WO2022182188A1 - 이중가닥 mirna를 유효성분으로 포함하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 조성물 - Google Patents

이중가닥 mirna를 유효성분으로 포함하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 조성물 Download PDF

Info

Publication number
WO2022182188A1
WO2022182188A1 PCT/KR2022/002765 KR2022002765W WO2022182188A1 WO 2022182188 A1 WO2022182188 A1 WO 2022182188A1 KR 2022002765 W KR2022002765 W KR 2022002765W WO 2022182188 A1 WO2022182188 A1 WO 2022182188A1
Authority
WO
WIPO (PCT)
Prior art keywords
hair
mir
improving
graying
preventing
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2022/002765
Other languages
English (en)
French (fr)
Inventor
박한오
이상규
권오승
고은아
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sirnagen Therapeutics Corp
Bioneer Corp
Original Assignee
Sirnagen Therapeutics Corp
Bioneer Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sirnagen Therapeutics Corp, Bioneer Corp filed Critical Sirnagen Therapeutics Corp
Priority to JP2023549095A priority Critical patent/JP7695727B2/ja
Priority to EP22760104.4A priority patent/EP4299078A4/en
Priority to CA3206861A priority patent/CA3206861A1/en
Priority to CN202280014067.3A priority patent/CN116847888A/zh
Priority to US18/261,882 priority patent/US20240299437A1/en
Priority to AU2022226837A priority patent/AU2022226837B2/en
Publication of WO2022182188A1 publication Critical patent/WO2022182188A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/543—Lipids, e.g. triglycerides; Polyamines, e.g. spermine or spermidine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/554—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being a steroid plant sterol, glycyrrhetic acid, enoxolone or bile acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/58—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained by reactions only involving carbon-to-carbon unsaturated bonds, e.g. poly[meth]acrylate, polyacrylamide, polystyrene, polyvinylpyrrolidone, polyvinylalcohol or polystyrene sulfonic acid resin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/60—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6921—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
    • A61K47/6927—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores
    • A61K47/6929—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/60—Sugars; Derivatives thereof
    • A61K8/606—Nucleosides; Nucleotides; Nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/14—Drugs for dermatological disorders for baldness or alopecia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q5/00—Preparations for care of the hair
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q5/00—Preparations for care of the hair
    • A61Q5/10—Preparations for permanently dyeing the hair
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q7/00—Preparations for affecting hair growth
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/32—Special delivery means, e.g. tissue-specific

