-ex1B CCGGCCTTTTTACCTTGGGGCTC 23 D4 (-) D8 (7.3) 　 　
3 22 Cpf1 CⅡTA-ex3A CTCCCAGAACCCGACACAGACAC 23 D4 (9.6) D8 (12.4) 　 　
4 23 Cpf1 CⅡTA-ex4A CTTGTCTGGGCAGCGGAACTGGA 23 D4 (4.6) D8 (5.3) 　 　
5 24 Cpf1 CⅡTA-ex5A TGCCCAACTTCTGCTGGCATCTC 23 D5 (5.6) D7 (11.4) D10 (14.9) D14 (17.7)
6 25 Cpf1 CⅡTA-ex5B TGACTTTTCTGCCCAACTTCTGC 23 D5 (0.6) 　 　 　
7 26 Cpf1 CⅡTA-ex7A TCCAGGCGCATCTGGCCGGAGGC 23 D5 (2.0) 　 　 　
8 27 Cpf1 CⅡTA-ex8A TCCCCACCATCTCCACTCTGCCC 23 D5 (5.4) D7 (13.1) D10 (14.9) D14 (19.9)
9 28 Cpf1 CⅡTA-ex8B TCCAGTTCCTCGTTGAGCTGCCT 23 D5 (-) 　 　 　
10 29 Cpf1 CⅡTA-ex8C CCAGAGCCCATGGGGCAGAGTGG 23 D5 (5.5) D8 (10.4) 　 　
11 30 Cpf1 CⅡTA-ex9A CTCGGGAGGTCAGGGCAGGTTCA 23 D5 (8.9) D8 (11.2) 　 　
12 31 Cpf1 CⅡTA-ex10A GAAGCTTGTTGGAGACCTCTCCA 23 D5 (-) 　 　 　
13 32 Cpf1 CⅡTA-ex11A GCAGCACGTGGTACAGGAGCTCC 23 D5 (3.5) D8 (9.1) 　 　
14 33 Cpf1 CⅡTA-ex11B GCCATCGCCCAGGTCCTCACGTC 23 D5 (5.1) 　 　 　
15 34 Cpf1 CⅡTA-ex11C AGAGCTCAGGGATGACAGAGCAC 23 D5
(-)		 　 　 　
16 35 Cpf1 RFXANK-ex1A CAGTAGGAGTAGTCGTCGCGTAT 23 D5
(-)		 　 　 　
17 36 Cpf1 RFXANK-ex1B CAGGGCAAGGGTGCGCAGGCGCA 23 D5
(-)		 　 　 　
18 37 Cpf1 RFXANK-ex1C CGAGATCTACTGAACCAGAAAAG 23 D5
(-)		 　 　 　
19 38 Cpf1 RFXANK-ex1D TGGTTCAGTAGATCTCGTAAAGA 23 D5
(-)		 　 　 　
20 39 Cpf1 RFXANK-ex2A GGACAAGGTTCTCTGCAACCTGA 23 D5
(-)		 　 　 　
21 40 MAD7 CⅡTA-ex1A CCTTGGGGCTCTGACAGGTAG 21 D5 (22.6) D7 (15.5) 　 　
22 41 MAD7 CⅡTA-ex1B GGGCTCTGACAGGTAGGACCC 21 D4 (1.0) D8 (0) 　 　
23 42 MAD7 CⅡTA-ex3A CCTCCCAGGCAGCTCACAGTG 21 D4 (1.3) D8 (0) 　 　
24 43 MAD7 CⅡTA-ex3B TATGACCAGATGGACCTGGCT 21 D4 (0.3) D8 (0) 　 　
25 44 MAD7 CⅡTA-ex5A TGCCCAACTTCTGCTGGCATC 21 D5 (38.6) D7 (40.1) 　 　
10-2) 유세포 분석을 위한 NK 세포 염색
NK 세포의 CⅡTA 또는 RFXANK 유전자의 녹-아웃 정도를 확인하기 위하여, 실시예 10-1)에서 CⅡTA RNP 반응액을 처리한 NK 세포를 염색한 후 유세포 분석하였다. 2 x 105 개의 NK 세포에 2% FBS를 포함하고 있는 2 mL의 FACS 완충액을 넣어 현탁하고 2,000 rpm, 3분 동안 원심분리한 뒤, 100 μL FACS 완충액으로 세포를 부유시키고 형광물질을 포함하는 항체를 가한 후(표 11), 4℃에서 30분간 인큐베이션하였다. 30분 후 2 mL의 FACS 완충액을 가하여 2,000 rpm으로 3분 동안 원심분리하고 300 μL 고정 용액을 넣어준 후 유세포 분석기인 BD LSRFortessa (BD Bioscience)로 분석하였고, 그 결과를 도 12에 나타내었다.
FACS 분석용 항체 목록
마커 항체정보(형광/ 제조사/ 카탈로그 No.) 항체 사용량
인간 B2M APC / BD Bioscience / 316312 0.5 μL
인간 HLA-DR PE / Invitrogen / 12-9956-42 1 μL
인간 CD56 BV421 / BD Bioscience / 562751 0.5 μL
인간 CD3 FITC / BD Bioscience / 555332 5 μL
7-AAD PerCp-Cy5.5 / Beckmen Coulter / A07704 5 μL
