WO2022131398A1 - 유전자 발현 및 억제가 동시에 가능한 핵산 구조체 - Google Patents

유전자 발현 및 억제가 동시에 가능한 핵산 구조체 Download PDF

Info

Publication number
WO2022131398A1
WO2022131398A1 PCT/KR2020/018484 KR2020018484W WO2022131398A1 WO 2022131398 A1 WO2022131398 A1 WO 2022131398A1 KR 2020018484 W KR2020018484 W KR 2020018484W WO 2022131398 A1 WO2022131398 A1 WO 2022131398A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
sirna
sequence
nucleic acid
mrna
Prior art date
Application number
PCT/KR2020/018484
Other languages
English (en)
French (fr)
Inventor
이규리
이혁진
Original Assignee
경상국립대학교산학협력단
이화여자대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 경상국립대학교산학협력단, 이화여자대학교 산학협력단 filed Critical 경상국립대학교산학협력단
Priority to PCT/KR2020/018484 priority Critical patent/WO2022131398A1/ko
Priority to JP2023537237A priority patent/JP2023554111A/ja
Publication of WO2022131398A1 publication Critical patent/WO2022131398A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues

Definitions

  • the present invention relates to a nucleic acid construct capable of simultaneously expressing and inhibiting a gene.
  • Cancer is one of the biggest diseases that threaten human health, and is a disease caused by cells undergoing a series of mutations to proliferate and become immortal in an unrestricted and uncontrolled manner.
  • Various biochemical mechanisms related to cancer have been identified and therapeutic agents have been developed.
  • a fundamental treatment method has not yet been proposed.
  • Immunochemotherapy is positioning itself as a new paradigm for cancer treatment.
  • the immunotherapy can be divided into passive immunotherapy and active immunotherapy.
  • passive immunotherapy immune checkpoint inhibitors, immune cell therapy, therapeutic antibodies, etc. are used.
  • immune checkpoint inhibitors are immune checkpoint proteins ( There are CTLA-4, PD-1, and PD-L1 inhibitors as therapeutic agents that attack cancer cells by activating T cells by blocking the activation of immune checkpoint protein).
  • Cancer treatment vaccines and immunomodulators are used for active immunotherapy. Specifically, it is a cell therapy method that collects and strengthens immune cells in the body or genetically modified them and put them back in.
  • Tumor infiltrating lymphocytes TIL
  • TCR T cell receptor
  • CAR chimeric antigen receptor
  • dendritic cells are the most important antigen-presenting cells of the immune system, and dendritic cell cancer vaccines are considered as ideal therapeutic agents that can effectively remove tumors by presenting cancer antigens and activating anticancer immune responses.
  • tumor and tumor microenvironment tumor microenvironment, TME
  • TME tumor microenvironment
  • the present inventors prepared a nucleic acid construct including mRNA and siRNA, and confirmed that the construct simultaneously expresses or inhibits specific genes through mRNA or siRNA, respectively.
  • the immune evasion mechanism by the immune checkpoint protein can be overcome by suppressing the activation of the immune checkpoint protein while activating the immune system by expressing the antigen mRNA, and thus the present invention has been completed.
  • nucleic acid construct comprising mRNA and siRNA capable of simultaneous gene expression and inhibition.
  • the present invention provides a nucleic acid construct comprising mRNA and siRNA.
  • the present invention provides a composition comprising the nucleic acid construct and the nucleic acid carrier.
  • the present invention provides a pharmaceutical composition for immunotherapy comprising the nucleic acid construct.
  • the present invention provides a cancer vaccine comprising the nucleic acid construct.
  • the present invention provides a method for preparing the nucleic acid construct.
  • the nucleic acid construct capable of simultaneously expressing and inhibiting gene expression according to the present invention includes both mRNA and siRNA in a single construct, so that mRNA and siRNA are simultaneously introduced into the same cell, and the protein to be expressed is normally expressed through this. Expression can be specifically inhibited.
  • the mRNA-siRNA nucleic acid construct can overcome the interference with immune evasion by activating the immune system by expressing the target protein in antigen-presenting cells and blocking the activation of the immune checkpoint protein at the same time. It is expected to be very useful.
  • FIG. 1 shows a schematic diagram of a nucleic acid construct.
  • FIG. 2 is a schematic diagram sequentially illustrating a method for preparing an mRNA-siRNA nucleic acid construct according to the present invention.
  • FIG. 3 is a schematic diagram sequentially illustrating a method for preparing an mRNA-siRNA nucleic acid construct according to the present invention.
  • mRNA-siRNA SS or AS
  • AS antisense sequence
  • FIG. 4 is a schematic diagram illustrating a process in which the mRNA-siRNA nucleic acid construct according to the present invention is separated into mRNA and siRNA by RNase H in an intracellular environment (AAAA, TTTT letters correspond to DNA sequences).
  • FIG. 5 is a schematic diagram illustrating examples of mRNA-siRNA prepared by annealing siRNA-Oligo (dT) in various configurations of siRNA sense or antisense sequences and Oligo (dT) of different lengths (annealing to mRNA) TT, TTTTTT, TTTT-AS, TTTT-SS letters correspond to DNA sequences).
  • FIG. 6 is a diagram showing the results of electrophoresis on the DNA template (a) and the in vitro transcription product (b).
  • FIG. 7 is a diagram showing the results of electrophoresis for mRNA-siRNA.
  • FIG. 8 is a diagram showing the results of evaluating the protein (red fluorescent protein, GFP) expression ability of different mRNA-siRNA examples.
  • FIG. 9 is a diagram showing the results of evaluating the protein (blue fluorescent protein, BFP) expression ability and gene (green fluorescent protein, GFP) expression inhibition ability of different mRNA-siRNA examples 24 hours after transfection.
  • BFP blue fluorescent protein
  • GFP green fluorescent protein
  • FIG. 10 is a diagram showing the results of evaluating the protein (blue fluorescent protein, BFP) expression ability and gene (green fluorescent protein, GFP) expression inhibition ability of different mRNA-siRNA examples 48 hours after transfection.
  • BFP blue fluorescent protein
  • GFP green fluorescent protein
  • FIG. 11 is a nucleic acid construct according to the present invention introducing siRNA that inhibits the expression of mRNA and STAT3 gene expressing Ovalbumin (OVA), and shows the results of evaluating the ability of the mOVA-siSTAT3 to inhibit STAT3 protein expression. It is also
  • FIG. 12 is a nucleic acid construct according to the present invention introducing siRNA that inhibits the expression of mRNA and STAT3 gene expressing ovalbumin (OVA), and the ability of mOVA-siSTAT3 to inhibit STAT3 protein expression was evaluated through western blot.
  • OVA ovalbumin
  • FIG. 13 is a diagram showing the results of confirming the dendritic cell maturation promoting effect of mOVA-siSTAT3 through CD40 and CD80 expression levels.
  • FIG. 15 shows the analysis result of 13.8% of the induced OVA antigen-specific cytotoxic T cell population among splenocytes collected from mice intramuscularly injected with mOVA-siSTAT3/siSTAT3.
  • siSTAT3/siSTAT3 (mOVA-T6-STAT3i) showing a significantly superior tumor suppression effect compared to a simple mixture.
  • vector refers to a nucleic acid construct comprising essential regulatory elements operably linked to enable expression of a desired protein in an appropriate host cell.
  • the vector can be used without limitation as long as it is suitable for producing the nucleic acid construct according to the present invention, and includes elements necessary for transcription, such as a promoter.
  • the vector may be an RNA vector or a DNA vector, preferably a DNA vector.
  • the vector may be used without limitation as long as it is a vector known to those skilled in the art, such as a viral vector or a plasmid vector, and preferably a DNA plasmid vector may be used.
  • the vector may be characterized in that it is a circular molecule.
  • the vector, preferably a circular vector may be linearized by, for example, a restriction enzyme.
  • promoter refers to a DNA nucleotide sequence site to which transcriptional regulators bind, and for the purpose of the present invention, a promoter capable of inducing strong and stable gene expression can be used to increase gene expression rate.
  • the promoter may be preferably an RNA polymerase promoter, more preferably a T7 promoter or an SP6 promoter, but is not limited thereto.
  • untranslation region refers to an untranslated region of mRNA and generally refers to both ends of a coding region.
  • the 5' end portion is referred to as 5' UTR and the 3' end portion is referred to as 3' UTR.
  • poly(A) tail is also called polyadenylic acid or polyadenylic acid fragment, and a continuous arrangement of adenylic acid commonly present at the 3' end of mRNA in eukaryotes means The length is about 10 to 200 nucleotides (nt), and can be variously adjusted according to the allowable size of the expression vector backbone.
  • Poly(A) is known to be involved in mRNA stabilization, translation, and transport from the nucleus to the cytoplasm.
  • siRNA small interfering RNA
  • nt nucleotides
  • Dicer enzyme Dicer enzyme
  • mRNA having a complementary sequence It can be used to specifically bind to and inhibit the expression of a target protein or mRNA.
  • the siRNA is preferably an siRNA molecule in which sense RNA and antisense RNA form a double-stranded RNA molecule, wherein the sense RNA comprises a nucleic acid sequence identical to the target sequence of a part of continuous nucleotides in the mRNA.
  • the antisense sequence most preferably has a sequence complementary to the sense sequence.
  • complementary sequence refers to 60 to 100% of a complementary sequence in addition to a 100% complementary sequence, preferably 80% to 100% complementary sequence, more Preferably, it may comprise 90 to 100% complementary sequence, even more preferably 95% to 100% complementary sequence.
  • target gene refers to a gene whose expression is selectively suppressed or inactivated by the siRNA. This inactivation is achieved by siRNA cleaving the mRNA of the target gene.
  • ribonuclease is an enzyme that catalyzes the reaction of decomposing ribonucleic acid into an oligonucleotide or a single nucleic acid, preferably an endo ribonuclease
  • the endoribonucleic acid lyase includes RNase A, RNase H, RNase I, RNase III, RNase L, RNase P, RNase PhyM, RNase T1, RNase T2, RNase U2, RNase V1 and RNase V.
  • the ribonucleic acid may be messenger RNA, and preferably RNase H may be used as the ribonuclease.
  • RNase H may be used as the ribonuclease.
  • the phosphodiester bond of the poly(A)-poly(T) hybridization portion of the mRNA-siRNA, which is a nucleic acid construct according to the present invention is hydrolyzed using RNase H to be added to the mRNA. It has been confirmed that both gene expression and siRNA suppression of protein expression can be achieved at the same time.
  • mRNA-siRNA refers to an mRNA including a sense or antisense sequence of siRNA at the 3' end.
  • a reverse primer comprising a poly(A) sequence and/or an siRNA (sense/antisense) sequence
  • a poly(T) tail at 3' immediately next to the 3' UTR
  • IVT in vitro transcription
  • mRNA-siRNA refers to annealing a “hybridization sequence” capable of complementary binding to the sense or antisense sequence of the siRNA introduced at the 3' end of the prepared mRNA-siRNA (SS or AS).
  • SS or AS mRNA-siRNA
  • a nucleic acid construct in which the poly(A) tail and siRNA sequence (sense/antisense) at the 3' end of the mRNA-siRNA bind to a hybridization sequence (antisense/sense) and oligo (dT) complementary thereto, respectively, to form a double-stranded nucleic acid construct it means.
  • hybridization sequence may be siRNA or DNA, and therefore “mRNA-siRNA” is also referred to as “mRNA-siRNA/siRNA” or “mRNA-siRNA/DNA” in the present specification.
  • the present invention provides a nucleic acid construct capable of simultaneous gene expression and inhibition.
  • the present invention relates to a nucleic acid construct comprising mRNA and siRNA, comprising: (i) a poly(A) tail sequentially positioned from a 5' direction to a 3' direction at the 3' end; and an mRNA comprising a first siRNA sense or antisense sequence; and (ii) a hybridization sequence complementary to the first siRNA sequence.
  • the hybridization sequence comprises a second siRNA antisense or sense sequence complementary to the first siRNA sequence; or a DNA antisense or sense sequence complementary to the first siRNA sequence.
  • the hybridization sequence may further include a poly(T) tail complementary to the poly(A) tail of the mRNA at the 3' end.
  • the poly(T) tail may have a length of 2 to 6 nt, but is not limited thereto.
  • the nucleic acid construct may further include a first linker sequence for an additional siRNA sense or antisense sequence at the 3' end of the first siRNA sense or antisense sequence, wherein the first linker sequence is the linker sequence. It may further comprise an additional siRNA sense or antisense sequence at the 3' end.
  • the nucleic acid construct comprises the first linker sequence; and a hybridization sequence that complementarily binds an additional siRNA sense or antisense sequence; and a second linker sequence.
  • the hybridization sequence may include the first linker sequence; and complementary binding to additional siRNA sense or antisense sequences.
  • the linker or adapter sequence a synthetic oligonucleotide sequence according to a conventional method may be used without limitation, and preferably, the first linker sequence may be a poly (U) tail, The second linker sequence may be a poly(A) tail complementary to the first linker sequence, but is not limited thereto.
  • the linker or adapter sequence may include a site that does not hybridize with DNA.
  • the nucleic acid construct may further include a plurality of repeating units indicated by a red dotted line in FIG. 1 , and preferably, may further include 1 to 5 repeating units.
  • the number of repeating units to be added may be appropriately adjusted by those skilled in the art according to the purpose.
  • the nucleic acid construct may further include a plurality of repeating units including (a) and (b) at the 3' end of the first siRNA sense or antisense sequence, wherein (a) and (b) are, (a) a first linker sequence for additional siRNA sense or antisense sequences; and additional siRNA sense or antisense sequences; and (b) a hybridization sequence; and a second linker sequence, wherein the hybridization sequence comprises: the first linker sequence; and complementary binding to additional siRNA sense or antisense sequences.
  • the siRNA added as part of the repeating unit may have the same or different target genes, and when the nucleic acid construct is injected into the cell, the hybridization site of mRNA-siRNA is cut by RNase H and separated into an independent double-stranded siRNA, effectively targeting gene expression can be inhibited. When two or more different types of siRNA are included, expression of two or more target genes can be simultaneously suppressed.
  • the present invention provides a composition comprising the nucleic acid construct and the nucleic acid carrier according to the present invention.
  • nucleic acid delivery system is used to increase the delivery efficiency of the nucleic acid construct according to the present invention into the body, and has excellent stability in the body and has the advantage that the manufacturing process as a drug is simple. There is this.
  • the nucleic acid carrier may include, but is not limited to, viral vectors, non-viral vectors, liposomes, cationic polymers, micelles, emulsions and nanoparticles, preferably nanoparticles.
  • the cationic polymer includes natural polymers such as chitosan, atelocollagen, cationic polypeptide, etc., poly(L-lysin), linear or branched PEI (polyethylene imine), cyclodextrin-based polycations ( cyclodextrin-based polycations), and synthetic polymers such as dendrimers.
  • the nanoparticles are not limited thereto, but magnetic beads, gold (Au) nanoparticles, silver (Ag) nanoparticles, platinum (Pt) nanoparticles, quantum dots, upper Upconversion nanoparticles (UCNP), graphene-nanoparticle complexes, color dyed particles and latex nanoparticles, silica nanoparticles, carbon derivative nanoparticles ( carbon derivative nanopartilces; for example, it may be any one selected from the group consisting of carbon nanotubes and solid lipid nanoparticles.
  • the delivery of the nucleic acid construct to the target cell is facilitated, and even a relatively low dose of the nucleic acid construct is delivered to the target cell to induce high target protein expression and target gene. It may exhibit an expression inhibitory function. In addition, it is possible to prevent the delivery of non-specific mRNA-siRNA to other organs and cells other than the target.
  • the present invention provides a pharmaceutical composition for immunotherapy comprising the nucleic acid construct according to the present invention.
  • the pharmaceutical composition according to the present invention may increase an immune response or selectively increase a part of an immune response desirable for the treatment or prevention of a specific disease, infection or condition.
  • the immunotherapy may preferably be cancer immunotherapy.
  • the cancer is brain tumor, benign astrocytoma, malignant astrocytoma, pituitary adenoma, meningioma, cerebral lymphoma, oligodendroglioma, intracranioma, ependymoma, brainstem tumor, head and neck tumor, laryngeal cancer, oropharyngeal cancer, nasal/sinus cancer , nasopharyngeal cancer, salivary gland cancer, hypopharyngeal cancer, thyroid cancer, chest tumor, small cell lung cancer, non-small cell lung cancer, thymus cancer, mediastinal tumor, esophageal cancer, breast cancer, male breast cancer, abdominal tumor, stomach cancer, liver cancer, gallbladder cancer, biliary tract cancer, pancreatic cancer, Small intestine cancer, colon cancer, anal cancer, bladder cancer, kidney cancer, male genital tumor, penile cancer, urethral cancer, prostate cancer, female genital tumor, cervical cancer,
  • the pharmaceutical composition may be provided including the nucleic acid construct according to the present invention alone or one or more pharmaceutically acceptable carriers, excipients or diluents.
  • the "pharmaceutically acceptable” means a composition that is physiologically acceptable and does not normally cause allergic reactions such as gastrointestinal disorders, dizziness, or similar reactions when administered to humans, and examples of the carriers, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.
  • the pharmaceutical composition according to the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like, in addition to the above components.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations include at least one excipient in the ceftesol, for example, starch, calcium carbonate, sucrose ) or lactose, gelatin, etc.
  • lubricants such as magnesium stearate and talc are also used.
  • Liquid formulations for oral use include suspensions, solutions, emulsions, syrups, etc.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories.
  • Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • As the base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like can be used.
  • the preferred dosage of the pharmaceutical composition varies depending on the condition and weight of the patient, the degree of disease, the drug form, the route and duration of administration, but may be appropriately selected by those skilled in the art. However, for a desirable effect, it is recommended to be administered at 0.0001 to 100 mg/kg per day, preferably at 0.001 to 100 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.
