WO2018030608A1 - Cas9 단백질 및 가이드 RNA의 혼성체를 함유하는 나노 리포좀 전달체 조성물 - Google Patents

Cas9 단백질 및 가이드 RNA의 혼성체를 함유하는 나노 리포좀 전달체 조성물 Download PDF

Info

Publication number
WO2018030608A1
WO2018030608A1 PCT/KR2017/003805 KR2017003805W WO2018030608A1 WO 2018030608 A1 WO2018030608 A1 WO 2018030608A1 KR 2017003805 W KR2017003805 W KR 2017003805W WO 2018030608 A1 WO2018030608 A1 WO 2018030608A1
Authority
WO
WIPO (PCT)
Prior art keywords
guide rna
composition
seq
nano
cas9 protein
Prior art date
Application number
PCT/KR2017/003805
Other languages
English (en)
French (fr)
Inventor
유경남
Original Assignee
주식회사 무진메디
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 무진메디 filed Critical 주식회사 무진메디
Priority to US15/837,987 priority Critical patent/US10363217B2/en
Publication of WO2018030608A1 publication Critical patent/WO2018030608A1/ko
Priority to US16/438,539 priority patent/US11364201B2/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A61K9/1271—Non-conventional liposomes, e.g. PEGylated liposomes, liposomes coated with polymers
    • A61K9/1272—Non-conventional liposomes, e.g. PEGylated liposomes, liposomes coated with polymers with substantial amounts of non-phosphatidyl, i.e. non-acylglycerophosphate, surfactants as bilayer-forming substances, e.g. cationic lipids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6905—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion
    • A61K47/6911—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion the form being a liposome
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A61K48/0025—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
    • A61K48/0041—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid the non-active part being polymeric
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/88—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/32—Special delivery means, e.g. tissue-specific

