WO2019103572A1 - Mirna를 포함하는 탈모 방지 또는 발모 촉진용 조성물 - Google Patents

Mirna를 포함하는 탈모 방지 또는 발모 촉진용 조성물 Download PDF

Info

Publication number
WO2019103572A1
WO2019103572A1 PCT/KR2018/014702 KR2018014702W WO2019103572A1 WO 2019103572 A1 WO2019103572 A1 WO 2019103572A1 KR 2018014702 W KR2018014702 W KR 2018014702W WO 2019103572 A1 WO2019103572 A1 WO 2019103572A1
Authority
WO
WIPO (PCT)
Prior art keywords
mirna
mir
hsa
seq
nucleotide sequence
Prior art date
Application number
PCT/KR2018/014702
Other languages
English (en)
French (fr)
Inventor
윤상원
이원종
박병순
최은욱
Original Assignee
(주)프로스테믹스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)프로스테믹스 filed Critical (주)프로스테믹스
Publication of WO2019103572A1 publication Critical patent/WO2019103572A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/13—Nucleic acids or derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/60—Sugars; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/60—Sugars; Derivatives thereof
    • A61K8/606—Nucleosides; Nucleotides; Nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q7/00—Preparations for affecting hair growth
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/318—Foods, ingredients or supplements having a functional effect on health having an effect on skin health and hair or coat