  • the pharmaceutical composition may be administered by various routes, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intraperitoneal, intrauterine dural or intracerebrovascular injection.
  • the present invention provides a cancer vaccine comprising the nucleic acid construct according to the present invention.
  • the nucleic acid construct according to the present invention can induce an immune response by labeling antigen-presenting cells, and simultaneously suppress the expression of immune checkpoint proteins.
  • the nucleic acid construct may be included in a cancer vaccine in a state in which it is bound to nanoparticles.
  • the cancer vaccine may further include dendritic cells.
  • the cancer vaccine may be provided in a form in which the nucleic acid construct according to the present invention is delivered to dendritic cells ex vivo, and then the transfected dendritic cells are delivered.
  • the dendritic cells may increase the immunogenicity of the subject, and thus effectively prevent or inhibit the proliferation and/or metastasis of the tumor in the subject.
  • dendritic cell refers to an antigen-presenting cell that absorbs an antigen into the cell, processes it, and presents the antigen or a peptide derived from the antigen together with the MHC class I complex or MHC class complex. it means. According to the degree of maturity, dendritic cells are classified into immature dendritic cells and mature dendritic cells.
  • the “immature dendritic cells” are found in the early stages of maturation, do not express cell surface markers such as CD14 like mature dendritic cells, and express low levels of HLA-DR, CD86, CD80, CD83 or CD40, and CD1a. and dendritic cells expressing CCR1, CCR2, CCR5 and CXCR1 at normal levels.
  • the "mature dendritic cell” refers to a cell formed by maturation of immature dendritic cells, and cell surface markers involved in B cell and T cell activity, for example, MHC class I or MHC class (HLA-DR), cell adhesion factor (CD54, CD18, CD11) and co-stimulatory factors (eg, CD86, CD80, CD83 or CD40) refer to cells expressing a high level or a relatively increased level compared to immature dendritic cells.
  • MHC class I or MHC class HLA-DR
  • cell adhesion factor CD54, CD18, CD11
  • co-stimulatory factors eg, CD86, CD80, CD83 or CD40
  • mRNA-siSTAT3 in which mRNA expressing Ovalbumin (OVA) and siRNA suppressing the expression of STAT3 gene are introduced into the nucleic acid construct according to the present invention.
  • Ovalbumin Ovalbumin
  • siRNA suppressing the expression of STAT3 gene are introduced into the nucleic acid construct according to the present invention.
  • the present invention also provides a pharmaceutical composition comprising a nucleic acid construct according to the present invention for use in immunotherapy.
  • the invention also provides the use of a nucleic acid construct according to the invention in the manufacture of a medicament for immunotherapy.
  • the present invention also provides an immunotherapy method comprising administering the nucleic acid construct according to the present invention to a subject in need thereof.
  • the immunotherapy may be cancer immunotherapy. More specifically, it may be used for treating cancer.
  • the DNA template is a transcription template for mRNA synthesis, and a DNA vector (pUCIDT- Amp vector) was prepared, and PCR was performed using the DNA as a template to linearize the vector and then amplify it.
  • a DNA vector pUCIDT- Amp vector
  • PCR is a PCR reaction mixture using a DNA vector as a primary template, an oligonucleotide consisting of 5'-TTGGACCCTCGTACAGAAGCTAATACG-3' (SEQ ID NO: 4) as a forward primer, and "5'-siRNA as a reverse primer” Sequence - poly(A) - primer sequence that specifically binds to a DNA vector - 3' (reverse primer)"
  • the reverse primer includes a poly(A) sequence and/or an siRNA (sense/antisense) sequence, and a poly(T) tail 3' immediately next to the 3' UTR of the prepared DNA template. ) and siRNA (antisense/sense) sequences were introduced.
  • the PCR reaction mixture was 2X TOPsimple TM DryMIX-HOT (enzynomics, Korea) was used, but is not limited thereto.
  • the conditions of PCR for preparing the DNA template can maintain the temperature and time for performing the three steps for performing the PCR, that is, the denaturation step, the annealing step, and the elongation step, respectively, and the denaturation
  • the conditions for performing the step are 85° C. to 105° C. for 5 minutes to 15 minutes, preferably 95° C. for 10 minutes
  • the conditions for performing the hybrid step are 40° C. to 65° C. for 20 to 40 seconds, preferably 59 °C 30 seconds
  • conditions for performing the extending step may be 50 °C to 80 °C 30 seconds to 2 minutes, preferably 72 °C 1 minute.
  • the specified temperature and time range for performing the PCR can be adjusted within a feasible range in performing the PCR.
  • the conditions of PCR for preparing the DNA template are: Initial denaturation 95 °C 10 min, denaturation 95 °C 3 sec, hybridization 59 °C 30 sec, extension 72 °C 1 min 1 A total of 30 rotations were performed by rotation, and an additional extension (Final elongation) of 72° C. was performed for 5 minutes.
  • the amplified PCR reaction product was purified using AccuPrep® PCR Purification Kit (Bioneer, South Korea).
  • Step 2) is an in vitro transcription (IVT) step, and the DNA template prepared in step 1) is treated with a reaction solution containing RNA polymerase, mRNA-siRNA”) may be characterized.
  • the in vitro transcription was performed by treating the prepared DNA template with a reaction solution, incubating it at 37°C for 16 hours, adding 1 ⁇ l of Turbo DNase I, and reacting it at 37°C for 15 minutes.
  • the specific reaction conditions for the in vitro transcription can be adjusted within a feasible range.
  • conditions for annealing are sequence-dependent and vary depending on environmental variables, but may be 40 to 80° C. for 5 to 15 minutes, preferably 75° C. for 10 minutes.
  • the annealing was performed by fast cooling (quick cooling) to 4°C after performing the annealing at 75°C for 10 minutes.
  • a DNA vector including a T7 promoter, 5' UTR, open reading frame (ORF) and 3' UTR as a transcription template for mRNA synthesis was prepared.
  • PCR was performed using the DNA as a template to linearize the vector and amplify from the T7 promoter to the 3' UTR.
  • PCR was performed using TOPsimpleTM DryMIX-HOT (enzynomics, Korea), and specific PCR conditions are shown in Table 1 below.
  • the amplified PCR reaction product was purified using AccuPrep® PCR Purification Kit (Bioneer, South Korea).
  • a reverse primer containing a poly(A) sequence and/or an siRNA (sense/antisense) sequence
  • a poly(T) tail poly(T) tail
  • siRNA antisense/sense sequences
  • the present inventors have as the reverse primer, a primer comprising only a 120 nt poly(A) sequence, a primer comprising a 120 nt poly(A) sequence and an siRNA (sense/antisense) sequence, and a green fluorescent protein (Green Fluorescent).
  • a primer comprising only a 120 nt poly(A) sequence
  • a primer comprising a 120 nt poly(A) sequence and an siRNA (sense/antisense) sequence
  • a green fluorescent protein Green Fluorescent
  • Protein (GFP) mRNA targeting siRNA hereinafter, siGFP
  • RFP red fluorescent protein
  • BFP blue fluorescent protein
  • mRNA-siRNA containing an siRNA sequence at the end by performing in vitro transcription (IVT) using the DNA template prepared in the above Example (hereinafter referred to as “mRNA-siRNA (SS or AS)”) do) was synthesized.
  • IVT in vitro transcription
  • SS or AS DNA template prepared in the above Example
  • In vitro transcription was performed using a reaction solution (MEGAscriptTM T7 Transcription Kit (Ambion, USA)) containing T7 RNA polymerase, rATP, rCTP, rGTP, rUTP, and a cap analogue, followed by dnaase (DNase). ) treatment to remove the template DNA and recover only the mRNA.
  • DNase dnaase
  • reaction solution was put into a tube and incubated at 37°C for 16 hours, 1 ⁇ l of Turbo DNase I was added and reacted at 37°C for 15 minutes, and the reaction product was purified using MEGAclearTM Kit (Ambion, USA). . All components constituting the reaction solution and their capacities and concentrations are shown in Table 2 below.
  • a reverse primer containing siRNA (siRNA-Oligo (dT)) linked to dTdTdTdTdTdTdT was annealed to the mRNA-siRNA (SS or AS) prepared in the above Example, followed by annealing, mRNA-siRNA (SS or AS) ) of the nucleic acid construct (“mRNA-siRNA”) according to the present invention, in which a portion of the hybridization sequence is complementarily bound to form a double strand.
  • the hybridization sequence is an siRNA sequence comprising poly(T). or a DNA sequence comprising poly(T).
  • mRNA-siRNA SS or AS
  • siRNA-Oligo dT
  • SS or AS siRNA-siRNA
  • dT siRNA-Oligo
  • mRNA-siRNA mRNA-siRNA
  • SS or AS mRNA-siRNA
  • a nucleic acid construct according to the present invention that binds to siRNA (antisense/sense) and oligo (dT) to form a double strand was formed (hereinafter referred to as “(or mRNA-siRNA/siRNA or mRNA-siRNA/DNA)”) .
  • the manufacturing process of the mRNA-siRNA is schematically shown in FIG. 3 .
  • the mRNA-siRNA according to the present invention is a double-stranded hybrid formed between poly(A) of mRNA and poly(T) of siRNA by Rnase H in an intracellular environment. isolated into siRNA capable of inhibiting expression, thereby enabling simultaneous expression and inhibition of protein expression in a subject (FIG. 4).
  • the mRNA-siRNA according to the present invention is characterized in that one or more siRNAs may be linked to the 3' end of the mRNA.
  • the experiment is performed under the same conditions as the annealing from the second siRNA, but by adding the siRNA sequence to the reverse primer.
  • siRNA to be added it is characterized in that it can be added by introducing as many siRNAs as desired to be introduced with respect to the reverse primer. For example, all primers used to introduce the second siRNA are shown in Table 4 below.
  • siRNA-Oligo in which sense or antisense sequences of siRNA and Oligo (dT) having different lengths were combined in various configurations as follows to determine mRNA protein expression efficiency and siRNA To evaluate the ability to inhibit gene expression, and to derive the optimal structure of a nucleic acid construct with excellent gene expression and inhibitory effects (FIG. 5).
  • reaction product was electrophoresed on a 1% agarose gel at 100V voltage for 30 minutes to confirm the PCR reaction product and the in vitro transcription product, as shown in FIG. 6 .
  • the size of the DNA fragment amplified using the reverse primer was 971 bp (poly(A)120, lane 4) and 992 bp (poly(A)120-AS siGFP, lane 5), respectively. It was confirmed that Through the above results, it was confirmed that the DNA template was effectively amplified through the reverse primer designed to introduce the poly(T) tail and siRNA sequence to the 3' right next to the 3' UTR as PCR was performed.
  • mRFP in which only the poly(A)120 sequence was introduced at the 3' end of the mRNA and the poly(A)120 and antisense siGFP sequence were introduced together were subjected to fast cooling with the sense siGFP strand.
  • the sense siGFP was successfully transferred to the mRFP in which the poly(A)120 and antisense siGFP sequences were introduced. It was confirmed that it was annealed.
  • FITC-labeled sense siGFP with respect to mRFP introduced with antisense siGFP at the 3' end rather than FITC-labeled sense siGFP (FITC-SS siGFP, lane 1).
  • mRFP-AS siGFP + FITC-SS siGFP, lane 2 FITC-labeled sense siGFP
  • the protein expression effects of the different mRNA-siRNA nucleic acid constructs prepared in the above Examples were confirmed. Specifically, cells were seeded at 1 x 10 4 per well in a 96-well plate, and the cells were transfected with each construct at a dose of 10 pg mRNA/cell using a transfection reagent. 24 hours after transfection, the fluorescence intensity of the red fluorescent protein expressed in each example was measured using a flow cytometer FACS Calibur (BD Biosciences, CA) to confirm the translation efficiency of each construct, and the results are shown. 8 is shown. All examples used in the experiment are shown in Table 5 below.
  • mRNA-SS/SS or mRNA-SS/AS means annealed with the siGFP-T2 sequence
  • mRNA-AS/SS (DNA) or mRNA-AS/AS (DNA) refers to the siGFP sequence It means that it is annealed with a sequence in which 4 additional dT sequences have been introduced into the possessed DNA.
  • mRNA-siRNA SS or AS
  • siRNA and/or DNA 5'-3'
  • mRNA containing an siRNA (sense/antisense) sequence at the 3' end, an siRNA (antisense/sense) sequence complementary to the siRNA, and Oligo (dT) complementary to the mRNA It was confirmed that by hybridizing the containing siRNA, the translation efficiency of the mRNA inhibited by the binding of the siRNA sequence can be restored by the DNA sequence annealed to the siRNA sequence of the mRNA-siRNA (SS or AS). This appears to be due to the mechanism in which the mRNA-siRNA/DNA hybrid construct according to the present invention is cleaved by intracellular RNase H.
  • siRNA-dTdT T2 annealed to mRNA-siRNA (SS or AS)
  • SS or AS mRNA-siRNA
  • siRNA-dTdTdTdTdT T6 was annealed to mRNA-siRNA (SS or AS) and separated into mRNA and siRNA by RNase H when introduced into cells, maintaining the efficiency of mRNA protein translation and siRNA protein inhibition. designed to be
  • mRNA-siRNA (SS or AS) (5'-3') siRNA and/or DNA (5'-3')
  • the blue fluorescence intensity was decreased in the example in which the mRNA containing the siRNA sequence at the 3' end was transfected, and it was confirmed that the protein expression efficiency was lowered by linking the siRNA sequence.
  • siGFP(AS)-TTTTTT(T6), siGFP(AS)-TTTT(DNA) annealed to mBFP(SS) in Examples and mBFP(AS) to siGFP(SS)-TTTTTT(T6), siGFP(SS) )-TTTT(DNA) was annealed, and the reduced translation efficiency was significantly increased, and the fluorescence intensity was stronger than that of the mBFP transfection, confirming that the mRNA protein expression ability was completely recovered.
  • siGFP (AS)-TTTTTT (T6) was annealed to mBFP (SS) and an embodiment in which siGFP (SS)-TTTTTT (T6) was annealed to mBFP (AS) showed a decrease in green fluorescence intensity, and in particular, it was confirmed that the measured fluorescence intensity was similar to that of normal siRNA transfection.
  • siRNA siRNA (sense/antisense) sequence at the 3' end and siRNA (antisense/sense) sequence complementary to the siRNA binding siRNA
  • hybridizing mRNA-siRNA
  • the expression of the gene targeted by the siRNA was remarkably suppressed.
  • the protein expression inhibition efficiency was highest when the Oligo (dT) located at the 3' end of the annealed siRNA was T6.
  • the reduced translation efficiency by linking the siRNA sequence to the mRNA increased the most when the Oligo (dT) located at the 3' end of the annealed siRNA was T2 or T4.
  • the gene expression inhibition efficiency was the highest in the example in which siGFP(SS)-TTTTTT(T6) was annealed to mBFP(AS).
  • the mRNA-siRNA nucleic acid construct according to the present invention is simultaneously introduced into cells with high efficiency, and after introduction, the double-stranded hybrid formed between mRNA and siRNA is cut by intracellular RNase to express the target protein. and siRNA capable of inhibiting the expression of specific genes. Furthermore, by having such a specific structure, the mRNA-siRNA nucleic acid construct according to the present invention can simultaneously successfully achieve the expression of a target protein by mRNA and suppression of the expression of a specific gene by siRNA in one cell. Confirmed.
  • mRNA is known to have an effect of inducing an immune response by stimulating a toll-like receptor (TLR).
  • TLR toll-like receptor
  • mRNA can be used as a vaccine without a separate adjuvant because it has an immune response-inducing effect and can express antigen (protein) at the same time.
  • mRNA-based vaccines express specific antigens on dendritic cells or T cells, in which case STAT3 protein suppresses immune response activation to suppress dendritic cell maturation.
  • the present inventors using the nucleic acid construct according to the present invention, introduce an siRNA sequence that inhibits the expression of STAT3 into an mRNA construct designed to express an antigen, thereby effectively promoting the maturation of dendritic cells without interfering with immune evasion. It was judged that it could be possible, and the experiment was performed as follows. First, in the same manner as described in the above Examples, mRNA expressing Ovalbumin (OVA) and siRNA inhibiting the expression of STAT3 gene were introduced into the nucleic acid construct according to the present invention.
  • Ovalbumin Ovalbumin
  • siRNA targeting STAT3 siSTAT3
  • mOVA + siSTAT3 a simple mixture of ovalbumin-expressing mRNA and siSTAT3
  • Bone marrow-derived dendritic cells were treated with siSTAT3, a simple mixture of mOVA and siSTAT3 (a simple mixture of mOVA and siSTAT3) and mOVA-siSTAT3/siSTAT3 constructs, respectively.
  • BMDCs (1 ⁇ 10 6 cells/well) were treated with X-vivo 15 media containing 10% FBS and antibiotics (100 unit/ml penicillin and 100 ⁇ g/ml streptomycin) at 37°C for 24-hours. Cultured in well plates. Cultured BMDCs were transfected with siSTAT3, mOVA + siSTAT3 and mOVA-siSTAT3/siSTAT3, respectively.
  • the expression level of the STAT3 gene in each BMDC was analyzed using the qRT-PCR method, and the results are shown in FIG. 11 .
  • BMDCs bone marrow-derived dendritic cells
  • FACS Fluorescence-activated cell sorting
  • CD40 and CD80 which are the phenotypes of mature dendritic cells, compared to mOVA + siSTAT3 in which mOVA and siSTAT3 were simply mixed. It was confirmed that all expression significantly increased. Through the above results, it was found that the dendritic cell maturation promoting effect is much better when the mRNA-siRNA nucleic acid construct in the form of mRNA and siRNA for protein expression are combined than when administered by mixing the isolated mRNA and siRNA. Confirmed.
  • mOVA + siSTAT3 mixture or mOVA-siSTAT3/siSTAT3 was transformed into lipid nanoparticles by rapid mixing of the following composition using a microfluidic device (NanoAssemblr Benchtop (Precision Nanosystems, Canada))
  • PEG 2000 35 : 16 : 46.5 : 2.5, molar ratio
  • aqueous with a lipid mixture Phase (10 mM citrate buffer, pH 3).
  • lipid-formulated mOVA + siSTAT3 mixture or mOVA-siSTAT3/siSTAT3 nanoparticles were administered to 6-week-old female C57BL/6 mice (20 pmole mOVA + 20 pmole siSTAT3 mixture or 20 pmole mOVA- siSTAT3/siSTAT3) were injected intramuscularly.
  • splenocytes were isolated and SIINFEKL (MHC I of OVA) combined with antibody mixtures (PerCP/Cyanine5.5-anti-mouse CD8a, FITC-anti-mouse CD44 and APCanti-mouse CD45 (BioLegend, USA)).
  • peptide epitope was stained as a tetramer.
  • the triple-positive cell population of CD45, SIINFEKL and CD8a displayed OVA-specific cytotoxic T cells.
  • 13.9% of splenocytes harvested from mOVA-siSTAT3/siSTAT3 treated dendritic cells were analyzed as a triple positive cell population.
  • the tumor suppression effect was confirmed using the mouse set of Experimental Example 5.
  • tumor cells expressing ovalbumin 3107E.G.7-OVA cells
  • siSTAT3/siSTAT3 (mOVA-T6-STAT3i) showed significantly superior tumor suppression effect compared to the simple mixture.
  • the nucleic acid construct according to the present invention can overcome immune evasion interference by expressing a target protein in antigen-presenting cells to activate the immune system and at the same time block the activation of immune checkpoint proteins. In particular, it was confirmed that it can be very usefully used in the field of anticancer immunotherapy.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Nanotechnology (AREA)
  • Optics & Photonics (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