Definitions

  • the present invention relates to a composition for improving graying of hair, promoting hair growth and/or preventing or improving hair loss, comprising double-stranded miRNA as an active ingredient, and more particularly, the double-stranded miRNA miR-3139, miR-3189, miR-3199 or miR-8485; a double-stranded oligonucleotide construct comprising the same; Or it relates to a pharmaceutical or cosmetic composition for improving graying whitening of hair, promoting hair growth and/or preventing or improving hair loss comprising nanoparticles comprising the structure as an active ingredient.
  • Hair graying of human hair is a phenomenon of physiological aging, and melanin pigment due to deterioration and depletion of melanocytes or melanocyte stem cells of hair follicles is known to be caused by a decrease in Melanin pigment is an important factor that determines the color of hair.
  • Melanin is synthesized and secreted from melanosomes present in melanocytes, and after delivery to adjacent keratinocytes, fibroblasts, etc., hair It moves with the growth of the hair and maintains the color of the hair.
  • simple dyeing is used as a solution to graying hair, but dyeing is a temporary method and re-dyeing is essential due to the growth of white hair.
  • melanogenesis is regulated by the interaction of various signals (SCF-KIT-RAS-ERK signaling pathway, MC1R-cAMP-PKA signaling pathway, Wnt- ⁇ -catenin signaling pathway). It is not easy to identify the mechanism of action and develop new substances to prevent or improve the graying of
  • AGA Androgenetic alopecia
  • the hair cycle consists of three phases: the anagen, in which hair grows most actively, the categen, in which growth stops and hair degeneration begins, and the state in which the activity of hair follicles is stopped. It is classified as a telogen, and hair loss refers to the natural loss of hair that has stopped growing according to the growth cycle, and it is known that various factors act to cause hair loss.
  • drug development for alleviating hair loss symptoms has been made for a long time, there is nothing other than finasteride, an oral hair loss treatment, and minoxidil, a hair loss treatment that is applied.
  • it induces the alleviation of hair loss symptoms through the mechanism of inhibiting male hormone production, it is accompanied by limitations in efficacy and side effects.
  • RNAi interfering RNA
  • siRNA is a single-stranded RNA composed of between 16 and 27 nucleotides and functions as a component of a ribonucleoprotein known as RNA Induced Silencing Complex (RISC) in the cell.
  • RISC functions as an RNA enzyme scissors, and cuts messenger RNA (hereinafter referred to as mRNA) to inhibit protein production from mRNA.
  • mRNA messenger RNA
  • the siRNA contained in RISC combines with mRNA having a sequence complementary to the siRNA sequence to form double-stranded RNA, and RISC acts as an RNA enzyme scissors to cut the target mRNA and the mRNA no longer repeats the protein as a template ( template) so that it cannot perform its function.
  • RNAi-based therapeutics are evaluated as more advanced than single-molecule therapeutics in that they block mRNA before the protein production stage and utilize RNA and the RISC system intrinsic to cells, but siRNA-based technology There is a side effect that cannot be solved even by this, which is a phenomenon called off-target effect. As described above, it degrades mRNA that is complementary to the siRNA sequence, but it is not complementary to the entire siRNA sequence and only partially binds to the complementary mRNA to cause degradation. This is called the target effect.
  • miRNA microRNA
  • miRNA is an RNA composed of 16 to 27 nucleotides and is classified as a protein non-coding RNA in contrast to a messenger RNA that is translated into a protein (Carthew, R.W. & Sontheimer, E.J., Cell 136, 642-55, 2009; MacFarlane, L.-A.
  • miRNAs are recorded in the genomes of higher plant and animal cells and are known to play a key role in regulating cell metabolism and functions, including cell generation, growth, differentiation, and death. To date, more than 2,000 types of miRNAs are known in the human genome, and the functions of many of them are still unknown.
  • miRNA is transcribed from the genome into RNA by an RNA polymerase called Pol II, and its initial length varies unspecifiedly (Carthew, R.W. & Sontheimer, E.J., Cell 136, 642-55, 2009; Brodersen, P. (&Voinnet, O., Nat Rev Mol Cell Biol 10, 141-148, 2009.). This is due to the diversity of positions included in miRNAs in the genome. When miRNAs are located in introns, which are non-involved in protein production, and are transcribed at the same time in mRNA production, inter-genic regions on the genome This is because it is generated in various ways, such as when it is located and independently transcribed (Malone, C.D.
  • the initially generated miRNA parent is called a primary miR (primary microRNA), and the primary miRNA is a precursor miRNA (precursor miRNA, hereinafter referred to as pre-miR) by an RNA cleaving enzyme (RNase) called Drosha in the nucleus. ) (Bartel, D.P., Cell 136, 215-33, 2009.).
  • RNase RNA cleaving enzyme
  • Pre-miR inside the cell nucleus is moved from the nucleus to the cytoplasm by the exportin protein, etc., and is secondary processed by another RNA cleaving enzyme called Dicer in the cytoplasm, which is a double strand composed of 16-27 nucleotides.
  • Dicer RNA cleaving enzyme
  • RNA of one strand of the double-stranded miR is selectively selected to bind to RISC, which is the ribonucleic acid protein conjugate, to have activity, and to bind to target mRNA using the miR sequence.
  • mRNA can be roughly divided into three parts based on whether it is involved in protein production.
  • the coding region containing protein translation information and the 5' and 3' parts of the coding region, respectively, are 5 parts that do not have protein translation information. It can be divided into '-UTR (Un-Translated Region) and 3'-UTR.
  • siRNA that induces degradation of target mRNA acts irrespective of the 5'-, 3'-UTR and coding portion of mRNA, whereas miR mainly binds with 3'-UTR ( Carthew, R. W. & Sontheimer, E. J., Cell 136, 642-55, 2009; Bartel, D.
  • siRNA and other miRNAs along with the difference in binding position with mRNA, is that siRNA mainly binds to mRNA including the sequence complementary to the entire siRNA sequence, whereas miRNA is located 2-8 nucleotides from the 5' end of the miRNA.
  • the difference is that the size of the seed region sequence is mainly used for target mRNA recognition, so the miRNA activity is not affected even if the entire miRNA sequence does not have a perfect complementary sequence to the target gene and contains a partial non-complementary sequence. not (Bartel, D.P., Cell 136, 215-33, 2009.).
  • miRNA As the sequence size of the seed part is 6-8 nucleotides, there are various types of mRNA having a complementary sequence in the 3' UTR. These miRNA properties have a function as an efficient regulator involved in the control of many aspects of cell physiology, including cell division, growth, differentiation, and death. In addition, the function of miRNA as a regulator acts as an advantage in that it can be effectively applied to various diseases. Whereas siRNA aims to suppress the expression of a single gene, miRNA expresses multiple genes involved in various signaling pathways.
  • a large number of mRNAs contain a portion where one or more miRNAs are likely to bind to the 3' UTR, and according to a bioinformatic calculation, it is known that about 30% of the total mRNA is regulated by miRNAs. have.
  • miRNA/siRNA can effectively target cells by improving the stability of miRNA/siRNA in the body and improving cell delivery efficiency. should be delivered (FY Xie., Drug Discov. Today. 2006 Jan; 11(1-2):67-73).
  • some nucleotides or backbone of miRNA/siRNA are modified to have nuclease resistance, or Viral vectors), liposomes, or carriers such as nanoparticles are actively being studied.
  • a delivery system using a viral vector such as an adenovirus or a retrovirus has high transfection efficacy, but high immunogenicity and oncogenicity.
  • a non-viral delivery system containing nanoparticles has a low cell delivery efficiency compared to a viral delivery system, but has high in vivo stability, Target-specific delivery is possible, uptake and internalization of contained RNAi oligonucleotides into cells or tissues, and has the advantage of little cytotoxicity and induction of innate immunity. It is evaluated as a powerful delivery method compared to the system (Akhtar S, J Clin Invest. 2007 December 3; 117(12): 3623-3632).
  • the method of using a nanocarrier is to form nanoparticles by using various polymers such as liposomes and cationic polymer complexes, and to carry miRNA/siRNA on these nanoparticles, that is, a nanocarrier.
  • method of delivery to cells include polymeric nanoparticles, polymer micelles, and lipoplexes.
  • the method using lipoplex is composed of cationic lipids It interacts with the anionic lipids of the endosome to induce a destabilizing effect of the endosome and deliver it into the cell.
  • siRNA conjugated with a high molecular compound such as polyethylene glycol (PEG) interacts with the anionic phosphate group of miRNA/siRNA in the presence of a cationic material to form a complex, thereby improving miRNA /siRNA becomes a carrier with stability (SH Kim, J Control Release 129(2):107-16, 2008).
  • a high molecular compound such as polyethylene glycol (PEG)
  • PEG polyethylene glycol
  • micelles composed of polymer complexes are extremely small in size compared to other systems used as drug delivery vehicles, such as microspheres or nanoparticles, but their distribution is very uniform and spontaneously formed. It has the advantage of being easy to manage and secure reproducibility.
  • miRNA/siRNA is conjugated to a biocompatible polymer, a hydrophilic substance (eg, polyethylene glycol by a simple covalent bond or a linker-mediated covalent bond).
  • a hydrophilic substance eg, polyethylene glycol by a simple covalent bond or a linker-mediated covalent bond.
  • TM self-assembled micelle inhibitory RNA
  • PEG or HEG Hexaethylenglycol
  • PEG is a synthetic polymer and is often used for increasing the solubility of pharmaceuticals, particularly proteins, and controlling pharmacokinetics.
  • PEG is a polydisperse material, and one batch of polymer is composed of the sum of different numbers of monomers, so the molecular weight is in the form of a Gaussian curve, and the polydisperse value (Mw/Mn) is It expresses the degree of homogeneity of a substance.
  • PEG has a low molecular weight (3 to 5 kDa), it shows a polydispersity index of about 1.01, and when it has a high molecular weight (20 kDa), it shows a high polydispersity index of about 1.2. looks like Therefore, when PEG is combined with pharmaceuticals, the polydispersity of PEG is reflected in the conjugate, making it difficult to verify a single substance.
  • the hydrophilic material of the double-stranded oligonucleotide structure constituting the SAMiRNA TM is combined with uniform 1 to 15 monomers having a constant molecular weight and a linker (if necessary)
  • a new type of carrier technology with a smaller size and remarkably improved polydispersity compared to the existing SAMiRNA TM by blocking the basic unit including the linker and using an appropriate number as needed. was developed
  • the present inventors have tried to discover miRNAs that can improve the graying of hair, and as a result, miR-3139, miR-3189, miR-3199 or miR-8485 activates melanocytes and promotes the production of melanin, respectively. It was confirmed that graying of hair can be improved. In addition, it was confirmed that the proliferation of hair follicle dermal papilla cells and keratinocytes present in the hair follicles were promoted along with the activation of melanocytes. By confirming, the present invention was completed.
  • Patent Document 1 Republic of Korea Patent No. 883471
  • Patent Document 2 Republic of Korea Patent No. 1224828
  • Patent Document 3 Republic of Korea Patent No. 1862349
  • Non-Patent Document 1 Iorns, E., Lord, C.J., Turner, N. & Ashworth, A., Nat Rev Drug Discov 6, 556-68. 2007
  • Non-Patent Document 2 Agostini, M. & Knight, R.A., Oncotarget 5, 872-81, 2014
  • Non-Patent Document 3 Dangwal, S. &Thum, T., Annu Rev Pharmacol Toxicol 54, 185-203, 2014
  • Non-Patent Document 4 Carthew, R.W. & Sontheimer, E. J., Cell 136, 642-55, 2009
  • Non-Patent Document 5 MacFarlane, L.-A. & Murphy, P.R., Current Genomics 11, 537-561, 2010
  • Non-Patent Document 6 Bartel, D.P., Cell 136, 215-33, 2009
  • Non-Patent Document 7 Carthew, R.W. & Sontheimer, E. J., Cell 136, 642-55, 2009
  • Non-Patent Document 8 Brodersen, P. & Voinnet, O., Nat Rev Mol Cell Biol 10, 141-148, 2009
  • Non-Patent Document 9 Malone, C.D. & Hannon, G. J., Cell 136, 656-68, 2009
  • Non-Patent Document 10 Akhtar S, J Clin Invest. 2007 December 3; 117(12): 3623-3632, 2007
  • Non-Patent Document 11 SH Kim, J Control Release 129(2):107-16, 2008
  • the present invention provides a novel composition capable of preventing or improving hair loss and promoting hair growth by improving graying of hair and promoting proliferation of hair follicle cells through activation of melanin-producing cells in hair follicles and promotion of melanin production will be.
  • A is a hydrophilic material
  • B is a hydrophobic material
  • X and Y are each independently a simple covalent bond or a linker-mediated covalent bond
  • R is miR-3139, miR-3189, miR-3199 or miR-8485;
  • nanoparticles comprising the double-stranded oligonucleotide structure; provides a pharmaceutical composition for improving graying of hair, promoting hair growth and/or preventing or improving hair loss, comprising as an active ingredient.
  • the present invention also provides: (i) miR-3139, miR-3189, miR-3199 or miR-8485; (ii) a double-stranded oligonucleotide construct comprising the structure of the following structural formula (1):
  • A is a hydrophilic material
  • B is a hydrophobic material
  • X and Y are each independently a simple covalent bond or a linker-mediated covalent bond
  • R is miR-3139, miR-3189, miR-3199 or miR-8485;
  • nanoparticles comprising the double-stranded oligonucleotide structure; provides a cosmetic composition for improving graying of hair, promoting hair growth and/or preventing or improving hair loss, comprising as an active ingredient.
  • the present invention relates to a subject in need of improvement of graying of hair, promotion of hair growth and/or prevention or improvement of hair loss.
  • A is a hydrophilic material
  • B is a hydrophobic material
  • X and Y are each independently a simple covalent bond or a linker-mediated covalent bond
  • R is miR-3139, miR-3189, miR-3199 , or miR-8485; or
  • (iii) provides a method for improving graying of hair, promoting hair growth and/or preventing or improving hair loss, comprising administering nanoparticles comprising the double-stranded oligonucleotide structure.
  • the present invention is for improving graying of hair, promoting hair growth and/or preventing or improving hair loss
  • A is a hydrophilic material
  • B is a hydrophobic material
  • X and Y are each independently a simple covalent bond or a linker-mediated covalent bond
  • R is miR-3139, miR-3189, miR-3199 , or miR-8485; or (iii) the use of nanoparticles comprising the double-stranded oligonucleotide construct.
  • the present invention is for the manufacture of pharmaceuticals or cosmetics for improving graying of hair, promoting hair growth and/or preventing or improving hair loss
  • A is a hydrophilic material
  • B is a hydrophobic material
  • X and Y are each independently a simple covalent bond or a linker-mediated covalent bond
  • R is miR-3139, miR-3189, miR-3199 or miR-8485; or (iii) the use of nanoparticles comprising the double-stranded oligonucleotide construct.
  • 1 shows the results of primary screening by measuring melanin production in a human skin cancer cell line (M21) using 1728 human miRNAs loaded on SAMiRNA TM .
  • Figure 2 shows the results of secondary screening in two types of human skin cancer cell lines (M21, SK-MEL28) for 18 kinds of high melanin production amount selected through screening.
  • 3 is a result of evaluating the reproducibility of melanin production and color change efficacy in a human skin cancer cell line (SK-MEL-28) for 9 types of miRNAs with the highest melanin production through primary and secondary screening
  • 5 shows melanogenesis of 9 types of miR-8485, miR-7978, miR-6074, miR-3132, miR-4644, miR-3139, miR-3189, miR-3199, and miR-933 selected in human epidermal melanocytes cell lines. It is the result of analyzing the signal transduction change through RT-qPCR reaction.
  • FIG. 6 shows the results of 9 types of miR-8485, miR-7978, miR-6074, miR-3132, miR-4644, miR-3139, miR-3189, miR-3199, and miR-933 selected from the SK-MEL-28 cell line. This is the result of confirming the change in melanogenesis signaling through Western blot analysis for the mechanism of action analysis.
  • Figure 9a shows the results of analysis of cell color change and melanin production by SAMiRNA-miR-3199 treatment in SK-MEL-28 cell line.
  • Figure 9b is the result of confirming the change in melanin fish signaling by SAMiRNA-miR-3199 treatment in SK-MEL-28 cell line through RT-qPCR.
  • Figure 9c is the result of confirming the change in melanin fish signaling by the SAMiRNA-miR-3199 treatment in the SK-MEL-28 cell line through immunoblot analysis.
  • Figure 9d is the result of confirming the efficacy of melanin fish signaling change by the SAMiRNA-miR-3199 treatment in SK-MEL-28 cell line through immunocytochemistry analysis.
  • 10a shows the results of selecting GSK3 ⁇ as a target gene of miR-3199.
  • Figure 10b shows the results of confirming the GSK3 ⁇ inhibitory ability by the SAMiRNA-miR-3199 treatment in the SK-MEL-28 cell line through RT-qPCR analysis.
  • 10c is a result of confirming the GSK3 ⁇ inhibitory ability by the SAMiRNA-miR-3199 treatment in the SK-MEL-28 cell line through immunoblot analysis.
  • Figure 10d is the result of confirming the GSK3 ⁇ inhibitory ability by the SAMiRNA-miR-3199 treatment in the SK-MEL-28 cell line through immunocytochemistry analysis.
  • Figure 10e is the result of confirming that miR-3199 acts by directly binding to GSK3 ⁇ mRNA 3' UTR through a luciferase reporter assay assay.
  • 11a shows the results of analysis of cell color change and melanin production by SAMiRNA-miR-3199 treatment in human epidermal melanocytes.
  • Figure 11b is the result of confirming through RT-qPCR analysis on the change in melanin fish signaling by SAMiRNA-miR-3199 treatment in human epidermal melanocytes.
  • Figure 11c is the result of confirming the change in melanin fish signaling by the SAMiRNA-miR-3199 treatment in human epidermal melanocytes through immunoblot analysis.
  • 12a is a result of evaluating the cytotoxicity and innate immunotoxicity of SAMiRNA-miR-3199 in human dermal papilla cells, keratinocytes, and human melanocytes.
  • Figure 12b is a result of evaluating the cytotoxicity and innate immunotoxicity of SAMiRNA-miR-3199 by checking whether the increase in inflammatory cytokines.
  • a screening library for 1728 human miRNAs was synthesized in response to the demand for preventing, preventing, or improving hair graying and hair loss (Table 2), and it was applied to human skin cancer cell lines M21 and SK-MEL-28 cells.
  • miRNAs miR-3139, miR-3189, miR-3199, and miR-8485, which are effective miRNAs, were discovered by comprehensively analyzing melanin production and cell color change.
  • the miRNA can improve melanocyte activity and melanin production, and hair graying, and the mechanism of action for promoting melanin production was identified. It was confirmed that it can be promoted.
  • A is a hydrophilic material
  • B is a hydrophobic material
  • X and Y are each independently a simple covalent bond or a linker-mediated covalent bond
  • R is miR-3139, miR-3189, miR-3199 , or miR-8485; or
  • compositions for improving graying whitening of hair, promoting hair growth and/or preventing or improving hair loss comprising nanoparticles comprising the double-stranded oligonucleotide structure as an active ingredient.
  • A is a hydrophilic material
  • B is a hydrophobic material
  • X and Y are each independently a simple covalent bond or a linker-mediated covalent bond
  • R is miR-3139, miR-3189, miR-3199 , or miR-8485; or
  • compositions for improving graying of hair, promoting hair growth and/or preventing or improving hair loss comprising nanoparticles comprising the double-stranded oligonucleotide structure as an active ingredient.
  • the composition may be characterized in that improvement of graying whitening of hair, promotion of hair growth and/or hair loss is prevented or improved by melanin-forming cell activity and hair follicle cell proliferation, but is not limited thereto.
  • the miR-3139 may include the nucleotide sequence represented by SEQ ID NO: 9 and the nucleotide sequence represented by SEQ ID NO: 10, preferably, the nucleotide sequence and sequence represented by SEQ ID NO: 9 It may be DNA/DNA, RNA/RNA, or a DNA/RNA hybrid composed of the nucleotide sequence represented by number 10.
  • the miR-3189 may include the nucleotide sequence represented by SEQ ID NO: 5 and the nucleotide sequence represented by SEQ ID NO: 6, preferably, the nucleotide sequence and sequence represented by SEQ ID NO: 5 It may be DNA/DNA, RNA/RNA, or a DNA/RNA hybrid composed of the nucleotide sequence represented by number 6.
  • the miR-3199 may include the nucleotide sequence represented by SEQ ID NO: 15 and the nucleotide sequence represented by SEQ ID NO: 16, preferably, the nucleotide sequence and sequence represented by SEQ ID NO: 15 It may be a DNA/DNA, RNA/RNA, or a DNA/RNA hybrid consisting of the nucleotide sequence represented by number 16.
  • the miR-8485 may include the nucleotide sequence represented by SEQ ID NO: 1 and the nucleotide sequence represented by SEQ ID NO: 2, preferably, the nucleotide sequence and sequence represented by SEQ ID NO: 1 It may be a DNA/DNA, RNA/RNA, or a DNA/RNA hybrid composed of the nucleotide sequence represented by number 2.
  • miR-3189, miR-3199, and miR-8485 of the present invention increase the expression of microphthalmia-associated transcription factor (MITF), tyrosinase (TYR), tyrosinase-related protein 1 (TYRP1), and tyrosinase-related protein 2 (TYRP2) and miR-3139 increased the expression of TYR and TYRP2.
  • MITF microphthalmia-associated transcription factor
  • TYR tyrosinase
  • TYRP1 tyrosinase-related protein 1
  • TYRP2 tyrosinase-related protein 2
  • miR-3139 increased the expression of TYR and TYRP2.
  • the genes increased by the miRNA of the present invention are known to function as follows.
  • MITF regulates the expression of TYR, TYRP1 and TYRP2 genes, which are enzymes directly involved in the synthesis of melanin, and is known as a key transcription factor for melanocyte development and differentiation (D'Mello, SA, Finlay, GJ, Baguley, BC & Askarian-Amiri, ME Signaling Pathways in Melanogenesis. Int J Mol Sci . 17 (2016) ; Kawakami A, Fisher DE. The master role of microphthalmia-associated transcription factor in melanocyte and melanoma biology. Lab Investig. (2017) )).
  • TYR, TYRP1, and TYRP2 are mainly involved in the conversion of tyrosine into melanin pigment.
  • TYR and TYRP2 are known as important enzymes affecting the quantity and quality of melanin (NIU, C., AISA, HA, 2017: Upregulation of melanogenesis) and tyrosinase activity: potential agents for vitiligo. Molecules 22, E1303. (2017); D'Mello, SA, Finlay, GJ, Baguley, BC & Askarian-Amiri, ME Signaling Pathways in Melanogenesis. Int J Mol Sci . 17 (2016) )).
  • the seed region corresponding to the 8-9th base from the second base of the miRNA activity sequence is a major factor in activity, and long double-stranded oligonucleotides including it are Stranded oligonucleotides can also be prepared and used.
  • the miRNA may be double-stranded, and as another aspect, may include a single-molecule polynucleotide.
  • it may be an antisense oligonucleotide or miRNA, but is not limited thereto.
  • miR-3139, miR-3189, miR-3199 or miR-8485 may include a sequence in which one or more bases are substituted, deleted, or inserted in the sense strand constituting it or the antisense strand complementary thereto.
  • the double-stranded oligonucleotide according to the present invention may include an overhang, which is a structure comprising one or more unpaired nucleotides at the 3' end of one or both strands.
  • the sense strand or the antisense strand may preferably consist of 19 to 31 nucleotides, but is not limited thereto.
  • the oligonucleotide in the case of an oligo conjugate in which a hydrophilic material and a hydrophobic material are bonded to the RNA or DNA oligonucleotide, the oligonucleotide is obtained through a conjugate in which a hydrophilic material and a hydrophobic material are conjugated to both ends of the RNA or DNA oligonucleotide.
  • a hydrophilic material and a hydrophobic material are conjugated to both ends of the RNA or DNA oligonucleotide.
  • the self-assembled nanoparticles are formed by the hydrophobic interaction of the hydrophobic materials.
  • These nanoparticles have extremely excellent delivery efficiency and stability in the body, and the particle size is very uniform through the improvement of the structure. Therefore, QC (Quality Control) is easy, so there is an advantage in that the manufacturing process as a drug is simple.
  • the hydrophilic material is represented by (P) n , (P m -J) n or (JP m ) n ,
  • P is a hydrophilic material monomer
  • n is 1 to 200
  • m is 1 to 15
  • J is It may be a linker connecting the m number of hydrophilic material monomers or the m number of hydrophilic material monomers and the oligonucleotide.
  • the hydrophilic material may have a molecular weight of 200 to 10,000.
  • the hydrophilic material may be any one selected from the group consisting of polyethylene glycol, polyvinylpyrrolidone and polyoxazoline, but is not limited thereto.
  • the hydrophilic material monomer (P) may have a structure of the following compound (1):
  • G is selected from the group consisting of CH 2 , O, S and NH.
  • the linker (J) may be selected from the group consisting of PO 3 - , SO 3 and CO 2 It may be characterized.
  • the molecular weight of the hydrophobic material may be 250 to 1,000
  • the hydrophobic material is a steroid (steroid) derivative, a glyceride (glyceride) derivative, glycerol ether (glycerol ether), polypropylene glycol ( polypropylene glycol), C 12 to C 50 unsaturated or saturated hydrocarbons (hydrocarbon), diacylphosphatidylcholine, fatty acid (fatty acid), phospholipid and, characterized in that selected from the group consisting of lipopolyamine can be, but is not limited thereto.
  • the steroid derivative may be characterized in that it is selected from the group consisting of cholesterol, cholestanol, cholic acid, cholesteryl formate, cotestanyl formate and colistanylamine, not limited
  • the glyceride derivative may be selected from mono-, di- and tri-glycerides, but is not limited thereto.
  • the covalent bond represented by X and Y may be a non-degradable bond or a degradable bond
  • the non-degradable bond may be an amide bond or a phosphorylated bond
  • the degradable bond may be characterized as a disulfide bond, an acid-degradable bond, an ester bond, an anhydride bond, a biodegradable bond, or an enzyme-degradable bond, but is not limited thereto.
  • the double-stranded oligonucleotide structure according to the present invention may have a structure of the following structural formula (1').
  • A, B, X and Y are the same as defined in Structural Formula (1), S is the sense strand of miRNA, and AS is the antisense strand of miRNA.
  • the double-stranded oligonucleotide construct comprising miRNA according to the present invention may be a double-stranded oligonucleotide construct comprising the structure of the following structural formula (2).
  • A, B, X, Y and R have the same definitions as in the structural formula (1).
  • the double-stranded oligonucleotide structure has the structure of the following structural formula (2').
  • the hydrophilic material may be a cationic or nonionic polymer material having a molecular weight of 200 to 10,000, preferably a nonionic polymer material having a molecular weight of 1,000 to 2,000.
  • the hydrophilic material may be a nonionic hydrophilic polymer compound, for example, any one selected from the group consisting of polyethylene glycol, polyvinylpyrrolidone and polyoxazoline, but is not limited thereto.
  • the double-stranded oligonucleotide structure according to the present invention has a structure of the following Structural Formula (3) or Structural Formula (4).
  • P is a hydrophilic material monomer
  • n is 1 to 200
  • m is 1 to 15
  • J is between m hydrophilic material monomers or m hydrophilic material monomers and oligonucleotides.
  • It may be a linker
  • X and Y are each independently a simple covalent bond or a linker-mediated covalent bond
  • R may be specific miRNAs of the present invention.
  • the double-stranded oligonucleotide construct comprising miRNA according to the present invention has the structure of the following structural formula (3').
  • the double-stranded oligonucleotide construct comprising miRNA according to the present invention has the structure of the following structural formula (4').
  • hydrophilic material monomer (P) in the structural formulas (3) and (4) can be used without any limitation as long as it meets the purpose of the present invention among the monomers of the nonionic hydrophilic polymer, preferably in Table 1
  • hydrophilic material monomers various functional groups can be introduced into the monomer represented by compound (1), and has excellent bio-compatibility, such as good in vivo compatibility and low immune response, as well as structural formula It has the advantage of increasing the in vivo stability of the oligonucleotide contained in the construct according to (3) and Structural Formula (4) and increasing the delivery efficiency, so it is very suitable for the preparation of the construct according to the present invention.
  • the hydrophilic material in Structural Formulas (3) and (4) preferably has a total molecular weight in the range of 1,000 to 2,000.
  • hexaethylene glycol according to compound (1) that is, G in structural formulas (3) and (4) is O
  • m 6
  • the hexaethylene glycol spacer Since the molecular weight is 344, it is preferable that the number of repetitions (n) is 3 to 5.
  • the repeating units of the hydrophilic group represented by (P m -J) or (JP m ) in the structural formulas (3) and (4), that is, the hydrophilic material block may be used in an appropriate number represented by n.
  • a different hydrophilic material monomer may be used for every hydrophilic material block, such as the hydrophilic material monomer according to compound (3) is used, and any hydrophilic material monomer selected from compounds (1) to (3) according to the compound (1) to (3) may be used in all the hydrophilic material blocks.
  • One hydrophilic material monomer may be used identically.
  • the same linker may be used for each block of the hydrophilic material, or a different linker may be used for each block of the hydrophilic material as a linker for mediating the binding of the hydrophilic material monomer.