Definitions

  • the present invention relates to nanoliposome transporter compositions containing hybrids of Cas9 protein and guide RNA. More specifically, the present invention relates to nanoliposome delivery compositions containing a hybrid of Cas9 protein and guide RNA specific for target DNA.
  • Gene editing technology originates from the adaptive immunity of microorganisms.
  • a fragment of bacteriophage is remembered as DNA for bacteriophage infection and then cut and removed by Cas9 ( C- RISPR as sociated protein 9 : RNA-guided DNA endonuclease enzyme), a nuclease that acts as a genetic scissors when reinfected. Started.
  • Cas9 C- RISPR as sociated protein 9 : RNA-guided DNA endonuclease enzyme
  • gRNA guide RNA
  • Type 2 diabetes is a disease in which insulin secretion remains but insulin resistance is increased due to various causes and normal glucose metabolism is not achieved.
  • GLP-1 Glucagon-like peptide-1
  • DPP4 Dipeptidyl peptidase-4
  • sitagliptin which is known as a DPP4 inhibitor
  • the drug should be taken daily, and the use of type 2 diabetes with renal failure is limited.
  • various side effects have been reported, including allergic reactions caused by drugs (Lenski M et al., 2011).
  • the present inventors prepared a cell delivery agent having high drug delivery efficiency by encapsulating a hybrid of Cas9 protein and guide RNA into a nano liposome containing DOGS-NTA-Ni lipid for treatment of type 2 diabetes through gene editing.
  • the present invention can be completed by using it as a type 2 diabetes medicament.
  • Patent Document 1 Korean Unexamined Patent Publication No. 10-2015-0101476 (Invention name: Composition for cutting target DNA, including nucleic acid or Cas protein encoding guide RNA and Cas protein specific for target DNA and its Use, Applicant: Toulzen Co., Ltd., Publication Date: September 03, 2015)
  • Patent Document 2 Korean Unexamined Patent Publication No. 10-2015-0101477 (Invention name: Composition for cutting target DNA, including nucleic acid or Cas protein encoding guide RNA and Cas protein specific for target DNA and its Use, Applicant: Toulzen Co., Ltd., Publication Date: September 03, 2015)
  • Patent Document 3 Korean Patent Publication No. 10-2015-0101478 (Invention name: Composition for cutting target DNA, including nucleic acid or Cas protein encoding guide RNA and Cas protein specific for target DNA and its Use, Applicant: Toulzen Co., Ltd., Publication Date: September 03, 2015)
  • Non-Patent Document 1 Lenski M et al., Effects of DPP-4 inhibition on cardiac metabolism and function in mice. "J Mol Cell Cardiol, 2011, 51 (6), 906-918.
  • Non-Patent Document 2 Ramakrishna S et al., Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA, Genome Res, 2014, 24 (6), 1020-1027.
  • Non-Patent Document 3 Woo JW et al., DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins, Nat Biotechnol, 2015, 33 (11), 1162-1164.
  • Non-Patent Document 4 Zuris JA et al., Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo, Nat Biotechnol, 2015, 33 (1), 73-80.
  • An object of the present invention is to provide a nano liposome delivery composition containing a hybrid of Cas9 protein and guide RNA. More specifically, the present invention is to provide a nano liposome delivery composition containing a hybrid of Cas9 protein and guide RNA specific for target DNA.
  • the present invention relates to nanoliposome transporter compositions containing hybrids of Cas9 protein and guide RNA. More specifically, the present invention relates to nanoliposome delivery compositions containing a hybrid of Cas9 protein and guide RNA specific for target DNA.
  • a cationic polymer may be bound to a hybrid of the Cas9 protein and guide RNA specific for the target DNA to form a complex.
  • the cationic polymer is preferably poly-L-lysine, polyamidoamine, poly [2- (N, N-dimethylamino) ethyl methacrylate], chitosan, poly-L-ornithine, cyclodextrin, histone
  • One or more selected from, collagen, dextran and polyethyleneimine can be used.
  • the nano liposomes may comprise lecithin, cholesterol and metal chelating lipids.
  • the nano liposomes may have a particle size of 10 ⁇ 2,000 nm.
  • the present invention can provide a composition for improving or treating type 2 diabetes containing the nanoliposomal delivery composition.
  • the nanoliposomal delivery composition may contain 'guide RNA that inhibits the expression of DPP4' as 'guide RNA specific for target DNA'.
  • the guide RNA is characterized in that it has a nucleotide sequence of SEQ ID NO: 1 or 2 as a single-stranded guide RNA.
  • the present invention also provides a method for preparing a nano liposome carrier composition as follows.
  • Cationic polymer may be bonded to the hybrid of the first step to form a complex.
  • the Cas9 protein and the guide RNA may be mixed in a molar ratio of 1: 1 to 3.
  • Lecithin, metal chelating lipids and cholesterol of the first step may be mixed in a molar ratio of 1.5 to 2.5: 0.5 to 1.5: 0.1 to 0.5.
  • the freezing and melting process in the third step may be repeated 3 to 6 times.
  • the present invention relates to a nanoliposome transporter composition in which a hybrid of Cas9 protein and guide RNA specific for target DNA is encapsulated.
  • the Cas9 protein can be obtained from a cell or strain transformed with a pET28a / Cas9-Cys plasmid having the following structure (inserted Cas9-Cys into the pET28a (+) vector).
  • pET28a / Cas9-Cys plasmid can be obtained by transforming Escherichia coli overexpressing Cas9 protein.
  • the guide RNA may inhibit the expression of the target DNA.
  • Guide RNA that can be applied in the present invention is a guide RNA comprising the following SEQ ID NO: 1 or 2, the nano liposome delivery composition comprising the guide RNA of SEQ ID NO: 1 or 2 of DPP4 (Dipeptidyl peptidase-4) It inhibits expression and functions to improve or treat type 2 diabetes.
  • the guide RNA of SEQ ID NO: 1 is derived from a partial DNA nucleotide sequence of human ( Homo sapiens ) DPP4 of SEQ ID NO: 3 below, and targets a partial DNA nucleotide sequence of DPP4 of SEQ ID NO: 5 (SEQ ID NO: 3 And SEQ ID NO: 5 have complementary nucleotide sequences).
  • the guide RNA of SEQ ID NO: 2 is derived from a partial DNA nucleotide sequence of DPP4 of SEQ ID NO: 4 below, and targets a partial DNA nucleotide sequence of DPP4 of SEQ ID NO: 6 below (SEQ ID NO: 4 and SEQ ID NO: 6 Having complementary sequences).
  • SEQ ID NO: 6 AAAAGCTGGCGAAACCGGAC
  • the present invention provides an animal experiment nano liposome on behalf of a person who is difficult to clinical application
  • the animal experiment nano liposomes include the guide RNA of SEQ ID NO: 7 or 8.
  • the animal is preferably a mouse ( Mus musculus ).
  • the guide RNA of SEQ ID NO: 7 is derived from a partial DNA nucleotide sequence of DPP4 of SEQ ID NO: 9 below, and targets a partial DNA nucleotide sequence of DPP4 of SEQ ID NO: 11 (SEQ ID NO: 9 and SEQ ID NO: 11 Having complementary sequences).
  • the guide RNA of SEQ ID NO: 8 is derived from a partial DNA nucleotide sequence of DPP4 of SEQ ID NO: 10 below, and targets a partial DNA nucleotide sequence of DPP4 of SEQ ID NO: 12 (SEQ ID NO: 10 and SEQ ID NO: 12 Having complementary sequences).
  • SEQ ID NO: 12 TTGCTCAGCAGAACTATTGG
  • the guide RNA nucleotide sequence of SEQ ID NO: 1 or 2 and the guide RNA nucleotide sequence of SEQ ID NO: 7 or 8 may be included a scaffold sequence (scaffold sequence) to form a complex with the Cas9 protein.
  • the type of scaffold base sequence is not particularly limited, and any base sequence can be used as long as it is a conventional base sequence used for the production of guide RNA.
  • the guide RNA applied to the nano liposome of the present invention is
  • Nano liposomes can be applied.
  • the DNA sequence of SEQ ID NO: 5 or 6 targeted by the base sequence of the guide RNA of SEQ ID NO: 1 or 2 is present between Exon 1 and Exon 2 of human DPP4 ( Homo sapiens Chromosome 2, Gene bank No. NC_000002.12) It is a nucleotide sequence, the DNA between the Exon1 and Exon2 is cut through the guide RNA of SEQ ID NO: 1 or 2.
  • Guide RNA of SEQ ID NO: 7 is DPP4 ( Mus musculus strain C57BL / 6J Location: Chromosome 2, Gene bank No. NC_000068.7) cuts the DNA of Exon3, and the guide RNA of SEQ ID NO: 8 cuts Exon2 of DPP4 of the mouse.
  • the guide RNA of SEQ ID NO: 1 or 2, SEQ ID NO: 7 or 8 can be synthesized through in vitro transcription using a T7 RNA polymerase.
  • a cationic polymer may be bonded to a hybrid of the Cas9 protein and the guide RNA to form a complex
  • the cationic polymer poly-L-lysine, polyamidoamine, poly [2- (N, N- Dimethylamino) ethyl methacrylate], chitosan, poly-L-ornithine, cyclodextrin, histone, collagen, dextran and polyethyleneimine can be used, and most preferably polyethyleneimine is used. Can be.
  • the nano liposomes may include lecithin ( ⁇ -phosphatidylcholin), cholesterol and metal chelating lipids, through which the lecithin, cholesterol and metal chelating lipids may form a membrane forming nano liposomes.
  • lecithin ⁇ -phosphatidylcholin
  • metal chelating lipids through which the lecithin, cholesterol and metal chelating lipids may form a membrane forming nano liposomes.
  • Lecithin is widely distributed in animal and plant systems, so it has excellent biocompatibility and has already been proven in its stability, and has been widely used in food and pharmaceutical delivery technologies. It can also be used as a material to facilitate the size control and modification of nano liposomes.
  • the metal chelating lipid preferably, one or more selected from the group consisting of DOGS-NTA-Ni lipid, DMPE-DTPA-Gd lipid, and DMPE-DTPA-Cu lipid may be used.
  • the DOGS-NTA-Ni lipid is a lipid having the chemical structure of Formula 1,
  • DMPE-DTPA-Gd lipid is a lipid having the chemical structure of Formula 2,
  • 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid (gadolinium salt).
  • DMPE-DTPA-Cu lipid is a lipid having the chemical structure of Formula 3
  • the DOGS-NTA-Ni lipids are encapsulated into the nano-liposomes (that contained His-Tag) to take advantage of the His-Tag (6X histidin) and Ni 2 + chinyeonseong (affinity) that is used in the protein purification methods Cas9 protein is efficiently ( encapsulation). More specifically His in the DOGS-NTA-Ni may form a lipid (lipid) along with the lecithin with one double bond structures in the 18 carbon, at the end there is Ni 2 + is coupled, attached to Cas9 protein dog 2 dog coupled -tag Ni 2 + 1 to Cas9 causes the protein encapsulated in nanoliposomes more effectively.
  • a Cas9 protein coupled with a guide RNA comprising a nucleotide sequence of SEQ ID NO: 1 and a Cas9 protein coupled with a guide RNA comprising a nucleotide sequence of SEQ ID NO: 2 may be present.
  • Cas9 protein coupled with a guide RNA comprising the nucleotide sequence of SEQ ID NO: 7 and Cas9 protein coupled with a guide RNA comprising the nucleotide sequence of SEQ ID NO: 8 may be present.
  • the nano liposomes may have a particle size of 10 ⁇ 2,000 nm.
  • the size of the nano liposomes is less than 10 nm, hybrids of the Cas9 protein and the guide RNA specific for the target DNA may be difficult to encapsulate in the nano liposomes, and may not be stable when injected into the body.
  • it exceeds 2,000 nm when the composition containing the nano liposomes are injected into the body it is not preferable because the stability can be lowered.
  • Nano liposomes of the present invention can be stably dispersed in neutral water, cell culture, blood and the like for several hours or more.
  • the present invention can provide a composition for improving or treating type 2 diabetes containing the nanoliposomal delivery composition.
  • the nanoliposome delivery composition may contain a guide RNA that suppresses the expression of DPP4 as a guide RNA specific for the target DNA.
  • the DPP4 is a gene related to diabetes, and a drug known as a diabetes therapeutic agent such as sitagliptin is known to have an excellent effect of inhibiting the expression of DPP4.
  • the present invention also provides a method for preparing a nano liposome carrier composition as follows.
  • a first step of preparing a hybrid of Cas9 protein and guide RNA specific for the target DNA and mixing lecithin, metal chelating lipids and cholesterol on chloroform to prepare a lipid film composition A second step of sonicating the lipid film composition with a hybrid of Cas9 protein and guide RNA specific for the target DNA; A third step of freezing and thawing the sonicated lipid film composition and then ultrasonicating again; And a fourth step of centrifuging the lipid film composition sonicated in the third step and recovering the precipitate.
  • Cationic polymer may be bonded to the hybrid of the first step to form a complex.
  • the cationic polymer poly-L-lysine, polyamidoamine, poly [2- (N, N-dimethylamino) ethyl methacrylate], chitosan, poly-L-ornithine, cyclodextrin, histone, collagen, dex One or more selected from tran and polyethyleneimine can be used.
  • the Cas9 protein and the guide RNA may be mixed in a molar ratio of 1: 1 to 3, and when a cationic polymer is added to the hybrid of the Cas9 protein and the guide RNA to form a complex, the Cas9 protein: guide RNA:
  • the cationic polymer may be mixed in a molar ratio of 1: 1 to 3:30 to 70, preferably in a molar ratio of 1: 2: 50.
  • the lecithin, metal chelating lipids and cholesterol of the first step may be mixed in a molar ratio of 1.5 to 2.5: 0.5 to 1.5: 0.1 to 0.5, preferably 1.8 to 2.2: 0.8 to 1.2: 0.2 to 0.4 It may be mixed in a molar ratio of, and most preferably in a molar ratio of 2: 1: 0.3.
  • the process of freezing and thawing in the third step may be repeated 3 to 6 times.
  • the process of freezing and thawing in the third step may be repeated 3 to 6 times.
  • the liposome may not be encapsulated in response to the negative charge ( ⁇ ) of the hybrid of Cas9 and the guide RNA. Therefore, in order to overcome this, encapsulation of the nano liposomes can be enhanced by preparing a complex in which a cationic polymer having a positive charge (+) is bound to a hybrid of Cas9 and guide RNA.
  • the present invention can also provide a pharmaceutical composition containing the nano-liposomal delivery composition, wherein the pharmaceutical composition is oral, such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc. according to conventional methods, respectively. It may be used in the form of a dosage form, an external preparation, a suppository, and a sterile injectable solution.
  • Carriers, excipients and diluents that may be included in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose , Methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • Solid form preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid form preparations include at least one excipient such as starch, calcium carbonate, sucrose or lactose, It is prepared by mixing gelatin.
  • excipients such as starch, calcium carbonate, sucrose or lactose, It is prepared by mixing gelatin.
  • lubricants such as magnesium stearate and talc are also used.
  • Oral liquid preparations include suspensions, solvents, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories.
