WO2018231034A2 - 암의 예방 또는 치료용 약학적 조성물 - Google Patents

암의 예방 또는 치료용 약학적 조성물 Download PDF

Info

Publication number
WO2018231034A2
WO2018231034A2 PCT/KR2018/006865 KR2018006865W WO2018231034A2 WO 2018231034 A2 WO2018231034 A2 WO 2018231034A2 KR 2018006865 W KR2018006865 W KR 2018006865W WO 2018231034 A2 WO2018231034 A2 WO 2018231034A2
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
mirna
pharmaceutical composition
seq
mir
Prior art date
Application number
PCT/KR2018/006865
Other languages
English (en)
French (fr)
Other versions
WO2018231034A3 (ko
Inventor
서민구
우은영
박은주
고성렬
이준원
최은욱
이원종
Original Assignee
(주)프로스테믹스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)프로스테믹스 filed Critical (주)프로스테믹스
Priority to US16/623,249 priority Critical patent/US20210139895A1/en
Publication of WO2018231034A2 publication Critical patent/WO2018231034A2/ko
Publication of WO2018231034A3 publication Critical patent/WO2018231034A3/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/04—Antineoplastic agents specific for metastasis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification

Definitions

  • the present invention relates to a pharmaceutical composition that can effectively prevent or treat cancer.
  • MicroRNAs are small non-coding RNAs consisting of 18-25 nucleotides (nts), which bind to the 3'-untranslated region (UTR) of the target gene to regulate gene expression (Bartel DP , et al., Cell 116: 281-297, 2004; Lewis BP, et al., Cell 120: 15-20, 2005), processing from introns, exons or intergenic regions. (Rodriguez A, et al., Genome Res 14: 1902-1910, 2004). First, miRNAs are transcribed by RNA polymerase into early miRNA (pri-miRNA) molecules containing thousands of nucleotides.
  • pri-miRNA early miRNA
  • the pri-miRNA is then microprocessord to form approximately 70 nt stem ring intermediates known as miRNA precursors (DroshaRNase endonuclease and DiGeorge syndrome region gene 8 protein, DGCR8). (Lee Y, et al., EMBO J21: 4663-4670, 2000; Zeng Y, et al., Proc Natl Acad Sci US A100: 9779-9784, 2003). Then, the pre-miRNA is transferred from the nucleus to the cytoplasm via the cofactor Ran-GTP with exopoltin-5 (EXP5), where the pre-miRNA is 18-25 by RNase endonuclease dicer.
  • miRNA precursors DroshaRNase endonuclease and DiGeorge syndrome region gene 8 protein, DGCR8
  • DGCR8 DiGeorge syndrome region gene 8 protein
  • Mature miRNA duplexes are incorporated into the RNA-induced silencing complex (RISC) as Argonaute protein and single-stranded RNA, which induces either cleavage or translational inhibition of the target mRNA (Diederichs S, et al., Cell 131: 1097-1108, 2007; Hammond SM, et al., Nature 404: 293-296, 2000; Martinez et al., Cell 110: 563-574, 2002).
  • RISC RNA-induced silencing complex
  • miRNAs are involved in various biological processes associated with cancer development, including the proliferation and infiltration of cancer cells, and miRNA expression is bidirectionally regulated in many types of cancers (Esquela-Kerscher A, et al., Nat Rev Cancer 6: 259-269). , 2006).
  • Cancer is one of the most common causes of death worldwide. About 10 million new cases occur each year, accounting for about 12% of all deaths, causing the third largest number of deaths.
  • breast cancer is the most common malignant tumor that causes more than 40,000 deaths every year for women, but early diagnosis is very important.However, despite many known anti-cancer therapies, the survival rate is high when cancer is advanced or metastasized. This situation has not been improved.
  • Chemotherapy a representative anticancer therapy, is currently used as the most efficient therapy for treating cancer, either alone or in combination with other therapies such as radiotherapy.
  • the efficacy of a cancer treatment drug in chemotherapy depends on its ability to kill cancer cells, but there is a problem in that the drug may act on cancer cells as well as general cells.
  • Cancer stem cells are cancer cells with unlimited regenerative capacity, and the hypothesis that tumors will originate from stem cells suggests that a group of cells that could become cancer stem cells in acute myeloid leukemia in the late 1990s was transplanted into immunosuppressed mice. It was confirmed that human leukemia could be reproduced in rats, and after that, cancer stem cells were proved in breast cancer, which confirmed the existence of stem cells in solid carcinomas.
  • Cancer stem cells may be a new target therapeutic field.
  • Notch signaling is carried out by an enzyme called gamma secretase, which can be used to inhibit tumors by using a gamma secretase inhibitor in Notch1 overexpressed breast cancer.
  • gamma secretase an enzyme that can be used to inhibit tumors by using a gamma secretase inhibitor in Notch1 overexpressed breast cancer.
  • targeting the hedgehog signaling system has been shown to be anti-cancer effect.
  • the hedgehog inhibitor cyclopamine was administered to a tumor xenograft animal, the tumor dramatically contracted.
  • One object of the present invention is to provide a pharmaceutical composition capable of preventing and / or treating cancer.
  • Another object of the present invention is to provide a pharmaceutical composition capable of effectively inhibiting the growth of cancer stem cells to prevent and / or treat cancer, as well as to prevent the resistance, metastasis and recurrence of cancer.
  • misa of hsa-miR-328-3p, hsa-miR-6514-5p and hsa-miR-503-3p effectively inhibit the growth and proliferation of cancer stem cells as well as cancer cells, metastasis of cancer It has also been found to inhibit and lead to the present invention.
  • a miRNA comprising a seed sequence represented by any one of SEQ ID NOs: 1 to 3; An expression vector comprising the same; Or it relates to a pharmaceutical composition for the prevention or treatment of cancer comprising a transformant transformed with the expression vector as an active ingredient.
  • a miRNA comprising a seed sequence represented by any one of SEQ ID NOs: 1 to 3; An expression vector comprising the same; Or it relates to a pharmaceutical composition for inhibiting the growth of cancer stem cells comprising a transformant transformed with the expression vector as an active ingredient.
  • a miRNA comprising a seed sequence represented by any one of SEQ ID NOs: 1 to 3; An expression vector comprising the same; Or it relates to a pharmaceutical composition for the prevention or treatment of metastasis of cancer comprising a transformant transformed with the expression vector as an active ingredient.
  • miRNA comprising a seed sequence represented by any one of SEQ ID NOS: 1 to 3 to the subject in need of treatment;
  • An expression vector comprising the same;
  • it relates to a method for preventing or treating cancer, comprising the step of administering an effective amount of a transformant transformed with the expression vector.
  • a subject in need of treatment comprising a seed sequence (seed sequence) represented by any one of the base sequence of SEQ ID NO: 1 to 3 miRNA;
  • An expression vector comprising the same;
  • a method for inhibiting growth of cancer stem cells comprising the step of administering an effective amount of a transformant transformed with the expression vector.
  • a subject in need of treatment comprises a seed sequence represented by any one of the nucleotide sequences of SEQ ID NOs: 1 to 3 miRNA; An expression vector comprising the same; Or it relates to a method for preventing or treating metastasis of cancer, comprising administering an effective amount of a transformant transformed with the expression vector.
  • the nucleotide sequence represented by SEQ ID NO: 1 may be a seed sequence of hsa-miR-328-3p miRNA represented by the nucleotide sequence of SEQ ID NO: 4 (CUGGCCCUCUCUGUGCUUCCGU).
  • the nucleotide sequence represented by SEQ ID NO: 2 may be a seed sequence of hsa-miR-6514-5p miRNA represented by the nucleotide sequence of SEQ ID NO: 5 (UAUGGAGUGGACUUUCAGCUGGC).