HLA class Ⅱ의 녹-아웃 정도는 HLA-DR의 발현으로 확인하였으며, 테스트한 총 25개의 gRNA 서열 중 대조군인 야생형 NK 세포 대비 Cpf1-#1 gRNA를 처리한 NK 세포는 28.2%의 CⅡTA 유전자 녹-아웃 효율을 보였고, Cpf1-#5 gRNA를 처리한 NK 세포는 17.7%, Cpf1-#8 gRNA를 처리한 NK 세포는 19.9%의 녹-아웃 효율을 확인하였다. 그리고, MAD7-#21 gRNA를 처리한 NK 세포는 15.5%, MAD7-#25 gRNA를 처리한 NK 세포는 40.1%의 녹-아웃 효율을 확인하였다. 따라서, CⅡTA 유전자 녹-아웃 효율이 가장 우수한 MAD7 뉴클레아제와 #25 gRNA를 선정하여 이후 실험을 진행하였다. 또한, 도 13에 나타낸 바와 같이 RNP 반응액 전달 후 배양 3-7일에 CⅡTA 녹-아웃 효율을 확인한 결과, 배양 3일에 대조군 NK 세포 세포 대비 21.3%에서 배양 7일에 50.4%로 증가하였다. 이러한 결과는 NK 세포에 CⅡTA 녹-아웃 후 배양 기간이 길어질수록 녹-아웃 효율이 증가함을 보여주는 것이다.
실시예 11: B2M과 CⅡTA 유전자가 제거된 NK 세포 제작 조건 최적화
B2M과 CⅡTA 유전자가 동시에 제거된 NK 세포를 제작하기 위하여 도 14a에서 나타낸 바와 같이 2가지 방법으로 제작하였고 B2M과 CⅡTA 유전자 더블 녹-아웃 효율을 비교하였다. 제작방법 1에서는 1.5 mL 원심분리 튜브에 13 μL의 1X PBS와 2 μL의 3.2 μM MAD7과 10 μL의 10 μM B2M gRNA를 섞어준 후 실온에서 5분 이상 반응시켜 RNP 반응액 튜브 1을 준비한다. 다른 1.5 mL 원심분리 튜브에는 13 μL의 1X PBS와 2 μL의 3.2 μM MAD7과 10 μL의 10 μM CⅡTA gRNA를 실온에서 5분 이상 반응시켜 RNP 반응액 튜브 2를 준비한다. 준비된 RNP 반응액 튜브 1과 2를 섞어주어 총 50 μL의 RNP 반응액을 만들었다. 이후의 실험 과정은 실시예 10 과 동일한 방법으로 2 x 106 개의 배양 7일차 NK 세포에 진행하였다. 제작방법 2에서는 2 x 106 개의 배양 7일차 NK 세포에 CⅡTA를 녹-아웃 하고 4일간 배양 한 뒤 2 x 106 개의 배양 11일차 NK 세포에 B2M을 순차적으로 녹-아웃 하였다. 구체적인 실험 과정 및 세포 배양은 실시예 1과 동일한 방법으로 수행하였다. 녹-아웃 후 배양한 NK 세포는 실시예 10-2)와 동일한 방법으로 FACS용 항체로 염색한 후 유세포분석기를 이용하여 B2M과 CⅡTA 유전자의 녹-아웃 효율을 확인하였다.
도 14b에서 확인할 수 있는 바와 같이, 3명의 공여자에서 분리된 NK 세포에서 상기 제작방법으로 실험한 결과, 공여자 1에서 제작방법 1로 제작한 NK 세포의 B2M과 CⅡTA의 더블 녹-아웃 효율은 대조군 NK 세포 대비 32.4%이며, 제작방법 2로 제작한 NK 세포의 효율은 17%였다. 나머지 두 공여자에서 분리한 NK 세포에서도 제작방법 2보다 제작방법 1에서 더 높은 더블 녹-아웃 효율을 보였다.
제작방법 1로 제작한 B2M과 CⅡTA가 더블 녹-아웃된 NK 세포에서 지놈 DNA를 분리하여 전장 유전체 시퀀싱(Whole Genome Sequencing)을 수행하였다. B2M 및 CⅡTA 각각의 gRNA 서열과 불일치(mismatch)되는 핵산 서열이 4개 이하로 존재하는 지놈 DNA 서열을 오프-타겟 가능성이 있는 부위로 가정하고 실제 오프-타겟에 의한 삽입/결실이 발생하였는지 여부를 확인하였다. 그 결과, B2M gRNA 서열에서 3개의 오프-타겟 예상 부위가 확인되었고(도 14c), CⅡTA gRNA 서열에서 2개의 오프-타겟 예상 부위가 확인되었다(도 14f). 유전자 삽입/결실에 대한 서열분석 결과를 확인하여 모든 오프-타겟 예상부위에서는 삽입/결실이 일어나지 않았음을 확인하였고, 결과적으로 #8 gRNA(서열번호 8)와 #25 gRNA(서열번호 44)를 이용한 B2M과 CⅡTA 더블 녹-아웃은 오프-타겟 예상 부위에서 변이가 일어나지 않음을 확인하였다(도 14d, 도 14e, 도 14g 및 도 14h).
실시예 12: Log-NK-CⅡTA KO 세포 (B2M-/CⅡTA-/HLA-E＋ NK 세포)의 제작
B2M-/HLA-E+ 발현 특성을 가지는 Log-NK에 CⅡTA 유전자를 녹-아웃하여 Ⅱ형 HLA 단백질인 HLA-DR/DP/DQ 발현 또한 억제시킨 HLA-ABC-/HLA-DR/DP/DQ-/HLA-E＋ 표현형을 가지는 NK 세포를 상기 도 14a의 제작방법 1 또는 제작방법 2로 제작하여“Log-NK-CⅡTA KO”세포로 명명하였다. Ⅰ형 HLA와 Ⅱ형 HLA의 발현이 동시에 억제된 동종이계(allogeneic) 저면역원성 NK 세포는 체내 주입시 숙주의 CD8(+) T세포, CD4(+) T세포 및 NK 세포에 의한 면역반응을 회피할 수 있을 것으로 예상하였다. 실시예 11 의 제작방법 1과 동일한 방법으로 B2M과 CⅡTA를 녹-아웃 한 NK 세포를 제작한 뒤 MACS(Magnetic Activated Cell Sorting) 장비를 이용하여 B2M을 발현하지 않는 NK 세포를 분리하고 다시 HLA-DR을 발현하지 않는 세포를 순차적으로 분리하였다. 바이오틴이 표지된 B2M 항체(Invitrogen)를 4℃에서 20분 동안 반응시킨 후 2 mL의 MACS 완충액 (0.5% FBS, 2 mM EDTA가 용해된 PBS)을 넣어주고 1,200 rpm에서 10분 동안 원심분리 하였다. 