  • the non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used.
  • As the base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
  • the dosage of the pharmaceutical composition of the present invention will vary depending on the age, sex, weight of the subject to be treated, the specific disease or pathology to be treated, the severity of the disease or pathology, the route of administration and the judgment of the prescriber. Dosage determination based on these factors is within the level of skill in the art and generally dosages range from 0.01 mg / kg / day to approximately 2000 mg / kg / day. More preferred dosage is 1 mg / kg / day to 500 mg / kg / day. Administration may be administered once a day or may be divided several times. The dosage does not limit the scope of the invention in any aspect.
  • the pharmaceutical composition of the present invention can be administered to mammals such as rats, livestock, humans, etc. by various routes. All modes of administration can be expected, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or cerebrovascular injections.
  • the present invention relates to a nano liposome carrier composition containing a hybrid of Cas9 protein and guide RNA, and more particularly, the present invention relates to a nano liposome carrier composition encapsulated with a hybrid of guide RNA specific for Cas9 protein and target DNA.
  • the nano liposome delivery composition has an excellent effect of inhibiting the expression of the target DNA, and can manage blood sugar efficiently for a long time with a single injection even without administering a diabetes treatment daily.
  • the pharmaceutical composition containing the nano liposome carrier composition may be easily used as a pharmaceutical composition that can improve or treat diseases such as diabetes.
  • sgRNAs single-stranded guide RNAs
  • the lower figure is a purified purified Cas9 protein prepared in Example 1 Shows the results confirmed by SDS-PAGE (Sodium dodecyl sulphate polyacrylamide gel electrophoresis).
  • FIG. 2 is a schematic of the nano liposomes of Example 2 of the present invention, the nano liposomes are composed of lecithin, cholesterol (Cholesterol) and metal chelating lipids, hybridization of Cas9 protein and guide RNA (guide RNA) The complex in which the polyethyleneimine (PEI) is bound to the sieve is enclosed.
  • PKI polyethyleneimine
  • Figure 3 shows a bio transmission electron microscope (Bio-TEM) image of the nano liposome of Example 2 of the present invention.
  • FIG. 4 is a graph showing the encapsulation efficiency of the nano liposomes prepared in the present invention (top) and Western blot results (bottom) showing the Cas9 protein content remaining in the filtrate (supernatant) remaining after preparing the nano liposomes.
  • Figure 5 shows the stability of the surface charge change (zeta potential, mV) and size and dispersion of the nano liposomes prepared in the present invention (surface charge- Figure 5A, size- Figure 5B, dispersion- Figure 5C).
  • FIG. 6 is a diagram showing the mutation of 18 nucleotide sequences of DPP4 gene in human liver cancer cells compared to wild gene (WT) of DPP4 through the use of nanoliposomes of the present invention.
  • Example 7 is a confocal fluorescence micrograph confirming that the nanoliposome of Example 2 labeled with RTC (rhodamine B isothiocyanate) is well-influxed into human liver cancer cells by fluorescence immunoassay using RITC and Cas9 antibodies.
  • RTC rhodamine B isothiocyanate
  • Figure 8 shows the change in the expression of the target gene DPP4 by treating the nano-liposomes prepared in the present invention in human liver cancer cells (Fig. 8a-DPP4 mRNA expression, Figure 8b-DPP4 protein expression, Figure 8c-DPP4 activity confirmation ).
  • Figure 9 shows the results of confirming the cell survival / proliferation when treated with human liposomes prepared in the present invention in human liver cancer cells by WST-1 assay.
  • FIG. 10 is a schematic of a timetable of the nanoliposome prepared in Example 2 of the present invention applied to an animal model of type 2 diabetes.
  • FIG. 11 shows the results of confirming the change of mRNA and protein expression of the target gene (DPP4) in liver tissue by applying the nano-liposomes prepared in Example 2 of the present invention to type 2 diabetic animal model .
  • Figure 12 shows the results of confirming the expression of the target gene (DPP4) in liver tissue by applying the nano-liposomes prepared in Example 2 of the present invention to a type 2 diabetic animal model and immunostaining.
  • Figure 13 shows the change in body weight and blood glucose of the experimental animals after applying the nano-liposomes prepared in Example 2 of the present invention in the type 2 diabetic animal model.
  • Figure 14 shows the results of confirming the expression of insulin in pancreatic cells by applying the nano-liposomes prepared in Example 2 of the present invention to a type 2 diabetic animal model and immunostaining.
  • Example 1-1 DPP4 Guide RNA production as target gene
  • RNAs using DPP4 as a target gene were prepared by in vitro transcription using T7 RNA polymerase (NEB).
  • T7 RNA polymerase T7 RNA polymerase
  • the T7 promoter sequence of Table 1 and the 20 bp sequence of DPP4 (human or mouse) SEQ ID NO: 3 TTTGGGCCATTTGGGGAGTT, SEQ ID NO: 4: GTCCGGTTTCGCCAGCTTTT, SEQ ID NO: TCAAGTCCTACTCTTTGTGG, SEQ ID NO: 10: CCAATAGTTCTGCTGAGCAA
  • Fourty four 69 mer forward primers, one '20 mer reverse primer 'containing a scaffold sequence to be linked to the guide RNA, and a plasmid Cas guide vector (origene) were used to generate a 140 bp DNA template by PCR.
  • a plasmid Cas guide vector origene
  • T7 promoter sequence corresponds to the underlined portion of Table 1 below.
  • the bold nucleotide sequence of Table 1 is a site for recognizing the DPP4 gene, and guide RNA is synthesized by recognizing the template of the scaffold nucleotide (plasmid Cas guide vector), the sequence of the finally prepared guide RNA and this nucleotide sequence It has this same (substituted by U instead of T) nucleotide sequence.
  • the plasmid Cas guide vector contains the template of the scaffold sequence.
  • sgRNA single stranded guide RNA
  • the final prepared guide RNA recognizes AACTCCCCAAATGGCCCAAA (SEQ ID NO: 5) or AAAAGCTGGCGAAACCGGAC (SEQ ID NO: 6) of the human DPP4 gene, and recognizes CCACAAAGAGTAGGACTTGA (SEQ ID NO: 11) or TTGCTCAGCAGAACTATTGG (SEQ ID NO: 12) of the DPP4 gene of the mouse. Recognition as a target serves to inhibit the expression of each DPP4 gene.
  • pET28a / Cas9-Cys plasmid (Addgene plasmid # 53261) was transformed into Escherichia coli (DH5 ⁇ ) to overexpress Cas9 protein under 0.5 mM IPTG (isopropyl ⁇ -D-1-thiogalactopyranoside) and 28 ° C, and overexpress Cas9 protein.
  • E. coli was sonicated with lysis buffer (20 mM Tris-Cl at pH 8.0, 300 mM NaCl, 20 mM imidazole, 1 ⁇ protease inhibitor cocktail, 1 mg / mL lysozyme). The pulverized product obtained by sonication was centrifuged to obtain a liquid phase containing protein.
  • Cas9 protein in the liquid phase was isolated by Ni-NTA agarose bead extraction (elution buffer: 20 mM Tris-Cl at pH 8.0, 300 mM NaCl, 300 mM imidazole, 1 ⁇ protease inhibitor cocktail). The isolate was then dialyzed (cut off 10K) in a mixed buffer in a storage buffer (50 mM Tris-HCl at pH 8.0, 200 mM KCl, 0.1 mM EDTA, 1 mM DTT, 0.5 mM PMSF, 20% glycerol). After removing the protein concentration was quantified (using BCA method). At this time, the Cas9 protein obtained by dialysis was confirmed by SDS-PAGE in a concentration-dependent manner to confirm that the Cas9 protein was well generated (see the lower photo of FIG. 1).
  • the complex was prepared by mixing the Cas9 protein, guide RNA and polyethyleneimine prepared in Example 1 in a 1: 2: 50 mole ratio.
  • the guide RNA SEQ ID NOs: 13 to 16 including a scaffold base sequence were used.
  • lecithin Scima Aldrich
  • DOGS-NTA-Ni lipid Avanti polar lipids
  • cholesterol Cholesterol, Sigma Aldrich
  • the process of freezing and thawing (freeze thaw cycle) five times using liquid nitrogen was repeated five times, followed by ultrasonication (probe method) to produce nano liposomes of smaller size and uniform state. Then, only the precipitated by centrifugation method was recovered to obtain a nano liposome of the present invention, was mixed in a progress buffer (cell culture medium or PBS [Phosphate Buffered Saline]) was used in the next experiment.
  • the cell treatment group of the nano liposomes prepared in this manner was labeled NL (Ni) -Cas9 / gDPP4 (PEI), and the animal treatment group was labeled db / db (Cas9 / gDPP4).
  • the schematic diagram of the nano liposomes is shown in FIG. 2, and an image of the nano liposomes taken with Bio-TEM is shown in FIG. 3.
  • the nano liposome of Figure 3 includes a guide RNA of SEQ ID NO: 2, nano liposomes including the guide RNA of SEQ ID NO: 1, SEQ ID NO: 7 and SEQ ID NO: 8, or nano liposomes including SEQ ID NO: 1 and 2, Nanoliposomes comprising SEQ ID NOS: 7 and 8 together were found to have similar stable images.
  • Nanoliposomes were prepared by mixing only lecithin and cholesterol by the method described in Example 2, except for DOGS-NTA-Ni lipids. In addition, the process of encapsulating the complex of Cas9 protein / guide RNA / polyethylenimine into nano liposomes was excluded, and the nano liposomes were labeled as NL upon cell treatment.
  • Nano liposomes were prepared from lecithin, cholesterol, and DOGS-NTA-Ni lipids by the method described in Example 2, except that a complex of Cas9 protein / guide RNA / polyethylenimine was added. Ni).
  • nano liposomes Except for DOGS-NTA-Ni lipid as in Comparative Example 1, only the lecithin and cholesterol were prepared to prepare nano liposomes, followed by the procedure of Example 2, but instead of the complex of Cas9 protein / guide RNA / polyethylenimine Cas9 protein Hybrids of / guide RNA were allowed to be enclosed in nano liposomes. These nano liposomes were labeled as NL-Cas9 / gDPP4 upon cell treatment.
  • Nano liposomes were prepared as in Example 2, but a hybrid of Cas9 protein / guide RNA was encapsulated in nano liposomes instead of the complex of Cas9 protein / guide RNA / polyethylenimine. These nano liposomes were labeled as NL (Ni) -Cas9 / gDPP4 upon cell treatment.
  • the total amount of Cas9 protein added at the start of the synthesis of the nano liposomes and the amount of Cas9 protein remaining in the filtrate after the synthesis of the nano liposomes were measured by Western blot experiments to confirm the encapsulation efficiency of the nano liposomes.
  • Western blot experiments were conducted with only Cas9 protein. Encapsulation efficiency of the nano liposomes is easily confirmed by comparing the content of the Cas9 protein remaining in the filtrate remaining after the preparation of the nano liposomes.
  • the nano liposomes of Example 2 belong to the lower surface charge value.
  • the nano liposome condition of Comparative Example 3 also has a low surface charge, but it is confirmed that the stability of the nano liposomes is poor due to the low dispersion.
  • the particle size of the nano liposomes also confirmed that the nano liposomes of Example 2 were manufactured to a constant size, it can be seen that the nano liposomes of Comparative Example 3 were not uniform in size (check two peaks).
  • FIG. 5 it was confirmed that the nanoliposomes of Example 2 were better in terms of size and dispersion than the nanoliposomes of Comparative Example 4.
  • Each nano liposome (for human target) prepared in the present invention was treated with human liver cancer cells (SNU398) at a concentration of Cas9: gRNA (74 ⁇ g: 28 ⁇ g) for 24 hours, and then DNA was extracted from the collected cells, followed by Foward primer. : GTGAGTGCCGCGCCACGTACG, Reverse primer: Template fragments were prepared by PCR using CTGCAAGCCGAGCAGATCAAG. Next, after inserting the template fragment into the T-blunt vector using a T-blunt PCR cloning kit (solgent), the sequence of the template fragment was analyzed by requesting a sequencing service from Bioneer. The result was almost no difference according to the type of guide RNA, represented by the representation of the DNA mutated in Figure 6 on behalf of that containing the guide RNA of SEQ ID NO: 2.
  • the guide RNA recognizes 20 nucleotide sequences, the Cas9 protein is cut by the PAM (protospacer adjacent motif) (TGG sequence) site, the cut DNA repairs itself ( During the repair process, 18 DNA sequences were cut out.
  • PAM protospacer adjacent motif
  • RITC rhodamine B isothiocyanate
  • SNU398 human liver cancer cells
  • RITC dyes were mixed and encapsulated together in the Cas9 protein when preparing the nanoliposomes.
  • the Cas9 protein (Rabbit) of CFL-488 was labeled with intracellular Cas9 protein and imaged by confocal fluorescence microscopy. The result was almost no difference according to the type of guide RNA, it is shown in Figure 7 representing a guide RNA of SEQ ID NO: 2 is included.
  • Each human liposome prepared in the present invention was treated with human liver cancer cells (SNU398) at a concentration of Cas9: gRNA (74 ⁇ g: 28 ⁇ g) for 24 hours, and then collected using Trizol (invitrogen). Total RNA was extracted and cDNA was synthesized using SuprimeScript RT premix 2x (GeNetBio).
  • DPP4 sense TCCCAACTCCAGAGGACAAC
  • DPP4 antisense CAGGGCTTTGGAGATCTGAG
  • GAPDH sense GCACCGTCAAGGCTGAGAA
  • GAPDH antisense AGGGATCTCGCTCCTGGAA
  • FIGS. 8A and 8B the top of FIG. 8B is a protein electrophoresis graph, the bottom of FIG. 8B is a quantified graph), it is confirmed that the nanoliposomes of Example 2 effectively limit mRNA and protein expression of DPP4.
  • DPP4 activity is based on the DPP4 assay kit (Abnova).
  • a substrate solution H-Gly-Pro-AMC
  • SNU398 the cell
  • sodium acetate solution (1M, pH 5.0) was added to stop the reaction, and the activity was measured by measuring the fluorescence value at excitation 360 nm and emission 460 nm.
  • nano liposomes of Example 2 200 ⁇ l, solvent PBS (for animal targets) were administered once by intravenous injection into db / db mice at a concentration of 1.48 ⁇ g: 0.56 ⁇ g of Cas9: gRNA.
  • the nano liposomes used at this time were those containing both SEQ ID NO: 7 and SEQ ID NO: 8.
  • the DPP4 inhibitor (sitagliptin) was orally administered until the end of the experiment at a concentration of 10 mg / day, and PBS was administered to the control group of the disease model and normal mice (non-disease model-C57BL / 6) ( db / db (PBS) and Normal (PBS)) (sitagliptin administration group is db / db (sitagliptin)).
  • the in vivo experiment execution time is shown in FIG.
  • the body weight and blood glucose of the animals were checked every three days.
  • the organs (liver, pancreas) of the animals were extracted and immunostained to confirm the expression of the target gene.
  • mRNA and protein expression amount of DPP4 was measured in the same manner as the cell experiment, but primers for mRNA analysis were used consisting of the following base sequence.
  • DPP4 sense TCCCAACTCCAGAGGACAAC
  • DPP4 antisense CAGGGCTTTGGAGATCTGAG
  • GAPDH sense GCACCGTCAAGGCTGAGAA
  • GAPDH antisense AGGGATCTCGCTCCTGGAA