본 발명은 유전자 발현 및 억제가 동시에 가능한 핵산 구조체에 관한 것이다. 본 발명에 따른 유전자 발현 및 억제가 동시에 가능한 핵산 구조체는 단일 구조체 내에 mRNA와 siRNA를 모두 포함함에 따라 동일한 세포에 mRNA 및 siRNA를 동시에 도입시키고, 이를 통해 발현하고자 하는 단백질을 정상적으로 발현시키면서도, 특정 유전자의 발현은 특이적으로 억제할 수 있다. 상기 mRNA-siRNA 핵산 구조체는 항원 제시 세포에 타겟 단백질을 발현시켜 면역체계를 활성화시킴과 동시에 면역관문 단백질의 활성화를 차단하여 면역회피 방해를 극복할 수 있어, 면역치료 분야, 특히 항암면역치료 분야에서 매우 유용하게 사용될 수 있을 것으로 기대된다.

Description

유전자 발현 및 억제가 동시에 가능한 핵산 구조체
본 발명은 유전자 발현 및 억제가 동시에 가능한 핵산 구조체에 관한 것이다.
암은 인류의 건강을 위협하는 최대의 질병 중의 하나로서 세포가 일련의 돌연변이 과정을 거쳐 무제한적이고, 비 조절적인 방식으로 증식 및 불사화되어 발생하는 질병이다. 암과 관련된 다양한 생화학적 기전이 규명되어 그에 따른 치료제가 개발되어 오고 있으나, 아직까지 근본적인 치료방법은 제시되지 않고 있다. 이러한 암치료의 새로운 패러다임으로 자리매김하고 있는 것이 바로 면역항암요법(암면역치료, cancer immunotherapy)이다.
상기 면역항암요법은 수동면역치료와 능동면역치료로 구분할 수 있다. 수동면역치료에는 면역관문 억제제(immune checkpoint inhibitor), 면역세포치료제(immune cell therapy), 치료용 항체(therapeutic antibody) 등이 사용되며, 이 중 면역관문억제제는 T세포 억제에 관여하는 면역관문 단백질(immune checkpoint protein)의 활성화를 차단하여 T세포를 활성화시켜 암세포를 공격하는 치료제로서 CTLA-4, PD-1, PD-L1 억제제 등이 있다.
능동면역치료에는 암치료 백신, 면역조절제 등이 사용되며, 구체적으로 체내 면역세포를 수집하여 강화시키거나 유전공학적으로 변형시켜 다시 넣어주는 세포치료 방식으로 종양침윤림프구(tumor infiltrating lymphocytes, TIL), T세포 수용체(T cell receptor, TCR), 키메릭항원수용체(chimeric antigen receptor, CAR) 세포치료제 등이 있고, 암세포가 갖고 있는 종양특이적 항원(tumor-specific antigen)을 암환자에게 투여하여 면역체계를 활성화시킴으로써 체내 면역기능을 활발하게 만들어 암세포를 공격하도록 하는 암백신 등이 있다.
그 중에서도 수지상세포(dendritic cell, DC)는 면역계의 가장 핵심적인 항원제시세포로서 수지상세포 암백신은 암 항원을 제시하여 항암 면역 반응 활성화를 통해 종양을 효과적으로 제거할 수 있는 이상적인 치료제로 여겨지고 있다. 그러나, 종양 및 종양미세환경(tumor microenvironment, TME)은 직접적으로 수지상세포의 기능장애를 유도하거나 종양 항원을 감추고 면역억제 사이토카인을 다량 분비하여 항암 면역 활성을 억제한다. 특히, 암세포와 이를 공격하려는 면역세포의 힘의 균형이 무너지게 되면 암세포가 본격적인 증식을 개시하며 체내 면역시스템을 교란하는데, 이 때 일부 암세포는 면역세포의 면역관문을 활용하여 면역을 회피하게 된다.
따라서, 면역체계를 활성화시켜 능동적으로 암세포에 대한 면역반응을 증가시키면서도, 수동적으로 면역관문 단백질의 활성화를 차단하여 면역회피 방해를 받지 않도록 하는 새로운 면역항암제에 대한 필요성이 대두된다.
또한, 유전체 시스템의 복잡한 환경, 특히 암 환경에서 특정 유전자들의 상향 또는 하향 조절이 원활하게 이루어질 필요가 있는데, 하나의 물질의 처리로써 이러한 유전자 조절을 이루는 것이 매우 어렵다. 즉, 단일의 분자를 이용하여 생체 내에서 유전자들의 정확하고 빠른 조절을 목적하는 많은 연구들이 있었으나, 충분한 결과를 확보하고 있지 못한 실정이다.
본 발명자들은 mRNA 및 siRNA를 포함하는 핵산 구조체를 제조하고, 상기 구조체가 특정 유전자들을 mRNA 또는 siRNA 각각을 통해 동시에 발현 또는 억제함을 확인하였다. 특히, 항원 mRNA를 발현시켜 면역체계를 활성화시킴과 동시에 면역관문 단백질의 활성화를 억제하여 면역관문 단백질에 의한 면역 회피 기전을 극복할 수 있음을 확인하고, 본 발명을 완성하게 되었다.
따라서, 본 발명의 목적은 유전자 발현 및 억제가 동시에 가능한 mRNA 및 siRNA를 포함하는 핵산 구조체를 제공하는 데에 있다.
상기 목적을 달성하기 위하여, 본 발명은 mRNA 및 siRNA를 포함하는 핵산 구조체를 제공한다.
또한, 본 발명은 상기 핵산 구조체 및 핵산 전달체를 포함하는 조성물을 제공한다.
또한, 본 발명은 상기 핵산 구조체를 포함하는 면역치료용 약학적 조성물을 제공한다.
또한, 본 발명은 상기 핵산 구조체를 포함하는 암 백신을 제공한다.
또한, 본 발명은 상기 핵산 구조체의 제조방법을 제공한다.
본 발명에 따른 유전자 발현 및 억제가 동시에 가능한 핵산 구조체는 단일 구조체 내에 mRNA와 siRNA를 모두 포함함에 따라 동일한 세포에 mRNA 및 siRNA를 동시에 도입시키고, 이를 통해 발현하고자 하는 단백질을 정상적으로 발현시키면서도, 특정 유전자의 발현은 특이적으로 억제할 수 있다. 상기 mRNA-siRNA 핵산 구조체는 항원 제시 세포에 타겟 단백질을 발현시켜 면역체계를 활성화시킴과 동시에 면역관문 단백질의 활성화를 차단하여 면역회피 방해를 극복할 수 있어, 면역치료 분야, 특히 항암면역치료 분야에서 매우 유용하게 사용될 수 있을 것으로 기대된다.
도 1은 핵산 구조체의 일모식도를 나타낸다.
도 2는 본 발명에 따른 mRNA-siRNA 핵산 구조체의 제조방법을 순서대로 도식화한 것이다.
도 3은 본 발명에 따른 mRNA-siRNA 핵산 구조체의 제조방법을 순서대로 도식화한 것이다. DNA 주형, 상기 주형 DNA를 사용하여 시험관 내 전사된 mRNA(“mRNA-siRNA(SS or AS)”) 및 상기 mRNA에 siRNA를 어닐링(annealing)시켜 제조된 mRNA-siRNA 핵산 구조체를 siRNA의 센스(SS) 또는 안티센스 서열(AS) 표시와 함께 도식화하였다.
도 4는 본 발명에 따른 mRNA-siRNA 핵산 구조체가 세포 내 환경에서 RNase H에 의해 mRNA 및 siRNA로 분리되는 과정을 도식화한 것이다(AAAA, TTTT 글씨는 DNA 서열에 해당).
도 5는 siRNA의 센스 또는 안티센스 서열, 길이를 달리하는 Oligo(dT)를 다양한 구성으로 조합한 siRNA-Oligo(dT)를 mRNA에 어닐링(annealing)시켜 제조한 mRNA-siRNA 실시예들을 도식화한 것이다(TT, TTTTTT, TTTT-AS, TTTT-SS 글씨는 DNA 서열에 해당).
도 6은 DNA 주형(a) 및 시험관 내 전사 산물(b)에 대하여 전기영동한 결과를 나타낸 도이다.
도 7은 mRNA-siRNA에 대하여 전기영동한 결과를 나타낸 도이다.
도 8은 서로 다른 mRNA-siRNA 실시예들의 단백질(빨간 형광 단백질, GFP) 발현 능력을 평가한 결과를 나타낸 도이다.
도 9는 형질주입 24시간 후, 서로 다른 mRNA-siRNA 실시예들의 단백질(파란 형광 단백질, BFP) 발현 능력 및 유전자(녹색 형광 단백질, GFP) 발현 억제 능력을 평가한 결과를 나타낸 도이다. (a) mBFP 단백질 발현 효율, (b) GFP 단백질 발현 억제 효율.
도 10은 형질주입 48시간 후, 서로 다른 mRNA-siRNA 실시예들의 단백질(파란 형광 단백질, BFP) 발현 능력 및 유전자(녹색 형광 단백질, GFP) 발현 억제 능력을 평가한 결과를 나타낸 도이다. (a) mBFP 단백질 발현 효율, (b) GFP 단백질 발현 억제 효율.
도 11은 본 발명에 따른 핵산 구조체에 오브알부민(Ovalbumin, OVA)을 발현하는 mRNA 및 STAT3 유전자의 발현을 억제하는 siRNA를 도입하고, 상기 mOVA-siSTAT3의 STAT3 단백질 발현 억제 능력을 평가한 결과를 나타낸 도이다.
도 12는 본 발명에 따른 핵산 구조체에 오브알부민(Ovalbumin, OVA)을 발현하는 mRNA 및 STAT3 유전자의 발현을 억제하는 siRNA를 도입하고, 상기 mOVA-siSTAT3의 STAT3 단백질 발현 억제 능력을 western blot을 통해 평가한 결과를 나타낸 도이다.
도 13은 mOVA-siSTAT3의 수지상세포 성숙 촉진 효과를 CD40, CD80 발현량을 통해 확인한 결과를 나타낸 도이다.
도 14는 OVA의 발현이 mOVA-siSTAT3/siSTAT3 구조체 처리를 통해 확인된 결과를 나타낸다.
도 15는 mOVA-siSTAT3/siSTAT3 를 근육 주사한 마우스에서 채취한 비장세포 (splenocyte) 중 유도된 OVA 항원 특이 세포 독성 T 세포 집단이 13.8 %로 분석된 결과를 나타낸다.
도 16은 mOVA-siSTAT3/siSTAT3를 근육 주사한 마우스의 비장 세포에서 mOVA와 siSTAT3의 단순 mixture를 근육 주사한 마우스에 비하여 더 높은 OVA 특이 세포 독성 T 세포 집단이 관찰되는 것을 보여준다.
도 17은 mOVA-siSTAT3/siSTAT3를 근육 주사한 마우스의 OVA-특이적 IgG 발현이 mOVA와 siSTAT3의 단순 mixture를 근육 주사한 마우스에 비하여 향상된 것을 확인한 결과를 나타낸다.
도 18은 siSTAT3/siSTAT3(mOVA-T6-STAT3i)는 단순 mixture와 대비하여 현저히 우수한 종양 억제 효과를 나타낸 결과를 보여준다.
이하, 본 발명을 보다 상세하게 설명한다.
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로, 본 명세서에서 사용된 명명법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
본 발명에서 용어, “벡터”는 적절한 숙주 세포에서 목적하는 단백질을 발현할 수 있도록 하는 작동 가능하게 연결된 필수적인 조절 요소를 포함하는 핵산 제작물을 의미한다.
본 발명에 있어서, 상기 벡터는 본 발명에 따른 핵산 구조체를 생산하는데 적합한 것이면 제한 없이 사용될 수 있으며, 프로모터 등 전사를 위해 필요한 요소를 포함한다. 상기 벡터는 RNA 벡터 또는 DNA 벡터일 수 있으며, 바람직하게는 DNA 벡터일 수 있다. 상기 벡터는 바이러스 벡터 또는 플라스미드 벡터와 같이 통상의 기술자에게 알려진 벡터이면 제한 없이 사용될 수 있으며, 바람직하게는 DNA 플라스미드 벡터를 사용할 수 있다. 또한, 상기 벡터는 원형 분자인 것을 특징으로 할 수 있다. 상기 벡터, 바람직하게 원형 벡터는, 예를 들어 제한 효소에 의해 선형화(linearization)될 수 있다.
본 발명에서 용어, "프로모터"는 전사조절인자들이 결합하는 DNA 염기서열 부위를 의미하며, 본 발명의 목적상 유전자 발현율을 높이기 위하여 강력하고 안정적인 유전자 발현을 유도할 수 있는 프로모터를 사용할 수 있다. 본 발명에 있어서, 상기 프로모터는 바람직하게는 RNA 중합효소 프로모터일 수 있고, 보다 바람직하게는 T7 프로모터 또는 SP6 프로모터일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 용어, "UTR(untranslation region, 비해독 부분)"은 mRNA의 비해독 부분을 이르는 단어로 일반적으로 코딩 영역의 양 말단을 의미한다. 특히, 5' 말단 부분을 5' UTR로 3' 말단 부분을 3' UTR로 지칭한다.
본 발명에서 용어, "폴리(A) 테일(poly(A) tail)"은 폴리아데닐산 또는 폴리아데닐산 절편으로도 불리며, 진핵생물의 mRNA 3' 말단에 보편적으로 존재하는 아데닐산의 연속한 배열을 의미한다. 그 길이는 10 내지 200 뉴클레오티드(nt) 정도이며, 발현벡터 백본(backbone)의 허용 크기에 따라 다양하게 조절될 수 있다. 폴리(A)는 mRNA의 안정화, 해독, 핵에서 세포질로의 수송 등에 관여하는 것으로 알려져 있다.
본 발명에서 용어, "siRNA(small interfering RNA)"는 이중가닥 RNA가 다이서(Dicer) 효소에 의해 절단되어 생성되는 18~23 뉴클레오티드(nt) 크기의 작은 RNA 조각으로, 상보적인 서열을 갖는 mRNA에 특이적으로 결합하여 타겟 단백질, mRNA의 발현을 억제하는 데 사용할 수 있다. 상기 siRNA는 센스 RNA와 안티센스 RNA가 이중가닥 RNA 분자를 형성하고, 이때 센스 RNA가 mRNA 중 일부의 연속 뉴클레오티드의 표적 서열과 동일한 핵산 서열을 포함하는 siRNA 분자인 것이 바람직하다. 상기 안티센스 서열은 센스 서열과 상보적인 서열을 가지는 것이 가장 바람직하다.
본 발명에서, 용어 "상보적인 서열"은 서로 상보적 결합을 이루는 특징을 유지할 수 있다면 100% 상보적 서열 외에 60 내지 100%의 상보적 서열, 바람직하게는 80% 내지 100% 상보적 서열, 더욱 바람직하게는 90 내지 100% 상보적 서열, 더더욱 바람직하게는 95% 내지 100%의 상보적 서열로 이루어지는 것을 포함할 수 있다.
본 발명에서 용어, "표적 유전자"란 상기 siRNA에 의해 발현이 선택적으로 억제되거나 불활성화되는 유전자이다. 이러한 불활성화는, siRNA가 표적 유전자의 mRNA를 절단함에 의해 달성된다.
본 발명에서 용어, “리보뉴클레아제(ribonuclease, RNase)”는 리보핵산을 분해하여 올리고뉴클레오티드 혹은 단일 핵산으로 만드는 반응을 촉매하는 효소로, 바람직하게는 엔도 리보핵산 분해효소(endo ribonuclease)이며, 상기 엔도 리보핵산 분해효소는 RNase A, RNase H, RNase I, RNase III, RNase L, RNase P, RNase PhyM, RNase T1, RNase T2, RNase U2, RNase V1 및 RNase V를 포함한다.
본 발명에 있어서, 상기 리보핵산은 전령 리보핵산(messenger RNA)일 수 있으며, 상기 리보뉴클레아제로는 바람직하게는 RNase H를 사용할 수 있다. 본 발명의 일 실시예에서는, RNase H를 사용하여 본 발명에 따른 핵산 구조체인 mRNA-siRNA의 폴리(A)-폴리(T) 혼성화 부분의 인산다이에스터 결합(phosphodiester bond)을 가수분해시켜 mRNA에 따른 유전자 발현 및 siRNA에 따른 단백질 발현 억제를 동시에 달성할 수 있음을 확인하고 있다.
본 발명에서 용어, “mRNA-siRNA(SS or AS)”는 3' 말단에 siRNA의 센스 또는 안티센스 서열을 포함하는 mRNA를 의미한다. 본 발명의 일 실시예에서는, 폴리(A) 서열 및/또는 siRNA(센스/안티센스) 서열을 포함하는 역방향 프라이머(Reverse Primer, RP)를 사용하여 3' UTR 바로 옆 3'에 폴리(T) 테일(poly(T) tail) 및 siRNA(안티센스/센스) 서열이 도입된 DNA 주형을 제조하고, 제조한 DNA 주형을 이용하여 시험관 내(in vitro) 전사(in vitro transcription, IVT)를 통해 3' 말단에 siRNA 센스 또는 안티센스 서열을 포함하는 mRNA(“mRNA-siRNA(SS or AS)”)를 제조하였다.
본 발명에서 용어, “mRNA-siRNA”는 상기 제조한 mRNA-siRNA(SS or AS)의 3' 말단에 도입된 siRNA의 센스 또는 안티센스 서열에 상보적으로 결합할 수 있는 “혼성화 서열”을 어닐링한 결과, mRNA-siRNA 3' 말단의 폴리(A) 테일 및 siRNA 서열(센스/안티센스)이 각각 이와 상보적인 혼성화 서열(안티센스/센스) 및 oligo(dT)와 결합하여 이중가닥을 형성하는 핵산 구조체를 의미한다.