  • m the number of hydrophilic material monomers, may be the same or different between blocks of the hydrophilic material.
  • the linker (J) is PO 3 - , SO 3 and CO 2 It is preferably selected from the group consisting of, but is not limited thereto, as long as it meets the purpose of the present invention according to the monomer of the hydrophilic material used, etc. It will be apparent to a person skilled in the art that any linker may be used.
  • hydrophilic material monomer may be modified to have a functional group necessary for binding to another material such as a target-specific ligand, if necessary.
  • one to three phosphate groups may be bonded to the 5′ end of the antisense strand of the double-stranded oligonucleotide construct including the gene-specific miRNA.
  • a double-stranded oligonucleotide construct including miRNA has a structure of the following structural formula (3'') or (4'').
  • the hydrophobic material (B) serves to form nanoparticles composed of an oligonucleotide structure according to Structural Formula (1) through hydrophobic interactions.
  • the hydrophobic material preferably has a molecular weight of 250 to 1,000, steroid derivatives, glyceride derivatives, glycerol ether, polypropylene glycol, C 12 to C 50 unsaturated or Saturated hydrocarbons, diacylphosphatidylcholine, fatty acid, phospholipid, lipopolyamine, etc. may be used, but are not limited thereto, and any It is obvious to those of ordinary skill in the art that a hydrophobic material can also be used.
  • the steroid derivative may be selected from the group consisting of cholesterol, cholestanol, cholic acid, cholesteryl formate, cotestanyl formate and colistanylamine, and the glyceride derivative is mono-, di- and tri- It may be selected from glyceride, etc.
  • the fatty acid of the glyceride is preferably a C 12 to C 50 unsaturated or saturated fatty acid.
  • saturated or unsaturated hydrocarbons or cholesterol are preferable in that they have the advantage that they can be easily combined in the synthesis step of the oligonucleotide structure according to the present invention.
  • the hydrophobic material is bound to the distal end of the hydrophilic material, and may be bound to any position of the sense strand or the antisense strand of the miRNA.
  • the hydrophilic material, the hydrophilic material block, or the hydrophobic material and the oligonucleotide are bonded by a simple covalent bond or a linker-mediated covalent bond (X or Y).
  • the covalent bond may be either a non-degradable bond or a degradable bond.
  • the non-degradable bond includes an amide bond or a phosphorylation bond
  • the degradable bond includes a disulfide bond, an acid-decomposable bond, an ester bond, an anhydride bond, a biodegradable bond, or an enzyme-degradable bond, but is not limited thereto. .
  • the miRNA sequence that can be used as an active ingredient of the composition for improving graying of hair, preventing or improving hair loss, promoting hair follicle cell proliferation and/or promoting hair growth through the promotion of melanocyte activity and melanin production is a human
  • the genome-derived sequence or miRNA-derived genome is not limited to the human genome, and miRNA sequences obtained from other animal-derived genomes may also be used.
  • the miRNA can be used in the form of various miRNA derivatives (miRNA mimic) that generate bioequivalent efficacy of miRNA, and a modified miRNA including a miRNA sequence including the same seed part can be used.
  • miRNA mimic miRNA derivatives
  • a modified miRNA including a miRNA sequence including the same seed part can be used.
  • the length of the miRNA sense and antisense sequences can be reduced, and a short derivative consisting of 15 nucleotides in length can also be used.
  • the miRNA derivative for the miRNA may partially include a phosphorothioate structure in which the RNA phosphate backbone structure is substituted with other elements such as sulfur, and DNA, PNA ( It can be used in a form that is completely or partially substituted with peptide nucleic acids) and LNA (locked nucleic acid) molecules, and can also be used in a form in which the 2' hydroxyl group of RNA sugar is substituted with various functional structures, which are methylated, methoxyl including, but not limited to, sylation, fluorination, and the like.
  • PNA PNA
  • LNA locked nucleic acid
  • the miRNA is not limited to the double-stranded RNA of the mature miRNA and the miRNA derivative derived therefrom, and may be used in the form of a miRNA precursor. Partial or total substitution with LNA or the like, and modification of the 2' hydroxyl group of the RNA sugar molecule are possible.
  • the miRNA can be used in the form of a miRNA precursor or primary miRNA (pre-miRNA), and it is possible to synthesize it by a chemical method or to express it by delivering it to a cell in the form of a plasmid.
  • pre-miRNA primary miRNA
  • a method of delivering miRNA to cells cultured in a culture dish a method using a mixture with cationic lipids, a method for delivering by electrical stimulation, a method using a virus, etc. may be used, but miRNAs in the art Since it is known to deliver a variety of methods can be easily applied and used by those skilled in the art, it is not limited to the above method.
  • the present invention relates to a double-stranded oligonucleotide construct and nanoparticles comprising the miR-3139, miR-3189, miR-3199, or miR-8485 miRNA.
  • the double-stranded oligonucleotide construct containing the miRNA is amphiphilic, including both hydrophobic and hydrophilic substances, and the hydrophilic part has affinity through interactions such as hydrogen bonding with water molecules present in the body. They are directed outwards, and hydrophobic materials are directed inward through hydrophobic interactions between them, forming thermodynamically stable nanoparticles. That is, the hydrophobic material is positioned at the center of the nanoparticles, and the hydrophilic material is positioned in the outer direction of the double-stranded oligonucleotide including the miRNA to form nanoparticles that protect the miRNA sequence.
  • Nanoparticles according to the present invention may be formed only with double-stranded oligonucleotide structures having the same sequence or may be composed of double-stranded oligonucleotide structures having different sequences.
  • a double-stranded oligonucleotide construct including a promoter gene target miRNA may be included in the nanoparticles according to the present invention.
  • the nanoparticles may be composed of nanoparticles by mixing a double-stranded oligonucleotide structure including miR-3139 and a double-stranded oligonucleotide structure including miR-8485.
  • a double-stranded oligonucleotide comprising a miRNA that promotes melanin production and promotes hair follicle proliferation through melanocyte activity other than the double-stranded oligonucleotide construct comprising the miRNA, or a double-stranded oligonucleotide construct comprising the same is provided in the present invention It may be additionally included in the composition according to the present invention.
  • the effect of promoting melanocyte activity and melanogenesis of the double-stranded oligonucleotide construct (SAMiRNA TM ) and nanoparticles containing the miRNA and the effect of improving graying was confirmed.
  • the proliferation-promoting effect of dermal papilla cells and keratinocytes present in hair follicles was confirmed.
  • the present invention can utilize the composition for pharmaceutical use and cosmetic use, wherein the pharmaceutical composition includes ointments, pastes, gels, jellies, serums, aerosol sprays, non-aerosol sprays, foams, creams, lotions, It may be characterized in that it is used in a formulation selected from formulations of solutions or suspensions, but is not limited thereto.
  • composition when using the composition as a cosmetic, but not limited thereto, hair tonic, hair conditioner, hair essence, hair lotion, hair nutrition lotion, hair shampoo, hair conditioner, hair treatment, hair cream, hair nutrition cream, hair moisture Cream, hair massage cream, hair wax, hair aerosol, hair pack, hair nutrition pack, hair soap, hair cleansing foam, hair oil, hair dryer, hair preservative, hair dye, hair wave agent, hair bleach, hair gel, hair glaze, It may be characterized in that it is used in a formulation selected from formulations of a hair dresser, a hair lacquer, a hair moisturizer, a hair mousse, or a hair spray.
  • composition of the present invention may be prepared by including one or more pharmaceutically acceptable carriers in addition to the above active ingredients.
  • a pharmaceutically acceptable carrier must be compatible with the active ingredient of the present invention, and contains saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or two or more of these components. They can be mixed and used, and other conventional additives such as antioxidants, buffers, and bacteriostats can be added as needed.
  • diluents, dispersants, surfactants, binders and lubricants may be additionally added to form an injectable formulation such as an aqueous solution, suspension, emulsion, and the like.
  • the formulation in a lyophilized form.
  • a method commonly known in the art to which the present invention pertains may be used, and a stabilizer for freeze-drying may be added.
  • it can be preferably formulated according to each disease or component using a method disclosed in Remington's Pharmaceutical Science (Mack Publishing company, Easton PA) by an appropriate method in the art or according to a component.
  • the content and administration method of the active ingredient included in the composition of the present invention can be determined by a person skilled in the art based on the number of melanocytes and the degree of functional decline of an individual, graying symptoms and the severity of the site.
  • it may be formulated in various forms such as powders, tablets, injections, ointments, and functional cosmetics, and may be provided in unit-dose or multi-dose containers, for example, sealed ampoules and bottles.
  • the formulations of functional cosmetics or external skin preparations include creams, lotions, gels, and water-soluble liquids. And it may be characterized in that it is selected from the group consisting of essence, but is not limited thereto.
  • the present invention is to improve graying of hair, promote hair growth and/or prevent or improve hair loss in subjects in need.
  • A is a hydrophilic material
  • B is a hydrophobic material
  • X and Y are each independently a simple covalent bond or a linker-mediated covalent bond
  • R is miR-3139, miR-3189, miR-3199 , or miR-8485; or
  • (iii) provides a method for improving graying of hair, promoting hair growth and/or preventing or improving hair loss, comprising administering nanoparticles comprising the double-stranded oligonucleotide structure.
  • the present invention is for improving graying of hair, promoting hair growth and/or preventing or improving hair loss.
  • A is a hydrophilic material
  • B is a hydrophobic material
  • X and Y are each independently a simple covalent bond or a linker-mediated covalent bond
  • R is miR-3139, miR-3189, miR-3199 , or miR-8485; or (iii) the use of nanoparticles comprising the double-stranded oligonucleotide construct.
  • the present invention provides (i) miR-3139, miR-3189, miR-3199, or miR- 8485;
  • A is a hydrophilic material
  • B is a hydrophobic material
  • X and Y are each independently a simple covalent bond or a linker-mediated covalent bond
  • R is miR-3139, miR-3189, miR-3199 or miR-8485; or (iii) the use of nanoparticles comprising the double-stranded oligonucleotide construct.
  • Example 1 Screening for melanogenesis promoting miRNA selection
  • a miRNA database As a human miRNA sequence of 21 versions provided by miRBase (www.mirbase.org), a miRNA database, 1728 types of miRNAs are loaded on a double-stranded oligonucleotide structure (SAMiRNA TM ) based on a stem-loop structure. was synthesized with (Table 2). All synthesized miRNA strands were determined and confirmed whether the intended sequence was synthesized using a MALDI-TOF mass spectrometer. Screening was conducted to discover miRNAs with the highest melanin production amount using 1728 miRNAs targeting human skin cancer cell lines.
  • SAMiRNA TM double-stranded oligonucleotide structure
  • miRNA of miR-3139 was prepared as follows.
  • each strand was synthesized as a sense and antisense strand.
  • miRNA of miR-3189 was prepared as follows.
  • human melanoma M21 (Korean cell line bank, KR), a human-derived skin cancer cell line, was used.
  • the M21 cell line was cultured at 37° C./5% CO 2 using DMEM medium (Hyclone, US) containing 10% Fetal Bovine Serum (FBS, Hyclone, US) and 1% Penicillin-Streptomycin (Hyclone, US). .
  • M21 cells were aliquoted in a 12 well plate (Falcon, US) at a condition of 4 ⁇ 10 4 cells/well, and the next day, using Lipofectamine RNAiMAX (Invitrogen, US), miRNA was transfected with 40 nM according to the manufacturer's protocol. .
  • Example 1-2 1728 kinds of miRNAs were repeatedly transfected into M21 cells three times. After 72 hours of culture, all cells were collected and reacted in 1M NaOH (Bioneer, KR) at 37° C. for 2 hours according to the melanin extraction protocol, and absorbance was measured under a wavelength of 405 mm to compare color change and melanin production. After 72 hours of culture, all cells were collected and reacted for 2 hours at 37° C. in 1M NaOH (Bioneer, KR) according to the melanin extraction protocol, and then the amount of melanin production was analyzed by measuring the absorbance under a wavelength of 405 mm.
  • 1M NaOH Bindioneer, KR
  • the top 9 miRNAs were treated in the M21 cell line by the method of Example 1-2. After 72 hours of culture, all cells were collected and reacted for 2 hours at 37° C. in 1M NaOH (Bioneer, KR) according to the melanin extraction protocol, and then the amount of melanin production was analyzed by measuring the absorbance under a wavelength of 405 mm.
  • the amount of melanin production in the M21 cell line treated with a total of 1728 species was 13.0 ⁇ g/ml or more (1.88 times or more compared to the negative control), and the positive control group, IBMX (Sigma, US)/CuSO 4 (Sigma, US) was similar to the treatment group.
  • IBMX Sigma, US
  • CuSO 4 Sigma, US
  • Example 2 Final sequence selection through re-evaluation and melanogenesis mechanism analysis of the selected 9 types of miRNAs
  • SK-MEL-28 (Korean cell line bank, KR), a human-derived skin cancer cell line, was used for reproducibility evaluation of the top 9 melanin production.
  • the SK-MEL-28 cell line was cultured at 37° C./5% CO 2 using MEM medium (Hyclone, US) containing 10% FBS (Hyclone, US) and 1% Penicillin-Streptomycin (Hyclone, US). .
  • SK-MEL-28 cells were aliquoted in a 12 well plate (Falcon, US) at a condition of 4 ⁇ 10 4 cells/well, and the next day, using Lipofectamine RNAiMAX (Invitrogen, US), miRNA was added to 40 nM according to the manufacturer's protocol. was transfected.
  • the group treated with miR-8485, miR-7978, miR-6074, miR-3132, miR-4644, miR-3139, miR-3189, miR-3199, or miR-933 showed distinct color changes compared to the negative control group.
  • An increase in melanogenesis was observed. It was confirmed that a significantly superior color change and increase in melanin production compared to the melanin inducer as a positive control (FIG. 3).
  • RT-qPCR analysis was performed to analyze genes such as MITF, TYR, TYRP1, TYRP2, which are important factors in the melanogenesis process, to analyze the mechanism of action of the selected top 9 miRNAs to promote melanogenesis.
  • the SK-MEL-28 cell line was aliquoted in a 12 well plate (Falcon, US) at 4 ⁇ 10 4 cells/well, and then cultured at 37° C./5% CO 2 condition. The next day, miR-8485, miR-7978, miR-6074, miR-3132, miR-4644, miR-3139, miR-3189, miR-3199, or miR- 933 was repeated 3 times, respectively, and the transfection was performed.
  • the mRNA expression levels of the above genes (Human qPCR panel kit, Bioneer, KR) and RPL13A (Human reference qPCR primer set, Bioneer, KR) were measured using GreenStar TM RT-qPCR Master Mix (Bioneer, KR) according to the manufacturer's protocol. It was analyzed by qRT-PCR.
  • the Ct values of the two genes derived after qPCR array were calculated as 2(- Delta Delta C(T)) Method [Livak KJ, Schmittgen TD. 2001. Methods. Dec;25(4):4 02-8], the relative amount (fold change) of each gene mRNA in the experimental group compared to the control group was calculated through relative quantitative analysis.
  • the primer sequences for each gene are as follows (Table 4).
  • MITF MITF
  • TYR TYR
  • TYRP1 TYRP2
  • TYRP2 TYRP2
  • human epidermal melanocytes obtained from normal human skin tissue.
  • Human Epidermal Melanocytes (Invitrogen, US) cells were seeded in a 12 well plate (Falcon, US) at 1 ⁇ 10 5 cells/well, and mammalian cell culture/primary cells containing human melanocyte growth supplement-2 (Gibco, US) culture (Gibco, US) at 37° C./5% CO 2 Conditions were incubated.
  • miR-8485, miR-7978, miR-6074, miR-3132, miR-4644, miR-3139, miR-3189, miR-3199 or miR-933 were each treated at a concentration of 5 ⁇ M.
  • the mRNA expression levels of the above genes (Human qPCR panel kit, Bioneer, KR) and RPL13A (Human reference qPCR primer set, Bioneer, KR) were measured using GreenStar TM RT-qPCR Master Mix (Bioneer, KR) according to the manufacturer's protocol. It was analyzed by qRT-PCR.
  • the gene expression of MITF was negative by miR-8485, miR-7978, miR-3139, miR-3189, miR-3199, and miR-933, unlike the M21 result of melanoma cells. It was confirmed that the increase was about 1.2 to 1.7 times compared to that. In addition, in the case of TYR, it was confirmed that it was increased by about 1.2 to 3.1 times by 9 types of miRNAs. In the case of TYRP1 and TYRP2, differences in expression patterns were observed for each of the nine miRNA sequences.
  • SK-MEL-28 cell line was aliquoted at 1 ⁇ 10 5 cells/well in a 6 well plate (Falcon, US) and cultured at 37° C./5% CO 2 condition. The next day, by the method of Example 2-1, SK-MEL-28 cells were transfected with miR-3139, miR-3189, miR-3199, or miR-8485, respectively. After 96 hours of incubation, analysis was performed according to the Western blot protocol.
  • MITF As the primary antibody, MITF (Santa Cruz Biotechnology, Inc, US) and Tyrosinase (Santa Cruz Biotechnology, Inc, US) were used, and as the secondary antibody, HRP-linked-anti-mouse IgG (Cell Signaling Technology, US) and HRP- Linked-anti-rabbit IgG (Cell Signaling Technology, US) was used.
  • MITF and TYR proteins were increased by 9 types of miRNAs similar to the above RT-qPCR results (FIG. 6).
  • the miR with the highest melanin synthesis and clear gene and protein expression of MITF, TYR, and TYRP1/2 by synthesizing the results of cell color change, melanin synthesis, and major gene and protein expression in the process of melanin production by treatment of selected top 9 miRNAs
  • Four types of -3139, miR-3189, miR-3199, and miR-8485 were finally selected (Table 5).
  • Example 3 Efficacy evaluation of the final selected 4 types of miRNAs in human hair
  • Example 4 Evaluation of the melanogenesis promoting efficacy of SAMiRNA-miR-3199 in SK-MEL-28 cells
  • SK-MEL-28 human-derived skin cancer cell line
  • the SK-MEL-28 cell line was cultured at 37° C./5% CO 2 using MEM medium (Hyclone, US) containing 10% FBS (Hyclone, US) and 1% Penicillin-Streptomycin (Hyclone, US).
  • SK-MEL-28 cells were aliquoted in a 12 well plate (Falcon, US) at a condition of 4 ⁇ 104 cells/well, and treated with a concentration of 5 ⁇ M the next day.
  • SK-MEL-28 cells were treated with SAMiRNA-miR-3199. After culturing for 72 hours, all cells were collected and observed for color change, and after reacting in 1M NaOH (Bioneer, KR) at 37°C for 2 hours according to the melanin extraction protocol to measure melanin production, absorbance was measured under a wavelength of 405 mm. The amount of melanin production was analyzed.
  • RT-qPCR analysis was performed for gene analysis of melanogenesis-related genes MITF, TYR, TYRP1, and TYRP2 following SAMiRNA-miR-3199 treatment.
  • SAMiRNA-miR-3199 was treated in the SK-MEL-28 cell line by the method of Example 4-1.
  • the mRNA expression levels of the above genes (Human qPCR panel kit, Bioneer, KR) and RPL13A (Human reference qPCR primer set, Bioneer, KR) were measured using GreenStar TM RT-qPCR Master Mix (Bioneer, KR) according to the manufacturer's protocol. It was analyzed by qRT-PCR.
  • the Ct values of the two genes derived after qPCR array were calculated as 2(- Delta Delta C(T)) Method [Livak KJ, Schmittgen TD. 2001. Methods. Dec;25(4):4 02-8], the relative amount (fold change) of each gene mRNA in the experimental group compared to the control group was calculated through relative quantitative analysis.
  • MITF a key transcription factor for melanin synthesis
  • SK-MEL-28 cell line was aliquoted at 1 ⁇ 10 5 cells/well in a 6 well plate (Falcon, US) and cultured at 37° C./5% CO 2 condition. The next day, SK-MEL-28 cell line was treated with 5 ⁇ M SAMiRNA-miR-3199. After 96 hours of incubation, analysis was performed according to the immunoblot protocol.
  • MITF Synerg., Santa Cruz Biotechnology, Inc, US
  • Tyrosinase Santa Cruz Biotechnology, Inc, US
  • ⁇ -Tubulin Cell Signaling Technology, US
  • HRP-linked-anti-mouse IgG (Cell Signaling Technology, US) and HRP-linked-anti-rabbit IgG (Cell Signaling Technology, US) were used.
  • MITF and TYR proteins which are key factors for melanogenesis
  • immunocytochemistry analysis was performed. Before cell dispensing, put a cover glass in a 12 well plate (Falcon, US) and coat with Poly-L-lysine for 1 hour. Then, the SK-MEL-28 cell line was dispensed at 2 ⁇ 10 4 cells/well at 37°C/ Incubated under 5% CO 2 conditions. The next day, the SK-MEL-28 cell line was treated with SAMiRNA-miR-3199 by the method of Example 4-1.
  • the GSK3 ⁇ gene a key regulator of the major signaling pathway of the melanogenesis mechanism was selected. Binding of miR-3199 to 4153-4159 of the 3' UTR of GSK3 ⁇ was predicted (FIG. 10a).
  • RT-qPCR analysis was performed to analyze the GSK3 ⁇ mRNA inhibitory ability of SAMiRNA-miR-3199.
  • the SK-MEL-28 cell line was aliquoted in a 12 well plate (Falcon, US) at 4 ⁇ 10 4 cells/well, and then cultured at 37° C./5% CO 2 condition. The next day, the SK-MEL-28 cell line was treated with SAMiRNA-miR-3199 by the method of Example 4-1. After culturing for 24 hours, total RNA was extracted from the cell lysate using the Universal RNA extraction kit (Bioneer, KR), and the RNA was used as a template for AccuPower .
  • the mRNA expression levels of GSK3 ⁇ (Bioneer, KR) and RPL13A (Human reference qPCR primer set, Bioneer, KR) were analyzed by qRT-PCR using GreenStar TM RT-qPCR Master Mix (Bioneer, KR) according to the manufacturer's protocol. .
  • the Ct values of the two genes derived after qPCR array were calculated as 2(- Delta Delta C(T)) Method [Livak KJ, Schmittgen TD. 2001. Methods. Dec;25(4):4 02-8], the relative amount (fold change) of each gene mRNA in the experimental group compared to the control group was calculated through relative quantitative analysis.
  • the primer sequences for GSK3 ⁇ are as follows (Table 6).
  • the SK-MEL-28 cell line was aliquoted in a 6-well plate (Falcon, US) at 1 ⁇ 10 5 cells/well and then cultured at 37° C./5% CO 2 condition.
  • SAMiRNA-miR-3199 was treated in the SK-MEL-28 cell line by the method of Example 4-1. After 96 hours of incubation, analysis was performed according to the immunoblot protocol.
  • GSK3 ⁇ Cell Signaling Technology, Inc, US
  • ⁇ -catenin Becton, Dickinson and Company Inc, US
  • ⁇ -Tubulin Cell Signaling Technology, US
  • HRP-linked- Anti-mouse IgG Cell Signaling Technology, US
  • HRP-linked-anti-rabbit IgG Cell Signaling Technology, US
  • GSK3 ⁇ protein was decreased by SAMiRNA-miR-3199 treatment, as in the result of GSK3 ⁇ gene expression analysis through RT-qPCR.
  • GSK3 ⁇ phosphorylates ⁇ -catenin to promote protein degradation, thereby lowering protein stability.
  • ⁇ -catenin protein stability increases and protein increases. Therefore, it was confirmed that the ⁇ -catenin protein was increased by the SAMiRNA-miR-3199 treatment (FIG. 10c).
  • Immunocytochemistry was performed to analyze the intracellular GSK3 ⁇ protein expression pattern following SAMiRNA-miR-3199 treatment. Before cell dispensing, put a cover glass in a 12 well plate (Falcon, US) and coat with Poly-L-lysine for 1 hour. Then, the SK-MEL-28 cell line was dispensed at 2 ⁇ 10 4 cells/well at 37°C/ Incubated under 5% CO2 conditions. The next day, the SK-MEL-28 cell line was treated with SAMiRNA-miR-3199 by the method of Example 4-1.
  • a luciferase reporter assay was performed.
  • the SK-MEL-28 cell line was seeded in a 12 well plate (Falcon, US) at 3 ⁇ 10 4 cells/well and then cultured at 37°C/5% CO2 condition. The next day, in the SK-MEL-28 cell line, GSK3 ⁇ -wild type (WT) in which the GSK3 ⁇ binding site is normal or GSK3 ⁇ -mutant (MT) in which the GSK3 ⁇ binding site is mutated (non-binding form) was inserted into Lipofectamine RNAiMAX (Invitrogen, US) ) was used for transfection.
  • WT GSK3 ⁇ -wild type
  • MT GSK3 ⁇ -mutant
  • Example 6 Evaluation of the melanogenesis promoting efficacy of SAMiRNA-miR-3199 in human melanocytes
  • 6-1 Cell culture and treatment of SAMiRNA-miR-3199
  • HEMs Human Epidermal Melanocytes obtained from normal human skin tissues were used. HEMs were cultured in a mammalian cell culture/primary cell culture medium (Gibco, US) containing melanocyte growth supplement-2 (Gibco, US) at 37° C./5% CO 2 conditions. HEMs were aliquoted in a 12 well plate (Falcon, US) at the condition of 1 ⁇ 10 5 cells/well, and the next day, SAMiRNA-miR-3199 was treated at a concentration of 5 ⁇ M.
  • HEMs were treated with SAMiRNA-miR-3199 at a concentration of 5 ⁇ M. After culturing for 72 hours, all cells were collected and observed for color change, and after reacting for 2 hours at 37°C in 1M NaOH (Bioneer, KR) according to the melanin extraction protocol to measure melanin production, absorbance was measured under a wavelength of 405 mm. The amount of melanin production was analyzed.
  • RT-qPCR analysis was performed to analyze genes such as MITF, TYR, TYRP1, TYRP2, and GSK3 ⁇ . HEMs were treated with SAMiRNA-miR-3199 in the method of Example 6-1.
  • RNA expression levels of the above genes Human qPCR panel kit, Bioneer, KR
  • RPL13A Human reference qPCR primer set, Bioneer, KR
  • the Ct values of the two genes derived after qPCR array were calculated as 2(- Delta Delta C(T)) Method [Livak KJ, Schmittgen TD. 2001. Methods. Dec;25(4):4 02-8], the relative amount (fold change) of each gene mRNA in the experimental group compared to the control group was calculated through relative quantitative analysis.
  • Immunoblot was performed to analyze MITF and TYR protein expression changes by SAMiRNA-miR-3199 treatment.
  • HEMs were aliquoted in a 6-well plate (Falcon, US) at 2 ⁇ 10 5 cells/well and then cultured at 37° C./5% CO 2 condition. HEMs were treated with SAMiRNA-miR-3199 in the method of Example 6-1. After 96 hours of incubation, analysis was performed according to the immunoblot protocol.
  • MITF Synerg., Santa Cruz Biotechnology, Inc, US
  • Tyrosinase Santa Cruz Biotechnology, Inc, US
  • ⁇ -Tubulin Cell Signaling Technology, US
  • HRP-linked-anti-mouse IgG (Cell Signaling Technology, US) was used.
  • Example 7 Evaluation of cytotoxicity and innate immunotoxicity of SAMiRNA-miR-3199
  • HFDPC human dermal papilla cells
  • Promocell DE
  • keratinocytes HaCaT ATCC, US
  • human epidermal melanocytes Human Epidermal Melanocytes, Invitrogen, US
  • HFDPC 3 ⁇ 10 3 cells/well HFDPC 3 ⁇ 10 3 cells/well
  • HaCaT 4 ⁇ 10 3 cells/well HEMs 5 ⁇ 10 3 cells/well were dispensed and cultured at 37°C/5% CO 2 conditions.
  • each cell was treated with SAMiRNA-miR-3199 at different concentrations (0, 1, 5, 10, 20, ⁇ M).
  • the WST assay kit DOGEN, KR
  • PBMC peripheral blood mononuclear cells
  • Falcon Cellular Technology Limited
  • SAMiRNA-miR-3199 was treated with different concentrations (0, 5, 10, 20 ⁇ M).
  • total RNA was extracted from the cell lysate using the Universal RNA extraction kit (Bioneer, KR), and the RNA was used as a template using AccuPower GreenStarTM RT-qPCR Master Mix (Bioneer, KR) from the manufacturer.
  • mRNA expression levels of inflammatory cytokine genes (Human Immune qPCR panel kit, Bioneer, KR) and RPL13A (Human reference qPCR primer set, Bioneer, KR) were analyzed by qRT-PCR.
  • the primer sequences for each gene are as follows (Table 7).
  • the double-stranded oligonucleotide construct prepared in the present invention has a structure as shown in the following structural formula (5).
  • S is the sense strand of miRNA
  • AS is the antisense strand of miRNA
  • PO 4 is a phosphate group
  • polyethylene glycol is a hydrophilic material monomer
  • polyethylene glycol 2000 is a linker phosphate group (PO 3 - ) is bonded through
  • C 24 is a hydrophobic material and contains a disulfide bond
  • 5' and 3' refer to the terminal direction of the double-stranded oligo RNA.
  • the sense strand of miRNA in Structural Formula (5) uses DMT-polyethylene glycol 2000-CPG as a support and ⁇ cyanoethylphosphoamidite is used to connect the phosphodiester bonds constituting the RNA backbone structure.
  • DMT-polyethylene glycol 2000-CPG DMT-polyethylene glycol 2000-CPG
  • ⁇ cyanoethylphosphoamidite is used to connect the phosphodiester bonds constituting the RNA backbone structure.
  • the antisense strand of the sequence complementary to the sense strand is obtained by linking the phosphodiester bond constituting the RNA backbone structure using ⁇ -cyanoethylphosphoamidite. After preparation, an antisense strand having a phosphate group bonded to the 5' end was prepared.
  • the composition according to the present invention activates melanin-forming cells and promotes the production of melanin to prevent graying of the hair and slow down the progress thereof, and it is possible to improve the hair that has already been grayed out to the state of the hair before graying, , it can be usefully used as a pharmaceutical, cosmetics, or hair dye composition without side effects differentiated from simple dyes that have been repeatedly used to hide graying and whitening of conventional hair. In addition, it can be usefully utilized as a pharmaceutical and cosmetic composition capable of inducing alopecia relief and hair growth promotion without side effects by promoting the proliferation of dermal papilla cells and keratinocytes present in the hair follicles along with melanin-producing cell activity.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Dermatology (AREA)
  • Biotechnology (AREA)
  • Nanotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Birds (AREA)
  • Botany (AREA)
  • Optics & Photonics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Cosmetics (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 이중가닥 miRNA를 유효성분으로 포함하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 조성물에 관한 것으로, 더욱 상세하게는 이중가닥 miRNA인 miR-3139, miR-3189, miR-3199 또는 miR-8485; 이를 포함하는 이중가닥 올리고뉴클레오티드 구조체; 또는 상기 구조체를 포함하는 나노입자를 유효성분으로 포함하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 약학적 또는 화장료 조성물에 관한 것이다. 본 발명에 따른 조성물은 멜라닌 형성 세포를 활성화시키고 멜라닌의 생성을 촉진하여 모발의 회백색화를 예방하고 그 진행 속도를 늦출 수 있으며, 이미 회백색화가 진행된 모발을 회백색화 이전의 모발 상태로 개선할 수 있다. 또한 멜라닌 생성 세포 활성과 더불어 모낭에 존재하는 모유두 세포 및 각질형성세포 증식 촉진, 외모근소 발달 및 모발 성장을 유도하여 발모 촉진 및/또는 탈모의 예방효과를 나타낼 수 있다.

