WO2019050071A1 - 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물 - Google Patents

엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2019050071A1
WO2019050071A1 PCT/KR2017/009910 KR2017009910W WO2019050071A1 WO 2019050071 A1 WO2019050071 A1 WO 2019050071A1 KR 2017009910 W KR2017009910 W KR 2017009910W WO 2019050071 A1 WO2019050071 A1 WO 2019050071A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
exosome
liver fibrosis
derived
mir
Prior art date
Application number
PCT/KR2017/009910
Other languages
English (en)
French (fr)
Inventor
홍재상
이도훈
장유진
김종훈
이영식
Original Assignee
고려대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 고려대학교 산학협력단 filed Critical 고려대학교 산학협력단
Priority to US16/645,180 priority Critical patent/US11667916B2/en
Priority to PCT/KR2017/009910 priority patent/WO2019050071A1/ko
Publication of WO2019050071A1 publication Critical patent/WO2019050071A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/13—Nucleic acids or derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/37—Digestive system
    • A61K35/407—Liver; Hepatocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2207/00—Modified animals
    • A01K2207/20—Animals treated with compounds which are neither proteins nor nucleic acids
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0331—Animal model for proliferative diseases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs

Definitions

  • the present invention relates to a composition for preventing or treating liver fibrosis or a cell treatment agent comprising a ribonucleic acid derived from exosomes or exosomes.
  • Liver fibrosis is caused by the combination of collagen and extracellular matrix (ECM), which are secreted in hepatic stellate cells, as the inflammatory reaction progresses due to damage of liver tissue. It is the process of wound healing. This progression of liver fibrosis develops into liver cirrhosis, in which a large amount of collagen is deposited in the liver tissue and the regenerative nodule is surrounded by collagen and has an abnormal structure.
  • ECM extracellular matrix
  • liver fibrosis can be improved according to the treatment method. Therefore, unlike cirrhosis, it is recognized as a reversible disease.
  • Cellular therapies are a series of "extracorporeal, autologous, allogenic, or xenogenic cells that are used to reproduce the functions of cells and tissues, to alter the biological properties of cells in various ways, Drug for the purpose of treatment, diagnosis and prevention through the act of '.
  • the cell therapy agent can be divided into a somatic cell treatment agent and a stem cell treatment agent.
  • the stem cell treatment agent can be divided into embryonic stem cell treatment agent and adult stem Cells (adult stem cells) can be categorized as a remedy.
  • adult stem cell therapy is an area where industrialization is progressing so much that it accounts for 99% of the worldwide stem cell therapy market.
  • Mesenchymal stem cells one of the adult stem cells, are pluripotent cells capable of differentiating into mesenchymal tissues such as bone, cartilage, muscle and liver under specific culture conditions. They can be easily separated and can be easily isolated It is advantageous in that it can secure the amount. In addition, the use of allogeneic hepatocellular carcinoma cells is very valuable because it helps to fix the cells and prolong the survival period of the transplanted cells.
  • mesenchymal stem cells have been shown to secrete various substances (cecum) that induce nerve, angiogenesis, and anti-inflammatory responses.
  • cecromium can help alleviate diseases such as cancer and heart disease. Therefore, the possibility of cell-free therapy using ciclom in the field of tissue treatment and regeneration has been suggested, but the research on hepatic fibrosis has not been conducted at present.
  • cecroms there is a lack of research on the specific components of cecroms that show therapeutic effects, and they also have an understanding of how certain mechanisms affect the recovery of damaged tissue through certain mechanisms and regulatory networks Further studies are needed to supplement this.
  • Exocose implicated in cecromium is an important mediator that carries a specific component from one cell to another and can cause a change in the gene expression of cells that receive it.
  • Exosomes are 40-100 nm in size and act as extracellular vesicles and are secreted from various cells including stem cells and present in blood, biological fluids, urine and cell culture fluids .
  • exosomes are produced by the fusion of endoplasmic reticulum with late endosomes generated through intracellular endomorphism trafficking.
  • exosomes contain specific proteins and mRNA transcripts expressed in the cells, but also importantly RNAs contain a variety of small non-coding RNAs (microRNAs, piRNAs, etc.) that regulate gene expression. Thus, it is known that exosomes reflect the genetic characteristics of the cells of origin.
  • ncRNA Small non-coding RNA
  • ncRNA small non-coding RNA
  • ncRNA small non-coding RNA
  • ncRNA is a type of RNA transcript that is not translated into protein, it has been reported to regulate the stability, transcription and translation of various genes.
  • RNAs transcribed from the human genome 97% are ncRNAs that are not translated into proteins.
  • ncRNA is closely related to various biological processes in vivo, and research on this is being evaluated as a hot topic in the field of life sciences.
  • microRNAs of these ncRNAs are small RNAs with a size of about 22 nucleotides, which causes RNA interference that regulates gene expression by degrading mRNA complementary to nucleotide sequences or by inhibiting translation into proteins.
  • RNA interference is closely related to virtually all biological processes, including the development and physiology of the body, cell differentiation, proliferation and death, and the stability of the genome, and is also closely linked to virus resistance and various human diseases. Based on the linkage between RNA interference and disease, competitive research for the development of therapeutic agents for human diseases is underway worldwide.
  • RNA interference technology is continuously increasing due to infinite possibility in the medical application field including the basic field.
  • the world market for RNA interference technology grew tremendously from $ 48 million in 2003 to $ 328 million in 2010.
  • the new report, released by BBC Research, is expected to reach $ 3.6 billion in 2013, with an average annual growth rate of 83.4%.
  • Jain PharmaBioTech research the scale of new drug development based on RNA interference technology has doubled from $ 500 million in 2004 to $ 1 billion in 2010, and another research shows that the RNA interference therapy industry The market size is expected to reach $ 2.3 billion by 2013.
  • the present inventors have discovered exonome and exosome-derived ribonucleic acid which are effective for the recovery of liver fibrosis and investigated their inhibitory effect on liver fibrosis. As a result, Thereby completing the invention.
  • an object of the present invention is to provide a composition for preventing or treating liver fibrosis comprising exo-soma or exosomal-derived ribonucleic acid.
  • the present invention provides a pharmaceutical composition for preventing or treating liver fibrosis comprising exo soma or exosomal-derived ribonucleic acid.
  • the present invention also provides a food composition for preventing or ameliorating liver fibrosis comprising exo soma or exosomal-derived ribonucleic acid.
  • the present invention also provides a cell therapy agent for preventing or treating liver fibrosis comprising exo soma or exosomal-derived ribonucleic acid.
  • the present invention provides a method for preventing or treating liver fibrosis, comprising administering exosome or exosome-derived ribonucleic acid to a subject in need thereof.
  • the present invention provides a method for improving liver fibrosis, comprising administering exo soma or exosomal-derived ribonucleic acid to a subject in need thereof.
  • the exosome of the present invention and the ribonucleic acid derived therefrom have an effect of inhibiting the activity of hepatic stellate cells and Cooper cells and decreasing the expression of? -SMA, inhibiting the deposition of collagen and inhibiting the progress of liver fibrosis , And may be useful as a cell therapy agent for preventing or treating liver fibrosis.
  • FIG. 1 is a graph showing the results of analysis of markers of mesenchymal stem cells.
  • FIG. 2 shows the results of induction of differentiation of mesenchymal stem cells into fat, bone, and cartilage cells (scale bar: 100 ⁇ m).
  • FIG. 3 is a graph showing the results of confirming whether proliferation of mesenchymal stem cells is observed in a culture solution containing exosome-deficient FBS.
  • FIG. 4 is a diagram showing steps of inducing differentiation of undifferentiated mesenchymal stem cells into hepatocyte-like cells.
  • FIG. 5 is a diagram showing a morphological change according to the stage of differentiation from undifferentiated mesenchymal stem cells into hepatocyte-like cells (scale bar: 100 ⁇ m).
  • FIG. 6 shows the results of analysis of expression of hepatocyte-associated genes in mesenchymal stem cells and hepatocyte-like cells using RT-PCR.
  • FIG. 7 is a graph showing the results of analysis of the secretion ability of albumin and urea in mesenchymal stem cells and hepatocyte-like cells.
  • FIG. 8 is a graph showing the results of analysis of glycogen storage capacity and ICG absorption function in hepatocyte-like cells (scale bar: 100 ⁇ m).
  • 9 is a flow chart for isolating exosomes from undifferentiated mesenchymal stem cells and hepatocyte-like cells.
  • FIG. 10 is a diagram showing the size distribution of exosomes isolated from undifferentiated mesenchymal stem cells and hepatocyte-like cells through NTA analysis.
  • FIG. 11 is a diagram showing the results of observation of exosomes isolated from undifferentiated mesenchymal stem cells and hepatocyte-like cells by a transmission electron microscope (TEM) (scale bar: 100 nm).
  • TEM transmission electron microscope
  • FIG. 12 is a graph showing the results of the hepatotoxicity test performed in an animal model of chronic liver fibrosis.
  • FIG. 13 shows the result of confirming the extent of collagen deposition in an animal model of chronic liver fibrosis.
  • FIG. 14 is a graph showing the results of hepatotoxicity test according to the treatment with exosomes in mesenchymal stem cells and hepatocyte-like cells.
  • 15 is a graph showing the result of confirming the degree of collagen deposition according to the treatment with exosomes in mesenchymal stem cells and hepatocyte-like cells.
  • FIG. 16 is a graph showing the results of analysis of hepatic stellate cells and Cooper cells activity in mesenchymal stem cells and hepatocyte-like cells by treatment with exosomes.
  • FIG. 17 is a graph showing the results of analysis of expression of? -SMA according to exosomal treatment in mesenchymal stem cells and hepatocyte-like cells.
  • FIG. 18 is a graph showing the results of isolation of small RNAs present in isolated exosomes from mesenchymal stem cells and hepatocyte-like cells.
  • FIG. 19 is a graph showing the results of immunofluorescence staining and analysis of liver tissue gene expression of liver tissue after administration of exosomes derived from HeLa cells and HEK293T cells.
  • FIG. 19 is a graph showing the results of immunofluorescence staining and analysis of liver tissue gene expression of liver tissue after administration of exosomes derived from HeLa cells and HEK293T cells.
  • FIG. 20 is a graph showing the results of comparison of expression patterns of exosomal microRNAs derived from mesenchymal stem cells and hepatocyte-like cells.
  • FIG. 21 is a graph showing the results of analysis of activity of hepatic stellate cells transfected with the microRNAs according to the control and the present invention.
  • FIG. 22 is a graph showing the results of confirming the effect of transferring the hepatic stellate cell target peptide fusion exosomal microRNA into the hepatic stellate cells.
  • FIG. 23 is a diagram showing the result of Sirius Red staining of liver tissue after administration of microRNA to an animal model of liver fibrosis.
  • FIG. 24 is a diagram showing the result of immunofluorescence staining of liver tissue after administration of microRNA to an animal model of liver fibrosis.
  • the present invention provides a composition for preventing or treating liver fibrosis comprising exo-soma or exosomal-derived ribonucleic acid.
  • the composition comprises a pharmaceutical composition, or a food composition.
  • exosome in the present invention means a small vesicle of membrane structure that is secreted from various cells.
  • the diameter of the exosome is about 30-100 nm, which means a follicle that is fused to the plasma membrane and released into the extracellular environment.
  • exosomes may originate from mesenchymal stem cells or hepatocyte-like cells.
  • stem cell refers to a cell that has the ability to self-replicate and has the ability to differentiate into two or more different types of cells.
  • the stem cells may be autologous or allogeneic stem cells, and may be derived from any type of animal, including human and non-human mammals, whether stem cells are derived from an adult or stem cells derived from an embryo.
  • the stem cells of the present invention include embryonic stem cells, adult stem cells, or degenerated stem cells, preferably adult stem cells.
  • the adult stem cells can be isolated from various tissues and include, for example, placenta-derived stem cells, bone marrow-derived stem cells, cord blood-derived stem cells, fat-derived stem cells, stillborn fetal brain derived neural stem cells, mesenchymal stem cells derived from adult cells, and the like, preferably human mesenchymal stem cells.
  • the mesenchymal stem cells may be mesenchymal stem cells derived from umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane and placenta, but are not limited thereto.
  • the hepatocyte-like cell (HLC) of the present invention includes cells derived from undifferentiated mesenchymal stem cells to induce differentiation into hepatocytes, and a method of inducing differentiation to undifferentiated mesenchymal stem cells is known in the art Lt; / RTI >
  • exosomal RNAs derived from exosomes &quot refers to ribonucleic acids derived from exosomes.
  • ribonucleic acid may include small RNA
  • small RNA refers to a short-length RNA of 200 nucleotides or less in length, which effectively prevents translation of a specific mRNA through complementary binding without being translated into a protein.
  • Small RNAs include siRNAs (small interfering RNAs), miRNAs (microRNAs), piRNAs (Piwi-associated RNAs), and Longer non-coding RNAs.
  • siRNAs are formed by cleavage of long double-stranded RNA molecules (20-25 nucleotides in length). siRNAs are particularly important to counteract the active tamsing of the transposon and viral infections and can regulate the gene encoding the protein. The synthesized siRNA can be artificially expressed for experimental purposes.
  • miRNA is a small RNA that is encoded by a specific gene and is a single-stranded RNA molecule that binds to the 3'-UTR of mRNA (messenger RNA) and controls the expression of eukaryotic genes (length 20-25 nucleotides).
  • the production of miRNA is made into a stem-loop structure precursor miRNA (pre-miRNA) by Drosha (RNase III type enzyme), and it is transferred to the cytoplasm and cleaved by Dicer to be made into mature miRNA.
  • pre-miRNA stem-loop structure precursor miRNA
  • Dicer Dicer to be made into mature miRNA.
  • the number of miRNAs is the number assigned to the order in which the small RNAs (small RNAs) are found, which is obvious to those skilled in the art (http://www.mirbase.org).
  • the piRNA is a small RNA (length 25-30 nucleotides) produced from a long single-strand precursor.
  • the piRNA functions in association with the piwi subfamily of the Argonaute protein and is essential for the development of germ cells.
  • the ribonucleic acid of the present invention is derived from exosomes and can affect liver fibrosis, for example miR-136, miR-199a, miR-409, miR-410 or mir- But is not limited thereto.
  • composition of the present invention may include, but is not limited to, the miRNA itself, but may include fragments thereof.
  • the miR-136 may be represented by the following SEQ ID NO: 1, which is a mature form of miR-136 and is derived from a precursor microRNA of a hairpin structure.
  • the miR-199a may be represented by the following SEQ ID NO: 2, which is a mature form of miR-199a and is derived from a precursor microRNA of a hairpin structure.
  • the miR-409 may be represented by SEQ ID NO: 3 below, which is a mature form of miR-409 and is derived from a precursor microRNA of a hairpin structure.
  • the miR-410 may be represented by the following SEQ ID NO: 4, which is a mature form of miR-410 and is derived from a precursor microRNA of a hairpin structure.
  • the miR-432 may be represented by SEQ ID NO: 5 below, which is a mature form of miR-432 and is derived from a precursor microRNA of a hairpin structure.
  • the present invention also includes a nucleic acid molecule having a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NOS: 1 to 5, and a mutant capable of functionally performing the function.
  • the nucleic acid molecule of the present invention may be nucleic acid analog molecules such as RNA, DNA, sugar-or skeletal-modified nucleotides or deoxyribonucleotides. It may also be, but is not limited to, other nucleic acid analog molecules such as PNA (peptide nucleic acids) or LNA (locked nucleic acids).
  • PNA peptide nucleic acids
  • LNA locked nucleic acids
  • the nucleic acid molecule of the present invention can be adapted to efficiently and smoothly flow into a cell.
  • the nucleic acid can be conjugated to and / or complexed with a transferring reactant (e. G., A cationic liposome).
  • a transferring reactant e. G., A cationic liposome