상층액을 제거한 뒤 80 μL의 MACS완충액을 넣고 20 μL의 항-바이오틴 Microbead(Miltenyi Biotec)를 섞어준 후 4℃에서 15분 동안 반응한 뒤 2 mL의 MACS 완충액을 넣어주고 1,200 rpm에서 10분 동안 원심분리 하였다. 500 μL의 세척완충액으로 NK 세포를 현탁한 후 QuadroMACS™ Separator (Miltenyi Biotec)에 부착한 LS 컬럼(Miltenyi Biotec)에 세포를 흘려주었다. 그 다음, 3 mL의 세척완충액을 두 번 흘려주어 컬럼에 결합되지 않은 B2M- 세포들을 회수하였다. 회수한 세포는 다시 1,200 rpm에서 10분 동안 원심분리 상층액을 제거한 뒤 펠렛 상태의 세포에 80 μL의 세척완충액을 넣고 20 μL의 항-HLA-DR 마이크로비드(Miltenyi Biotec)를 섞어준 후 4℃에서 15분 동안 반응시키고 2 mL의 세척완충액을 넣어준 뒤 1,200 rpm에서 10분 동안 원심분리 하였다. 500μL의 완충액으로 NK 세포를 현탁한 후 QuadroMACS™ Separator(Miltenyi Biotec)에 부착한 LD 컬럼(Miltenyi Biotec)에 세포를 흘려주고 1 mL의 세척완충액을 두 번 흘려주어 최종적으로 B2M-/HLA-DR- NK 세포들을 회수하였다. 분리된 B2M-/HLA-DR- NK 세포는 세포수를 측정한 후 곧바로 실시예 3-2)와 동일한 방법으로 렌티바이러스 벡터를 이용하여 단일쇄 HLA-E 삼중체(scHLA-E)를 도입하였다. 1 x 106/mL 농도로 NK 세포를 배지에 부유시켜 적합한 크기의 웰 플레이트에 담아 배양하였다.
실시예 13: Log-NK-CⅡTA KO 세포의 배양 및 표현형 발현 확인
13-1) Log-NK-CⅡTA KO 세포 증식능 측정
상기 실시예 12에서 제작된 Log-NK-CⅡTA KO 세포의 증식능을 확인하기 위하여 도 15에서 나타낸 바와 같이, 배양 기간 동안 세포 증식과 세포 생존율을 측정하였다. 그 결과 제작방법 1로 제작한 Log-NK-CⅡTA KO 세포 생존율은 대조군 NK 세포의 생존율과 큰 차이가 없었으며, 대조군 NK 세포의 증식은 배양 43일 동안 지속적으로 증가하였고 Log-NK-CⅡTA KO 세포는 배양 시작 시점의 세포수보다 배양 43일에 약 268배 증가함을 확인하였다(도 15a). 제작방법 2로 제작한 Log-NK-CⅡTA KO 세포는 상기 실시예 12의 세포 분리 과정 후 세포 수가 감소하였으나, 이후 배양 39일까지 세포 증식이 회복되는 것을 확인하였고 배양 시작 시점의 세포수보다 배양 39일차에 약 936배 증가함을 확인하였다(도 15b).
13-2) 배양 기간 동안의 Log-NK-CⅡTA KO 세포의 표현형 확인
Log-NK-CⅡTA KO 세포 제작 후 배양 43일 동안 HLA-ABC와 HLA-DR/DP/DQ의 발현이 지속적으로 억제되는 지를 확인하기 위하여 실시예 11의 방법으로 제작한 NK 세포를 염색한 후 유세포분석기로 발현을 확인하였다. 2 x 105 개의 NK 세포에 2% FBS를 포함하고 있는 2 mL의 FACS 완충액을 넣은 후 2,000 rpm, 3분 동안 원심분리한 뒤 상층액을 제거한다. 100 μL FACS 완충액으로 세포를 부유시키고 표 12에 나열된 항체를 가하여 4℃에서 30분간 반응하였다. 이후 2 mL의 FACS 완충액을 가하여 2,000 rpm으로 3분 동안 원심분리하고 상층액을 제거한 뒤 300 μL 고정 용액을 넣어준 후 유세포 분석기인 BD LSRFortessa(BD Bioscience)로 발현을 분석하였다. 그 결과, 도 16a에서 보는 바와 같이, 공여자 3명 모두에서 배양 22일 후 HLA-ABC와 HLA-DR/DP/DQ의 발현이 동시에 억제된 세포가 전체 세포 중 60% 이상 존재하였으며, 공여자 1과 2의 경우 배양 43일에 전체 세포 중 90% 이상으로 증가된 것을 확인하였다 . 또한, 배양 43일 차에 Log-NK-CⅡTA KO 세포의 HLA-E 발현을 분석한 결과, 대조군 NK 세포 대비하여 공여자 1은 69.1%, 공여자 2는 72.3%, 공여자 3은 53.8%의 HLA-E 발현이 증가되어 있는 것을 확인하였다(도 16b).
FACS 분석용 항체 목록
마커 항체정보 (형광/ 제조사/ 카탈로그 No.) 항체 사용량
인간 HLA-DR/DP/DQ FITC / BD Bioscience / 555558 5 μL
인간 CD56 APC / BD Bioscience / 555518 5 μL
인간 HLA-ABC BV421 / BD Bioscience / 565332 0.5 μL
인간 CD3 PE-Cy7 / Invitrogen / 25-0038-42 1 μL
인간 HLA-E PE / Biolegend / 342604 1 μL
7-AAD PerCp-Cy5.5 / Beckmen Coulter / A07704 5 μL
실시예 14: Log-NK-CⅡTA KO 세포의 항암 능력 분석
14-1) Calcein-AM을 이용한 암세포 살상 능력 확인