Definitions

  • the present invention is intended to provide a composition for various uses that can contain hair microRNA (miRNA) as an active ingredient to prevent hair loss or promote hair growth or hair growth.
  • miRNA hair microRNA
  • miRNA is a small non-coding RNA composed of 18-25 nucleotides (nt), which binds to the 3'-untranslated region (UTR) of the target gene to regulate gene expression (Bartel DP, et al. , Cell 116: 281-297, 2004; Lewis BP, et al., Cell 120: 15-20, 2005), intron, exon or intergenic region (Rodriguez A , et al., Genome Res 14: 1902-1910, 2004).
  • nt nucleotides
  • UTR 3'-untranslated region
  • the pri-miRNA is then used as a microprocessor (DroshaRNase endonuclease and DiGeorge syndrome region gene 8 protein, DGCR8) to form approximately 70 nt trunk loop intermediates, known as miRNA precursors.
  • DGCR8 DiGeorge syndrome region gene 8 protein
  • the pre-miRNA is then transferred from the nucleus to the cytoplasm via exoportin-5 (Exportin-5, EXP5) and the cofactor Ran-GTP, where the pre-miRNA is expressed by RNase endonuclease Dicer 18-25 nt mature miRNA duplexes (Lee Y, et al., EMBO J23: 4051-4060, 2004; Shenouda SK, et al., Cancer Metastasis Rev 28: 369-378, 2009).
  • Mature miRNA duplexes are integrated as single-stranded RNA with Argonaute protein into an RNA-induced silencing complex (RISC), which induces either truncation or translational inhibition of the target mRNA (Diederichs S, et al., Cell 131: 1097-1108, 2007; Hammond SM, et al., Nature 404: 293-296,2000; Martinez et al., Cell 110: 563-574, 2002).
  • RISC RNA-induced silencing complex
  • Hair loss is the most important cause of hair loss, but with the recent increase in social stress, the hair loss population is gradually increasing due to westernized eating habits such as environmental pollution and instant food, frequent perm and dyeing, and wrong scalp care.
  • the hair is maintained by repeating hair growth and hair loss around the cycles of Anagen, Catagen and Telogen. Specifically, there are anagen which grows hair, catagen which is the period of termination of growth and reduction of the size of the moles, talag, which is the period when the papilla stops its activity and keeps its hair on the scalp, Or a generator that generates new hair to depilate old hair.
  • Hair growth is 3 ⁇ 5 years for males, 4 ⁇ 6 years for females, 30 ⁇ 45 days for degenerative period, and 3 ⁇ 4 months for rest period. And at the end of the pause, a generator starts to generate new hair.
  • Hair loss is a normal phenomenon, but normal people have a lot of hair growing, compared with normal hair loss (Alopecia) people are in the off-state hair is a lot of visible hair loss appears.
  • the characteristic of people who exhibit alopecia is in the miniaturization of hair. As hair loss progresses, the period of growth is shortened and hair becomes smaller and smaller. Therefore, in order to treat hair loss, it is important to allow the hair follicle in a resting state to grow rapidly and to shorten the growth period.
  • testosterone is a hormone that causes male sexiness and develops muscles in adolescence and development of male organs.
  • This testosterone is known as 5-alpha-reductase, (DHT), a hormone that acts on the hair follicle to induce the hair follicle from the growth phase to the regenerator stage, resulting in hair loss. Therefore, in order to treat alopecia caused by these causes, a method of suppressing the production of DHT by 5 alpha-reductase is mainly used.
  • Female alopecia are caused mainly by a decrease in the amount of estrogen after menopause.
  • Female alopecia is different from the shape of male alopecia, the head is not removed from the front part of the head is mainly hair loss.
  • Female alopecia affects less than men in the association with 5 alpha - reductase. Therefore, drugs that inhibit 5 alpha-reductase inhibition are not effective for postmenopausal women with alopecia. Accordingly, minoxidil or estrogen is mainly used as a therapeutic agent for such alopecia.
  • Alopecia areata is caused by autoimmune diseases, mental stress, genetic predisposition. It is characterized by the appearance of round or oval hair loss, and the appearance of tofu rings or hairy walls. These alopecia areata are fundamentally different from those of androgenetic alopecia, and different methods of treatment are used, such as a method of treating corticosteroids, minoxidil being applied to the affected part or artificially induced to the affected part.
  • minoxidil has been reported to have a sticky feel and side effects that cause irritation to the skin.
  • pinasteride it is currently used as a preparation for oral administration.
  • adverse effects such as sexual dysfunction have been reported depending on its consumption,
  • the effect of 5 alpha-reductase inhibitor on the hair loss is effective only when it is taken steadily, and there is a lot of inconvenience in using the 5 alpha-reductase inhibitor because it is difficult to expect the effect by application and can be expected only by oral administration.
  • hsa-miR-328-3p miRNA, hsa-miR-6514-3p miRNA, hsa-miR-463-5p miRNA, hsa-miR- hsa-miR-4287, hsa-miR-6879-5p, hsa-miR-4484 and hsa-miR-619-5p have excellent hair growth and hair growth effects and can effectively prevent, ameliorate or treat hair loss. It was.
  • a miRNA comprising a seed sequence represented by any one of SEQ ID NOS: 1 to 9; An expression vector containing the same; Or a transformant transformed with the expression vector as an active ingredient.
  • a miRNA comprising a seed sequence represented by any one of SEQ ID NOS: 1 to 9; An expression vector containing the same; Or a transformant transformed with the expression vector as an active ingredient.
  • a miRNA comprising a seed sequence represented by any one of SEQ ID NOS: 1 to 9; An expression vector containing the same; Or a transformant transformed with the expression vector as an active ingredient.
  • the term 'hair growth' means that the hair grows in the hair follicles formed on the scalp, eyelid or skin, and 'hair growth' means that the hair grows longer (that is, hair growth).
  • the nucleotide sequence (UGGCCCU) represented by SEQ ID NO: 1 may be a seed sequence of hsa-miR-328-3p miRNA represented by the nucleotide sequence of SEQ ID NO: 10 (CUGGCCCUCUCUGCCCUUCCGU).
  • the nucleotide sequence (AUGGAGU) represented by SEQ ID NO: 2 may be a seed sequence of hsa-miR-6514-5p miRNA represented by the nucleotide sequence of SEQ ID NO: 11 (UAUGGAGUGGACUUUCAGCUGGC).
  • the nucleotide sequence (GGGUAUU) represented by SEQ ID NO: 3 may be a seed sequence of hsa-miR-503-3p miRNA represented by the nucleotide sequence of SEQ ID NO: 12 (GGGGUAUUGUUUCCGCUGCCAGG).
  • the nucleotide sequence (UGGGGGA) of SEQ ID NO: 4 may be a seed sequence of hsa-miR-4665-5p miRNA represented by the nucleotide sequence of SEQ ID NO: 13 (CUGGGGGACGCGUGAGCGCGAGC).
  • nucleotide sequence (GUGACUU) of SEQ ID NO: 5 may be a seed sequence of hsa-miR-6820-3p miRNA represented by the nucleotide sequence of SEQ ID NO: 14 (UGUGACUUCUCCCCUGCCACAG).
  • the nucleotide sequence (CUCCCUU) represented by SEQ ID NO: 6 may be a seed sequence of hsa-miR-4287 miRNA represented by the nucleotide sequence of SEQ ID NO: 15 (UCUCCCUUGAGGGCACUUU).
  • the nucleotide sequence (AGGGCAG) of SEQ ID NO: 7 may be a seed sequence of hsa-miR-6879-5p miRNA represented by the nucleotide sequence of SEQ ID NO: 16 (CAGGGCAGGGAAGGUGGGAGAG).
  • the nucleotide sequence of SEQ ID NO: 8 may be a seed sequence of hsa-miR-4484 miRNA represented by the nucleotide sequence of SEQ ID NO: 17 (AAAAGGCGGGAGAAGCCCCA).
  • the nucleotide sequence of SEQ ID NO: 9 may be a seed sequence of hsa-miR-619-5p miRNA represented by the nucleotide sequence of SEQ ID NO: 18 (GCUGGGAUUACAGGCAUGAGCC).
  • seed sequence in the present invention means a nucleotide sequence of a partial region of a miRNA that binds with complete complementarity when a miRNA recognizes a target, And is a region that has a substantially effective function.
  • the miRNA may be a polynucleotide represented by any one of SEQ ID NOS: 1 to 9, or a miRNA including the polynucleotide.
  • the miRNAs used in the present invention may be functionally equivalent to the miRNA nucleic acid molecule even if a functional equivalent of the nucleic acid molecule constituting the miRNA molecule, for example, a part of the base sequence of the miRNA nucleic acid molecule is modified by deletion, substitution or insertion And a variant capable of performing an equivalent action.
  • the miRNA of the present invention may exhibit at least 80% homology with the nucleotide sequence of each corresponding SEQ ID NO, and preferably at least 90%, more preferably at least 95%. Such homology can be readily determined by comparing the sequence of the nucleotide with the corresponding portion of the target gene using computer algorithms well known in the art, for example Align or BLAST algorithms.
  • the miRNA may be a mature miRNA as described above, but may be a miRNA precursor, a miRNA precursor in the form of a primary miRNA (pri-miRNA) or a plasmid.
  • the nucleic acid molecule constituting the miRNA precursor or the primary miRNA may have a length of 50 to 100 nt, more preferably 65 to 95 nt.
  • the miRNA may exist in a single stranded or double stranded form. Although mature miRNA molecules are predominantly single stranded, precursor miRNA molecules may contain a partial self-complementary structure (e.g., a stem-loop structure) that can form double strands.
  • a partial self-complementary structure e.g., a stem-loop structure
  • At least one of the nucleic acid molecules constituting the miRNA of the present invention includes a phosphorothiolate structure in which a phosphate backbone structure is substituted with a sulfur element; DNA, a form substituted with PNA (petide nucleic acids) or LNA (locked nucleic acid) molecules; Or a form wherein the 2 ' hydroxyl group of the sugar is replaced by a methylated, methoxylated or fluorinated structure.
  • the miRNA of the present invention can be isolated or prepared using standard molecular biology techniques such as chemical synthesis methods or recombinant methods, or commercially available miRNAs can be used.
  • the miRNA nucleic acid molecule can be provided in a form contained in an expression vector.
  • the expression vectors of the invention preferably encode miRNAs of the invention in an expressible form.
  • An " in an expressible form " in the present invention means that when the vector is introduced into a host cell, the vector expresses the molecule.
  • the vector may comprise regulatory elements necessary for expression of the miRNA.
  • the vector of the present invention may be used in the production of miRNA of the present invention or may be used as an active ingredient for direct hair loss treatment.
  • the expression vectors of the present invention can be used to stably insert into the genome of a target cell (see Thomas KR & Capecchi MR, Cell 1987, 51: 503-12 for a description of homologous recombinant cassette vectors). See, for example, Wolff et al., Science 1990, 247: 1465-8, U.S. Patent 5,580,859; 5,589, 466; 5,804, 566; 5,739,118; 5,736,524; 5,679,647; And WO 98/04720.
  • DNA-based delivery techniques include delivery of "naked DNA”, facilitating (bupivicaine, polymer, peptide-mediated) delivery, cationic lipid complexes and particle- mediated ["gene gun”] or pressure-mediated delivery (see, for example, U.S. Patent No. 5,922,687).
  • the expression vector is preferably a non-viral vector or a viral vector.
  • the non-viral vector is a plasmid DNA.
  • the viral vector include lentivirus, retrovirus, But are not limited to, adenovirus, herpes virus or avipox virus vectors.
  • the expression vector further comprises a selection marker in order to facilitate selection of the transformed cells.
  • Markers conferring selectable phenotypes such as, for example, drug resistance, resistance to nutritional requirements, cytotoxic agents or expression of surface proteins, such as green fluorescent protein, puromycin, neomycin, hygromycin, Histidine dehydrogenase (hisD) and guanine phosphoribosyltransferase (Gpt).
  • the expression vector may be introduced into a host cell and transformed into a transformant.
  • the host cell is preferably a somatic cell of a mammal including a human.
  • the host cell is a pelvic cell, but is not limited thereto.
  • the method for introducing the expression vector into the host cell may include a method of introducing the expression vector into the host cell by using a method such as G-fectin, Mirus TrasIT-TKO lipophilic reagent, lipofectin, lipofectamine, cellfectin, but are not limited to, cationic polymers, cationic micelles, cationic emulsions, or delivery reagents including liposomes, or may be introduced into cells or conjugated with biocompatible polymers such as polyethylene glycol to increase intracellular absorption.
  • a method such as G-fectin, Mirus TrasIT-TKO lipophilic reagent, lipofectin, lipofectamine, cellfectin, but are not limited to, cationic polymers, cationic micelles, cationic emulsions, or delivery reagents including liposomes, or may be introduced into cells or conjugated with biocompatible polymers such as polyethylene glycol to increase intracellular absorption.
  • composition of the present invention may contain a cell culture containing the miRNA as an active ingredient, or the miRNA may be isolated from the cell culture and included as an active ingredient.
  • the cell may be a dermal papilla cell or a stem cell.
  • the type of the stem cells is not limited.
  • the stem cells may be fat, bone marrow, umbilical cord or cord blood-derived stem cells, and more preferably, adipose-derived stem cells.
  • the type of adipose-derived stem cells is not limited as long as it does not cause the risk of infection by a pathogen and does not cause an immune rejection reaction, but it may be most preferably a stem cell derived from human adipose.
  • the culture medium used for the cell culture is an in vitro culture medium containing essential elements for growth and proliferation of cells such as sugars, amino acids, various nutrients, serum, growth factors and minerals, Or a mixture for growth and proliferation of cells such as stem cells.
  • DMEM Dulbecco's Modified Eagle's Medium
  • MEM Minimal Essential Medium
  • BME Base Medium Eagle
  • the method for separating miRNA from the cell culture is not particularly limited and may be carried out by a method generally used in the art.
  • a method of separating miRNA using a phenol compound or a method using a column Can be used to perform the separation.
  • composition of the present invention may contain an exosome containing the miRNA as an active ingredient, or the miRNA may be isolated from the exosome and include the miRNA as an active ingredient.
  • the term "exosome” refers to a small follicle having a membrane structure secreted from various cells, and is also defined as a nanobeicle.
  • the diameter of the micro-vesicles is about 30 to 1,000 nm, preferably 100 to 300 nm in average diameter, and refers to a follicle which is fused to the plasma membrane and released to the extracellular environment.
  • the exosome may be derived from a culture of dermal papilla cells or stem cells.
  • the type of the stem cells is not limited.
  • the stem cells may be fat, bone marrow, umbilical cord or cord blood-derived stem cells, and more preferably, adipose-derived stem cells.
  • the type of adipose-derived stem cells is not limited as long as it does not cause the risk of infection by a pathogen and does not cause an immune rejection reaction, but it may be most preferably a stem cell derived from human adipose.
  • the culture medium used for the cell culture is a culture medium containing in vivo an essential component for growth and proliferation of cells such as sugar, amino acid, various nutrients, serum, growth factor, ≪ / RTI > and the like.
  • DMEM Dulbecco's Modified Eagle's Medium
  • MEM Minimal Essential Medium
  • BME Base Medium Eagle
  • the method for isolating exosome from the cell culture is not particularly limited and may be carried out by a method generally used in the art.
  • a method generally used in the art for example, in the culture medium, centrifugation, ultracentrifugation, Separation by gel filtration chromatography, pre-flow electrophoresis, capillary electrophoresis, separation using a polymer, and the like, or a combination thereof, preferably centrifugation / ultracentrifugation .
  • the centrifugation / ultracentrifugation is preferably carried out at 4 ° C, 3,000-100,000 g for 10 minutes to 5 hours.
  • the method for isolating miRNA from the exosome is not particularly limited and may be carried out by a method generally used in the related art.
  • the exosome may be hemolyzed using a hemolysis reagent, Or a method of separating by using a column can be performed.
  • MiRNAs, expression vectors, transformants, cell cultures or exosomes provided by the present invention can promote hair growth and hair growth of desired hair such as hair, eyebrows and whiskers, thereby slowing down or suppressing the progress of hair loss.
  • the miRNA in the present invention can be very usefully used as a composition for scalp pillar for cosmetic or therapeutic purposes for preventing, ameliorating or treating the hair loss, and more particularly, as a composition for injecting pills.
  • the above-mentioned " comprising as an active ingredient” may mean that it contains an effective amount to such an extent that the hair growth promoting effect is exhibited.
  • prevention may include without limitation any act that blocks the symptoms of hair loss using the compositions of the present invention, or inhibits or delays the progression of hair loss symptoms.
  • treatment and “ improvement” may include, without limitation, any behavior that alleviates or alleviates hair loss symptoms using the composition of the present invention.
  • the treatment concentration of the miRNA of the present invention is not particularly limited, but may be 1 nM to 1 ⁇ M, preferably 1 nM to 100 nM, and more preferably 1 nM to 10 nM.
  • the expression vector comprising the miRNA of the invention More specifically, it contains 0.01 to 500 mg, and containing 0.1 to 300 mg and more specifically, in the case of a recombinant virus comprising the miRNA of the invention, in particular 10 3 to 10 12 IU (10-10 10 PFU), more specifically 10 5 to 10 10 IU, but is not limited thereto.
  • the transformant contains 10 3 to 10 8 , more specifically 10 4 to 10 7 , but is not limited thereto.
  • the effective dose of the composition containing the miRNA-containing expression vector or the transformant as an active ingredient of the present invention is 0.05 to 12.5 mg / kg in the case of the vector per 1 kg of body weight, 10 7 to 10 for the 11 virus-like particles (10 5 to 10 9 IU) / kg, cells 10 3 to 10 6 cells / kg and, specifically, if the vector is 0.1 to 10 mg / kg, when the recombinant virus is 10 8 to 10 in the case of 10 particles (10 6 to 10 8 IU) / kg, cells, and 10 2 to 10 5 cells / kg, it may be administered twice or three times a day.
  • Such composition is not necessarily limited to this, and may vary depending on the condition of the patient and the severity of the disease.
  • the pharmaceutical composition may be in the form of a capsule, a tablet, a granule, an injection, an ointment, a powder or a drink, and the pharmaceutical composition may be a human.
  • the pharmaceutical composition of the present invention may be formulated in the form of oral preparations such as powders, granules, capsules, tablets, aqueous suspensions, etc., external preparations, suppositories and sterilized injection solutions according to a conventional method, .
  • the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier may be a binder, a lubricant, a disintegrant, an excipient, a solubilizing agent, a dispersing agent, a stabilizer, a suspending agent, a coloring matter, a perfume or the like in the case of oral administration.
  • a solubilizing agent, an isotonic agent, a stabilizer and the like may be mixed and used.
  • a base an excipient, a lubricant, a preservative and the like may be used.
  • Formulations of the pharmaceutical compositions of the present invention may be prepared in a variety of ways by mixing with a pharmaceutically acceptable carrier as described above.
  • oral administration may be in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc.
  • they may be formulated in unit dosage ampoules or in multiple dosage forms have.
  • suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltoditol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil. Further, it may further include a filler, an anticoagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent, an antiseptic, and the like.