  • the nucleic acid can be complexed with, or conjugated to, a protein that increases the nuclease resistance of the oligonucleotide and increases cellular uptake (e.g., Atelocollagen).
  • &quot hepatic fibrosis " in the present invention refers to a condition in which the fiber increases between the results of liver failure.
  • hepatic fibrosis may include, without limitation, diseases that may be caused by an increase in hepatic fibrosis, and may include hepatic fibrosis, portal hepatic cirrhosis, necrotic hepatocirrhosis, biliary cirrhosis, nutritional liver cirrhosis, alcoholic liver cirrhosis, viral hepatitis cirrhosis, Cholestatic liver cirrhosis, cardiac cirrhosis, and the like.
  • diseases that may be caused by an increase in hepatic fibrosis and may include hepatic fibrosis, portal hepatic cirrhosis, necrotic hepatocirrhosis, biliary cirrhosis, nutritional liver cirrhosis, alcoholic liver cirrhosis, viral hepatitis cirrhosis, Cholestatic liver cirrhosis, cardiac cirrhosis, and the like.
  • the present invention is not limited thereto.
  • liver fibrosis refers to a condition in which hepatocellular carcinoma (collagen) and extracellular matrix (extracellular matrix, ECM Quot;) < / RTI > of the wound healing process.
  • ECM Quot extracellular matrix
  • RTI &gt extracellular matrix
  • liver cirrhosis is also referred to as liver cirrhosis. It is also referred to as " liver cirrhosis " in which hepatic tissue is replaced with a fibrotic tissue such as regenerative nodules.
  • liver cirrhosis refers to chronic diseases. It is a chronic complication of chronic liver diseases, metabolic disturbances due to hepatic dysfunction, and symptoms due to portal blood flow disorders. It is morphologically divided into portal, necrotic and biliary. Causes can be divided into nutritional, alcoholic, viral hepatitis, cholestatic, cardiac.
  • Fibrosis of liver tissue can be caused by various causes such as hepatitis virus, alcohol, and other toxic substances.
  • the exosome or ribonucleic acid of the present invention has an effect of reducing the expression of? -SMA.
  • Liver fibrosis is caused by chronic liver damage and is caused by a network of extracellular matrix and fibrosis-associated signaling pathways.
  • Such a signal transduction system has a transforming growth factor? Signaling system, and the composition of the present invention reduces the expression of? -SMA expressed in hepatic stellate cells activated by the TGF-? Signaling system, It can inhibit fibrosis, and this has been specifically confirmed in the examples of the present invention.
  • exosome or ribonucleic acid of the present invention may further comprise one or more known active ingredients having an effect of preventing or treating liver fibrosis.
  • the pharmaceutical composition of the present invention may be formulated into a unit dosage form suitable for intra-body administration of an individual according to a conventional method in the pharmaceutical field.
  • suitable formulations for this purpose include injections such as ampoules injected as parenteral dosage forms, injecting agents such as injection bags, and spray agents such as aerosol formulations.
  • the injectable ampoule may be mixed with an injection solution immediately before use, and physiological saline, glucose, Ringer's solution or the like may be used as an injection solution.
  • the injection bag may be made of polyvinyl chloride or polyethylene.
  • compositions of the present invention may further comprise suitable carriers routinely used in the manufacture of pharmaceutical compositions.
  • suitable carriers routinely used in the manufacture of pharmaceutical compositions.
  • a preservative, an anhydrous agent, a solubilizing agent or a stabilizer may be added in the case of an injection, and a base, an excipient, a lubricant or a preservative in the case of a preparation for topical administration.
  • compositions of the present invention may be administered to a subject in a variety of routes. All modes of administration may be expected, for example, by oral, rectal, intraperitoneal, intravenous, intramuscular, subcutaneous, intra-dural or intracerebral injection, preferably intraperitoneal But is not limited thereto.
  • exosome, exosome-derived ribonucleic acid or composition of the present invention can be used alone or in combination with methods for the treatment or prevention of liver fibrosis or using surgery, radiation therapy, hormone therapy, chemotherapy and biological response modifiers have.
  • " prophylactic " in the present invention may mean all actions that inhibit or delay the onset of hepatic fibrosis by administering to a subject a composition for the prevention or treatment of hepatic fibrosis according to the present invention.
  • " treatment " as used herein in the present invention means all the actions of causing the composition according to the present invention to be administered to suspected individuals with hepatic fibrosis so that symptoms of hepatic fibrosis can be improved or benefited.
  • the term "individual" may refer to any animal, including a human, who has or may have developed hepatic fibrosis.
  • composition of the present invention may be added to a food composition, preferably a health functional food, for the purpose of preventing or improving liver fibrosis.
  • the term "health functional food” refers to a food having a biological control function such as prevention and improvement of disease, bio-defense, immunity, recovery of disease and aging inhibition.
  • the mixing amount of the active ingredient contained in the food composition of the present invention can be suitably determined according to the purpose of use (prevention, health or therapeutic treatment), but is not limited thereto.
  • the present invention also provides a cell therapy agent for preventing or treating liver fibrosis comprising exo soma or exosomal-derived ribonucleic acid.
  • " cell therapeutic agent " in the present invention refers to a therapeutic agent using autologous, allogenic, xenogenic cells for restoring the function of tissue, and used in the present invention for inhibiting liver fibrosis or cirrhosis It refers to a cure.
  • the cell therapeutic agent of the present invention can be used as an agent for preventing or treating diseases such as skin, cartilage, bone, blood vessel, brain, liver, heart, ligament, muscle, spinal cord, blood, bone marrow, lung, tooth, nerve, cornea, retina, esophagus, spine, May be used to regenerate selected tissues, but is not limited thereto.
  • diseases such as skin, cartilage, bone, blood vessel, brain, liver, heart, ligament, muscle, spinal cord, blood, bone marrow, lung, tooth, nerve, cornea, retina, esophagus, spine, May be used to regenerate selected tissues, but is not limited thereto.
  • the present invention may include a vial, an ampule or a syringe in which the cell therapeutic agent is frozen.
  • the positive marker CD73 was 99.17% and the CD44 was 99.6%.
  • the negative markers CD34 and CD45 were expressed in 0.21% and 0.14%, respectively I could not confirm it.
  • Stempro adipocyte differentiation kit Stempro osteocyte differentiation kit
  • Stempro chondrocyte differentiation kit (gibco) were used for differentiation into adipocytes, bone cells, and chondrocytes.
  • mesenchymal stem cells were seeded on a 12-well plate at 1 ⁇ 10 4 or 3 ⁇ 10 4 , respectively, and then cultured for 3 days for about 4 weeks while replacing each differentiation inducing medium. After completion of differentiation, each cell was stained with Oil-red O and Alizarin-Red S staining.
  • chondrocyte differentiation 1 ⁇ 10 4 mesenchymal stem cells were subjected to haning-drop culturing in 10 ⁇ l culture for 48 hours, and then the cells formed with spheroids were transferred to cell culture plates and cultured for 3 days for 4 weeks. The cells were cultured while being replaced. The differentiated cells were frozen sectioned and then differentiated through Alcian Blue staining. The results are shown in FIG.
  • Example 2 Exosome lack of FBS The concentration of Intermediate lobe Confirmation of stem cell proliferation
  • the exosomes should not be present in the FBS to be added to the basal cultures of the mesenchymal stem cells.
  • mesenchymal stem cell culture broth was supplemented with exosome - deficient FBS, and it was confirmed by WST assay whether mesenchymal stem cell proliferation was not problematic.
  • the measurement of the formation of the formazan coloring substance in WST-1 (Tetrazolium Salts) by the mitochondrial dehydrogenase occurring in the cell metabolism is carried out by measuring the presence of the chromogenic substance called formazan in the mitochondrial electron transport system of metabolically active cells It is effective only for living cells by succinatetrazolium reductase, a dehydrogenase, and its color intensity shows a linear correlation with the number of cells.
  • the results of the WST assay are shown in FIG.
  • Example 3 undifferentiation Intermediate lobe Cross-differentiation induction from stem cells to hepatocyte-like cells
  • the first step was seeding at 3.0 ⁇ 10 4 cells / cm 2 with the basic culture medium of the mesenchymal stem cells on a cell culture plate coated with collagen type I of 5 ng / cm 2 , and about 80% confluence confluence).
  • IMDM Iscove's Modified Dulbecco's Medium
  • EGF epidermal growth factor
  • bFGF basic fibroblast growth factor
  • the third step is to change the culture medium every two days for 10 days in the culture medium supplemented with HGH (hepatocyte growth factor), basic FGF, nicotinamide and ITS (insulin-transferrin-sodium selenite) Lt; / RTI >
  • HGH hepatocyte growth factor
  • basic FGF basic FGF
  • nicotinamide ITS
  • ITS insulin-transferrin-sodium selenite
  • Example 4 Intermediate lobe Characterization of stem cells and differentiation-induced hepatocyte-like cells
  • FIG. 7 shows the result of comparing the amount of albumin and urea secreted in the culture medium with that of mesenchymal stem cells by securing the cell culture medium induced to differentiate into hepatocyte-like cells.
  • glycogen storage capacity was increased in hepatocyte-like cells, and it was confirmed that absorption of hepatocyte-like cells was increased when ICG was added to mesenchymal stem cell (MSC) and hepatocyte-like cell (HLC) culture medium.
  • MSC mesenchymal stem cell
  • HSC hepatocyte-like cell
  • the hepatocyte-like cells derived as described above have characteristics represented by normal hepatocytes.
  • Example 5 Intermediate lobe In stem cells and hepatocyte-like cell culture medium Exosome Separation and characterization
  • exosomes were obtained as shown in Fig.
  • the mesenchymal stem cells or hepatocyte-like cells were cultured, and the culture solution was collected. After centrifugation to separate the cells, a 0.22 ⁇ m filter was used to remove the aggregate from the supernatant.
  • 100 ml of a 100-kDa cut-off centrifugal filter (ExoQuick-TC) was mixed with the culture medium and stored at low temperature for one day. Finally, centrifugation And the precipitated exosomes were extracted. The obtained exosomes were diluted with PBS, lysis buffer, or Trizol according to the following experiment.
  • NTA nanoparticle tracking assay
  • the obtained exosomes were diluted with PBS to an appropriate concentration, placed in a Nanosight equipment, and the size distribution of the exosomes was confirmed by analyzing the image of the exosomes reflected from the laser, which is shown in FIG.
  • exosome derived from mesenchymal stem cells and hepatocyte-like cells can be extracted by the above-described method.
  • TEM transmission electron microscope
  • mesenchymal stem cells MSC
  • HLC hepatocyte-like cell
  • Example 6 Chronic Liver fibrosis For animal models Exosome Verification of hepatic damage recovery efficacy by administration
  • a chronic hepatic fibrosis model was constructed by the long-term administration of TAA (thioacetamide) to the peritoneal cavity of mice through a known method (3 times a week, 8 weeks). Hepatic toxicity test (ALT / AST) and Sirius Red staining were performed in the serum of the mice in which administration of TAA was completed to confirm the production of a chronic liver fibrosis mouse model, and the results are shown in FIG. 12 and FIG.
  • hepatic toxicity test results confirmed that both serum AST and ALT values were highly measured in the TAA-administered mouse test group (TAA).
  • TAA TAA-administered mouse test group
  • Fig. 13 the degree of deposition of collagen was found to be high in TAA-administered mouse group (TAA) through Sirius red staining.
  • the animal model produced by the method was utilized as a study resource for chronic liver fibrosis animal models for mesenchymal stem cell and hepatocyte-like cell exosome treatment.
  • TAA was administered for a long time to obtain a model of chronic liver fibrosis (total 20 mice, 5 mice, TAA, 5 saline, TAA Five MSC exosomes and five HLC exosomes after TAA administration were prepared.
  • hepatic toxicity test (ALT / AST) was performed in the serum of the control group (normal saline, sham) and the test group (MSC-exo, HLC-exo) Is shown in Fig.
  • Liver fibrosis is a process of wound healing that is caused by the combination of extracellular matrix with a large amount of secreted collagen in hepatic stellate cells as the inflammatory reaction progresses due to damage of liver tissue.
  • the liver fibrosis continues to develop, it develops into a liver cirrhosis in which a large amount of collagen is deposited in the liver tissue, and the regenerated nodule is surrounded by the collagen and has an abnormal structure. It is therefore essential to identify the collagen deposited by the liver injury healing response.
  • hepatic stellate cells play an important role in the formation of collagen and extracellular matrix.
  • Cooper cells act as macrophages to remove them when they enter bacteria and toxins. When activated, various cytokines, reactive oxygen species (ROS) , which affect hepatocytes, endothelial cells, and hepatic stellate cells to promote liver fibrosis.
  • ROS reactive oxygen species
  • hepatic tissues were isolated from the mice and analyzed for alpha-smooth muscle actin ( ⁇ -SMA) and paraffin blocks F4 / 80 staining was performed to confirm the activity of hepatic stellate cells and Cooper cells, and the results are shown in Fig.
  • ⁇ -SMA alpha-smooth muscle actin
  • Example 7 In liver stellate cells ⁇ - Of SMA Due to decreased expression Exosomatic Confirming liver fibrosis treatment efficacy
  • Liver fibrosis is caused by chronic liver damage and is caused by a complex network of extracellular matrix and fibrosis-related signaling pathways. To determine whether it is associated with the TGF- ⁇ (transforming growth factor ⁇ ) signaling pathway , And the hepatic fibrosis-restoring effect was verified by comparing the amount of ⁇ -SMA expressed after treatment with exosomes in active hepatic stellate cells.
  • TGF- ⁇ transforming growth factor ⁇
  • the cultured hepatic stellate cells were seeded on a 6-well plate at 5 ⁇ 10 4 cells / cm 2 , and after 24 hours, the culture medium containing 0.2% FBS was changed to a quiescent hepatic stellate cell I made it. Then, 10 ng / ml of human TGF-beta was treated for 24 hours to cultivate the cells in an active state by TGF-beta. TGF- ⁇ was treated and about 3 ⁇ 10 9 exosomes were treated to confirm the activation of the TGF- ⁇ signaling system through the expression amount of SMAD2 protein. The expression level of ⁇ -SMA was compared with the control group The results of verifying the efficacy of liver fibrosis treatment are shown in Fig.
  • ⁇ -SMA expression was decreased in serum-free (SF) medium treatment and increased again in TGF- ⁇ treatment. It was also confirmed that ⁇ -SMA expression was decreased when mesenchymal stem cells and hepatocyte-like cell exocytes were treated at the same time.
  • mesenchymal stem cells and hepatocyte-like cell exosomes were found to be effective in the treatment of liver fibrosis.
  • Example 8 exosome Isolation and identification of the derived small RNA
  • the conventional Trizol (phenol-guanidine thioacetamide) method was modified in order to isolate small RNAs in exosomes derived from mesenchymal stem cells and hepatocyte-like cells, which are effective for treatment of liver fibrosis .
  • RNA was precipitated.
  • RNAs of 200 nt or less were well isolated, and in the following, the effect of treating liver fibrosis using small RNAs of 200 nt or less was examined at the cell level.
  • Example 9 Through mass sequencing Exosome Identification and analysis of derived small RNA
  • Example 8 Based on the results of Example 8, the following experiment was carried out to identify small RNA derived from exosomes. First, it was confirmed that the numbers of macrophages (F4 / 80) and active hepatic stellate cells (a-SMA) were not significantly different from those of the control group after securing the exosomes derived from HeLa and HEK293T cells The expression patterns of hepatic fibrosis-related genes were similar to those of the control group in hepatocytes treated with HeLa cell-derived exosomes, and they were selected as control exosomes of high-throughput sequencing 19). The results of mass base sequence analysis are shown in Fig.
  • Example 10 Port Liver fibrosis Selection and production of candidate RNA
  • RNA-based RNA and exosomal RNA sequences among the first-selected microRNAs in Example 9 Based on the results of the analysis of the RNA-based RNA and exosomal RNA sequences among the first-selected microRNAs in Example 9, a total of five microRNAs expected to have antifibrinolytic activity were secondly screened. The sequence is shown in Table 1 and customized to a private biotechnology company.
  • Example 11 Chronic Liver fibrosis In animal models, Liver fibrosis MicroRNA Efficacy verification
  • microRNAs were stably injected into the peritoneal cavity of the mice.
  • plasmid DNA was prepared to fuse a peptide capable of targeting hepatic stellate cells to membrane protein (Lamp2b) of exosome, and transfection was performed on HeLa cells and HEK293T cells. The exosomes of each cell were extracted using an exosome extraction kit (Exoquick-TC).
  • TAF thioacetamide
  • RNA miR-409 or miR-410