암세포인 K562(만성골수성백혈병), DU145(전립선암), HepG2(간암), HCC1954(유방암), MDA-MB-231(유방암), MDA-MB-468(유방암), SKOV3(난소암)를 타겟 세포로 사용하기 위하여 각각 1 x 106/mL의 농도로 10% FBS가 첨가된 RPMI 1640 배지인 assay 배지 1 mL을 넣어 현탁한 후 30 μL의 Calcein-AM(Invitrogen)을 처리한 뒤 1시간 동안 37℃의 CO2 배양기에서 반응하였다. 반응을 마친 세포는 assay 배지로 2번 세척한 뒤 1 x 105/mL 농도로 준비한다. 작동세포인 NK 또는 Log-NK-CⅡTA KO는 3:1의 작동:타겟 세포 비율을 위해 3 X 106/mL 로 assay 배지에 현탁하고 1:1의 작동:타겟 세포 비율을 위해 1 x 106/mL 로 assay 배지에 현탁한다. 준비된 작동 세포는 둥근바닥 96 웰 플레이트의 3개 웰에 각각 100 μL씩 넣어준 뒤, 1 x 105/mL의 농도의 타겟 세포를 100μL씩 넣어주었다. 이후의 실험과정과 측정값 계산방법은 실시예 4와 동일하다.
도 17a에서 나타내는 바와 같이 Log-NK-CⅡTA KO 세포는 다양한 암세포주에 대하여 대조군 NK 세포보다 유사하거나 증가된 암세포 살상능을 보였다 .
14-2) CFSE 염색을 이용한 암세포 살상 능력 확인
암세포인 DU145, HepG2, HCC1954, MDA-MB-231, MDA-MB-468, SKOV3는 4 x 104/mL의 농도로 10% FBS가 첨가된 RPMI 1640 배지인 assay 배지에 현탁한 뒤 96-웰 플레이트의 웰에 100 μL씩 넣어 18-22 시간동안 배양한 후 작동세포를 넣어준다. 작동세포인 NK 또는 Log-NK-CⅡTA KO 세포는 2:1의 작동:타겟 세포 비율을 위해 8 X 104/mL 로 10% FBS와 1000IU IL-2가 용해된 RPMI 1640 배지에 현탁한 뒤 타겟세포를 배양중인 96-웰 플레이트에 3개 웰에 100 μL 씩 넣어준다. 37℃의 CO2 배양기 안에 설치되어있는 실시간 세포영상 분석기 IncuCyte®S3 장비(Sartorius)에서 7일 동안 배양하며 매 2시간 간격으로 세포 이미지를 저장하고 분석하여 암세포 살상능을 평가하였다. 그 결과 Log-NK-CⅡTA KO 세포는 DU145와 MDA-MB-231에서 대조군 NK 세포 보다 증가된 암세포 살상능을 보였으며, 이외의 암세포주에 대해서는 대조군 NK 세포와 유사한 살상능을 보였다(도 17b). 상기 결과는 Log-NK-CⅡTA KO 세포를 제작하기 위해 유전자를 편집하고 도입 하더라도 NK 세포 자체의 암세포 살상능이 감소하는 현상이 발생하지 않았다는 것을 보여준다.
실시예 15: 다양한 gRNA 전달방법을 이용한 B2M 및 CⅡTA 유전자의 녹-아웃
셔틀 이외의 전달 시스템으로도 동일한 녹-아웃 효과가 발휘되는지는 추가적으로 확인하기 위해, B2M gRNA 또는 CⅡTA gRNA와 MAD7 뉴클레아제의 RNP를 NK 세포에 다양한 방법으로 전달하여 각 유전자의 녹-아웃 효율을 확인하였다. B2M 유전자에 대해서는 #8 gRNA(서열번호 8)를 이용하고, CⅡTA 유전자에 대해서는 #25 gRNA(서열번호 44)를 이용하였다. 각각의 전달 방법에 1 X 106 개의 동일한 수의 NK 세포를 사용하였다. 녹-아웃 당일은 opti-MEM(Gibco, 31985062)500 μL 배지에 세포를 부유시켜 12웰 플레이트에 세포를 배양하고, 다음날 NK 세포 배양 배지 1mL을 각 웰에 첨가해주었다.
방법 1은 26 μL의 PBS, 40μM의 MAD7 뉴클레아제 4 μL와 100 μM의 B2M 또는 CⅡTA gRNA 2 μL를 섞어준 뒤 실온에서 5분 이상 반응시켜 RNP 반응액을 제조하고, 48 μL의 α-MEM 배지에 5 μM의 FSD64d1 셔틀 2 μL를 첨가한 후 상기 반응시켰던 50 μL의 RNP 반응액에 혼합하여 NK 세포에 처리 후 1분 30초 동안 상온에서 반응시켰다. 상세한 전달방법은 실시예 1에서 기술된 내용과 동일하게 진행하였다.
방법 2는 전기천공법(electroporation)으로 gRNA를 NK 세포로 전달하였으며 Nucleofector(Lonza) 장비와 Human Natural Killer Cell Nucleofector Kit(Lonza,VPA-1005)를 사용하였다. Kit에서 제공되는 용액 100μL에 방법 1과 동일한 양의 gRNA와 MAD7 뉴클레아제 및 NK 세포를 섞어 큐벳에 넣은 후 U-01 프로그램으로 전기천공을 실시하였다.
방법 3은 Lipofectamine CRISPRMAX transfection 시약(Invitrogen, CMAX00008)을 이용하였다. 12-웰 플레이트에 1 X 106 개의 NK 세포를 미리 부유시켜 준비하고 1.5 mL 튜브에 방법 1과 동일한 양의 gRNA와 MAD7 뉴클레아제 및 Cas9 plus 시약 2.5 μL, opti-MEM 25μL를 섞어 튜브 1을 제조하여 상온에서 반응시켰다. 또 다른 1.5 mL 튜브에 CRISPRMAX 시약 1.5 μL와 opti-MEM 25μL를 섞어 튜브 2를 준비한 후 튜브 1에 준비된 반응액을 섞어 5분간 상온에서 반응시킨 후 NK 세포에 처리해주었다.
방법 4는 Lipofectamine2000 Transfection 시약(Invitrogen,11668027)을 이용하였다. 12-웰 플레이트에 1 X 106 개의 NK 세포를 미리 부유시켜 준비하고 1.5mL 튜브에 방법 1과 동일한 양의 gRNA와 MAD7 뉴클레아제 및 opti-MEM 25 μL를 섞어 튜브 1을 제조하였다. 또 다른 1.5 mL 튜브에 Lipofectamine2000 2.5 μL 와 opti-MEM 25 μL를 섞어 튜브 2를 준비한 후 튜브 1에 준비된 반응액을 섞어 5분간 상온에서 반응시킨 후 NK 세포에 처리하였다.