Description

이중가닥 MIRNA를 유효성분으로 포함하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 조성물
본 발명은 이중가닥 miRNA를 유효성분으로 포함하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 조성물에 관한 것으로, 더욱 상세하게는 이중가닥 miRNA인 miR-3139, miR-3189, miR-3199 또는 miR-8485; 이를 포함하는 이중가닥 올리고뉴클레오티드 구조체; 또는 상기 구조체를 포함하는 나노입자를 유효성분으로 포함하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 약학적 또는 화장료 조성물에 관한 것이다.
인간 모발의 회백색화(Hair greying)는 생리적 노화의 한 현상으로, 모낭(hair follicle)의 멜라닌 형성 세포(melanocyte) 또는 줄기세포(melanocyte stem cell)의 기능 저하 및 고갈에 의한 멜라닌 색소(melanin pigment)의 감소에 의해 유발되는 것으로 알려져 있다. 멜라닌 색소는 모발의 색상을 결정하는 중요한 인자로써, 멜라닌 세포 내에 존재하는 멜라닌 소체(melanosome)에서 멜라닌이 합성되어 분비되고, 근접한 각질형성세포(keratinocyte), 섬유아세포(fibroblast) 등에 전달된 후, 모발의 성장과 함께 이동하여 모발의 색을 유지하게 된다. 현재 모발 회백색화의 해결방안으로는 단순 염색시술이 사용되고 있으나, 염색은 일시적인 방법으로 흰 머리카락의 성장에 의해 재염색이 필수적이고, 모발 염색약의 염료 속에 포함된 성분에는 두피 및 모낭에 자극을 주거나 알러지 또는 피부염을 일으키는 등 다양한 부작용이 존재한다. 현재 멜라닌 색소 생성 조절에 관련된 연구는 유전적 요인, 노화, 호르몬, 성장인자, 자외선 등 다양한 요인들에 의해 발생하는 피부의 멜라닌 과유발에 의한 색소침착 등의 증상들을 억제하여 피부 미백 효과를 나타내는 물질개발 및 작용기전 규명에 한정되어 있다. 반대로 모발의 회백색화 또는 멜라닌 합성 저하 극복을 위한 멜라닌 생성 촉진에 관련된 작용기전 및 물질 개발에 대한 연구는 거의 진행되고 있지 않다. 또한 멜라닌 생성(melanogenesis)은 다양한 신호(SCF-KIT-RAS-ERK 신호경로, MC1R-cAMP-PKA 신호경로, Wnt-β-catenin 신호경로)들의 상호작용에 의해 조절되는데, 이러한 복잡한 작용기전 때문에 모발의 회백색화를 방지하거나 개선하기 위한 작용기전 규명 및 신규물질의 개발이 용이하지 않은 실정이다.
최근 중년남성에서 주로 발병하여 남성들의 유전적 질환으로 여겨지던 남성형 탈모증(androgenetic alopecia, AGA)은 심각한 환경오염, 스트레스, 식생활 변화, 인구의 급격한 노령화로 인해 젊은 남성들 뿐만 아니라 여성들에게도 보편적으로 발생하고 있으며 탈모에 대한 관심이 높아지면서 탈모시장이 급속하게 성장하고 있다. 유전적 요인, 남성 호르몬, 노화, 혈액순환장애 등 다양한 요인들에 의해 탈모가 유발되는 것으로 알려져 있고, 남성호르몬(androgen)인 Dihydrotestosterone (DHT) 생성을 억제하는 피나스테리드(finasteride)와 혈관확장 및 혈액순환을 개선시키는 미녹시딜(minoxidil) 만이 현재 허가 받은 치료제이다. 하지만 이들 약물은 투여용법 및 용량에 따라 일시적이고 제한된 효능을 가지면서, 다양한 부작용이 수반되고 있어, 부작용 없이 모발성장 촉진을 위한 모낭세포의 활성화 및 세포증식을 유도하는 새로운 개념의 물질개발이 요구되고 있다.
모발 성장주기(hair cycle)는 3단계로 구성되는데, 모발이 가장 활발하게 성장하는 성장기(anagen), 성장이 멈추고 모발의 퇴화가 시작되는 퇴화기(categen), 그리고 모낭의 활동성이 정지된 상태인 휴지기(telogen)로 분류되고, 탈모란 성장주기에 따라서 성장을 멈춘 모발이 자연스럽게 빠지는 것을 말하며, 다양한 인자들이 작용함으로써 탈모를 유발하는 것으로 알려져 있다. 탈모증상 완화를 위한 약물 개발이 오랫동안 이루어져 왔지만 경구용 탈모치료제인 피나스테리드와 바르는 탈모치료제인 미녹시딜 외에는 전무한 실정이다. 하지만 남성호르몬 생성 억제 기전을 통해 탈모증상 완화를 유도하기 때문에 효능의 한계 및 부작용이 수반되고 있다. 따라서 부작용 없이 효능을 나타내는 새로운 기전 및 전략을 가진 물질 개발이 필요하다. 모낭세포(hair follicle cell)의 활성화 및 증식을 촉진하여 휴지기의 모발을 성장기로 빠르게 전환을 유도하는 것은 탈모치료제 개발의 중요한 전략 중 하나이다. 따라서 모발성장 촉진을 위한 모낭세포의 활성화 및 세포증식을 유도하는 새로운 개념의 물질개발이 요구되고 있다.
유전자의 발현을 억제하는 기술은 질병치료를 위한 치료제 개발 및 표적검증에서 중요한 도구이고, 기존의 전통적인 약물 치료 방법의 한계점을 극복하기 위해 다양한 방면으로 개발이 진행되었는데, 그 중 하나가 간섭 RNA (RNA interference, 이하 RNAi로 표기)의 이용이다(Iorns, E., Lord, C.J., Turner, N. & Ashworth, A., Nat Rev Drug Discov 6, 556-68. 2007.). RNAi는 유전자 발현을 억제하기 위해 사용되는 방법으로 간편하면서 적은 비용으로 유전자 억제 효과를 뚜렷하게 볼 수 있기 때문에 그 기술의 응용 분야가 다양해지고 있다. siRNA는 16에서 27사이의 뉴클레오티드로 구성된 단일 가닥 RNA로서, 세포 내에서 리스크(RNA Induced Silencing Complex, RISC)라 알려진 리보핵산단백질 결합체(ribonucleoprotein)의 구성 성분으로서 활동을 한다. RISC는 RNA 효소 가위로서 기능을 하는데, 메신저 RNA (messenger RNA, 이하 mRNA로 표기)를 절단하여 mRNA로부터 단백질이 생성되는 것을 저해한다. RISC에 포함된 siRNA는 siRNA 서열과 상보적인 서열을 갖는 mRNA와 결합하여 이중가닥 RNA를 형성하고, RISC는 RNA 효소 가위로 작용하여 목표가 되는 mRNA를 절단하여 mRNA가 더 이상 단백질을 반복 생성하는 주형(template)으로서의 기능을 수행할 수 없도록 한다.
이처럼 RNAi 기반의 치료제는 단백질 생성 단계 이전의 mRNA를 차단한다는 점, 그리고 RNA 와 세포 내재적인 RISC 시스템을 활용한다는 점에 있어서 상기 단분자 물질의 치료제보다 진보한 기술로 평가되나, siRNA 기반의 기술로도 해결하지 못하는 부작용이 있는데, 이는 비표적 효과(off-target effect)로 불리는 현상이다. 상기 기술한 바와 같이 siRNA 서열과 상보적으로 결합하는 mRNA를 분해하는데, siRNA 서열 전체와 상보적이지 않고 일부분만 상보적인 mRNA와도 결합하여 분해를 유발하는데 이를 표적이 아닌 mRNA의 분해를 유발한다 하여 비표적 효과라 불린다.
상기 기술된 RNAi 기반 치료제의 기술적 난점을 극복하기 위하여 마이크로 RNA (microRNA, 이하 miRNA로 표기)를 치료제로 사용하려는 연구가 활발히 진행 중이다(Agostini, M. & Knight, R.A., Oncotarget 5, 872-81, 2014; Dangwal, S. &Thum, T., Annu Rev PharmacolToxicol 54, 185-203, 2014.). miRNA는 16에서 27사이의 뉴클레오티드로 구성된 RNA로서 단백질로 번역되는 메신저 RNA에 대비하여 단백질 비생성 RNA (protein non-coding RNA)로 분류된다(Carthew, R.W. &Sontheimer, E.J., Cell 136, 642-55, 2009; MacFarlane, L.-A. & Murphy, P.R., Current Genomics 11, 537-561, 2010; Bartel, D.P., Cell 136, 215-33, 2009.). miRNA는 고등 동식물 세포의 유전체에 기록되어 있으며 세포의 생성, 성장, 분화, 사멸을 포함한 세포의 대사 및 기능을 조절하는데 핵심적인 역할을 하는 것으로 알려져 있다. 현재까지 인간의 유전체에서는 2000 여종의 miRNA가 알려져 있으며 이 중 상당수의 miRNA의 기능은 아직 알려져 있지 않다.
miRNA는 유전체로부터 Pol II라 불리는 RNA 폴리머라제(polymerase)에 의해 RNA로 전사되는데, 초기 길이는 특정할 수 없이 다양하다(Carthew, R.W. &Sontheimer, E.J., Cell 136, 642-55, 2009; Brodersen, P. &Voinnet, O., Nat Rev Mol Cell Biol 10, 141-148, 2009.). 이는 miRNA가 유전체에 포함된 위치의 다양성에 기인하는데, mRNA의 단백질 생성 비관여 부분인 인트론(intron)에 위치하여 mRNA 생성 동일 시점에 전사되는 경우 및 유전체상에서 유전자간 빈 공간(inter-genic region)에 위치하여 독자적으로 전사되는 경우 등 다양한 방식으로 생성되기 때문이다(Malone, C.D. & Hannon, G.J., Cell 136, 656-68, 2009.). 이와 같이 초기에 생성된 miRNA 모체를 일차 miR (primary microRNA)라 하는데, 일차 miRNA는 핵 속의 드로셔(Drosha)라 불리는 RNA 절단 효소(RNase) 등에 의하여 전구체 miRNA (precursor miRNA, 이하 pre-miR로 표기)로 편집된다(Bartel, D.P., Cell 136, 215-33, 2009.). Pre-miR는 RNA 헤어핀 구조(RNA hair-pin structure)를 이루며 대략 70-80개의 뉴클레오티드로 구성된다. 세포 핵 내부의 Pre-miR는 exportin 단백질 등에 의해 핵에서 세포질로 이동되며, 세포질 내에서 다이서(Dicer)라 불리는 또 다른 RNA 절단 효소에 의하여 이차 가공이 되어 16-27개의 뉴클레오티드로 구성되는 이중가닥의 성숙 miRNA (mature microRNA, 이하 다른 수식어 없이 miR로 기술하는 경우는 성숙 miR를 의미함)를 생성한다. 이중가닥 miR 중 한 가닥의 RNA가 선택적으로 선정되어 상기 리보핵산단백질 결합체인 RISC와 결합하여 활성을 가지게 되고, miR의 서열을 이용하여 목표 mRNA와 결합한다.
일반적으로 mRNA는 단백질 생성 관여 여부를 기준으로 크게 세 부분으로 나눌 수 있는데, 단백질 번역 정보를 담고 있는 코딩 부분(coding region)과 코딩 부분의 각각 5' 과 3' 부분으로서 단백질 번역 정보를 가지지 않는 5'-UTR (Un-Translated Region)과 3'-UTR로 구분할 수 있다. mRNA와의 상보적 서열을 이용, 목표 mRNA의 분해를 유발하는 siRNA는 mRNA의 5'-, 3'-UTR 및 코딩 부분에 상관없이 작용을 하는 반면, miR는 주로 3'-UTR과 결합을 한다(Carthew, R.W. &Sontheimer, E.J., Cell 136, 642-55, 2009; Bartel, D.P., Cell 136, 215-33, 2009.). mRNA와의 결합 위치 차이와 더불어 siRNA와 다른 miRNA의 독특한 특징은 siRNA는 siRNA 전체 서열과 상보적인 서열을 포함한 mRNA와 주로 결합하는 반면, miRNA는 miRNA의 5' 끝으로부터 2-8 뉴클레오티드 자리에 위치한, 한정된 크기의 씨앗부분(seed region)서열이 주로 목표 mRNA 인식에 사용되는 점이 다르며, 따라서 전체 miRNA의 서열이 목표 유전자와 완벽한 상보적인 서열을 가지지 않고 일정 부분 비상보적 서열이 포함되어도 miRNA 활성에 영향을 주지 않는다(Bartel, D.P., Cell 136, 215-33, 2009.). 씨앗 부분의 서열 크기가 6-8 뉴클레오티드인 만큼 이와 상보적인 서열을 3' UTR에 가지는 mRNA 종류는 다양하며, 이러한 이유로 한 종의 miRNA로 여러 종의 mRNA를 동시에 제어할 수 있다. 이러한 miRNA의 성질은 miRNA가 세포의 분열, 성장, 분화, 사멸에 이르는 많은 부분의 세포 생리학적 측면의 제어에 관여하는 효율적인 조절인자(regulator)로서의 기능을 가진다. 또한, 조절인자로서의 miRNA의 기능은 다양한 질병에 효과적으로 적용할 수 있는 것이 장점으로서 작용하는데, siRNA의 경우 단일 유전자 발현의 억제를 목표로 하는데 반하여, miRNA는 다양한 신호전달경로에 관여하는 유전자 다수의 발현을 동시에 저해할 수 있기 때문이다. 많은 수의 mRNA가 3' UTR에 한 종 이상의 miRNA가 결합할 가능성이 있는 부분을 포함하고 있으며, 한 생물정보학적인 계산에 따르면 전체 mRNA의 대략 30%가 miRNA에 의해 단백질 생성이 조절되고 있는 것으로 알려져 있다.
miRNA 또는 siRNA의 뛰어난 효과 및 다양한 사용범위에도 불구하고, miRNA/siRNA가 치료제로 개발되기 위해서는 체내에서의 miRNA/siRNA의 안정성(stability) 개선과 세포 전달 효율 개선을 통해 miRNA/siRNA가 타겟 세포에 효과적으로 전달되어야 한다(FY Xie., Drug Discov. Today. 2006 Jan; 11(1-2):67-73). 체내 안정성 향상 및 miRNA/siRNA의 비특이적인 선천면역반응(innate immune stimulation) 문제 해결을 위하여 miRNA/siRNA의 일부 뉴클레오티드 또는 골격(backbone)을 핵산분해효소 저항성을 가지도록 변형(modification)하거나 바이러스성 벡터(viral vector), 리포좀 또는 나노입자(nanoparticle) 등의 전달체를 이용하는 등, 이에 대한 연구가 활발하게 시도되고 있다. 아데노바이러스나 레트로바이러스 등의 바이러스성 벡터를 이용한 전달 시스템은 형질주입 효율(transfection efficacy)이 높지만, 면역원성(immunogenicity) 및 발암성(oncogenicity)이 높다. 반면에 나노입자(nanoparticle)를 포함하는 비바이러스성(non-viral) 전달 시스템은 바이러스성 전달 시스템에 비하여 세포전달효율은 낮은 편이지만, 생체 내(in vivo)에서의 안정성(stability)이 높고, 타겟 특이적으로 전달이 가능하며, 내포되어 있는 RNAi 올리고 뉴클레오타이드를 세포 또는 조직으로 흡수(uptake) 및 내재화(internalization)하고, 세포독성 및 선천면역유발이 거의 없다는 장점을 가지고 있어, 현재는 바이러스성 전달 시스템에 비해 유력한 전달방법으로 평가되고 있다(Akhtar S, J Clin Invest. 2007 December 3; 117(12): 3623-3632).
비바이러스성 전달 시스템 중에서 나노전달체(nanocarrier)를 이용하는 방법은 리포좀, 양이온 고분자 복합체 등의 다양한 고분자를 사용함으로써 나노입자를 형성하고, miRNA/siRNA를 이러한 나노입자, 즉 나노전달체(nanocarrier)에 담지하여 세포에 전달하는 방법이다. 나노전달체를 이용하는 방법 중 주로 활용되는 방법은 고분자 나노입자(polymeric nanoparticle), 고분자 미셀(polymer micelle), 리포플렉스(lipoplex) 등이 있는데, 이 중에서 리포플렉스를 이용한 방법은 양이온성 지질로 구성되어 세포의 엔도좀(endosome)의 음이온성 지질과 상호작용하여 엔도좀의 탈 안정화 효과를 유발하여 세포 내로 전달하는 역할을 한다. 또한, miRNA/siRNA 센스(sense; 패신저(passenger)) 가닥의 말단 부위에 화학물질 등을 연결하여 증진된 약동력학(pharmacokinetics)적 특징을 갖도록 하여 생체 내(in vivo)에서 높은 효율을 유도할 수 있다는 것이 알려져 있다(J Soutschek, Nature 11; 432(7014):173-8, 2004). 이 때 miRNA/siRNA 센스 또는 안티센스(antisense; 가이드(guide)) 가닥의 말단에 결합된 화학 물질의 성질에 따라 miRNA/siRNA의 안정성이 달라진다.
예를 들어, 폴리에틸렌 글리콜(polyethylene glycol, PEG)과 같은 고분자 화합물이 접합된 형태의 siRNA는 양이온성 물질이 존재하는 조건에서 miRNA/siRNA의 음이온성 인산기와 상호작용하여 복합체를 형성함으로써, 개선된 miRNA/siRNA 안정성을 가진 전달체가 된다(SH Kim, J Control Release 129(2):107-16, 2008). 특히 고분자 복합체로 구성된 미셀(micelle)들은 약물 전달 운반체로 쓰이는 다른 시스템인, 미소구체(microsphere) 또는 나노입자 등에 비해 그 크기가 극히 작으면서도 분포가 매우 일정하고, 자발적으로 형성되는 구조이므로 제제의 품질 관리 및 재현성 확보가 용이하다는 장점이 있다. miRNA/siRNA의 세포 내 전달 효율성을 향상시키기 위해, miRNA/siRNA에 생체 적합성 고분자인 친수성 물질(예를 들면, 폴리에틸렌 글리콜을 단순 공유결합 또는 링커-매개(linker-mediated) 공유결합으로 접합시킨 miRNA/siRNA 접합체를 통해 안정성 확보 및 효율적인 세포막 투과성을 위한 기술이 개발되었다(대한민국 등록특허 제883471호).
하지만 miRNA/siRNA의 화학적 변형 및 폴리에틸렌 글리콜을 접합시키는 것(PEGylation)만으로는 생체 내에서의 낮은 안정성과 표적 장기로의 전달이 원활하지 못하다는 단점은 여전히 가진다. 이러한 단점을 해결하기 위하여 이중가닥 올리고뉴클레오티드, 특히 miRNA/siRNA와 같은 이중가닥 올리고 RNA에 친수성 및 소수성 물질이 결합된 이중가닥 올리고뉴클레오티드 구조체가 개발되었는데, 상기 구조체는 소수성 물질의 소수성 상호작용에 의하여 SAMiRNATM (self-assembled micelle inhibitory RNA) 라고 명명된 자가조립 나노입자를 형성하게 되는데(대한민국 등록 특허 제1224828호), SAMiRNATM기술은 기존의 전달기술들에 비해 매우 사이즈가 작으면서도 균일한(homogenous) 나노입자를 수득할 수 있다는 장점을 가진다. 　　
SAMiRNATM 기술의 구체적인 예로서, 친수성 물질로서 PEG 또는 HEG (Hexaethylenglycol)가 사용되는데, PEG는 합성 폴리머(synthetic polymer)로 흔히 의약품 특히 단백질의 수용성(solubility) 증가 및 약물동태학의 조절을 위해 사용된다. PEG는 다분산계(polydisperse) 물질로, 한 배치(batch)의 폴리머는 다른 개수의 단량체(monomer)의 총 합으로 이루어져 분자량이 가우스 곡선 형태를 나타내며, 다분산지수(polydisperse value, Mw/Mn)로 물질의 동질성 정도를 표현한다. 즉, PEG가 낮은 분자량(3~5kDa)일 때 약 1.01의 다분산지수를 나타내며 높은 분자량(20 kDa)일 때 약 1.2라는 높은 다분산지수를 나타내어, 높은 분자량일수록 물질의 동질성이 상대적으로 낮은 특징을 보인다. 따라서, PEG를 의약품에 결합시킨 경우 접합체에 PEG의 다분산적 특징이 반영되어 단일물질의 검증이 쉽지 않다는 단점이 있어 PEG의 합성 및 정제과정의 개선을 통해 낮은 다분산지수를 가지는 물질을 생산하는 추세이지만, 특히 분자량이 작은 물질에 PEG를 결합시킨 경우 결합이 용이하게 이루어졌는지 확인이 용이하지 않은 불편한 점이 있는 등 물질의 다분산성 특징에 따른 문제점 들이 존재한다(Francesco M. VDRUG DISCOVERY TODAY(2005) 10(21):1451-1458). 이에 따라 최근에는 기존 자가조립 나노입자인 SAMiRNATM 기술의 개량된 형태로, SAMiRNATM를 구성하는 이중가닥 올리고뉴클레오티드 구조체의 친수성 물질을 일정한 분자량을 갖는 균일한 1~15개의 단량체와 필요에 따라 링커(linker)를 포함하는 기본단위를 블록(block)화 하여, 이를 필요에 따라 적절한 개수를 사용함으로써, 기존의 SAMiRNATM에 비해 보다 작은 크기를 가지며 또한 다분산성이 획기적으로 개선된 새로운 형태의 전달체 기술이 개발되었다.
이에, 본 발명자들은 모발의 회백색화를 개선시킬 수 있는 miRNA를 발굴하고자 노력한 결과, miR-3139, miR-3189, miR-3199 또는 miR-8485가 각각 멜라닌형성세포를 활성화하고 멜라닌의 생성을 촉진하여 모발의 회백색화를 개선할 수 있음을 확인하였다. 또한 멜라닌 세포 활성화와 더불어 모낭에 존재하는 모유두 세포(hair follicle dermal papilla cell), 각질형성세포(keratinocyte) 등의 증식 촉진을 확인하였고, 모낭의 외모근소(outer root sheath, ORS) 및 모발길이 증가를 확인함으로써 본 발명을 완성하였다.
특허문헌
(특허문헌 1) 대한민국 등록특허 제883471호
(특허문헌 2) 대한민국 등록특허 제1224828호
(특허문헌 3) 대한민국 등록특허 제1862349호
비특허문헌
(비특허문헌 1) Iorns, E., Lord, C.J., Turner, N. & Ashworth, A., Nat Rev Drug Discov 6, 556-68. 2007
(비특허문헌 2) Agostini, M. & Knight, R.A., Oncotarget 5, 872-81, 2014
(비특허문헌 3) Dangwal, S. &Thum, T., Annu Rev PharmacolToxicol 54, 185-203, 2014
(비특허문헌 4) Carthew, R.W. &Sontheimer, E.J., Cell 136, 642-55, 2009
(비특허문헌 5) MacFarlane, L.-A. & Murphy, P.R., Current Genomics 11, 537-561, 2010
(비특허문헌 6) Bartel, D.P., Cell 136, 215-33, 2009
(비특허문헌 7) Carthew, R.W. &Sontheimer, E.J., Cell 136, 642-55, 2009
(비특허문헌 8) Brodersen, P. &Voinnet, O., Nat Rev Mol Cell Biol 10, 141-148, 2009
(비특허문헌 9) Malone, C.D. & Hannon, G.J., Cell 136, 656-68, 2009
(비특허문헌 10) Akhtar S, J Clin Invest. 2007 December 3; 117(12): 3623-3632, 2007
(비특허문헌 11) SH Kim, J Control Release 129(2):107-16, 2008
발명의 요약
본 발명은 머리카락 모낭의 멜라닌 생성 세포의 활성화 및 멜라닌 생성 촉진을 통하여 모발의 회백색화를 개선시키고 모낭세포의 증식 촉진을 유도하여 탈모를 예방하거나 개선하고 발모를 촉진할 수 있는 신규한 조성물을 제공하는 것이다.
상기 목적을 달성하기 위하여 본 발명은, (i) miR-3139, miR-3189, miR-3199 또는 miR-8485;
(ii) 하기 구조식 (1)의 구조를 포함하는 이중가닥 올리고뉴클레오티드 구조체:
A-X-R-Y-B 구조식 (1)
상기 구조식 (1)에서 A는 친수성 물질, B는 소수성 물질, X 및 Y는 각각 독립적으로 단순 공유결합 또는 링커가 매개된 공유결합을 의미하며, R은 miR-3139, miR-3189, miR-3199 또는 miR-8485을 의미함; 또는
(iii) 상기 이중가닥 올리고뉴클레오티드 구조체를 포함하는 나노입자;를 유효성분으로 포함하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 약학적 조성물을 제공한다.
본 발명은 또한, (i) miR-3139, miR-3189, miR-3199 또는 miR-8485; (ii) 하기 구조식 (1)의 구조를 포함하는 이중가닥 올리고뉴클레오티드 구조체:
A-X-R-Y-B 구조식 (1)
상기 구조식 (1)에서 A는 친수성 물질, B는 소수성 물질, X 및 Y는 각각 독립적으로 단순 공유결합 또는 링커가 매개된 공유결합을 의미하며, R은 miR-3139, miR-3189, miR-3199 또는 miR-8485을 의미함; 또는
(iii) 상기 이중가닥 올리고뉴클레오티드 구조체를 포함하는 나노입자;를 유효성분으로 포함하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 화장료 조성물을 제공한다.
본 발명은 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선이 필요한 객체에
(i) miR-3139, miR-3189, miR-3199 또는 miR-8485;
(ii) 하기 구조식 (1)의 구조를 포함하는 이중가닥 올리고뉴클레오티드 구조체:
A-X-R-Y-B 구조식 (1)
상기 구조식 (1)에서 A는 친수성 물질, B는 소수성 물질, X 및 Y는 각각 독립적으로 단순 공유결합 또는 링커가 매개된 공유결합을 의미하며, R은 miR-3139, miR-3189, miR-3199, 또는 miR-8485를 의미함; 또는
(iii) 상기 이중가닥 올리고뉴클레오티드 구조체를 포함하는 나노입자를 투여하는 단계를 포함하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선방법을 제공한다.
본 발명은 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선을 위한
(i) miR-3139, miR-3189, miR-3199 또는 miR-8485;
(ii) 하기 구조식 (1)의 구조를 포함하는 이중가닥 올리고뉴클레오티드 구조체:
A-X-R-Y-B 구조식 (1)
상기 구조식 (1)에서 A는 친수성 물질, B는 소수성 물질, X 및 Y는 각각 독립적으로 단순 공유결합 또는 링커가 매개된 공유결합을 의미하며, R은 miR-3139, miR-3189, miR-3199, 또는 miR-8485를 의미함; 또는 (iii) 상기 이중가닥 올리고뉴클레오티드 구조체를 포함하는 나노입자의 용도를 제공한다.
본 발명은 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선을 위한 의약품 또는 화장료의 제조를 위한
(i) miR-3139, miR-3189, miR-3199, 또는 miR-8485;
(ii) 하기 구조식 (1)의 구조를 포함하는 이중가닥 올리고뉴클레오티드 구조체:
A-X-R-Y-B 구조식 (1)
상기 구조식 (1)에서 A는 친수성 물질, B는 소수성 물질, X 및 Y는 각각 독립적으로 단순 공유결합 또는 링커가 매개된 공유결합을 의미하며, R은 miR-3139, miR-3189, miR-3199 또는 miR-8485를 의미함; 또는 (iii) 상기 이중가닥 올리고뉴클레오티드 구조체를 포함하는 나노입자의 용도를 제공한다.
도 1은 SAMiRNATM에 탑재된 인간 miRNA 1728종을 이용하여 인간 피부암 세포주(M21)에서 멜라닌 생성량 측정을 통한 1차 스크리닝한 결과를 나타낸 것이다.
도 2는 스크리닝을 통해 선별된 멜라닌 생성량이 높은 18종에 대해 두 종류의 인간 피부암 세포주(M21, SK-MEL28)에서 2차 스크리닝한 결과를 나타낸 것이다.
도 3은 1, 2차 스크리닝을 통해 멜라닌 생성량이 가장 높은 9종 miRNA에 대해 인간 피부암 세포주(SK-MEL-28)에서 멜라닌 생성량 및 색 변화 효능에 대한 재현성을 평가한 결과이다
도 4는 SK-MEL-28 세포주에서 멜라닌 생성량이 가장 높은 9종 miR-8485, miR-7978, miR-6074, miR-3132, miR-4644, miR-3139, miR-3189, miR-3199, miR-933의 작용기전 분석을 위해 멜라닌 생성 신호전달 변화를 RT-qPCR 반응을 통해 분석한 결과이다.
도 5는 human epidermal melanocytes 세포주에서 선별된 9종 miR-8485, miR-7978, miR-6074, miR-3132, miR-4644, miR-3139, miR-3189, miR-3199, miR-933의 멜라닌 생성 신호전달 변화를 RT-qPCR 반응을 통해 분석한 결과이다.
도 6은 SK-MEL-28 세포주에서 선별된 9종 miR-8485, miR-7978, miR-6074, miR-3132, miR-4644, miR-3139, miR-3189, miR-3199, miR-933의 작용기전 분석을 위해 멜라닌 생성 신호전달 변화를 웨스턴 블랏 분석법을 통해 확인한 결과이다.
도 7은 최종 선별된 4종 miR-3139, miR-3189, miR-3199, miR-8485에 대해 인간 흰 머리카락에서 외모근소(ORS) 및 모낭세포 증식 촉진을 관찰한 결과이다.
도 8은 최종 선별된 4종 miR-3139, miR-3189, miR-3199, miR-8485에 대해 인간 흰 머리카락에서 효능(색 변화)을 관찰한 결과이다.
도 9a는 SK-MEL-28 세포주에서 SAMiRNA-miR-3199 처리에 의한 세포 색변화 및 멜라닌 생성량 분석 결과를 나타낸 것이다.
도 9b는 SK-MEL-28 세포주에서 SAMiRNA-miR-3199 처리에 의한 멜라닌 생선 신호전달 변화를 RT-qPCR을 통해 확인한 결과이다.
도 9c는 SK-MEL-28 세포주에서 SAMiRNA-miR-3199 처리에 의한 멜라닌 생선 신호전달 변화를 immunoblot 분석법을 통해 확인한 결과이다.
도 9d는 SK-MEL-28 세포주에서 SAMiRNA-miR-3199 처리에 의한 멜라닌 생선 신호전달 변화를 immunocytochemistry 분석법을 통해 효능을 확인한 결과이다.
도 10a는 miR-3199의 타겟 유전자로 GSK3β를 선별한 결과를 나타낸 것이다.
도 10b는 SK-MEL-28 세포주에서 SAMiRNA-miR-3199 처리에 의해 GSK3β 억제능을 RT-qPCR 분석법을 통해 확인한 결과이다.
도 10c는 SK-MEL-28 세포주에서 SAMiRNA-miR-3199 처리에 의해 GSK3β 억제능을 immunoblot 분석법을 통해 확인한 결과이다.
도 10d는 SK-MEL-28 세포주에서 SAMiRNA-miR-3199 처리에 의해 GSK3β 억제능을 immunocytochemistry 분석법을 통해 확인한 결과이다.
도 10e는 miR-3199가 GSK3β mRNA 3’ UTR에 직접 결합하여 작용하는 것을 luciferase reporter assay 분석법을 통해 확인한 결과이다.
도 11a는 human epidermal melanocytes에서 SAMiRNA-miR-3199 처리에 의한 세포 색변화 및 멜라닌 생성량 분석 결과를 나타낸 것이다.
도 11b는 human epidermal melanocytes에서 SAMiRNA-miR-3199 처리에 의해 멜라닌 생선 신호전달 변화를 RT-qPCR 분석법을 통해 확인한 결과이다.
도 11c는 human epidermal melanocytes에서 SAMiRNA-miR-3199 처리에 의해 멜라닌 생선 신호전달 변화를 immunoblot 분석법을 통해 확인한 결과이다.
도 12a는 인간 모유두세포, 각질형성세포, 인간 멜라닌세포에서 SAMiRNA-miR-3199의 세포독성 및 선천면역독성을 평가한 결과이다.
도 12b는 염증성 사이토카인의 증가 여부 확인을 통해 SAMiRNA-miR-3199의 세포독성 및 선천면역독성을 평가한 결과이다.
발명의 상세한 설명 및 바람직한 구현예
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로 본 명세서에서 사용된 명명법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
본 발명에서는 모발의 회백색화 및 탈모를 예방하거나 방지 또는 개선하고자 하는 수요에 힘입어 인간 miRNA 1728종에 대한 스크리닝 라이브러리를 합성하고 (표 2) 이를 인간 피부암 세포주인 M21, SK-MEL-28 세포에 처리하여, 멜라닌 생성량 측정 및 세포 색 변화를 종합적으로 분석함으로써, 효과 좋은 miRNA인 miR-3139, miR-3189, miR-3199, miR-8485 등 4종을 발굴하였다. 또한, 상기 miRNA가 멜라닌 세포 활성 및 멜라닌 생성 촉진, 모발 회백색화를 개선할 수 있음을 확인하고, 멜라닌 생성 촉진 작용기전을 규명하였으며, 세포독성 및 선천면역독성 평가를 통해 부작용 없이 모발의 멜라닌 생성을 촉진할 수 있음을 확인하였다. 이와 더불어, 멜라닌 생성 세포 활성과 함께 모낭에 존재하는 모유두 세포 및 각질형성세포 등의 세포증식이 촉진되고, 외모근소의 발달 및 모발 길이가 증가함을 확인하였다.
따라서, 본 발명은 일 관점에서
(i) miR-3139, miR-3189, miR-3199 또는 miR-8485;
(ii) 하기 구조식 (1)의 구조를 포함하는 이중가닥 올리고뉴클레오티드 구조체:
A-X-R-Y-B 구조식 (1)
상기 구조식 (1)에서 A는 친수성 물질, B는 소수성 물질, X 및 Y는 각각 독립적으로 단순 공유결합 또는 링커가 매개된 공유결합을 의미하며, R은 miR-3139, miR-3189, miR-3199, 또는 miR-8485를 의미함; 또는
(iii) 상기 이중가닥 올리고뉴클레오티드 구조체를 포함하는 나노입자를 유효성분으로 포함하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 약학적 조성물에 관한 것이다.
본 발명은 또 다른 관점에서,
(i) miR-3139, miR-3189, miR-3199, 또는 miR-8485;
(ii) 하기 구조식 (1)의 구조를 포함하는 이중가닥 올리고뉴클레오티드 구조체:
A-X-R-Y-B 구조식 (1)
상기 구조식 (1)에서 A는 친수성 물질, B는 소수성 물질, X 및 Y는 각각 독립적으로 단순 공유결합 또는 링커가 매개된 공유결합을 의미하며, R은 miR-3139, miR-3189, miR-3199, 또는 miR-8485를 의미함; 또는
(iii) 상기 이중가닥 올리고뉴클레오티드 구조체를 포함하는 나노입자를 유효성분으로 포함하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 화장료 조성물에 관한 것이다.
본 발명에 있어서, 상기 조성물은 멜라닌 형성세포 활성 및 모낭세포 증식에 의해 모발의 회백색화 개선, 발모 촉진 및/또는 탈모가 예방 또는 개선되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.