Abstract

본 발명은 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물 또는 세포치료제에 관한 것이다. 본 발명의 엑소좀 및 이로부터 유래된 리보핵산은 간성상세포 및 쿠퍼세포의 활성을 억제하고 α-SMA의 발현을 감소시키는 효과가 있으며, 교원질의 침착을 억제하여 간섬유증의 진행을 억제시킴으로써 간섬유증의 예방이나 치료에 있어서 세포치료제로 유용하게 이용될 수 있다.

Description

엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물
본 발명은 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물 또는 세포치료제에 관한 것이다.
간섬유화 (Liver fibrosis)는 간 조직의 손상으로 인해 염증반응이 계속 진행됨에 따라 활성 간성상세포 (hepatic stellate cell)에서 다량 분비된 교원질 (collagen)과 세포 외기질 (extracellularmatrix, ECM)이 결합함으로써 나타나는 상처치유의 과정이다. 이러한 간섬유화가 지속적으로 진행되면 간 조직 내 교원질이 다량 침착되고, 재생결절이 교원질로 둘러싸여 비정상적인 구조를 지니게 되는 간 경화 (Liver cirrhosis)로 발달된다.
만성 간질환의 경우 현재 확실한 완치를 위한 특효약은 없으며, 특히 간경화까지 질환이 발달된 경우 비가역적이므로 이의 치료 방법에 대한 연구가 답보상태에 있다. 그러나 그 이전 단계인 간섬유화는 치료방법에 따라 호전될 수 있다는 연구결과가 있어 간경화와 달리 가역적 질환으로 인식되고 있다.
현재 간섬유화 진행을 억제하는 방법으로는 크게 간세포 손상의 원인 제거, 간 조직 내 염증반응 완화, 간섬유화 인자 활성억제, 활성 간성상세포 활성억제, 그리고 세포외기질 분해 등의 방법이 알려졌으나, 유전자 치료 및 줄기세포를 이용한 치료방법은 알려진 바가 거의 없다.
세포 치료제는 '세포와 조직의 기능을 복원하기 위하여 살아있는 자가 (autologous), 동종 (allogenic), 혹은 이종 (xenogenic)의 세포를 체외에서 증식, 선별하거나 여러 가지 방법으로 세포의 생물학적 특성을 변화시키는 일련의 행위를 통하여 치료, 진단, 예방의 목적으로 사용하는 의약품'으로 정의된다.
세포 치료제는 사용하는 세포의 종류 및 분화 정도에 따라 크게 체세포 치료제와 줄기세포 치료제로 나눌 수 있으며, 줄기세포 치료제는 다시 줄기세포가 얻어지는 출처에 따라 크게 배아줄기세포 (embryonic stem cells) 치료제와 성체줄기세포 (adult stem cells) 치료제로 분류할 수 있다. 현재 성체줄기세포 치료제는 전 세계 줄기세포 치료제 시장의 99%를 차지하고 있을 정도로 산업화가 상당히 진척되어 있는 분야다.
성체줄기세포의 하나인 중간엽 줄기세포는 특정 배양 조건에서 뼈, 연골, 근육 및 간 등의 중간엽 조직들로 분화할 수 있는 다능성 세포로서, 쉽게 분리할 수 있으며 일반 배지 조건에서도 분화 없이 충분한 양을 확보할 수 있다는 장점이 있다. 이외에도 동종 간 세포치료에서 세포 정착을 도와 이식된 세포의 생존 기간을 연장시켜줌으로써 그 이용가치가 매우 높다.
최근에 조직재생 분야에서 중간엽 줄기세포를 이용한 세포 대체 치료뿐만 아니라 중간엽 줄기세포로부터 생성되는 물질의 근거리분비 (paracrine)에 의한 치료 효과들이 보고되고 있다. 실제로 중간엽 줄기세포는 신경, 혈관생성 및 항염증반응 등을 유도하는 다양한 물질들 (세크레톰; secretome)을 분비하는 것으로 확인되었다. 이러한 세크레톰을 이용해 암이나 심장 질환 같은 질병을 완화할 수 있다는 연구들이 보고되고 있다. 따라서 조직 치료 및 재생 분야에서 세크레톰을 이용한 무세포치료 (cell-free therapy)의 가능성이 제시되었으나, 현재 간섬유화에 대한 연구는 거의 진행되어 있지 않은 실정이다. 또한, 치료 효과를 보이는 세크레톰에 구체적으로 어떠한 성분들이 포함되어 있는지에 대한 연구는 많이 부족하며, 또한 그들이 특정 질환에서 어떤 기전 및 조절 네트워크를 통해 손상 조직의 회복에 영향을 주는지에 대한 이해가 매우 미흡하여 이를 보완할 추가 연구가 반드시 필요하다.
한편, 세크레톰에 내포된 엑소좀은 한 세포로부터 다른 세포로 특정 성분을 운반하는 중요한 매개체로서, 이를 받아들이는 세포의 유전자 발현 변화를 야기할 수 있다고 알려져 있다. 엑소좀은 40-100 nm의 크기를 지닌 입자로, 세포외 운반체 (extracellular vesicles)로서 역할을 하며 줄기세포를 비롯한 다양한 세포로부터 분비되어 혈액, 체액(biological fluid), 뇨 및 세포배양액에 존재하는 것으로 확인되었다.
이러한 엑소좀은 세포내 엔도좀 트래피킹 과정을 통해 생성된 후기 엔도좀과 원형질막의 융합을 통해 생성된다.
엑소좀은 해당 세포에서 발현하고 있는 특정 단백질과 mRNA 전사체를 포함하고 있을 뿐만 아니라 중요하게도 RNA 자체로서 유전자의 발현을 조절하는 다양한 small non-coding RNA (microRNA, piRNA 등)들도 함유되어 있다. 따라서 엑소좀은 기원한 해당 세포의 유전적 특성을 반영하고 있다고 알려져있다.
엑소좀 구성 물질 중 small non-coding RNA (ncRNA)는 매우 적은 양으로도 다양한 유전자 발현조절 효과를 보일 수 있으며, 또한 하나의 ncRNA가 매우 다양한 신호전달 경로에 관여할 수 있어 그 영향력이 매우 크다. ncRNA는 RNA 전사체의 일종으로 단백질로 번역 (translation)되지는 않지만 다양한 유전자의 안정성, 전사 및 번역을 조절하는 것으로 보고되었다. 인간 유전체로부터 전사되는 RNA들 가운데 97%는 단백질로 번역되지 않는 ncRNA다. 따라서 ncRNA는 생체 내 다양한 생물학적 과정과 밀접하게 연관되어 있어 이에 대한 연구는 생명과학분야의 핫이슈로 평가되고 있다.
특히 이러한 ncRNA 중 microRNA는 약 22 뉴클레오티드 (nucleotide)의 크기를 갖는 small RNA로 염기서열 상보적인 mRNA를 분해하거나 단백질로의 번역을 억제함으로써 유전자 발현을 조절하는 RNA 간섭현상을 유발한다. RNA 간섭은 생체의 발생 및 생리, 세포의 분화, 증식 및 사멸, 그리고 유전체의 안정성 등 거의 모든 생물학적 과정에 밀접하게 관련되어 있으며, 또한 바이러스에 대한 저항성 및 다양한 인간 질병과도 밀접하게 연관되어 있다. 이러한 RNA 간섭과 질병과의 연관성을 토대로 인간 질병 치료제의 개발을 위한 경쟁적 연구가 전 세계적으로 진행되고 있다.
따라서 기초분야를 포함한 의약학적 응용분야에서의 무한한 가능성 때문에 RNA 간섭 기술을 이용한 경제적 시장 규모는 계속 증가하고 있는 추세다. Frost&Sullivan 조사에 의하면 RNA 간섭 기술의 세계 시장 규모는 2003년 기준 4800만 달러에서 2010년 기준 3 억 2800만 달러로 엄청난 성장을 이루었다. 또한 BBC 리서치사가 발표한 새로운 보고서는 2013년 36억 달러로 연평균 성장률이 83.4%에 이를 것으로 판단하였다. 뿐만 아니라 Jain PharmaBioTech 조사에 의하면 RNA 간섭 기술에 기반을 둔 신약 개발의 규모가 2004년 기준 5억 달러에서 2010년 기준 10억 달러로 2배의 성장을 보였고, 또 다른 조사에 의하면 RNA 간섭 치료산업의 시장 규모는 2013년 23억 달러에 이를 것으로 예상된 바 있다.
따라서 이러한 연구를 기반으로 중간엽 줄기세포 유래 엑소좀에 의한 간섬유화 회복의 검증을 통해 기존의 제한된 치료 방법에 큰 변화를 줄 수 있는 새로운 치료 방법에 대한 필요성이 있다.
이에 본 발명자들은 간섬유증의 회복에 효과를 보이는 엑소좀 및 엑소좀 유래 리보핵산을 발굴하고 이들의 간섬유증 억제 효과를 조사한 결과 향후 경제적으로 우수한 효과를 가진 치료 제제로서 이용가능성이 있음을 확인함으로써 본 발명을 완성하였다.
따라서 본 발명의 목적은 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물을 제공하는 것이다.
본 발명의 또다른 목적은 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 개선용 식품 조성물을 제공하는 것이다.
본 발명의 또다른 목적은 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 세포치료제를 제공하는 것이다.
본 발명의 또다른 목적은 엑소좀 또는 엑소좀 유래 리보핵산을 이를 필요로 하는 개체에 투여하는 단계;를 포함하는 간섬유증 예방 또는 치료 방법을 제공하는 것이다.
본 발명의 또다른 목적은 엑소좀 또는 엑소좀 유래 리보핵산을 이를 필요로 하는 개체에 투여하는 단계;를 포함하는 간섬유증 개선 방법을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 개선용 식품 조성물을 제공한다.
또한, 본 발명은 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 세포치료제를 제공한다.
또한, 본 발명은 엑소좀 또는 엑소좀 유래 리보핵산을 이를 필요로 하는 개체에 투여하는 단계;를 포함하는 간섬유증 예방 또는 치료 방법을 제공한다.
또한, 본 발명은 엑소좀 또는 엑소좀 유래 리보핵산을 이를 필요로 하는 개체에 투여하는 단계;를 포함하는 간섬유증 개선 방법을 제공한다.
본 발명의 엑소좀 및 이로부터 유래된 리보핵산은 간성상세포 및 쿠퍼세포의 활성을 억제하고 α-SMA의 발현을 감소시키는 효과가 있으며, 교원질의 침착을 억제하여 간섬유증의 진행을 억제시키는바, 간섬유증의 예방이나 치료를 위한 세포치료제로 유용하게 이용될 수 있다.
도 1은 중간엽 줄기세포의 표지인자를 분석한 결과를 나타낸 도이다.
도 2는 중간엽 줄기세포를 지방, 뼈, 연골세포로 분화 유도한 결과를 나타낸 도이다(스케일 바: 100 μm).
도 3은 엑소좀 결핍 FBS를 포함하는 배양액에서 중간엽 줄기세포의 증식 여부를 확인한 결과를 나타낸 도이다.
도 4는 미분화 중간엽 줄기세포에서 간세포 유사세포로의 분화 유도 단계를 나타낸 도이다.
도 5는 미분화 중간엽 줄기세포에서 간세포 유사세포로의 분화 단계에 따른 형태적 변화를 나타낸 도이다(스케일 바: 100 μm).
도 6은 중간엽 줄기세포 및 간세포 유사세포에서 간세포 연관 유전자의 발현을 RT-PCR을 이용하여 분석한 결과를 나타낸 도이다.
도 7은 중간엽 줄기세포 및 간세포 유사세포에서 알부민 및 요소의 분비능을 분석한 결과를 나타낸 도이다.
도 8은 간세포 유사세포에서 글리코겐 저장능 및 ICG 흡수 기능을 분석한 결과를 나타낸 도이다(스케일 바: 100μm).
도 9는 미분화 중간엽 줄기세포 및 간세포 유사세포에서 엑소좀을 분리하기 위한 순서도를 나타낸 도이다.
도 10은 미분화 중간엽 줄기세포 및 간세포 유사세포에서 분리한 엑소좀의 크기 분포도를 NTA 분석을 통해 확인한 도이다.
도 11은 미분화 중간엽 줄기세포 및 간세포 유사세포에서 분리한 엑소좀을 투과전자현미경(TEM)으로 관찰한 결과를 나타낸 도이다(스케일 바: 100 nm).
도 12는 만성 간섬유화 동물 모델에서 수행한 간독성 테스트 결과를 나타낸 도이다.
도 13은 만성 간섬유화 동물 모델에서 교원질 침착 정도를 확인한 결과를 나타낸 도이다.
도 14는 중간엽 줄기세포 및 간세포 유사세포에서 엑소좀 처리에 따른 간독성 테스트 결과를 나타낸 도이다.
도 15는 중간엽 줄기세포 및 간세포 유사세포에서 엑소좀 처리에 따른 교원질 침착 정도를 확인한 결과를 나타낸 도이다.
도 16은 중간엽 줄기세포 및 간세포 유사세포에서 엑소좀 처리에 따른 간성상세포 및 쿠퍼세포의 활성을 분석한 결과를 나타낸 도이다.
도 17은 중간엽 줄기세포 및 간세포 유사세포에서 엑소좀 처리에 따른 α-SMA의 발현을 분석한 결과를 나타낸 도이다.
도 18은 중간엽 줄기세포 및 간세포 유사세포에서 분리된 엑소좀에 존재하는 small RNA를 분리하여 확인한 결과를 나타낸 도이다.
도 19는 HeLa 세포 및 HEK293T 세포 유래 엑소좀 투여 후 간조직의 면역 형광 염색 결과 및 간조직 유전자 발현 분석 결과를 나타낸 도이다.
도 20은 중간엽 줄기세포 및 간세포 유사세포 유래 엑소좀 마이크로RNA 발현 분석 비교 결과를 나타낸 도이다.
도 21은 대조군 및 본 발명에 따른 마이크로RNA를 트렌스펙션한 간성상세포의 활성을 분석한 결과를 나타낸 도이다.
도 22는 간성상세포 표적 펩타이드 융합 엑소좀 마이크로RNA의 간 성상세포로 내부로의 전달 효과를 확인한 결과를 나타낸 도이다.
도 23은 간섬유화 동물모델에 마이크로RNA 투여 후, 간조직의 Sirius Red 염색 결과를 나타낸 도이다.