  • the nucleotide sequence represented by SEQ ID NO: 3 may be a seed sequence of hsa-miR-503-3p miRNA represented by the nucleotide sequence of SEQ ID NO: 6 (GGGGUAUUGUUUCCGCUGCCAGG).
  • the nucleotide sequence represented by SEQ ID NO: 4 may be a sequence of hsa-miR-328-3p miRNA.
  • the nucleotide sequence represented by SEQ ID NO: 5 may be a sequence of hsa-miR-6514-5p miRNA.
  • the nucleotide sequence represented by SEQ ID NO: 6 may be a sequence of hsa-miR-503-3p miRNA.
  • the "seed sequence” means a nucleotide sequence of some region in the miRNA to which miRNA binds with complete complementarity when it recognizes a target, which is an essential part of the miRNA to bind to the target. It is a site that functions effectively.
  • the miRNA in the present invention may be included without limitation as long as it is a polynucleotide represented by any one of SEQ ID NOs: 1 to 3, or a miRNA including the polynucleotide.
  • a nucleic acid molecule that functions for the treatment of cancer or cancer stem cells in succession to the polynucleotide represented by any one of SEQ ID NO: 1 to 3 the total nucleic acid molecule is 14 to 29nt, more preferably It may be in the form of a mature miRNA 19 to 25 nt, more preferably 21, 22 or 23 nt in length.
  • the miRNA is at least one miRNA selected from the group consisting of (1) hsa-miR-328-3p miRNA, hsa-miR-6514-5p miRNA, and hsa-miR-503-3p miRNA. ; And (2) a miRNA comprising a nucleotide sequence represented by any one of SEQ ID NOs: 1 to 3, and having a nucleotide sequence of at least 80%, or at least 90%, or at least 95% homology with the nucleotide sequence of (1). ; It may include at least one of.
  • miRNAs used in the present invention are functionally equivalent to the miRNA nucleic acid molecules even if functional equivalents of the nucleic acid molecules constituting the same, for example, some nucleotide sequences of the miRNA nucleic acid molecules are modified by deletion, substitution or insertion. It is a concept that includes variants that can have an equivalent action.
  • the miRNA of the present invention may exhibit at least 80% homology with the nucleotide sequence of each corresponding SEQ ID NO, preferably may include 90%, more preferably at least 95% homology. Such homology can be readily determined by using computer algorithms well known in the art, such as the Align or BLAST algorithms, to compare the sequence of nucleotides with corresponding portions of the target gene.
  • the miRNA may be a mature miRNA as described above, but may be a miRNA precursor in the form of a miRNA precursor, a primary miRNA (pri-miRNA), or a plasmid.
  • the nucleic acid molecules constituting the miRNA precursor or primary miRNA in the present invention may have a length of 50 to 150nt, preferably 50 to 100nt, more preferably 65 to 95nt.
  • the miRNA may exist in a single stranded or double stranded form. While mature miRNA molecules exist predominantly in single strands, precursor miRNA molecules may comprise partial self-complementary structures (eg stem-loop structures) capable of forming double strands.
  • precursor miRNA molecules may comprise partial self-complementary structures (eg stem-loop structures) capable of forming double strands.
  • the phosphate backbone structure is a form containing a phosphorothiolate (phosphothiolate) structure that is a form substituted with elemental sulfur; Forms substituted with DNA, PNA (petide nucleic acids) or LNA (locked nucleic acid) molecules;
  • the 2 ′ hydroxyl group of the sugar may be substituted with a methylated, methoxylated or fluorinated structure.
  • the miRNA of the present invention may be isolated or prepared using standard molecular biology techniques such as chemical synthesis or recombinant methods, or may be commercially available.
  • the miRNA nucleic acid molecule may be provided in a form included in an expression vector.
  • the expression vector is preferably a non-viral vector or a viral vector
  • the non-viral vector is preferably plasmid DNA
  • the viral vector is a lentivirus, a retrovirus, a retrovirus, Adenovirus, herpes virus, and avidox virus vectors may be used, but the present invention is not limited thereto.
  • the expression vector further comprises a selection marker in order to facilitate selection of transformed cells.
  • a selection marker in order to facilitate selection of transformed cells. Markers that confer a selectable phenotype such as, for example, drug resistance, nutritional requirements, resistance to cytotoxic agents or expression of surface proteins such as green fluorescent protein, puromycin, neomycin, hygromycin, Histidinol dehydrogenase (hisD) and guanine phosphoribosyltransferase (Gpt) and the like.
  • the expression vector may be introduced into a host cell to provide a transformed transformant.
  • the host cell is preferably a somatic cell of a mammal including a human, and more preferably, it is a cell of a tissue region for treatment of human, or a cancer cell or a cancer stem cell of the region, but is not limited thereto.
  • a method for introducing the expression vector into a host cell may include G-fectin, Mirus TrasIT-TKO lipid affinity reagent, lipofectin, lipofectamine, cellfectin, cationic phospholipid nanoparticles, It may be introduced into a cell with a delivery reagent comprising a cationic polymer, a cationic micelle, a cationic emulsion, or a liposome, or a biocompatible polymer such as polyethylene glycol may be conjugated to increase intracellular uptake.
  • MiRNAs, expression vectors or transformants provided in the present invention may inhibit the growth or proliferation of cancer cells or cancer stem cells or induce death, or may inhibit the stem cell ability of cancer stem cells, Specifically, by inhibiting the expression of at least one of NANOG and OCT4, which are stem cell-related markers in cancer stem cells, or by increasing the expression of at least one of CK18 and KRT20, which are inhibited in cancer stem cells, May lead to loss of stem cell capacity.
  • the "subject in need” is a symptom of or suspected of having cancer or cancer metastasis, and thus preventing, improving or treating cancer or cancer metastasis by inhibiting the growth or proliferation of cancer or cancer stem cells. It may be a subject.
  • cancer stem cells refers to cancer cells in a comprehensive sense having self-renewal or differentiation ability that is characteristic of stem cells.
  • cancer refers to or indicates a physiological condition characterized by unregulated cell growth typically in mammals.
  • Cancers to be treated and prevented in the present invention are breast cancer, colon cancer, uterine cancer, fallopian tube cancer, ovarian cancer, stomach cancer, brain cancer, head and neck cancer, rectal cancer, small intestine cancer, esophageal cancer, lymph gland cancer, gallbladder cancer, lung cancer , Skin cancer (or melanoma), kidney cancer, bladder cancer, blood cancer, pancreatic cancer, prostate cancer, thyroid cancer, endocrine cancer, oral cancer, liver cancer, blood cancer, etc., preferably breast cancer, colon cancer, uterine cancer, fallopian tube cancer, ovary Cancer, stomach cancer, brain cancer, head and neck cancer, rectal cancer, small intestine cancer, esophageal cancer, lymph gland cancer, gallbladder cancer, lung cancer, skin cancer (or melanoma), kidney cancer, bladder cancer, blood cancer, pancreatic cancer, prostate cancer, thyroid cancer, endocrine cancer, oral cancer,
  • Cancer stem cells capable of differentiating into such cancer cells are present in the malignant tumor tissue in the range of 1 to 2%, self-renewal, which is characteristic of normal stem cells, and pluripotent that can differentiate into other cells.
  • self-renewal which is characteristic of normal stem cells
  • pluripotent that can differentiate into other cells.
  • it has been reported to have an abnormality in the self-regulatory function, thereby increasing the number of cells due to cell division and differentiating itself into malignant tumor cells.
  • cancer stem cells Since the presence of cancer stem cells in leukemia in 1997 (Blood, 1997), breast cancer (PNAS, 2003), brain tumors (Nature, 2004), prostate cancer (Cancer Res, 2005), colon cancer (Nature) , 2007), evidence suggests that cancer stem cells also exist in melanoma (Nature, 2008). A small number of cancer stem cells included in tumors have emerged as the main cause of tumor malignancy, anticancer resistance and recurrence.