Abstract

본 발명은 Cas9 단백질 및 가이드 RNA의 혼성체를 함유하는 나노 리포좀 전달체 조성물에 관한 것으로서, 보다 자세하게는 본 발명은 Cas9 단백질 및 표적 DNA에 특이적인 가이드 RNA의 혼성체가 봉입된 나노 리포좀 전달체 조성물에 관한 것이다. 상기 나노 리포좀 전달체 조성물은 표적 DNA의 발현을 억제하는 효과가 우수하여, 상기 나노 리포좀 전달체 조성물이 포함된 약학 조성물은 당뇨병과 같은 질병을 개선 또는 치료할 수 있는 약학조성물로서 용이하게 이용될 수 있다.

Description

Cas9 단백질 및 가이드 RNA의 혼성체를 함유하는 나노 리포좀 전달체 조성물
본 발명은 Cas9 단백질 및 가이드 RNA의 혼성체를 함유하는 나노 리포좀 전달체 조성물에 관한 것이다. 보다 자세하게는 본 발명은 Cas9 단백질 및 표적 DNA에 특이적인 가이드 RNA의 혼성체가 봉입된 나노 리포좀 전달체 조성물에 관한 것이다.
유전자 편집 기술은 미생물의 적응면역에서 비롯된 기술이다. 박테리오파지 감염에 박테리오파지의 단편을 DNA로 기억하고 있다가 재감염 되었을 때 유전자 가위 역할을 하는 누클레아제(nuclease)인 Cas9(CRISPR associated protein 9 : RNA-guided DNA endonuclease enzyme)으로 잘라 없애는 면역 시스템에서 시작되었다. 이는 유전체에서도 특정 염기 서열을 가이드 RNA(guide RNA, gRNA)에 의해서 인식 가능하면 원하는 부위를 잘라 고칠 수 있는 유전자 교정 기술로 발전하였다(Woo JW et al., 2015).
이는 불치병으로 분리되었던 유전자 이상으로 유도된 질환에서 질병의 근본원인을 치료할 수 있는 방법으로 각광받고 있다. 하지만 유전자 편집 시스템의 효율적인 체내 전달과 목표 유전자가 아닌 다른 유전자를 자르는 off targeting 등의 해결해야 하는 문제점들을 가지고 있다. 특히 초기 방식인 Cas9 플라스미드를 사용한 유전자 편집 시스템은 체내 전달시의 항생제 저항성, 여러 면역 반응 등의 안전성에 대한 검증이 필요하였다. 최근에는 단백질로 이뤄진 유전자 가위(Cas9)와 가이드 RNA를 실험관내에서 만들어 전달하는 시스템이 그 대안으로 적용되고 있으나 이 또한 세포내 효율적인 전달과 단백질과 RNA의 안정성에 대한 문제가 제기되고 있다(Ramakrishna S et al., 2014).
제2형 당뇨병은 인슐린 분비 기능은 남아있지만 여러 가지 원인에 의해 상대적으로 인슐린 저항성이 증가하여 정상적인 당대사가 이루어지지 않는 질환이다. 특히 인슐린 저항성에 관여하는 GLP-1(Glucagon-like peptide-1)은 췌장에서 인슐린 분비를 조절한다. 제2형 당뇨병의 경우 GLP-1을 분해시키는 것으로 알려진 DPP4(Dipeptidyl peptidase-4)의 발현이 증가되고 이로 인하여 인슐린 저항성이 증가되는 것으로 알려져 있다. 실제로도 제2형 당뇨병의 경우 DPP4 억제제로 알려진 시타글립틴(sitagliptin) 등이 치료약으로 사용되고 있다. 이런 DPP4 억제제를 제형으로 쓰는 경우는 효과가 일시적이므로 날마다 약을 섭취해야 하며 신장장애를 동반하는 2형 당뇨의 경우는 그 사용이 제한적이다. 또한 약으로 인한 알레르기 반응을 포함한 각종 부작용도 보고되어 있다(Lenski M et al., 2011).
한편 세포 내 약물 전달 시스템에서 요구되는 중요 두가지 성질은 효율성과 세포 독성(안전성)으로서, 콜레스테롤이나 지질 등으로 구성된 나노 리포좀 전달체 기술이 폭넓게 사용되고 있다(Zuris JA et al., 2015).
이에 본 발명자들은 유전자 편집을 통한 제2형 당뇨 치료를 위해 Cas9 단백질 및 가이드 RNA의 혼성체를 DOGS-NTA-Ni 지질을 포함하는 나노 리포좀에 봉입함으로써 약물전달 효율이 좋은 세포 전달체를 제조하고, 이를 제2형 당뇨병 체료제로서 이용함으로써 본 발명을 완성할 수 있었다.
[선행기술문헌]
[특허문헌]
(특허문헌 1) 대한민국 공개특허 제10-2015-0101476호 (발명의 명칭 : 표적 DNA에 특이적인 가이드 RNA 및 Cas 단백질을 암호화하는 핵산 또는 Cas 단백질을 포함하는, 표적 DNA를 절단하기 위한 조성물 및 이의 용도, 출원인 : 주식회사 툴젠, 공개일 : 2015년09월03일)
(특허문헌 2) 대한민국 공개특허 제10-2015-0101477호 (발명의 명칭 : 표적 DNA에 특이적인 가이드 RNA 및 Cas 단백질을 암호화하는 핵산 또는 Cas 단백질을 포함하는, 표적 DNA를 절단하기 위한 조성물 및 이의 용도, 출원인 : 주식회사 툴젠, 공개일 : 2015년09월03일)
(특허문헌 3) 대한민국 공개특허 제10-2015-0101478호 (발명의 명칭 : 표적 DNA에 특이적인 가이드 RNA 및 Cas 단백질을 암호화하는 핵산 또는 Cas 단백질을 포함하는, 표적 DNA를 절단하기 위한 조성물 및 이의 용도, 출원인 : 주식회사 툴젠, 공개일 : 2015년09월03일)
[비특허문헌]
(비특허문헌 1) Lenski M et al., Effects of DPP-4 inhibition on cardiac metabolism and function in mice." J Mol Cell Cardiol, 2011, 51(6), 906-918.
(비특허문헌 2)Ramakrishna S et al., Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA, Genome Res, 2014, 24(6), 1020-1027.
(비특허문헌 3)Woo JW et al., DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins, Nat Biotechnol, 2015, 33(11), 1162-1164.
(비특허문헌 4) Zuris JA et al., Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo, Nat Biotechnol, 2015, 33(1), 73-80.
본 발명의 목적은 Cas9 단백질 및 가이드 RNA의 혼성체를 함유하는 나노 리포좀 전달체 조성물을 제공하는 데에 있다. 보다 자세하게는 본 발명은 Cas9 단백질 및 표적 DNA에 특이적인 가이드 RNA의 혼성체가 봉입된 나노 리포좀 전달체 조성물을 제공하는 데에 있다.
본 발명은 Cas9 단백질 및 가이드 RNA의 혼성체를 함유하는 나노 리포좀 전달체 조성물에 관한 것이다. 보다 자세하게는 본 발명은 Cas9 단백질 및 표적 DNA에 특이적인 가이드 RNA의 혼성체가 봉입된 나노 리포좀 전달체 조성물에 관한 것이다.
상기 Cas9 단백질 및 표적 DNA에 특이적인 가이드 RNA의 혼성체에 양이온성 폴리머가 결합되어 복합체를 형성할 수 있다. 상기 양이온성 폴리머로는 바람직하게는 폴리-L-리신, 폴리아미도아민, 폴리[2-(N,N-디메틸아미노)에틸 메타아크릴레이트], 키토산, 폴리-L-오르니틴, 시클로덱스트린, 히스톤, 콜라겐, 덱스트란 및 폴리에틸렌이민으로 선택되는 것 1종 이상이 사용될 수 있다.
상기 나노 리포좀은 레시틴, 콜레스테롤 및 메탈 킬레이팅 지질을 포함할 수 있다.
상기 나노 리포좀은 10 ~ 2,000 nm의 입자크기를 가질 수 있다.
본 발명은 상기 나노 리포좀 전달체 조성물을 함유하는 제2형 당뇨병의 개선 또는 치료용 조성물을 제공할 수 있다.
상기 제2형 당뇨병의 개선 또는 치료용 조성물에 있어서, 상기 나노 리포좀 전달체 조성물은, '표적 DNA에 특이적인 가이드 RNA'로서 'DPP4의 발현을 억제하는 가이드 RNA'를 함유할 수 있다. 상기 가이드 RNA는 단일가닥 가이드 RNA로서 하기의 서열번호 1 또는 2의 염기서열을 갖는 것을 특징으로 한다.
서열번호 1 : UUUGGGCCAUUUGGGGAGUU
서열번호 2 : GUCCGGUUUCGCCAGCUUUU
본 발명은 또한 하기와 같은 나노 리포좀 전달체 조성물의 제조방법을 제공한다.
바람직하게는, Cas9 단백질 및 표적 DNA에 특이적인 가이드 RNA의 혼성체를 제조하고, 레시틴, 메탈 킬레이팅 지질 및 콜레스테롤을 클로로포름 상에서 혼합하여 지질 필름 조성물을 제조하는 제1단계;
상기 지질 필름 조성물에, Cas9 단백질 및 표적 DNA에 특이적인 가이드 RNA의 혼성체를 넣어 초음파 처리하는 제2단계;
상기 초음파 처리된 지질 필름 조성물을 동결하고 융해한 후, 다시 초음파 처리하는 제3단계; 및,
상기 제3단계에서 초음파 처리된 지질 필름 조성물을 원심분리하고 침전된 것을 회수하는 제4단계;
를 포함할 수 있다.
상기 제1단계의 혼성체에 양이온성 폴리머가 결합되어 복합체를 형성할 수 있다.
상기 제1단계의 혼성체 제조시, Cas9 단백질과 가이드 RNA는 1:1~3의 몰 비로 혼합될 수 있다.
상기 제1단계의 레시틴, 메탈 킬레이팅 지질 및 콜레스테롤은 1.5~2.5 : 0.5~1.5 : 0.1~0.5의 몰 비로 혼합될 수 있다.
이 때, 상기 제3단계에서 동결하고 융해 과정은 3~6회 반복할 수 있다.
이하 본 발명을 보다 자세하게 설명한다.
본 발명은 Cas9 단백질 및 표적 DNA에 특이적인 가이드 RNA의 혼성체가 봉입된 나노 리포좀 전달체 조성물에 관한 것이다.
상기 Cas9 단백질은 하기의 구조를 갖는 pET28a/Cas9-Cys 플라스미드(pET28a(+) 벡터에 Cas9-Cys가 삽입된 것)가 형질전환된 세포 또는 균주에서 획득할 수 있다. 바람직하게는 pET28a/Cas9-Cys 플라스미드를 대장균에 형질전환하여 Cas9 단백질을 과발현하여 얻을 수 있다.
상기 가이드 RNA는 표적 DNA의 발현을 억제할 수 있다. 본 발명에서 적용할 수 있는 가이드 RNA는 하기의 서열번호 1 또는 2를 포함하는 가이드 RNA이며, 하기의 서열번호 1 또는 2의 가이드 RNA가 포함된 나노 리포좀 전달체 조성물은 DPP4(Dipeptidyl peptidase-4)의 발현을 억제하여 제2형 당뇨병을 개선 또는 치료할 수 있는 기능을 한다.
서열번호 1 : UUUGGGCCAUUUGGGGAGUU
서열번호 2 : GUCCGGUUUCGCCAGCUUUU
상기 서열번호 1의 가이드 RNA는 하기의 서열번호 3의 사람(Homo sapiens) DPP4의 일부 DNA 염기서열로부터 유래된 것이며, 하기의 서열번호 5의 DPP4의 일부 DNA 염기서열을 타겟으로 한다(서열번호 3과 서열번호 5는 상보적인 염기서열을 가짐). 상기 서열번호 2의 가이드 RNA는 하기의 서열번호 4의 DPP4의 일부 DNA 염기서열로부터 유래된 것이며, 하기의 서열번호 6의 DPP4의 일부 DNA 염기서열을 타겟으로 한다(서열번호 4와 서열번호 6은 상보적인 염기서열을 가짐).
서열번호 3 : TTTGGGCCATTTGGGGAGTT
서열번호 4 : GTCCGGTTTCGCCAGCTTTT
서열번호 5 : AACTCCCCAAATGGCCCAAA
서열번호 6 : AAAAGCTGGCGAAACCGGAC
한편, 본 발명에서는 임상적용이 힘든 사람을 대신해서 동물실험용 나노 리포좀을 제공하며, 이 동물실험용 나노 리포좀은 하기의 서열번호 7 또는 8의 가이드 RNA를 포함한다. 상기 동물로는 바람직하게는 마우스(Mus musculus)를 사용한다.
서열번호 7 : UCAAGUCCUACUCUUUGUGG
서열번호 8 : CCAAUAGUUCUGCUGAGCAA
상기 서열번호 7의 가이드 RNA는 하기의 서열번호 9의 DPP4의 일부 DNA 염기서열로부터 유래된 것이며, 하기의 서열번호 11의 DPP4의 일부 DNA 염기서열을 타겟으로 한다(서열번호 9와 서열번호 11은 상보적인 염기서열을 가짐). 상기 서열번호 8의 가이드 RNA는 하기의 서열번호 10의 DPP4의 일부 DNA 염기서열로부터 유래된 것이며, 하기의 서열번호 12의 DPP4의 일부 DNA 염기서열을 타겟으로 한다(서열번호 10과 서열번호 12는 상보적인 염기서열을 가짐).
서열번호 9 : TCAAGTCCTACTCTTTGTGG
서열번호 10 : CCAATAGTTCTGCTGAGCAA
서열번호 11 : CCACAAAGAGTAGGACTTGA
서열번호 12 : TTGCTCAGCAGAACTATTGG
상기 서열번호 1 또는 2의 가이드 RNA 염기서열과 서열번호 7 또는 8의 가이드 RNA 염기서열 이후에는 Cas9 단백질과 복합체를 형성하기 위해 스캐폴드 염기서열(scaffold sequence)이 포함될 수 있다. 이 때 스캐폴드 염기서열의 종류는 크게 제한되지 않으며, 가이드 RNA의 제조에 이용되는 통상적인 염기서열이라면 어떤 것이든지 사용될 수 있다.
따라서, 본 발명의 나노 리포좀에 적용되는 가이드 RNA는 하기의
서열번호 13 :
UUUGGGCCAUUUGGGGAGUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU
또는, 서열번호 14 :
GUCCGGUUUCGCCAGCUUUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU
를 포함할 수 있고, 본 발명에서 동물 실험을 위해,
서열번호 15 :
UCAAGUCCUACUCUUUGUGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU
또는, 서열번호 16 :
CCAAUAGUUCUGCUGAGCAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU
가 적용된 나노 리포좀을 제공할 수 있다.
상기 서열번호 1 또는 2의 가이드 RNA의 염기서열이 타겟으로 하는 서열번호 5 또는 6의 DNA 염기서열은 사람의 DPP4(Homo sapiens Chromosome 2, Gene bank No. NC_000002.12)의 Exon1과 Exon2 사이에 존재하는 염기서열이며, 서열번호 1 또는 2의 가이드 RNA를 통해 상기 Exon1과 Exon2 사이의 DNA가 잘려지게 된다.
서열번호 7의 가이드 RNA는 마우스의 DPP4(Mus musculus strain C57BL/6J Location : Chromosome 2, Gene bank No. NC_000068.7)의 Exon3의 DNA를 자르며, 서열번호 8의 가이드 RNA는 상기 마우스의 DPP4의 Exon2를 자른다.
상기 서열번호 1 또는 2, 서열번호 7 또는 8의 가이드 RNA는 T7 RNA 폴리머라아제(polymerase)를 사용한 시험관 내 전사 반응 과정(in vitro transcription)을 통하여 합성할 수 있다.
상기 Cas9 단백질 및 가이드 RNA의 혼성체에 양이온성 폴리머가 결합되어 복합체를 형성할 수 있으며, 상기 양이온성 폴리머로서 바람직하게는 폴리-L-리신, 폴리아미도아민, 폴리[2-(N,N-디메틸아미노)에틸 메타아크릴레이트], 키토산, 폴리-L-오르니틴, 시클로덱스트린, 히스톤, 콜라겐, 덱스트란 및 폴리에틸렌이민으로 선택되는 것 1종 이상이 사용될 수 있으며, 가장 바람직하게는 폴리에틸렌이민이 사용될 수 있다.
상기 나노 리포좀은 레시틴(lecithin, α-phosphatidylcholin), 콜레스테롤 및 메탈 킬레이팅 지질을 포함할 수 있으며, 이를 통해, 상기 레시틴, 콜레스테롤 및 메탈 킬레이팅 지질이 나노 리포좀을 형성하는 막을 이룰 수 있다.
레시틴은 동/식물계에 널리 분포되어 있어 생체 적합성이 우수하며 그 안정성에 있어서도 이미 검증되어 식품과 제약의 전달체 기술에 널리 활용되고 있다. 또한 나노 리포좀의 크기 조절과 변형을 용이하게 하는 재료로 사용될 수 있다.
상기 메탈 킬레이팅 지질로는 바람직하게는 DOGS-NTA-Ni 지질, DMPE-DTPA-Gd 지질, DMPE-DTPA-Cu 지질로 이루어진 군 중에서 선택되는 1종 이상을 사용할 수 있다.
상기 DOGS-NTA-Ni 지질은 하기 화학식 1의 화학구조를 갖는 지질로서,
[화학식 1]
Figure PCTKR2017003805-appb-I000001
1,2-디올레오일-sn-글리세로-3-[(N-(5-아미노-1-카르복시펜틸)이미노디아세트산)숙시닐](니켈염)이라 한다.
*1,2-dioleoyl-sn-glycero-3-[(N-(5-amino-1-carboxypentyl)iminodiacetic acid)succinyl](nikel salt)
DMPE-DTPA-Gd 지질은 하기의 화학식 2의 화학구조를 갖는 지질로서,
[화학식 2]
Figure PCTKR2017003805-appb-I000002