도 24는 간섬유화 동물모델에 마이크로RNA 투여 후, 간조직의 면역 형광 염색 결과를 나타낸 도이다.
이하, 본 발명에 대해 상세히 설명한다.
본 발명은 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물을 제공한다.
상기 조성물은 약학적 조성물, 또는 식품 조성물을 포함한다.
본 발명에서 용어 "엑소좀(exosome)"은 다양한 세포들로부터 분비되는 막 구조의 작은 소낭을 의미한다. 엑소좀의 직경은 대략 30-100 nm이며, 다낭체와 원형질막의 융합이 일어나 세포 밖 환경으로 방출되는 소낭을 의미한다.
본 발명에서 엑소좀은 중간엽 줄기세포 또는 간세포 유사세포에서 유래할 수 있다.
본 발명에서 "줄기세포"란 미분화된 세포로서 자기 복제 능력을 가지면서 두 개 이상의 서로 다른 종류의 세포로 분화하는 능력을 갖는 세포를 말한다.
상기 줄기세포는 자가 또는 동종 유래 줄기세포일 수 있으며, 인간 및 비인간 포유류를 포함한 임의 유형의 동물 유래일 수 있고, 상기 줄기세포가 성체로부터 유래된 것이든 배아로부터 유래된 것이든 이에 한정되지 않는다.
본 발명의 줄기세포는 배아 줄기세포, 성체 줄기세포 또는 역분화 줄기세포를 포함하며, 바람직하게는 성체 줄기세포이다. 상기 성체줄기세포는 다양한 조직으로부터 분리할 수 있으며, 예를 들어, 태반-유래 줄기세포, 골수-유래 줄기세포, 제대혈-유래 줄기세포, 지방-유래 줄기세포, 낙태아 전뇌 유래 신경줄기세포(stillborn fetal brain derived neural stem cells), 또는 성체세포로부터 유래된 중간엽 줄기세포(mesenchymal stem cells) 등을 포함할 수 있고, 바람직하게는 인간 중간엽 줄기세포이나, 이에 한정되지 않는다. 상기 중간엽 줄기세포는 제대, 제대혈, 골수, 지방, 근육, 신경, 피부, 양막 및 태반 등으로부터 유래된 중간엽 줄기세포일 수 있으나, 이에 한정되지 않는다.
본 발명의 간세포 유사세포(hepatocyte-like cell; HLC)는 미분화된 중간엽 줄기세포로부터 간세포로 분화가 유도된 세포를 포함하며, 미분화된 중간엽 줄기세포에 대해 분화를 유도하는 방법은 당업계에 공지되어 있다.
본 발명에서 “엑소좀 유래 리보핵산(exosomal RNAs)"은 엑소좀에서 유래한 리보핵산을 지칭한다.
본 발명에서 용어 "리보핵산"은 small RNA를 포함할 수 있으며, 본원에서 "small RNA"란, 단백질로 번역되지 않으며 상보적 결합을 통해 특정 mRNA의 번역을 효과적으로 억제하는, 보통 염기 서열의 길이가 200개 이하의 짧은 길이의 RNA이다. small RNA는 siRNAs(small interfering RNAs), miRNAs (microRNAs), piRNAs (Piwi-associated RNAs), Longer non-coding RNAs 등을 포함한다.
siRNA는 긴 이중 가닥 RNA 분자의 절단에 의해 형성된다(길이 20-25 뉴클레오티드). siRNA는 트랜스포존의 활성 길들이기(taming) 및 바이러스 감염에 대항하기 위해 특히 중요하며, 단백질을 코딩하는 유전자를 조절할 수 있다. 합성된 siRNA는 실험 목적을 위해 인위적으로 발현될 수 있다.
miRNA(microRNA)는 특정 유전자에 의해 암호화되는 small RNA 이며, 단일가닥 RNA 분자로서 mRNA(messengerRNA)의 3'-UTR에 결합하여 진핵생물의 유전자 발현을 제어하는 물질이다(길이 20-25 뉴클레오티드). miRNA의 생성은 Drosha(RNaseⅢ type 효소)에 의해 스템-루프 구조의 전구체 miRNA(pre-miRNA)로 만들어지고, 세포질로 이동하여 다이서(Dicer)에 의해 절단되어 성숙한 miRNA로 만들어진다. 본 발명에 있어서, miRNA의 넘버는 작은 RNA(small RNA)의 발견된 순서에 따라 매겨진 번호로써, 이는 당업자에게 자명하다(http://www.mirbase.org).
piRNA는 긴 단일-가닥 전구체로부터 생성되는 small RNA이다(길이 25-30 뉴클레오티드). piRNA는 Argonaute 단백질의 piwi 서브패밀리와 연관된 기능을 수행하며, 생식 세포의 발달에 있어 필수적이다.
본 발명의 리보핵산은 엑소좀에서 유래하는 것으로, 간 섬유화에 영향을 줄 수 있는 것이며, 예를 들어, miR-136, miR-199a, miR-409, miR-410 또는 mir-432일 수 있으며, 이에 제한되지 않는다.
본 발명의 조성물은 상기 miRNA 자체를 포함할 수도 있으나 그의 단편을 포함할 수도 있으며, 이에 한정되지 않는다.
보다 구체적으로, 상기 miR-136은 하기 서열번호 1으로 표시될 수 있으며, 상기 염기서열은 miR-136의 성숙한 형태로써 헤어핀 구조의 전구체 miRNA(precusor microRNA)로부터 유래한 것이다.
5‘-CAUCAUCGUCUCAAAUGAGUCU(서열번호 1)-3’
보다 구체적으로, 상기 miR-199a는 하기 서열번호 2로 표시될 수 있으며, 상기 염기서열은 miR-199a의 성숙한 형태로써 헤어핀 구조의 전구체 miRNA(precusor microRNA)로부터 유래한 것이다.
5‘-ACAGUAGUCUGCACAUUGGUUA(서열번호 2)-3’
보다 구체적으로, 상기 miR-409는 하기 서열번호 3으로 표시될 수 있으며, 상기 염기서열은 miR-409의 성숙한 형태로써 헤어핀 구조의 전구체 miRNA(precusor microRNA)로부터 유래한 것이다.
5‘-GAAUGUUGCUCGGUGAACCCCU(서열번호 3)-3’
보다 구체적으로, 상기 miR-410은 하기 서열번호 4로 표시될 수 있으며, 상기 염기서열은 miR-410의 성숙한 형태로써 헤어핀 구조의 전구체 miRNA(precusor microRNA)로부터 유래한 것이다.
5‘-AGGUUGUCUGUGAUGAGUUCG(서열번호 4)-3’
보다 구체적으로, 상기 miR-432은 하기 서열번호 5로 표시될 수 있으며, 상기 염기서열은 miR-432의 성숙한 형태로써 헤어핀 구조의 전구체 miRNA(precusor microRNA)로부터 유래한 것이다.
5‘-UCUUGGAGUAGGUCAUUGGGUGG(서열번호 5)-3’
또한, 본 발명은 서열번호 1 내지 5의 염기서열과 상보적인 염기서열을 갖는 핵산 분자 및 이와 기능적으로 동일한 기능을 할 수 있는 변이체를 포함한다.
본 발명의 핵산 분자는 RNA, DNA, 당- 또는 골격-변형 뉴클레오티드 또는 데옥시리보뉴클레오티드와 같은 핵산 유사체 분자(analog molecules)일 수 있다. 또한 PNA(peptide nucleic acids) 또는 LNA(locked nucleic acids)와 같은 다른 핵산 유사체 분자일 수도 있으나, 이에 제한되지는 않는다.
본 발명의 핵산 분자는 세포 내로 효율적으로 원활하게 유입될 수 있도록 핵산을 적합화될질 수 있다. 예를 들어, 핵산은 전달 반응물질(예를 들어, 양이온성 리포솜)에 컨쥬게이트되고/되거나, 그와 복합체를 형성할 수 있다. 일부 경우에, 핵산은 올리고뉴클레오티드의 뉴클레아제 내성을 증가시키고, 세포 흡수를 증가시키는 단백질(예를 들어, 아텔로콜라겐(Atelocollagen))과 복합체를 형성하거나, 그에 컨쥬게이트될 수 있다.
본 발명에서 용어 “간섬유증(hepatic fibrosis)”은 간 장애의 결과 간에 섬유가 증가한 상태를 지칭한다.
본 발명에서 간섬유증은 간 섬유의 증가에 의해 발생할 수 있는 질병을 제한 없이 포함할 수 있으며, 간섬유화, 문맥성 간경화, 괴사후성 간경화, 담즙성 간경화, 영양성 간경화, 알코올성 간경화, 바이러스 간염성 간경화, 담즙정체성 간경화, 심장성 간경화로 구성된 군으로부터 선택된 1종 이상을 포함할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에서 용어 "간섬유화(liver fibrosis)"는 조직의 손상으로 인해 염증반응이 계속 진행됨에 따라 활성 간성상세포 (hepatic stellate cell)에서 다량 분비된 교원질 (collagen)과 세포외기질 (extracellularmatrix, ECM)이 결합함으로써 나타나는 상처치유의 과정을 지칭한다. 간섬유화가 지속적으로 진행되면 간 조직 내 교원질이 다량 침착되고, 재생결절이 교원질로 둘러싸여 비정상적인 구조를 지니게 되는 간경화로 발달할 수 있다.
본 발명에서 용어 "간경화(liver cirrhosis)"는 간경변증이라고도 하며, 만성적인 염증으로 인해 정상적인 간 조직이 재생결절(regenerative nodules; 작은 덩어리가 만들어지는 현상) 등의 섬유화 조직으로 바뀌어 간의 기능이 저하되는 간의 만성질환을 지칭한다. 이는 간의 만성질병을 대표하며 간기능 저하에 의한 대사장애, 문맥계 혈류 장애로 인한 증세가 겹쳐져 복잡한 양상을 나타낸다. 형태학적으로는 크게 문맥성·괴사후성·담즙성으로 나누고, 원인적으로는 영양성·알코올성·바이러스 간염성·담즙정체성·심장성 등으로 나눌 수 있다.
간조직의 섬유화는 간염바이러스나 알코올, 기타 독성물질 등 다양한 원인에 의해 진행될 수 있다.
본 발명의 엑소좀 또는 리보핵산은 α-SMA의 발현을 감소시키는 효과가 있다. 간섬유화는 만성적인 간 손상으로 인해 야기되며, 세포외기질 및 섬유화 연관 신호전달체계의 네트워크에 의해 유발된다. 이러한 신호전달체계에는 TGF-β(transforming growth factor β) 신호전달체계가 있으며, 본 발명의 조성물은 TGF-β 신호전달체계에 의해 활성화된 간성상세포에서 발현되는 α-SMA의 발현을 감소시킴으로써 간섬유증을 억제할 수 있으며, 본 발명의 실시예에서 이를 구체적으로 확인하고 있다.
본 발명의 엑소좀 또는 리보핵산은 간섬유증의 예방 또는 치료 효과를 갖는 공지의 유효성분을 1종 이상 더 포함할 수 있다.
본 발명의 약학적 조성물은 약학적 분야에서 통상의 방법에 따라 개체의 신체 내 투여에 적합한 단위투여형의 제제로 제형화시켜 투여할 수 있다. 이러한 목적에 적합한 제형으로는 비경구투여 제제로서 주사용 앰플과 같은 주사제, 주입 백과 같은 주입제, 및 에어로졸 제제와 같은 분무제 등이 바람직하다. 상기 주사용 앰플은 사용 직전에 주사액과 혼합 조제할 수 있으며, 주사액으로는 생리 식염수, 포도당, 링거액 등을 사용할 수 있다. 또한, 주입 백은 염화폴리비닐 또는 폴리에틸렌 재질의 것을 사용할 수 있다.
본 발명의 조성물은 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체를 더 포함할 수 있다. 예를 들어, 주사제의 경우에는 보존제, 무통화제, 가용화제 또는 안정화제 등을, 국소 투여용 제제의 경우에는 기제(base), 부형제, 윤활제 또는 보존제 등을 추가로 포함할 수 있다.
본 발명의 조성물은 개체에게 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구, 직장, 복강내, 정맥, 근육, 피하, 자궁 내 경막 또는 뇌혈관 내 주사에 의해 투여될 수 있으며, 바람직하게는 복강내 투여가 가능하나 이에 한정되지는 않는다.
본 발명의 엑소좀, 엑소좀 유래 리보핵산 또는 조성물은 간섬유증의 치료 또는 예방을 위하여 단독으로, 또는 수술, 방사선 치료, 호르몬 치료, 화학 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다.
본 발명에서 용어 “예방”은 본 발명에 따른 간섬유증의 예방 또는 치료용 조성물을 개체에 투여하여 간섬유증의 발병을 억제하거나 지연시키는 모든 행위를 의미할 수 있다.
본 발명에서 용어, “치료”는 본 발명에 따른 조성물을 간섬유증 발병 의심 개체에 투여하여 간섬유증의 증세가 호전되도록 하거나 이롭게 되도록 하는 모든 행위를 의미할 수 있다.
본 발명에서 용어, "개체"는 간섬유증이 발병되었거나 발병할 가능성이 있는 인간을 포함한 모든 동물을 의미할 수 있다.
또한, 본 발명의 조성물은 간섬유증 예방 또는 개선을 목적으로 식품 조성물, 바람직하게는 건강기능식품에 첨가될 수 있다.
본 발명에서, ‘건강기능식품’이란 질병의 예방 및 개선, 생체방어, 면역, 병후의 회복, 노화 억제 등 생체조절기능을 가지는 식품을 말하는 것으로, 장기적으로 복용하였을 때 생체에 무해하여야 한다.
본 발명의 식품 조성물에 포함되는 유효성분의 혼합양은 사용 목적 (예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있으며, 이에 제한되지 않는다.
또한, 본 발명은 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 세포치료제를 제공한다.