  • the route of administration of the pharmaceutical composition according to the present invention may be, but is not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, , Sublingual or rectal. Oral or parenteral administration is preferred.
  • parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.
  • the pharmaceutical compositions of the present invention may also be administered in the form of suppositories for rectal administration.
  • the pharmaceutical composition of the present invention may be administered orally or parenterally depending on various factors including the activity of the specific compound used, age, weight, general health, sex, diet, time of administration, route of administration, rate of excretion, drug combination, And the dose of the pharmaceutical composition may be appropriately selected by a person skilled in the art depending on the condition of the patient, the body weight, the degree of disease, the mode of administration, the route of administration and the period of time, and is preferably from 0.0001 to 50 mg / kg or 0.001 to 50 mg / kg.
  • the administration may be carried out once a day or divided into several times.
  • the dose is not intended to limit the scope of the invention in any way.
  • the pharmaceutical composition according to the present invention can be formulated into pills, dragees, capsules, solutions, gels, syrups, slurries, suspensions.
  • the cosmetic composition according to the present invention may be used in cosmetics, nutritional lotions, nutritional essences, massage creams, cosmetic bath additives, body lotions, body milks, bath oils, baby oils, baby powders, shower gels, shower creams, sunscreen lotions, Face and Body Cream, Face and Body Cream, Skin Whitening Cream, Hand Lotion, Hair Lotion, Cosmetic Cream, Jasmine Oil, Face Cream, Skin Cream, Skin Cream, Sunscreen Cosmetics, Bath soap, water soap, soap, shampoo, hand cleanser, medicinal soap ⁇ non-medical use ⁇ , cream soap, facial wash, whole body cleanser, scalp cleanser, hair rinse, cosmetic soap, tooth whitening gel, . ≪ / RTI >
  • the composition of the present invention may further comprise a solvent commonly used in the production of a cosmetic composition, or a suitable carrier, excipient or diluent.
  • water, saline solution, DMSO, or a combination thereof may be used.
  • the carrier, excipient or diluent include purified water, oil, wax But are not limited to, fatty acids, fatty acid alcohols, fatty acid esters, surfactants, humectants, thickeners, antioxidants, viscosity stabilizers, chelating agents, buffers, lower alcohols and the like. Further, if necessary, it may contain a whitening agent, a moisturizing agent, a vitamin, an ultraviolet screening agent, a perfume, a dye, an antibiotic, an antibacterial agent, and an antifungal agent.
  • oil hydrogenated vegetable oil, castor oil, cottonseed oil, olive oil, palm oil, jojoba oil and avocado oil may be used.
  • wax examples include wax, wax, carnauba, candelilla, montan, ceresin, liquid paraffin, Can be used.
  • fatty acid stearic acid, linoleic acid, linolenic acid and oleic acid may be used.
  • fatty acid alcohol cetyl alcohol, octyldodecanol, oleyl alcohol, panthenol, lanolin alcohol, stearyl alcohol and hexadecanol may be used.
  • fatty acid esters isopropyl myristate, isopropyl palmitate, and butyl stearate may be used.
  • surfactant a cationic surfactant, an anionic surfactant and a nonionic surfactant known in the art can be used, and a surfactant derived from a natural material is preferably used.
  • it may contain a hygroscopic agent, a thickening agent, an antioxidant and the like widely known in the field of cosmetics, and the kind and amount thereof are well known in the art.
  • the food composition of the present invention may be prepared in the form of various foods such as beverage, gum, tea, vitamin complex, powder, granule, tablet, capsule, confection, rice cakes, bread and the like. Since the food composition of the present invention is composed of a plant extract having little toxicity and side effects, it can be safely used for prolonged use even for prophylactic purposes.
  • the amount thereof may be added in a proportion of 0.1 to 50% of the total weight.
  • natural carbohydrates include monosaccharides such as glucose, disaccharides such as fructose, sucrose and the like and sugar sugars such as polysaccharide, dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol can do.
  • natural flavors include natural flavors (such as tau martin and stevia extract (for example, rebaudioside A and glycyrrhizin) and synthetic flavors (for example, saccharine and aspartame).
  • the food composition of the present invention can be used as a flavoring agent such as various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavors, colorants, pectic acid and its salts, alginic acid and its salts, , a pH adjusting agent, a stabilizer, a preservative, a glycerin, an alcohol, a carbonating agent used in a carbonated drink, and the like.
  • a flavoring agent such as various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavors, colorants, pectic acid and its salts, alginic acid and its salts, , a pH adjusting agent, a stabilizer, a preservative, a glycerin, an alcohol, a carbonating agent used in a carbonated drink, and the like.
  • additives may be used independently or in combination.
  • the proportion of such additives is not so critical, but is generally selected in the range of 0.1 to about 50 parts by weight per 100 parts by weight of the composition of the present invention.
  • a method for preventing, ameliorating or treating hair loss comprising administering to a subject an miRNA, an expression vector, a transformant, or a composition for preventing, And to a method of preventing or treating such diseases.
  • the above-mentioned " objective individual” means an individual having hair loss or having a high possibility of developing hair loss.
  • a cell culture containing the miRNA may be administered to the desired individual, or the miRNA may be isolated from the cell culture.
  • the exosome containing the miRNA may be administered to the subject, or the miRNA may be isolated from the exosome and administered.
  • the miRNA, the expression vector, the transformant, the cell culture, the exosome, and the composition for preventing, ameliorating or treating hair loss overlap with those described above, and detailed description will be omitted.
  • the dosage, schedule and route of administration of the miRNA, expression vector or transformant provided herein can be determined according to the size and condition of the individual, and according to standard pharmaceutical practice.
  • Exemplary routes of administration include intravenous, intraarterial, intraperitoneal, intrapulmonary, intravascular, intramuscular, intratracheal, subcutaneous, intrathecal, intrathecal, or transdermal.
  • the dosage of the miRNA, expression vector or transformant administered to the subject in the methods of the present invention may vary depending on, for example, the particular type of miRNA, expression vector or transformant administered, the route of administration, It depends on the specific type and stage.
  • the amount should be sufficient to bring about the desired response, such as a therapeutic response to hair loss, without severe toxic or adverse events.
  • the effect can be scaled using standard methods such as in vitro assays with purified enzyme, cell-based assays, animal models or human experiments.
  • the administration concentration of the miRNA is not particularly limited, but may be 1 nM to 1 ⁇ M, preferably 1 nM to 100 nM, more preferably 1 nM to 10 nM .
  • the expression vector containing the miRNA may be specifically administered in an amount of 0.01 to 500 mg, more specifically, in an amount of 0.1 to 300 mg, In the case of a recombinant virus, specifically, it may be administered in an amount of 10 3 to 10 12 IU (10 to 10 10 PFU), more specifically, in an amount of 10 5 to 10 10 IU, but is not limited thereto.
  • a transformant containing the miRNA of the present invention may be administered in an amount of 10 3 to 10 8 , more specifically, in an amount of 10 4 to 10 7 , but is not limited thereto .
  • the effective dose of the miRNA-containing expression vector or the transformant is 0.05 to 12.5 mg / kg in the case of the vector per 1 kg of body weight, 10 7 to 10 11 viral particles in the case of the recombinant virus 10 5 to 10 9 IU) / kg, if the cells 10 3 to 10 6 cells / kg and, specifically, if the vector is 0.1 to 10 mg / kg, when the recombinant virus is 10 8 to 10 10 particles (10 6 to 10 8 IU) / kg, and in the case of cells, 10 2 to 10 5 cells / kg, and can be administered 2 to 3 times a day.
  • Such composition is not necessarily limited to this, and may vary depending on the condition of the patient and the severity of the disease.
  • the exosome containing the miRNA of the present invention may be contained in an amount of 0.001 to 1000 ⁇ g / ml, 0.01 to 100 ⁇ g / ml, or 0.1 to 50 ⁇ g / ml based on the amount of protein, 10 8 / ml to 1 X 10 14 atoms / ml, 1 X 10 9 number / ml to 1 X 10 13 atoms / ml, 1 X 10 10 atoms / ml to 1 X 10 12 atoms / be contained in an amount of ml But is not limited thereto.
  • a cell culture containing the miRNA of the present invention it may be contained in an amount of 0.001 to 1000 ⁇ g / ml, 0.01 to 100 ⁇ g / ml, or 0.1 to 50 ⁇ g / ml, based on the amount of protein, but is not limited thereto.
  • the miRNA, expression vector or transformant may be respectively formulated in the form of oral preparations such as powders, granules, capsules, tablets and aqueous suspensions, external preparations, suppositories and sterilized injection solutions, .
  • a pharmaceutically acceptable carrier may be administered together with the miRNA, the expression vector or the transformant.
  • the pharmaceutically acceptable carrier may be a binder, a lubricant, a disintegrant, an excipient, a solubilizing agent, a dispersing agent, a stabilizer, a suspending agent, a coloring matter, a perfume or the like in the case of oral administration.
  • a solubilizing agent, an isotonic agent, a stabilizer and the like may be mixed and used.
  • a base, an excipient, a lubricant, a preservative and the like may be used.
  • the secretory protease can be mixed with a pharmaceutically acceptable carrier and variously manufactured.
  • oral administration may be in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc.
  • they may be formulated in unit dosage ampoules or in multiple dosage forms have.
  • solutions, suspensions, tablets, capsules, sustained-release preparations and the like are examples of the secretory protease.
  • suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltoditol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil. Further, it may further include a filler, an anticoagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent, an antiseptic, and the like.
  • the miRNA provided by the present invention promotes the growth and proliferation of dermal papilla cells and promotes the expression of various genes related to the hair, thereby excelling in hair growth and hair growth, and more effectively preventing or treating hair loss.
  • FIG. 1A is a graph showing the results of analysis of cell survival rate after treatment of 1 nM of miRNA according to the present invention in dermal papilla cells in Example 1.
  • FIG. 1A is a graph showing the results of analysis of cell survival rate after treatment of 1 nM of miRNA according to the present invention in dermal papilla cells in Example 1.
  • FIG. 1B is a graph showing the results of analysis of cell survival rate after treatment of 10 nM of miRNA according to the present invention in dermal papilla cells in Example 1.
  • FIG. 1B is a graph showing the results of analysis of cell survival rate after treatment of 10 nM of miRNA according to the present invention in dermal papilla cells in Example 1.
  • FIG. 1C is a graph showing the results of analysis of cell survival rate after treatment of 100 nM of miRNA according to the present invention in dermal papilla cells in Example 1 in Example 1.
  • FIG. 1C is a graph showing the results of analysis of cell survival rate after treatment of 100 nM of miRNA according to the present invention in dermal papilla cells in Example 1 in Example 1.
  • FIG. 2 is a graph showing the results of analysis of cell viability after treatment of miRNA according to the present invention on dermal papilla cells in Example 2.
  • FIG. 2 is a graph showing the results of analysis of cell viability after treatment of miRNA according to the present invention on dermal papilla cells in Example 2.
  • FIG. 3 is a graph showing the results of analysis of expression levels of TGF- ⁇ 1 protein associated with hair loss after treatment of miRNA according to the present invention on dermal papilla cells in Example 3.
  • FIG. 3 is a graph showing the results of analysis of expression levels of TGF- ⁇ 1 protein associated with hair loss after treatment of miRNA according to the present invention on dermal papilla cells in Example 3.
  • FIG. 4 is a graph showing the results of analysis of expression levels of FGF-7 associated with hair growth after treatment of miRNA according to the present invention in dermal papilla cells in Example 4.
  • FIG. 4 is a graph showing the results of analysis of expression levels of FGF-7 associated with hair growth after treatment of miRNA according to the present invention in dermal papilla cells in Example 4.
  • FIG. 5 is a graph showing the results of analysis of expression levels of TGF- ⁇ 2 associated with hair loss after treatment of miRNA according to the present invention on dermal papilla cells in Example 4.
  • FIG. 5 is a graph showing the results of analysis of expression levels of TGF- ⁇ 2 associated with hair loss after treatment of miRNA according to the present invention on dermal papilla cells in Example 4.
  • FIG. 6 is a graph showing the results of analysis of expression levels of NOG associated with hair loss after treatment of miRNA according to the present invention on dermal papilla cells in Example 4.
  • FIG. 6 is a graph showing the results of analysis of expression levels of NOG associated with hair loss after treatment of miRNA according to the present invention on dermal papilla cells in Example 4.
  • FIG. 7 is a graph showing the results of analysis of expression levels of Wnt10b related to hair loss after treatment of miRNA according to the present invention on dermal papilla cells in Example 5.
  • FIG. 7 is a graph showing the results of analysis of expression levels of Wnt10b related to hair loss after treatment of miRNA according to the present invention on dermal papilla cells in Example 5.
  • a miRNA comprising a seed sequence represented by any one of SEQ ID NOS: 1 to 9; An expression vector containing the same; Or a transformant transformed with the expression vector as an active ingredient.
  • a miRNA comprising a seed sequence represented by any one of SEQ ID NOS: 1 to 9; An expression vector containing the same; Or a transformant transformed with the expression vector as an active ingredient.
  • a miRNA comprising a seed sequence represented by any one of SEQ ID NOS: 1 to 9; An expression vector containing the same; Or a transformant transformed with the expression vector as an active ingredient.
  • a method for preventing, ameliorating or treating hair loss provided by the miRNA, an expression vector, a transformant, or the hair loss provided by the present invention And a method of preventing or treating hair loss.
  • the nucleotide sequence (UGGCCCU) represented by SEQ ID NO: 1 may be a seed sequence of hsa-miR-328-3p miRNA represented by the nucleotide sequence of SEQ ID NO: 10 (CUGGCCCUCUCUGCCCUUCCGU).
  • the nucleotide sequence (AUGGAGU) represented by SEQ ID NO: 2 may be a seed sequence of hsa-miR-6514-5p miRNA represented by the nucleotide sequence of SEQ ID NO: 11 (UAUGGAGUGGACUUUCAGCUGGC).
  • the nucleotide sequence (GGGUAUU) represented by SEQ ID NO: 3 may be a seed sequence of hsa-miR-503-3p miRNA represented by the nucleotide sequence of SEQ ID NO: 12 (GGGGUAUUGUUUCCGCUGCCAGG).
  • the nucleotide sequence (UGGGGGA) of SEQ ID NO: 4 may be a seed sequence of hsa-miR-4665-5p miRNA represented by the nucleotide sequence of SEQ ID NO: 13 (CUGGGGGACGCGUGAGCGCGAGC).
  • nucleotide sequence (GUGACUU) of SEQ ID NO: 5 may be a seed sequence of hsa-miR-6820-3p miRNA represented by the nucleotide sequence of SEQ ID NO: 14 (UGUGACUUCUCCCCUGCCACAG).
  • the nucleotide sequence (CUCCCUU) represented by SEQ ID NO: 6 may be a seed sequence of hsa-miR-4287 miRNA represented by the nucleotide sequence of SEQ ID NO: 15 (UCUCCCUUGAGGGCACUUU).
  • the nucleotide sequence (AGGGCAG) of SEQ ID NO: 7 may be a seed sequence of hsa-miR-6879-5p miRNA represented by the nucleotide sequence of SEQ ID NO: 16 (CAGGGCAGGGAAGGUGGGAGAG).
  • the nucleotide sequence of SEQ ID NO: 8 may be a seed sequence of hsa-miR-4484 miRNA represented by the nucleotide sequence of SEQ ID NO: 17 (AAAAGGCGGGAGAAGCCCCA).
  • the nucleotide sequence of SEQ ID NO: 9 may be a seed sequence of hsa-miR-619-5p miRNA represented by the nucleotide sequence of SEQ ID NO: 18 (GCUGGGAUUACAGGCAUGAGCC).
  • the miRNA may be a polynucleotide represented by any one of SEQ ID NOS: 1 to 9, or a miRNA including the polynucleotide.
  • the cell survival rate of the dermal papilla cells was increased. Especially, when the treatment was performed at a concentration of 1 to 10 nM, the cell survival rate was higher.
  • TGF- ⁇ 1 is known to induce and promote hair loss by inducing apoptosis of hair follicle cells.
  • six types of miRNAs of P1 to P6 obtained in Preparation Example 1 were introduced into the dermal papilla cells using lipofectamine at a concentration of 10 nM and then subjected to Immunocytochemistry
  • the expression level of TGF- ⁇ 1 was examined by RT-PCR and the results are shown in FIG.
  • minoxidil MNX
  • FGF-7, TGF- ⁇ 2 and NOG are known to be related to hair growth.
  • six types of miRNAs of P1 to P6 obtained in Preparation Example 1 were introduced into dermal papilla cells at a concentration of 10 nM using lipofectamine, harvested and harvested to obtain FGF -7, TGF-? 2 and NOG were isolated and cDNA was synthesized and quantified by quantifying the cycle of real-time amplification of the gene through the qPCR technique using the primer shown in Table 3 below. The results are shown in Figs. However, minoxidil (PC) was treated as a positive control.
  • PC minoxidil
  • Wnt10b is also known as a hair-related gene.
  • three types of miRNAs of P7 to P9 obtained in Preparation Example 1 were introduced into the dermal papilla cells using lipofectamine at a concentration of 2 nM, and the cells were harvested to prepare Wnt10b
  • the cDNAs were synthesized and the genes were amplified by the qRT-PCR technique using the primers shown in Table 4 below. Quantitation of the amplified gene was calculated by Delta-Delta-Ct (ddCt). All samples were normalized by the cDNA amplification of GAPDH, a housekeeping gene, and analyzed for expression level. The results are shown in FIG.
  • the expression level of Wnt10b, a hair growth-related gene was significantly increased as compared to the case of no treatment (miR-CT).
  • miRNAs of P1 to P9 according to the present invention promote the proliferation of the dermal papilla cells and inhibit the expression of the hair loss related gene, but the expression of the hair growth related gene is increased and the hair growth and hair growth effect are excellent .
  • the present invention relates to a method of preventing hair loss using microRNA (miRNA), or promoting hair growth or hair growth.
  • miRNA microRNA
  • SEQ ID NO: 1 seed sequence of hsa-miR-328-3p miRNA
  • SEQ ID NO: 2 Seed sequence of hsa-miR-6514-5p miRNA
  • SEQ ID NO: 3 hsa-miR-503-3p miRNA seed sequence
  • SEQ ID NO: 4 hsa-miR-4665-5p miRNA seed sequence
  • SEQ ID NO: 5 hsa-miR-6820-3p miRNA seed sequence
  • SEQ ID NO: 6 hsa-miR-4287 miRNA seed sequence
  • SEQ ID NO: 7 hsa-miR-6879-5p miRNA seed sequence
  • SEQ ID NO: 8 hsa-miR-4484 miRNA seed sequence
  • SEQ ID NO: 9 hsa-miR-619-5p miRNA seed sequence
  • SEQ ID NO: 10 hsa-miR-328-3p miRNA sequence
  • SEQ ID NO: 11 hsa-miR-6514-5p miRNA sequence
  • SEQ ID NO: 12 hsa-miR-503-3p miRNA sequence
  • SEQ ID NO: 13 hsa-miR-4665-5p miRNA sequence
  • SEQ ID NO: 14 hsa-miR-6820-3p miRNA sequence
  • SEQ ID NO: 15 hsa-miR-4287 miRNA sequence
  • SEQ ID NO: 16 hsa-miR-6879-5p miRNA sequence
  • SEQ ID NO: 17 hsa-miR-4484 miRNA sequence
  • SEQ ID NO: 18 hsa-miR-619-5p miRNA sequence