1,2-디미리스토일-sn-글리세로-3-포스포에탄올라민-N-디에틸렌트리아민펜타아세트산(가돌리늄염)이라 한다.
*1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid(gadolinium salt)
DMPE-DTPA-Cu 지질은 하기의 화학식 3의 화학구조를 갖는 지질로서,
[화학식 3]
Figure PCTKR2017003805-appb-I000003
1,2-디미리스토일-sn-글리세로-3-포스포에탄올라민-N-디에틸렌트리아민펜타아세트산(구리염)이라 한다.
*1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid(copper salt)
상기 DOGS-NTA-Ni 지질은 단백질 정제 방법에서 사용되는 His-Tag(6X histidin)과 Ni2 + 친연성(affinity)을 활용하여 Cas9 단백질(His-Tag 포함된 것)이 효과적으로 나노 리포좀 내부로 봉입(encapsulation)되게 하는 역할을 할 수 있다. 더 자세하게는 상기 DOGS-NTA-Ni은 18개의 탄소에 이중결합이 1개 있는 구조로 레시틴과 함께 지질(lipid)를 형성할 수 있고, 끝에 Ni2 +가 결합되어 있어, Cas9 단백질에 붙어있는 His-tag 2개와 Ni2 + 1개가 결합하여 Cas9 단백질이 좀 더 효율적으로 나노 리포좀 안으로 봉입되게 한다.
본 발명의 나노 리포좀 내에는 서열번호 1의 염기서열을 포함하는 가이드 RNA와 결합된 Cas9 단백질과, 서열번호 2의 염기서열을 포함하는 가이드 RNA와 결합된 Cas9 단백질이 혼재되어 존재할 수도 있다. 동물실험용 나노 리포좀의 경우에도, 서열번호 7의 염기서열을 포함하는 가이드 RNA와 결합된 Cas9 단백질과, 서열번호 8의 염기서열을 포함하는 가이드 RNA와 결합된 Cas9 단백질이 혼재되어 존재할 수도 있다.
상기 나노 리포좀은 10 ~ 2,000 nm의 입자크기를 가질 수 있다. 나노 리포좀의 크기가 10 nm 미만일 경우, Cas9 단백질 및 표적 DNA에 특이적인 가이드 RNA의 혼성체가 상기 나노 리포좀에 봉입되기 어려울 수 있으며, 체내로 주입될 경우에 안정성이 낮아질 수 있어 바람직하지 않다. 또한 2,000 nm를 초과할 경우에도 상기 나노 리포좀이 포함된 조성물이 체내로 주입될 경우에 안정성이 낮아질 수 있어 바람직하지 않다.
본 발명의 나노 리포좀은 중성의 물, 세포 배양액, 혈액 등에서 수시간 이상 안정하게 분산될 수 있다.
본 발명은 상기 나노 리포좀 전달체 조성물을 함유하는 제2형 당뇨병의 개선 또는 치료용 조성물을 제공할 수 있다. 상기 제2형 당뇨병의 개선 또는 치료용 조성물에 있어서, 상기 나노 리포좀 전달체 조성물은 표적 DNA에 특이적인 가이드 RNA로서 DPP4의 발현을 억제하는 가이드 RNA를 함유할 수 있다. 상기 DPP4는 당뇨병과 관련된 유전자로서 시타글립틴(Sitagliptin) 등과 같은 당뇨병 치료제로 알려진 약물이 DPP4의 발현을 억제하는 효과가 우수한 것으로 알려져 있다.
본 발명은 또한 하기와 같은 나노 리포좀 전달체 조성물의 제조방법을 제공한다. 바람직하게는, Cas9 단백질 및 표적 DNA에 특이적인 가이드 RNA의 혼성체를 제조하고, 레시틴, 메탈 킬레이팅 지질 및 콜레스테롤을 클로로포름 상에서 혼합하여 지질 필름 조성물을 제조하는 제1단계; 상기 지질 필름 조성물에, Cas9 단백질 및 표적 DNA에 특이적인 가이드 RNA의 혼성체를 넣어 초음파 처리하는 제2단계; 상기 초음파 처리된 지질 필름 조성물을 동결 융해한 후, 다시 초음파 처리하는 제3단계; 상기 제3단계에서 초음파 처리된 지질 필름 조성물을 원심분리하고 침전된 것을 회수하는 제4단계;를 포함할 수 있다.
상기 제1단계의 혼성체에 양이온성 폴리머가 결합되어 복합체를 형성할 수 있다. 상기 양이온성 폴리머로서 폴리-L-리신, 폴리아미도아민, 폴리[2-(N,N-디메틸아미노)에틸 메타아크릴레이트], 키토산, 폴리-L-오르니틴, 시클로덱스트린, 히스톤, 콜라겐, 덱스트란 및 폴리에틸렌이민으로 선택되는 것 1종 이상이 사용될 수 있다.
상기 제1단계에서 Cas9 단백질과 가이드 RNA는 1:1~3의 몰 비로 혼합될 수 있으며, 상기 Cas9 단백질와 가이드 RNA의 혼성체에 양이온성 폴리머가 첨가되어 복합체를 이룰 경우, Cas9 단백질:가이드 RNA:양이온성 폴리머가 1:1~3:30~70의 몰 비로 혼합될 수 있으며, 바람직하게는 1:2:50의 몰비로 혼합될 수 있다.
이 때, 상기 제1단계의 레시틴, 메탈 킬레이팅 지질 및 콜레스테롤은 1.5~2.5 : 0.5~1.5 : 0.1~0.5의 몰 비로 혼합될 수 있으며, 바람직하게는 1.8~2.2 : 0.8~1.2 : 0.2~0.4의 몰 비로 혼합될 수 있으며, 가장 바람직하게는 2:1:0.3의 몰 비로 혼합될 수 있다.
이 때, 상기 제3단계에서 동결하고 융해하는 과정은 3~6회 반복할 수 있다. 지질 필름 조성물을 동결하고 융해하는 단계를 반복함으로써 보다 균일한 크기의 나노 리포좀 분산액이 형성될 수 있고, 나노 리포좀의 약물 봉입 효율을 높일 수 있다. 단, 6회를 초과할 경우에는 나노 리포좀의 봉입 효율이 오히려 줄어들 수 있기 때문에 6회 이내가 바람직하다.
본 발명의 나노 리포좀 제조시, 메탈 킬레이팅 지질은 음전하(-)를 띄기 때문에, Cas9과 가이드 RNA의 혼성체의 음전하(-)에 반응하여 리포좀의 캡슐화가 잘 되지 않을 수 있다. 따라서 이를 극복하기 위하여 Cas9과 가이드 RNA의 혼성체에 양전하(+)를 갖는 양이온성 고분자를 결합시킨 복합체를 제조함으로써 나노 리포좀의 캡슐화를 강화할 수 있다.
본 발명은 또한 상기 나노 리포좀 전달체 조성물을 함유하는 약학 조성물을 제공할 수 있는데, 상기 약학 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 상기 약학 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 본 발명의 조성물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 탄산칼슘, 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜, 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명의 약학 조성물의 투여량은 치료받을 대상의 연령, 성별, 체중, 치료할 특정 질환 또는 병리 상태, 질환 또는 병리 상태의 심각도, 투여경로 및 처방자의 판단에 따라 달라질 것이다. 이러한 인자에 기초한 투여량 결정은 당업자의 수준 내에 있으며, 일반적으로 투여량은 0.01㎎/㎏/일 내지 대략 2000㎎/㎏/일의 범위이다. 더 바람직한 투여량은 1㎎/㎏/일 내지 500㎎/㎏/일이다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
본 발명의 약학 조성물은 쥐, 가축, 인간 등의 포유동물에 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구, 직장 또는 정맥, 근육, 피하, 자궁내 경막 또는 뇌혈관내 주사에 의해 투여될 수 있다.
본 발명은 Cas9 단백질 및 가이드 RNA의 혼성체를 함유하는 나노 리포좀 전달체 조성물에 관한 것으로서, 보다 자세하게는 본 발명은 Cas9 단백질 및 표적 DNA에 특이적인 가이드 RNA의 혼성체가 봉입된 나노 리포좀 전달체 조성물에 관한 것이다. 상기 나노 리포좀 전달체 조성물은 표적 DNA의 발현을 억제하는 효과가 우수하고, 매일 당뇨 치료제를 투여하지 않더라도 한 번의 주사로 장기간 효율적으로 혈당관리를 할 수 있다. 이에 상기 나노 리포좀 전달체 조성물이 포함된 약학 조성물은 당뇨병과 같은 질병을 개선 또는 치료할 수 있는 약학조성물로서 용이하게 이용될 수 있다.
도 1의 상단 그림은 제2형 당뇨병을 억제하기 위해 본 발명에서 사용하는 단일 가닥 상태의 가이드 RNA(sgRNAs)의 염기서열 구조를 도식화한 것이고, 하단 그림은 실시예 1에서 제조한 Cas9 단백질을 정제하여 SDS-PAGE(Sodium dodecyl sulphate polyacrylamide gel electrophoresis)로 확인한 결과를 나타낸다.
도 2는 본 발명의 실시예 2의 나노 리포좀을 도식화한 것으로서, 상기 나노 리포좀은 레시틴(Lecithin), 콜레스테롤(Cholesterol) 및 메탈 킬레이팅 지질로 구성되며, Cas9 단백질과 가이드 RNA(guide RNA)의 혼성체에 폴리에틸렌이민(PEI)이 결합된 복합체가 봉입되어 있다.
도 3은 본 발명의 실시예 2의 나노 리포좀의 바이오 투과전자현미경(Bio-TEM) 이미지를 나타낸 것이다.
도 4는 본 발명에서 제조한 나노 리포좀들의 봉입효율을 나타낸 그래프(상단)와 나노 리포좀을 제조하고 남은 여액(상층액)에 잔류한 Cas9 단백질 함량을 나타내는 웨스턴 블롯 결과(하단)를 나타낸다.
도 5는 본 발명에서 제조한 나노 리포좀들의 표면 전하 변화(zeta potential, mV)와 크기 및 분산도에 대한 안정성을 나타낸 것이다(표면전하 - 도 5A, 크기 - 도 5B, 분산도 - 도 5C).
도 6은 본 발명의 나노 리포좀 이용을 통해 DPP4의 야생 유전자(WT)와 비교해서 인간간암세포에서의 DPP4 유전자의 18개의 염기서열이 잘렸음(mutation)을 나타내는 그림이다.
도 7은 RITC(rhodamine B isothiocyanate)가 표지된 실시예 2의 나노 리포좀이 인간간암세포 내 유입이 잘 되는지를 RITC 및 Cas9 항체를 이용하여 형광면역법으로 확인한 공초점 형광 현미경 사진이다.
도 8은 본 발명에서 제조한 나노 리포좀을 인간간암세포에 처리하여 목표 유전자인 DPP4의 발현 변화를 확인한 것이다(도 8a - DPP4의 mRNA 발현, 도 8b - DPP4의 단백질 발현, 도 8c - DPP4 활성 확인).
도 9는 본 발명에서 제조한 나노 리포좀을 인간간암세포에 처리했을 때의 세포 생존/증식을 WST-1 어세이로 확인한 결과를 나타낸다.
도 10은 본 발명의 실시예 2에서 제조한 나노 리포좀을 제2형 당뇨병 동물 모델에 적용한 시간표를 도식화한 것이다.
도 11(a 및 b)은 본 발명의 실시예 2에서 제조한 나노 리포좀을 제2형 당뇨병 동물 모델에 적용하여 간조직에서의 목표 유전자(DPP4)의 mRNA와 단백질 발현의 변화를 확인한 결과를 나타낸다.
도 12는 본 발명의 실시예 2에서 제조한 나노 리포좀을 제2형 당뇨병 동물 모델에 적용하고 면역 염색법을 통해 간조직에서의 목표 유전자(DPP4)의 발현을 확인한 결과를 나타낸다.
도 13은 본 발명의 실시예 2에서 제조한 나노 리포좀을 제2형 당뇨병 동물 모델에 적용한 후 실험동물의 몸무게와 혈당의 변화를 나타낸 것이다.
도 14는 본 발명의 실시예 2에서 제조한 나노 리포좀을 제2형 당뇨병 동물 모델에 적용하고 면역 염색법을 통하여 췌장 세포에서 인슐린의 발현을 확인한 결과를 나타낸다.
이하 본 발명의 바람직한 실시예를 상세히 설명하기로 한다. 그러나, 본 발명은 여기서 설명되는 실시예에 한정되지 않고 다른 형태로 구체화될 수도 있다. 오히려, 여기서 소개되는 내용이 철저하고 완전해지도록, 당업자에게 본 발명의 사상을 충분히 전달하기 위해 제공하는 것이다.
< 실시예 1. 가이드 RNA 제조 및 Cas9 단백질 정제>
실시예 1-1. DPP4를 목표유전자로 하는 가이드 RNA 제조
T7 RNA polymerase(NEB)를 활용한 in vitro transcription 방법을 이용하여 DPP4를 목표유전자로 하는 가이드 RNA를 제조하였다. 이를 위해 표 1의 T7 promoter 염기서열과 DPP4(사람 또는 마우스)의 20 b.p. 염기서열(서열번호 3 : TTTGGGCCATTTGGGGAGTT, 서열번호 4 : GTCCGGTTTCGCCAGCTTTT, 서열번호 9 : TCAAGTCCTACTCTTTGTGG, 서열번호 10 : CCAATAGTTCTGCTGAGCAA)을 포함하는 '69 mer forward primer' 4개, 가이드 RNA에 연결될 스캐폴드 염기서열을 포함하는 '20 mer reverse primer' 1개, plasmid Cas guide vector(origene)를 사용하여 PCR법으로 140 b.p.의 DNA　주형(template)을 제조하였다. 이 DNA 주형, rNTP mixture, T7 RNA polymerase, RNase inhibitor를 포함하여 37℃에서 2시간 전사 반응을 통하여 가이드 RNA를 제작하였고 RNA 정제 과정을 거쳐 RNA 순도를 높였다.
* T7 promoter 염기서열은 아래 표 1의 밑줄 친 부분에 해당됨.
* 표 1의 굵은 글씨의 염기 서열은 DPP4 유전자를 인식하는 부위이며, 스캐폴드 염기서열의 주형(plasmid Cas guide vector)을 인식하여 가이드 RNA 합성이 되며, 최종 제조된 가이드 RNA의 서열과 이 염기서열이 같은(T 대신 U로 치환된) 염기서열 구조를 가짐.
* F 프라이머 뒤의 GTTTTAGAGCTAGAAATAGCA는 스캐폴드 염기 서열 일부분임.
* plasmid Cas guide vector에 스캐폴드 염기서열의 주형이 포함되어 있음.
* 이 실험에 사용된 plasmid Cas guide vector의 구조는 하기와 같음.
[규칙 제91조에 의한 정정 08.06.2017]　
출처 : http://www.origene.com/CRISPR-CAS9/Detail.aspx?sku=GE100001
forward primer Human DPP4 sgRNA 1_F GCGGCCTCTAATACGACTCACTATAGGG TTTGGGCCATTTGGGGAGTTGTTTTAGAGCTAGAAATAGCA
Human DPP4 sgRNA 2_F GCGGCCTCTAATACGACTCACTATAGGG GTCCGGTTTCGCCAGCTTTTGTTTTAGAGCTAGAAATAGCA
Mouse DPP4 sgRNA 1_F GCGGCCTCTAATACGACTCACTATAGGG TCAAGTCCTACTCTTTGTGGGTTTTAGAGCTAGAAATAGCA
Mouse DPP4 sgRNA 2_F GCGGCCTCTAATACGACTCACTATAGGG CCAATAGTTCTGCTGAGCAAGTTTTAGAGCTAGAAATAGCA
reverse primer(sg RNA_R) AAAAGCACCGACTCGGTGCCA
상기 실험을 통해 하기 표 2의 염기서열을 갖는 가이드 RNA를 제조하였다.
서열번호 13(사람 DPP4 타겟) UUUGGGCCAUUUGGGGAGUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU
서열번호 14(사람 DPP4 타겟) GUCCGGUUUCGCCAGCUUUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU
서열번호 15(마우스 DPP4 타겟) UCAAGUCCUACUCUUUGUGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU
서열번호 16(마우스 DPP4 타겟) CCAAUAGUUCUGCUGAGCAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU
본 발명에서 제조한 표 2의 단일 가닥 상태의 가이드 RNA(sgRNA)의 구조 도식화는 도 1의 상단에 개시되어 있다.
최종 제조된 상기 가이드 RNA는 사람의 DPP4 유전자의 AACTCCCCAAATGGCCCAAA(서열번호 5) 또는 AAAAGCTGGCGAAACCGGAC(서열번호 6)를 타겟으로 인식하고, 마우스의 DPP4 유전자의 CCACAAAGAGTAGGACTTGA(서열번호 11) 또는 TTGCTCAGCAGAACTATTGG(서열번호 12)를 타겟으로 인식하여 각 DPP4 유전자의 발현을 억제하는 역할을 한다.
실시예 1-2. Cas9 단백질 정제