본 발명에서 용어, “세포치료제”는 조직의 기능을 복원하기 위하여 자가(autologous), 동종(allogenic), 이종(xenogenic) 세포를 이용한 치료제로, 본 발명에서는 간섬유화 또는 간경화의 억제를 위해 사용되는 치료제를 말한다.
본 발명의 세포치료제는 피부, 연골, 골, 혈관, 뇌, 간, 심장, 인대, 근육, 척수, 혈액, 골수, 폐, 치아, 신경, 각막, 망막, 식도, 척추, 신장, 췌장 또는 요도로부터 선택되는 조직들을 재생하기 위해 사용될 수 있으나 이에 한정하는 것은 아니다.
본 발명은 상기 세포치료제가 동결보관된 바이알, 앰플 또는 시린지 (Syringe)를 포함할 수 있다.
이하, 본 발명을 실시예, 제제예에 의해 상세히 설명한다. 단, 하기 실시예, 제제예는 본 발명을 예시하는 것일 뿐 본 발명의 내용이 하기 실시예, 제제예에 한정되는 것은 아니다.
실시예 1: 미분화 중간엽 줄기세포의 특성 및 다분화능 확인
인간탯줄유래 중간엽 줄기세포 (human umbilical cord derived mesenchymal stem cell)를 ATCC (cat# ATCC-PCS-500-010)에서 구매한 후 세포의 특성을 파악하기 위하여 중간엽 줄기세포의 표지인자 (CD44, CD73)와 비표지인자 (CD34, CD45)의 발현을 FACS(Fluorescence activated cell sorting) 분석을 통해 확인하였고, 그 결과를 도 1에 나타내었다.
도 1에 나타낸 바와 같이, 양성표지인자인 CD73은 대조군 대비 99.17%, CD44는 99.6%가 해당 표지인자 발현세포로 분석되었으며, 음성표지인자인 CD34 및 CD45는 각각 0.21%, 0.14%로 발현을 거의 확인할 수 없었다.
또한, 중간엽 줄기세포를 뼈, 연골, 그리고 지방세포로의 분화를 유도하여 분화능을 확인하였다. 지방세포, 뼈세포, 그리고 연골세포로의 분화는 각각 Stempro adipocyte differentiation kit, Stempro osteocyte differentiation kit, 그리고 Stempro chondrocyte differentiation kit (gibco)를 이용하였다. 지방 및 뼈세포 분화는 중간엽 줄기세포를 12-웰 플레이트에 각각 1 X 104 혹은 3 X 104개로 시딩(seeding)한 후 약 4주간 3일씩 각각의 분화유도 배양액을 교체해주면서 배양하였다. 분화 완료 후 각각의 세포를 Oil-red O, Alizarin-Red S 염색을 통해 분화여부를 확인하였다. 연골세포 분화는 1 X 104개의 중간엽 줄기세포를 48시간 동안 10 μl 배양액에 현적 (haning-drop) 배양을 실시한 후 스페로이드로 형성된 세포들을 세포배양 플레이트로 옮겨 4주간 3일씩 분화유도 배양액을 교체해주면서 배양하였다. 분화된 세포에 대해 동결절편을 실시한 후 Alcian Blue 염색을 통해 분화여부를 확인하였고, 그 결과를 도 2에 나타내었다.
도 2에 나타낸 바와 같이, 중간엽 줄기세포가 다분화능이 있음을 확인하였다.
실시예 2: 엑소좀 결핍 FBS가 포함된 배양액에서의 중간엽 줄기세포 증식확인
미분화 중간엽 줄기세포 및 간세포 유사세포 유래 엑소좀만을 확보하고자 할 때, 중간엽 줄기세포의 기본 배양액에 첨가될 FBS에는 엑소좀이 존재하지 않아야만 한다. 이에 중간엽 줄기세포 배양액에 엑소좀 결핍 FBS를 첨가하여 배양을 시도하였으며, 중간엽 줄기세포의 증식에는 문제가 없는지 여부를 WST assay를 통해 확인하였다.
구체적으로, 세포 대사과정에서 발생하는 미토콘드리아 탈수소효소에 의해 WST-1(Tetrazolium Salts )에서 포르마잔이라는 발색 물질이 생성되는 것을 측정하는 것으로, 대사적으로 왕성한 활동을 하는 세포의 미토콘드리아 전자전달계에 존재하는 탈수소효소인 succinatetrazolium reductase에 의해 살아있는 세포에만 유효하며, 발색강도가 세포수와 직선 상관관계를 나타낸다. WST assay 결과를 도 3에 나타내었다.
도 3에 나타낸 바와 같이, 엑소좀 결핍 FBS가 첨가된 기본배양액에서 배양된 중간엽 줄기세포(Exo-)와 엑소좀이 존재하는 기본배양액에서 배양된 중간엽 줄기세포(Exo+)의 증식에는 차이가 없음을 확인하였으므로 본 발명에서 엑소좀 결핍 FBS가 첨가된 기본배양액에서 배양된 중간엽 줄기세포를 사용하였다.
실시예 3: 미분화 중간엽 줄기세포에서 간세포 유사세포로의 교차분화 유도
미분화 중간엽 줄기세포를 간세포 유사세포로 분화시키기 위해서, 도 4에 나타낸 바와 같이 미분화 중간엽 줄기세포로부터 간세포 분화용 사이토카인들을 조합하여 총 4단계에 걸쳐 분화를 유도하였다.
첫 번째 단계로 5 ng/cm2의 교원질 typeI이 코팅되어있는 세포배양 플레이트에 중간엽 줄기세포 기본배양액과 함께 3.0 X 104 cell/cm2으로 시딩을 실시한 후 약 80% 정도의 컨플루언스(confluence)로 증식을 유도했다. 두 번째 단계로, EGF(epidermal growth factor) 및 bFGF(basic fibroblast growth factor) 사이토카인이 포함된 Iscove's Modified Dulbecco's Medium (IMDM)에서 48시간 동안 배양하였다. 세 번째 단계는 분화유도 단계로 IMDM에 HGH(hepatocyte growth factor), basic FGF, 니코틴아미드(nicotinamide), 그리고 ITS(insulin-transferrin-sodium selenite)가 첨가된 배양액에서 10일간 2일마다 배양액을 교체해주며 배양하였다. 최종 성숙단계로써 온코스타틴 M(oncostatin M), 덱사메타손(dexamethasone), 그리고 ITS가 첨가된 IMDM에 10일 이상 2일마다 배양액을 교체해주며 간세포 유사세포의 분화를 유도하였다. 분화를 유도한 결과를 도 5에 나타내었다.
도 5에 나타낸 바와 같이 상기 분화 유도 단계에 따른 세포의 형태적 변화를 관찰한 결과, 최종단계(step 4)에서 다각형을 나타내는 세포로 변화됨을 확인하였다.
실시예 4: 중간엽 줄기세포와 분화유도된 간세포 유사세포의 특성 확인
분화유도가 완료된 간세포 유사세포에서 간세포 연관 유전자의 발현변화를 확인해보기 위해서, 초기 간세포에서 발현되는 유전자의 발현을 mRNA 수준에서 중간엽 줄기세포와 간세포 유사세포에서 통상의 RT-PCR 방법을 통해 비교분석하여 그 결과를 도 6에 나타내었다.
도 6에 나타낸 바와 같이, 내배엽 분화, 간세포 성숙, 그리고 간 대사에 주요한 역할을 담당하는 Sox17, AFT, albumin, TTR, TAT, CXCR4, G6pase, 그리고 Hnf4a 모두에서 발현이 증가함을 확인하였다. 더불어 분화유도된 간세포 유사세포(HLC)에서 albumin의 발현이 중간엽 줄기세포(MSC)에서 보다 크게 증가되었음을 면역염색법을 통해 확인하였다.
또한, 분화유도가 완료된 간세포 유사세포에서 간세포의 기능적 특성을 확인하기 위해서 하기와 같이 수행하였다. 정상 간세포는 특이적으로 알부민과 요소(urea) 분비능, ICG(indocyanine green) 흡수능, 그리고 글리코겐 저장능을 가진다. 이에 간세포 유사세포로 분화유도된 세포배양액을 확보하여 배양액으로 분비된 알부민과 요소의 양을 중간엽 줄기세포와 비교분석한 결과를 도 7에 나타내었다.
도 7에 나타낸 바와 같이, 통계적으로 알부민 및 요소 분비가 상대적으로 많이 간세포 유사세포(HLC)에서 일어남을 확인하였고, 알부민의 경우는 유전자 발현양과는 달리 분비가 크게 증가하지 않음을 확인하였다.
더불어 Periodic acidSchiff (PAS) 염색을 수행한 결과를 도 8에 나타내었다.
도 8에 나타낸 바와 같이, 글리코겐 저장능이 간세포 유사세포에서 증가됨을 확인하였으며, 중간엽 줄기세포(MSC) 및 간세포 유사세포(HLC) 배양액에 ICG 첨가 시 간세포 유사세포에서 흡수가 증가됨을 확인하였다.
따라서, 상기와 같이 유도된 간세포 유사세포는 정상 간세포가 나타내는 특성을 가지는 것을 확인하였다.
실시예 5: 중간엽 줄기세포 및 간세포 유사세포 배양액에서의 엑소좀 분리 및 특성분석
중간엽 줄기세포 및 간세포 유사세포 배양액에서 엑소좀을 분리하기 위해서, 도 9에 나타낸 바와 같이 엑소좀을 확보하였다.
구체적으로, 중간엽 줄기세포 또는 간세포 유사세포를 배양하고 배양액을 수거한 후 세포를 분리하기 위하여 원심분리를 실시한 후 상층액에서 응집물(aggregate)을 제거하기 위하여 0.22 μm 필터를 사용하였다. 엑소좀이 포함된 배양액을 농축하기 위하여 centrifugal filter (100 kDa 컷-오프) 100 MWCO를 이용한 후 엑소좀 추출 키트 (ExoQuick-TC)를 배양액과 혼합하여 저온에서 하루 동안 보관하였으며, 최종적으로 원심분리를 통해 침전된 엑소좀을 추출하였다. 확보된 엑소좀은 차후 실험에 따라 PBS, 용해 완충액(lysis buffer), 또는 Trizol을 이용해 희석하였다.
상기와 같이 분리하여 확보한 엑소좀의 크기 분포도를 확인하기 위하여, Nanosight 장비를 활용하여 nanoparticle tracking assay (NTA)를 실시하였다. NTA는 나노입자가 레이져에 의해 산란된 빛들을 수집하여 장비로 전송함으로써 시각적으로 확인할 수 있는 실험 기법으로, 엑소좀 분석에 사용되는 방법이다.
구체적으로, 확보한 엑소좀을 적절한 농도로 PBS에 희석하여 Nanosight 장비에 넣은 후 엑소좀이 레이져에 반사되어 나오는 이미지를 분석함으로써 엑소좀의 크기 분포도를 확인하고, 이를 도 10에 나타내었다.
도 10에 나타낸 바와 같이, 중간엽 줄기세포(MSC) 및 간세포 유사세포(HLC)에서 유래된 엑소좀은 80-110 nm에 많이 존재하고 있음을 확인하였고, 이는 현재까지 알려진 엑소좀의 대표적인 크기에 대응한다.
따라서, 상기와 같은 방법으로 중간엽 줄기세포 및 간세포 유사세포에서 유래한 엑소좀을 추출할 수 있음을 확인하였다.
또한, 엑소좀을 실체적으로 확인하기 위하여 투과전자현미경 (transmission electron microscope, TEM) 이미지를 확보하고자 하였고, TEM을 위한 엑소좀 샘플을 준비하기 위하여 PFA(paraformaldehyde)를 이용하여 엑소좀을 고정하였으며, formvar-carbon EM grid에 부착시켰다. 그 후 grid를 글루타르알데히드를 이용해 후고정을 실시하였으며 대조 및 염색을 위해 우라닐 옥살레이트(uranyl oxalate)에 보관하였다. 최종적으로 메틸셀룰로오스-우라닐 아세테이트(methylcellulose-uranyl acetate) 용액을 이용하여 임베딩(embeding)을 실시하였다. 전자현미경을 통해 엑소좀을 확인한 결과를 도 11에 나타내었다.
도 11에 나타낸 바와 같이, 전자현미경을 통해 약 50-110 nm 크기의 중간엽 줄기세포(MSC) 및 간세포 유사세포(HLC) 유래 엑소좀을 확인하였다.
실시예 6: 만성 간섬유화 동물 모델에 대한 엑소좀 투여에 따른 간 손상 회복 효능 검증
6-1. 만성 간섬유화 동물 모델 제작 및 확인
공지된 방법을 통해서 TAA(thioacetamide)를 생쥐의 복강에 장기 투여 (주 3회, 8주)하여 만성 간섬유화 모델을 제작하였다. TAA의 투여가 완료된 생쥐의 혈청에서 간독성 테스트 (ALT/AST) 및 Sirius Red 염색을 실시하여 만성 간섬유화 마우스 모델의 제작 여부를 확인하고 그 결과를 도 12 및 도 13에 나타내었다.
도 12에 나타낸 바와 같이, 간독성테스트 결과 혈청 AST 및 ALT 값이 모두 TAA 투여 마우스 실험군(TAA)에서 높게 측정됨을 확인하였다. 더불어 도 13에 나타낸 바와 같이, Sirius Red 염색을 통해 교원질의 침착 정도가 TAA 투여 마우스군(TAA)에서 높음을 확인하였다.
따라서, 상기 방법에 의해 제작된 동물 모델을 중간엽 줄기세포 및 간세포 유사세포 엑소좀 처리를 위한 만성 간섬유화 동물모델 연구자원으로 활용하였다.
6-2. 엑소좀 투여에 따른 간 독성 변화 확인
엑소좀 투여에 따른 간 회복 확인을 위한 생쥐모델을 확보하기 위하여 검증된 방법을 통해 TAA를 장기 투여하여 만성 간섬유화 생쥐 모델 (총 20마리; 미투여 5마리, TAA 투여 후 saline 투여 5마리, TAA 투여 후 MSC 엑소좀 투여 5마리, TAA 투여 후 HLC 엑소좀 투여 5마리)을 제작하였다.
중간엽 줄기세포 및 간세포 유사세포에서 정제된 엑소좀 수를 NTA로 정량화 하여 약 3 X 109개의 엑소좀을 만성 간섬유화 동물 모델의 복강에 직접 주사하였다. 동시에 동일량의 식염수(saline)도 함께 투여하여 간 손상 회복 효능의 대조군으로 활용하였다.