B2M 유전자를 녹-아웃시킨 NK 세포는 배양 3일 후 B2M 항체를 이용하여, CⅡTA 유전자를 녹-아웃시킨 NK 세포는 배양 7일 후 HLA-DR 항체를 이용하여 유세포분석으로 유전자 발현 감소를 확인하였다. 유세포분석기로 측정한 야생형 NK의 유전자 발현량을 1로 환산한 뒤 B2M 또는 CⅡTA 유전자를 녹-아웃 시킨 NK 세포의 발현량을 NK 세포 대비 비율로 계산하여 유전자 발현 감소 효율을 확인하였다. 도 18a에서 보는 바와 같이 대조군 NK 세포의 B2M 발현량을 1로 보았을 때 방법 1은 0.46, 방법 2는 0.74, 방법 3은 0.89, 방법 4는 0.74로 B2M 발현이 감소하였으며 전달 방법에 따른 발현량 감소 값의 차이는 통계적 유의성을 보이지 않았다. 도 18b에서 보는 바와 같이 대조군 NK 세포의 HLA-DR 발현량을 1로 보았을 때 방법 1은 0.48, 방법 2는 0.53, 방법 3은 0.67, 방법 4는 0.66으로 CIITA의 녹-아웃에 의해 HLA-DR의 발현이 감소하였으며 전달 방법에 따른 발현량 감소 값의 차이는 통계적 유의성을 보이지 않았다. 실시예 14 결과로부터 본 발명에서 사용하는 B2M gRNA 또는 CⅡTA gRNA를 포함하는 유전자 편집 시스템은 다양한 전달방법을 사용하여 목적 세포에 전달될 수 있음을 확인하였다.
실시예 16: Log-NK-CⅡTA KO 세포의 인 비트로 저면역원성 평가
Log-NK-CⅡTA KO 세포는 표면에 I형 HLA와 Ⅱ형 HLA의 발현이 억제되어 있는 NK 세포이므로 저면역원성의 특성을 가질 것으로 예상하였다. 체내 주입 시 수여자의 CD4(+) T 세포와 CD8(+) T 세포에 의한 공격을 회피하여 오래 생존할 수 있는지를 확인하기 위하여 인 비트로 혼합 림프구 반응 시험(MLR assay)을 수행하였다. 먼저, MLR 반응이 잘 일어날 수 있도록 CD8(+) T 세포 또는 CD4(+) T 세포와 야생형 NK 또는 Log-NK-CⅡTA KO 세포의 HLA-A, B, C, DRB1 타입은 100% 불일치하고, CD8(+) T 세포 또는 CD4(+) T 세포 배양을 위해 사용하는 방사선 조사된 PBMC는 야생형 NK 또는 Log-NK-CⅡTA KO 세포의 HLA-A, B, C, DRB1 타입과 37.5% 일치되는 조건으로 진행하였다. PBMC에서 CD8(+) T 세포를 분리하는 방법은 실시예 9에 기술한 과정과 동일하며, CD4(+) T 세포를 분리하기 위하여 CD4(+) T 세포 분리 키트 (Miltenyi Biotec, 130-096-533)를 사용하였고 방법은 다음과 같다. PBMC를 MACS 완충액으로 1회 세척한 후 세포 펠렛을 1 x 107/40 μL가 되도록 현탁시켰고, 바이오틴-항체 칵테일을 1 x 107 세포/10 μL을 넣어 4℃에서 5분간 반응시켰다. 이후 다시 1 x 107/30 μL의 MACS 완충액을 가하고, 1 x 107/20 μL의 CD4(+) T 세포 마이크로비드 칵테일을 넣어 준 후 4℃에서 10분간 반응하였다. 반응이 끝난 세포 현탁액을 LS 컬럼(Miltenyi Biotec)에 통과시켜 CD4를 발현하는 T 세포만을 분리했다. HLA 타입이 37.5% 일치하는 PBMC를 2,000 cGy로 방사선조사해 준 뒤 분리한 CD4(+) T 세포 또는 CD8(+) T 세포와 1:1 비율로 섞고 7일간 배양하였다. 같은 방법으로 PBMC를 준비하여 7일간 배양해놓은 CD4(+) T 세포와 CD8(+) T 세포를 1:1 비율로 섞고 7일간 더 배양하여 최종 14일 배양 후 실험에 사용하였다. 대조군 NK 세포와 Log-NK-CⅡTA KO 세포를 CFSE로 형광염색한 후 CD8(+) T 세포 또는 CD4(+) T 세포를 작동세포: 타겟세포 10:1 비율을 만들기 위해 실시예 9와 동일한 방법으로 희석하여 96 평면 웰-플레이트에 넣어주었다. CD4(+) T 세포를 넣어준 웰에는 2,000 cGy로 방사선 조사한 CD3 T 세포가 제거된 PBMC를 CD4(+) T 세포와 동일한 세포수로 넣어주었다. 세포를 넣어 준비한 96 웰-플레이트는 37℃의 CO2 배양기에서 배양하면서 IncuCyte®S3 장비(Sartorius)를 이용하여 2시간에 한번 씩 CFSE 형광 양성 세포만 계수하는 분석을 실시하였다. 그 결과, 도 19a에서 보는 바와 같이 CD8(+) T 세포와 4일간의 공배양 할 경우 Log-NK-CⅡTA KO 세포는 대조군 NK 대비 최대 5배 이상의 세포가 존재하는 것을 확인하였다. 또한, Log-NK-CⅡTA KO 세포는 CD4(+) T 세포 및 방사선 조사한 PBMC와 함께 4일간의 공배양 후 대조군 NK 대비 1.6배 이상의 세포가 존재하는 것을 확인하였다(도 19b). 이들 결과를 통해 Log-NK-CⅡTA KO 세포가 CD4(+) T 세포와 CD8(+) T 세포의 공격을 야생형 NK 세포보다 현저히 높은 효율로 회피할 수 있음을 알 수 있었다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.