pET28a/Cas9-Cys plasmid(Addgene plasmid # 53261)를 대장균(DH5α)에 형질전환하여 0.5 mM IPTG(isopropyl β- D -1-thiogalactopyranoside)와 28℃ 조건에서 Cas9 단백질을 과발현하였고, Cas9 단백질이 과발현된 대장균을 lysis buffer(20 mM Tris-Cl at pH 8.0, 300 mM NaCl, 20 mM imidazole, 1× protease inhibitor cocktail, 1 mg/mL lysozyme)와 함께 초음파 처리하였다. 초음파 처리하여 얻은 분쇄물을 원심분리하여 단백질이 포함된 액상을 얻었다. Ni-NTA agarose bead 추출법(elution buffer : 20 mM Tris-Cl at pH 8.0, 300 mM NaCl, 300 mM imidazole, 1× protease inhibitor cocktail)으로 상기 액상에 포함된 Cas9 단백질을 분리하였다. 이후 분리물을 storage buffer(50 mM Tris-HCl at pH 8.0, 200 mM KCl, 0.1 mM EDTA, 1 mM DTT, 0.5 mM PMSF, 20% glycerol)에 혼합한 상태로 투석하여(cut off 10K) 이미다졸을 제거한 후 단백질 농도를 정량하였다(BCA법 이용). 이 때, 투석하여 얻은 Cas9 단백질을 농도의존적으로 SDS-PAGE하여 확인하여 Cas9 단백질이 잘 생성되었음을 확인하였다(도 1의 하단 사진 참조).
** pET28a/Cas9-Cys plasmid(Addgene plasmid # 53261)의 구조 :
[규칙 제91조에 의한 정정 08.06.2017]　
출처 : Addgene (http://www.addgene.org/)
<실시예 2. 나노 리포좀 제작>
실시예 1에서 제조한 Cas9 단백질, 가이드 RNA, 폴리에틸렌이민을 1:2:50 몰 비(mole ratio)로 혼합하여 복합체를 제조하였다. 이 때 가이드 RNA로는 스캐폴드 염기서열이 포함된 서열번호 13~16을 사용하였다. 다음으로 레시틴(Lecithin, Sigma Aldrich), DOGS-NTA-Ni 지질(Avanti polar lipids), 콜레스테롤(Cholesterol, Sigma Aldrich)을 2 : 1 : 0.3 몰 비로 클로로포름(chloroform) 상에서 섞은 후 Rotary evaporator를 활용하여 지질필름(lipid film)화 하였다. 여기에 Cas9 단백질/가이드 RNA/폴리에틸렌이민의 복합체를 넣어 초음파를 가하며 혼합하였다. 액체질소를 활용하여 동결하고 융해하는 과정(freeze thaw cycle)을 5차례 반복하고 이후 초음파(probe 방식) 처리하여 좀 더 작은 사이즈이면서도 균일한 상태의 나노 리포좀을 제작하였다. 이후 원심분리 방법으로 침전된 것만을 회수하여 본 발명의 나노 리포좀을 얻었고, 진행 buffer(세포배양용 배지 또는 PBS[Phosphate Buffered Saline])에 섞어 다음 실험에 사용하였다. 이러한 방식으로 제조된 나노 리포좀의 세포처리군은 NL(Ni)-Cas9/gDPP4(PEI)으로 표기하였고, 동물처리군은 db/db(Cas9/gDPP4)라 표기하였다. 상기 나노 리포좀의 도식은 도 2에 나타내었고, 이 상태의 나노 리포좀을 Bio-TEM으로 촬영한 이미지는 도 3에 나타내었다. 이 때 도 3의 나노 리포좀에는 서열번호 2의 가이드 RNA가 포함되어 있으며, 서열번호 1, 서열번호 7 및 서열번호 8의 가이드 RNA를 포함한 나노 리포좀, 또는 서열번호 1 및 2를 함께 포함한 나노 리포좀, 서열번호 7 및 8을 함께 포함한 나노 리포좀도 이와 유사한 안정적인 이미지를 갖는 것으로 확인되었다.
<비교예 1. 나노 리포좀 제조 - NL>
DOGS-NTA-Ni 지질을 제외하고, 실시예 2에 기재된 방법으로 레시틴과 콜레스테롤만 혼합하여 나노 리포좀을 제조하였다. 또한 Cas9 단백질/가이드 RNA/ 폴리에틸렌이민의 복합체를 나노 리포좀에 봉입하는 과정은 제외하였으며, 이 나노 리포좀을 세포처리시 NL이라 표기하였다.
<비교예 2. 나노 리포좀 제조 - NL(Ni)>
실시예 2에 기재된 방법으로 레시틴, 콜레스테롤, DOGS-NTA-Ni 지질로 나노 리포좀을 제조하였으나 Cas9 단백질/가이드 RNA/ 폴리에틸렌이민의 복합체를 첨가하는 과정은 제외하였고, 이 나노 리포좀을 세포처리시 NL(Ni)라 표기하였다.
< 비교예 3. DOGS- NTA - Ni 지질과 폴리에틸렌이민을 포함하지 않은 나노 리포좀 - NL-Cas9/gDPP4>
비교예 1에서처럼 DOGS-NTA-Ni 지질을 제외하고, 레시틴과 콜레스테롤만 포함하여 나노 리포좀을 제조하였고, 이후는 실시예 2의 과정을 수행하되, Cas9 단백질/가이드 RNA/ 폴리에틸렌이민의 복합체 대신 Cas9 단백질/가이드 RNA의 혼성체가 나노 리포좀에 봉입되게 하였다. 이 나노 리포좀은 세포처리시 NL-Cas9/gDPP4로 표시하였다.
< 비교예 4. 폴리에틸렌이민을 포함하지 않은 나노 리포좀 - NL( Ni )-Cas9/gDPP4>
실시예 2에서처럼 나노 리포좀을 제조하되, Cas9 단백질/가이드 RNA/ 폴리에틸렌이민의 복합체 대신 Cas9 단백질/가이드 RNA의 혼성체가 나노 리포좀에 봉입되게 하였다. 이 나노 리포좀은 세포처리시 NL(Ni)-Cas9/gDPP4로 표시하였다.
<실험예 1. 나노 리포좀의 상태 확인>
실험예 1-1. 나노 리포좀의 봉입 효율 확인
나노 리포좀을 합성 시작 시에 넣은 Cas9 단백질의 총량과, 나노 리포좀 합성 후 여액에 남은 Cas9 단백질 양을 웨스턴 블롯 실험 방법으로 측정하여 나노 리포좀의 봉입 효율을 확인하였다. 이 때 나노 리포좀을 제조 후, 원심분리기를 이용하여 13000rpm에 원심분리하면 나노 리포좀이 가라앉게 되고, 나노 리포좀에 봉입되지 않은 Cas9 단백질은 여액에 그대로 존재하기 때문에, 상기 여액을 취해서 나노 리포좀에 들어가지 않은 Cas9 단백질으로만 웨스턴 블롯 실험을 진행하였다. 나노 리포좀 제조 후 남은 여액에 잔류한 Cas9 단백질의 함량 비교를 통해 나노 리포좀의 봉입 효율이 용이하게 확인된다.
상기 봉입효율 결과는 가이드 RNA의 종류에 따른 차이는 거의 없었으며, 서열번호 2의 가이드 RNA가 포함된 것을 대표로 하여 도 4에 나타내었다. 도 4를 참고하면, 가이드 RNA가 포함된 혼성체 또는 복합체의 봉입효율은 실시예 2의 나노 리포좀에서 가장 좋음을 알 수 있다.
실험예 1-2. 나노 리포좀의 표면 전하, 크기 및 분산도 확인
본 발명에서 제조한 나노 리포좀들의 표면 전하 변화(zeta potential, mV)와 크기 및 분산도를 Dynamic Light Scattering(DLS)로 측정하였다. 이들 측정값 역시 가이드 RNA의 종류에 따른 차이는 거의 없었으며, 서열번호 2의 가이드 RNA가 포함된 것을 대표로 하여 그 결과를 도 5에 나타내었다(표면전하 - A, 크기 - B, 분산도 - C).
세포 내로 가이드 RNA가 포함된 나노 리포좀을 전달하기 위해서는 (-) 전하를 띄는 표면전하값이 최대한 감소하는 것이 좋은데, 도 5를 참고하면 실시예 2의 나노 리포좀은 표면전하값이 낮은 편에 속한다. 비교예 3의 나노 리포좀 조건도 표면전하가 낮지만, 시간의 흐름에 따라 분산도가 낮아져 나노 리포좀의 안정성이 좋지 않음이 확인된다. 또한, 나노 리포좀의 입자크기 또한 실시예 2의 나노 리포좀은 일정한 크기로 제조됨이 확인되지만, 비교예 3의 나노 리포좀은 크기가 균일하지 않은 것을 알 수 있다(2개의 피크 확인). 상기 도 5에는 나타내지 않았지만 비교예 4의 나노 리포좀보다는 실시예 2의 나노 리포좀이 크기와 분산도 면에서 더 우수한 것으로 확인된다.
<실험예 2. DPP4 발현 및 활성 측정>
실험예 2-1. DPP4 유전자의 mutation 확인
인간간암세포(SNU398)에 본 발명에서 제조한 각 나노 리포좀(사람 타겟용)을 24시간 동안 Cas9:gRNA(74㎍:28㎍)의 농도로 처리 후 수집된 세포에서 DNA를 추출하고, Foward primer : GTGAGTGCCGCGCCACGTACG, Reverse primer : CTGCAAGCCGAGCAGATCAAG를 이용하여 PCR법을 통해 template fragment를 만들었다. 다음으로는 T-blunt PCR cloning kit(solgent)를 이용하여 template fragment를 T-blunt vector안에 삽입시켜 준 뒤, (주)바이오니아에 Sequencing service를 요청하여 template fragment 부분의 서열을 분석하였다. 상기 결과는 가이드 RNA의 종류에 따른 차이는 거의 없었으며, 서열번호 2의 가이드 RNA가 포함된 것을 대표로 하여 도 6에 mutation 된 DNA를 나타내는 그림을 표현하였다.
도 6을 참고하면, 본 발명의 나노 리포좀을 통해, 가이드 RNA가 염기서열 20개를 인식하게 되고, Cas9 단백질이 PAM(protospacer adjacent motif)(TGG 서열) 부위를 자르게 됨으로써, 잘려진 DNA가 스스로 회복(repair)되는 과정 중에 18개의 DNA 염기서열이 잘려 나간 것이 확인된다.
실험예 2-2. DPP4 발현 측정 i
실시예 2의 나노 리포좀(사람 타겟용)에 RITC(rhodamine B isothiocyanate)를 표지하고, 인간간암세포(SNU398)에 처리 후 면역염색하여 도 7에 공초점 형광 현미경 사진을 나타내었다. 나노 리포좀에 RITC를 표지하기 위해서는 나노 리포좀 제조 시, Cas9 단백질에 RITC 염료를 같이 혼합하여 함께 봉입하였다. 또한 면역염색을 위해 CFL-488의 Cas9 1차 항체(Rabbit)를 이용하여 세포 내 Cas9 단백질을 표지하고 공초점 형광 현미경으로 이미지화하였다. 상기 결과는 가이드 RNA의 종류에 따른 차이는 거의 없었으며, 서열번호 2의 가이드 RNA가 포함된 것을 대표로 하여 도 7에 나타내었다.
도 7을 참고하면, 실시예 2의 나노 리포좀 처리로 인해 인간간암세포의 핵 내로 RITC와 Cas9 단백질이 잘 주입되어 있음을 알 수 있다.
실험예 2-3. DPP4 발현 측정 ii
인간간암세포(SNU398)에 본 발명에서 제조한 각 나노 리포좀(사람 타겟용)을 24시간 동안 Cas9:gRNA(74㎍:28㎍)의 농도로 처리 후 수집된 세포에 Trizol(invitrogen)을 이용하여 총RNA를 추출하였고, SuprimeScript RT premix 2x(GeNetBio)를 이용하여 cDNA를 합성하였다.
DPP4의 mRNA 발현 확인을 위한 Real-time PCR은 SYBR green 2x Premix(Applied Biosystems)와 AB step one plus real-time PCR system(Applied Biosystems)을 활용하여 측정하였다. 이 때 검출에 사용한 primer의 염기서열은 다음과 같다.
DPP4 sense : TCCCAACTCCAGAGGACAAC
DPP4 antisense : CAGGGCTTTGGAGATCTGAG
GAPDH sense : GCACCGTCAAGGCTGAGAA
GAPDH antisense : AGGGATCTCGCTCCTGGAA
또한 mRNA 발현 확인 실험과 동일한 조건으로 인간간암세포(SNU398)에 본 발명에서 제조한 각 나노 리포좀을 처리 후 세포를 수집하고, 상기 세포에 RIPA Buffer(Sigma)를 처리하여 단백질을 추출하였고, anti-DPP4(mouse)(origene, TA500733), anti-GAPDH(mouse)(santacruz, sc-32233)를 통하여 DPP4 단백질 발현량을 검출하였다.
상기 실험의 결과는 가이드 RNA의 종류에 따른 차이는 거의 없었으며, 서열번호 2의 가이드 RNA가 포함된 것을 대표로 하여 도 8에 나타내었다. 도 8a와 도 8b(도 8b 상단은 단백질 전기영동 그래프, 도 8b 하단은 이를 정량화한 그래프)을 참고하면, 실시예 2의 나노 리포좀이 DPP4의 mRNA와 단백질 발현을 효과적으로 제한하고 있음이 확인된다.
실험예 2-4. DPP4 활성 측정
DPP4의 활성은 DPP4 assay kit(Abnova)를 기본 재료로 사용한다. 본 발명에서 제조한 각 나노 리포좀(사람 타겟용) 처리 후 세포(SNU398) 추출 단백질에 substrate solution(H-Gly-Pro-AMC)을 넣어 37℃에서 30분간 반응한다. 반응 후 sodium acetate solution(1M, pH 5.0)을 넣어 반응을 정지하고 excitation 360nm와 emission 460nm에서 형광 값을 측정하여 활성을 측정한다.
상기 결과는 도 8C에 나타내었으며, 실시예 2의 나노 리포좀이 DPP4 유전자의 발현을 가장 효과적으로 제한함을 알 수 있다.
<실험예 3. 세포 생존율 및 증가율 확인>
세포 생존율 및 증가율의 확인은 WST-1 어세이를 통해 진행하였다. 이를 위해, EZ-Cytox(DoGen, EZ-3000) 키트를 사용하였고, 인간간암세포(SNU398)를 96웰 플레이트(96well plate)에 각 웰당 5 x 103의 밀도로 24시간 배양 후 실시예 2 및 비교예 1~4에서 제조한 나노 리포좀(사람 타겟용), Cas9/gDPP4(PEI)를 처리하고 24시간 후 배양액으로 바꾼 후에 WST-1 용액이 10%(v/v) 농도가 되도록 처리하였다. *Cas9/gDPP4(PEI) : 나노 리포좀을 제조하지 않고 Cas9 단백질/가이드 RNA/ 폴리에틸렌이민의 복합체를 처리함.
2시간 후에 460nm에서 흡광도를 측정하여 세포 생존 및 증식을 대조군(비처리군)과 비교하였다. 세포 독성 평가는 처리 후 72시간 동안 24시간을 주기로 측정하였다. 상기 결과는 가이드 RNA의 종류에 따른 차이는 거의 없었으며, 서열번호 2의 가이드 RNA가 포함된 것을 대표로 하여 도 9에 나타내었다.
도 9를 참고하면, 실시예 2 및 비교예 1~4에서 제조한 나노 리포좀을 처리한 샘플의 세포 증식 및 생존이 비처리군과 비교하여 유의미한 변화를 보이지 않은 것으로 확인된다. 이는 본 발명의 나노 리포좀이 생체적합성이 뛰어나고 세포의 증식과 성장에 유해하지 않음을 나타낸다.
<실험예 4. 2형 당뇨 동물 모델을 통한 DPP4 발현 억제 확인>
in vivo 적용 실험은 현재 사용되고 있는 DPP4 억제제(sitagliptin)와 비교하여 수행하였다. 실시예 2의 나노 리포좀(200㎕, 용매 PBS)(동물 타겟용)을 Cas9:gRNA이 1.48㎍:0.56㎍인 농도로 db/db 마우스에 정맥 주사 방법으로 단회투여하였다. 이 때 사용된 나노 리포좀으로는 서열번호 7과 서열번호 8을 동시에 포함하는 것을 사용하였다.
DPP4 억제제(sitagliptin)는 10 mg/day의 농도로 매일 실험종료시까지 경구투여하였고, 질환모델의 대조군과 정상 마우스(비 질환모델-C57BL/6)에는 PBS를 투여하였다(db/db(PBS)와 Normal(PBS)로 표기)(시타글립틴[sitagliptin] 투여군은 db/db(sitagliptin)로 표기). 이 때 in vivo 실험 수행 시간은 도 10에 나타내었다. in vivo 실험 진행 중에는 3일 간격으로 실험동물의 몸무게와 혈당을 체크하였으며 실험 종료 후에는 실험동물의 장기(간, 췌장)를 적출하여 면역염색법을 통하여 목표 유전자의 발현 변화를 확인하였다.
이 때, DPP4의 mRNA와 단백질 발현량은 세포실험과 동일한 방법으로 측정하되, mRNA 분석을 위한 프라이머는 하기의 염기서열로 구성된 것을 사용하였다.
DPP4 sense : TCCCAACTCCAGAGGACAAC
DPP4 antisense : CAGGGCTTTGGAGATCTGAG
GAPDH sense : GCACCGTCAAGGCTGAGAA
GAPDH antisense : AGGGATCTCGCTCCTGGAA
면역염색법을 수행하기 위해 동물 조직을 적출 후, 4% 파라포름알데히드(paraformaldehyde)에 고정시킨 후, 파라핀 몰드 방식을 사용해서 조직 몰드를 제작 후 5㎛로 절편하여 조직 슬라이드를 얻었다. 이 슬라이드에 DPP4 항체와 DAB(3,3-Diaminobenzidine tablets, sigma, D4418)을 사용하여 발색하였다.
각 실험 결과는 도 11 내지 14에 나타냈으며, 실시예 2의 나노 리포좀을 투여한 동물 모델의 간조직에서 목표 유전자인 DPP4의 발현이 나노 리포좀을 투여하지 않은 질환동물군에 비하여 현저히 감소되는 것이 확인되며, 나노 리포좀 투여군이 DPP4 억제제를 매일 투여한 군과 비교 혈당의 변화가 비슷한 것으로 나타난다. 면역 염색법으로 확인한 결과에서도 췌장 세포에서 인슐린을 분비하는 영역이 DPP4 억제제와 비슷하게 증가되어 있는 것을 확인할 수 있다. 한편 각 실험결과는 서열번호 7 또는 서열번호 8을 단독으로 포함하는 나노 리포좀을 사용해도 실험결과가 비슷한 것으로 확인된다.