본 발명에 있어서, 상기 miR-3139는 서열번호 9로 표시되는 염기서열 및 서열번호 10으로 표시되는 염기서열을 포함하는 것을 특징으로 할 수 있으며, 바람직하게는 서열번호 9로 표시되는 염기서열과 서열번호 10으로 표시되는 염기서열로 구성된 DNA/DNA, RNA/RNA, 또는 DNA/RNA 하이브리드일 수 있다.
miR-3139
5'- CAGGCAUCUGUUGAGCUCCUAUU -3' (서열번호 9)
5'- UAGGAGCUCAACAGAUGCCUGUU -3' (서열번호 10)
본 발명에 있어서, 상기 miR-3189는 서열번호 5로 표시되는 염기서열 및 서열번호 6으로 표시되는 염기서열을 포함하는 것을 특징으로 할 수 있으며, 바람직하게는 서열번호 5로 표시되는 염기서열과 서열번호 6으로 표시되는 염기서열로 구성된 DNA/DNA, RNA/RNA, 또는 DNA/RNA 하이브리드일 수 있다.
miR-3189
5'- UGCCCCAUCUGUGCCCUGGGUAGGA -3' (서열번호 5)
5'- CCCUUGGGUCUGAUGGGGUAG -3' (서열번호 6)
본 발명에 있어서, 상기 miR-3199는 서열번호 15로 표시되는 염기서열 및 서열번호 16으로 표시되는 염기서열을 포함하는 것을 특징으로 할 수 있으며, 바람직하게는 서열번호 15로 표시되는 염기서열과 서열번호 16으로 표시되는 염기서열로 구성된 DNA/DNA, RNA/RNA, 또는 DNA/RNA 하이브리드일 수 있다.
miR-3199
5'- CUUUCUCCUAAGGCAGUCCCUUU -3' (서열번호 15)
5'- AGGGACUGCCUUAGGAGAAAGUU -3' (서열번호 16)
본 발명에 있어서, 상기 miR-8485는 서열번호 1로 표시되는 염기서열 및 서열번호 2로 표시되는 염기서열을 포함하는 것을 특징으로 할 수 있으며, 바람직하게는 서열번호 1로 표시되는 염기서열과 서열번호 2로 표시되는 염기서열로 구성된 DNA/DNA, RNA/RNA, 또는 DNA/RNA 하이브리드일 수 있다.
miR-8485
5'- ACGUGUGUGUGUGUGUGUGUU -3' (서열번호 1)
5'- CACACACACACACACACGUAU -3' (서열번호 2)
본 발명의 miR-3189, miR-3199, miR-8485는 microphthalmia-associated transcription factor (MITF), tyrosinase (TYR), tyrosinase-related protein 1 (TYRP1), tyrosinase-related protein 2 (TYRP2)의 발현을 증가시키고, miR-3139는 TYR, TYRP2의 발현을 증가시키는 것을 확인하였다.
본 발명의 miRNA가 증가시키는 유전자들은 하기와 같은 기능을 하는 것으로 알려져 있다.
MITF는 전사인자로써 멜라닌 색소 합성에 직접적으로 관여하는 효소인 TYR, TYRP1 및 TYRP2 유전자 발현을 조절하며, 멜라닌 세포 발달 및 분화를 위한 핵심 전사 인자로 알려져 있다(D'Mello, S. A., Finlay, G. J., Baguley, B. C. & Askarian-Amiri, M. E. Signaling Pathways in Melanogenesis.　Int J Mol Sci. 17 (2016) ; Kawakami A, Fisher DE. The master role of microphthalmia-associated transcription factor in melanocyte and melanoma biology. Lab Investig. (2017)).
TYR, TYRP1, TYRP2는 주로 티로신을 멜라닌 색소로 변환하는데 관여하며, 특히 TYR과 TYRP2는 멜라닌의 양과 품질에 영향을 미치는 중요한 효소로 알려져 있다(NIU, C., AISA, H.A., 2017: Upregulation of melanogenesis and tyrosinase activity: potential agents for vitiligo. Molecules 22, E1303. (2017) ; D'Mello, S. A., Finlay, G. J., Baguley, B. C. & Askarian-Amiri, M. E. Signaling Pathways in Melanogenesis.　Int J Mol Sci. 17 (2016)).
상기 배경 기술에서 기술한 바와 같이 miRNA 활성서열의 두 번째 염기로부터 8-9 번째 염기까지 해당하는 씨앗서열(seed region)이 활성의 주요한 인자인데, 이중가닥 올리고뉴클레오티드를 제조할 때 이를 포함하는 긴 이중가닥 올리고뉴클레오티드를 제조하여 사용할 수도 있다.
또한, 상기 miRNA는 이중가닥일 수 있으며, 다른 양태로서 단일분자 폴리뉴클레오티드를 포함할 수 있다. 예컨대, 안티센스 올리고뉴클레오티드 또는 miRNA일 수 있으나, 이에 한정되는 것은 아니다.
한편, miR-3139, miR-3189, miR-3199 또는 miR-8485는 이를 구성하는 센스가닥 또는 이에 상보적인 안티센스 가닥에서, 하나 이상의 염기가 치환, 결실, 또는 삽입된 서열을 포함할 수 있다.
본 발명에 따른 이중가닥 올리고뉴클레오티드는 하나 또는 양쪽 가닥의 3' 말단에 하나 또는 그 이상의 비결합된(unpaired) 뉴클레오티드를 포함하는 구조인 오버행(overhang)을 포함할 수 있다.　또한, 상기 센스 가닥 또는 안티센스 가닥은 바람직하게는 19 내지 31개의 뉴클레오티드로 구성되는 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 RNA 또는 DNA 올리고뉴클레오티드에 친수성 물질 및 소수성 물질이 결합된 올리고 접합체의 경우, RNA 또는 DNA 올리고뉴클레오티드의 양 말단에 친수성 물질 및 소수성 물질이 접합된 형태의 접합체를 통해, 올리고뉴클레오티드를 생체 내 효율적으로 전달할 수 있을 뿐 아니라 안정성이 향상될 수 있다.
또한, 소수성 물질의 소수성 상호작용에 의하여 자가조립 나노입자를 형성하게 되는데, 이러한 나노입자는 체내로의 전달효율 및 체내에서의 안정성이 극히 우수할 뿐 아니라, 구조의 개선을 통해 입자 크기가 매우 균일하여 QC (Quality control)이 용이하므로 약물로서의 제조 공정이 간단하다는 장점이 있다.
일 양태로서, 상기 친수성 물질은 (P)n, (Pm-J)n 또는 (J-Pm)n으로 표시되고, P는 친수성 물질 단량체, n은 1 내지 200, m은 1 내지 15, J는 m개의 친수성 물질 단량체 간 또는 m개의 친수성 물질 단량체와 올리고뉴클레오티드를 서로 연결하는 링커일 수 있다.
본 발명에 있어서, 상기 친수성 물질은 분자량이 200 내지 10,000인 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 친수성 물질은 폴리에틸렌 글리콜, 폴리비닐피롤리돈 및 폴리옥사졸린으로 구성된 군에서 선택되는 어느 하나인 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.
본 발명에 있어서, 상기 친수성 물질 단량체(P)는 하기 화합물 (1)의 구조를 갖는 것을 특징으로 할 수 있다:
Figure PCTKR2022002765-appb-img-000001
상기화합물 (1)에서 G는 CH2, O, S 및 NH로 이루어진 군에서 선택된다.
본 발명에 있어서, 상기 링커(J)는 PO3 -, SO3 및 CO2로 구성된 군에서 선택되는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 소수성 물질의 분자량은 250 내지 1,000인 것을 특징으로 할 수 있으며, 상기 소수성 물질은 스테로이드(steroid) 유도체, 글리세라이드(glyceride) 유도체, 글리세롤 에테르(glycerol ether), 폴리프로필렌 글리콜(polypropylene glycol), C12 내지 C50의 불포화 또는 포화탄화수소(hydrocarbon), 디아실포스파티딜콜린(diacylphosphatidylcholine), 지방산(fatty acid), 인지질(phospholipid) 및, 리포폴리아민(lipopolyamine)으로 구성된 군에서 선택되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.
본 발명에 있어서, 상기 스테로이드(steroid) 유도체는 콜레스테롤, 콜레스탄올, 콜산, 콜리스테릴포르메이트, 코테스타닐포르메이트 및 콜리스타닐아민으로 구성된 군에서 선택되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.
본 발명에 있어서, 상기 글리세라이드 유도체는 모노-, 디- 및 트리-글리세라이드에서 선택되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.
본 발명에 있어서, 상기 X 및 Y 로 표시되는 공유결합은 비분해성 결합 또는 분해성 결합인 것을 특징으로 할 수 있으며, 상기 비분해성 결합은 아미드 결합 또는 인산화 결합인 것을 특징으로 할 수 있고, 상기 분해성 결합은 이황화 결합, 산분해성 결합, 에스테르 결합, 안하이드라이드 결합, 생분해성 결합 또는 효소 분해성 결합인 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.
상기 친수성 물질이 A인 경우, 본 발명에 따른 이중가닥 올리고뉴클레오티드 구조체는 하기 구조식 (1')의 구조를 가질 수 있다.
Figure PCTKR2022002765-appb-img-000002
상기 구조식 (1')에서 A, B, X 및 Y는 상기 구조식 (1)에서의 정의와 동일하며, S는 miRNA의 센스가닥, AS는 miRNA의 안티센스 가닥을 의미한다.
일 양태로서, 본 발명에 따른 miRNA를 포함하는 이중가닥 올리고뉴클레오티드 구조체는 하기 구조식 (2)의 구조를 포함하는 이중가닥 올리고뉴클레오티드 구조체일 수 있다.
A-X-5' R 3' Y-B 구조식 (2)
상기 구조식 (2)에서, A, B, X, Y 및 R은 구조식 1에서의 정의와 동일하다.
보다 바람직하게는, 이중가닥 올리고뉴클레오티드 구조체는 하기 구조식 (2')의 구조를 가진다.
Figure PCTKR2022002765-appb-img-000003
일 양태로서, 상기 친수성 물질은 분자량이 200 내지 10,000인 양이온성 또는 비이온성 고분자 물질일 수 있으며, 바람직하게는 1,000 내지 2,000인 비이온성 고분자 물질일 수 있다. 상기 친수성 물질로 비이온성 친수성 고분자 화합물로서, 예를 들어, 폴리에틸렌 글리콜, 폴리비닐피롤리돈 및 폴리옥사졸린으로 구성된 군에서 선택되는 어느 하나인 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.
다른 양태로서, 상기 친수성 물질이 (Pm-J)n 또는 (J-Pm)n인 경우, 본 발명에 따른 이중가닥 올리고뉴클레오티드 구조체는 하기 구조식 (3) 또는 구조식 (4)의 구조를 가진다.
(Pm-J)n-X-R-Y-B 구조식 (3)
(J-Pm)n-X-R-Y-B 구조식 (4)
상기 구조식 (3) 및 구조식 (4)에서 P는 친수성 물질 단량체, n은 1 내지 200, m은 1 내지 15, J는 m개의 친수성 물질 단량체 간 또는 m개의 친수성 물질 단량체와 올리고뉴클레오티드를 서로 연결하는 링커일 수 있으며, X와 Y는 각각 독립적으로 단순 공유결합 또는 링커가 매개된 공유결합, R은 본 발명의 특이적 miRNAs일 수 있다. 보다 바람직하게, 본 발명에 따른 miRNA를 포함하는 이중가닥 올리고뉴클레오티드 구조체는 하기 구조식 (3')의 구조를 가진다.
Figure PCTKR2022002765-appb-img-000004
상기 구조식 (3')에서 P, B, J, m, n, X 및 Y는 상기 구조식 (3)에서의 정의와 동일하며, S는 miRNA의 센스가닥, AS는 miRNA의 안티센스 가닥을 의미한다.
보다 바람직하게, 본 발명에 따른 miRNA를 포함하는 이중가닥 올리고뉴클레오티드 구조체는 하기 구조식 (4')의 구조를 가진다.
Figure PCTKR2022002765-appb-img-000005
상기 구조식 (4')에서 P, B, J, m, n, X 및 Y는 상기 구조식 (4)에서의 정의와 동일하며, S는 miRNA의 센스가닥, AS는 miRNA의 안티센스 가닥을 의미한다.
상기 구조식 (3) 및 구조식 (4)에서의 친수성 물질 단량체 (P)는 비이온성 친수성 고분자의 단량체 중에서 본 발명의 목적에 부합하는 것이라면 어느 것이라도 제한없이 사용이 가능하며, 바람직하게는 표 1에 기재된 화합물 (1) 내지 화합물 (3)에서 선택된 단량체, 더욱 바람직하게는 화합물(1)의 단량체가 사용될 수 있으며, 화합물 (1)에서 G는 바람직하게는 CH2, O, S 및 NH에서 선택될 수 있다.
특히, 친수성 물질 단량체 중에서도 화합물 (1)로 표시되는 단량체에는 다양한 기능기를 도입할 수 있으며, 생체 내 친화성이 좋고 면역반응을 적게 유도하는 등 생체 적합성(bio-compatibility)이 우수할 뿐 아니라, 구조식 (3) 및 구조식 (4)에 따른 구조체 내에 포함된 올리고뉴클레오티드의 생체 내 안정성을 증가시키고, 전달 효율을 증가시킬 수 있다는 장점을 가지고 있어 본 발명에 따른 구조체의 제조에 매우 적합하다.
Figure PCTKR2022002765-appb-img-000006
구조식 (3) 및 구조식 (4)에서의 친수성 물질은 총 분자량이 1,000 내지 2,000에 범위 내인 것이 바람직하다. 따라서, 예를 들어, 화합물 (1)에 따른 헥사에틸렌글리콜, 즉 구조식 (3) 및 구조식(4)에서의 G가 O이고, m이 6인 물질이 사용되는 경우 헥사에틸렌글리콜 스페이서(spacer)의 분자량이 344이므로, 반복 횟수(n)는 3 내지 5인 것이 바람직하다. 본 발명은 필요에 따라 상기 구조식 (3) 및 구조식 (4)에서 (Pm-J) 또는 (J-Pm)으로 표시되는 친수성 그룹의 반복 단위, 즉 친수성물질 블록이 n으로 표시되는 적절한 개수로 사용될 수 있음을 특징으로 한다. 상기 각 친수성 물질 블록 내에 포함되는 친수성 물질 단량체인 P와 링커인 J는 독립적으로 각 친수성 물질 블록간에 동일할 수도 있고, 상이할 수도 있다. 즉, 친수성 물질 블록이 3개 사용될 경우(n=3), 첫 번째 블록에는 화합물 (1)에 따른 친수성 물질 단량체가, 두 번째 블록에는 화합물 (2)에 따른 친수성 물질 단량체가, 세 번째 블록에는 화합물 (3)에 따른 친수성 물질 단량체가 사용되는 등, 모든 친수성 물질 블록별로 다른 친수성 물질 단량체가 사용될 수도 있고, 모든 친수성 물질 블록에 화합물 (1) 내지 화합물 (3)에 따른 친수성 물질 단량체에서 선택된 어느 하나의 친수성 물질 단량체가 동일하게 사용될 수도 있다. 마찬가지로, 친수성 물질 단량체의 결합을 매개하는 링커 역시 각 친수성 물질 블록별로 모두 동일한 링커가 사용될 수도 있고, 각 친수성 물질 블록별로 상이한 링커가 사용될 수도 있다. 또한, 친수성 물질 단량체의 개수인 m 역시 각 친수성 물질 블록간에 동일할 수도 있고, 상이할 수도 있다. 즉, 첫 번째 친수성 물질 블록에서는 친수성 물질 단량체가 3개 연결(m=3)되고, 두 번째 친수성 물질 블록에서는 친수성 물질 단량체가 5개(m=5), 세 번째 친수성 물질 블록에서는 친수성 물질 단량체가 4개 연결(m=4)되는 등, 서로 다른 개수의 친수성 물질 단량체가 사용될 수도 있고, 모든 친수성 물질 블록에서 동일한 개수의 친수성 물질 단량체가 사용될 수도 있다.
본 발명에서 상기 링커(J)는 PO3 -, SO3 및 CO2로 구성된 군에서 선택되는 것이 바람직하지만, 이에 제한되는 것은 아니며, 사용되는 친수성 물질의 단량체 등에 따라 본 발명의 목적에 부합하는 한 어떠한 링커라도 사용될 수 있음은 통상의 기술자에게는 자명한 것이다.
상기 친수성 물질 단량체의 전부 또는 일부는 필요에 따라 타겟 특이적 리간드와 같은 다른 물질과의 결합을 위해 필요한 기능기를 갖도록 변경되어도 무방하다.
경우에 따라서, 상기 유전자에 특이적 miRNA를 포함하는 이중가닥 올리고뉴클레오티드 구조체의 안티센스 가닥의 5´말단에 인산기(phosphate group)가 한 개 내지 세 개 결합될 수 있다.
예를 들어, miRNA를 포함하는 이중가닥 올리고뉴클레오티드 구조체는 하기 구조식 (3'') 또는 구조식 (4'')의 구조를 가진다.
Figure PCTKR2022002765-appb-img-000007
Figure PCTKR2022002765-appb-img-000008
상기 소수성 물질(B)은 소수성 상호작용을 통해 구조식 (1)에 따른 올리고뉴클레오티드 구조체로 구성된 나노입자를 형성하는 역할을 수행한다.
상기 소수성 물질은 분자량이 250 내지 1,000인 것이 바람직하며, 스테로이드(steroid) 유도체, 글리세라이드(glyceride) 유도체, 글리세롤 에테르(glycerol ether), 폴리프로필렌 글리콜(polypropylene glycol), C12 내지 C50의 불포화 또는 포화 탄화수소(hydrocarbon), 디아실포스파티딜콜린 (diacylphosphatidylcholine), 지방산(fatty acid), 인지질(phospholipid), 리포폴리아민(lipopolyamine) 등이 사용될 수 있지만, 이에 제한되는 것은 아니며, 본 발명의 목적에 부합하는 것이라면 어떠한 소수성 물질도 사용 가능하다는 점은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게는 자명한 것이다.
상기 스테로이드 유도체는 콜레스테롤, 콜레스탄올, 콜산, 콜리스테릴포르메이트, 코테스타닐포르메이트 및 콜리스타닐아민으로 이루어진 군에서 선택될 수 있으며, 상기 글리세라이드 유도체는 모노-, 디- 및 트리-글리세라이드 등에서 선택될 수 있는데 이때, 글리세라이드의 지방산은 C12 내지 C50의 불포화 또는 포화 지방산이 바람직하다.
특히, 상기 소수성 물질 중에서도 포화 또는 불포화 탄화수소나 콜레스테롤이 본 발명에 따른 올리고뉴클레오티드 구조체의 합성 단계에서 용이하게 결합시킬 수 있는 장점을 가지고 있다는 점에서 바람직하다.
상기 소수성 물질은 친수성 물질의 반대쪽 말단(distal end)에 결합되며, miRNA의 센스가닥 또는 안티센스 가닥의 어느 위치에 결합되어도 무방하다.
본 발명에서, 친수성 물질, 친수성 물질 블록 또는 소수성 물질과 올리고뉴클레오티드는 단순 공유 결합 또는 링커가 매개된 공유결합(X 또는 Y)에 의해 결합된다. 상기 공유결합은 비분해성 결합 또는 분해성 결합 중 어느 것이어도 무방하다. 이때, 비분해성 결합으로는 아미드 결합 또는 인산화 결합이 있고, 분해성 결합으로는 이황화 결합, 산분해성 결합, 에스테르 결합, 안하이드라이드 결합, 생분해성 결합 또는 효소 분해성 결합 등이 있으나, 이에 한정되는 것은 아니다.
본 발명에서 제공하는 멜라닌 세포 활성 및 멜라닌 생성 촉진을 통한 모발의 회백색화 개선용, 탈모의 예방 또는 개선용, 모낭세포 증식 촉진용 및/또는 발모 촉진용 조성물의 유효성분으로서 사용 가능한 miRNA 서열은 인간 유전체 유래의 서열이나, miRNA의 유래 유전체를 인간 유전체로 한정하지 않고 다른 동물 유래 유전체부터 구해진 miRNA 서열 역시 사용할 수 있다.
상기 miRNA는 miRNA의 생물학적 등가 효능을 발생시키는 다양한 miRNA 유도체(miRNA mimic)의 형태로 사용할 수 있는데, 동일한 씨앗부분을 포함하는 miRNA 서열을 포함하는 변형된 miRNA를 사용할 수 있다. 이 때 상기 miRNA 센스 및 안티센스 서열 길이를 줄일 수 있는데, 길이가 15개의 뉴클레오티드로 구성된 짧은 유도체 사용도 가능하다.
상기 miRNA에 대한 miRNA 유도체로서는 RNA 인산 뼈대 구조(phosphate backbone structure)를 황 등의 다른 원소로 치환한 형태인 포스포로사이오에이트(phosphorothiolate) 구조를 부분적으로 포함할 수 있으며, RNA 대신 DNA, PNA (peptide nucleic acids) 및 LNA (locked nucleic acid) 분자로의 전체 또는 부분적으로 치환한 형태로 사용 가능하고, 또한, RNA 당의 2'수산화기를 다양한 기능성 구조로 치환한 형태로 사용이 가능한데, 이는 메틸화, 메톡시화, 플르오르화 등을 포함하나 이러한 변형에 한정되는 것은 아니다.
상기 miRNA는 성숙 miRNA와 이로부터 유도된 상기 miRNA 유도체의 이중가닥 RNA에 한정하는 것이 아니고, miRNA 전구체의 형태로 사용될 수 있으며, miRNA 전구체 또한 상기 기술된 RNA 인산 뼈대 구조, RNA 핵산의 DNA, PNA 및 LNA 등으로의 부분 또는 전체 치환, RNA 당 분자의 2'수산화기의 변형이 가능하다.
상기 miRNA는 miRNA 전구체 또는 일차 miRNA (pre-miRNA) 형태로 사용 가능한데 이를 화학적인 방법으로 합성하거나 또는 플라스미드(plasmid)의 형태로 세포로 전달하여 발현하는 것이 가능하다.
본 발명에 있어서, miRNA를 배양 접시에서 배양한 세포로 전달하는 방법은 양이온성 지질과의 혼합물 사용하는 방법, 전기적인 자극으로 전달하는 방법 및 바이러스를 이용하는 방법 등을 사용할 수 있으나, 당업계에서 miRNA를 전달하는 것으로 알려지니 다양한 방법을 당업자가 용이하게 적용하여 사용할 수 있으며, 상기한 방법에 제한을 두는 것은 아니다.
본 발명은 또 다른 관점에서, 상기 miR-3139, miR-3189, miR-3199, 또는 miR-8485의 miRNA를 포함하는 이중가닥 올리고뉴클레오티드 구조체 및 나노입자에 관한 것이다.
앞서 설명한 바와 같이 상기 miRNA를 포함하는 이중가닥 올리고뉴클레오티드 구조체는 소수성 및 친수성 물질을 모두 포함하고 있는 양친매성이며, 친수성 부분은 체내에 존재하는 물 분자들과 수소결합 등의 상호작용을 통해 친화력을 가지고 있어 바깥쪽으로 향하게 되고, 소수성 물질들은 그들 간의 소수성 상호작용(hydrophobic interaction)을 통해 안쪽으로 향하게 되어 열역학적으로 안정한 나노입자를 형성하게 된다. 즉, 나노입자의 중심에 소수성 물질이 위치하게 되고, 상기 miRNA를 포함하는 이중가닥 올리고뉴클레오티드의 바깥쪽 방향에 친수성 물질이 위치하여 상기 miRNA 서열을 보호하는 형태의 나노입자를 형성한다.
본 발명에 따른 나노입자는 동일한 서열을 가지는 이중가닥 올리고뉴클레오티드 구조체만으로 형성될 수도 있고, 서로 다른 서열을 가지는 이중가닥 올리고뉴클레오티드 구조체로 구성될 수도 있음을 특징으로 하는데, 다른 멜라닌 생성 촉진 및 모낭세포 증식 촉진 유전자 타겟 miRNA를 포함하는 이중가닥 올리고뉴클레오티드 구조체가 본 발명에 따른 나노입자에 포함될 수도 있다. 예를 들어, 상기 나노입자는 miR-3139를 포함하는 이중가닥 올리고 뉴클레오티드 구조체와 miR-8485를 포함하는 이중가닥 올리고뉴클레오티드 구조체가 혼합되어 나노입자를 구성할 수 있다.
또한, 상기 miRNA를 포함하는 이중가닥 올리고뉴클레오티드 구조체 이외의 다른 멜라닌 세포 활성을 통한 멜라닌 생성 촉진 및 모낭세포 증식 촉진 miRNA를 포함하는 이중가닥 올리고뉴클레오티드, 또는 이를 포함하는 이중가닥 올리고뉴클레오티드 구조체가 본 발명에 따른 조성물에 추가적으로 포함될 수 있다.
본 발명에서는 상기 miRNA를 포함하는 이중가닥 올리고뉴클레오티드 구조체(SAMiRNATM) 및 나노입자의 멜라닌 세포 활성 및 멜라닌 생성 촉진 효과와 이를 통한 회백색화 개선효과가 확인되었다. 또한 멜라닌 생성 세포 활성과 더불어 모낭에 존재하는 모유두 세포 및 각질형성세포의 증식 촉진 효과가 확인되었다.
따라서, 본 발명은 상기 조성물을 약학적 용도 및 화장료로서 활용할 수 있는데, 상기 약학적 조성물은 연고, 페이스트, 젤, 젤리, 세럼(serum), 에어로졸 스프레이, 비-에어로졸 스프레이, 폼, 크림, 로션, 용액 또는 현탁액의 제형 중에서 선택되는 제형에 사용되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.
상기 조성물을 화장료로 사용하는 경우, 이에 한정되지는 않으나, 헤어토닉, 헤어컨디셔너, 헤어에센스, 헤어로션, 헤어영양로션, 헤어샴푸, 헤어린스, 헤어트리트먼트, 헤어크림, 헤어영양크림, 헤어모이스처크림, 헤어맛사지크림, 헤어왁스, 헤어에어로졸, 헤어팩, 헤어영양팩, 헤어비누, 헤어클렌징폼, 머릿기름, 모발건조제, 모발보존처리제, 모발염색제, 모발용 웨이브제, 모발탈색제, 헤어겔, 헤어글레이즈, 헤어드레싱어, 헤어래커, 헤어모이스처라이저, 헤어무스 또는 헤어스프레이의 제형 중에서 선택되는 제형에 사용되는 것을 특징으로 할 수 있다.
본 발명의 조성물에는 상기의 유효성분 이외에 추가로 약제학적으로 허용 가능한 담체를 1종 이상 포함하여 제조할 수 있다. 약제학적으로 허용 가능한 담체는 본 발명의 유효성분과 양립 가능하여야 하며, 식염수, 멸균수, 링거액, 완충 식염수, 덱스트로즈 용액, 말토덱스트린 용액, 글리세롤, 에탄올 및 이들 성분 중 한 성분 또는 둘 이상의 성분을 혼합하여 사용할 수 있고, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. 또한 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형으로 제제화 할 수 있다. 특히, 동결건조(lyophilized)된 형태의 제형으로 제제화하여 제공하는 것이 바람직하다. 동결건조 제형 제조를 위해서 본 발명이 속하는 기술분야에서 통상적으로 알려져 있는 방법이 사용될 수 있으며, 동결건조를 위한 안정화제가 추가될 수도 있다. 더 나아가 당 분야의 적정한 방법으로 또는 레밍톤 약학 과학(Remington's pharmaceutical Science, Mack Publishing company, Easton PA)에 개시되어 있는 방법을 이용하여 각 질병에 따라 또는 성분에 따라 바람직하게 제제화 할 수 있다.
본 발명의 조성물에 포함되는 유효성분 등의 함량 및 투여방법은 통상의 개인의 멜라닌 세포 수 및 기능 저하 정도, 회백색화 증후와 부위의 심각도에 기초하여 본 기술분야의 통상의 전문가가 결정할 수 있다. 또한 산제, 정제, 주사제, 연고제, 기능성 화장품 등의 다양한 형태로 제제화 할 수 있으며 단위-투여량 또는 다-투여량 용기, 예를 들면 밀봉된 앰플 및 병 등으로 제공될 수도 있다.
본 발명에 따른 상기 miRNA를 포함하는 이중가닥 올리고뉴클레오티드 구조체, 이를 포함하는 조성물 또는 나노입자를 기능성 화장품 또는 피부 외용제의 제조에 이용하는 경우, 기능성 화장품 또는 피부 외용제의 제형은 크림, 로션, 겔, 수용성 리퀴드 및 에센스로 구성된 군에서 선택되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.
본 발명은 또 다른 관점에서 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선이 필요한 객체에
(i) miR-3139, miR-3189, miR-3199 또는 miR-8485;
(ii) 하기 구조식 (1)의 구조를 포함하는 이중가닥 올리고뉴클레오티드 구조체:
A-X-R-Y-B 구조식 (1)
상기 구조식 (1)에서 A는 친수성 물질, B는 소수성 물질, X 및 Y는 각각 독립적으로 단순 공유결합 또는 링커가 매개된 공유결합을 의미하며, R은 miR-3139, miR-3189, miR-3199, 또는 miR-8485를 의미함; 또는
(iii) 상기 이중가닥 올리고뉴클레오티드 구조체를 포함하는 나노입자를 투여하는 단계를 포함하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선방법을 제공한다.
본 발명은 또 다른 관점에서 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선을 위한
(i) miR-3139, miR-3189, miR-3199 또는 miR-8485;
(ii) 하기 구조식 (1)의 구조를 포함하는 이중가닥 올리고뉴클레오티드 구조체:
A-X-R-Y-B 구조식 (1)
상기 구조식 (1)에서 A는 친수성 물질, B는 소수성 물질, X 및 Y는 각각 독립적으로 단순 공유결합 또는 링커가 매개된 공유결합을 의미하며, R은 miR-3139, miR-3189, miR-3199, 또는 miR-8485를 의미함; 또는 (iii) 상기 이중가닥 올리고뉴클레오티드 구조체를 포함하는 나노입자의 용도를 제공한다.
본 발명은 또 다른 관점에서 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선을 위한 의약품 또는 화장료의 제조를 위한 (i) miR-3139, miR-3189, miR-3199, 또는 miR-8485;
(ii) 하기 구조식 (1)의 구조를 포함하는 이중가닥 올리고뉴클레오티드 구조체:
A-X-R-Y-B 구조식 (1)
상기 구조식 (1)에서 A는 친수성 물질, B는 소수성 물질, X 및 Y는 각각 독립적으로 단순 공유결합 또는 링커가 매개된 공유결합을 의미하며, R은 miR-3139, miR-3189, miR-3199 또는 miR-8485를 의미함; 또는 (iii) 상기 이중가닥 올리고뉴클레오티드 구조체를 포함하는 나노입자의 용도를 제공한다.
실시예
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1: 멜라닌 생성 촉진 miRNA 선별을 위한 스크리닝
1-1. 멜라닌 생성 촉진 인간 miRNA 후보군
miRNA 데이터베이스인 miRBase (www.mirbase.org)에서 제공하는 21 버전의 인간 miRNA 서열로서 줄기고리 구조(stem-loop structure) 기준으로 1728종의 miRNA를 이중가닥 올리고뉴클레오티드 구조체(SAMiRNATM)에 탑재된 형태로 합성하였다(표 2). 합성된 모든 miRNA 가닥은 MALDI-TOF 방식의 질량 분석기를 사용하여 의도한 서열의 합성 여부를 판별 및 확인하였다. 인간 피부암 세포주를 대상으로 1728종의 miRNA를 이용하여 멜라닌 생성량이 가장 높은 miRNA 발굴을 위한 스크리닝을 진행하였다. 본 발명에서 실험한 인간 1728종의 miRNA 센스가닥의 서열은 miRbase (http://www.mirbase.org)에 공지되어 있으며, 씨앗서열(seed region)이 한쪽 가닥에만 있을 경우 이중 가닥 형태로 세포에 전달하기 위해 상보적인 서열을 합성하였다.
예를 들어, miR-3139의 miRNA는 하기와 같이 제조하였다.
서열번호 9: 5'- CAGGCAUCUGUUGAGCUCCUAUU -3'
서열번호 10; 5'- UAGGAGCUCAACAGAUGCCUGUU -3'
또한 씨앗서열이 양쪽 가닥에 있을 경우 각 가닥을 센스 및 안티센스 가닥으로 합성하였다. 예를 들어, miR-3189의 miRNA는 하기와 같이 제조하였다.
서열번호 5: 5'- UGCCCCAUCUGUGCCCUGGGUAGGA -3' (sense)
서열번호 6: 5'- CCCUUGGGUCUGAUGGGGUAG -3' (antisense)
Figure PCTKR2022002765-appb-img-000009
Figure PCTKR2022002765-appb-img-000010
Figure PCTKR2022002765-appb-img-000011
Figure PCTKR2022002765-appb-img-000012
Figure PCTKR2022002765-appb-img-000013
Figure PCTKR2022002765-appb-img-000014
Figure PCTKR2022002765-appb-img-000015
Figure PCTKR2022002765-appb-img-000016
Figure PCTKR2022002765-appb-img-000017
Figure PCTKR2022002765-appb-img-000018
Figure PCTKR2022002765-appb-img-000019
Figure PCTKR2022002765-appb-img-000020
Figure PCTKR2022002765-appb-img-000021
Figure PCTKR2022002765-appb-img-000022
Figure PCTKR2022002765-appb-img-000023
Figure PCTKR2022002765-appb-img-000024
Figure PCTKR2022002765-appb-img-000025
Figure PCTKR2022002765-appb-img-000026
Figure PCTKR2022002765-appb-img-000027
Figure PCTKR2022002765-appb-img-000028
1-2: 세포 배양 및 miRNA의 트랜스펙션(Transfection)
멜라닌 생성을 효과적으로 증가시키는 miRNA 발굴을 위하여 인간 유래 피부암 세포주인 human melanoma M21 (Korean cell line bank, KR)을 이용하였다. M21 세포주는 10% Fetal Bovine Serum (FBS, Hyclone, US) 및 1% Penicillin-Streptomycin (Hyclone, US)이 포함된 DMEM 배지(Hyclone, US)를 이용하여 37℃/5% CO2 조건에서 배양하였다. M21 세포를 12 well plate (Falcon, US)에 4 Х 104 cells/well의 조건으로 분주하고, 다음날 Lipofectamine RNAiMAX (Invitrogen, US)를 이용하여 제조업자의 프로토콜에 따라 miRNA를 40 nM로 트랜스펙션 시켰다.
1-3: 멜라닌 생성량 측정을 통한 1728종 miRNA 1차 스크리닝 및 재현평가
실시예 1-2의 방법으로 M21 세포에 1728종의 miRNA를 3회 반복하여 트랜스펙션을 진행하였다. 72 시간 배양 후, 모든 세포를 모아서 멜라닌 추출 프로토콜에 따라 1M NaOH (Bioneer, KR)에 37℃에서 2시간 반응 후, 파장 405 mm 하에 흡광도를 측정하여 색변화 및 멜라닌 생성량을 비교하였다. 72 시간 배양 후, 모든 세포를 모아서 멜라닌 추출 프로토콜에 따라 1M NaOH (Bioneer, KR)에 37℃에서 2시간 반응 후, 파장 405 mm 하에 흡광도를 측정하여 멜라닌 생성량을 분석하였다. 재현평가를 위해 상위 9종 miRNA를 대상으로 M21 세포주에 실시예 1-2의 방법으로 처리하였다. 72 시간 배양 후, 모든 세포를 모아서 멜라닌 추출 프로토콜에 따라 1M NaOH (Bioneer, KR)에 37℃에서 2시간 반응 후, 파장 405 mm 하에 흡광도를 측정하여 멜라닌 생성량을 분석하였다.