Claims (24)

  1. Ⅱ형 HLA 단백질의 발현을 억제하는 핵산 분자를 유효성분으로 포함하는 포유류 세포의 면역원성 저해용 조성물.
  2. 제 1 항에 있어서, 상기 핵산 분자는 상기 Ⅱ형 HLA 단백질 또는 이의 활성화 단백질을 인코딩하는 뉴클레오타이드 서열을 특이적으로 인식하는 유도 RNA(gRNA) 또는 상기 gRNA를 인코딩하는 뉴클레오타이드인 것을 특징으로 하는 조성물.
  3. 제 2 항에 있어서, 상기 Ⅱ형 HLA 단백질의 활성화 단백질은 CⅡTA(Class Ⅱ Major Histocompatibility Complex Transactivator) 단백질인 것을 특징으로 하는 조성물.
  4. 제 2 항에 있어서, 상기 조성물은 RNA-유도 엔도뉴클레아제 또는 RNA-유도 엔도뉴클레아제 인코딩 뉴클레오타이드를 추가적으로 포함하는 것을 특징으로 하는 조성물.
  5. 제 3 항에 있어서, 상기 gRNA는 서열목록 제20서열, 서열목록 제22서열, 서열목록 제24서열, 서열목록 제27서열, 서열목록 제29서열, 서열목록 제30서열, 서열목록 제40서열 및 서열목록 제44서열로 구성된 군으로부터 선택되는 뉴클레오타이드 서열 또는 이들의 상보적인 서열을 특이적으로 인식하는 것을 특징으로 하는 조성물.
  6. 제 1 항에 있어서, 상기 조성물은 β2-마이크로글로불린 단백질의 발현을 억제하는 핵산 분자를 추가적으로 포함하는 것을 특징으로 하는 조성물.
  7. 제 6 항에 있어서, 상기 핵산 분자는 상기 β2-마이크로글로불린 단백질을 인코딩하는 뉴클레오타이드 서열을 특이적으로 인식하는 유도 RNA(gRNA) 또는 상기 gRNA를 인코딩하는 뉴클레오타이드인 것을 특징으로 하는 조성물.
  8. 제 7 항에 있어서, 상기 조성물은 RNA-유도 엔도뉴클레아제 또는 RNA-유도 엔도뉴클레아제 인코딩 뉴클레오타이드를 추가적으로 포함하는 것을 특징으로 하는 조성물.
  9. 제 7 항에 있어서, 상기 유도 RNA(gRNA)는 서열목록 제1서열, 서열목록 제8서열, 서열목록 제9서열 및 서열목록 제14서열로 구성된 군으로부터 선택되는 뉴클레오타이드 서열 또는 이들의 상보적인 서열을 특이적으로 인식하는 것을 특징으로 하는 조성물.
  10. 제 4 항 또는 제 8 항에 있어서, 상기 RNA-유도 엔도뉴클레아제는 Cas9(CRISPR associated protein 9), Cpf1(CRISPR from Prevotella and Francisella 1) 및 MAD7으로 구성된 군으로부터 선택되는 것을 특징으로 하는 조성물.
  11. 제 1 항에 있어서, 상기 조성물은 I형 HLA 단백질을 인코딩하는 핵산 분자를 추가적으로 포함하는 것을 특징으로 하는 조성물.
  12. 제 11 항에 있어서, 상기 I형 HLA 단백질은 HLA-E 단백질인 것을 특징으로 하는 조성물.
  13. 제 1 항에 있어서, 상기 세포는 이식용 동종(Allogenic) 또는 자가(Autologous) 세포인 것을 특징으로 하는 조성물.
  14. 제 13 항에 있어서, 상기 세포는 줄기세포 또는 면역세포인 것을 특징으로 하는 조성물.
  15. 제 14 항에 있어서, 상기 면역세포는 자연살해세포인 것을 특징으로 하는 세포.
  16. 제 1 항 내지 제 9 항 및 제 11 항 내지 제 15 항 중 어느 한 항의
    조성물을 이용하여 제조된 저면역원성 포유류 세포.
  17. 다음 단계를 포함하는 저면역원성 포유류 세포의 제조방법:
    (a) 포유류 개체로부터 분리된 세포에서 β2-마이크로글로불린 단백질, Ⅱ형 HLA 단백질, Ⅱ형 HLA 단백질의 활성화 단백질 및 이들의 조합으로 구성된 군으로부터의 선택되는 단백질의 발현을 억제하는 단계; 및
    (b) 상기 세포에 HLA-E 유전자를 도입하는 단계.
  18. 제 17 항에 있어서, 상기 단계 (a)는 상기 단백질을 인코딩하는 뉴클레오타이드 서열을 특이적으로 인식하는 유도 RNA(gRNA) 또는 상기 gRNA를 인코딩하는 뉴클레오타이드 및 RNA-유도 엔도뉴클레아제 또는 RNA-유도 엔도뉴클레아제 인코딩 뉴클레오타이드를 상기 세포에 도입함으로써 수행되는 것을 특징으로 하는 방법.
  19. 제 18 항에 있어서, 상기 β2-마이크로글로불린 단백질을 인코딩하는 뉴클레오타이드 서열을 특이적으로 인식하는 유도 RNA(gRNA)는 서열목록 제1서열, 서열목록 제8서열, 서열목록 제9서열 및 서열목록 제14서열로 구성된 군으로부터 선택되는 뉴클레오타이드 서열 또는 이들의 상보적인 서열을 특이적으로 인식하는 것을 특징으로 하는 방법.
  20. 제 17 항에 있어서, 상기 Ⅱ형 HLA 단백질의 활성화 단백질은 CⅡTA(Class Ⅱ Major Histocompatibility Complex Transactivator) 단백질인 것을 특징으로 하는 방법.
  21. 제 20 항에 있어서, 상기 CⅡTA 단백질을 인코딩하는 뉴클레오타이드 서열을 특이적으로 인식하는 유도 RNA(gRNA)는 서열목록 제20서열, 서열목록 제22서열, 서열목록 제24서열, 서열목록 제27서열, 서열목록 제29서열, 서열목록 제30서열, 서열목록 제40서열 및 서열목록 제44서열로 구성된 군으로부터 선택되는 뉴클레오타이드 서열 또는 이들의 상보적인 서열을 특이적으로 인식하는 것을 특징으로 하는 방법.
  22. 제 17 항에 있어서, 상기 단계 (b)는 상기 단계 (a)가 완료된 후 2 내지 4일 경과 후 이루어지는 것을 특징으로 하는 방법.
  23. 제 17 항에 있어서, 상기 단계 (a) 이후에 상기 단백질의 발현이 억제된 세포를 분리하는 단계를 추가로 포함하는 것을 특징으로 하는 방법.
  24. 제 1 항 내지 제 15 항 중 어느 한 항의 조성물을 포유류 세포에 도입하는 단계를 포함하는 포유류 세포의 면역원성 저해 방법.
PCT/KR2021/008554 2020-07-06 2021-07-06 면역원성이 감소된 신규한 이식용 세포 WO2022010220A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CN202180048711.4A CN115803436A (zh) 2020-07-06 2021-07-06 免疫原性降低的新型移植细胞
US18/004,241 US20230242894A1 (en) 2020-07-06 2021-07-06 Novel transplantation cells having reduced immunogenicity
EP21837627.5A EP4177344A1 (en) 2020-07-06 2021-07-06 Novel transplantation cells having reduced immunogenicity
JP2022578885A JP2023532645A (ja) 2020-07-06 2021-07-06 免疫原性が減少した新規な移植用細胞