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Dermatology (AREA)
  • Mycology (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Nutrition Science (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Birds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 마이크로RNA(miRNA)를 유효 성분으로 포함하여, 탈모를 방지하거나, 발모 또는 육모를 촉지할 수 있는 조성물로, 구체적으로는 서열번호 1 내지 9 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효 성분으로 포함하는 조성물에 관한 것이다.

Description

MIRNA를 포함하는 탈모 방지 또는 발모 촉진용 조성물
본 발명은 마이크로RNA(miRNA)를 유효 성분으로 포함하여, 탈모를 방지하거나, 발모 또는 육모를 촉진할 수 있는 다양한 용도의 조성물을 제공하고자 한다.
miRNA는 18-25 뉴클레오티드(nucleotide, nt)로 구성된 작은 비-암호화 RNA로서, 표적 유전자의 3'-비번역 부위(untranslated region, UTR)에 결합하여 유전자 발현을 조절하고(Bartel DP, et al., Cell 116: 281-297, 2004; Lewis BP, et al., Cell 120: 15-20, 2005), 인트론(intron), 엑손(exon) 또는 유전자 간 부위(intergenic region)로부터 공정된다(Rodriguez A, et al., Genome Res14: 1902-1910, 2004). 첫째로, miRNA는 수천 개의 뉴클레오티드를 포함하는 초기 miRNA(pri-miRNA) 분자 내로 RNA 폴리머라아제에 의해 전사된다. 그런 다음, pri-miRNA는 miRNA 전구체로 알려진 대략 70 nt 줄기 고리 중간체를 형성하기 위해 마이크로프로세서[DroshaRNase 엔도뉴클레아제 및 디조지증후군 부위 유전자 8 단백질(DroshaRNase endonuclease and DiGeorge syndrome region gene 8 protein, DGCR8)]에 의해 연속적으로 공정된다(Lee Y, et al., EMBO J21: 4663-4670, 2000; Zeng Y, et al., Proc Natl Acad Sci U S A100: 9779-9784, 2003). 그런 다음, pre-miRNA는 엑소폴틴-5(Exportin-5, EXP5)와 공동인자 Ran-GTP를 통해 핵으로부터 세포질로 이동되고, 여기서 pre-miRNA는 RNase 엔도뉴클레아제 다이서에 의해 18-25 nt 성숙 miRNA 듀플렉스(duplexe)로 공정된다(Lee Y, et al., EMBO J23: 4051-4060, 2004; Shenouda SK, et al., Cancer Metastasis Rev28: 369-378, 2009). 성숙 miRNA 듀플렉스는 RNA-유도 침묵 복합체(RNA-induced silencing complex, RISC) 내로 아르고노트(Argonaute) 단백질과 단일 가닥 RNA로서 통합되고, 이는 표적 mRNA의 절단 또는 번역 억제 중 어느 하나를 유도한다(Diederichs S, et al., Cell131: 1097-1108, 2007; Hammond SM, et al., Nature404: 293-296, 2000; Martinez et al., Cell 110: 563-574, 2002).
탈모는 유전적 요인이 가장 주요한 원인으로 작용하나, 최근 사회적 스트레스의 증가와 더불어 환경 오염 및 인스턴트 식품 등 서구화된 식습관, 잦은 파마와 염색, 잘못된 두피 관리들로 인하여 탈모 인구가 점차 증가하고 있다.
모발은 성장기(Anagen), 퇴화기(Catagen), 휴지기(Telogen)의 주기를 돌며 발모와 탈모를 반복하며 유지되고 있다. 상세하게는, 모발을 성장시키는 성장기(anagen), 성장을 종료하고 모구부가 축소하는 시기인 퇴화기(catagen), 모유두가 활동을 멈추고 모발을 두피에 머무르게 하는 시기인 휴지기(talogen), 모유두가 활동을 시작하거나 또는 새로운 모발을 발생시켜 오래된 모발을 탈모시키는 시기인 발생기로 나눌 수 있다.
모발의 성장기는 남성 3~5년, 여성이 4~6년 정도로 그 후 퇴화기 30~45일 정도, 휴지기가 3~4개월 정도 지나 자연적으로 탈모가 된다. 그리고 휴지기의 마지막이 되면 새로운 모발이 생성되는 발생기가 시작된다.
탈모는 정상적인 현상이나 정상인 사람이 성장기 상태의 모발이 많은 데 비해 보통 탈모증(Alopecia)인 사람은 휴지기 상태의 모발이 많아 눈으로 보이는 탈모현상이 나타내게 된다.
탈모증을 나타내는 사람들의 특징은 모발의 소형화에 있다. 탈모가 진행될 수록 성장기의 기간이 짧아지고 이로 인하여 모발은 점점 소형화된다. 따라서 탈모의 치료를 위해서는 휴지기 상태의 모낭을 성장기로 빨리갈 수 있도록 하고, 짧아진 성장기를 늘려주는 것이 중요하다.
남성형 탈모증은 남성의 성징을 나타나게 하며 사춘기에 근육의 발달, 남성 기관의 발달 등에 작용하는 호르몬인 테스토스테론(Testosterone)이라는 남성호르몬에 의해 나타나는 현상으로 이 테스토스테론이 5 알파-리덕타아제(α-reductase)라는 효소에 의해 더 강력한 호르몬인 디히드로테스토스테로(Dihydrotestosterone:DHT)으로 바뀌게 되면, 이 호르몬이 모낭에 작용하여 모낭을 성장기 단계에서 퇴화기 단계로 유도하여 탈모가 일어나게 한다. 따라서 이러한 원인에 의한 탈모증을 치료하기 위하여 5 알파-리덕타아제에 의한 DHT의 생성을 억제하는 방법이 주로 사용된다.
여성형 탈모증은 주로 폐경기 이후 에스트로겐 양의 감소에 의해 발생한다. 여성의 탈모증은 남성형 탈모증의 모양과는 좀 다르게 머리 앞부분은 빠지지 않고 중간 부분의 머리만이 주로 탈모된다. 여성의 탈모증은 5 알파-리덕타아제와의 연관관계가 남성보다 적게 작용한다. 따라서 5 알파-리덕타아제를 억제시키는 약물은 폐경기 이후의 탈모증 여성에게는 별로 효과가 없다. 따라서, 이러한 탈모증을 위한 치료제로는 주로 미녹시딜이나 에스트로겐을 사용한다.
원형 탈모증은 자가면역질환이나 정신적 스트레스, 유전적 소인에 의해 발생한다. 원형 또는 난원형의 탈모가 일어나며, 두부 백선이나 발모벽이 생기는 특징을 갖고 있다. 이러한 원형 탈모증은 안드로겐성 탈모증과는 근본적으로 원인이 다르며, 치료법 또한 달라서 부신피질 호르몬제를 처리하는 방법을 사용하거나, 미녹시딜을 환부에 바르거나 인위적으로 환부에 자극을 유발하는 방법을 사용한다.
이처럼 다양하고 복잡한 탈모 원인에 대하여, 현재까지 알려진 탈모 방지 제품에는 유효성분으로 혈액 순환 촉진, 남성 호르몬 작용 억제, 모근 기능 강화 등을 목적으로 하는 성분 등이 시중에 제품으로 판매되고 있으나, 효과 면에서 뚜렷한 효과를 지닌 것은 아직까지 없는 상태이고, 대부분 부작용의 문제가 제기되기도 한다.
이러한 발모제로, 처음에는 혈액 순환 촉진을 위한 용도로 개발되어 사용되다가 이를 사용하는 환자들 사이에서 부작용으로 발모 효과를 나타내는 것으로 알려져, 이후, 발모용 원료로 미국식품의약품안전청(FDA)에서 승인받아 발모 치료제로 사용되어진 미국특허 제3,382,247호의 미녹시딜(6-Amino-1,2-dihydro-1-hydroxy-2-imino-4-phenoxypyrimidine)은 현재에도 발모용 치료제로 사용되고 있으며, 미국특허 제5,215,894호에서 언급된 머크사의 피나스테라이드(finasteride)는 처음에는 남성의 전립선 치료제로 사용되던 성분이었으나, 역시 인체 내 투여량을 조절하여 남성형 탈모증 치료제로 탄생하게 되었다.
그러나, 미녹시딜의 경우 끈적이는 사용감과 피부에 자극을 유발하는 부작용이 보고된 바 있으며, 피나스테라이드의 경우 현재 경구투여용 제제로 사용되고 있으나, 이의 섭취에 따라 성기능 장애 등의 부작용이 보고된 일도 있을 뿐 아니라, 탈모에 대해서도 꾸준한 복용이 이루어져야만 효과가 있으며, 이들의 5 알파-리덕타아제 활성 억제제는 도포에 의한 효과를 기대하기 어렵고, 경구복용에 의해서만 효과를 기대할 수 있어서 사용상에 많은 불편함이 있다.
본 발명의 일 목적은 발모 및 육모 촉진 효과가 뛰어나 탈모를 효과적으로 예방 또는 치료할 수 있는 약학적 조성물을 제공하고자 한다.
본 발명의 일 목적은 발모 및 육모 촉진 효과가 뛰어나 탈모를 효과적으로 예방 또는 개선할 수 있는 화장료 조성물을 제공하고자 한다.
본 발명의 일 목적은 발모 및 육모 촉진 효과가 뛰어나 탈모를 효과적으로 예방 또는 개선할 수 있는 식품 조성물을 제공하고자 한다.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
본 발명의 발명자들은 hsa-miR-328-3p miRNA, hsa-miR-6514-5p miRNA, hsa-miR-503-3p miRNA, hsa-miR-4665-5p miRNA, hsa-miR-6820-3p miRNA, hsa-miR-4287, hsa-miR-6879-5p, hsa-miR-4484 및 hsa-miR-619-5p가 발모 및 육모 효과가 뛰어나 탈모를 효과적으로 예방, 개선 또는 치료할 수 있음을 발견하여 본 발명에 이르게 되었다.
본 발명의 일 구현 예에 따르면, 서열번호 1 내지 9 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효 성분으로 포함하는 탈모 예방 또는 치료용 약학적 조성물에 관한 것이다.
본 발명의 다른 구현 예에 따르면, 서열번호 1 내지 9 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효 성분으로 포함하는 탈모 예방 또는 개선용 화장료 조성물에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 서열번호 1 내지 9 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효 성분으로 포함하는 탈모 예방 또는 개선용 식품 조성물에 관한 것이다.
본 발명에서 상기 '발모'는 두피, 눈꺼풀 또는 피부 등에 형성된 모낭에서 모발이 나는 것을 의미하고, '육모'는 모발의 길이가 길어지는 것(즉, 모발 성장)을 의미한다.
본 발명에서 상기 서열번호 1로 표시되는 염기서열(UGGCCCU)은, 서열번호 10의 염기서열(CUGGCCCUCUCUGCCCUUCCGU)로 표시되는 hsa-miR-328-3p miRNA의 종자 서열일 수 있다.
또한, 본 발명에서 상기 서열번호 2로 표시되는 염기서열(AUGGAGU)은, 서열번호 11의 염기서열(UAUGGAGUGGACUUUCAGCUGGC)로 표시되는 hsa-miR-6514-5p miRNA의 종자 서열일 수 있다.
또한, 본 발명에서 상기 서열번호 3으로 표시되는 염기서열(GGGUAUU)은, 서열번호 12의 염기서열(GGGGUAUUGUUUCCGCUGCCAGG)로 표시되는 hsa-miR-503-3p miRNA의 종자 서열일 수 있다.
또한, 본 발명에서 상기 서열번호 4로 표시되는 염기서열(UGGGGGA)은, 서열번호 13의 염기서열(CUGGGGGACGCGUGAGCGCGAGC)로 표시되는 hsa-miR-4665-5p miRNA의 종자 서열일 수 있다.
또한, 본 발명에서 상기 서열번호 5로 표시되는 염기서열(GUGACUU)은, 서열번호 14의 염기서열(UGUGACUUCUCCCCUGCCACAG)로 표시되는 hsa-miR-6820-3p miRNA의 종자 서열일 수 있다.
또한, 본 발명에서 상기 서열번호 6으로 표시되는 염기서열(CUCCCUU)은, 서열번호 15의 염기서열(UCUCCCUUGAGGGCACUUU)로 표시되는 hsa-miR-4287 miRNA의 종자 서열일 수 있다.
또한, 본 발명에서 상기 서열번호 7로 표시되는 염기서열(AGGGCAG)은, 서열번호 16의 염기서열(CAGGGCAGGGAAGGUGGGAGAG)로 표시되는 hsa-miR-6879-5p miRNA의 종자 서열일 수 있다.
또한, 본 발명에서 상기 서열번호 8로 표시되는 염기서열(AAAGGCG)은, 서열번호 17의 염기서열(AAAAGGCGGGAGAAGCCCCA)로 표시되는 hsa-miR-4484 miRNA의 종자 서열일 수 있다.
또한, 본 발명에서 상기 서열번호 9로 표시되는 염기서열(CUGGGAU)은, 서열번호 18의 염기서열(GCUGGGAUUACAGGCAUGAGCC)로 표시되는 hsa-miR-619-5p miRNA의 종자 서열일 수 있다.
본 발명에서 상기 "종자 서열(seed sequence)"이란 miRNA가 타겟을 인식할 때 완전한 상보성을 가지고 결합하는 miRNA 내 일부 영역의 뉴클레오타이드 서열을 의미하며, 이는 miRNA가 타겟에 결합하기 위해 필수적으로 요구되는 부분이자 실질적으로 유효한 기능을 하는 부위이다.
따라서, 본 발명에서 상기 miRNA로는 서열번호 1 내지 9 중 어느 하나로 표시되는 폴리뉴클레오타이드이거나, 혹은 상기 폴리뉴클레오타이드를 포함하는 miRNA라면 제한없이 포함될 수 있다. 바람직하게는 상기 서열번호 1 내지 9 중 어느 하나로 표시되는 폴리뉴클레오타이드에 연속하여 발모 및 육모 촉진의 기능을 하는 핵산 분자가 존재하는 것으로, 총 핵산 분자가 19 내지 25nt, 더욱 바람직하게는 21, 22 또는 23nt 길이의 성숙 miRNA 형태일 수 있다. 보다 바람직하게는, 본 발명에서 상기 miRNA는 (1) hsa-miR-328-3p miRNA, hsa-miR-6514-5p miRNA, hsa-miR-503-3p miRNA, hsa-miR-4665-5p miRNA 및 hsa-miR-6820-3p miRNA, hsa-miR-4287 miRNA, hsa-miR-6879-5p miRNA, hsa-miR-4484 miRNA 및 hsa-miR-619-5p miRNA로 이루어진 군에서 선택된 1종 이상의 miRNA; 및 (2) 상기 서열번호 1 내지 9 중 어느 하나로 표시되는 염기서열은 포함하되, 상기 (1)의 염기서열과 상동성이 80% 이상, 또는 90% 이상, 또는 95% 이상인 염기서열로 이루어진 miRNA; 중 적어도 하나를 포함할 수 있다.