엑소좀 처리 3일 후 대조군 (미투여, normal; 식염수 투여, sham) 및 실험군 (MSC-exo, HLC-exo)의 혈청에서 간독성테스트 (ALT/AST)를 실시하여 간 손상 회복 효능을 확인하고 결과를 도 14에 나타내었다.
도 14에 나타낸 바와 같이, Sham 대비 MSC-exo, HLC-exo에서 AST 및 ALT 값이 유의적으로 줄어드는 것을 확인하였다. 이를 통해 간접적으로 중간엽 줄기세포 및 간세포 유사세포유래 엑소좀이 간 손상 치료 효능이 있음을 예측할 수 있다.
6-3. 엑소좀 투여에 따른 교원질 침착 분석
간섬유화는 간 조직의 손상으로 인해 염증반응이 계속 진행됨에 따라 활성 간성상세포 (hepatic stellate cell)에서 다량 분비된 교원질과 세포외기질이 결합함으로써 나타나는 상처치유의 과정이다. 이러한 간섬유화가 지속적으로 진행되면 간 조직 내 교원질이 다량 침착되고, 재생결절이 교원질로 둘러싸여 비정상적인 구조를 지니게 되는 간경화로 발달하게 된다. 따라서 간 손상 치유반응으로 침착된 교원질을 확인하는 것은 필수적이다.
엑소좀 투여에 따른 교원질 침착을 분석하기 위해서, 상기와 같은 대조군에서 엑소좀 처리 3일 후 생쥐에서 간 조직을 분리하여 파라핀블록을 제작한 후 절편을 이용해 Sirius Red 염색을 진행하여 교원질 침착 정도를 대조군과 정량적으로 비교분석하였고 그 결과를 도 15에 나타내었다.
도 15에 나타낸 바와 같이, 간독성테스트의 결과와 마찬가지로 sham 대비 MSC-exo, HLC-exo에서 교원질 침착 정도가 유의성을 지니며 줄어드는 것을 확인하였다.
6-4. 엑소좀 투여에 따른 간성상세포 및 쿠퍼세포의 활성 분석
간손상 정도를 파악하는데 있어 간성상세포 및 쿠퍼세포의 활성을 확인하는 것이 중요하다. 간성상세포는 교원질 및 세포 외기질 형성에 중요한 역할을, 쿠퍼세포는 대식세포로서 세균 및 독소 등의 유입시 이들을 제거하는 기능을 하며 활성화되었을 때 다양한 사이토카인, 활성 산소(reactive oxygen species; ROS)등을 방출하는데 이는 간세포, 내피세포, 간성상세포에 영향을 주어 간섬유화를 촉진시킨다.
엑소좀 투여에 따른 간성상세포 및 쿠퍼세포의 활성 분석을 위해서, 엑소좀 처리 3일 후 생쥐에서 간 조직을 분리하여 파라핀블록을 제작한 후 절편을 각각 alpha-smooth muscle actin (α-SMA) 및 F4/80 염색을 실시하여 간성상세포 및 쿠퍼세포의 활성을 확인하고 결과를 도 16에 나타내었다.
도 16에 나타낸 바와 같이, sham 대비 MSC-exo, HLC-exo에서 간성상세포 및 쿠퍼세포의 활성이 줄어드는 것을 확인하였다.
실시예 7: 간성상세포에서 α- SMA의 발현 감소에 의한 엑소좀의 간 섬유화 치료 효능 확인
간 섬유화는 만성적인 간 손상으로 인해 야기되는 현상으로 세포외기질 및 섬유화 연관 신호전달체계의 복잡한 네트워크에 의해 유발되는데, TGF-β(transforming growthfactor β) 신호전달체계와 연관성이 있는지 여부를 확인하기 위해서, 활성 간성상세포에 엑소좀을 처리한 후 α-SMA의 발현양을 비교분석함으로써 간 섬유화 회복 효능을 검증하였다.
구체적으로, 배양 중인 간성상세포를 6-웰 플레이트에 5 X 104 cell/cm2으로 시딩을 실시한 후 24시간 후에 0.2% FBS가 함유되어 있는 배양액으로 바꾸어주어 활성이 없는 (quiescent) 간성상세포로 만들어주었다. 이후 10 ng/ml의 인간 TGF-β를 24시간 동안 처리하여 TGF-β에 의한 활성상태로 세포를 배양하였다. TGF-β를 처리함과 동시에 약 3 X 109의 엑소좀을 처리하여 SMAD2 단백질 발현양을 통해 TGF-β 신호전달체계의 활성 여부를 확인하였으며, α-SMA의 발현양을 대조군과 비교분석함으로써 간 섬유화 치료 효능을 검증한 결과를 도 17에 나타내었다.
도 17에 나타낸 바와 같이, serum-free (SF) 배지 처리 시 α-SMA 발현이 감소하였고 TGF-β 처리시 다시 증가함을 확인하였다. 또한 중간엽 줄기세포 및 간세포 유사세포 엑소좀을 동시에 처리하였을 때 α-SMA의 발현이 감소하고 있음을 확인하였다.
따라서, 중간엽 줄기세포 및 간세포 유사세포 엑소좀은 간 섬유화 치료에 효능을 나타냄을 확인하였다.
실시예 8: 엑소좀 유래 small RNA 분리 및 확인
상기에서 확인한 바와 같이 간 섬유화 치료에 효능을 나타내는 중간엽 줄기세포 및 간세포 유사세포로부터 유래된 엑소좀에 존재하는 small RNA들을 분리하기 위해서, 기존의 Trizol (phenol-guanidine thioacetamide) 방법을 변형하여 수행하였다.
구체적으로, 엑소좀 침전물에 Trizol 700 ㎕를 혼합하고 140 ㎕의 클로로포름을 혼합하여 볼텍싱 하였다 15,000 X G로 4℃에서 15분간 원심분리하여 액체상와 유기상을 분리킨 후, 분리된 액체상을 70%(v/v) 에탄올 500 ㎕와 혼합하여 약 200 nt 이상의 RNA들을 침전시켰다. 15,000 X G로 4 ℃에서 15분간 원심분리하여 침전물을 분리시키고, 상층액을 500 ㎕의 100% 에탄올 및 1 ㎕의 10 mg/ml 글리코겐을 넣고 섞어주어 상온에서 30분을 보관하여 약 200 nt 이하의 RNA들을 침전시켰다. 이후 15,000 X G로 4℃에서 15분간 원심분리하여 침전물을 분리시키고 상층액을 제거 후 700 ㎕의 70% 에탄올을 넣어주고 세척 과정을 진행하였다. 최종적으로 15,000 X G로 4℃에서 5분간 원심분리하여 침전물을 분리하고, 핵산가수분해효소가 없는 물(nuclease free water) 15 ㎕로 분리된 RNA들을 녹여주었다. 이 후 2X 겔 로딩 완충액에 RNA를 섞어 준 후 12% 폴리아크릴아미드 겔에서 크기에 따른 분리를 실시하였으며, TBO (Toluidine blue stain) 용액 (0.016% TBO, 2% methanol, 0.04% acetate)에 상온에서 20분 보관하여 RNA를 염색하고, 3차 증류수를 10분 간격으로 바꾸어주며 겔 상의 염색을 제거하였다. 그 결과를 도 18에 나타내었다.
도 18에 나타낸 바와 같이, 200 nt 이하 혹은 이상의 RNA들이 잘 분리 된 것으로 확인하였으며 하기에서 200 nt 이하의 small RNA들을 이용해 간 섬유화 치료 효능을 세포수준에서 확인하고자 하였다.
실시예 9: 대량 염기서열 분석을 통한 엑소좀 유래 small RNA 동정 및 분석
실시예　8의 결과를 바탕으로, 엑소좀 유래 small RNA를 동정하기 위해 하기와 같은 실험을 수행하였다. 먼저, HeLa 및 HEK293T 세포 유래 엑소좀을 확보하여 이를 간 손상 생쥐모델에 투여한 후, 대식세포 (F4/80) 및 활성 간성상세포 (a-SMA)의 수가 대조군과 유의한 차이가 없는 것을 확인하였으며, 간섬유화 연관 유전자 발현양상을 비교 시 HeLa 세포 유래 엑소좀을 처리한 간 조직에서 대조군과 가장 비슷한 발현양상을 나타내기에 이를 대량 염기서열 분석(high-throughput sequencing)의 대조군 엑소좀으로 선별하였다(도 19 참조). 대량 염기서열 분석 결과를 도 20에 나타내었다.
도 20에 나타낸 바와 같이, 엑소좀 마이크로RNA는 현재까지 보고된 2,588개의 인간 마이크로RNA 중 1,247개가 동정되었으며, 대조군, 중간엽 줄기세포, 그리고 간세포-유사 세포 유래 엑소좀에서는 각각 929, 681, 그리고 836개의 마이크로RNA가 동정되었다. 또한, 추가적인 분석을 통해 대조군 엑소좀 대비 중간엽 줄기세포 엑소좀에서는 78개, 분화된 간세포-유사 세포 엑소좀에는 69개의 마이크로RNA가 많은 양으로 포함되어 있음을 확인하였다. 이 중, 항 간섬유화 효능을 보이는 두 세포에서 유래된 엑소좀에서 공통적으로 유의성있게 많은 양이 포함된 것으로 확인된 57개의 마이크로RNA를 1차 선별하였다.
실시예 10: 항 간섬유화 후보 RNA 선정 및 제작
실시예 9를 통해 1차 선별한 마이크로RNA 중 간섬유화 연관 네트워크 및 엑소좀 RNA 염기서열 분석 결과에 기초하여 항 간섬유화 효능이 예상되는 총 5개의 마이크로RNA를 2차 선별하였다. 그 서열을 표 1에 나타내었으며, 사설 바이오업체에 주문제작하여 확보하였다.
No miRNAs Orientation Sequence (5’ to 3’)
1 Control miRNA Sense UUCUCCGAACGUGUCACGUTT
Antisense ACGUGACACGUUCGGAGAATT
2 hsa-miR-136 Sense CAUCAUCGUCUCAAAUGAGUCU (서열번호 1)
Antisense ACUCCAUUUGUUUUGAUGAUGGA
3 hsa-miR-199a Sense ACAGUAGUCUGCACAUUGGUUA (서열번호 2)
Antisense CCCAGUGUUCAGACUACCUGUUC
4 hsa-miR-409 Sense GAAUGUUGCUCGGUGAACCCCU (서열번호 3)
Antisense AGGUUACCCGAGCAACUUUGCAU
5 hsa-miR-410 Sense AGGUUGUCUGUGAUGAGUUCG (서열번호 4)
Antisense AAUAUAACACAGAUGGCCUGU
6 hsa-miR-432 Sense UCUUGGAGUAGGUCAUUGGGUGG (서열번호 5)
Antisense CUGGAUGGCUCCUCCAUGUCU
2차 선별된 마이크로RNA 5종을 활성 간성상세포로 트랜스팩션하여 간성상세포의 활성도를 웨스턴 블랏을 통해 확인하였다. 그 결과를 도 21에 나타내었다.
도 21에 나타낸 바와 같이, 2차 선별된 마이크로RNA 5종의 간성상세포 활성 저하 효과를 확인하였다.
실시예 11: 만성 간섬유화 동물 모델에서의 항 간섬유화 마이크로RNA의 효능 검증
마이크로RNA의 항 간섬유화 효능을 확인하기 위해 만성 간섬유화 동물 모델을 이용한 실험을 수행하였다. 다만, 생쥐의 복강으로 마이크로RNA를 직접 주입하게 되면 생체 내에 존재하는 다양한 RNA분해 효소에 의해 분해되어 효율적으로 간조직으로 전달되기 어려울 것으로 예상되었는바, 안정적으로 생체 내 특정 조직 및 세포로 전달할 수 있는 엑소좀에 선별한 마이크로RNA를 각각 주입하고, 이들을 생쥐 복강에 투여하여 마이크로RNA를 안정적으로 간조직으로 전달하고자 하였다. 우선적으로 엑소좀의 막단백질 (Lamp2b)에 간성상세포를 표적할 수 있는 펩타이드를 융합시키기 위해 plasmid DNA를 제작하여 HeLa 세포 및 HEK293T 세포에 트랜스팩션을 진행한 후 실시예 5에서 언급된 방법을 통해 각 세포의 엑소좀을 엑소좀 추출키트 (Exoquick-TC)를 이용해 추출하였다. 이들을 활용한 마이크로RNA의 간 성상세포로의 효과적 전달 여부를 확인하기 위해 각 3 X 109 개의 엑소좀에 빨간색 형광물질이 붙어있는 100 pmole의 RNA를 Exofect reagent를 활용하여 엑소좀 내부로 주입한 후 활성 간성상세포 배양액에 투여하였고, 그 결과를 도 22에 나타내었다.
도 22에 나타낸 바와 같이, RNA가 주입된 엑소좀을 활성 간성상세포 배양액에 투여하였을 때 RNA들이 HeLa 세포 유래 엑소좀을 활용하였을 때 2배 이상 간성상세포 내부로 유입됨을 확인하였다.
다음으로, 간독성 물질의 일종인 TAA(thioacetamide)를 8주간 (주당 3회) 반복적으로 생쥐의 복강에 투여하여 간섬유화 동물 모델을 제작한 후 상기와 같이 확립한 방법을 통해 각각의 100 pmole의 마이크로RNA(miR-409 또는 miR-410)가 주입된 3 X 109 개의 엑소좀을 생쥐복강에 투여하였다. 3일 후 생쥐를 희생시킨 뒤, 간조직을 분리하였으며, 종래 공지된 방법에 따라 Sirius Red 염색 및 면역형광염색을 수행하였다. 그 결과를 도 23 및 24에 나타내었다.
도 23에 나타낸 바와 같이, Sirius Red 염색 결과 miR-409 및 miR-410의 투여에 의해 간 조직 내 콜라겐 침착이 억제됨을 확인하였다.
또한, 도 24에 나타낸 바와 같이, 면역형광염색 결과 miR-409 및 miR-410의 투여에 의해 대식세포 (F4/80) 및 간섬유화의 주된 원인인 활성 간성상세포 (a-SMA)의 수가 감소됨을 확인하였다.
이상의 실험 결과를 통하여, 본 발명의 엑소좀 및 이로부터 유래된 리보핵산은 간성상세포 및 쿠퍼세포의 활성을 억제하고 α-SMA의 발현을 감소시키는 효과가 있으며, 교원질의 침착을 억제하여 간섬유증의 진행을 억제시키는 우수한 효과가 있음을 확인하였다.
비록 본 발명이 상기에 언급된 바람직한 실시예로서 설명되었으나, 발명의 요지와 범위로부터 벗어남이 없이 다양한 수정이나 변형을 하는 것이 가능하다. 또한 첨부된 청구 범위는 본 발명의 요지에 속하는 이러한 수정이나 변형을 포함한다.