  • Cancer stem cells have markers that distinguish them from other cancer cells, and cancer stem cell-specific cancer stem cell markers are known as cancer stem cell markers as shown in Table 1 below. have.
  • Cancer stem cells that are subject to growth inhibition in the present invention include breast cancer, colon cancer, uterine cancer, fallopian tube cancer, ovarian cancer, gastric cancer, brain cancer, head and neck cancer, rectal cancer, small intestine cancer, esophageal cancer, lymph gland cancer, gallbladder cancer, lung cancer Stem cells of cancers such as skin cancer (or melanoma), kidney cancer, bladder cancer, blood cancer, pancreatic cancer, prostate cancer, thyroid cancer, endocrine cancer, oral cancer, liver cancer, and blood cancer, but preferably breast cancer, Colorectal cancer, uterine cancer, fallopian tube cancer, ovarian cancer, stomach cancer, brain cancer, head and neck cancer, rectal cancer, small intestine cancer, esophageal cancer, lymph gland cancer, gallbladder cancer, lung cancer, skin cancer (or melanoma), kidney cancer, bladder cancer, blood cancer, pancreatic cancer, prostate It may be a stem cell of cancer, thyroid cancer, endocrine cancer, oral cancer or liver cancer, in particular
  • cancer stem cells are constantly self-renewal and can make tumors with less than a thousand cells in experimental animal models and possess the capacity as malignant tumor cells.
  • cancer stem cell removal is increasingly recognized as a barometer to determine the success of cancer treatment.
  • cancer stem cells are killed using various treatment methods such as surgery, radiation therapy, and chemotherapy, it is recognized that cancer may recur from remaining cancer stem cells if the cancer stem cells are not killed. .
  • chemotherapy targeting cancer stem cells having the ability to regenerate tumors and treatment protocols for treating cancer based thereon.
  • cancer stem cells in normal tissues regulate cell growth and differentiation by self-renewal mechanisms, but cancer stem cells are affected by tumor microenvironment factors surrounding tumor cells, resulting in abnormal self-renewal and It has been suggested to activate the maintenance pathway and accumulate rapidly, thereby becoming malignant and gaining resistance to chemotherapy and ultimately causing cancer to recur.
  • tumor microenvironment factors that regulate the accumulation and maintenance of cancer stem cells.
  • prophylaxis may include without limitation any action that blocks cancer symptoms, inhibits or delays cancer symptoms using the miRNA, expression vector, transformant or pharmaceutical composition of the present invention.
  • treatment may include without limitation any action that improves or benefits cancer symptoms using the miRNA, expression vector, transformant or pharmaceutical composition of the present invention.
  • the miRNA, expression vector, transformant or pharmaceutical composition of the present invention can be further co-administered with other anticancer agents, thereby further enhancing the growth inhibitory effect or cancer metastasis suppression effect on cancer cells and cancer stem cells.
  • the anticancer agent is nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, zefitinib, vandetanib, nirotinib, semasanib, conservinib, axitinib, cediranib , Restautinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, bevacizumab, cisplatin, cetuximab, biscumalbum, asparaginase, tretinoin, hydroxycarbamide, da Satinib, estramastin, gemtuzumab ozogamycin, ibritumab tucetan, heptaplatin, methylaminolevulinic acid, amsacrine, alemtuzumab, procarbazine, alprostad
  • the miRNA, expression vector, transformant or pharmaceutical composition may be in the form of capsules, tablets, granules, injections, ointments, powders or beverages, the miRNA, expression vector, transformants or The pharmaceutical composition may be characterized as targeting humans.
  • the miRNAs, expression vectors, transformants or pharmaceutical compositions of the present invention are not limited to these, but are oral formulations, external preparations, suppositories, and sterilizations such as powders, granules, capsules, tablets and aqueous suspensions, respectively, according to conventional methods. It can be used in the form of an injection solution.
  • the miRNAs, expression vectors or transformants of the invention can be administered with a pharmaceutically acceptable carrier, and the pharmaceutical compositions of the invention can comprise a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers can be used as oral administration binders, suspending agents, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, pigments, flavors, etc., and in the case of injections, buffers, preservatives, analgesic Topical agents, solubilizers, isotonic agents, stabilizers and the like can be mixed and used, and for topical administration, bases, excipients, lubricants, preservatives and the like can be used.
  • Formulations of miRNAs, expression vectors, transformants or pharmaceutical compositions of the invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above.
  • oral administration may be in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like, in the case of injections, in unit dosage ampoules or multiple dosage forms.
  • solutions, suspensions, tablets, capsules, sustained release preparations and the like may be used.
  • Suitable carriers, excipients, and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil and the like can be used.
  • fillers, anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives and the like may be further included.
  • Routes of administration of miRNAs, expression vectors, transformants or pharmaceutical compositions according to the invention are not limited to these, but are oral, intravenous, intramuscular, intraarterial, intramedullary, intradural, intracardiac, transdermal, subcutaneous, Intraperitoneal, intranasal, intestinal, topical, sublingual or rectal. Oral or parenteral release is preferred.
  • parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intramuscular, intrasternal, intradural, intralesional and intracranial injection or infusion techniques.
  • MiRNAs, expression vectors, transformants or pharmaceutical compositions of the invention may also be administered in the form of suppositories for rectal administration.
  • the miRNAs, expression vectors, transformants or pharmaceutical compositions of the present invention may be characterized by the activity, age, weight, general health, sex, formulation, time of administration, route of administration, rate of release, combination of drugs and the particular to be prevented or treated, of the specific compound employed.
  • the dosage of the pharmaceutical composition may vary depending on the patient's condition, weight, extent of disease, drug form, route of administration, and duration, but may be appropriately selected by those skilled in the art. It may be administered at 0.0001 to 50 mg / kg or 0.001 to 50 mg / kg per day. Administration may be administered once a day or may be divided several times. The dosage does not limit the scope of the invention in any aspect.
  • MiRNAs, expression vectors, transformants or pharmaceutical compositions according to the invention may be formulated as pills, dragees, capsules, solutions, gels, syrups, slurries, suspensions.
  • Expression vectors containing the miRNA of the present invention specifically contains 0.01 to 500 mg, or more specifically 0.1 to 300 mg, and in the case of recombinant virus comprising the miRNA of the present invention, specifically 10 3 ⁇ 10 12 IU (10 to 10 10 PFU), more specifically 10 5 to 10 10 IU, but is not limited thereto.
  • the transformant including the miRNA of the present invention specifically contains 10 3 to 10 8 , and more specifically contains 10 4 to 10 7 , but is not limited thereto.
  • the effective dose of the composition containing the expression vector or transformant containing the miRNA of the present invention as an active ingredient is 0.05 to 12.5 mg / kg for the vector per kg of body weight, 10 7 to 10 for the recombinant virus 11 virus particles (10 5 to 10 9 IU) / kg, 10 3 to 10 6 cells / kg for cells, specifically 0.1 to 10 mg / kg for vectors, 10 8 to 10 for recombinant viruses 10 particles (10 6 to 10 8 IU) / kg, in the case of cells 10 2 to 10 5 cells / kg, may be administered 2-3 times a day.
  • the composition as described above is not necessarily limited thereto, and may vary depending on the condition of the patient and the onset of the disease.
  • MiRNA provided by the present invention can effectively inhibit the growth of cancer cells as well as cancer stem cells to prevent and / or treat cancer, furthermore can prevent cancer resistance, metastasis and recurrence.
  • Figure 1a is a graph showing the results of analyzing the cell survival rate after treatment with miRNA according to the present invention MCF7 breast cancer cells in Example 1 of the present invention.
  • Figure 1b is a graph showing the results of analyzing the cell viability after treatment with miRNA according to the present invention to BT474 breast cancer cells in Example 1 of the present invention.