상기한 바와 같이, 본 발명에서 사용되는 miRNA 들은 이를 구성하는 핵산 분자의 작용성 등가물, 예를 들어, miRNA 핵산 분자의 일부 염기서열이 결실, 치환 또는 삽입에 의해 변형되더라도 상기 miRNA 핵산 분자와 기능적으로 동등한 작용을 할 수 있는 변이체를 포함하는 개념이다. 예를 들어, 본 발명의 miRNA는 각 해당 서열번호의 염기서열과 80% 이상의 상동성을 나타낼 수 있으며, 바람직하게는 90%, 보다 바람직하게는 95% 이상의 상동성을 나타내는 것을 포함할 수 있다. 이러한 상동성은 당 분야에 널리 공지된 컴퓨터 알고리즘, 예를 들어 Align 또는 BLAST 알고리즘을 이용하여 뉴클레오티드의 서열을 표적 유전자의 상응하는 부분과 비교하여 용이하게 결정할 수 있다.
또한, 본 발명에서 상기 miRNA는 상기한 바와 같이 성숙한 miRNA일 수 있으나, miRNA 전구체(miRNA precursor), 일차 miRNA (pri-miRNA) 또는 플라스미드 (plasmid) 형태의 miRNA 전구체일 수 있다. 다만, 본 발명에서 miRNA 전구체 또는 일차 miRNA를 구성하는 핵산 분자는 50 내지 100nt, 더욱 바람직하게는 65 내지 95nt 길이를 가질 수 있다.
또한, 본 발명에서 상기 miRNA는 단일 가닥 또는 이중 가닥 형태로 존재할 수 있다. 성숙 miRNA 분자는 주로 단일 가닥으로 존재하지만, 전구체 miRNA 분자는 이중 가닥을 형성할 수 있는 부분적인 자가-상보적인 구조(예를 들어 스템-루프 구조)를 포함할 수 있다.
또한, 본 발명의 상기 miRNA를 구성하는 핵산 분자 중 적어도 하나는, 인산 뼈대 구조 (phosphate backbone structure)가 황 원소로 치환한 형태인 포스포로사이오에이트 (phosphorothiolate) 구조가 포함하는 형태; DNA, PNA(petide nucleic acids) 또는 LNA(locked nucleic acid) 분자로 치환된 형태; 또는 당의 2'수산화기가 메틸화, 메톡시화 또는 플르오르화 구조로 치환된 형태일 수 있다.
본 발명의 상기 miRNA는 표준 분자 생물학 기술, 예를 들어 화학적 합성 방법 또는 재조합 방법을 이용하여 분리 또는 제조하거나, 시판되는 것을 사용할 수 있다.
본 발명에서는, 상기한 바와 같이 상기 miRNA 핵산 분자를 발현 벡터에 포함된 형태로 제공할 수 있다.
본 발명의 발현 벡터는, 바람직하게는 발현 가능한 형태로 본 발명의 miRNA를 암호화한다. 본 발명에서 "발현 가능한 형태(in an expressible form)"는 숙주 세포에 도입할 경우, 그 벡터가 그 분자를 발현되는 것을 의미할 수 있다. 바람직하게는, 벡터는 miRNA의 발현에 필요한 조절 요소를 포함할 수 있다. 본 발명의 벡터는 본 발명의 miRNA의 생산에 사용되거나, 직접 탈모 치료를 위한 활성 성분으로서 사용될 수 있다.
본 발명의 발현 벡터는, 표적 세포의 게놈에 안정적으로 삽입시키기 위해서 이용될 수 있다(상동적 재조합 카세트 벡터의 설명에 관해서 Thomas KR & Capecchi MR, Cell 1987,51:503-12 참조). 예를 들면, Wolff et al., Science 1990,247:1465-8, 미국 특허 제5,580,859호; 제5,589,466호; 제5,804,566호; 제5,739,118호; 제5,736,524호; 제5,679,647호; 및 WO98/04720을 참조할 수 있다. DNA 베이스의 송달 기술의 예는, 「naked DNA」, 촉진성 [부피비카인(bupivicaine), 폴리머, 펩티드 매개(peptide-mediated)] 송달, 양이온의 지방질 복합체(cationic lipid complexes) 및 입자매개(particle-mediated) ["유전자총(gene gun)"] 또는 압력매개 전달(pressure-mediated delivery) (예를 들면, 미국 특허 제5,922,687호를 참조)을 포함한다.
본 발명에서 상기 발현 벡터는 비바이러스성 벡터 또는 바이러스성 벡터인 것이 바람직하고, 비바이러스성 벡터로는 플라스미드 DNA인 것이 바람직하며, 바이러스성 벡터로는 렌티바이러스(lentivirus), 레트로바이러스(retrovirus), 아데노바이러스(adenovirus), 허피스바이러스(herpes virus) 또는 아비폭스바이러스(avipox virus) 벡터 등을 사용할 수 있으나, 이에 제한되는 것은 아니다.
또한, 본 발명에서 상기 발현 벡터는, 형질 전환된 세포의 선별을 용이하게 하기 위하여 선별 마커를 추가로 포함하는 것이 바람직하다. 예를 들어, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들, 예를 들어 녹색 형광 단백질, 퓨로마이신, 네오마이신, 하이그로마이신, 히스티디놀 디하이드로게나제(hisD) 및 구아닌 포스포리보실트랜스퍼라제(Gpt) 등을 예시할 수 있다.
본 발명에서는 상기 발현 벡터가 숙주 세포에 도입되어 형질 전환된 형질 전환체로 제공될 수 있다.
본 발명에서 숙주 세포는 인간을 포함한 포유류의 체세포인 것이 바람직하고, 인간의 치료를 목적하는 조직 부위의 세포로 예를 들면, 모유두 세포인 것이 바람직하나 이에 한정되지 않는다.
또한, 본 발명에서 상기 발현 벡터를 숙주 세포에 도입하기 위한 방법으로는 G-fectin, Mirus TrasIT-TKO 지질친화성 시약, 리포펙틴, 리포펙타민, 셀펙틴(cellfectin), 양이온성 인지질 나노입자, 양이온성 고분자, 양이온성 미셀, 양이온성 에멀젼 또는 리포좀을 포함하는 전달시약과 함께 세포 내로 도입되거나, 폴리에틸렌글리콜과 같은 생체적합성 고분자를 접합하여 세포 내 흡수를 증가시킬 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 조성물은 상기 miRNA를 포함하는 세포 배양물을 유효 성분으로 포함할 수 있고, 혹은 상기 세포 배양물에서 상기 miRNA를 분리하여 이를 유효 성분으로 포함할 수 있다.
본 발명에서 상기 세포는 모유두 세포 또는 줄기세포일 수 있다. 이때 상기 줄기세포의 종류는 제한되지 않으나, 바람직하게는 지방, 골수, 제대 또는 제대혈 유래 줄기세포일 수 있으며, 보다 바람직하게는 지방 유래 줄기세포일 수 있다. 상기 지방 유래 줄기세포의 종류는 병원체에 의한 감염의 위험이 없고 면역 거부 반응을 일으키지 않는 것이라면 제한되지 않으나, 가장 바람직하게는 인간 지방 유래 줄기세포일 수 있다.
또한, 본 발명에서 상기 세포 배양에 이용되는 배지는, 당, 아미노산, 각종 영양물질, 혈청, 성장인자, 무기질 등의 세포의 성장 및 증식 등에 필수적인 요소를 포함하는 생체 외(in vitro)에서 모유두 세포 또는 줄기세포 등의 세포의 성장 및 증식을 위한 혼합물을 의미한다. 본 발명에서 이용될 수 있는 배지는 DMEM(Dulbecco's Modified Eagle's Medium), MEM(Minimal Essential Medium), BME(Basal Medium Eagle), RPMI1640, DMEM/F-10 (Dulbecco's Modified Eagle's Medium: Nutrient Mixture F-10), DMEM/F-12 (Dulbecco's Modified Eagle's Medium: Nutrient Mixture F-12), α-MEM(α-Minimal essential Medium), G-MEM(Glasgow's Minimal Essential Medium), IMDM(Isocove's Modified Dulbecco's Medium) 및 KnockOut DMEM 등의 상업적으로 제조된 배지 또는 인위적으로 합성한 배지를 포함하나, 이에 제한되지 않는다.
본 발명에서 상기 세포 배양물에서 miRNA를 분리하는 방법은 특별히 제한하지 않으며 당해 기술분야에서 일반적으로 사용되는 방법에 의해 수행될 수 있으나, 예를 들면 페놀계 화합물을 이용하여 분리하는 방법 또는 컬럼(column)을 이용하여 분리하는 방법을 수행할 수 있다.
또한, 본 발명의 조성물은 상기 miRNA를 포함하는 엑소좀(exosome)을 유효 성분으로 포함할 수 있고, 혹은 상기 엑소좀으로부터 상기 miRNA를 분리하여 이를 유효 성분으로 포함할 수 있다.
본 발명에서 상기 "엑소좀(exosome)"이란 다양한 세포들로부터 분비되는 막 구조의 작은 소낭을 의미하며, 나노베지클(nanovesicle)로도 정의된다. 미세소포체의 직경은 대략 30~1,000 nm이고, 바람직하게는 평균 직경이 100~300 nm이며, 다낭체와 원형질막의 융합이 일어나 세포 밖 환경으로 방출되는 소낭을 의미한다.
본 발명에서 상기 엑소좀은 모유두 세포 또는 줄기세포의 배양물로부터 유래된 것일 수 있다. 이때 상기 줄기세포의 종류는 제한되지 않으나, 바람직하게는 지방, 골수, 제대 또는 제대혈 유래 줄기세포일 수 있으며, 보다 바람직하게는 지방 유래 줄기세포일 수 있다. 상기 지방 유래 줄기세포의 종류는 병원체에 의한 감염의 위험이 없고 면역 거부 반응을 일으키지 않는 것이라면 제한되지 않으나, 가장 바람직하게는 인간 지방 유래 줄기세포일 수 있다.
또한, 본 발명에서 상기 세포 배양에 이용되는 배지는, 당, 아미노산, 각종 영양물질, 혈청, 성장인자, 무기질 등의 세포의 성장 및 증식 등에 필수적인 요소를 포함하는 생체 외(in vitro)에서 줄기세포 등의 세포의 성장 및 증식을 위한 혼합물을 의미한다. 본 발명에서 이용될 수 있는 배지는 DMEM(Dulbecco's Modified Eagle's Medium), MEM(Minimal Essential Medium), BME(Basal Medium Eagle), RPMI1640, DMEM/F-10 (Dulbecco's Modified Eagle's Medium: Nutrient Mixture F-10), DMEM/F-12 (Dulbecco's Modified Eagle's Medium: Nutrient Mixture F-12), α-MEM(α-Minimal essential Medium), G-MEM(Glasgow's Minimal Essential Medium), IMDM(Isocove's Modified Dulbecco's Medium) 및 KnockOut DMEM 등의 상업적으로 제조된 배지 또는 인위적으로 합성한 배지를 포함하나, 이에 제한되지 않는다.
본 발명에서 상기 세포 배양물에서 엑소좀을 분리하는 방법은 특별히 제한하지 않으며 당해 기술분야에서 일반적으로 사용되는 방법에 의해 수행될 수 있으나, 예를 들면, 배양액에서, 원심분리, 초고속 원심분리, 필터에 의한 여과, 겔 여과 크로마토그래피, 프리-플로우 전기영동, 모세관 전기영동, 폴리머를 이용한 분리 등의 방법 및 이들의 조합을 이용하여 분리할 수 있으며, 바람직하게는 원심분리/초원심분리일 수 있다. 이때, 원심분리/초원심분리는, 4℃, 3,000-100,000g에서 10분 내지 5시간 동안 행하는 것이 바람직하다.
본 발명에서 상기 엑소좀으로부터 miRNA를 분리하는 방법은 특별히 제한하지 않으며 당해 기술분야에서 일반적으로 사용되는 방법에 의해 수행될 수 있으나, 예를 들면 용혈 시약을 이용하여 엑소좀을 용혈시킨 뒤 페놀계 화합물을 이용하여 분리하는 방법 또는 컬럼(column)을 이용하여 분리하는 방법을 수행할 수 있다.
본 발명에서 제공하는 miRNA, 발현 벡터, 형질 전환체, 세포 배양물 또는 엑소좀은 머리카락뿐만 아니라, 눈썹 및 수염 등 목적하는 모발의 육모 및 발모를 촉진하여 탈모의 진행을 늦추거나 억제할 수 있다.
또한, 본 발명에서 상기 miRNA는 상기 탈모를 예방, 개선 또는 치료하기 위한 미용 또는 치료적 목적의 두피 필러용 조성물, 보다 상세하게는 필러 주사용 조성물로 매우 유용하게 사용될 수 있다.
본 발명에서 상기 "유효 성분으로 포함하는"은 육모 또는 발모 촉진 효과를 나타낼 수 있는 정도의 유효량을 함유하는 것을 의미할 수 있다.
본 발명에서, "예방"은 본 발명의 조성물을 이용하여 탈모의 증상을 차단하거나, 탈모 증상의 진행을 억제 또는 지연시키는 모든 행위라면 제한없이 포함할 수 있다.
본 발명에서, "치료" 및 "개선"은 본 발명의 조성물을 이용하여 탈모 증상이 호전되거나 이롭게 되는 모든 행위라면 제한없이 포함할 수 있다.
본 발명의 miRNA의 처리 농도를 특별히 제한하지 않으나, 1 nM 내지 1 μM일 수 있고, 바람직하게는 1 nM 내지 100 nM, 보다 바람직하게는 1 nM 내지 10 nM일 수 있다.
본 발명의 miRNA를 포함하는 발현 벡터의 경우 구체적으로 0.01 내지 500 mg을 함유하고, 보다 구체적으로 0.1 내지 300 mg을 함유하며, 본 발명의 miRNA를 포함하는 재조합 바이러스의 경우, 구체적으로 103 내지 1012 IU(10 내지 1010 PFU)를 함유하고, 보다 구체적으로 105 내지 1010 IU를 함유하나, 이에 한정되지 않는다.
또한, 본 발명의 miRNA를 포함하는 형질 전환체의 경우, 구체적으로 103 내지 108 개를 함유하고, 보다 구체적으로 104 내지 107개를 함유하나, 이에 한정되지 않는다.