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0082748 2020-07-06
KR1020200082748A KR20220005208A (ko) 2020-07-06 2020-07-06 면역원성이 감소된 신규한 이식용 세포

Publications (1)

Publication Number Publication Date
WO2022010220A1 true WO2022010220A1 (ko) 2022-01-13

Family

ID=79341939

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/008554 WO2022010220A1 (ko) 2020-07-06 2021-07-06 면역원성이 감소된 신규한 이식용 세포

Country Status (6)

Country Link
US (1) US20230242894A1 (ko)
EP (1) EP4177344A1 (ko)
JP (1) JP2023532645A (ko)
KR (1) KR20220005208A (ko)
CN (1) CN115803436A (ko)
WO (1) WO2022010220A1 (ko)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050196404A1 (en) 2003-05-06 2005-09-08 Crew Mark D. Genes encoding single chain human leukocyte antigen E (HLA-E) proteins to prevent natural killer cell-mediated cytotoxicity and cytotoxic T Lymphocyte (CTL)-mediated cytotoxicity
WO2014186585A2 (en) * 2013-05-15 2014-11-20 Sangamo Biosciences, Inc. Methods and compositions for treatment of a genetic condition
KR20160018425A (ko) * 2014-08-06 2016-02-17 차의과학대학교 산학협력단 조직적합성항원 유전자들의 교정을 통하여 구축한, 면역적합형 세포
KR20170002381A (ko) * 2014-03-11 2017-01-06 셀렉티스 동종이형 이식에 양립성인 t-세포들을 만들어내는 방법
WO2017093969A1 (en) * 2015-12-04 2017-06-08 Novartis Ag Compositions and methods for immunooncology
KR20200074954A (ko) * 2017-11-16 2020-06-25 재단법인 목암생명과학연구소 형질전환된 인간세포 및 이의 용도

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2666477A1 (en) 2012-05-23 2013-11-27 Theravectys Lentiviral vectors containing an MHC class I promoter

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050196404A1 (en) 2003-05-06 2005-09-08 Crew Mark D. Genes encoding single chain human leukocyte antigen E (HLA-E) proteins to prevent natural killer cell-mediated cytotoxicity and cytotoxic T Lymphocyte (CTL)-mediated cytotoxicity
WO2014186585A2 (en) * 2013-05-15 2014-11-20 Sangamo Biosciences, Inc. Methods and compositions for treatment of a genetic condition
KR20170002381A (ko) * 2014-03-11 2017-01-06 셀렉티스 동종이형 이식에 양립성인 t-세포들을 만들어내는 방법
KR20160018425A (ko) * 2014-08-06 2016-02-17 차의과학대학교 산학협력단 조직적합성항원 유전자들의 교정을 통하여 구축한, 면역적합형 세포
WO2017093969A1 (en) * 2015-12-04 2017-06-08 Novartis Ag Compositions and methods for immunooncology
KR20200074954A (ko) * 2017-11-16 2020-06-25 재단법인 목암생명과학연구소 형질전환된 인간세포 및 이의 용도

Non-Patent Citations (16)