Claims (13)

  1. 엑소좀(exosome) 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서, 상기 엑소좀은 중간엽 줄기세포 또는 간세포 유사세포에서 유래한 것을 특징으로 하는, 간섬유증 예방 또는 치료용 약학적 조성물.
  3. 제1항에 있어서, 상기 엑소좀 유래 리보핵산은 miR-136, miR-199a, miR-409, miR-410 및 mir-432 중에서 선택된 마이크로RNA인 것을 특징으로 하는, 간섬유증 예방 또는 치료용 약학적 조성물.
  4. 제3항에 있어서, 상기 miR-136은 서열번호 1로 표시되는 염기서열로 이루어진 것을 특징으로 하는, 간섬유증 예방 또는 치료용 약학적 조성물.
  5. 제3항에 있어서, 상기 miR-199a는 서열번호 2로 표시되는 염기서열로 이루어진 것을 특징으로 하는, 간섬유증 예방 또는 치료용 약학적 조성물.
  6. 제3항에 있어서, 상기 miR-409은 서열번호 3으로 표시되는 염기서열로 이루어진 것을 특징으로 하는, 간섬유증 예방 또는 치료용 약학적 조성물.
  7. 제3항에 있어서, 상기 miR-410은 서열번호 4로 표시되는 염기서열로 이루어진 것을 특징으로 하는, 간섬유증 예방 또는 치료용 약학적 조성물.
  8. 제3항에 있어서, 상기 miR-432은 서열번호 5로 표시되는 염기서열로 이루어진 것을 특징으로 하는, 간섬유증 예방 또는 치료용 약학적 조성물.
  9. 제1항 내지 제8항 중 어느 한 항에 있어서, 상기 간섬유증은 간섬유화, 문맥성 간경화, 괴사후성 간경화, 담즙성 간경화, 영양성 간경화, 알코올성 간경화, 바이러스 간염성 간경화, 담즙정체성 간경화 및 심장성 간경화로 구성된 군으로부터 선택된 1종 이상인 것을 특징으로 하는, 간섬유증 예방 또는 치료용 약학적 조성물.
  10. 엑소좀(exosome) 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 개선용 식품 조성물.
  11. 엑소좀(exosome) 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 세포치료제.
  12. 엑소좀(exosome) 또는 엑소좀 유래 리보핵산을 이를 필요로 하는 개체에 투여하는 단계;를 포함하는 간섬유증 예방 또는 치료 방법.
  13. 엑소좀(exosome) 또는 엑소좀 유래 리보핵산을 이를 필요로 하는 개체에 투여하는 단계;를 포함하는 간섬유증 개선 방법.
PCT/KR2017/009910 2017-09-08 2017-09-08 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물 WO2019050071A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US16/645,180 US11667916B2 (en) 2017-09-08 2017-09-08 Composition for preventing or treating liver fibrosis, containing exosome or exosome-derived ribonucleic acid
PCT/KR2017/009910 WO2019050071A1 (ko) 2017-09-08 2017-09-08 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2017/009910 WO2019050071A1 (ko) 2017-09-08 2017-09-08 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물