또한, 본 발명의 miRNA를 포함하는 발현 벡터 또는 형질 전환체를 유효성분으로 함유하는 조성물의 유효 용량은 체중 1 ㎏당 벡터의 경우에는 0.05 내지 12.5 ㎎/㎏, 재조합 바이러스의 경우에는 107 내지 1011 바이러스 입자(105 내지 109 IU)/㎏, 세포의 경우에는 103 내지 106 세포/㎏이고, 구체적으로 벡터의 경우에는 0.1 내지 10 ㎎/㎏, 재조합 바이러스의 경우에는 108 내지 1010 입자(106 내지 108 IU)/㎏, 세포의 경우에는 102 내지 105 세포/㎏이며, 하루 2 내지 3회 투여될 수 있다. 상기와 같은 조성은 반드시 이에 한정되는 것은 아니고, 환자의 상태 및 질환의 발병 정도에 따라 변할 수 있다.
본 발명에 있어서, 상기 약학적 조성물은 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태임을 특징으로 할 수 있으며, 상기 약학적 조성물은 인간을 대상으로 하는 것을 특징으로 할 수 있다.
본 발명의 약학적 조성물은 이들로 한정되는 것은 아니지만, 각각 통상의 방법에 따라 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 본 발명의 약학적 조성물은 약제적으로 허용 가능한 담체를 포함할 수 있다. 약제학적으로 허용되는 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. 본 발명의 약학적 조성물의 제형은 상술한 바와 같은 약제학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여 시에는 정제, 트로키, 캡슐, 엘릭서(elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형할 수 있다.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.
본 발명에 따른 약학적 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장이 포함된다. 경구 또는 비경구 투하가 바람직하다.
본 발명에서, "비경구"는 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골내 주사 또는 주입기술을 포함한다. 본 발명의 약학적 조성물은 또한 직장 투여를 위한 좌제의 형태로 투여될 수 있다.
본 발명의 약학적 조성물은 사용된 특정 화합물의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여시간, 투여경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 약학적 조성물의 투여량은 환자의 상태, 체중, 질병의 정도, 약무형태, 투여경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있고, 1일 0.0001 내지 50mg/kg 또는 0.001 내지 50mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. 본 발명에 따른 의약 조성물은 환제, 당의정, 캡슐, 액제, 겔, 시럽, 슬러리, 현탁제로 제형될 수 있다.
본 발명에서 화장료 조성물은 화장수, 영양로션, 영양에센스, 마사지 크림, 미용 목욕물 첨가제, 바디로션, 바디밀크, 배스오일, 베이비오일, 베이비파우더, 샤워겔, 샤워크림, 선스크린로션, 선스크린크림, 선탠크림, 스킨로션, 스킨크림, 자외선차단용 화장품, 크렌징밀크, 탈모제{화장용}, 페이스 및 바디로션, 페이스 및 바디크림, 피부미백크림, 핸드로션, 헤어로션, 화장용크림, 쟈스민오일, 목욕비누, 물비누, 미용비누, 샴푸, 손세정제(핸드클리너), 약용비누{비의료용}, 크림비누, 페이셜 워시, 전신 세정제, 두피 세정제, 헤어린스, 화장비누, 치아미백용 겔, 치약 등의 형태로 제조될 수 있다. 이를 위해 본 발명의 조성물은 화장료 조성물의 제조에 통상적으로 사용하는 용매나, 적절한 담체, 부형제 또는 희석제를 더 포함할 수 있다.
본 발명의 화장료 조성물 내에 더 추가될 수 있는 용매의 종류는 특별히 한정하지 않으나, 예를 들어, 물, 식염수, DMSO 또는 이들의 조합을 사용할 수 있고, 담체, 부형제 또는 희석제로는 정제수, 오일, 왁스, 지방산, 지방산 알콜, 지방산 에스테르, 계면활성제, 흡습제(humectant), 증점제, 항산화제, 점도 안정화제, 킬레이팅제, 완충제, 저급 알콜 등이 포함되지만, 이에 제한되는 것은 아니다. 또한, 필요에 따라 미백제, 보습제, 비타민, 자외선 차단제, 향수, 염료, 항생제, 항박테리아제, 항진균제를 포함할 수 있다.
상기 오일로서는 수소화 식물성유, 피마자유, 면실유, 올리브유, 야자인유, 호호바유, 아보카도유가 이용될 수 있으며, 왁스로는 밀랍, 경랍, 카르나우바, 칸델릴라, 몬탄, 세레신, 액체 파라핀, 라놀린이 이용될 수 있다.
지방산으로는 스테아르산, 리놀레산, 리놀렌산, 올레산이 이용될 수 있고, 지방산 알콜로는 세틸 알콜, 옥틸 도데칸올, 올레일 알콜, 판텐올, 라놀린 알콜, 스테아릴 알콜, 헥사데칸올이 이용될 수 있으며 지방산 에스테르로는 이소프로필 미리스테이트, 이소프로필 팔미테이트, 부틸 스테아레이트가 이용될 수 있다. 계면 활성제로는 당업계에 알려진 양이온 계면활성제, 음이온 계면활성제 및 비이온성 계면활성제가 사용가능하며 가능한 한 천연물 유래의 계면활성제가 바람직하다.
그 외에도 화장품 분야에서 널리 알려진 흡습제, 증점제, 항산화제 등을 포함할 수 있으며, 이들의 종류와 양은 당업계에 공지된 바에 따른다.
본 발명의 식품 조성물은 각종 식품류, 예를 들어, 음료, 껌, 차, 비타민 복합제, 분말, 과립, 정제, 캡슐, 과자, 떡, 빵 등의 형태로 제조될 수 있다. 본 발명의 식품 조성물은 독성 및 부작용이 거의 없는 식물추출물로 구성된 것이므로 예방 목적으로 장기간 복용 시에도 안심하고 사용할 수 있다.
본 발명의 miRNA, 발현 벡터 또는 형질전환체가 식품 조성물에 포함될 때 그 양은 전체 중량의 0.1 내지 50%의 비율로 첨가할 수 있다.
여기서, 상기 식품 조성물이 음료 형태로 제조되는 경우 지시된 비율로 상기 식품 조성물을 함유하는 것 외에 특별한 제한점은 없으며 통상의 음료와 같이 여러가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 즉, 천연 탄수화물로서 포도당 등의 모노사카라이드, 과당 등의 디사카라이드, 슈크로스 등의 및 폴리사카라이드, 덱스트린, 시클로덱스트린 등과 같은 통상적인 당 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜 등을 포함할 수 있다. 상기 향미제로서는 천연 향미제(타우마틴, 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진등) 및 합성 향미제(사카린, 아스파르탐 등) 등을 들 수 있다.
그 외 본 발명의 식품 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다.
이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 그렇게 중요하진 않지만 본 발명의 조성물 100 중량부 당 0.1 내지 약 50 중량부의 범위에서 선택되는 것이 일반적이다.
본 발명의 다른 구현 예에 따르면, 목적하는 개체에 본 발명에서 제공하는 miRNA, 발현 벡터, 형질 전환체 또는 본 발명에서 제공하는 탈모의 예방, 개선 또는 치료용 조성물을 투여하는 단계를 포함하는, 탈모의 예방 또는 치료 방법에 관한 것이다.
본 발명에서 상기 "목적하는 개체"란, 탈모가 발병하였거나, 발병 가능성이 높은 개체를 의미한다.
본 발명의 방법에서 상기 목적하는 개체에 상기 miRNA를 포함하는 세포 배양물을 투여할 수 있고, 혹은 상기 세포 배양물로부터 상기 miRNA를 분리하여 투여할 수 있다.
또한, 본 발명의 방법에서 상기 목적하는 개체에 상기 miRNA를 포함하는 엑소좀을 투여할 수 있고, 혹은 상기 엑소좀으로부터 상기 miRNA를 분리하여 이를 투여할 수 있다.
본 발명에서 상기 miRNA, 발현 벡터, 형질 전환체, 세포 배양물, 엑소좀 및 탈모 예방, 개선 또는 치료용 조성물은 상기 기재된 바와 중복되어 이하 자세한 기재를 생략한다.
본 발명에서 제공하는 miRNA, 발현 벡터 또는 형질 전환체의 투여량, 스케줄 및 투여 경로는 개체의 크기 및 조건에 따라, 그리고 표준 약제학적 관행에 따라 결정될 수 있다. 예시적인 투여 경로는 정맥내, 동맥내, 복강내, 폐내, 혈관내, 근육내, 기관내, 피하, 안내, 척수강내 또는 경피를 포함한다.
본 발명의 방법에서 목적하는 개체에 투여되는 miRNA, 발현 벡터 또는 형질 전환체의 용량은, 예를 들어, 투여되는 miRNA, 발현 벡터 또는 형질 전환체의 특정 유형, 투여 경로 및 치료 또는 개선되는 탈모의 특정 유형과 병기에 따라 달라질 수 있다. 상기 양은 심한 독성 또는 유해 사례없이, 탈모에 대한 치료 반응과 같은 원하는 반응을 가져오기 충분해야 한다. 정제된 효소를 사용한 시험관내 검정, 세포 기반 검정, 동물 모델 또는 인체 실험과 같은 표준 방법을 사용하여 효과의 규모를 측정할 수 있다.
예를 들면, 본 발명의 방법에서 상기 miRNA의 투여 농도를 특별히 제한하지 않으나, 1 nM 내지 1 μM일 수 있고, 바람직하게는 1 nM 내지 100 nM, 보다 바람직하게는 1 nM 내지 10 nM일 수 있다.
본 발명의 방법에서 상기 miRNA를 포함하는 발현 벡터의 경우 구체적으로 0.01 내지 500 mg의 양으로 투여될 수 있고, 보다 구체적으로 0.1 내지 300 mg의 양으로 투여될 수 있으며, 본 발명의 miRNA를 포함하는 재조합 바이러스의 경우, 구체적으로 103 내지 1012 IU(10 내지 1010 PFU)로 투여될 수 있고, 보다 구체적으로 105 내지 1010 IU의 양으로 투여될 수 있으나, 이에 제한되지 않는다.
또한, 본 발명의 miRNA를 포함하는 형질 전환체의 경우, 구체적으로 103 내지 108 개의 양으로 투여될 수 있고, 보다 구체적으로 104 내지 107개의 양으로 투여될 수 있으나, 이에 제한되지 않는다.
또한, 본 발명의 방법에서 miRNA를 포함하는 발현 벡터 또는 형질 전환체의 유효 투여 용량은 체중 1 ㎏당 벡터의 경우에는 0.05 내지 12.5 ㎎/㎏, 재조합 바이러스의 경우에는 107 내지 1011 바이러스 입자(105 내지 109 IU)/㎏, 세포의 경우에는 103 내지 106 세포/㎏이고, 구체적으로 벡터의 경우에는 0.1 내지 10 ㎎/㎏, 재조합 바이러스의 경우에는 108 내지 1010 입자(106 내지 108 IU)/㎏, 세포의 경우에는 102 내지 105 세포/㎏이며, 하루 2 내지 3회 투여될 수 있다. 상기와 같은 조성은 반드시 이에 한정되는 것은 아니고, 환자의 상태 및 질환의 발병 정도에 따라 변할 수 있다.
또한, 본 발명의 miRNA를 포함하는 엑소좀의 경우 단백질량 기준 0.001 내지 1000 ㎍/ml, 0.01 내지 100 ㎍/ml, 또는 0.1 내지 50 ㎍/ml의 양으로 포함될 수 있거나, 혹은 파티클 수 기준 1 X 108 개/ml 내지 1 X 1014 개/ml, 1 X 109 개/ml 내지 1 X 1013 개/ml, 1 X 1010 개/ml 내지 1 X 1012 개/ml의 양으로 포함될 수 있으나, 이에 제한되지 않는다.
또한, 본 발명의 miRNA를 포함하는 세포 배양물의 경우 단백질량 기준 0.001 내지 1000 ㎍/ml, 0.01 내지 100 ㎍/ml, 또는 0.1 내지 50 ㎍/ml의 양으로 포함될 수 있으나, 이에 제한되지 않는다.
또한, 본 발명의 방법에서는 상기 miRNA, 발현 벡터 또는 형질 전환체를 각각 통상의 방법에 따라 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 투여할 수 있다.
또한, 본 발명에서는 상기 miRNA, 발현 벡터 또는 형질 전환체 외에 약제적으로 허용 가능한 담체를 함께 투여할 수 있다. 약제학적으로 허용되는 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. 또한, 본 발명에서 상기 분비 단백체를 약제학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서(elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형할 수 있다.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.
본 발명에서 제공하는 miRNA는 모유두 세포의 성장 및 증식을 촉진하고 모발 관련 다양한 유전자의 발현을 촉진하는 등 발모 및 육모 효과가 뛰어나며, 더 나아가서는 탈모를 효과적으로 예방 또는 치료할 수 있다.
도 1a는 실시예 1에서 모유두 세포에 본 발명에 따른 miRNA를 1 nM의 양으로 처리한 후 세포 생존율을 분석한 결과를 그래프로 나타낸 것이다.
도 1b는 실시예 1에서 모유두 세포에 본 발명에 따른 miRNA를 10 nM의 양으로 처리한 후 세포 생존율을 분석한 결과를 그래프로 나타낸 것이다.
도 1c는 실시예 1에서 실시예 1에서 모유두 세포에 본 발명에 따른 miRNA를 100 nM의 양으로 처리한 후 세포 생존율을 분석한 결과를 그래프로 나타낸 것이다.
도 2는 실시예 2에서 모유두 세포에 본 발명에 따른 miRNA를 처리한 후 세포 생존율을 분석한 결과를 그래프로 나타낸 것이다.
도 3은 실시예 3에서 모유두 세포에 본 발명에 따른 miRNA를 처리한 후 탈모와 관련된 TGF-β1 단백질의 발현 수준을 분석한 결과를 그래프로 나타낸 것이다.
도 4는 실시예 4에서 모유두 세포에 본 발명에 따른 miRNA를 처리한 후 발모와 관련된 FGF-7의 발현 수준을 분석한 결과를 그래프로 나타낸 것이다.
도 5는 실시예 4에서 모유두 세포에 본 발명에 따른 miRNA를 처리한 후 탈모와 관련된 TGF-β2의 발현 수준을 분석한 결과를 그래프로 나타낸 것이다.