본 발명에 있어서, 상기 “혼성화 서열”은 siRNA 또는 DNA일 수 있으며, 따라서 “mRNA-siRNA”은 본 명세서 내에서 “mRNA-siRNA/siRNA”또는 “mRNA-siRNA/DNA”로도 표기된다.
본 발명은 유전자 발현 및 억제가 동시에 가능한 핵산 구조체를 제공한다.
보다 구체적으로, 본 발명은 mRNA 및 siRNA를 포함하는 핵산 구조체로, (i) 3' 말단에 5' 방향에서 3' 방향으로 순차적으로 위치하는 폴리(A) 테일(poly(A) tail); 및 제1 siRNA 센스 또는 안티센스 서열을 포함하는 mRNA; 및 (ii) 상기 제1 siRNA 서열에 상보적으로 결합하는 혼성화 서열을 포함하는 핵산 구조체를 제공한다.
본 발명에 있어서, 상기 혼성화 서열은 제1 siRNA 서열에 상보적으로 결합하는 제2 siRNA 안티센스 또는 센스 서열; 또는 제1 siRNA 서열에 상보적으로 결합하는 DNA 안티센스 또는 센스 서열인 것을 특징으로 한다.
본 발명에 있어서, 상기 혼성화 서열은 3' 말단에 상기 mRNA의 폴리(A) 테일과 상보적으로 결합하는 폴리(T) 테일(poly(T) tail)을 더 포함할 수 있다. 상기 폴리(T) 테일은 2 내지 6 nt 길이일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 있어서, 상기 핵산 구조체는 제1 siRNA 센스 또는 안티센스 서열의 3' 말단에 추가의 siRNA 센스 또는 안티센스 서열을 위한 제1 링커 서열을 더 포함할 수 있고, 상기 제1 링커 서열은 링커 서열의 3' 말단에 추가의 siRNA 센스 또는 안티센스 서열을 더 포함할 수 있다.
또한, 본 발명에 있어서, 상기 핵산 구조체는 상기 제1 링커 서열; 및 추가의 siRNA 센스 또는 안티센스 서열에 상보적으로 결합하는 혼성화 서열; 및 제2 링커 서열을 더 포함할 수 있다. 상기 혼성화 서열은 상기 제1 링커 서열; 및 추가의 siRNA 센스 또는 안티센스 서열에 상보적으로 결합하는 것을 특징으로 한다.
본 발명에 있어서, 링커(linker) 또는 어댑터(adaptor) 서열은 통상의 방법에 따른 합성 올리고뉴클레오타이드 서열을 제한 없이 사용할 수 있고, 바람직하게는 상기 제1 링커 서열은 폴리(U) 테일일 수 있고, 상기 제2 링커 서열은 제1 링커 서열과 상보적으로 결합하는 폴리(A) 테일일 수 있으나, 이에 제한되는 것은 아니다.
상기 링커 또는 어댑터 서열은 DNA와 혼성화되지 않는 부위를 포함할 수 있다.
본 발명에 있어서, 상기 핵산 구조체는 하기 도 1에서 붉은 점선으로 표시한 반복단위를 복수 개 더 포함할 수 있으며, 바람직하게는 1개 내지 5개 더 포함할 수 있다. 추가되는 반복단위의 개수는 당업자가 목적에 따라 적절히 조절할 수 있다.
구체적으로, 상기 핵산 구조체는 제1 siRNA 센스 또는 안티센스 서열의 3' 말단에 (a) 및 (b)를 포함하는 반복단위를 복수 개 더 포함할 수 있고, 상기 (a) 및 (b)는, (a) 추가의 siRNA 센스 또는 안티센스 서열을 위한 제1 링커 서열; 및 추가의 siRNA 센스 또는 안티센스 서열; 및 (b) 혼성화 서열; 및 제2 링커 서열인 것을 특징으로 하며, 이 때 상기 혼성화 서열은 상기 제1 링커 서열; 및 추가의 siRNA 센스 또는 안티센스 서열에 상보적으로 결합하는 것을 특징으로 한다.
반복단위의 일부로 추가되는 siRNA는 타겟으로 하는 유전자가 서로 같거나 다를 수 있으며, 상기 핵산 구조체는 세포 내로 주입되면 RNase H에 의해 mRNA-siRNA의 혼성화 부위가 절단되어 독립된 이중가닥 siRNA로 분리되어 효과적으로 표적 유전자의 발현을 억제할 수 있다. 서로 상이한 2종 이상의 siRNA를 포함하는 경우, 2 이상의 타겟 유전자를 동시에 발현 억제할 수 있다.
또한, 본 발명은 본 발명에 따른 핵산 구조체 및 핵산 전달체를 포함하는 조성물을 제공한다.
본 발명에서, 용어 “핵산 전달체(nucleic acid delivery system)”는 본 발명에 따른 핵산 구조체의 체내로의 전달효율을 높이기 위한 것으로, 체내에서의 안정성이 우수할 뿐 아니라 약물로서의 제조 공정이 간단하다는 장점이 있다.
상기 핵산 전달체는, 이에 제한되는 것은 아니나, 바이러스성 벡터, 비바이러스성 벡터, 리포좀, 양이온성 고분자, 미셀(micelle), 에멀젼 및 나노입자(nanoparticles)를 포함할 수 있고, 바람직하게는 나노입자일 수 있다. 상기 양이온성 고분자에는 키토산, 아텔로콜라겐(atelocollagen), 양이온성 폴리펩타이드(cationic polypeptide) 등과 같은 천연고분자와 poly(L-lysin), 선형 또는 분지형 PEI(polyethylene imine), 사이클로덱스트린계열 다가양이온(cyclodextrin-based polycation), 덴드리머(dendrimer) 등과 같은 합성고분자를 포함한다.
본 발명에 있어서, 상기 나노입자는 이에 제한되는 것은 아니나, 자성입자(magnetic bead), 금(Au) 나노입자, 은(Ag) 나노입자, 백금(Pt) 나노입자, 양자점(Quantum dot), 상방전환 나노입자(upconversion nanoparticle, UCNP), 그래핀(graphene)-나노입자 복합체, 색 염색 나노입자(color dyed particles) 및 라텍스(latex) 나노입자, 실리카 나노입자(silica nanoparticle), 탄소유도체 나노입자(carbon derivative nanopartilces; 예컨대, 탄소나노튜브(carbon nanotube) 및 고형리피드 나노입자(solid lipid nanoparticles)로 이루어지는 군에서 선택되는 어느 하나일 수 있다.
본 발명에 따른 핵산 구조체는 상기와 같은 나노입자에 도입되는 경우 상기 핵산 구조체의 타겟 세포로의 전달이 촉진되어, 비교적 낮은 농도의 투여량으로도 타겟 세포로 전달되어 높은 타겟 단백질 발현 유도 및 표적 유전자 발현 억제 기능을 나타낼 수 있다. 또한, 타겟 이외의 타 장기 및 세포로의 비 특이적인 mRNA-siRNA의 전달을 방지할 수 있다.
또한, 본 발명은 본 발명에 따른 핵산 구조체를 포함하는 면역치료용 약학적 조성물을 제공한다. 본 발명에 따른 약학적 조성물은 면역 반응을 증가시키거나, 특정 질병, 감염 또는 질환의 치료 또는 예방에 바람직한 면역 반응의 일부를 선택적으로 상승시킬 수 있다.
본 발명에 있어서, 상기 면역치료는 바람직하게는 암 면역치료일 수 있다.
본 발명에 있어서, 상기 암은 뇌종양, 양성성상세포종, 악성성상세포종, 뇌하수체 선종, 뇌수막종, 뇌림프종, 핍지교종, 두개내인종, 상의세포종, 뇌간종양, 두경부 종양, 후두암, 구인두암, 비강/부비동암, 비인두암, 침샘암, 하인두암, 갑상선암, 흉부종양, 소세포성 폐암, 비소세포성 폐암, 흉선암, 종격동 종양, 식도암, 유방암, 남성유방암, 복부종양, 위암, 간암, 담낭암, 담도암, 췌장암, 소장암, 대장암, 항문암, 방광암, 신장암, 남성생식기종양, 음경암, 요도암, 전립선암, 여성생식기종양, 자궁경부암, 자궁내막암, 난소암, 자궁육종, 질암, 여성외부생식기암, 여성요도암, 피부암, 골수종, 백혈병 및 악성 림프종으로 이루어진 군으로부터 선택되는 어느 하나일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 있어서, 상기 약학적 조성물은 본 발명에 따른 핵산 구조체를 단독으로 포함하거나 하나 이상의 약학적으로 허용되는 담체, 부형제 또는 희석제를 포함하여 제공될 수 있다.
상기 "약학적으로 허용되는"이란 생리학적으로 허용되고 인간에게 투여될 때, 통상적으로 위장 장애, 현기증과 같은 알레르기 반응 또는 이와 유사한 반응을 일으키지 않는 조성물을 의미하며, 상기 담체, 부형제 및 희석제의 예로는 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 폴리비닐피롤리톤, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있으나 이에 제한되는 것은 아니다.
본 발명에 따른 약학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 세프 테졸에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calciumcarbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
상기 약학적 조성물의 바람직한 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 그러나, 바람직한 효과를 위해서, 1일 0.0001 내지 100 mg/kg으로, 바람직하게는 0.001 내지 100 mg/kg으로 투여하는 것이 좋다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
상기 약학적 조성물은 다양한 경로로 투여될 수 있으며, 예를 들어 경구, 직장 또는 정맥, 근육, 피하, 복강, 자궁내 경막 또는 뇌혈관내 주사에 의해 투여될 수 있다.
또한, 본 발명은 본 발명에 따른 핵산 구조체를 포함하는 암 백신을 제공한다. 본 발명에 따른 핵산 구조체는 항원제시세포에 항원을 표지하여 면역반응을 유도시킬 수 있으며, 동시에 면역 관문 단백질의 발현을 억제할 수 있다. 상기 핵산 구조체는 나노입자와 결합한 상태로 암 백신에 포함될 수 있다.
본 발명에 있어서, 상기 암 백신은 수지상세포를 더 포함하는 것일 수 있다. 예를 들어, 상기 암 백신은 생체 외(ex vivo)에서 본 발명에 따른 핵산 구조체를 수지상세포에 전달한 다음, 형질감염된 수지상세포를 전달하는 형태로 제공될 수 있다. 상기 수지상세포는 대상체의 면역원성을 증가시킬 수 있어, 대상체 내 종양의 증식 및/또는 전이를 효과적으로 예방 또는 억제할 수 있다.
본 명세서에서 용어, "수지상세포"는 항원을 세포 내부로 흡수하고, 이를 처리하여 항원 또는 항원으로부터 유래된 펩타이드를 MHC 클라스 I 복합체 또는 MHC 클래스 복합체와 함께 제시하는 항원제시세포(antigen presenting cell)를 의미한다. 수지상세포는 성숙도에 따라 미성숙 수지상세포와 성숙 수지상세포로 분류한다.
상기 "미성숙 수지상세포"는 성숙 초기 단계에서 발견되는 것으로서, 성숙 수지상세포와 마찬가지로 CD14와 같은 세포 표면 마커를 발현하지 않으며, HLA-DR, CD86, CD80, CD83 또는 CD40을 낮은 수준으로 발현하고, CD1a 및 CCR1, CCR2, CCR5 및 CXCR1을 통상적 수준으로 발현하는 수지상세포를 말한다.
상기 "성숙 수지상세포"는 미성숙 수지상세포가 성숙화되어 형성된 세포를 의미하며, B 세포 및 T 세포 활성에 관여하는 세포 표면 마커, 예를 들어 MHC 클라스 I 또는 MHC 클래스 (HLA-DR), 세포 부착인자(CD54, CD18, CD11), 공동 자극 인자(예를 들어, CD86, CD80, CD83 또는 CD40)이 미성숙 수지상세포에 비하여 높은 수준 또는 상대적으로 증가된 수준으로 발현하는 세포를 의미한다.
예를 들어, 본 발명의 일 실시예에서는 본 발명에 따른 핵산 구조체에 오브알부민(Ovalbumin, OVA)을 발현하는 mRNA 및 STAT3 유전자의 발현을 억제하는 siRNA를 도입한 mRNA-siSTAT3을 형질주입한 결과, CD40 및 CD80 마커의 발현량이 현저히 증가하여 분리된 mRNA 및 siRNA를 혼합하여 투여하는 것보다 수지상세포 성숙 촉진 효과가 훨씬 우수함을 확인하였다.
본 발명은 또한 면역치료에 사용하기 위한 본 발명에 따른 핵산 구조체를 포함하는 약학적 조성물을 제공한다.
본 발명은 또한 면역치료를 위한 약제의 제조에 있어 본 발명에 따른 핵산 구조체의 용도를 제공한다.
본 발명은 또한, 본 발명에 따른 핵산 구조체를 이를 필요로 하는 개체에 투여하는 단계를 포함하는 면역 치료방법을 제공한다.
본 발명에 있어서 상기 면역 치료는, 암 면역 치료일 수 있다. 보다 구체적으로, 암 치료 용도일 수 있다.
또한, 본 발명은
1) 3' 말단에 5' 방향에서 3' 방향으로 순차적으로 위치하는 폴리(T) 테일(poly(T) tail) 및 siRNA 안티센스 또는 센스 서열이 도입된 DNA 주형을 제조하는 단계;
2) DNA 주형에 RNA 중합효소를 포함하는 반응용액을 처리하여 3' 말단에 siRNA 서열을 포함하는 mRNA를 얻는 단계; 및
3) 3' 말단에 Oligo(dT)가 연결된 siRNA를 상기 mRNA 산물에 어닐링하는 단계; 를 포함하는 mRNA 및 siRNA를 포함하는 핵산 구조체의 제조방법을 제공한다.
상기 1) 단계에 있어서, DNA 주형은 mRNA 합성을 위한 전사주형으로서, T7 프로모터(promoter), 5' UTR, 오픈 리딩 프레임(open reading frame, ORF) 및 3' UTR을 포함하는 DNA 벡터(pUCIDT-Amp vector)를 제조하였고, 상기 DNA를 주형으로 PCR을 수행하여 벡터를 선형화한 후 증폭시킨 것일 수 있다.
PCR은 DNA 벡터를 1차 주형으로 하여 PCR 반응 혼합액, 정방향 프라이머(forward primer)로서 5'-TTGGACCCTCGTACAGAAGCTAATACG-3'(서열번호 4)으로 이루어진 올리고뉴클레오티드, 역방향 프라이머(reverse primer)로서 “5' - siRNA 서열 - 폴리(A) - DNA 벡터와 특이적으로 결합하는 프라이머 서열 - 3' (역방향 프라이머)” 구성에 기반한 것을 사용하여 수행하였다. 구체적으로, 상기 역방향 프라이머는 폴리(A) 서열 및/또는 siRNA(센스/안티센스) 서열을 포함하여, 제조된 DNA 주형의 3' UTR 바로 옆 3'에 폴리(T) 테일(poly(T) tail) 및 siRNA(안티센스/센스) 서열을 도입시켰다. 본 발명의 일 실시예에 있어서, 상기 PCR 반응 혼합액은 2X TOPsimple TM DryMIX-HOT(enzynomics, 한국)을 사용하였으나, 이에 제한되는 것은 아니다.
DNA 주형을 제조하기 위한 PCR의 조건은 PCR 수행을 위한 3단계, 즉 변성(Denaturation) 단계, 혼성(Annealing) 단계, 연장(Elongation) 단계를 수행하기 위한 온도 및 시간을 각각 유지할 수 있고, 상기 변성 단계를 수행하기 위한 조건은 85℃ 내지 105℃ 5분 내지 15분, 바람직하게는 95℃ 10분, 상기 혼성 단계를 수행하기 위한 조건은 40℃ 내지 65℃ 20초 내지 40초, 바람직하게는 59℃ 30초, 상기 연장 단계를 수행하기 위한 조건은 50℃ 내지 80℃ 30초 내지 2분, 바람직하게는 72℃ 1분일 수 있다. 상기 PCR 수행을 위한 특정된 온도 및 시간 범위는 PCR을 수행함에 있어서 실현 가능한 범위 내에서 조절 가능하다.
본 발명의 일 실시예에서, 상기 DNA 주형을 제조하기 위한 PCR의 조건은 초기변성(Initial denaturation) 95℃ 10분 후, 변성 95℃ 3초, 혼성 59℃ 30초, 연장 72℃ 1분을 1회전으로 총 30회전을 진행하고, 추가 연장(Final elongation) 72℃ 5분을 진행하였다. 또한, 증폭된 PCR 반응산물은 AccuPrep®PCR Purification Kit(Bioneer, South Korea)를 사용하여 정제하였다.