Publications (1)

Publication Number Publication Date
WO2019050071A1 true WO2019050071A1 (ko) 2019-03-14

Family

ID=65634885

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/009910 WO2019050071A1 (ko) 2017-09-08 2017-09-08 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물

Country Status (2)

Country Link
US (1) US11667916B2 (ko)
WO (1) WO2019050071A1 (ko)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021237238A1 (en) * 2020-05-19 2021-11-25 Cedars-Sinai Medical Center Exosome-derived piwi-interacting rna and methods of use thereof
US11220687B2 (en) 2012-08-13 2022-01-11 Cedars-Sinai Medical Center Exosomes and micro-ribonucleic acids for tissue regeneration
US11253551B2 (en) 2016-01-11 2022-02-22 Cedars-Sinai Medical Center Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of heart failure with preserved ejection fraction
US11351200B2 (en) 2016-06-03 2022-06-07 Cedars-Sinai Medical Center CDC-derived exosomes for treatment of ventricular tachyarrythmias
US11357799B2 (en) 2014-10-03 2022-06-14 Cedars-Sinai Medical Center Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of muscular dystrophy
US11541078B2 (en) 2016-09-20 2023-01-03 Cedars-Sinai Medical Center Cardiosphere-derived cells and their extracellular vesicles to retard or reverse aging and age-related disorders
US11660355B2 (en) 2017-12-20 2023-05-30 Cedars-Sinai Medical Center Engineered extracellular vesicles for enhanced tissue delivery
US11660317B2 (en) 2004-11-08 2023-05-30 The Johns Hopkins University Compositions comprising cardiosphere-derived cells for use in cell therapy
US11759482B2 (en) 2017-04-19 2023-09-19 Cedars-Sinai Medical Center Methods and compositions for treating skeletal muscular dystrophy

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA3235384A1 (en) * 2021-10-18 2023-04-27 Takahiro Ochiya Compositions and methods of use thereof for treating liver fibrosis
CN114107179B (zh) * 2021-12-27 2023-11-21 山东农业大学 鸡胆汁外泌体在治疗鸡肝损伤注射药物中的用途及药物

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016054094A1 (en) * 2014-09-30 2016-04-07 Research Institute At Nationwide Children's Hospital Compositions and methods for treating hepatic fibrosis
WO2017058938A1 (en) * 2015-09-29 2017-04-06 Research Institute At Nationwide Children's Hospital Methods for detecting hepatic fibrosis and responsiveness to therapy
KR20170103697A (ko) * 2016-03-03 2017-09-13 고려대학교 산학협력단 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2096171A1 (en) 2008-02-27 2009-09-02 Julius-Maximilians-Universität Würzburg MicroRNA (miRNA) and down-stream targets for diagnostic and therapeutic purposes
CA3052092A1 (en) * 2017-01-31 2018-08-09 Medizinische Hochschule Hannover (Mhh) Mir-671-5p inhibitor for the treatment of fibrosis

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016054094A1 (en) * 2014-09-30 2016-04-07 Research Institute At Nationwide Children's Hospital Compositions and methods for treating hepatic fibrosis
WO2017058938A1 (en) * 2015-09-29 2017-04-06 Research Institute At Nationwide Children's Hospital Methods for detecting hepatic fibrosis and responsiveness to therapy
KR20170103697A (ko) * 2016-03-03 2017-09-13 고려대학교 산학협력단 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HONG, J.: "Exosomes derived from mesenchymal stem cells and differentiated hepatocyte-like cells relieve liver fibrosis", INTERNATIONAL CONFERENCE OF THE KOREAN SOCIETY FOR MOLECULAR AND CELLULAR BIOLOGY, 21 September 2015 (2015-09-21), Seoul Korea *
MURAKAMI ET AL.: "The progression of liver fibrosis is related with overexpression of the miR-199 and 200 families", PLOS ONE, January 2011 (2011-01-01) *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11660317B2 (en) 2004-11-08 2023-05-30 The Johns Hopkins University Compositions comprising cardiosphere-derived cells for use in cell therapy
US11220687B2 (en) 2012-08-13 2022-01-11 Cedars-Sinai Medical Center Exosomes and micro-ribonucleic acids for tissue regeneration
US11357799B2 (en) 2014-10-03 2022-06-14 Cedars-Sinai Medical Center Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of muscular dystrophy
US11253551B2 (en) 2016-01-11 2022-02-22 Cedars-Sinai Medical Center Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of heart failure with preserved ejection fraction
US11351200B2 (en) 2016-06-03 2022-06-07 Cedars-Sinai Medical Center CDC-derived exosomes for treatment of ventricular tachyarrythmias
US11541078B2 (en) 2016-09-20 2023-01-03 Cedars-Sinai Medical Center Cardiosphere-derived cells and their extracellular vesicles to retard or reverse aging and age-related disorders
US11759482B2 (en) 2017-04-19 2023-09-19 Cedars-Sinai Medical Center Methods and compositions for treating skeletal muscular dystrophy
US11660355B2 (en) 2017-12-20 2023-05-30 Cedars-Sinai Medical Center Engineered extracellular vesicles for enhanced tissue delivery
WO2021237238A1 (en) * 2020-05-19 2021-11-25 Cedars-Sinai Medical Center Exosome-derived piwi-interacting rna and methods of use thereof

Also Published As

Publication number Publication date
US20200283763A1 (en) 2020-09-10
US11667916B2 (en) 2023-06-06

Similar Documents

Publication Publication Date Title
WO2019050071A1 (ko) 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물
KR101835018B1 (ko) 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물
IL240680B2 (en) Nucleic acids encoding telomerase reverse transcriptase, preparations containing them and their uses
US20180312839A1 (en) Methods and compositions for increasing smn expression
WO2011122889A2 (ko) miRNA의 발현 억제를 이용한 성체줄기세포의 노화 억제 방법
WO2019198995A1 (ko) 엑소좀 기반의 면역세포의 교차분화 방법
US20120003186A1 (en) Method for dedifferentiating adipose tissue stromal cells
WO2020149702A1 (ko) Nrl(neural retina leucine zipper)의 발현을 억제하는 비대칭 sirna
WO2018030630A1 (ko) Sox 유전자가 이입된 비바이러스성 미니써클 벡터 및 이의 제조방법
WO2019103300A1 (ko) Mirna를 포함하는 상처 치료 또는 피부 개선용 조성물
WO2023282688A1 (ko) 산화스트레스 저항성을 갖는 중간엽 줄기세포, 이의 제조방법 및 용도
WO2016043410A1 (ko) Oct4 및 sox2를 과발현하는 중간엽줄기세포 및 그 용도
WO2018231034A2 (ko) 암의 예방 또는 치료용 약학적 조성물
WO2016178519A1 (ko) 근육 노화 억제용 또는 근육 노화 관련 질환 치료용 조성물
KR102089088B1 (ko) 혈액 응고인자 ⅷ의 교정용 조성물 및 이를 이용한 방법
KR101516763B1 (ko) Dna 메틸기전달효소 억제제를 처리한 줄기세포 또는 그 배양물을 포함하는 면역질환 또는 염증질환의 예방 또는 치료용 약학조성물
WO2012133992A1 (ko) 지방유래 중간엽 줄기세포를 연골세포로 분화시키는 방법
WO2011087343A2 (ko) Ｈｐｖ 감염과 관련된 암의 치료용 조성물
WO2015056970A1 (ko) 프로그래뉼린 억제제를 유효성분으로 함유하는 골다공증 예방 또는 치료용 조성물
WO2019103572A1 (ko) Mirna를 포함하는 탈모 방지 또는 발모 촉진용 조성물
WO2023140524A1 (ko) 항섬유화 억제용 조성물
WO2022035287A1 (ko) 체외에서 유전자 교정된 세포 및 이의 용도
WO2022124626A1 (ko) 자가유지능이 향상된 중간엽줄기세포를 선별하는 방법 및 그에 의해 선별된 중간엽줄기세포
US20190055553A1 (en) Methods for identifying and targeting non-coding rna scaffolds
WO2021145703A1 (ko) 알츠하이머 예방 또는 치료용 약학적 조성물 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17924513

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17924513

Country of ref document: EP

Kind code of ref document: A1