  • Figure 2a is a graph showing the results of analyzing the change in the relative colony number after treatment with miRNA according to the present invention to BT474 breast cancer stem cells in Example 2 of the present invention.
  • Figure 2b is a graph showing the results of analyzing the change in the relative colony number after treatment with miRNA according to the present invention HCT15 colon cancer stem cells in Example 2 of the present invention.
  • Figure 3a shows the result of analyzing the cell viability after treatment of hsa-miR-6514-5p miRNA according to the present invention to SK-MEL-28 melanoma cells in Example 3 of the present invention.
  • Figure 3b is a graph showing the results of analyzing the cell viability after treating the miRNA of hsa-miR-503-3p according to the present invention to SK-MEL-28 melanoma cells in Example 3 of the present invention.
  • Figure 3c is a graph showing the results of analyzing the cell survival after treatment of the positive control hsa-miR-34a to SK-MEL-28 melanoma cells in Example 3 of the present invention.
  • Figure 4a is a graph showing the results of analyzing the cell viability after treatment of hsa-miR-6514-5p miRNA according to the present invention to NCI-H460 lung cancer cells in Example 4 of the present invention.
  • Figure 4b is a graph showing the results of analyzing the cell viability after treatment of the miRNA of hsa-miR-503-3p according to the present invention to NCI-H460 lung cancer cells in Example 4 of the present invention.
  • Figure 4c is a graph showing the results of analyzing the cell viability after treatment of the positive control hsa-miR-34a to NCI-H460 lung cancer cells in Example 4 of the present invention.
  • Figure 5a is a graph showing the results of analyzing the change in the expression level of NANOG, a gene related to stem function after treatment of miRNA according to the present invention to BT474 breast cancer stem cells in Example 5 of the present invention.
  • Figure 5b is a graph showing the results of analyzing the change in the expression level of OCT4, a gene related to stem function after treatment of miRNA according to the present invention to BT474 breast cancer stem cells in Example 5 of the present invention.
  • Figure 5c is a graph showing the results of analyzing the change in the expression level of CK18, a gene related to stem function after treatment of miRNA according to the present invention to BT474 breast cancer stem cells in Example 5 of the present invention.
  • Figure 6a shows the result of analyzing the change in the expression level of NANOG, a gene related to stem function after treatment of miRNA according to the present invention to HCT15 colon cancer stem cells in Example 5 of the present invention.
  • Figure 6b is a graph showing the results of analyzing the change in the expression level of OCT4, a gene related to stem function (stemness) after treating miRNA according to the present invention to HCT15 colon cancer stem cells in Example 5 of the present invention.
  • Figure 6c is a graph showing the results of analyzing the change in the expression level of KRT20, a gene related to stem function (stemness) after treatment of miRNA according to the present invention to HCT15 colon cancer stem cells in Example 5 of the present invention.
  • Figure 7a is a graph showing the results of analyzing the change in the expression level of NANOG, a gene related to stem function after treating miRNA according to the present invention to SK-MEL-28 melanoma stem cells in Example 6 of the present invention; It is shown.
  • Figure 7b is a graph showing the results of analyzing the change in the expression level of OCT4, a gene related to stem function after treating miRNA according to the present invention to SK-MEL-28 melanoma stem cells in Example 6 of the present invention; It is shown.
  • Figure 8 shows the number of infiltrating cancer cells attached to the bottom of the transwell through the Matrigel after treating the miRNA according to the invention to SK-MEL-28 melanoma cells in Example 7 of the present invention.
  • Figure 9 shows a photo of infiltrating cancer cells attached to the bottom of the transwell through the Matrigel after treating the miRNA according to the invention to SK-MEL-28 melanoma cells in Example 7 of the present invention.
  • Figure 10 shows the number of infiltrating cancer cells attached to the bottom of the transwell through the Matrigel after treating the miRNA according to the invention to NCI-H460 lung cancer cells in Example 8 of the present invention.
  • FIG. 11 shows a photograph of infiltrating cancer cells attached to the bottom of a transwell after passing through Matrigel after treating miRNA according to the present invention to NCI-H460 lung cancer cells in Example 8 of the present invention.
  • a miRNA comprising a seed sequence represented by any one of SEQ ID NOs: 1 to 3; An expression vector comprising the same; Or it relates to a pharmaceutical composition for the prevention or treatment of cancer comprising a transformant transformed with the expression vector as an active ingredient.
  • a miRNA comprising a seed sequence represented by any one of SEQ ID NOs: 1 to 3; An expression vector comprising the same; Or it relates to a pharmaceutical composition for inhibiting the growth of cancer stem cells comprising a transformant transformed with the expression vector as an active ingredient.
  • a miRNA comprising a seed sequence represented by any one of SEQ ID NOs: 1 to 3; An expression vector comprising the same; Or it relates to a pharmaceutical composition for the prevention or treatment of metastasis of cancer comprising a transformant transformed with the expression vector as an active ingredient.
  • miRNA types Sequence hsa-miR-328-3p miRNA CUGGCCCUCUCUGCCCUUCCGU (SEQ ID NO: 4) hsa-miR-6514-5p miRNA UAUGGAGUGGACUUUCAGCUGGC (SEQ ID NO: 5) hsa-miR-503-3p miRNA GGGGUAUUGUUUCCGCUGCCAGG (SEQ ID NO: 6)
  • MCF-7, BT474, HCT15 and SK-MEL-28 cancer cell lines were purchased from ATCC and cultured in DMEM / F12 medium supplemented with B27 supplement and growth factors (FGF and EGF 20 ng / mL) to induce cancer stem cells. It was. Only cells expressing the cancer stem cell marker CD44 + were selected and cultured for about 2 weeks.
  • NCI-H460 cancer cell lines were prepared as other cancer cells.
  • lipofectamine lipofectamine
  • 5-FU 5-fluorouracil
  • miRNA according to the present invention can be seen that there is an effect of inhibiting the growth and proliferation and death of cancer cells or cancer stem cells.
  • FIGS. 2A and 2B After introducing three miRNAs of Preparation Example 1 into BT474 breast cancer stem cells and HCT15 colon cancer stem cells prepared in Preparation Example 2 in the same manner as in Example 1, and comparing the change in the number of colonies, FIGS. 2A and 2B. Shown in However, no treatment was performed as a negative control, and 5-fluorouracil (5-FU) (Sigma, USA) was treated as a positive control.
  • 5-FU 5-fluorouracil
  • miRNA according to the present invention can be seen that there is an effect of inhibiting the growth and proliferation and death of cancer cells or cancer stem cells.
  • the treatment of melanoma cells with miRNA according to the present invention significantly reduced the survival rate of melanoma cells, melanoma at a lower concentration than when treated with a positive control miR-34a It was confirmed that the survival rate of the cells was significantly suppressed.
  • the hRNA-miR-6514-5p and hsa-miR-503-3p miRNAs prepared in Preparation Example 1 were introduced into NCI-H460 lung cancer cells prepared in Preparation Example 2 using lipofectamine for 48 hours. 4A to 4C are compared to change the cell viability according to the treatment concentration, and the final concentration for killing IC 50 and total lung cancer cells for the lung cancer cells was measured and the results are shown in Table 4 below. At this time, no treatment was performed as a negative control, miR-34a was used as a positive control.
  • FIGS. 5A-5C and 6A-6C The results are shown in FIGS. 5A-5C and 6A-6C. However, no treatment was performed with the negative control, and napabucasin (Abcam, USA) was treated with the positive control.
  • NANOG and OCT14 which are genes related to stemness
  • BT474 breast cancer stem cells and HCT15 colon cancer stem cells 5c and 6c
  • the expression levels of CK18 and KRT20 whose expression was suppressed in cancer stem cells were increased.
  • miRNA according to the present invention can be seen that there is an effect to lose the stem cell capacity (stemness) of cancer stem cells.