상기 2) 단계는 시험관 내 전사( in vitro transcription, IVT) 단계로, 1) 단계에서 제조한 DNA 주형에 RNA 중합효소를 포함하는 반응용액을 처리하여 3' 말단에 siRNA 서열을 포함하는 mRNA(“mRNA-siRNA”)를 제조하는 것을 특징으로 할 수 있다. 본 발명의 일 실시예에서, 상기 시험관 내 전사는 제조한 DNA 주형에 반응용액을 처리하여 37℃에서 16시간 동안 배양한 뒤, Turbo DNase I를 1μl 추가하여 37℃에서 15분간 반응시켜 수행하였다. 다만, 상기 시험관 내 전사를 위한 구체적인 반응조건은 실현 가능한 범위 내에서 조절 가능하다.
상기 3) 단계에 있어서, 어닐링(annealing)을 위한 조건은 서열-의존적이며 환경적 변수에 따라 다양하나, 40 내지 80℃ 5분 내지 15분, 바람직하게는 75℃ 10분일 수 있다. 본 발명의 일 실시예에서, 상기 어닐링은 75℃ 10분 수행 후 4℃까지 패스트 쿨링(급냉)하여 수행하였다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐 당해 기술분야에서 통상의 지식을 가진 자라면 이로부터 다양한 변형 및 균등한 다른 실시예가 가능하다는 점을 이해할 것이다. 따라서 본 발명의 진정한 기술적 보호 범위는 첨부된 특허청구 범위의 기술적 사상에 의하여 정해져야 할 것이다.
실시예 . 본 발명에 따른 핵산 구조체의 제조
DNA 주형 제조
유전자 발현 및 억제가 동시에 가능한 핵산 구조체를 제조하기 위해, 다음과 같이 실험을 수행하였다. 먼저, mRNA 합성을 위한 전사주형으로서 T7 프로모터(promoter), 5' UTR, 오픈 리딩 프레임(open reading frame, ORF) 및 3' UTR을 포함하는 DNA 벡터(pUCIDT-Amp vector)를 제조하였다. 상기 DNA를 주형으로 PCR을 수행하여 벡터를 선형화하고 T7 프로모터부터 3' UTR까지 증폭시켰다. PCR은 TOPsimple™ DryMIX-HOT(enzynomics, 한국)을 사용하여 수행하였고, 구체적인 PCR 조건은 하기 표 1과 같다. 증폭된 PCR 반응산물은 AccuPrep® PCR Purification Kit(Bioneer, South Korea)를 사용하여 정제하였다.
[표 1]
Figure PCTKR2020018484-appb-img-000001
이 때, 폴리(A) 서열 및/또는 siRNA(센스/안티센스) 서열을 포함하는 역방향 프라이머(Reverse Primer, RP)를 사용하여 3' UTR 바로 옆 3'에 폴리(T) 테일(poly(T) tail) 및 siRNA(안티센스/센스) 서열이 도입된 DNA 주형을 제조하였다(도 2의 a). 즉, 상기 역방향 프라이머는 다음 구성에 기반한 것을 사용하였다.
5' - siRNA 서열 - 폴리 (A) - DNA 벡터와 특이적으로 결합하는 프라이머 서열 - 3' (역방향 프라이머 )
본 실시예에 있어서, 본 발명자들은 상기 역방향 프라이머로 120 nt 폴리(A) 서열만으로 이루어진 프라이머, 120 nt 폴리(A) 서열과 siRNA(센스/안티센스) 서열을 포함하는 프라이머, 녹색 형광 단백질(Green Fluorescent Protein, GFP) mRNA를 표적하는 siRNA(이하, siGFP), 빨간 형광 단백질(Red fluorescent Protein, RFP) 및 파랑 형광 단백질(Blue fluorescent Protein, BFP)을 코딩하는 mRNA를 사용하였다.
mRNA - siRNA 합성
상기 실시예에서 제조한 DNA 주형을 사용하여 시험관 내( in vitro) 전사( in vitro transcription, IVT)를 수행하여 말단에 siRNA 서열을 포함하는 mRNA(이하, “mRNA-siRNA(SS or AS)”라 한다)를 합성하였다. T7 RNA 중합효소, rATP, rCTP, rGTP, rUTP 및 캡 유사체(cap analogue)를 포함하는 반응 용액(MEGAscript™T7 Transcription Kit (Ambion, USA)을 사용하여 시험관 내 전사를 수행하고, DNA 분해효소(DNase) 처리로 주형 DNA를 제거하고 mRNA만을 회수하였다.
구체적으로, 반응용액을 튜브에 넣고 37℃에서 16시간 동안 배양한 뒤, Turbo DNase I를 1μl 추가하여 37℃에서 15분간 반응시키고, 반응산물을 MEGAclear™ Kit(Ambion, USA)를 사용하여 정제하였다. 반응용액을 구성하는 모든 성분 및 이의 용량, 농도는 하기 표 2와 같다. 이를 통해 합성된 mRNA는 캡 유사체를 전사 반응에 첨가함으로써 생산된 5'-캡(5'-cap)을 5' 말단에 포함하였다(도 2의 b).
[표 2]
Figure PCTKR2020018484-appb-img-000002
본 발명에 따른 핵산 구조체 제조
다음으로, dTdTdTdTdTdT와 연결시킨 siRNA(siRNA-Oligo(dT))를 포함하는 역방향 프라이머를 상기 실시예에서 제조한 mRNA-siRNA(SS or AS)에 어닐링(annealing)하여, mRNA-siRNA(SS or AS)의 일부가 혼성화 서열과 상보적으로 결합하여 이중가닥을 형성하는, 본 발명에 따른 핵산 구조체(“mRNA-siRNA”를 제조하였다. 이 때, 상기 혼성화 서열은 폴리(T)를 포함하는 siRNA 서열 또는 폴리(T)를 포함하는 DNA 서열에 해당한다.
구체적으로, 어닐링은 mRNA-siRNA(SS or AS)와 siRNA-Oligo(dT)를 동일한 튜브에 넣어 혼합하고, 75℃에서 10분간 반응시킨 뒤, 4℃까지 패스트 쿨링(급냉)하였다. 이 때, dTdTdTdTdTdT 부위는 mRNA-siRNA(SS or AS)의 폴리(A) 테일(poly(A) tail)에 어닐링되고, siRNA 서열(안티센스/센스)은 mRNA-siRNA(SS or AS)의 3' 말단에 도입된 siRNA에 상보적으로 어닐링되었고(도 2의 c), 그 결과 mRNA-siRNA(SS or AS) 3' 말단의 폴리(A) 테일 및 siRNA 서열(센스/안티센스)이 각각 이와 상보적인 siRNA(안티센스/센스) 및 oligo(dT)와 결합하여 이중가닥을 형성하는 본 발명에 따른 핵산 구조체가 형성되었다(이하, “(또는 mRNA-siRNA/siRNA 또는 mRNA-siRNA/DNA)”라 한다). 상기 mRNA-siRNA의 제조과정을 도식화하여 도 3에 나타내었다.
본 실시예 및 실험예에서 사용한 DNA 벡터, 모든 프라이머 서열, 모든 siRNA 서열을 하기 표 3에 나타내었다. 모든 서열은 IDT(유전자 합성서비스)로부터 제공받아 사용하였다.
[표 3]
Figure PCTKR2020018484-appb-img-000003
Figure PCTKR2020018484-appb-img-000004
Figure PCTKR2020018484-appb-img-000005
Figure PCTKR2020018484-appb-img-000006
Figure PCTKR2020018484-appb-img-000007
Figure PCTKR2020018484-appb-img-000008
Figure PCTKR2020018484-appb-img-000009
Figure PCTKR2020018484-appb-img-000010
본 발명에 따른 mRNA-siRNA는 세포 내 환경에서 Rnase H에 의해 mRNA의 폴리(A)와 siRNA의 폴리(T) 간에 형성된 이중가닥 혼성체가 절단되어, 타겟 단백질을 발현시킬 수 있는 mRNA와 특정 유전자의 발현을 억제시킬 수 있는 siRNA로 분리되고, 이를 통해 대상체에서 단백질의 발현과 억제를 동시에 가능하게 한다(도 4).
한편, 도 4에 나타낸 바와 같이, 본 발명에 따른 mRNA-siRNA는 mRNA의 3' 말단에 siRNA가 하나 이상 연결될 수 있는 것을 특징으로 한다. 이 때, 첫번째 siRNA의 도입 이후 두번째 siRNA부터는 상기 어닐링과 동일한 조건으로 실험을 수행하되, 역방향 프라이머에 siRNA 서열을 추가하여 진행한다. 추가되는 siRNA의 경우, 역방향 프라이머에 대하여 도입하고자 하는 개수만큼 siRNA를 도입하여 추가할 수 있음을 특징으로 한다. 예를 들어, 두번째 siRNA를 도입하기 위해 사용한 모든 프라이머를 하기 표 4에 나타내었다.
유전자 이름 서열 정보 서열번호
Forward primer- pUCIDT-AMP_mTagBFP2 TTGGACCCTCGTACAGAAGCTAATACG 4
Reverse primer- pUCIDT-AMP_mTagBFP2-siGFP (2개) (AS) AAG CAA GCT GAC CCT GAA GTT AAAA AAG CAA GCT GAC CCT GAA GTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT CTT CCT ACT CAG GCT TTA TTC AAA GAC CA (Italic: sequence for antisense strand of siGFP 2개) 18
Reverse primer- pUCIDT-AMP_mTagBFP2-siGFP (2개) (SS) AAA ACT TCA GGG TCA GCT TGC AAAA AAA ACT TCA GGG TCA GCT TGC TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT CTT CCT ACT CAG GCT TTA TTC AAA GAC CA (Italic: sequence for sense strand of siGFP 2개) 19
AS siGFP 5′-AAC UUC AGG GUC AGC UUG C (dT) 2 or 6-3′ 9, 10
SS siGFP 5′-GCA AGC UGA CCC UGA AGU U (dT) 2 or 6-3′ 6, 7
본 실시예에 있어서, 본 발명자들은 하기와 같이 siRNA의 센스 또는 안티센스 서열, 길이를 달리하는 Oligo(dT)를 다양한 구성으로 조합한 siRNA-Oligo(dT)를 사용하여 mRNA의 단백질 발현 효율 및 siRNA의 유전자 발현 억제능을 평가하고, 유전자 발현 및 억제 효과가 우수한 핵산 구조체의 최적 구조를 도출하고자 하였다(도 5).
5' - siGFP와 상보적으로 결합하는 siRNA 서열( 안티센스 /센스) - dTdT - 3' (T2)
5' - siGFP와 상보적으로 결합하는 siRNA 서열( 안티센스 /센스) - dTdTdTdTdTdT - 3' (T6)
5' - siGFP와 상보적으로 결합하는 DNA 서열( 안티센스 /센스) - dTdTdTdT - 3' (DNA)
실험예 1. 각 반응산물의 확인
상기 실시예의 각 반응이 끝난 후, 반응 산물을 1% 아가로스 겔에 100V 전압으로 30분간 전기영동하여 PCR 반응 산물, 시험관 내 전사 산물을 확인한 결과를 도 6에 나타내었다.
도 6의 a에 나타낸 바와 같이, 역방향 프라이머를 사용하여 증폭된 DNA 단편의 크기는 각각 971 bp(poly(A)120, 레인 4) 및 992 bp(poly(A)120-AS siGFP, 레인 5)임을 확인하였다. 상기 결과를 통해, PCR을 수행함에 따라 3' UTR 바로 옆 3'에 폴리(T) tail 및 siRNA 서열이 도입되도록 디자인된 역방향 프라이머를 통해 DNA 주형이 효과적으로 증폭되었음을 확인하였다.
또한, 도 6의 b에 나타낸 바와 같이, 상기 DNA 주형을 사용하여 시험관 내 전사를 수행한 결과, 각각 3' 말단에 poly(A)120 서열이 도입된 mRFP(레인 2) 및 3' 말단에 poly(A)120-AS siGFP 서열이 도입된 mRFP(레인 3)가 합성되었음을 확인하였다.
마찬가지로, 상기 실시예에 기재한 방법으로 제조한 mRNA-siRNA 핵산 구조체를 확인한 결과를 도 7에 나타내었다.
도 7의 a에 나타낸 바와 같이, mRNA의 3' 말단에 poly(A)120 서열만 도입된 것과 poly(A)120과 안티센스 siGFP 서열이 함께 도입된 형태의 mRFP를 센스 siGFP 가닥과 패스트 쿨링을 시킨 결과, poly(A)120과 안티센스 siGFP 서열이 함께 도입된 형태의 mRFP에 주입한 센스 siGFP의 밴드가 옅어지는 것을 확인함으로써 센스 siGFP가 성공적으로 poly(A)120과 안티센스 siGFP 서열이 도입된 mRFP에 어닐링되었음을 확인하였다.
또한, 도 7의 b에 나타낸 바와 같이, FITC 표지된 센스 siGFP(FITC-SS siGFP, 레인 1)보다, 3' 말단에 안티센스 siGFP가 도입된 mRFP(mRFP-AS siGFP)에 대하여 FITC 표지된 센스 siGFP가 어닐링된 경우(mRFP-AS siGFP + FITC-SS siGFP, 레인 2) 밴드가 더 위쪽에서 나타남을 확인하였다. 상기 결과를 통해, 3' 말단에 siRNA 서열을 포함하는 mRNA와 상기 siRNA 서열에 상보적으로 결합하는 siRNA를 어닐링시키면, 상호 간에 부분적으로 혼성화된 mRNA-siRNA 핵산 구조체가 형성됨을 확인하였다.
실험예 2. 각 구조체의 단백질 발현 능력 평가
상기 실시예에서 제조한 서로 다른 mRNA-siRNA 핵산 구조체의 단백질 발현 효과를 확인하였다. 구체적으로, 세포를 96-웰 플레이트에 웰당 1 x 10 4개로 시딩하고, 형질주입 시약을 사용하여 세포를 10 pg mRNA/cell의 용량의 각 구조체로 형질주입(transfection)시켰다. 형질주입 24시간 후, 유세포 분석기 FACS Calibur(BD Biosciences, CA)를 사용하여 각 실시예에서 발현되는 빨간 형광 단백질의 형광 강도를 측정하여 각 구조체의 번역 효율(translation efficiency)을 확인하고 그 결과를 도 8에 나타내었다. 실험에 사용한 모든 실시예를 하기 표 5에 나타내었다. 하기 표 5에 있어서, mRNA-SS/SS 또는 mRNA-SS/AS는 siGFP-T2 서열과 어닐링 된 것을 의미하며, mRNA-AS/SS(DNA) 또는 mRNA-AS/AS(DNA)는 siGFP 서열을 가지고 있는 DNA에 추가적으로 dT 서열이 4개 도입된 서열과 어닐링 된 것을 의미한다.
본 발명의 실시예
mRNA-siRNA(SS or AS)
(5'-3')		 siRNA 및/또는 DNA (5'-3') 실시예
mRNA siRNA siRNA Oligo(dT)
- - - - Blank
mRFP - - - mRNA
siGFP(SS) - - mRNA-SS
siGFP(SS) TT(T2) mRNA-SS/SS
siGFP(AS) TT(T2) mRNA-SS/AS
siGFP(SS) (DNA) TTTT(DNA) mRNA-SS/SS(DNA)
siGFP(AS) (DNA) TTTT(DNA) mRNA-SS/AS(DNA)
siGFP(AS) - - mRNA-AS
siGFP(SS) TT(T2) mRNA-AS/SS
siGFP(AS) TT(T2) mRNA-AS/AS
siGFP(SS) (DNA) TTTT(DNA) mRNA-AS/SS(DNA)
siGFP(AS) (DNA) TTTT(DNA) mRNA-AS/AS(DNA)
도 8에 나타낸 바와 같이, 3' 말단에 siRNA 서열을 포함하는 mRNA를 형질주입한 실시예에서 공통적으로 번역 효율이 낮아진 것을 확인하였다. 반면, mRNA(SS)에 siGFP(AS)-TTTT(DNA)를 어닐링시킨 실시예와 mRNA(AS)에 siGFP(SS)-TTTT(DNA)를 어닐링시킨 실시예의 경우 감소된 번역 효율이 현저히 증가하며, mRFP을 형질주입한 경우보다도 형광 강도가 강하여 mRNA의 단백질 발현 능력이 완전히 회복되었음을 확인하였다.