Claims (13)

  1. Cas9 단백질 및 표적 DNA에 특이적인 가이드 RNA의 혼성체가 봉입된 것을 특징으로 하는 나노 리포좀 전달체 조성물.
  2. 제1항에 있어서,
    상기 Cas9 단백질 및 표적 DNA에 특이적인 가이드 RNA의 혼성체에 양이온성 폴리머가 결합되어 복합체를 형성하는 것을 특징으로 하는 나노 리포좀 전달체 조성물.
  3. 제2항에 있어서,
    상기 양이온성 폴리머는 폴리-L-리신, 폴리아미도아민, 폴리[2-(N,N-디메틸아미노)에틸 메타아크릴레이트], 키토산, 폴리-L-오르니틴, 시클로덱스트린, 히스톤, 콜라겐, 덱스트란 및 폴리에틸렌이민으로 선택되는 것 1종 이상인 것을 특징으로 하는 나노 리포좀 전달체 조성물.
  4. 제1항에 있어서,
    상기 나노 리포좀은 레시틴, 콜레스테롤 및 메탈 킬레이팅 지질을 포함하는 것을 특징으로 하는 나노 리포좀 전달체 조성물.
  5. 제1항에 있어서,
    상기 나노 리포좀은 10 ~ 2,000 nm의 입자크기를 갖는 것을 특징으로 하는 나노 리포좀 전달체 조성물.
  6. 제1항 내지 제5항 중 어느 한 항에 따른 나노 리포좀 전달체 조성물을 함유하는 제2형 당뇨병의 개선 또는 치료용 조성물.
  7. 제6항에 있어서,
    상기 나노 리포좀 전달체 조성물은, 표적 DNA에 특이적인 가이드 RNA로서 DPP4(Dipeptidyl peptidase-4)의 발현을 억제하는 가이드 RNA를 함유하는 것을 특징으로 하는 제2형 당뇨병의 개선 또는 치료용 조성물.
  8. 제7항에 있어서,
    상기 가이드 RNA는 하기의 서열번호 1 또는 2의 염기서열을 포함하는 가이드 RNA인 것을 특징으로 하는 제2형 당뇨병의 개선 또는 치료용 조성물.
    서열번호 1 : UUUGGGCCAUUUGGGGAGUU
    서열번호 2 : GUCCGGUUUCGCCAGCUUUU
  9. Cas9 단백질 및 표적 DNA에 특이적인 가이드 RNA의 혼성체를 제조하고, 레시틴, 메탈 킬레이팅 지질 및 콜레스테롤을 클로로포름 상에서 혼합하여 지질 필름 조성물을 제조하는 제1단계;
    상기 지질 필름 조성물에, Cas9 단백질 및 표적 DNA에 특이적인 가이드 RNA의 혼성체를 넣어 초음파 처리하는 제2단계;
    상기 초음파 처리된 지질 필름 조성물을 동결하고 융해한 후, 다시 초음파 처리하는 제3단계; 및,
    상기 제3단계에서 초음파 처리된 지질 필름 조성물을 원심분리하고 침전된 것을 회수하는 제4단계;
    를 포함하는 것을 특징으로 하는 나노 리포좀 전달체 조성물의 제조방법.
  10. 제9항에 있어서,
    상기 제1단계의 혼성체에 양이온성 폴리머가 결합되어 복합체를 형성하는 것을 특징으로 하는 나노 리포좀 전달체 조성물의 제조방법.
  11. 제9항에 있어서,
    상기 제1단계의 혼성체 제조시, Cas9 단백질과 가이드 RNA는 1:1~3의 몰 비로 혼합되는 것을 특징으로 하는 나노 리포좀 전달체 조성물의 제조방법.
  12. 제9항에 있어서,
    상기 제1단계의 레시틴, 메탈 킬레이팅 지질 및 콜레스테롤은 1.5~2.5 : 0.5~1.5 : 0.1~0.5의 몰 비로 혼합되는 것을 특징으로 하는 나노 리포좀 전달체 조성물의 제조방법.
  13. 제9항에 있어서,
    상기 제3단계에서 동결하고 융해하는 과정은 3~6회 반복되는 것을 특징으로 하는 나노 리포좀 전달체 조성물의 제조방법.
PCT/KR2017/003805 2016-08-10 2017-04-07 Cas9 단백질 및 가이드 RNA의 혼성체를 함유하는 나노 리포좀 전달체 조성물 WO2018030608A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US15/837,987 US10363217B2 (en) 2016-08-10 2017-12-11 Nano-liposome carrier composition containing hybrid of Cas9 protein and guide RNA
US16/438,539 US11364201B2 (en) 2016-08-10 2019-06-12 Nano-liposome carrier composition containing hybrid of Cas9 protein and guide RNA