도 6은 실시예 4에서 모유두 세포에 본 발명에 따른 miRNA를 처리한 후 탈모와 관련된 NOG의 발현 수준을 분석한 결과를 그래프로 나타낸 것이다.
도 7은 실시예 5에서 모유두 세포에 본 발명에 따른 miRNA를 처리한 후 탈모와 관련된 Wnt10b의 발현 수준을 분석한 결과를 그래프로 나타낸 것이다.
본 발명의 일 구현 예에 따르면, 서열번호 1 내지 9 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효 성분으로 포함하는 탈모 예방 또는 치료용 약학적 조성물에 관한 것이다.
본 발명의 다른 구현 예에 따르면, 서열번호 1 내지 9 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효 성분으로 포함하는 탈모 예방 또는 개선용 화장료 조성물에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 서열번호 1 내지 9 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효 성분으로 포함하는 탈모 예방 또는 개선용 식품 조성물에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 목적하는 개체에 본 발명에서 제공하는 miRNA, 발현 벡터, 형질 전환체 또는 본 발명에서 제공하는 탈모의 예방, 개선 또는 치료용 조성물을 투여하는 단계를 포함하는, 탈모의 예방 또는 치료 방법에 관한 것이다.
본 발명에서 상기 서열번호 1로 표시되는 염기서열(UGGCCCU)은, 서열번호 10의 염기서열(CUGGCCCUCUCUGCCCUUCCGU)로 표시되는 hsa-miR-328-3p miRNA의 종자 서열일 수 있다.
또한, 본 발명에서 상기 서열번호 2로 표시되는 염기서열(AUGGAGU)은, 서열번호 11의 염기서열(UAUGGAGUGGACUUUCAGCUGGC)로 표시되는 hsa-miR-6514-5p miRNA의 종자 서열일 수 있다.
또한, 본 발명에서 상기 서열번호 3으로 표시되는 염기서열(GGGUAUU)은, 서열번호 12의 염기서열(GGGGUAUUGUUUCCGCUGCCAGG)로 표시되는 hsa-miR-503-3p miRNA의 종자 서열일 수 있다.
또한, 본 발명에서 상기 서열번호 4로 표시되는 염기서열(UGGGGGA)은, 서열번호 13의 염기서열(CUGGGGGACGCGUGAGCGCGAGC)로 표시되는 hsa-miR-4665-5p miRNA의 종자 서열일 수 있다.
또한, 본 발명에서 상기 서열번호 5로 표시되는 염기서열(GUGACUU)은, 서열번호 14의 염기서열(UGUGACUUCUCCCCUGCCACAG)로 표시되는 hsa-miR-6820-3p miRNA의 종자 서열일 수 있다.
또한, 본 발명에서 상기 서열번호 6으로 표시되는 염기서열(CUCCCUU)은, 서열번호 15의 염기서열(UCUCCCUUGAGGGCACUUU)로 표시되는 hsa-miR-4287 miRNA의 종자 서열일 수 있다.
또한, 본 발명에서 상기 서열번호 7로 표시되는 염기서열(AGGGCAG)은, 서열번호 16의 염기서열(CAGGGCAGGGAAGGUGGGAGAG)로 표시되는 hsa-miR-6879-5p miRNA의 종자 서열일 수 있다.
또한, 본 발명에서 상기 서열번호 8로 표시되는 염기서열(AAAGGCG)은, 서열번호 17의 염기서열(AAAAGGCGGGAGAAGCCCCA)로 표시되는 hsa-miR-4484 miRNA의 종자 서열일 수 있다.
또한, 본 발명에서 상기 서열번호 9로 표시되는 염기서열(CUGGGAU)은, 서열번호 18의 염기서열(GCUGGGAUUACAGGCAUGAGCC)로 표시되는 hsa-miR-619-5p miRNA의 종자 서열일 수 있다.
따라서, 본 발명에서 상기 miRNA로는 서열번호 1 내지 9 중 어느 하나로 표시되는 폴리뉴클레오타이드이거나, 혹은 상기 폴리뉴클레오타이드를 포함하는 miRNA라면 제한없이 포함될 수 있다. 바람직하게는 상기 서열번호 1 내지 9 중 어느 하나로 표시되는 폴리뉴클레오타이드에 연속하여 발모 및 육모 촉진의 기능을 하는 핵산 분자가 존재하는 것으로, 총 핵산 분자가 19 내지 25nt, 더욱 바람직하게는 21, 22 또는 23nt 길이의 성숙 miRNA 형태일 수 있다. 보다 바람직하게는, 본 발명에서 상기 miRNA는 (1) hsa-miR-328-3p miRNA, hsa-miR-6514-5p miRNA, hsa-miR-503-3p miRNA, hsa-miR-4665-5p miRNA 및 hsa-miR-6820-3p miRNA, hsa-miR-4287 miRNA, hsa-miR-6879-5p miRNA, hsa-miR-4484 miRNA 및 hsa-miR-619-5p miRNA로 이루어진 군에서 선택된 1종 이상의 miRNA; 및 (2) 상기 서열번호 1 내지 9 중 어느 하나로 표시되는 염기서열은 포함하되, 상기 (1)의 염기서열과 상동성이 80% 이상, 또는 90% 이상, 또는 95% 이상인 염기서열로 이루어진 miRNA; 중 적어도 하나를 포함할 수 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예
[준비예 1] miRNA의 준비
하기 표 1에 나타낸 염기서열로 표시되는 9종의 miRNA를 합성하였다.
구분 miRNA 종류 염기서열
P1 hsa-miR-328-3p 5'-CUGGCCCUCUCUGCCCUUCCGU-3'(서열번호 10)
P2 hsa-miR-6514-5p 5'-UAUGGAGUGGACUUUCAGCUGGC-3'(서열번호 11)
P3 hsa-miR-503-3p 5'-GGGGUAUUGUUUCCGCUGCCAGG-3'(서열번호 12)
P4 hsa-miR-4665-5p 5'-CUGGGGGACGCGUGAGCGCGAGC-3'(서열번호 13)
P5 hsa-miR-6820-3p 5'-UGUGACUUCUCCCCUGCCACAG-3'(서열번호 14)
P6 hsa-miR-4287 5'-UCUCCCUUGAGGGCACUUU-3'(서열번호 15)
P7 hsa-miR-6879-5p 5'-CAGGGCAGGGAAGGUGGGAGAG-3'(서열번호 16)
P8 hsa-miR-4484 5'-AAAAGGCGGGAGAAGCCCCA-3'(서열번호 17)
P9 hsa-miR-619-5p 5'-GCUGGGAUUACAGGCAUGAGCC-3'(서열번호 18)
[실시예 1] 모유두 세포의 생존율 평가
모유두 세포(Demal papilla cell, DPC) 5 X 103 세포를 1% FBS를 포함하는 a-MEM 배지에 접종한 뒤, 리포펙타민(lipofectamine)을 이용하여 상기 준비예 1에서 얻어진 P1 내지 P6의 miRNA 6종 각각을 1 nM, 10 nM 및 100 nM의 농도로 24시간 동안 상기 세포 내에 도입한 뒤 각 농도별 세포 생존율의 변화를 측정하여 도 1a 내지 1c의 그래프로 나타내었다. 단, 도 1a 내지 1c의 그래프는 음성 대조군(miR-CT) 대비 세포 생존율을 의미하는 것이다.
도 1a 내지 1c에서 보는 바와 같이, 본 발명에 따른 miRNA를 처리한 경우 모유두 세포의 세포 생존율이 증가하였고, 특히 1 내지 10 nM의 농도로 처리하였을 때 세포 생존율 증가 정도가 더욱 높은 볼 수 있었다.
[실시예 2] 모유두 세포의 생존율 평가
인간 모유두 세포(Demal papilla cell, DPC) 5 X 103 세포를 1% FBS를 포함하는 a-DMEM 배지에 접종한 뒤, 리포펙타민(lipofectamine)을 이용하여 상기 준비예 1에서 얻어진 P7 내지 P9 miRNA 3종 각각을 2 nM의 농도로 24시간 동안 상기 세포 내에 도입한 뒤 48시간 경과 후 세포 생존율의 변화를 측정하여 그 결과를 하기 표 2 및 도 2에 나타내었다. 단, 도 2의 그래프는 음성 대조군(miR-CT) 대비 세포 생존율을 의미하는 것이다.
miRNA 세포 생존율(%)
P7 127.0
P8 122.8
P9 115.4
상기 표 2 및 도 2에서 보는 바와 같이, 본 발명에 따른 miRNA를 처리한 경우 모유두 세포의 세포 생존율이 현저히 증가한 것을 볼 수 있었다.
[실시예 3] TGF-β1 발현 수준 평가
TGF-β1은 모낭 세포의 자멸을 유도하여 탈모를 유도 및 촉진하는 것으로 알려져 있다. 이에, 상기 실시예 1과 동일한 방법으로 리포펙타민을 이용하여 모유두 세포에 상기 준비예 1에서 얻어진 P1 내지 P6의 miRNA 6종 각각을 10 nM의 농도로 도입한 뒤 면역세포화학법(Immunocytochemistry)과 RT-PCR를 통해서 TGF-β1의 발현 수준을 조사하여 그 결과를 도 3에 나타내었다. 다만, 양성 대조군으로는 미녹시딜(MNX)을 처리하였다.
도 3에서 보는 바와 같이, 모유두 세포에 본 발명에 따른 miRNA를 처리한 경우 무처리한 경우(miR-CT) 또는 양성 대조군으로 미녹시딜을 처리한 경우보다 TGF-β1의 발현이 효과적으로 억제된 것을 볼 수 있었다.
[실시예 4] 발모 관련 유전자의 발현 수준 평가
FGF-7, TGF-β2 및 NOG는 발모 관련 유전자로 알려져 있다. 이에, 상기 실시예 1과 동일한 방법으로 리포펙타민을 이용하여 모유두 세포에 상기 준비예 1에서 얻어진 P1 내지 P6의 miRNA 6종 각각을 10 nM의 농도로 도입한 뒤 세포를 수확(harvesting)하여 FGF-7, TGF-β2 및 NOG의 RNA를 분리한 뒤 cDNA를 합성하고 하기 표 3에 나타낸 프라이머를 이용하여 qPCR 기법을 통해 유전자의 실시간 증폭되는 사이클(cycle)을 수치화해 정량화 하였다. 그 결과는 도 4 내지 6과 같다. 다만, 양성 대조군으로는 미녹시딜(PC)을 처리하였다.
프라이머 이름 프라이머 서열
GAPDH Forward TTAGGAAAGCCTGCCGGTGA
Reverse GACTGTGGTCATGAGTCCTTCC
Noggin Forward CTTCAGTAAGCGCTCGTGC
Reverse ATGATGGGGTACTGGATGGG
FGF-7 Forward TCCTGCCAACTTTGCTCTACA
Reverse CAGGGCTGGAACAGTTCACAT
TGF-β2 Forward TGCCGCCCTTCTTCCCCTC
Reverse GGAGCACAAGCTGCCCACTGA
도 4 내지 6에서 보는 바와 같이, 본 발명에 따른 miRNA를 처리한 경우 무처리한 경우(miR-CT)에 비하여 발모 관련 유전자인 FGF-7, TGF-β2 및 NOG의 발현 수준이 현저히 증가한 것을 확인할 수 있었다.
[실시예 5] 발모 관련 유전자의 발현 수준 평가
Wnt10b 또한 발모 관련 유전자로 알려져 있다. 이에, 상기 실시예 1과 동일한 방법으로 리포펙타민을 이용하여 모유두 세포에 상기 준비예 1에서 얻어진 P7 내지 P9의 miRNA 3종 각각을 2 nM의 농도로 도입한 뒤 세포를 수확(harvesting)하여 Wnt10b의 RNA를 분리한 뒤 cDNA를 합성하고 하기 표 4에 나타낸 프라이머를 이용하여 qRT-PCR 기법을 통해 유전자를 증폭시켰다. 증폭된 유전자의 정량은 Delta-Delta-Ct (ddCt) 값으로 계산하였고 모든 시료는 하우스키핑 유전자(housekeeping gene)인 GAPDH의 cDNA 증폭 결과로 평준화하여 발현 양을 분석하였다. 그 결과는 도 7과 같다.
프라이머 이름 프라이머 서열
Wnt10b Forward GAATGCGAATCCACAACAACAG
Reverse TTGCGGTTGTGGGTATCAATGAA
GAPDH Forward TTAGGAAAGCCTGCCGGTGA
Reverse GACTGTGGTCATGAGTCCTTCC
도 7에서 보는 바와 같이, 본 발명에 따른 miRNA를 처리한 경우 무처리한 경우(miR-CT)에 비하여 발모 관련 유전자인 Wnt10b의 발현 수준이 현저히 증가한 것을 확인할 수 있었다. 이를 통하여 본 발명에 따른 P1 내지 P9의 miRNA 9종은 모두 모유두 세포의 증식을 촉진하고, 탈모 관련 유전자의 발현은 억제하나, 발모 관련 유전자의 발현은 증가시켜 발모 및 육모 효과가 뛰어남을 알 수 있다.
본 발명은 마이크로RNA(miRNA)를 이용하여 탈모를 방지하거나, 발모 또는 육모를 촉진하는 방법에 관한 것이다.
서열번호 1: hsa-miR-328-3p miRNA의 종자 서열
UGGCCCU
서열번호 2: hsa-miR-6514-5p miRNA의 종자 서열
AUGGAGU
서열번호 3: hsa-miR-503-3p miRNA 종자 서열
GGGUAUU
서열번호 4: hsa-miR-4665-5p miRNA 종자 서열
UGGGGGA
서열번호 5: hsa-miR-6820-3p miRNA 종자 서열
GUGACUU
서열번호 6: hsa-miR-4287 miRNA 종자 서열
CUCCCUU
서열번호 7: hsa-miR-6879-5p miRNA 종자 서열
AGGGCAG
서열번호 8: hsa-miR-4484 miRNA 종자 서열
AAAGGCG
서열번호 9: hsa-miR-619-5p miRNA 종자 서열
CUGGGAU
서열번호 10: hsa-miR-328-3p miRNA 서열
CUGGCCCUCUCUGCCCUUCCGU
서열번호 11: hsa-miR-6514-5p miRNA 서열
UAUGGAGUGGACUUUCAGCUGGC
서열번호 12: hsa-miR-503-3p miRNA 서열
GGGGUAUUGUUUCCGCUGCCAGG
서열번호 13: hsa-miR-4665-5p miRNA 서열
CUGGGGGACGCGUGAGCGCGAGC
서열번호 14: hsa-miR-6820-3p miRNA 서열
UGUGACUUCUCCCCUGCCACAG
서열번호 15: hsa-miR-4287 miRNA 서열
UCUCCCUUGAGGGCACUUU
서열번호 16: hsa-miR-6879-5p miRNA 서열
CAGGGCAGGGAAGGUGGGAGAG
서열번호 17: hsa-miR-4484 miRNA 서열
AAAAGGCGGGAGAAGCCCCA
서열번호 18: hsa-miR-619-5p miRNA 서열
GCUGGGAUUACAGGCAUGAGCC