그 결과, 총 1728종을 처리한 M21 세포주에서 멜라닌 생성량이 13.0 μg/ml 이상(음성 대조군 대비 1.88배 이상), 양성 대조군인 IBMX (Sigma, US)/CuSO4 (Sigma, US) 처리군과 유사한 멜라닌 생성량을 보이는 9종의 miRNA를 선별하였다(도 1). 재현평가를 위한 반복실험에서도 선별된 상위 9종 miRNA에 의해 M21 세포주에서 음성 대조군 대비 높은 색 변화 및 멜라닌 생성이 확인되었다(도 2, 표 3).
Figure PCTKR2022002765-appb-img-000029
실시예 2: 선별된 9종 miRNA의 재현평가 및 멜라닌 생성 메커니즘 분석을 통한 최종서열 선별
2-1: 세포 배양 및 miRNA의 트랜스펙션(Transfection)
멜라닌 생성 상위 9종의 재현평가를 위해 인간 유래 피부암 세포주인 SK-MEL-28 (Korean cell line bank, KR)을 이용하였다. SK-MEL-28 세포주는 10% FBS (Hyclone, US) 및 1% Penicillin-Streptomycin (Hyclone, US)가 포함된 MEM 배지(Hyclone, US)를 이용하여 37℃/5% CO2 조건에서 배양하였다. SK-MEL-28 세포를 12 well plate (Falcon, US)에 4 × 104 cells/well의 조건으로 분주하고, 다음날 Lipofectamine RNAiMAX (Invitrogen, US)를 이용하여 제조업자의 프로토콜에 따라 miRNA를 40 nM로 트랜스펙션 시켰다.
2-2-: 멜라닌 생성량 분석을 통한 상위 9종 miRNA 재현평가
선별된 상위 9종 miRNA의 재현평가를 위해 SK-MEL-28 세포를 대상으로 색 변화 및 멜라닌 생성량을 측정하였다. 실시예 2-1의 방법으로 SK-MEL-28 세포에 miR-8485, miR-7978, miR-6074, miR-3132, miR-4644, miR-3139, miR-3189, miR-3199 또는 miR-933을 각각 3회 반복하여 트랜스펙션을 진행하였다. 72 시간 배양 후, 모든 세포를 모아서 색변화를 관찰하였고, 멜라닌 생성량 측정을 위해 멜라닌 추출 프로토콜에 따라 1M NaOH (Bioneer, KR)에 37℃에서 2시간 반응시킨 후, 파장 405 mm 하에 흡광도를 측정하여 멜라닌 생성량을 분석하였다.
그 결과 miR-8485, miR-7978, miR-6074, miR-3132, miR-4644, miR-3139, miR-3189, miR-3199 또는 miR-933을 처리한 군에서 음성대조군에 비해 뚜렷한 색 변화 및 멜라닌 생성증가가 관찰되었다. 이는 양성대조군인 멜라닌 유도물질과 비교할 때 현저히 우수한 색 변화 및 멜라닌 생성량 증가가 확인되었다(도 3).
2-3: SK-MEL-28 세포에서 멜라닌 생성 촉진 작용기전 분석을 위한 RT-qPCR 분석
선별된 상위 9종 miRNA의 멜라닌 생성 촉진 작용기전 분석을 위해 멜라닌 생성 과정의 중요한 인자인 MITF, TYR, TYRP1, TYRP2 등의 유전자 분석을 위해 RT-qPCR 분석을 수행하였다. SK-MEL-28 세포주를 12 well plate (Falcon, US)에 4 Х 104 cells/well로 분주한 후 37℃/5% CO2 조건으로 배양하였다. 다음날 실시예 2-1의 방법으로 SK-MEL-28 세포에 miR-8485, miR-7978, miR-6074, miR-3132, miR-4644, miR-3139, miR-3189, miR-3199 또는 miR-933을 각각 3회 반복하여 트랜스펙션을 진행하였다. 96 시간 배양 후 Universal RNA extraction kit (Bioneer, KR)을 이용하여 세포 용해물로부터 총 RNA를 추출하고, 이 RNA를 주형으로 AccuPower 　GreenStarTM RT-qPCR Master Mix (Bioneer, KR)를 이용하여 제조업자의 프로토콜에 따라 상기 유전자(Human qPCR panel kit, Bioneer, KR) 및 RPL13A (Human reference qPCR primer set, Bioneer, KR)의 mRNA 발현 수준을 qRT-PCR로 분석하였다. qPCR array 후 도출되는 두 유전자의 Ct값을 2(- Delta Delta C(T)) Method [Livak KJ, Schmittgen TD. 2001. Methods. Dec;25(4):4 02-8]을 통하여 상대 정량 분석으로 대조군 대비 실험군의 각 유전자 mRNA의 상대적인 양 (fold change)을 계산하였다. 각 유전자에 대한 프라이머 서열은 하기와 같다 (표 4).
Figure PCTKR2022002765-appb-img-000030
그 결과, 멜라닌 소체에서 멜라닌 합성에 직접적으로 관여하는 효소인 TYR, TYRP1 및 TYRP2의 유전자 발현이 9종 miRNA에 의해 증가하는 것을 확인하였다 (도 4). 전사인자인 MITF의 경우 약하게 증가하거나 변화가 관찰되지 않는 것을 확인하였으며, 이는 MITF의 조절이 유전자 발현 뿐만 아니라 단백질 안정성 및 활성화(activity)에 의해 조절되는 기전이 존재하기 때문인 것으로 해석된다.
2-4: 인간 멜라닌 형성세포에서 멜라닌 생성 촉진 작용기전 분석을 위한 RT-qPCR 분석
인간 정상 피부조직에서 얻어낸 멜라닌형성세포(Human Epidermal Melanocytes)를 이용하여 9종 miRNA에 의한 MITF, TYR, TYRP1, TYRP2의 유전자 발현을 분석하였다. Human Epidermal Melanocytes (Invitrogen, US) 세포를 12 well plate (Falcon, US)에 1 Х 105 cells/well로 분주한 후 human melanocyte growth supplement-2 (Gibco, US)가 포함된 mammalian cell culture/primary cell culture (Gibco, US)에 37℃/5% CO2 조건으로 배양하였다. 다음날 miR-8485, miR-7978, miR-6074, miR-3132, miR-4644, miR-3139, miR-3189, miR-3199 또는 miR-933 9종을 각각 5 μM 농도로 처리하였다. 96 시간 배양 후 Universal RNA extraction kit (Bioneer, KR)을 이용하여 세포 용해물로부터 총 RNA를 추출하고, 이 RNA를 주형으로 AccuPower 　GreenStarTM RT-qPCR Master Mix (Bioneer, KR)를 이용하여 제조업자의 프로토콜에 따라 상기 유전자(Human qPCR panel kit, Bioneer, KR) 및 RPL13A (Human reference qPCR primer set, Bioneer, KR)의 mRNA 발현 수준을 qRT-PCR로 분석하였다.
그 결과, 인간 정상 멜라닌형성세포에서는 흑색종 세포인 M21 결과와는 다르게 miR-8485, miR-7978, miR-3139, miR-3189, miR-3199, miR-933에 의해 MITF의 유전자 발현이 음성대조군 대비 약 1.2 ~ 1.7배 증가하는 것을 확인하였다. 또한 TYR의 경우 9종 miRNA에 의해 약 1.2 ~ 3.1배 증가하는 것을 확인하였다. TYRP1 및 TYRP2의 경우 9종 miRNA 서열별로 발현양상의 차이가 관찰되었는데, miR-8485, miR-7978, miR-3189, miR-3199, miR-933의 경우 TYRP1 및 TYRP2가 모두 증가하는 경향성을 보였고, miR-6074, miR-3139, miR-4644의 경우 TYRP2만 증가되는 것을 확인하였다(도 5).
2-5: 멜라닌 생성 촉진 작용기전 분석을 위한 웨스턴 블랏 분석
멜라닌 생성 과정에서 중요한 인자인 MITF 및 TYR 단백질 발현 분석을 위해 웨스턴 블랏 분석을 수행하였다. SK-MEL-28 세포주를 6 well plate (Falcon, US)에 1 Х 105 cells/well로 분주한 후 37℃/5% CO2 조건으로 배양하였다. 다음날 실시예 2-1의 방법으로 SK-MEL-28 세포에 miR-3139, miR-3189, miR-3199, 또는 miR-8485를 각각 트랜스펙션하였다. 96 시간 배양 후, 웨스턴 블랏 프로토콜에 따라 분석을 진행하였다. 일차 항체는 MITF (Santa Cruz Biotechnology, Inc, US), Tyrosinase (Santa Cruz Biotechnology, Inc, US)을 사용하였고, 이차항체로는 HRP-linked-anti-mouse IgG (Cell Signaling Technology, US)와 HRP-linked-anti-rabbit IgG (Cell Signaling Technology, US)를 사용하였다.
그 결과, 상기의 RT-qPCR 결과와 유사하게 9종 miRNA에 의해 MITF 및 TYR 단백질이 증가하는 것을 확인하였다(도 6). 선별된 상위 9종 miRNA 처리에 의한 세포 색 변화, 멜라닌 합성량, 멜라닌 생성과정의 주요 유전자 및 단백질 발현결과를 종합하여 가장 멜라닌 합성량이 높으면서 MITF, TYR, TYRP1/2의 유전자 및 단백질 발현이 분명한 miR-3139, miR-3189, miR-3199, miR-8485 4종을 최종 선별하였다(표 5).
Figure PCTKR2022002765-appb-img-000031
실시예 3: 최종 선별된 4종 miRNA의 인간 머리카락 대상 효능평가
최종 선별된 4종 miRNA를 이용하여 사람 흰 머리카락을 대상으로 효능평가를 수행하였다. 모발은 실험 당일 흰 머리카락의 가장 끝 부분을 잡고 뽑아 채취하였으며, 모근에서부터 1~2 cm 정도로 자른 뒤에 24 well plate (Falcon, US)에 10% FBS (Hyclone, US) 및 1% Penicillin-Streptomycin (Hyclone, US)가 포함된 DMEM/F12 배지(Gibco, US) 200 μL에 배양을 시작하였다. 2일 간격으로 약 35일 동안 4종의 miRNA를 5 μM 농도로 처리하면서 흰 머리카락의 모근세포 증식, 모발 색 변화 및 성상을 관찰하였다.
그 결과, 음성대조군에서는 처리 기간 동안 큰 변화가 없었지만, miR-3139, miR-3189, miR-3199 또는 miR-8485로 처리된 군에서는 시간이 지남에 따라 Hair follicle의 외모근소　부위가 넓어지고, 모낭세포 및 각질형성세포의 증식(proliferation) 또는 이동(migration)의 증가가 관찰되었고, hair follicle의 길이 증가도 관찰되었다(도 7). 또한 모간(hair shaft)을 포함하여 전체적으로 회백색화가 개선되는 것을 확인하였다(도 8).
실시예 4: SK-MEL-28 세포에서 SAMiRNA-miR-3199의 멜라닌 생성 촉진 효능평가
4-1: 세포배양 및 SAMiRNA-miR-3199의 처리(treatment)
SAMiRNA-miR-3199의 멜라닌 생성 촉진 효능평가를 위해 인간 유래 피부암 세포주인 SK-MEL-28 (Korean cell line bank, KR)을 이용하였다. SK-MEL-28 세포주는 10% FBS (Hyclone, US) 및 1% Penicillin-Streptomycin (Hyclone, US)가 포함된 MEM 배지(Hyclone, US)를 이용하여 37℃/5% CO2 조건에서 배양하였다. SK-MEL-28 세포를 12 well plate (Falcon, US)에 4 × 104 cells/well의 조건으로 분주하고, 다음날 5 μM 농도로 처리하였다.
4-2: SAMiRNA-miR-3199 처리에 따른 멜라닌 생성량 분석
실시예 4-1의 방법으로 SK-MEL-28 세포에 SAMiRNA-miR-3199를 처리하였다. 72 시간 배양 후, 모든 세포를 모아서 색변화를 관찰하였고, 멜라닌 생성량 측정을 위해 멜라닌 추출 프로토콜에 따라 1M NaOH (Bioneer, KR)에 37℃에서 2시간 반응시킨 후, 파장 405 mm 하에 흡광도를 측정하여 멜라닌 생성량을 분석하였다.
그 결과 SAMiRNA-miR-3199를 처리한 경우 음성대조군에 비해 뚜렷한 색 변화 및 멜라닌량 증가가 관찰되었다(도 9a).
4-3: SAMiRNA-miR-3199 처리에 따른 멜라닌 생성 관련 유전자 발현 분석
SAMiRNA-miR-3199 처리에 따른 멜라닌 생성 관련 유전자 MITF, TYR, TYRP1, TYRP2의 유전자 분석을 위해 RT-qPCR 분석을 수행하였다. 실시예 4-1의 방법으로 SK-MEL-28 세포주에 SAMiRNA-miR-3199를 처리하였다. 96 시간 배양 후 Universal RNA extraction kit (Bioneer, KR)을 이용하여 세포 용해물로부터 총 RNA를 추출하고, 이 RNA를 주형으로 AccuPower 　GreenStarTM RT-qPCR Master Mix (Bioneer, KR)를 이용하여 제조업자의 프로토콜에 따라 상기 유전자(Human qPCR panel kit, Bioneer, KR) 및 RPL13A (Human reference qPCR primer set, Bioneer, KR)의 mRNA 발현 수준을 qRT-PCR로 분석하였다. qPCR array 후 도출되는 두 유전자의 Ct값을 2(- Delta Delta C(T)) Method [Livak KJ, Schmittgen TD. 2001. Methods. Dec;25(4):4 02-8]을 통하여 상대 정량 분석으로 대조군 대비 실험군의 각 유전자 mRNA의 상대적인 양 (fold change)을 계산하였다.
그 결과, SAMiRNA-miR-3199 처리에 의해 멜라닌 합성의 핵심 전사인자인 MITF가 유의적으로 증가하였고, 멜라닌 합성 핵심 효소인 TYR, TYRP1 및 TYRP2의 유전자 발현이 크게 증가하는 것을 확인하였다(도 9b).
4-4: SAMiRNA-miR-3199 처리에 따른 멜라닌 생성 관련 단백질 발현량 분석
멜라닌 생성 과정에서 핵심 인자인 MITF 및 TYR 단백질 발현 분석을 위해 immunoblot을 수행하였다. SK-MEL-28 세포주를 6 well plate (Falcon, US)에 1 Х 105 cells/well로 분주한 후 37℃/5% CO2 조건으로 배양하였다. 다음날 SK-MEL-28 세포주에 5 μM SAMiRNA-miR-3199를 처리하였다. 96시간 배양 후, immunoblot 프로토콜에 따라 분석을 진행하였다. 일차 항체는 MITF (Santa Cruz Biotechnology, Inc, US), Tyrosinase (Santa Cruz Biotechnology, Inc, US), α-Tubulin (Cell Signaling Technology, US)을 사용하였고, 이차항체로는 HRP-linked-anti-mouse IgG (Cell Signaling Technology, US)와 HRP-linked-anti-rabbit IgG (Cell Signaling Technology, US)를 사용하였다.
그 결과, RT-qPCR을 통한 유전자 발현 분석결과와 동일하게 SAMiRNA-miR-3199처리에 의해 MITF 및 TYR 단백질이 크게 증가하는 것을 확인하였다(도 9c).
4-5: SAMiRNA-miR-3199 처리에 따른 멜라닌 생성 관련 단백질 세포내 발현 분석
멜라닌 생성 핵심 인자인 MITF 및 TYR 단백질의 세포내 발현 패턴 분석을 위해 immunocytochemistry 분석을 수행하였다. 세포 분주 전 12 well plate (Falcon, US)에 cover glass를 넣고 Poly-L-lysine을 이용해 1시간 동안 코팅한 후, SK-MEL-28 세포주를 2 Х 104 cells/well로 분주하여 37℃/5% CO2 조건으로 배양하였다. 다음날 실시예 4-1의 방법으로 SK-MEL-28 세포주에 SAMiRNA-miR-3199를 처리하였다. 96 시간 배양 후, 세포 투과를 위해 0.1%의 Triton-X100 용액에 10분간 반응시킨 후, 1% BSA가 포함된 용액에 1시간 동안 blocking 하고, 일차 항체는 MITF (abcam, UK), Tyrosinase (Santa Cruz Biotechnology, Inc, US)을 사용하였고, 이차항체로는 HRP-linked-anti-mouse IgG (Cell Signaling Technology, US)와 HRP-linked-anti-rabbit IgG (Cell Signaling Technology, US)를 사용하였다. 염색된 세포의 형광 분석을 위해 스피닝 디스크 콘포칼(Dragonfly high-speed confocal image platform, Andor)을 이용하여 이미지를 분석하였다.
그 결과, SAMiRNA-miR-3199처리에 의해 전사인자인 MITF의 경우 핵에서 발현이 크게 증가하였고, 멜라닌 합성효소인 TYR의 경우 멜라닌 소체가 있는 세포질에서 발현이 크게 증가하는 것을 확인하였다(도 9d).
실시예 5: SAMiRNA-miR-3199의 타겟 유전자 분석 및 메커니즘 분석
5-1: miR-3199 타겟 유전자 분석
miRNA 타겟 유전자 예측 프로그램(TargetScan, http://www/targetscan.org/)을 이용하여 miR-3199의 씨앗서열과 결합이 가능한 예측된 많은 유전자 중에서 멜라닌 생성 기전의 주요 신호전달계 핵심 조절 인자인 GSK3β 유전자를 선별하였다. GSK3β의 3’ UTR의 4153-4159에 miR-3199의 결합이 예측되었다(도 10a).
5-2: SAMiRNA-miR-3199의 타겟 유전자 GSK3β mRNA 억제능 분석
SAMiRNA-miR-3199의 타겟 유전자 GSK3β mRNA 억제능 분석을 위해 RT-qPCR 분석을 수행하였다. SK-MEL-28 세포주를 12 well plate (Falcon, US)에 4 Х 104 cells/well로 분주한 후 37℃/5% CO2 조건으로 배양하였다. 다음날 실시예 4-1의 방법으로 SK-MEL-28 세포주에 SAMiRNA-miR-3199를 처리하였다. 24 시간 배양 후 Universal RNA extraction kit (Bioneer, KR)을 이용하여 세포 용해물로부터 총 RNA를 추출하고, 이 RNA를 주형으로 AccuPower 　GreenStarTM RT-qPCR Master Mix (Bioneer, KR)를 이용하여 제조업자의 프로토콜에 따라 GSK3β (Bioneer, KR) 및 RPL13A (Human reference qPCR primer set, Bioneer, KR)의 mRNA 발현 수준을 qRT-PCR로 분석하였다. qPCR array 후 도출되는 두 유전자의 Ct값을 2(- Delta Delta C(T)) Method [Livak KJ, Schmittgen TD. 2001. Methods. Dec;25(4):4 02-8]을 통하여 상대 정량 분석으로 대조군 대비 실험군의 각 유전자 mRNA의 상대적인 양 (fold change)을 계산하였다. GSK3β에 대한 프라이머 서열은 하기와 같다 (표 6).
Figure PCTKR2022002765-appb-img-000032
그 결과, SAMiRNA-miR-3199 처리에 의해 타겟 유전자인 GSK3β가 유의적으로 감소하는 것을 확인하였다(도 10b).
5-3: SAMiRNA-miR-3199 처리에 따른 GSK3β 단백질 발현량 분석
SAMiRNA-miR-3199의 GSK3β 단백질 억제능 분석을 위해 immunoblot을 수행하였다. SK-MEL-28 세포주를 6 well plate (Falcon, US)에 1 × 105 cells/well로 분주한 후 37℃/5% CO2 조건으로 배양하였다. 실시예 4-1의 방법으로 SK-MEL-28 세포주에 SAMiRNA-miR-3199를 처리하였다. 96 시간 배양 후, immunoblot 프로토콜에 따라 분석을 진행하였다. 일차 항체는 GSK3β (Cell Signaling Technology, Inc, US), β-catenin (Becton, Dickinson and Company Inc, US), α-Tubulin (Cell Signaling Technology, US)을 사용하였고, 이차항체로는 HRP-linked-anti-mouse IgG (Cell Signaling Technology, US)와 HRP-linked-anti-rabbit IgG (Cell Signaling Technology, US)를 사용하였다.
그 결과, RT-qPCR을 통한 GSK3β 유전자 발현 분석결과와 동일하게 SAMiRNA-miR-3199처리에 의해 GSK3β 단백질이 감소하는 것을 확인하였다. GSK3β는 β-catenin을 인산화하여 단백질 분해(degradation)를 촉진하여 단백질 안정성을 낮추고, GSK3β의 발현이 저해되면 β-catenin 단백질 안정성이 증가되어 단백질이 증가한다. 따라서 SAMiRNA-miR-3199처리에 의해 β-catenin 단백질이 증가하는 것을 확인하였다(도 10c).
5-4: SAMiRNA-miR-3199 처리에 따른 세포내 GSK3β 단백질 발현 패턴 분석
SAMiRNA-miR-3199 처리에 따른 세포내 GSK3β 단백질 발현 패턴 분석을 위해 immunocytochemistry를 수행하였다. 세포 분주전 12 well plate (Falcon, US)에 cover glass를 넣고 Poly-L-lysine을 이용해 1시간 동안 코팅한 후, SK-MEL-28 세포주를 2 × 104 cells/well로 분주하여 37℃/5% CO2 조건으로 배양하였다. 다음날 실시예 4-1의 방법으로 SK-MEL-28 세포주에 SAMiRNA-miR-3199를 처리하였다. 48 시간 배양 후, 세포 투과를 위해 0.1%의 Triton-X100 용액에 10분간 반응시킨 후, 1% BSA가 포함된 용액에 1시간 동안 blocking 하고 일차 항체는 GSK3β (Cell Signaling Technology, Inc, US), β-catenin (Becton, Dickinson and Company Inc, US)을 사용하였고, 이차항체로는 HRP-linked-anti-mouse IgG (Cell Signaling Technology, US)와 HRP-linked-anti-rabbit IgG (Cell Signaling Technology, US)를 사용하였다. 염색된 세포의 형광 분석을 위해 스피닝 디스크 콘포칼(Dragonfly high-speed confocal image platform, Andor)을 이용하여 분석하였다.
그 결과, SAMiRNA-miR-3199처리에 의해 타겟 유전자인 GSK3β의 발현이 감소하는 것을 확인하였고, β-catenin 단백질이 핵과 세포질에서 크게 증가하는 것을 확인하였다 (도10d).
5-5: SAMiRNA-miR-3199의 GSK3β mRNA의 3’ UTR에 직접 결합 여부 분석
miR-3199가 GSK3β mRNA의 3’ UTR에 직접 결하는지 분석하기 위해 luciferase reporter assay를 수행하였다. SK-MEL-28 세포주를 12 well plate (Falcon, US)에 3 × 104 cells/well로 분주한 후 37℃/5% CO2 조건으로 배양하였다. 다음날 SK-MEL-28 세포주에 GSK3β 결합부위가 정상인 GSK3β-wild type (WT) 또는 GSK3β 결합부위를 돌연변이 시킨(결합하지 못하는 형태) GSK3β-mutant (MT)가 삽입된 vector를 Lipofectamine RNAiMAX (Invitrogen, US)를 이용하여 트랜스펙션 시켰다. 동시에 5 μM의 SAMiRNA-miR-3199 각각 처리하였다. 96 시간 배양 후, luciferase activity 측정을 위해 Dual-Luciferase® Reporter Assay System (PromegaTM Corporation, US)를 사용하여 제조업자의 프로토콜에 따라 실험을 진행하여 분석하였다.
그 결과, 정상 결합부위를 가진 GSK3β-WT가 발현되고 있는 세포에 SAMiRNA-miR-3199 처리한 경우 luciferase activity 가 유의적으로 감소하였고, 돌연변이 결합부위를 가진 GSK3β-MT가 발현되고 있는 세포에서는 SAMiRNA-miR-3199 처리에 의한 luciferase activity 변화가 없음을 확인하였다(도 10e). 이를 통해 miR-3199가 GSK3β mRNA의 3’ UTR (4153-4159)에 직접 결합하여 GSK3β를 억제하는 것을 확인하였다.
실시예 6: 인간 멜라닌세포에서 SAMiRNA-miR-3199의 멜라닌 생성 촉진 효능평가
6-1: 세포배양 및 SAMiRNA-miR-3199의 처리(treatment)
SAMiRNA-miR-3199의 멜라닌 생성 촉진 효능평가를 위해 인간 정상 피부조직에서 얻어낸 Human Epidermal Melanocytes (HEMs, Invitrogen, US)를 이용하였다. HEMs는 melanocyte growth supplement-2 (Gibco, US)가 포함된 mammalian cell culture/primary cell culture medium (Gibco, US)에 37℃/5% CO2 조건으로 배양하였다. HEMs를 12 well plate (Falcon, US)에 1 Х 105 cells/well의 조건으로 분주하고, 다음날 SAMiRNA-miR-3199를 5 μM 농도로 처리하였다.
6-2: SAMiRNA-miR-3199 처리에 따른 멜라닌 생성량 분석
SAMiRNA-miR-3199의 효능평가를 위해 HEMs를 대상으로 색 변화 및 멜라닌 생성량을 측정하였다. 실시예 6-1의 방법으로 HEMs에 SAMiRNA-miR-3199를 5 μM 농도로 처리하였다. 72 시간 배양 후, 모든 세포를 모아서 색변화를 관찰하였고, 멜라닌 생성량 측정을 위해 멜라닌 추출 프로토콜에 따라 1M NaOH (Bioneer, KR)에 37℃에서 2시간 반응시킨 후, 파장 405 mm 하에 흡광도를 측정하여 멜라닌 생성량을 분석하였다.
그 결과 SAMiRNA-miR-3199를 처리한 경우 음성대조군에 비해 뚜렷한 색 변화 및 멜라닌량 증가가 관찰되었다(도 11a).
6-3: SAMiRNA-miR-3199 처리에 따른 멜라닌 생성 관련 유전자 발현 분석
SAMiRNA-miR-3199 처리 후 MITF, TYR, TYRP1, TYRP2, GSK3β 등의 유전자 분석을 위해 RT-qPCR 분석을 수행하였다. 실시예 6-1의 방법으로 HEMs에 SAMiRNA-miR-3199를 처리하였다. 96 시간 배양 후 Universal RNA extraction kit (Bioneer, KR)을 이용하여 세포 용해물로부터 총 RNA를 추출하고, 이 RNA를 주형으로 AccuPower　GreenStar™ RT-qPCR Master Mix (Bioneer, KR)를 이용하여 제조업자의 프로토콜에 따라 상기 유전자(Human qPCR panel kit, Bioneer, KR) 및 RPL13A (Human reference qPCR primer set, Bioneer, KR)의 mRNA 발현 수준을 qRT-PCR로 분석하였다. qPCR array 후 도출되는 두 유전자의 Ct값을 2(- Delta Delta C(T)) Method [Livak KJ, Schmittgen TD. 2001. Methods. Dec;25(4):4 02-8]을 통하여 상대 정량 분석으로 대조군 대비 실험군의 각 유전자 mRNA의 상대적인 양 (fold change)을 계산하였다.
그 결과, SAMiRNA-miR-3199 처리에 의해 MITF, TYR, TYRP1, TYRP2의 유전자 발현이 크게 증가하는 것을 확인하였다(도 11b). 또한 miR-3199의 타겟 유전자인 GSK3β이 유의적으로 감소하는 것을 확인하였다(도 11b).
6-4: SAMiRNA-miR-3199 처리에 따른 멜라닌 생성 핵심 단백질 발현량 분석
SAMiRNA-miR-3199 처리에 의한 MITF 및 TYR 단백질 발현 변화 분석을 위해 immunoblot을 수행하였다. HEMs를 6 well plate (Falcon, US)에 2 × 105 cells/well로 분주한 후 37℃/5% CO2 조건으로 배양하였다. 실시예 6-1의 방법으로 HEMs에 SAMiRNA-miR-3199를 처리하였다. 96 시간 배양 후, immunoblot 프로토콜에 따라 분석을 진행하였다. 일차 항체는 MITF (Santa Cruz Biotechnology, Inc, US), Tyrosinase (Santa Cruz Biotechnology, Inc, US), α-Tubulin (Cell Signaling Technology, US)을 사용하였고, 이차항체로는 HRP-linked-anti-mouse IgG (Cell Signaling Technology, US)를 사용하였다.
그 결과, RT-qPCR을 통한 유전자 발현 분석결과와 동일하게 SAMiRNA-miR-3199처리에 의해 MITF 및 TYR 단백질이 증가하는 것을 확인하였다(도 11c).
실시예 7: SAMiRNA-miR-3199의 세포독성 및 선천면역독성 평가
7-1: SAMiRNA-miR-3199의 세포독성 평가
SAMiRNA-miR-3199의 세포독성 평가를 위해 인간 모유두세포인 Human follicle dermal papilla cell (HFDPC, Promocell, DE), 각질형성세포인 HaCaT (ATCC, US), 인간 멜라닌세포(Human Epidermal Melanocytes, Invitrogen, US)를 이용하였다. 96 well plate (Falcon, US)에 HFDPC 3 × 103 cells/well, HaCaT 4 × 103 cells/well, HEMs 5 × 103 cells/well 로 분주한 후 37℃/5% CO2 조건으로 배양하였다. 다음날 각 세포에 SAMiRNA-miR-3199를 농도별(0, 1, 5, 10, 20, μM)로 처리하였다. 72 시간 배양 후, 세포독성 측정을 위해 WST assay kit (DOGEN, KR)를 사용하여 제조업자의 프로토콜에 따라 실험을 진행하여 분석하였다.
그 결과, 모든 세포주에서 고농도인 SAMiRNA-miR-3199 20 μM 농도에서도 세포독성이 관찰되지 않았다(도 12a).
7-2: SAMiRNA-miR-3199의 선천면역 독성 평가
SAMiRNA-miR-3199의 선천면역독성 평가를 위해 인간 말초혈액단핵세포(peripheral blood mononuclear cell, PBMC) (Cellular Technology Limited, US)를 이용하였다. 12 well plate (Falcon, US)에 5 × 105 cells/well로 분주한 후 37℃/5% CO2 조건으로 배양하였다. 다음날 SAMiRNA-miR-3199을 농도별(0, 5, 10, 20 μM)로 처리하였다. 6 시간 배양 후, Universal RNA extraction kit (Bioneer, KR)을 이용하여 세포 용해물로부터 총 RNA를 추출하고, 이 RNA를 주형으로 AccuPower　GreenStar™ RT-qPCR Master Mix (Bioneer, KR)를 이용하여 제조업자의 프로토콜에 따라 염증성 사이토카인 유전자(Human Immune qPCR panel kit, Bioneer, KR) 및 RPL13A (Human reference qPCR primer set, Bioneer, KR)의 mRNA 발현 수준을 qRT-PCR로 분석하였다. 각 유전자에 대한 프라이머 서열은 하기와 같다 (표 7).
Figure PCTKR2022002765-appb-img-000033
그 결과, 고농도인 SAMiRNA-miR-3199 20 μM 농도에서도 염증성 사이토카인(IL-1β, IL-6, IL-12β, TNF-α, INF-γ 등)의 증가가 관찰되지 않아 선천면역독성은 나타나지 않는 것으로 확인되었다(도 12b).
실시예 8: 이중가닥 올리고뉴클레오티드 구조체 (SAMiRNA)
본 발명에서 제조한 이중가닥 올리고뉴클레오티드 구조체는 하기 구조식 (5)과 같은 구조를 가진다.
C18-S-S-C6- 5' S 3' -폴리에틸렌글리콜2000 구조식 (5)
3' AS 5' -PO4
상기 구조식 (5)에서, S는 miRNA의 센스가닥, AS는 miRNA의 안티센스 가닥, PO4는 인산기, 폴리에틸렌글리콜은 친수성 물질 단량체로 폴리에틸렌글리콜2000 (polyethylene glycol 2000)이 링커인 인산기(PO3 -)를 통해 결합되고, C24는 소수성 물질로 이황화 결합이 포함되어 있고, 5' 및 3'은 이중가닥 올리고 RNA의 말단방향을 의미한다.
상기 구조식 (5)에서의 miRNA의 센스가닥은 DMT-폴리에틸렌글리콜2000-CPG를 지지체로 하고 β시아노에틸포스포아미다이트를 이용하여 RNA 골격구조를 이루는 포스포디에스터 결합을 연결해가는 방법을 통해 3' 말단 부위에 폴리에틸렌글리콜이 결합된 센스가닥을 포함하는 올리고 RNA-친수성 물질 구조체를 합성한 뒤, 이황화 결합이 포함되어 있는 소수성 C24을 5' 말단에 결합하여 원하는 RNA-고분자 구조체의 센스가닥을 제조하였다. 센스가닥과 어닐링을 수행할 안티센스 가닥의 경우 또한 β시아노에틸포스포아미다이트를 이용하여 RNA 골격구조를 이루는 포스포디에스터 결합을 연결해 가는 방법을 사용하여 센스가닥과 상보적인 서열의 안티센스 가닥을 제조한 뒤에 5' 말단에 인산기가 결합된 안티센스 가닥을 제조하였다.
본 발명에 따른 조성물은 멜라닌 형성 세포를 활성화시키고 멜라닌의 생성을 촉진하여 모발의 회백색화를 예방하고 그 진행 속도를 늦출 수 있으며, 이미 회백색화가 진행된 모발을 회백색화 이전의 모발 상태로 개선할 수 있어, 종래 모발의 회백색화를 감추기 위하여 반복 사용하던 단순 염색제와는 차별화된 부작용 없이 약학적 용도 및 화장료나 염모용 조성물로 유용하게 활용될 수 있다. 또한 멜라닌 생성 세포 활성과 더불어 모낭에 존재하는 모유두 세포 및 각질형성세포의 증식을 촉진하여 부작용 없이 탈모증 완화 및 발모 촉진을 유도할 수 있는 약학적 용도 및 화장료 조성물로 유용하게 활용될 수 있다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적 기술은 단지 바람직한 실시태양일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
전자파일 첨부하였음.