상기 결과를 통해, 3' 말단에 siRNA(센스/안티센스) 서열을 포함하는 mRNA와, 상기 siRNA에 상보적으로 결합하는 siRNA(안티센스/센스) 서열 및 mRNA에 상보적으로 결합하는 Oligo(dT)를 포함하는 siRNA를 혼성화시키면, siRNA 서열의 결합에 의해 저해된 mRNA의 번역 효율이, mRNA-siRNA(SS or AS)의 siRNA 서열에 어닐링(annealing)된 DNA 서열에 의해 회복될 수 있음을 확인하였다. 이는 본 발명에 따른 mRNA-siRNA/DNA 하이브리드 구조체가 세포 내 RNase H에 의해 잘려나가는 기전에 의한 것으로 보인다. 또한, mRNA-siRNA(SS or AS)에 어닐링시킨 siRNA-dTdT(T2)의 경우 단백질 번역 효율이 저해되는 것을 확인함으로써 mRNA-siRNA(SS or AS)와 어닐링된 DNA의 시퀀스의 길이가 적어도 2개 이상은 되어야 세포 내 RNase H에 의해 추가적으로 도입된 siRNA 시퀀스가 잘려나가 mRNA 단백 번역 효율이 회복될 수 있음을 알 수 있었다. 따라서, 이후 실험에서는 mRNA-siRNA(SS or AS)에 siRNA-dTdTdTdTdTdT(T6)를 어닐링시켜 세포 내 도입 시 RNase H에 의해 mRNA와 siRNA로 분리되어 mRNA의 단백질 번역 효율 및 siRNA의 단백질 억제 효율이 유지될 수 있도록 디자인하였다.
실험예 3. 각 구조체의 단백질 발현 능력 및 유전자 발현 억제 능력 평가
상기 실시예에서 제조한 서로 다른 mRNA-siRNA 구조체의 단백질 발현 능력 및 유전자 발현 억제 효과를 확인하였다. 구체적으로, 세포를 96-웰 플레이트에 웰당 1 x 10 4개로 시딩하고, 형질주입 시약을 사용하여 세포를 10 pg mRNA/cell의 용량의 각 구조체로 형질주입(transfection)시켰다. 형질주입 24, 48시간 후, 유세포 분석기 FACS Calibur(BD Biosciences, CA)를 사용하여 각 실시예에서 발현되는 파란 형광 단백질 및 녹색 형광 단백질의 형광 강도를 측정하여 각 구조체의 단백질 발현 효율을 확인하고 그 결과를 도 9 및 도 10에 나타내었다. 실험에 사용한 모든 실시예를 하기 표 6에 나타내었다.
mRNA-siRNA(SS or AS)
(5'-3')		 siRNA 및/또는 DNA (5'-3') 실시예
mRNA siRNA siRNA Oligo(dT)
- - - - Blank
mBFP - - - mBFP
- - siGFP TT(T2) siGFP-T2
- - siGFP TTTTTT(T6) siGFP-T6
mBFP siGFP(SS) - - mBFP-SS
siGFP(AS) TT(T2) mBFP-SS/AS-T2
siGFP(AS) TTTTTT(T6) mBFP-SS/AS-T6
siGFP(AS) TTTT(DNA) mBFP-SS/AS(DNA)
siGFP(AS) - - mBFP-AS
siGFP(SS) TT(T2) mBFP-AS/SS-T2
siGFP(SS) TTTTTT(T6) mBFP-AS/SS-T6
siGFP(SS) TTTT(DNA) mBFP-AS/SS(DNA)
도 9의 a에 나타낸 바와 같이, 3' 말단에 siRNA 서열을 포함하는 mRNA를 형질주입한 실시예에서 파란 형광 강도가 감소했으며, 이를 통해 siRNA 서열을 연결함에 따라 단백질 발현 효율이 낮아진 것을 확인하였다. 반면, mBFP(SS)에 siGFP(AS)-TTTTTT(T6), siGFP(AS)-TTTT(DNA)를 어닐링시킨 실시예와 mBFP(AS)에 siGFP(SS)-TTTTTT(T6), siGFP(SS)-TTTT(DNA)를 어닐링시킨 실시예의 경우 감소된 번역 효율이 현저히 증가하며, mBFP을 형질주입한 경우보다도 형광 강도가 강하여 mRNA의 단백질 발현 능력이 완전히 회복되었음을 확인하였다.
상기 결과를 통해, 3' 말단에 siRNA(센스/안티센스) 서열을 포함하는 mRNA와, 상기 siRNA에 상보적으로 결합하는 siRNA(안티센스/센스) 서열을 포함하는 siRNA를 혼성화시키는 경우(mRNA-siRNA), mRNA에 siRNA 서열을 연결시킴에 따른 번역 효율의 감소를 극복할 수 있음을 확인하였다. 나아가, 감소된 번역 효율은 어닐링되는 siRNA의 3' 말단에 위치하는 Oligo(dT)가 T2인 경우보다는 T6이, T6인 경우보다는 T4일 때 현저히 증가함을 확인하였다.
한편, 도 9의 b에 나타낸 바와 같이, mBFP(SS)에 siGFP(AS)-TTTTTT(T6)을 어닐링시킨 실시예와 mBFP(AS)에 siGFP(SS)-TTTTTT(T6)을 어닐링시킨 실시예에서 녹색 형광 강도가 감소했으며, 특히 측정된 형광 강도가 정상 siRNA를 형질주입한 경우와 유사함을 확인하였다.
상기 결과를 통해, mRNA의 단백질 발현과는 독립적으로, 3' 말단에 siRNA(센스/안티센스) 서열을 포함하는 mRNA와, 상기 siRNA에 상보적으로 결합하는 siRNA(안티센스/센스) 서열을 포함하는 siRNA를 혼성화시키는 경우(mRNA-siRNA), 상기 siRNA가 표적하는 유전자의 발현이 현저히 억제됨을 확인하였다. 특히, 단백질 발현 억제 효율은 어닐링되는 siRNA의 3' 말단에 위치하는 Oligo(dT)가 T6인 경우 가장 높음을 확인하였다.
이와 같은 결과는 형질주입 48시간 후에도 유사하게 나타남을 확인하였다. 다만, 도 10의 a에 나타낸 바와 같이, mRNA에 siRNA 서열을 연결시킴에 따른 감소된 번역 효율은 어닐링되는 siRNA의 3' 말단에 위치하는 Oligo(dT)가 T2 또는 T4일 때 가장 크게 증가하였다. 또한, 도 10의 b에 나타낸 바와 같이, 유전자 발현 억제 효율은 mBFP(AS)에 siGFP(SS)-TTTTTT(T6)을 어닐링시킨 실시예에서 가장 높았다.
상술한 분석 결과, 본 발명에 따른 mRNA-siRNA 핵산 구조체는 고효율로 세포에 동시에 도입되고, 도입된 후 세포 내 RNase에 의해 mRNA와 siRNA간에 형성된 이중가닥 혼성체가 절단되어 타겟 단백질을 발현시킬 수 있는 mRNA와 특정 유전자의 발현을 억제시킬 수 있는 siRNA로 분리됨을 확인하였다. 나아가, 이와 같은 특이적 구조를 가짐으로써, 본 발명에 따른 mRNA-siRNA 핵산 구조체는 하나의 세포에서 mRNA에 의한 타겟 단백질의 발현 및 siRNA에 의한 특정 유전자의 발현 억제를 동시에 성공적으로 달성할 수 있음을 확인하였다.
실험예 4. 본 발명에 따른 핵산 구조체의 면역원성 향상 능력 평가
mRNA는 톨-유사 수용체(toll-like receptor, TLR)를 자극하여 면역반응을 유도하는 효과가 있다고 알려져 있다. 즉, mRNA는 자체적으로 면역반응 유도 효과가 있는 동시에 항원(단백질) 발현이 가능하여 별도의 어쥬번트(adjuvant) 없이도 백신으로 활용 가능하다. 한편, 이와 같은 mRNA 기반 백신은 수지상세포나 T 세포에 특정 항원을 발현시키는데, 이 때 STAT3 단백질은 면역반응 활성화를 억제하여 수지상세포의 성숙(maturation)을 억제한다.
이에, 본 발명자들은 본 발명에 따른 핵산 구조체를 활용하여, 항원을 발현하도록 설계된 mRNA 구조체에 STAT3의 발현을 억제하는 siRNA 서열을 도입하면 면역회피 방해를 받지 않으면서 동시에 수지상세포의 성숙을 효과적으로 촉진할 수 있을 것으로 판단하고 다음과 같이 실험을 수행하였다. 먼저, 상기 실시예에 기재한 것과 동일한 방법으로, 본 발명에 따른 핵산 구조체에 오브알부민(Ovalbumin, OVA)을 발현하는 mRNA 및 STAT3 유전자의 발현을 억제하는 siRNA를 도입하였다. 비교실험군으로는 STAT3을 표적하는 siRNA(siSTAT3), 오브알부민을 발현하는 mRNA와 siSTAT3의 단순 혼합물(mOVA + siSTAT3)을 사용하였다. 실험에 사용한 모든 mRNA와 siRNA 서열은 상기 실시예 내 표 3에 기재하였다.
4-1. STAT3 단백질 발현 억제 효과
골수-유래 수지상세포(bone marrow-derived dendritic cell, BMDC)에 상기 제조한 siSTAT3, mOVA 및 siSTAT3의 단순 혼합물(mOVA 및 siSTAT3의 단순 혼합물) 및 mOVA-siSTAT3/siSTAT3 구조체를 각각 처리하였다. 구체적으로, BMDC(1 × 10 6 cells/웰)를 10% FBS와 항생제(100 unit/ml 페니실린 및 100 μg/ml 스트렙토마이신)를 함유한 X-vivo 15 media으로 37℃에서 24시간 동안 24-웰 플레이트에서 배양하였다. 배양한 BMDC를 대상으로 siSTAT3, mOVA + siSTAT3 및 mOVA-siSTAT3/siSTAT3을 각각 형질주입하였다. 각 BMDC에서 STAT3 유전자의 발현 정도를 qRT-PCR 방법을 사용하여 분석하고, 그 결과를 도 11에 나타내었다.
도 11에 나타낸 바와 같이, 본 발명에 따른 핵산 구조체에 mOVA 및 siSTAT3을 도입한 mOVA-siSTAT3/siSTAT3(mOVA-T6-STAT3i) 처리 시, mOVA 및 siSTAT3을 단순 혼합한 mOVA + siSTAT3에 비해 STAT3 발현이 현저히 억제됨을 확인하였다. 상기 결과를 통해, 분리된 mRNA 및 siRNA를 혼합하여 투여하는 것보다 단백질 발현을 목적으로 하는 mRNA와 siRNA가 결합된 형태의 mRNA-siRNA 핵산 구조체를 투여하는 경우에 면역원성 향상 효과가 훨씬 우수함을 확인하였다.
또한, 상기 발현 변화의 확인 결과를 western blot을 통해 확인하고, 그 결과를 도 12에 나타내었다.
도 12에서 확인할 수 있는 바와 같이, mRNA와 siRNA가 결합된 형태의 mRNA-siRNA 핵산 구조체를 투여하는 경우에 면역원성 향상 효과가 훨씬 우수함을 확인하였다.
4-2. 수지상세포 성숙 촉진 효과
상기 실험예 4-1에 기재한 것과 동일한 방법으로 골수-유래 수지상세포(bone marrow-derived dendritic cell, BMDC)에 상기 제조한 siSTAT3, mOVA + siSTAT3 및 mOVA-siSTAT3/siSTAT3 구조체를 각각 처리하여 12시간 내지 48시간 동안 배양하였다. 일부 세포를 취하여 세포 표면에서 발현하는 CD40 및 CD80 마커의 발현양을 유세포분석(Fluorescence-activated cell sorting, FACS)을 통하여 분석하였다. 그 결과를 도 13에 나타내었다.
도 13에 나타낸 바와 같이, 본 발명에 따른 핵산 구조체에 mOVA 및 siSTAT3을 도입한 mOVA-siSTAT3/siSTAT3 처리 시, mOVA 및 siSTAT3을 단순 혼합한 mOVA + siSTAT3에 비해 성숙한 수지상세포의 표현형인 CD40 및 CD80의 발현이 모두 현저하게 증가함을 확인하였다. 상기 결과를 통해, 분리된 mRNA 및 siRNA를 혼합하여 투여하는 것보다 단백질 발현을 목적으로 하는 mRNA와 siRNA가 결합된 형태의 mRNA-siRNA 핵산 구조체를 투여하는 경우에 수지상세포 성숙 촉진 효과가 훨씬 우수함을 확인하였다.
4-3. 오브알부민( Ovalbumin , OVA) 발현 확인
mOVA-siSTAT3/siSTAT3 (mOVA-T6-STAT3i) 구조체를 수지상 세포에 처리한 후 OVA의 발현량을 ELISA를 통해 측정하여, 그 결과를 도 14에 나타내었다.
도 14에서 확인할 수 있는 바와 같이, 상당량의 OVA의 발현이 mOVA-siSTAT3/siSTAT3 구조체 처리를 통해 확인되었다.
실험예 5. Tetramer assay
In vivo 연구를 위해, mOVA + siSTAT3 혼합물 또는 mOVA-siSTAT3/siSTAT3(mOVA-T6-STAT3i)는 미세 유체 장치(NanoAssemblr Benchtop (Precision Nanosystems, Canada)를 사용하여 다음 조성의 빠른 혼합에 의해 지질 나노 입자로 제제화되었다: 지질 혼합물을 포함하는 에탄올 상 (C 12-200 : 디올레오일 포스파티딜 에탄올 아민 (DOPE) : 콜레스테롤 : C 14- 폴리에틸렌 글리콜 (PEG) 2000 = 35 : 16 : 46.5 : 2.5, 몰비) 및 수성 상 (10mM 구연산염 완충액, pH 3).
세포 독성 T 세포 면역 유도를 확인하기 위해, 지질로 제형화된 mOVA + siSTAT3 혼합물 또는 mOVA-siSTAT3/siSTAT3 나노 입자를 6 주령 암컷 C57BL/6 마우스 (20 pmole mOVA + 20 pmole siSTAT3 혼합물 또는 20 pmole mOVA-siSTAT3/siSTAT3)에 근육 내 주사하였다. 주사 1 주 후, 비장 세포를 분리하고 항체 혼합물 (PerCP / Cyanine5.5-anti-mouse CD8a, FITC-anti-mouse CD44 및 APCanti-mouse CD45 (BioLegend, USA))과 조합된 SIINFEKL (OVA의MHC I 펩타이드 에피토프) 사량체로 염색하였다.
염색된 세포는 NovoCyte Flow Cytometer (ACEA)를 사용하여 검증되었으며, Flowjo 소프트웨어는 데이터 분석에 사용되었다.
상기 결과를 도 15 및 도 16에 나타내었다.
비장 세포 중 CD45, SIINFEKL 및 CD8a의 삼중 양성 세포 집단은 OVA- 특이 적 세포 독성 T 세포를 나타냈다. 도 15에 나타낸 바와 같이, mOVA-siSTAT3/siSTAT3 처리된 수지상 세포에서 수확된 비장 세포의 13.9 %가 삼중 양성 세포 집단으로 분석되었다.
또한, 도 16은 mOVA-siSTAT3/siSTAT3를 처리한 마우스의 비장 세포에서 더 높은 OVA 특이 세포 독성 T 세포 집단이 관찰되었음을 보여준다. 향상된 수지상 세포 성숙은 향상된 세포 독성 T 세포 면역을 가진 mRNA로 달성될 수 있는 것으로 확인되었다.
이러한 결과는 Ovalbumine 항원에 대한 CD8+ T 세포 유도 효과에서 본 발명에 따른 핵산 구조체의 우수한 효과를 나타낸다.
실험예 6. 총 IgG 분석
상기 실험예 5의 마우스 세트를 이용하여 총 IgG 함량의 분석을 수행하였다. 혈청 샘플은 주입 후 1 주에 수집되었다. Nunc Maxisorp 면역 플레이트를 밤새 배양하여 10 ug/ml의 ovalbumin (invivogen)으로 코팅하였다. ovalbumin 코팅된 플레이트를 희석된 혈청 (1 % 소 혈청 알부민 (BSA)에서 1 : 200)과 함께 37 ℃에서 2 시간 동안 배양한 다음 세척 완충액 (0.05 % Tween-20이 포함된 PBS)으로 세척하였다. 세척된 플레이트를 2 차 항체 (Mouse IgG 중쇄 및 경쇄 항체 (Bethyl Laboratories, USA))와 함께 1 시간 동안 배양한 후 세척 버퍼로 세척한 후 마지막으로 플레이트를 TMB 기질 용액 (Thermo Scientific)으로 처리하고 정지 용액 (Thermo Scientific)을 사용하여 반응을 정지시킨 후, 450 nm에서의 흡광도를 microplate multi-reader로 축정하였다.
그 결과를 도 17에 나타내었다.
도 17에서 확인할 수 있는 바와 같이, OVA-특이적 IgG 발현 향상이 유도된 것을 확인하였다.
실험예 7. 종양 크기 감소 확인
상기 실험예 5의 마우스 세트를 이용하여 종양 억제 효과를 확인하였다. 약물 주입 1 주 후 오발부민 (3107E.G.7-OVA 세포)을 발현하는 종양 세포로 챌린지하였다. 종양 챌린지 후, 디지털 캘리퍼를 사용하여 종양 크기를 측정하고 종양의 부피를 eq. V = 0.5 W 2 L (V; 종양 부피, W; 종양 폭, L; 종양 길이)로 계산하였다.
상기 결과를 도 18에 나타내었다.
도 18에서 확인할 수 있는 바와 같이, siSTAT3/siSTAT3(mOVA-T6-STAT3i)는 단순 mixture와 대비하여 현저히 우수한 종양 억제 효과를 나타내었다.
상기와 같은 실험들을 통해, 본 발명에 따른 mRNA-siRNA 핵산 구조체는 mRNA와 siRNA가 동시에 세포에 도입되어, mRNA는 발현하고자 하는 단백질을 정상적으로 발현하고, siRNA는 특정 유전자의 발현을 특이적으로 억제할 수 있음을 확인하였다. 상기 결과를 통해, 본 발명에 따른 핵산 구조체는 항원 제시 세포에 타겟 단백질을 발현시켜 면역체계를 활성화시킴과 동시에, 면역관문 단백질의 활성화를 차단하여 면역회피 방해를 극복할 수 있어, 면역치료 분야, 특히 항암면역치료 분야에서 매우 유용하게 사용될 수 있음을 확인하였다.