  • the miRNAs of hsa-miR-6514-5p and hsa-miR-503-3p prepared in Preparation Example 1 were introduced into SK-MEL-28 melanoma stem cells prepared in Preparation Example 2.
  • miRNA harvested from the cancer stem cells
  • the cycle was quantified and quantified.
  • the results are shown in Figures 7a to 7b. However, no treatment was performed as a negative control, and miR-34a was used as a positive control.
  • miRNA according to the present invention can be seen that there is an effect to lose the stem cell capacity (stemness) of cancer stem cells.
  • miRNA according to the present invention has an inhibitory effect on metastasis of cancer cells.
  • miRNA according to the present invention has an inhibitory effect on metastasis of cancer cells.
  • the present invention relates to pharmaceutical compositions capable of preventing, ameliorating or treating cancer.

Abstract

본 발명은 서열번호 1 내지 3 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효 성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물에 관한 것이다. 본 발명에서 제공하는 miRNA는 암 세포뿐만 아니라 암 줄기세포의 성장을 효과적으로 억제하여 암을 예방 및/또는 치료할 수 있으며, 더 나아가서는 암의 내성, 전이 및 재발 또한 방지할 수 있다.

Description

암의 예방 또는 치료용 약학적 조성물
본 발명은 암을 효과적으로 예방 또는 치료할 수 있는 약학적 조성물에 관한 것이다.
마이크로RNA(miRNA)는 18~25 뉴클레오티드(nucleotide, nt)로 구성된 작은 비-암호화 RNA로서, 표적 유전자의 3'-비번역 부위(untranslated region, UTR)에 결합하여 유전자 발현을 조절하고(Bartel DP, et al., Cell 116: 281-297, 2004; Lewis BP, et al., Cell 120: 15-20, 2005), 인트론(intron), 엑손(exon) 또는 유전자 간 부위(intergenic region)로부터 공정된다(Rodriguez A, et al., Genome Res14: 1902-1910, 2004). 첫째로, miRNA는 수천 개의 뉴클레오티드를 포함하는 초기 miRNA(pri-miRNA) 분자 내로 RNA 폴리머라아제 에 의해 전사된다. 그런 다음, pri-miRNA는 miRNA 전구체로 알려진 대략 70 nt 줄기 고리 중간체를 형성하기 위해 마이크로프로세서[DroshaRNase 엔도뉴클레아제 및 디조지증후군 부위 유전자 8 단백질(DroshaRNase endonuclease and DiGeorge syndrome region gene 8 protein, DGCR8)]에 의해 연속적으로 공정된다(Lee Y, et al., EMBO J21: 4663-4670, 2000; Zeng Y, et al., Proc Natl Acad Sci U S A100: 9779-9784, 2003). 그런 다음, pre-miRNA는 엑소폴틴-5(Exportin-5, EXP5)와 공동인자 Ran-GTP를 통해 핵으로부터 세포질로 이동되고, 여기서 pre-miRNA는 RNase 엔도뉴클레아제 다이서에 의해 18-25 nt 성숙 miRNA 듀플렉스(duplexe)로 공정된다(Lee Y, et al., EMBO J23: 4051-4060, 2004; Shenouda SK, et al., Cancer Metastasis Rev28: 369-378, 2009). 성숙 miRNA 듀플렉스는 RNA-유도 침묵 복합체(RNA-induced silencing complex, RISC) 내로 아르고노트(Argonaute) 단백질과 단일 가닥 RNA로서 통합되고, 이는 표적 mRNA의 절단 또는 번역 억제 중 어느 하나를 유도한다(Diederichs S, et al., Cell131: 1097-1108, 2007; Hammond SM, et al., Nature404: 293-296, 2000; Martinez et al., Cell 110: 563-574, 2002). miRNA는 암세포의 증식 및 침윤을 포함하는 암 발달과 관련된 다양한 생물학적 공정과 관련되고, miRNA 발현은 많은 유형의 암에서 양방향으로 조절된다(Esquela-Kerscher A, et al., Nat Rev Cancer6: 259-269, 2006).
암은 전세계적으로 가장 보편적인 사망원인 중의 하나이다. 약 천만 건의 새로운 케이스가 매년 발생하며, 전체 사망원인의 약 12%를 차지하여 세 번째로 많은 사망의 원인이 되고 있다.
암 중에서도 유방암은 여성에게 있어서 매년 40,000명 이상의 사망의 원인이 되는 가장 보편적인 악성 종양으로서 조기 진단이 매우 중요하나, 이미 알려져 있는 많은 항암치료제의 치료에도 불구하고 암이 많이 진행된 경우나 전이된 경우 생존율이 향상되지 못한 실정이다.
대표적인 항암 요법인 화학요법(chemotherapy)은, 단독으로 또는 방사능요법과 같은 다른 치료법과 조합하여 현재 암을 치료하기 위한 가장 효율적인 치료법으로 사용되고 있다. 그러나, 화학요법에서 암 치료 약물의 효능은 암 세포를 죽일 수 있는 능력에 따르나, 약물 사용시 암세포뿐만 아니라 일반적인 세포에도 작용할 수 있다는 문제가 있다.
암 줄기세포(cancer stem cell)는 무제한 재생능력을 가진 암세포로서 줄기세포에서 종양이 기원할 것이라는 가설은, 90년대 말 급성 골수성 백혈병에서 암 줄기세포가 될 수 있는 일단의 세포를 면역억제 쥐에 이식하여 사람의 백혈병이 쥐에서 재현됨이 발표되면서 확고하게 되었고, 이후 유방암에서 암줄기세포를 증명하면서 고형 암종에서도 줄기세포의 존재를 확신하게 되었다.
악성 종양이 보이는 다양한 이질성이 줄기세포의 다양한 분화성과 일치하며, 많은 표적치료에도 불구하고 끊임없이 발현되는 암세포의 약물 저항성은 줄기세포의 기본 특성과 일치하는데 이로써 종양의 발생과 줄기세포를 연관지어 생각할 수 있으며, 암 줄기세포는 새로운 표적 치료 분야가 될 수 있다.
암 줄기세포 가설에 근거하여 여러 치료 방법들이 고안되었는데, 그 중 많이 알려진 방법은 암 줄기세포의 자가 재생 경로를 이용하는 방법이다. 이러한 치료에서 중요한 점은 정상 줄기세포의 자가 재생은 유지하면서 암 줄기세포의 자가 재생만을 표적으로 해야 하는 것이다. 예로서 Notch 신호는 gamma secretase라는 효소에 의해 진행되는데, 이에 대한 억제제(gamma secretase inhibitor)를 Notch1이 과발현된 유방암에 사용하면 종양 억제 효과를 달성할 수 있다. Hedgehog 신호체계를 표적으로 할 경우에도 항암효과를 보인다는 최근 보고가 있는데, Hedgehog 억제제인 cyclopamine을 종양을 이종이식(tumor xenograft)한 동물에 투여했을 때 극적으로 종양이 위축되었다는 것이다. 그 밖에도, PI3K/AKT, MAPK, JAK2/STAT3 signaling pathway와 관련 있다고 알려져 있다.
그러나, 지금까지 암 줄기세포에 대한 연구에는 제한성도 많고, 종양의 형성이나 유지에서의 역할에 대해서는 아직까지 확실하게 밝혀진 것은 없다. 정상 줄기세포에는 손상을 주지 않으면서 암 줄기세포만을 표적으로 하는 치료를 효율적으로 수행하기 위해서는 암 줄기세포의 유지와 조절에 중요한 분자생물학적인 특성이나 그 조절 경로에 대한 지식과 이해가 필요하다.