Claims (35)

  1. (i) miR-3139, miR-3189, miR-3199 또는 miR-8485;
    (ii) 하기 구조식 (1)의 구조를 포함하는 이중가닥 올리고뉴클레오티드 구조체:
    A-X-R-Y-B 구조식 (1)
    상기 구조식 (1)에서 A는 친수성 물질, B는 소수성 물질, X 및 Y는 각각 독립적으로 단순 공유결합 또는 링커가 매개된 공유결합을 의미하며, R은 miR-3139, miR-3189, miR-3199, 또는 miR-8485를 의미함; 또는
    (iii) 상기 이중가닥 올리고뉴클레오티드 구조체를 포함하는 나노입자;를 유효성분으로 포함하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 약학적 조성물.
  2. 제1항에 있어서, 상기 miR-3139는 서열번호 9로 표시되는 염기서열 및 서열번호 10으로 표시되는 염기서열을 포함하는 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 약학적 조성물.
  3. 제1항에 있어서, 상기 miR-3189는 서열번호 5로 표시되는 염기서열 및 서열번호 6으로 표시되는 염기서열을 포함하는 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 약학적 조성물.
  4. 제1항에 있어서, 상기 miR-3199는 서열번호 15로 표시되는 염기서열 및 서열번호 16으로 표시되는 염기서열을 포함하는 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 약학적 조성물.
  5. 제1항에 있어서, 상기 miR-8485는 서열번호 1로 표시되는 염기서열 및 서열번호 2로 표시되는 염기서열을 포함하는 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 약학적 조성물.
  6. 제1항에 있어서,
    상기 친수성 물질은 (P)n, (Pm-J)n 또는 (J-Pm)n으로 표시되고, P는 친수성 물질 단량체(monomer), n은 1 내지 200, m은 1 내지 15, J는 m개의 친수성 물질 단량체 간 또는 m개의 친수성 물질 단량체와 올리고뉴클레오티드를 서로 연결하는 링커인 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 약학적 조성물.
  7. 제1항에 있어서,
    상기 친수성 물질은 분자량이 200 내지 10,000인 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 약학적 조성물.
  8. 제1항에 있어서,
    상기 친수성 물질은 폴리에틸렌 글리콜(PEG), 폴리비닐피롤리돈 및 폴리옥사졸린으로 구성된 군에서 선택되는 어느 하나인 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 약학적 조성물.
  9. 제6항에 있어서,
    상기 친수성 물질 단량체(P)는 하기 화합물 (1)의 구조를 갖는 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 약학적 조성물:
    Figure PCTKR2022002765-appb-img-000034
    상기 화합물 (1)에서 G는 CH2, O, S 및 NH로 이루어진 군에서 선택된다.
  10. 제6항에 있어서,
    상기 링커(J)는 PO3 -, SO3 및 CO2로 구성된 군에서 선택되는 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 약학적 조성물.
  11. 제1항에 있어서,
    상기 소수성 물질의 분자량은 250 내지 1,000인 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 약학적 조성물.
  12. 제11항에 있어서,
    상기 소수성 물질은 스테로이드(steroid) 유도체, 글리세라이드(glyceride) 유도체, 글리세롤 에테르(glycerol ether), 폴리프로필렌 글리콜(polypropylene glycol), C12 내지 C50의 불포화 또는 포화탄화수소(hydrocarbon), 디아실포스파티딜콜린(diacylphosphatidylcholine), 지방산(fatty acid), 인지질(phospholipid) 및, 리포폴리아민(lipopolyamine)으로 구성된 군에서 선택되는 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 약학적 조성물.
  13. 제12항에 있어서,
    상기 스테로이드(steroid) 유도체는 콜레스테롤, 콜레스탄올, 콜산, 콜리스테릴포르메이트, 코테스타닐포르메이트 및 콜리스타닐아민으로 구성된 군에서 선택되는 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 약학적 조성물.
  14. 제12항에 있어서
    상기 글리세라이드 유도체는 모노-, 디- 및 트리-글리세라이드에서 선택되는 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 약학적 조성물.
  15. 제1항에 있어서,
    상기 X 및 Y 로 표시되는 공유결합은 비분해성 결합 또는 분해성 결합인 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 약학적 조성물.
  16. 제15항에 있어서,
    상기 비분해성 결합은 아미드 결합 또는 인산화 결합인 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 약학적 조성물.
  17. 제15항에 있어서,
    상기 분해성 결합은 이황화 결합, 산분해성 결합, 에스테르 결합, 안하이드라이드 결합, 생분해성 결합 또는 효소 분해성 결합인 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 약학적 조성물.
  18. (i) miR-3139, miR-3189, miR-3199 또는 miR-8485;
    (ii) 하기 구조식 (1)의 구조를 포함하는 이중가닥 올리고뉴클레오티드 구조체:
    A-X-R-Y-B 구조식 (1)
    상기 구조식 (1)에서 A는 친수성 물질, B는 소수성 물질, X 및 Y는 각각 독립적으로 단순 공유결합 또는 링커가 매개된 공유결합을 의미하며, R은 miR-3139, miR-3189, miR-3199 또는 miR-8485를 의미함; 또는
    (iii) 상기 이중가닥 올리고뉴클레오티드 구조체를 포함하는 나노입자;를 유효성분으로 포함하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 화장료 조성물.
  19. 제18항에 있어서, 상기 miR-3139는 서열번호 9로 표시되는 염기서열 및 서열번호 10으로 표시되는 염기서열을 포함하는 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 화장료 조성물.
  20. 제18항에 있어서, 상기 miR-3189는 서열번호 5로 표시되는 염기서열 및 서열번호 6으로 표시되는 염기서열을 포함하는 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 화장료 조성물.
  21. 제18항에 있어서, 상기 miR-3199는 서열번호 15로 표시되는 염기서열 및 서열번호 16으로 표시되는 염기서열을 포함하는 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 화장료 조성물.
  22. 제18항에 있어서, 상기 miR-8485는 서열번호 1로 표시되는 염기서열 및 서열번호 2로 표시되는 염기서열을 포함하는 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 화장료 조성물.
  23. 제18항에 있어서,
    상기 친수성 물질은 (P)n, (Pm-J)n 또는 (J-Pm)n으로 표시되고, P는 친수성 물질 단량체(monomer), n은 1 내지 200, m은 1 내지 15, J는 m개의 친수성 물질 단량체 간 또는 m개의 친수성 물질 단량체와 올리고뉴클레오티드를 서로 연결하는 링커인 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 화장료 조성물.
  24. 제18항에 있어서,
    상기 친수성 물질은 분자량이 200 내지 10,000인 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 화장료 조성물.
  25. 제18항에 있어서,
    상기 친수성 물질은 폴리에틸렌 글리콜(PEG), 폴리비닐피롤리돈 및 폴리옥사졸린으로 구성된 군에서 선택되는 어느 하나인 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 화장료 조성물.
  26. 제23항에 있어서,
    상기 친수성 물질 단량체(P)는 하기 화합물 (1)의 구조를 갖는 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 화장료 조성물:
    Figure PCTKR2022002765-appb-img-000035
    상기 화합물 (1)에서 G는 CH2, O, S 및 NH로 이루어진 군에서 선택된다.
  27. 제23항에 있어서,
    상기 링커(J)는 PO3 -, SO3 및 CO2로 구성된 군에서 선택되는 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 화장료 조성물.
  28. 제18항에 있어서,
    상기 소수성 물질의 분자량은 250 내지 1,000인 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 화장료 조성물.
  29. 제28항에 있어서,
    상기 소수성 물질은 스테로이드(steroid) 유도체, 글리세라이드(glyceride) 유도체, 글리세롤 에테르(glycerol ether), 폴리프로필렌 글리콜(polypropylene glycol), C12 내지 C50의 불포화 또는 포화탄화수소(hydrocarbon), 디아실포스파티딜콜린(diacylphosphatidylcholine), 지방산(fatty acid), 인지질(phospholipid) 및, 리포폴리아민(lipopolyamine)으로 구성된 군에서 선택되는 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 화장료 조성물.
  30. 제29항에 있어서,
    상기 스테로이드(steroid) 유도체는 콜레스테롤, 콜레스탄올, 콜산, 콜리스테릴포르메이트, 코테스타닐포르메이트 및 콜리스타닐아민으로 구성된 군에서 선택되는 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 화장료 조성물.
  31. 제29항에 있어서
    상기 글리세라이드 유도체는 모노-, 디- 및 트리-글리세라이드에서 선택되는 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 화장료 조성물.
  32. 제18항에 있어서,
    상기 X 및 Y 로 표시되는 공유결합은 비분해성 결합 또는 분해성 결합인 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 화장료 조성물.
  33. 제32항에 있어서,
    상기 비분해성 결합은 아미드 결합 또는 인산화 결합인 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 화장료 조성물.
  34. 제32항에 있어서,
    상기 분해성 결합은 이황화 결합, 산분해성 결합, 에스테르 결합, 안하이드라이드 결합, 생분해성 결합 또는 효소 분해성 결합인 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 화장료 조성물.
  35. 제18항에 있어서, 상기 화장료 조성물은 헤어토닉, 헤어컨디셔너, 헤어에센스, 헤어로션, 헤어영양로션, 헤어샴푸, 헤어린스, 헤어트리트먼트, 헤어크림, 헤어영양크림, 헤어모이스처크림, 헤어맛사지크림, 헤어왁스, 헤어에어로졸, 헤어팩, 헤어영양팩, 헤어비누, 헤어클렌징폼, 머릿기름, 모발건조제, 모발보존처리제, 모발염색제, 모발용 웨이브제, 모발탈색제, 헤어겔, 헤어글레이즈, 헤어드레싱어, 헤어래커, 헤어모이스처라이저, 헤어무스 및 헤어스프레이로 구성된 군에서 선택되는 것을 특징으로 하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 화장료 조성물.
PCT/KR2022/002765 2021-02-25 2022-02-25 이중가닥 mirna를 유효성분으로 포함하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 조성물 Ceased WO2022182188A1 (ko)