Claims (23)

  1. mRNA 및 siRNA를 포함하는 핵산 구조체로,
    (i) 3' 말단에 5' 방향에서 3' 방향으로 순차적으로 위치하는 폴리(A) 테일(poly(A) tail); 및 제1 siRNA 센스 또는 안티센스 서열을 포함하는 mRNA; 및
    (ii) 상기 제1 siRNA 서열에 상보적으로 결합하는 혼성화 서열을 포함하는 핵산 구조체.
  2. 제1항에 있어서, 상기 혼성화 서열은 제1 siRNA 서열에 상보적으로 결합하는 제2 siRNA 안티센스 또는 센스 서열; 또는 제1 siRNA 서열에 상보적으로 결합하는 DNA 안티센스 또는 센스 서열인 것을 특징으로 하는, 핵산 구조체.
  3. 제1항에 있어서, 상기 혼성화 서열은 3' 말단에 상기 mRNA의 폴리(A) 테일과 상보적으로 결합하는 폴리(T) 테일(poly(T) tail)을 더 포함하는 것을 특징으로 하는, 핵산 구조체.
  4. 제3항에 있어서, 상기 폴리(T) 테일은 2 내지 6 nt 길이인 것을 특징으로 하는, 핵산 구조체.
  5. 제1항에 있어서, 상기 핵산 구조체는 상기 mRNA가 코딩하는 타겟 단백질의 발현 및 표적 유전자의 발현 억제를 동시에 유발하는 것을 특징으로 하는, 핵산 구조체.
  6. 제1항에 있어서, 제1 siRNA 센스 또는 안티센스 서열의 3' 말단에 추가의 siRNA 센스 또는 안티센스 서열을 위한 제1 링커 서열을 더 포함하는 것을 특징으로 하는, 핵산 구조체.
  7. 제6항에 있어서, 상기 제1 링커 서열은 폴리(U) 테일(poly(U) tail)인 것을 특징으로 하는, 핵산 구조체.
  8. 제6항에 있어서, 상기 제1 링커 서열의 3' 말단에 추가의 siRNA 센스 또는 안티센스 서열을 더 포함하는 것을 특징으로 하는, 핵산 구조체.
  9. 제8항에 있어서, 혼성화 서열; 및 제2 링커 서열을 더 포함하는 것을 특징으로 하는 핵산 구조체로서,
    상기 혼성화 서열은 상기 제1 링커 서열; 및 추가의 siRNA 센스 또는 안티센스 서열에 상보적으로 결합하는 것을 특징으로 하는, 핵산 구조체.
  10. 제9항에 있어서, 상기 혼성화 서열은 추가의 siRNA 서열에 상보적으로 결합하는 제2 siRNA 안티센스 또는 센스 서열; 또는 추가의 siRNA 서열에 상보적으로 결합하는 DNA 안티센스 또는 센스 서열인 것을 특징으로 하는, 핵산 구조체.
  11. 제9항에 있어서, 상기 제2 링커 서열은 제1 링커 서열과 상보적으로 결합하는 폴리(A) 테일(poly(A) tail)인 것을 특징으로 하는, 핵산 구조체.
  12. 제1항에 있어서, 상기 핵산 구조체는 제1 siRNA 센스 또는 안티센스 서열의 3' 말단에 다음 (a) 및 (b)를 포함하는 반복단위를 복수 개 더 포함하는 것을 특징으로 하는, 핵산 구조체:
    (a) 추가의 siRNA 센스 또는 안티센스 서열을 위한 제1 링커 서열; 및 추가의 siRNA 센스 또는 안티센스 서열; 및
    (b) 혼성화 서열; 및 제2 링커 서열로서, 상기 혼성화 서열은 상기 제1 링커 서열; 및 추가의 siRNA 센스 또는 안티센스 서열에 상보적으로 결합하는 것임.
  13. 제1항의 핵산 구조체 및 핵산 전달체를 포함하는 조성물.
  14. 제13항에 있어서, 상기 핵산 전달체는 나노입자인 것을 특징으로 하는, 조성물.
  15. 제1항의 핵산 구조체를 포함하는 면역치료용 약학적 조성물.
  16. 제15항에 있어서, 상기 면역치료는 암 면역치료인 것을 특징으로 하는, 약학적 조성물.
  17. 제15항에 있어서, 상기 암은 뇌종양, 양성성상세포종, 악성성상세포종, 뇌하수체 선종, 뇌수막종, 뇌림프종, 핍지교종, 두개내인종, 상의세포종, 뇌간종양, 두경부 종양, 후두암, 구인두암, 비강/부비동암, 비인두암, 침샘암, 하인두암, 갑상선암, 흉부종양, 소세포성 폐암, 비소세포성 폐암, 흉선암, 종격동 종양, 식도암, 유방암, 남성유방암, 복부종양, 위암, 간암, 담낭암, 담도암, 췌장암, 소장암, 대장암, 항문암, 방광암, 신장암, 남성생식기종양, 음경암, 요도암, 전립선암, 여성생식기종양, 자궁경부암, 자궁내막암, 난소암, 자궁육종, 질암, 여성외부생식기암, 여성요도암, 피부암, 골수종, 백혈병 및 악성림프종으로 이루어진 군으로부터 선택된 1종 이상인 것을 특징으로 하는, 약학적 조성물.
  18. 제1항의 핵산 구조체를 포함하는 암 백신.
  19. 제18항에 있어서, 상기 암 백신은 수지상세포를 더 포함하는 것을 특징으로 하는, 암 백신.
  20. 1) 3' 말단에 5' 방향에서 3' 방향으로 순차적으로 위치하는 폴리(T) 테일(poly(T) tail) 및 siRNA 안티센스 또는 센스 서열이 도입된 DNA 주형을 제조하는 단계;
    2) DNA 주형에 RNA 중합효소를 포함하는 반응용액을 처리하여 3' 말단에 siRNA 서열을 포함하는 mRNA를 얻는 단계; 및
    3) 3' 말단에 Oligo(dT)가 연결된 siRNA를 상기 mRNA 산물에 어닐링하는 단계; 를 포함하는 mRNA 및 siRNA를 포함하는 핵산 구조체의 제조방법.
  21. 면역 치료에 사용하기 위한 제1항의 핵산 구조체를 포함하는 약학적 조성물.
  22. 면역 치료를 위한 약제의 제조에 있어 제1항의 핵산 구조체의 용도.
  23. 제1항의 핵산 구조체를 이를 필요로 하는 개체에 투여하는 단계를 포함하는 면역 치료방법.
PCT/KR2020/018484 2020-12-16 2020-12-16 유전자 발현 및 억제가 동시에 가능한 핵산 구조체 WO2022131398A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
PCT/KR2020/018484 WO2022131398A1 (ko) 2020-12-16 2020-12-16 유전자 발현 및 억제가 동시에 가능한 핵산 구조체
JP2023537237A JP2023554111A (ja) 2020-12-16 2020-12-16 遺伝子発現および抑制が同時に可能な核酸構造体