현재까지 암 줄기세포를 직접적으로 타겟팅하는 항암제나 천연물 유래 추출물의 연구는 거의 없는 실정이다. 종래의 기술은 암 줄기세포의 직접적인 타겟 유전자를 억제하는 실험으로 암 줄기세포를 억제하거나 암 줄기세포의 상위 신호전달 단백질을 억제하여 암 줄기세포를 억제하는 연구들이 진행되었다. 그러나 많은 종양 환자에 있어서 종양 유전자의 변이나 단백질의 변이로 이러한 타겟팅 실험이 어려움이 많다.
따라서, 암 줄기세포에 대한 약물의 선택성을 개선하는 것은 항암 약물에 의한 화학 요법의 효능을 증가시킴으로써 약물을 더 낮은 용량으로 사용하게 하는 것을 분명히 가능하게 할 것이다. 그러므로 암 치료 및 예방을 위하여 암 줄기세포의 성장을 선택적으로 억제할 수 있는 개선된 접근법이 요구된다.
본 발명의 일 목적은 암을 예방 및/또는 치료할 수 있는 약학적 조성물을 제공하는 것을 목적으로 한다.
본 발명의 다른 목적은 암 줄기세포의 성장 또한 효과적으로 억제하여 암을 예방 및/또는 치료할 수 있을 뿐만 아니라, 암의 내성, 전이 및 재발 또한 방지할 수 있는 약학적 조성물을 제공하고자 한다.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
본 발명의 발명자들은 hsa-miR-328-3p, hsa-miR-6514-5p 및 hsa-miR-503-3p의 miRNA가 암 세포뿐만 아니라 암 줄기세포의 성장 및 증식을 효과적으로 억제하며, 암의 전이 또한 억제함을 발견하여 본 발명에 이르게 되었다.
본 발명의 일 구현 예에 따르면, 서열번호 1 내지 3 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효 성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물에 관한 것이다.
본 발명의 다른 구현 예에 따르면, 서열번호 1 내지 3 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효 성분으로 포함하는 암 줄기세포의 성장 억제용 약학적 조성물에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 서열번호 1 내지 3 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효 성분으로 포함하는 암의 전이의 예방 또는 치료용 약학적 조성물에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 암을 예방 또는 치료하기 위하여, 치료를 필요로 하는 대상체에 서열번호 1 내지 3 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효량으로 투여하는 단계를 포함하는, 암의 예방 또는 치료 방법에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 암 줄기세포의 성장을 억제하기 위하여, 치료를 필요로 하는 대상체에 서열번호 1 내지 3 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효량으로 투여하는 단계를 포함하는, 암 줄기세포의 성장 억제 방법에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 암의 전이를 예방 또는 치료하기 위하여, 치료를 필요로 하는 대상체에 서열번호 1 내지 3 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효량으로 투여하는 단계를 포함하는, 암의 전이의 예방 또는 치료 방법에 관한 것이다.
본 발명에서 상기 서열번호 1로 표시되는 염기서열은 서열번호 4의 염기서열(CUGGCCCUCUCUGCCCUUCCGU)로 표시되는 hsa-miR-328-3p miRNA의 종자 서열일 수 있다.
본 발명에서 상기 서열번호 2로 표시되는 염기서열은 서열번호 5의 염기서열(UAUGGAGUGGACUUUCAGCUGGC)로 표시되는 hsa-miR-6514-5p miRNA의 종자 서열일 수 있다.
본 발명에서 상기 서열번호 3으로 표시되는 염기서열은 서열번호 6의 염기서열(GGGGUAUUGUUUCCGCUGCCAGG)로 표시되는 hsa-miR-503-3p miRNA의 종자 서열일 수 있다.
본 발명에서 상기 서열번호 4로 표시되는 염기서열은 hsa-miR-328-3p miRNA의 서열일 수 있다.
본 발명에서 상기 서열번호 5로 표시되는 염기서열은 hsa-miR-6514-5p miRNA의 서열일 수 있다.
본 발명에서 상기 서열번호 6으로 표시되는 염기서열은 hsa-miR-503-3p miRNA의 서열일 수 있다.
본 발명에서 상기 "종자 서열(seed sequence)"이란 miRNA가 타겟을 인식할 때 완전한 상보성을 가지고 결합하는 miRNA 내 일부 영역의 뉴클레오타이드 서열을 의미하며, 이는 miRNA가 타겟에 결합하기 위해 필수적으로 요구되는 부분이자 실질적으로 유효한 기능을 하는 부위이다.
따라서, 본 발명에서 상기 miRNA로는 서열번호 1 내지 3 중 어느 하나로 표시되는 폴리뉴클레오타이드이거나, 혹은 상기 폴리뉴클레오타이드를 포함하는 miRNA라면 제한없이 포함될 수 있다. 바람직하게는 상기 서열번호 1 내지 3 중 어느 하나로 표시되는 폴리뉴클레오타이드에 연속하여 암 또는 암 줄기세포의 치료를 위한 기능을 하는 핵산 분자가 존재하는 것으로, 총 핵산 분자가 14 내지 29nt, 보다 바람직하게는 19 내지 25nt, 더욱 바람직하게는 21, 22 또는 23nt 길이의 성숙 miRNA 형태일 수 있다.
보다 바람직하게는, 본 발명에서 상기 miRNA는, (1) hsa-miR-328-3p miRNA, hsa-miR-6514-5p miRNA 및 hsa-miR-503-3p miRNA로 이루어진 군에서 선택된 1종 이상의 miRNA; 및 (2) 상기 서열번호 1 내지 3 중 어느 하나로 표시되는 염기서열은 포함하되, 상기 (1)의 염기 서열과 상동성이 80% 이상, 또는 90% 이상, 또는 95% 이상인 염기서열로 이루어진 miRNA; 중 적어도 하나를 포함할 수 있다.
상기한 바와 같이, 본 발명에서 사용되는 miRNA 들은 이를 구성하는 핵산 분자의 작용성 등가물, 예를 들어, miRNA 핵산 분자의 일부 염기서열이 결실, 치환 또는 삽입에 의해 변형되더라도 상기 miRNA 핵산 분자와 기능적으로 동등한 작용을 할 수 있는 변이체를 포함하는 개념이다. 예를 들어, 본 발명의 miRNA는 각 해당 서열번호의 염기서열과 80% 이상의 상동성을 나타낼 수 있으며, 바람직하게는 90%, 보다 바람직하게는 95% 이상의 상동성을 나타내는 것을 포함할 수 있다. 이러한 상동성은 당 분야에 널리 공지된 컴퓨터 알고리즘, 예를 들어 Align 또는 BLAST 알고리즘을 이용하여 뉴클레오티드의 서열을 표적 유전자의 상응하는 부분과 비교하여 용이하게 결정할 수 있다.
또한, 본 발명에서 상기 miRNA는 상기한 바와 같이 성숙한 miRNA일 수 있으나, miRNA 전구체(miRNA precursor), 일차 miRNA (pri-miRNA) 또는 플라스미드 (plasmid) 형태의 miRNA 전구체일 수 있다. 다만, 본 발명에서 miRNA 전구체 또는 일차 miRNA를 구성하는 핵산 분자는 50 내지 150nt, 바람직하게는 50 내지 100nt, 더욱 바람직하게는 65 내지 95nt 길이를 가질 수 있다.
또한, 본 발명에서 상기 miRNA는 단일 가닥 또는 이중 가닥 형태로 존재할 수 있다. 성숙 miRNA 분자는 주로 단일 가닥으로 존재하지만, 전구체 miRNA 분자는 이중 가닥을 형성할 수 있는 부분적인 자가-상보적인 구조(예를 들어 스템-루프 구조)를 포함할 수 있다.
또한, 본 발명의 상기 miRNA를 구성하는 핵산 분자 중 적어도 하나는, 인산 뼈대 구조 (phosphate backbone structure)가 황 원소로 치환한 형태인 포스포로사이오에이트 (phosphorothiolate) 구조가 포함하는 형태; DNA, PNA(petide nucleic acids) 또는 LNA(locked nucleic acid) 분자로 치환된 형태; 또는 당의 2'수산화기가 메틸화, 메톡시화 또는 플르오르화 구조로 치환된 형태일 수 있다.