Priority Applications (6)

Application Number Priority Date Filing Date Title
JP2023549095A JP7695727B2 (ja) 2021-02-25 2022-02-25 二本鎖ｍｉＲＮＡを有効成分として含む毛髪の灰白色化改善、発毛促進及び／または脱毛の予防または改善用組成物
EP22760104.4A EP4299078A4 (en) 2021-02-25 2022-02-25 Composition for alleviating hair graying, promoting hair growth and/or preventing or alleviating hair loss, comprising double-stranded mirna as active ingredient
CA3206861A CA3206861A1 (en) 2021-02-25 2022-02-25 Composition for alleviating hair graying, promoting hair growth and/or preventing or alleviating hair loss, comprising double-stranded mirna as active ingredient
CN202280014067.3A CN116847888A (zh) 2021-02-25 2022-02-25 用于减轻毛发变白、促进毛发生长和/或预防或减轻脱发的包含双链miRNA作为活性成分的组合物
US18/261,882 US20240299437A1 (en) 2021-02-25 2022-02-25 Composition for alleviating hair graying, promoting hair growth and/or preventing or alleviating hair loss, comprising double-stranded mirna as active ingredient
AU2022226837A AU2022226837B2 (en) 2021-02-25 2022-02-25 Composition for alleviating hair graying, promoting hair growth and/or preventing or alleviating hair loss, comprising double-stranded mirna as active ingredient

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20210025554 2021-02-25
KR10-2021-0025554 2021-02-25

Publications (1)

Publication Number Publication Date
WO2022182188A1 true WO2022182188A1 (ko) 2022-09-01

Family

ID=83049563

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/002765 Ceased WO2022182188A1 (ko) 2021-02-25 2022-02-25 이중가닥 mirna를 유효성분으로 포함하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 조성물

Country Status (8)

Country Link
US (1) US20240299437A1 (ko)
EP (1) EP4299078A4 (ko)
JP (1) JP7695727B2 (ko)
KR (1) KR20220121743A (ko)
CN (1) CN116847888A (ko)
AU (1) AU2022226837B2 (ko)
CA (1) CA3206861A1 (ko)
WO (1) WO2022182188A1 (ko)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100883471B1 (ko) 2005-08-17 2009-02-16 (주)바이오니아 siRNA의 세포내 전달을 위한 siRNA와 친수성 고분자 간의접합체 및 그의 제조방법
KR101224828B1 (ko) 2009-05-14 2013-01-22 (주)바이오니아 ｓｉＲＮＡ 접합체 및 그 제조방법
WO2016014478A1 (en) * 2014-07-21 2016-01-28 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College USE OF AN miRNA TO REDUCE PROLIFERATION OF A CANCER CELL
KR101862349B1 (ko) 2013-07-05 2018-05-31 (주)바이오니아 개선된 고효율 나노입자형 올리고뉴클레오타이드 구조체 및 그의 제조방법
KR101960067B1 (ko) * 2015-02-25 2019-03-20 (주)바이오니아 마이크로 rna를 유효 성분으로 포함하는 암 치료용 약학 조성물
KR20190062263A (ko) * 2017-11-27 2019-06-05 (주)프로스테믹스 miRNA를 포함하는 탈모 방지 또는 발모 촉진용 조성물

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0373195B1 (en) * 1988-03-30 1994-06-15 Trustees Of Boston University Composition for increasing melanin content of melanocytes in-vivo and in-vitro and methods for the in-vitro use thereof
KR101800243B1 (ko) * 2011-06-22 2017-12-20 (주)아모레퍼시픽 마이크로 ｒｎａ를 포함하는 색소형성유전자 발현조절용 조성물
KR101849102B1 (ko) * 2011-06-22 2018-04-17 (주)아모레퍼시픽 마이크로 ｒｎａ를 포함하는 색소형성유전자 발현조절용 조성물
KR101938548B1 (ko) * 2011-06-23 2019-01-15 (주)아모레퍼시픽 마이크로 ｒｎａ를 포함하는 색소형성유전자 발현조절용 조성물
EP3178943B1 (en) * 2013-12-17 2018-10-03 Csir A method for identification of anti-hiv human mirna mimics and mirna inhibitors and anti-hiv pharmaceutical compounds
US20190300882A1 (en) 2016-06-07 2019-10-03 Garvan Institute Of Medical Research Methods of treating neuroblastoma and reagents therefor
US10682425B2 (en) 2016-12-14 2020-06-16 The Regents Of The University Of California Engineered B lymphocytes and compositions having micro-RNA and methods for making and using them
KR102141124B1 (ko) * 2018-01-30 2020-08-04 (주)바이오니아 이중 가닥 miRNA를 포함하는 이중나선 올리고뉴클레오타이드 구조체 및 이의 용도
KR102370637B1 (ko) * 2019-01-15 2022-03-07 (주)바이오니아 Dkk1 유전자를 표적으로 하는 이중나선 올리고뉴클레오티드, 이를 포함하는 구조체 및 이를 포함하는 탈모 예방 또는 발모용 조성물

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100883471B1 (ko) 2005-08-17 2009-02-16 (주)바이오니아 siRNA의 세포내 전달을 위한 siRNA와 친수성 고분자 간의접합체 및 그의 제조방법
KR101224828B1 (ko) 2009-05-14 2013-01-22 (주)바이오니아 ｓｉＲＮＡ 접합체 및 그 제조방법
KR101862349B1 (ko) 2013-07-05 2018-05-31 (주)바이오니아 개선된 고효율 나노입자형 올리고뉴클레오타이드 구조체 및 그의 제조방법
WO2016014478A1 (en) * 2014-07-21 2016-01-28 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College USE OF AN miRNA TO REDUCE PROLIFERATION OF A CANCER CELL
KR101960067B1 (ko) * 2015-02-25 2019-03-20 (주)바이오니아 마이크로 rna를 유효 성분으로 포함하는 암 치료용 약학 조성물
KR20190062263A (ko) * 2017-11-27 2019-06-05 (주)프로스테믹스 miRNA를 포함하는 탈모 방지 또는 발모 촉진용 조성물

Non-Patent Citations (21)

* Cited by examiner, † Cited by third party
Title
AGOSTINI, M.KNIGHT, R.A., ONCOTARGET, vol. 5, 2014, pages 872 - 81
AKHTAR S, J. CLIN INVEST., vol. 117, no. 12, 3 December 2007 (2007-12-03), pages 3623 - 3632
AKHTAR S, J., CLIN. INVEST., vol. 117, no. 12, 3 December 2007 (2007-12-03), pages 3623 - 3632
BIAN YUE, GUO JUNFU, QIAO LINLIN, SUN XIUJU: "miR-3189-3p Mimics Enhance the Effects of S100A4 siRNA on the Inhibition of Proliferation and Migration of Gastric Cancer Cells by Targeting CFL2", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 19, no. 1, 13 January 2018 (2018-01-13), pages 236, XP055961486, DOI: 10.3390/ijms19010236 *
BRODERSEN, P.VOINNET, O., NAT. REV. MOL. CELL BIOL., vol. 10, 2009, pages 141 - 148
CARTHEW, R.W.SONTHEIMER, E.J., CELL, vol. 136, 2009, pages 656 - 68
DANGWAL, S.THUM, T., ANNU. REV. PHARMACOLTOXICOL., vol. 54, 2014, pages 185 - 203
D'MELLO, S. A.FINLAY, G. J.BAGULEY, B. C.ASKARIAN-AMIRI, M. E.: "Signaling Pathways in Melanogenesis", INT. J. MOL. SCI., vol. 17, 2016, pages 17
FRANCESCO M., VDRUG DISCOVERY TODAY, vol. 10, no. 21, 2005, pages 1451 - 1458
FY XIE., DRUG DISCOV. TODAY., vol. 11, no. 1-2, January 2006 (2006-01-01), pages 67 - 73
IORNS, E., LORD, C.J., TURNER, N. & ASHWORTH, A., DRUG DISCOV., vol. 6, 2007, pages 556 - 68
IORNS, E.LORD, C.J.TURNER, N.ASHWORTH, A., NAT. REV. DRUG DISCOV., vol. 6, 2007, pages 556 - 68
J. SOUTSCHEK, NATURE, vol. 11, no. 432, 2004, pages 7014
KAWAKAMI AFISHER DE.: "The master role of microphthalmia-associated transcription factor in melanocyte and melanoma biology", LAB. INVESTIG., 2017
LIVAK KJSCHMITTGEN TD., METHODS, vol. 25, no. 4, 2001, pages 4 02 - 8
LIVAK KJSCHMITTGEN TD., METHODS., vol. 25, no. 4, 2001, pages 4 02 - 8
MACFARLANE, L.-A.MURPHY, P.R., CURRENT GENOMICS, vol. 11, 2010, pages 537 - 561
NIU, C.AISA, H.A.: "Upregulation of melanogenesis and tyrosinase activity: potential agents for vitiligo", MOLECULES, vol. 22, 2017, pages E1303
S.H. KIM, J. CONTROL RELEASE, vol. 129, no. 2, 2008, pages 107 - 16
S.H. KIM, J., CONTROL RELEASE, vol. 129, no. 2, 2008, pages 107 - 16
See also references of EP4299078A4

Also Published As

Publication number Publication date
CN116847888A (zh) 2023-10-03
AU2022226837A9 (en) 2024-09-19
JP7695727B2 (ja) 2025-06-19
CA3206861A1 (en) 2022-09-01
US20240299437A1 (en) 2024-09-12
AU2022226837A1 (en) 2023-07-20
JP2024508742A (ja) 2024-02-28
EP4299078A4 (en) 2025-01-15
KR20220121743A (ko) 2022-09-01
EP4299078A1 (en) 2024-01-03
AU2022226837B2 (en) 2025-10-09

Similar Documents

Publication Publication Date Title
WO2019156365A1 (ko) 엔도좀 탈출능을 갖는 펩티드 핵산 복합체 및 이의 용도
WO2013089522A1 (ko) 신규한 올리고뉴클레오티드 접합체 및 그 용도
WO2020111614A1 (ko) 안드로젠 수용체 특이적 서열을 포함하는 이중나선 올리고뉴클레오티드 구조체, 및 이를 포함하는 탈모 예방 및 발모용 조성물
WO2015002511A1 (ko) 개선된 고효율 나노입자형 올리고뉴클레오타이드 구조체 및 그의 제조방법
WO2015002513A2 (ko) 호흡기 질환 연관 유전자 특이적 siRNA, 그러한 siRNA를 포함하는 이중나선 올리고 RNA 구조체 및 이를 포함하는 호흡기 질환 예방 또는 치료용 조성물
WO2015152693A2 (ko) 신규 이중 나선 올리고 rna 및 이를 포함하는 섬유증 또는 호흡기 질환의 예방 또는 치료용 약학조성물
WO2018030789A1 (ko) 세포투과성이 향상된 펩티드 핵산 복합체 및 이를 포함하는 약학적 조성물
WO2010131916A2 (ko) siRNA 접합체 및 그 제조방법
WO2019225968A1 (ko) 엠피레귤린 유전자 특이적 이중가닥 올리고뉴클레오티드 및 이를 포함하는 섬유증 관련 질환 및 호흡기 관련 질환 예방 및 치료용 조성물
WO2013103249A1 (ko) 고효율 나노입자형 이중나선 올리고 rna 구조체 및 그의 제조방법
WO2019156366A1 (ko) 핵산 복합체를 함유하는 피부 투과성 전달체 및 이의 용도
WO2015005670A1 (en) LIVER CANCER RELATED GENES-SPECIFIC siRNA, DOUBLE-STRANDED OLIGO RNA MOLECULES COMPRISING THE siRNA, AND COMPOSITION FOR PREVENTING OR TREATING CANCER COMPRISING THE SAME
WO2016140492A1 (ko) 신규 dna-rna 하이브리드 정사면체 구조물 또는 rna 정사면체 구조물
WO2015005669A1 (en) LIVER CANCER RELATED GENES-SPECIFIC siRNA, DOUBLE-STRANDED OLIGO RNA MOLECULES COMPRISING THE siRNA, AND COMPOSITION FOR PREVENTING OR TREATING CANCER COMPRISING THE SAME
WO2020149644A1 (ko) Dkk1 유전자를 표적으로 하는 이중나선 올리고뉴클레오티드, 이를 포함하는 구조체 및 이를 포함하는 탈모 예방 또는 발모용 조성물
WO2020027641A1 (ko) 아토피성 질환 예방 또는 치료용 약학적 조성물
WO2022182188A1 (ko) 이중가닥 mirna를 유효성분으로 포함하는 모발의 회백색화 개선, 발모 촉진 및/또는 탈모의 예방 또는 개선용 조성물
WO2014054927A1 (ko) 엠피레귤린 특이적 이중 나선 올리고 rna, 그러한 이중나선 올리고 rna를 포함하는 이중나선 올리고 rna 구조체 및 이를 포함하는 호흡기 질환의 예방 또는 치료용 조성물
WO2021010723A1 (en) Melanophilin antisense oligonucleotides
WO2015002512A1 (ko) 뎅기 바이러스 특이적 siRNA, 그러한 siRNA를 포함하는 이중나선 올리고 RNA 구조체 및 이를 포함하는 뎅기 바이러스 증식 억제용 조성물
WO2021101113A1 (ko) Ctgf 유전자 특이적 이중가닥 올리고뉴클레오티드 및 이를 포함하는 섬유증 관련 질환 및 호흡기 관련 질환 예방 및 치료용 조성물
WO2023075527A1 (ko) 지질 나노입자 및 세포 투과성을 갖는 신규 펩타이드의 복합체
WO2017188707A1 (en) Dicer substrate rna nanostructures with enhanced gene silencing effect and preparation method thereof
WO2022191567A1 (ko) Covid-19를 포함하는 호흡기 바이러스 감염증, 바이러스 감염에 의한 폐섬유증, 또는 호흡기 질환 예방 또는 치료를 위한 초음파 방식 연무식 흡입기를 이용한 이중가닥 올리고뉴클레오티드 구조체 투여용 조성물
WO2016204515A1 (ko) STAT3 유전자 특이적 siRNA, 그러한 siRNA를 포함하는 이중나선 올리고 RNA 구조체, 이를 포함하는 조성물 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22760104

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 18261882

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2022226837

Country of ref document: AU

Date of ref document: 20220225

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 3206861

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 202327051514

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 202280014067.3

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: 2023549095

Country of ref document: JP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023016608

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112023016608

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20230817

WWE Wipo information: entry into national phase

Ref document number: 2022760104

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022760104

Country of ref document: EP

Effective date: 20230925