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2016-0101701 2016-08-10
KR1020160101701A KR101710026B1 (ko) 2016-08-10 2016-08-10 Cas9 단백질 및 가이드 RNA의 혼성체를 함유하는 나노 리포좀 전달체 조성물

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/837,987 Continuation US10363217B2 (en) 2016-08-10 2017-12-11 Nano-liposome carrier composition containing hybrid of Cas9 protein and guide RNA

Publications (1)

Publication Number Publication Date
WO2018030608A1 true WO2018030608A1 (ko) 2018-02-15

Family

ID=58315876

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/003805 WO2018030608A1 (ko) 2016-08-10 2017-04-07 Cas9 단백질 및 가이드 RNA의 혼성체를 함유하는 나노 리포좀 전달체 조성물

Country Status (3)

Country Link
US (2) US10363217B2 (ko)
KR (1) KR101710026B1 (ko)
WO (1) WO2018030608A1 (ko)

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109072205A (zh) * 2016-02-10 2018-12-21 密歇根大学董事会 核酸的检测
KR101710026B1 (ko) * 2016-08-10 2017-02-27 주식회사 무진메디 Cas9 단백질 및 가이드 RNA의 혼성체를 함유하는 나노 리포좀 전달체 조성물
KR101796036B1 (ko) 2016-12-29 2017-11-10 주식회사 무진메디 Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체가 봉입된 나노 리포좀 전달체 조성물 또는 이를 함유하는 KRAS 유전자 변이에 따른 항암제 저항성 대장암 치료제
KR101870694B1 (ko) 2017-10-18 2018-06-25 주식회사 무진메디 Cas9 단백질, SRD5A2 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체가 봉입된 나노 리포좀-마이크로버블 결합체 및 이를 함유하는 탈모 개선 또는 치료용 조성물
KR101918250B1 (ko) 2018-06-18 2018-11-13 주식회사 무진메디 탈모 치료용 약물이 봉입된 나노 리포좀-마이크로버블 결합체 및 이를 함유하는 탈모 개선 또는 치료용 조성물
EP4119166A1 (en) 2020-03-12 2023-01-18 Institute for Basic Science Composition for inducing apoptosis of cells having genomic sequence variation and method for inducing apoptosis of cells by using composition
KR102328197B1 (ko) * 2021-03-09 2021-11-17 주식회사 무진메디 Kras 및 p53 유전자의 편집 기능이 있는 나노 리포좀 전달체 조성물
KR102544632B1 (ko) 2022-08-05 2023-06-16 주식회사 무진메디 장쇄 세라마이드가 포함된 지질 나노입자 및 이를 포함하는 세포 사멸용 조성물
KR102569192B1 (ko) 2023-02-24 2023-08-22 주식회사 무진메디 장쇄 세라마이드가 포함된 지질 나노입자 및 이를 포함하는 세포 성장용 조성물

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014204728A1 (en) * 2013-06-17 2014-12-24 The Broad Institute Inc. Delivery, engineering and optimization of systems, methods and compositions for targeting and modeling diseases and disorders of post mitotic cells
WO2016100857A1 (en) * 2014-12-19 2016-06-23 Regeneron Pharmaceuticals, Inc. Stem cells for modeling type 2 diabetes

Family Cites Families (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7341835B2 (en) 2004-01-13 2008-03-11 Affymetrix, Inc. Methods of analysis of alternative splicing in mouse
LT3401400T (lt) 2012-05-25 2019-06-10 The Regents Of The University Of California Būdai ir kompozicijos, skirtos rnr molekulės nukreipiamai tikslinės dnr modifikacijai ir rnr molekulės nukreipiamam transkripcijos moduliavimui
DE202013012597U1 (de) 2012-10-23 2017-11-21 Toolgen, Inc. Zusammensetzung zum Spalten einer Ziel-DNA, umfassend eine für die Ziel-DNA spezifische guide-RNA und eine Cas-Protein-codierende Nukleinsäure oder ein Cas-Protein, sowie deren Verwendung
US8697359B1 (en) 2012-12-12 2014-04-15 The Broad Institute, Inc. CRISPR-Cas systems and methods for altering expression of gene products
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US20160237455A1 (en) 2013-09-27 2016-08-18 Editas Medicine, Inc. Crispr-related methods and compositions
WO2015089473A1 (en) 2013-12-12 2015-06-18 The Broad Institute Inc. Engineering of systems, methods and optimized guide compositions with new architectures for sequence manipulation
MX2016007327A (es) 2013-12-12 2017-03-06 Broad Inst Inc Suministro, uso y aplicaciones terapeuticas de sistemas y composiciones crispr-cas para dirigirlos a trastornos y enfermedades usando componentes para suministro de particulas.
CN107530399B (zh) 2014-10-10 2022-03-18 马萨诸塞眼科耳科诊所 治疗分子在体外和体内的有效递送
AU2016209295B2 (en) 2015-01-21 2021-08-12 Genevant Sciences Gmbh Methods, compositions, and systems for delivering therapeutic and diagnostic agents into cells
US10787523B2 (en) 2015-01-29 2020-09-29 University Of Massachusetts Nanoparticle-protein complex for intracellular protein delivery
JP6873911B2 (ja) 2015-04-06 2021-05-19 ザ ボード オブ トラスティーズ オブ ザ レランド スタンフォード ジュニア ユニバーシティー 初代細胞において標的核酸の遺伝子調節を誘導するためにインビトロで行う方法
EP3087974A1 (en) 2015-04-29 2016-11-02 Rodos BioTarget GmbH Targeted nanocarriers for targeted drug delivery of gene therapeutics
US10626393B2 (en) 2015-06-04 2020-04-21 Arbutus Biopharma Corporation Delivering CRISPR therapeutics with lipid nanoparticles
AU2016280893B2 (en) 2015-06-18 2021-12-02 Massachusetts Institute Of Technology CRISPR enzyme mutations reducing off-target effects
US20180243446A1 (en) 2015-09-01 2018-08-30 The Hospital For Sick Children Method and compositions for removing duplicated copy number variaions (cnvs) for genetic disorders and related uses
WO2017066707A1 (en) 2015-10-14 2017-04-20 Life Technologies Corporation Ribonucleoprotein transfection agents
EP3373938A4 (en) 2015-11-09 2019-05-15 Seattle Children's Hospital (DBA Seattle Children's Research Institute) NOVEL RNA-BASED VECTOR SYSTEM FOR TEMPORARY AND STABLE GENE EXPRESSION
KR101710026B1 (ko) * 2016-08-10 2017-02-27 주식회사 무진메디 Cas9 단백질 및 가이드 RNA의 혼성체를 함유하는 나노 리포좀 전달체 조성물

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014204728A1 (en) * 2013-06-17 2014-12-24 The Broad Institute Inc. Delivery, engineering and optimization of systems, methods and compositions for targeting and modeling diseases and disorders of post mitotic cells
WO2016100857A1 (en) * 2014-12-19 2016-06-23 Regeneron Pharmaceuticals, Inc. Stem cells for modeling type 2 diabetes

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI, GenBank 14 July 2016 (2016-07-14), "dipeptidyl peptidase IV {promoter} [human, placenta, Genomic, 2435 nt]", XP055603826, Database accession no. S79876.1 *
KEE, P. H.: "Synthesis, acoustic stability, and pharmacologic activities of papaverine-loaded echogenic liposomes for ultrasound controlled drug delivery", JOURNAL OF LIPOSOME RESEARCH, vol. 18, no. 4, 2008, pages 263 - 277, XP055603832, ISSN: 0898-2104, DOI: 10.1080/08982100802354558 *
WANG, L.: "In vivo delivery systems for therapeutic genome editing", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 17, no. 5, 27 April 2016 (2016-04-27), pages 626, XP055499285, DOI: 10.3390/ijms17050626 *

Cited By (35)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Also Published As

Publication number Publication date
US11364201B2 (en) 2022-06-21
US20180193269A1 (en) 2018-07-12
US10363217B2 (en) 2019-07-30
US20200146988A1 (en) 2020-05-14
KR101710026B1 (ko) 2017-02-27

Similar Documents

Publication Publication Date Title
WO2018030608A1 (ko) Cas9 단백질 및 가이드 RNA의 혼성체를 함유하는 나노 리포좀 전달체 조성물
AU2018208708A1 (en) Delivery system for functional nucleases
WO2018124538A1 (ko) Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체가 봉입된 나노 리포좀 전달체 조성물 또는 이를 함유하는 KRAS 유전자 변이에 따른 항암제 저항성 대장암 치료제
WO2010041913A2 (ko) Grs 단백질 또는 이의 단편의 신규한 용도
WO2022191431A1 (ko) Kras 및 p53 유전자의 편집 기능이 있는 나노 리포좀 전달체 조성물
CA2551064A1 (en) Compounds, pharmaceutical compositions and therapeutic methods of preventing and treating diseases and disorders associated with amyloid fibril formation
WO2015137705A1 (ko) 세포 투과성 펩티드 및 이를 이용한 생물학적 활성 물질의 전달방법
WO2019078611A1 (ko) Cas9 단백질, SRD5A2 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체가 봉입된 나노 리포좀-마이크로버블 결합체 및 이를 함유하는 탈모 개선 또는 치료용 조성물
WO2012050402A2 (ko) 세포투과성 parkin 재조합 단백질 및 이를 함유하는 퇴행성 뇌질환 치료용 약학적 조성물
WO2019117660A2 (ko) Crispr 시스템 기능 향상 방법 및 그의 이용
WO2018074682A1 (ko) 항비만 및 항당뇨 효능을 갖는 펩타이드 및 이의 용도
WO2023282688A1 (ko) 산화스트레스 저항성을 갖는 중간엽 줄기세포, 이의 제조방법 및 용도
US20230257722A1 (en) Nucleases For Genome Editing
WO2023008933A1 (ko) 혈액 적합성을 갖는 중간엽 줄기세포, 이의 제조방법 및 용도
WO2022164288A1 (ko) 비염증성 식세포작용 유도 활성을 갖는 융합분자
WO2018004294A9 (ko) 인간 성장호르몬 변이 단백질 또는 이의 트랜스페린 융합 단백질을 유효성분으로 포함하는 약학적 조성물
WO2022010241A1 (ko) 질환 세포-특이적인 mirna에 의해 세포 생리 활성 조절 물질의 활성을 조절하는 복합체 및 이를 crispr/cas 시스템에 적용한 질환 특이적 유전자 조작용 복합체
WO2021172925A1 (ko) Apoe4 rna 특이적 트랜스-스플라이싱 리보자임 및 이의 용도
WO2021125762A1 (ko) 혈뇌장벽 투과능을 가지는 펩티드 핵산 복합체를 유효성분으로 함유하는 치매 예방 또는 치료용 조성물
WO2020139031A1 (ko) Crispr-cas를 기반으로 하는 유전자 교정용 조성물
WO2020235936A1 (ko) Pd-1의 발현을 억제하는 비대칭 sirna
WO2023008887A1 (ko) 염기 편집기 및 이의 용도
WO2022260468A1 (ko) 신규 fgf21 변이체 개발 및 이의 생산기법과 용도
WO2018164507A2 (ko) Mast4 유전자를 이용한 세포외 기질 생산용 조성물 및 그 제조방법
WO2022065726A1 (ko) 신규의 cd47 바인더와 폴리뉴클레오티드를 포함하는 암 치료를 위한 리포좀 복합체

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17839626

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205N DATED 16/04/2019)

122 Ep: pct application non-entry in european phase

Ref document number: 17839626

Country of ref document: EP

Kind code of ref document: A1