본 발명의 상기 miRNA는 표준 분자 생물학 기술, 예를 들어 화학적 합성 방법 또는 재조합 방법을 이용하여 분리 또는 제조하거나, 시판되는 것을 사용할 수 있다.
본 발명에서는, 상기한 바와 같이 상기 miRNA 핵산 분자를 발현 벡터에 포함된 형태로 제공할 수 있다.
본 발명에서 상기 발현 벡터는 비바이러스성 벡터 또는 바이러스성 벡터인 것이 바람직하고, 비바이러스성 벡터로는 플라스미드 DNA인 것이 바람직하며, 바이러스성 벡터로는 렌티바이러스(lentivirus), 레트로바이러스(retrovirus), 아데노바이러스(adenovirus), 허피스바이러스(herpes virus) 및 아비폭스바이러스(avipox virus) 벡터 등을 사용할 수 있으나, 이에 제한되는 것은 아니다.
또한, 본 발명에서 상기 발현 벡터는, 형질 전환된 세포의 선별을 용이하게 하기 위하여 선별마커를 추가로 포함하는 것이 바람직하다. 예를 들어, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들, 예를 들어 녹색 형광 단백질, 퓨로마이신, 네오마이신, 하이그로마이신, 히스티디놀 디하이드로게나제(hisD) 및 구아닌 포스포리보실트랜스퍼라제(Gpt) 등을 예시할 수 있다.
본 발명에서는 상기 발현 벡터가 숙주세포에 도입되어 형질 전환된 형질 전환체로 제공될 수 있다.
본 발명에서 숙주세포는 인간을 포함한 포유류의 체세포인 것이 바람직하고, 인간의 치료를 목적하는 조직 부위의 세포이거나, 그 부위의 암 세포 또는 암 줄기세포인 것이 더욱 바람직하나 이에 한정되지 않는다.
또한, 본 발명에서 상기 발현 벡터를 숙주세포에 도입하기 위한 방법으로는 G-fectin, Mirus TrasIT-TKO 지질친화성 시약, 리포펙틴, 리포펙타민, 셀펙틴(cellfectin), 양이온성 인지질 나노입자, 양이온성 고분자, 양이온성 미셀, 양이온성 에멀젼 또는 리포좀을 포함하는 전달시약과 함께 세포 내로 도입되거나, 폴리에틸렌글리콜과 같은 생체적합성 고분자를 접합하여 세포 내 흡수를 증가시킬 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 제공하는 miRNA, 발현 벡터 또는 형질 전환체는 암 세포 또는 암 줄기세포의 성장 또는 증식을 억제하거나 사멸을 유도할 수 있고, 혹은 암 줄기세포의 줄기세포능(stemness)을 억제할 수 있으며, 구체적으로는 암 줄기세포에 있어서 줄기세포능(stemness) 관련 마커인 NANOG 및 OCT4 중 적어도 하나의 발현을 억제하거나, 암 줄기세포에서 그 발현이 억제되는 CK18 및 KRT20 중 적어도 하나의 발현은 증가시켜 줄기세포능을 상실하도록 유도할 수 있다.
본 발명에서 상기 "치료를 필요로하는 대상체"란 암 또는 암 전이의 증상이 있거나 의심되어, 암 또는 암 줄기세포의 성장 또는 증식을 억제하는 등으로 암 또는 암 전이를 예방, 개선 또는 치료가 필요한 대상체일 수 있다.
일반적으로 "암 줄기세포"란 줄기세포 특유의 능력인 자가재생이나 분화능력을 가지고 있는 포괄적인 의미의 암 세포를 의미한다.
상기 "암"은 포유류에서 전형적으로 조절되지 않는 세포 성장으로 특징지어진 생리적 상태를 나타내거나 가리킨다. 본 발명에서 치료 및 예방의 대상이 되는 암은 그 발생 부위에 따라 유방암, 대장암, 자궁암, 나팔관암, 난소암, 위암, 뇌암, 두경부암, 직장암, 소장암, 식도암, 임파선암, 담낭암, 폐암, 피부암(또는 흑색종), 신장암, 방광암, 혈액암, 췌장암, 전립선암, 갑상선암, 내분비선암, 구강암, 간암, 혈액암 등일 수 있고, 바람직하게는 유방암, 대장암, 자궁암, 나팔관암, 난소암, 위암, 뇌암, 두경부암, 직장암, 소장암, 식도암, 임파선암, 담낭암, 폐암, 피부암(또는 흑색종), 신장암, 방광암, 혈액암, 췌장암, 전립선암, 갑상선암, 내분비선암, 구강암 또는 간암일 수 있으며, 보다 바람직하게는 유방암, 흑색종, 폐암, 혈액암 또는 대장암일 수 있으나, 종양의 분화 및/또는 증식 등 암의 진행이 본 발명에서 기술하는 암 줄기세포에 의존적인 암의 종류라면 이에 제한되지 않는다.
이러한 암 세포로 분화할 수 있는 암 줄기세포는 악성 종양 조직 내에 1 ~ 2% 정도로 존재하며 정상줄기세포의 특성인 자가복제 능력 (self-renewal)과 다른 세포로 분화 할 수 있는 전분화능 (pluripotent)을 가지고 있으나 자가 조절 기능에 이상이 있어 세포분열 활성화로 세포 수를 증가하게 되고 스스로 악성 종양 세포로 분화하는 것으로 보고되었다.
1997년 백혈병에서 암 줄기세포(cancer stem cell)의 존재가 밝혀진 이래로 (Blood, 1997), 유방암 (PNAS, 2003), 뇌종양 (Nature, 2004), 전립선암 (Cancer Res, 2005), 대장암 (Nature, 2007), 흑색종 (Nature, 2008)에서도 암 줄기세포가 존재한다는 증거들이 제시되었고. 종양에 포함되어있는 소수의 암 줄기세포가 종양의 악성화, 항암저항성 및 재발의 주된 원인으로 부각되었다.
암 줄기세포들은 다른 암 세포들과 구별되는 표지 인자(marker)가 존재하며, 암 줄기세포의 표지 인자(cancer stem cell marker)로는 하기 표 1과 같이 다양한 암 종 특이적인 암 줄기세포 표지 인자가 알려져 있다.
암종 암 줄기세포 표지인자 출처
교모세포종 CD133
신장암 CD105, CD133 Contemp Oncol (Pozn). 2015; 19(1A): A44-A51
갑상선암 ABCG2, MRP1, LRP 및 CXCR4 J Clin Pathol. 2014 Feb;67(2):125-33
급성골수성백혈병 (AMM) CD34+/CD38-
다발성골수종 (multiple myeloma) CD133-
유방암 CD44+/CD24-/low Breast Cancer Res. 2007; 9(3): 303
대장암 CD133+
전립선암 CD44+/α2β1hi/CD133+
흑색종 (melanoma) ABCB5+
본 발명에서 성장 억제의 대상이 되는 암 줄기세포로는 상기 열거된 유방암, 대장암, 자궁암, 나팔관암, 난소암, 위암, 뇌암, 두경부암, 직장암, 소장암, 식도암, 임파선암, 담낭암, 폐암, 피부암(또는 흑색종), 신장암, 방광암, 혈액암, 췌장암, 전립선암, 갑상선암, 내분비선암, 구강암, 간암, 혈액암 등의 암의 줄기세포를 모두 포함할 수 있지만, 바람직하게는 유방암, 대장암, 자궁암, 나팔관암, 난소암, 위암, 뇌암, 두경부암, 직장암, 소장암, 식도암, 임파선암, 담낭암, 폐암, 피부암(또는 흑색종), 신장암, 방광암, 혈액암, 췌장암, 전립선암, 갑상선암, 내분비선암, 구강암 또는 간암의 줄기세포일 수 있으며, 특히 유방암 줄기세포, 피부암 줄기세포, 폐암 줄기세포 또는 대장암 줄기세포일 수 있다.