Claims (15)

  1. 서열번호 1 내지 9 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효 성분으로 포함하는 탈모 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서,
    상기 miRNA는,
    (1) hsa-miR-328-3p miRNA, hsa-miR-6514-5p miRNA, hsa-miR-503-3p miRNA, hsa-miR-4665-5p miRNA, hsa-miR-6820-3p miRNA, hsa-miR-4287 miRNA, hsa-miR-6879-5p miRNA, hsa-miR-4484 miRNA 및 hsa-miR-619-5p miRNA로 이루어진 군에서 선택된 1종 이상의 miRNA; 및
    (2) 상기 서열번호 1 내지 9 중 어느 하나로 표시되는 염기서열은 포함하되, 상기 (1)의 염기서열과 상동성이 80% 이상, 또는 90% 이상, 또는 95% 이상인 염기서열로 이루어진 miRNA; 중 적어도 하나를 포함하는, 약학적 조성물.
  3. 제2항에 있어서,
    상기 hsa-miR-328-3p miRNA는 서열번호 10의 염기서열로 구성되거나,
    상기 hsa-miR-6514-5p miRNA는 서열번호 11의 염기서열로 구성되거나,
    상기 hsa-miR-503-3p miRNA는 서열번호 12의 염기서열로 구성되거나,
    상기 hsa-miR-4665-5p miRNA는 서열번호 13의 염기서열로 구성되거나,
    상기 hsa-miR-6820-3p miRNA는 서열번호 14의 염기서열로 구성되거나,
    상기 hsa-miR-4287 miRNA는 서열번호 15의 염기서열로 구성되거나,
    상기 hsa-miR-6879-5p miRNA는 서열번호 16의 염기서열로 구성되거나,
    상기 hsa-miR-4484 miRNA는 서열번호 17의 염기서열로 구성되거나,
    상기 hsa-miR-619-5p miRNA는 서열번호 18의 염기서열로 구성되는 것인, 약학적 조성물.
  4. 제1항에 있어서,
    상기 miRNA를 구성하는 핵산 분자 중 적어도 하나는,
    인산 뼈대 구조 (phosphate backbone structure)가 황 원소로 치환한 형태인 포스포로사이오에이트 (phosphorothiolate) 구조가 포함하는 형태;
    DNA, PNA(petide nucleic acids) 또는 LNA(locked nucleic acid) 분자로 치환된 형태; 또는
    당의 2'수산화기가 메틸화, 메톡시화 또는 플르오르화 구조로 치환된 형태인, 약학적 조성물.
  5. 제1항에 있어서,
    상기 miRNA는 miRNA 전구체(miRNA precursor), 일차 miRNA (pri-miRNA) 또는 플라스미드 (plasmid) 형태의 miRNA 전구체인, 약학적 조성물.
  6. 제1항에 있어서,
    상기 miRNA는 단일 가닥 또는 이중 가닥의 형태인, 약학적 조성물.
  7. 제1항에 있어서,
    상기 조성물은 상기 miRNA를 포함하는 엑소좀(exosome)을 유효 성분으로 포함하는, 약학적 조성물.
  8. 제1항에 있어서,
    상기 조성물은 상기 miRNA를 포함하는 세포 배양물을 유효 성분으로 포함하는, 약학적 조성물.
  9. 제1항에 있어서,
    상기 발현 벡터는 비바이러스성 벡터 또는 바이러스성 벡터인, 약학적 조성물.
  10. 제1항에 있어서,
    상기 약학적 조성물은 모유듀 세포의 증식을 촉진하는, 약학적 조성물.
  11. 제1항에 있어서,
    상기 약학적 조성물은 TGF-β1의 발현을 억제하거나, FGF-7, TGF-β2, NOG 및 Wnt10b 중 적어도 하나의 발현은 증가시키는, 약학적 조성물.
  12. 서열번호 1 내지 9 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효 성분으로 포함하는 탈모 예방 또는 개선용 화장료 조성물.
  13. 서열번호 1 내지 9 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효 성분으로 포함하는 탈모 예방 또는 개선용 식품 조성물.
  14. 서열번호 1 내지 9 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효 성분으로 포함하는 두피 필러용 조성물.
  15. 목적하는 개체에 서열번호 1 내지 9 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 투여하는 단계를 포함하는, 탈모의 예방 또는 치료 방법.
PCT/KR2018/014702 2017-11-27 2018-11-27 Mirna를 포함하는 탈모 방지 또는 발모 촉진용 조성물 WO2019103572A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2017-0159666 2017-11-27
KR20170159666 2017-11-27
KR20170159667 2017-11-27
KR10-2017-0159667 2017-11-27

Publications (1)

Publication Number Publication Date
WO2019103572A1 true WO2019103572A1 (ko) 2019-05-31

Family

ID=66631059

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/014702 WO2019103572A1 (ko) 2017-11-27 2018-11-27 Mirna를 포함하는 탈모 방지 또는 발모 촉진용 조성물

Country Status (2)

Country Link
KR (1) KR102189987B1 (ko)
WO (1) WO2019103572A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022182188A1 (ko) * 2021-02-25 2022-09-01 (주)바이오니아 이중가닥 mirna를 유효성분으로 포함하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 조성물

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140154303A1 (en) * 2011-02-11 2014-06-05 Singapore Health Services Pte Ltd. Treating cancer by inhibiting expression of olfm4, sp5, tob1, arid1a, fbn1 or hat1
KR20160049874A (ko) * 2014-10-28 2016-05-10 삼성전자주식회사 탈모 예방 또는 치료용 약학적 조성물, 탈모 예방 또는 치료 방법, 및 탈모 예방, 치료, 또는 개선용 물질의 스크리닝 방법
KR20160093313A (ko) * 2015-01-29 2016-08-08 영남대학교 산학협력단 hsa-miR-371a-3p를 유효성분으로 함유하는 세포노화 질환 예방 또는 치료용 약학조성물
WO2016179605A1 (en) * 2015-05-07 2016-11-10 The Trustees Of Columbia University In The City Of New York Methods and compositions for promoting hair growth

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2686313C2 (ru) * 2015-02-25 2019-04-25 Байонир Корпорейшн Фармацевтическая композиция для лечения рака, содержащая микроРНК в качестве активного ингредиента

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140154303A1 (en) * 2011-02-11 2014-06-05 Singapore Health Services Pte Ltd. Treating cancer by inhibiting expression of olfm4, sp5, tob1, arid1a, fbn1 or hat1
KR20160049874A (ko) * 2014-10-28 2016-05-10 삼성전자주식회사 탈모 예방 또는 치료용 약학적 조성물, 탈모 예방 또는 치료 방법, 및 탈모 예방, 치료, 또는 개선용 물질의 스크리닝 방법
KR20160093313A (ko) * 2015-01-29 2016-08-08 영남대학교 산학협력단 hsa-miR-371a-3p를 유효성분으로 함유하는 세포노화 질환 예방 또는 치료용 약학조성물
WO2016179605A1 (en) * 2015-05-07 2016-11-10 The Trustees Of Columbia University In The City Of New York Methods and compositions for promoting hair growth

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE Nucleotide NCBI; 4 June 2017 (2017-06-04), "Homo Sapiens MicroRNA 328 (MIR328), MicroRNA", XP055617202, Database accession no. NR-029887.1 *

Also Published As

Publication number Publication date
KR20190062263A (ko) 2019-06-05
KR102189987B1 (ko) 2020-12-11

Similar Documents

Publication Publication Date Title
Wright et al. Myogenin, a factor regulating myogenesis, has a domain homologous to MyoD
WO2019050071A1 (ko) 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물
WO2019103300A1 (ko) Mirna를 포함하는 상처 치료 또는 피부 개선용 조성물
WO2015056982A1 (ko) 만능 줄기세포의 유도 방법 및 상기 방법에 의해 제조된 만능줄기세포
WO2017142305A1 (ko) 발모 촉진 활성 및/또는 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
WO2017047996A1 (ko) 나노그를 도입한 양수 내 태아 유래 중간엽 줄기세포를 이용한 육모 촉진용 조성물의 제조방법
KR20060123256A (ko) 모발의 태모화 방법 및 조성물
KR101938548B1 (ko) 마이크로 ｒｎａ를 포함하는 색소형성유전자 발현조절용 조성물
WO2019103572A1 (ko) Mirna를 포함하는 탈모 방지 또는 발모 촉진용 조성물
KR20190011207A (ko) 티로시나아제 안티센스 올리고뉴클레오티드
WO2018056706A1 (ko) 티오레독신 결합단백질 유래 펩타이드 또는 이를 암호화 하는 폴리뉴클레오타이드를 유효성분으로 함유하는 노화 줄기세포의 역노화용 조성물 및 이의 용도
WO2021002664A1 (ko) 암의 예방, 개선 또는 치료용 조성물
WO2022139524A1 (ko) 신규 fk506 유도체 및 이를 포함하는 발모 촉진용 조성물
KR101943203B1 (ko) 지방유래줄기세포로부터 모유두 세포로의 분화방법 및 이의 용도
WO2018155890A1 (ko) 남성형 탈모 표적 유전자의 발현을 억제하는 비대칭 siRNA
KR102187371B1 (ko) FoxQ1 유전자가 과발현된 지방유래 줄기세포 및 이의 용도
WO2021251790A1 (ko) 항비만 활성을 가지는 디옥시콜산-펩타이드 결합체 및 이의 용도
WO2016178519A1 (ko) 근육 노화 억제용 또는 근육 노화 관련 질환 치료용 조성물
WO2010095879A2 (ko) 세포사멸 관련 유전자의 전사체에 결합하는 ｓｉＲＮＡ 및 이를 이용한 암 치료용 조성물
WO2023195749A1 (ko) 신규한 foxn1 변이체 및 이의 용도
WO2021075870A1 (ko) Rip 키나아제 억제제를 포함하는 탈모 방지 또는 발모 촉진용 조성물
WO2015030422A9 (ko) 21-ｏ-안젤로일티아사포제놀 ｅ3을 포함하는 발모 또는 육모 촉진용 조성물
WO2018030683A1 (ko) TYMP(Thymidine Phosphorylase) 단백질을 유효성분으로 포함하는 탈모 예방 또는 치료용 약학적 조성물
WO2024106586A1 (ko) 발모 촉진 및 탈모 억제 활성을 갖는 펩타이드 및 이의 용도
KR102488325B1 (ko) Rab27b 발현 억제제 및 이를 포함하는 탈모 방지 또는 발모 촉진용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18880708

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18880708

Country of ref document: EP

Kind code of ref document: A1

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 26/01/2021)

122 Ep: pct application non-entry in european phase

Ref document number: 18880708

Country of ref document: EP

Kind code of ref document: A1