* Cited by examiner, † Cited by third party
Title
"Methods in Molecular Biology", vol. 199, 2002, HUMAN PRESS
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 10
BLOOD CELLS MOLECULES & DISEASE, vol. 33, 2004, pages 261 - 266
CHAMBER R. ET AL., PROC. NATL. ACT. SCI USA, vol. 92, 1995, pages 1411 - 1415
HUANG ET AL., COMP. APPL. BIOSCI, vol. 8, 1992, pages 155 - 65
KIM, HS, HANYANG MED REV, vol. 33, 2013, pages 59 - 64
LOCKETT LJ ET AL., CLIN. CANCER RES., vol. 3, 1997, pages 2075 - 2080
PEARSON ET AL., METH. MOL. BIOL, vol. 24, 1994, pages 307 - 31
PUHLMANN M. ET AL., HUMAN GENE THERAPY, vol. 10, 1999, pages 649 - 657
ROMAGNE F, VIVIER E.,F1000 MED REP, vol. 3, 2011, pages 9
ROMAGNE FVIVIER E., F1000 MED REP, vol. 3, 2011, pages 9
SCHEIT: "Nucleotide Analogs", 1980, JOHN WILEY
UHLMANPEYMAN, CHEMICAL REVIEWS, vol. 90, 1990, pages 543 - 584
WALDMANN TA., NAT REV IMMUNOL, vol. 6, 2006, pages 595 - 601
WANG G ET AL., J. CLIN. INVEST, vol. 104, no. 11, 1999, pages 55 - 62
XU HUAIGENG; WANG BO; ONO MIYUKI; KAGITA AKIHIRO; FUJII KAHO; SASAKAWA NORIKO; UEDA TATSUKI; GEE PETER; NISHIKAWA MISATO; NOMURA M: "Targeted Disruption of HLA Genes via CRISPR-Cas9 Generates iPSCs with Enhanced Immune Compatibility", CELL STEM CELL, ELSEVIER, CELL PRESS, AMSTERDAM, NL, vol. 24, no. 4, 1 January 1900 (1900-01-01), AMSTERDAM, NL , pages 566, XP085654753, ISSN: 1934-5909, DOI: 10.1016/j.stem.2019.02.005 *

Also Published As

Publication number Publication date
EP4177344A1 (en) 2023-05-10
CN115803436A (zh) 2023-03-14
JP2023532645A (ja) 2023-07-31
US20230242894A1 (en) 2023-08-03
KR20220005208A (ko) 2022-01-13

Similar Documents

Publication Publication Date Title
US11977073B2 (en) HLA G-modified cells and methods
WO2018217064A2 (ko) 형질전환된 t세포를 이용한 자연살해세포의 배양방법
Fu et al. Comparison of immunological characteristics of mesenchymal stem cells derived from human embryonic stem cells and bone marrow
Shi et al. Generation of hypoimmunogenic human pluripotent stem cells via expression of membrane-bound and secreted β2m-HLA-G fusion proteins
WO2020197318A1 (ko) Car 유전자가 도입된 nk 세포의 제조방법 및 그의 용도
WO2016048107A1 (ko) 인터페론-감마 또는 인터류킨-1베타를 처리한 줄기세포 또는 그 배양물을 포함하는 면역질환 또는 염증질환의 예방 또는 치료용 약학조성물
WO2019231266A1 (ko) Hla 유전자가 제거된 인간 유도만능줄기세포 유래 중간엽줄기세포 및 그의 제조 방법
WO2020101361A1 (ko) 형질전환된 t세포를 이용한 제대혈 유래 자연살해세포의 배양방법
US20170283769A1 (en) Modified Cells Evoking Reduced Immunogenic Responses
WO2017146538A1 (ko) 조절 t 세포 매개성 질환의 예방 또는 치료용 약학적 조성물
AU712415B2 (en) Transplantation of genetically modified cells having low levels of class I MHC proteins on the cell surface
WO2011102680A2 (ko) Pi3k/akt/gsk3 경로를 통해 성체줄기세포의 증식, 다분화능 및 재프로그래밍을 촉진하는 cd49f
WO2016117960A1 (ko) 면역질환 치료 효능을 갖는 grim19이 과발현된 중간엽줄기세포 및 이의 용도
WO2022010220A1 (ko) 면역원성이 감소된 신규한 이식용 세포
WO2017003153A1 (ko) 제대혈 단핵세포 또는 이로부터 유래된 세포로부터 자연살해세포를 제조하는 방법
WO2022158800A1 (ko) 면역세포 관용성 조절인자 과발현 줄기세포 및 이의 용도
WO2023282688A1 (ko) 산화스트레스 저항성을 갖는 중간엽 줄기세포, 이의 제조방법 및 용도
WO2021107234A1 (ko) Hiv 감염 치료 또는 예방을 위한 ccr5/cxcr4 유전자 동시 넉아웃 환자맞춤형 조혈모세포 및 이의 제조방법
WO2023167575A1 (ko) 저면역원성 줄기세포, 줄기세포로부터 분화되거나 유래된 저면역원성 세포 및 이의 제조방법
WO2023008918A1 (ko) B2m 유전자의 발현이 저해된 유전적으로 조작된 줄기세포 및 이의 이용방법
WO2022075784A1 (ko) T 세포 수용체, t 세포 수용체를 포함하는 면역 세포 및 이를 이용하는 방법
WO2023211180A1 (ko) 이종 면역세포에 대한 화학주성을 유도하는 전능성 줄기세포 유래 면역세포
JP2023521157A (ja) 低免疫原性の細胞ならびにそれらの産生のための方法および組成物
WO2015167226A1 (ko) Har-nds 유래 줄기세포, 그 분리방법 및 용도
WO2017026838A1 (ko) 향상된 탯줄 유래 부착형 줄기세포, 그의 제조방법 및 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21837627

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022578885

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021837627

Country of ref document: EP

Effective date: 20230206