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2020/018484 WO2022131398A1 (ko) 2020-12-16 2020-12-16 유전자 발현 및 억제가 동시에 가능한 핵산 구조체

Publications (1)

Publication Number Publication Date
WO2022131398A1 true WO2022131398A1 (ko) 2022-06-23

Family

ID=82057679

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/018484 WO2022131398A1 (ko) 2020-12-16 2020-12-16 유전자 발현 및 억제가 동시에 가능한 핵산 구조체

Country Status (2)

Country Link
JP (1) JP2023554111A (ko)
WO (1) WO2022131398A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117883410A (zh) * 2024-01-22 2024-04-16 华中科技大学同济医学院附属协和医院 包封有mRNA及Acod1基因si-RNA的脂质体纳米颗粒及其应用

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100870314B1 (ko) * 2008-02-19 2008-11-25 고려대학교 산학협력단 암 치료용 핵산 의약 조성물
KR20110079529A (ko) * 2009-12-31 2011-07-07 주식회사 삼양사 ｃ-Ｍｅｔ의 발현을 저해하는 ｓｉＲＮＡ 및 이를 포함하는 항암 조성물
KR20150080232A (ko) * 2013-12-31 2015-07-09 연세대학교 산학협력단 간세포 특이적 핵산 전달 및 자기공명영상용 자성 나노벡터
WO2017039313A1 (ko) * 2015-09-01 2017-03-09 한양대학교 산학협력단 ＩＬ-12 및 ｓｈＶＥＧＦ 동시발현 아데노바이러스를 포함하는 항종양 면역성 증진 조성물
KR102224580B1 (ko) * 2019-10-04 2021-03-08 이화여자대학교 산학협력단 유전자 발현 및 억제가 동시에 가능한 핵산 구조체

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100870314B1 (ko) * 2008-02-19 2008-11-25 고려대학교 산학협력단 암 치료용 핵산 의약 조성물
KR20110079529A (ko) * 2009-12-31 2011-07-07 주식회사 삼양사 ｃ-Ｍｅｔ의 발현을 저해하는 ｓｉＲＮＡ 및 이를 포함하는 항암 조성물
KR20150080232A (ko) * 2013-12-31 2015-07-09 연세대학교 산학협력단 간세포 특이적 핵산 전달 및 자기공명영상용 자성 나노벡터
WO2017039313A1 (ko) * 2015-09-01 2017-03-09 한양대학교 산학협력단 ＩＬ-12 및 ｓｈＶＥＧＦ 동시발현 아데노바이러스를 포함하는 항종양 면역성 증진 조성물
KR102224580B1 (ko) * 2019-10-04 2021-03-08 이화여자대학교 산학협력단 유전자 발현 및 억제가 동시에 가능한 핵산 구조체

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LEE KYURI; KIM TAE-SHIN; SEO YUNMI; KIM SOO YOUNG; LEE HYUKJIN: "Combined hybrid structure of siRNA tailed IVT mRNA (ChriST mRNA) for enhancing DC maturation and subsequent anticancer T cell immunity", JOURNAL OF CONTROLLED RELEASE, ELSEVIER, AMSTERDAM, NL, vol. 327, 11 August 2020 (2020-08-11), AMSTERDAM, NL , pages 225 - 234, XP086328272, ISSN: 0168-3659, DOI: 10.1016/j.jconrel.2020.08.009 *
SIMON J ALLISON, JO MILNER: "RNA Interference by Single- and Double-stranded siRNA With a DNA Extension Containing a 3′ Nuclease-resistant Mini-hairpin Structure", MOLECULAR THERAPY-NUCLEIC ACIDS, CELL PRESS, US, vol. 3, 1 January 2014 (2014-01-01), US , pages e141, XP055583865, ISSN: 2162-2531, DOI: 10.1038/mtna.2013.68 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117883410A (zh) * 2024-01-22 2024-04-16 华中科技大学同济医学院附属协和医院 包封有mRNA及Acod1基因si-RNA的脂质体纳米颗粒及其应用

Also Published As

Publication number Publication date
JP2023554111A (ja) 2023-12-26

Similar Documents

Publication Publication Date Title
AU2006242225B2 (en) Human microRNAs and methods for inhibiting same
WO2018030608A1 (ko) Cas9 단백질 및 가이드 RNA의 혼성체를 함유하는 나노 리포좀 전달체 조성물
US20180179526A1 (en) Method and Medicament For Inhibiting The Expression of A Given Gene
WO2010131916A2 (ko) siRNA 접합체 및 그 제조방법
WO2010104237A1 (ko) 에스아이알엔에이 다중 접합체 및 이의 제조방법
WO2013103249A1 (ko) 고효율 나노입자형 이중나선 올리고 rna 구조체 및 그의 제조방법
WO2019050071A1 (ko) 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물
WO2013027988A2 (ko) 트랜스-스플라이싱 라이보자임 및 암치료 유전자를 포함하는 재조합 아데노바이러스 및 이의 용도
WO2022131398A1 (ko) 유전자 발현 및 억제가 동시에 가능한 핵산 구조체
WO2015005669A1 (en) LIVER CANCER RELATED GENES-SPECIFIC siRNA, DOUBLE-STRANDED OLIGO RNA MOLECULES COMPRISING THE siRNA, AND COMPOSITION FOR PREVENTING OR TREATING CANCER COMPRISING THE SAME
WO2021010723A1 (en) Melanophilin antisense oligonucleotides
WO2020149702A1 (ko) Nrl(neural retina leucine zipper)의 발현을 억제하는 비대칭 sirna
US20220243186A1 (en) Fusion protein for natural killer cell specific crispr/cas system and use thereof
EP4352226A1 (en) Peptide nucleic acids for spatiotemporal control of crispr-cas binding
WO2021172925A1 (ko) Apoe4 rna 특이적 트랜스-스플라이싱 리보자임 및 이의 용도
JP3908274B2 (ja) 遺伝子治療用の抗菌ペプチドをコードする治療用遺伝子を有するベクター
WO2022270969A1 (ko) 비천연 5'-비번역 영역 및 3'-비번역 영역 및 그의 용도
CN106999573B (zh) 佐剂组合物
WO2022010241A1 (ko) 질환 세포-특이적인 mirna에 의해 세포 생리 활성 조절 물질의 활성을 조절하는 복합체 및 이를 crispr/cas 시스템에 적용한 질환 특이적 유전자 조작용 복합체
WO2021194179A1 (ko) Stat3 및 mtor를 이중 특이적으로 표적하는 핵산서열을 포함한 항암 바이러스
WO2020013617A1 (ko) 항종양 조성물
WO2020235936A1 (ko) Pd-1의 발현을 억제하는 비대칭 sirna
WO2020139031A1 (ko) Crispr-cas를 기반으로 하는 유전자 교정용 조성물
WO2010095879A2 (ko) 세포사멸 관련 유전자의 전사체에 결합하는 ｓｉＲＮＡ 및 이를 이용한 암 치료용 조성물
WO2023121131A1 (ko) 코로나바이러스 백신

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20966052

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2023537237

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20966052

Country of ref document: EP

Kind code of ref document: A1