상기한 암 줄기세포들은 끊임없이 자기 재생(self-renewal)을 하며, 실험 동물 모델에서 천개 미만의 적은 세포수로도 종양을 만들 수 있으며 악성 종양 세포로서의 능력을 보유하고 있다. 또한 암 치료법인 항암제 치료와 방사선 치료에 놀라울 정도로 저항성을 가지고 있어, 암 줄기세포의 제거는 암 치료의 성패를 가늠할 수 있는 바로미터로 점차 인식 되고 있다. 최근에는 수술, 방사선 치료, 항암화학요법 등 기존의 여러 치료방법을 이용해 암 세포들을 사멸시키더라도 암 줄기세포들을 모두 사멸시키지 못한다면 남아있는 암 줄기세포들로부터 다시 암이 재발할 수 있다는 것으로 인식되고 있다. 이러한 암의 재발을 방지하기 위하여 종양을 재생성할 수 있는 능력을 가진 암 줄기세포를 타겟으로 하는 화학요법 및 이를 바탕으로 암을 치료하고자 하는 치료 프로토콜 개발에 관심이 높아지고 있다.
정상 조직에서의 줄기세포는 자가 재생 (self-renewal) 기전에 의해 세포 성장과 분화를 조절하지만, 암 줄기세포는 종양세포 주변의 종양 미세환경 인자에 영향을 받아 비정상적인 자가분열(self-renewal) 및 유지(maintenance) 경로를 활성화하여 급격히 집적됨으로써 악성화 되고 항암 치료에 대한 저항성을 획득하게 되며 궁극적으로 암의 재발을 야기한다고 제시되고 있다. 그러나 아직까지 암 줄기세포의 집적 및 유지를 조절하는 종양 미세 환경 인자의 실체와 상호작용에 대한 구체적인 기전 연구는 진행되지 못하고 있다.
본 발명에서, "예방"은 본 발명의 miRNA, 발현 벡터, 형질 전환체 또는 약학적 조성물을 이용하여 암 증상을 차단하거나, 암 증상의 억제 또는 지연시키는 모든 행위라면 제한없이 포함할 수 있다.
본 발명에서, "치료"는 본 발명의 miRNA, 발현 벡터, 형질 전환체 또는 약학적 조성물을 이용하여 암 증상이 호전되거나 이롭게 되는 모든 행위라면 제한없이 포함할 수 있다.
본 발명의 miRNA, 발현 벡터, 형질 전환체 또는 약학적 조성물은 다른 항암제와도 추가로 병용 투여할 수 있으며, 이를 통해서 암 세포 및 암 줄기세포에 대한 성장 억제 효과 또는 암 전이 억제 효과를 더욱 증강시킬 수 있다.
여기서 상기 항암제로는 나이트로젠 머스타드, 이마티닙, 옥살리플라틴, 리툭시맙, 엘로티닙, 네라티닙, 라파티닙, 제피티닙, 반데타닙, 니로티닙, 세마사닙, 보수티닙, 악시티닙, 세디라닙, 레스타우르티닙, 트라스투주맙, 게피티니브, 보르테조밉, 수니티닙, 카보플라틴, 베바시주맙, 시스플라틴, 세툭시맙, 비스쿰알붐, 아스파라기나제, 트레티노인, 하이드록시카바마이드, 다사티닙, 에스트라머스틴, 겜투주맵오조가마이신, 이브리투모맙튜세탄, 헵타플라틴, 메칠아미노레불린산, 암사크린, 알렘투주맙, 프로카르바진, 알프로스타딜, 질산홀뮴 키토산, 젬시타빈, 독시플루리딘, 페메트렉세드, 테가푸르, 카페시타빈, 기메라신, 오테라실, 아자시티딘, 메토트렉세이트, 우라실, 시타라빈, 플루오로우라실, 플루다가빈, 에노시타빈, 플루타미드, 데시타빈, 머캅토푸린, 티오구아닌, 클라드리빈, 카르모퍼, 랄티트렉세드, 도세탁셀, 파클리탁셀, 이리노테칸, 벨로테칸, 토포테칸, 비노렐빈, 에토포시드, 빈크리스틴, 빈블라스틴, 테니포시드, 독소루비신, 이다루비신, 에피루비신, 미톡산트론, 미토마이신, 블레로마이신, 다우노루비신, 닥티노마이신, 피라루비신, 아클라루비신, 페프로마이신, 템시롤리무스, 테모졸로마이드, 부설판, 이포스파미드, 사이클로포스파미드, 멜파란, 알트레트민, 다카바진, 치오테파, 니무스틴, 클로람부실, 미토락톨, 레우코보린, 트레토닌, 엑스메스탄, 아미노글루테시미드, 아나그렐리드, 나벨빈, 파드라졸, 타목시펜, 토레미펜, 테스토락톤, 아나스트로졸, 레트로졸, 보로졸, 비칼루타미드, 로무스틴 및 카르무스틴으로 이루어진 군에서 선택된 1종 이상을 사용할 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 있어서, 상기 miRNA, 발현 벡터, 형질 전환체 또는 약학적 조성물은 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태임을 특징으로 할 수 있으며, 상기 miRNA, 발현 벡터, 형질 전환체 또는 약학적 조성물은 인간을 대상으로 하는 것을 특징으로 할 수 있다.
본 발명의 miRNA, 발현 벡터, 형질 전환체 또는 약학적 조성물은 이들로 한정되는 것은 아니지만, 각각 통상의 방법에 따라 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 본 발명의 miRNA, 발현 벡터 또는 형질 전환체는 약제적으로 허용 가능한 담체와 함께 투여될 수 있고, 본 발명의 약학적 조성물은 약제적으로 허용 가능한 담체를 포함할 수 있다. 약제학적으로 허용되는 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. 본 발명의 miRNA, 발현 벡터, 형질 전환체 또는 약학적 조성물의 제형은 상술한 바와 같은 약제학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서(elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형할 수 있다.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.
본 발명에 따른 miRNA, 발현 벡터, 형질 전환체 또는 약학적 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장이 포함된다. 경구 또는 비경구 투하가 바람직하다.
본 발명에서, "비경구"는 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골내 주사 또는 주입기술을 포함한다. 본 발명의 miRNA, 발현 벡터, 형질 전환체 또는 약학적 조성물은 또한 직장 투여를 위한 좌제의 형태로 투여될 수 있다.
본 발명의 miRNA, 발현 벡터, 형질 전환체 또는 약학적 조성물은 사용된 특정 화합물의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여시간, 투여경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 약학적 조성물의 투여량은 환자의 상태, 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있고, 1일 0.0001 내지 50mg/kg 또는 0.001 내지 50mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. 본 발명에 따른 miRNA, 발현 벡터, 형질 전환체 또는 약학적 조성물은 환제, 당의정, 캡슐, 액제, 겔, 시럽, 슬러리, 현탁제로 제형될 수 있다.
본 발명의 miRNA를 포함하는 발현 벡터의 경우 구체적으로 0.01 내지 500 mg을 함유하거나, 보다 구체적으로 0.1 내지 300 mg을 함유하며, 본 발명의 miRNA를 포함하는 재조합 바이러스의 경우, 구체적으로 103~1012 IU(10 내지 1010 PFU)를 함유하고, 보다 구체적으로 105 내지 1010 IU를 함유하나, 이에 한정되지 않는다.
또한, 본 발명의 miRNA를 포함하는 형질 전환체의 경우, 구체적으로 103 내지 108 개를 함유하고, 보다 구체적으로 104 내지 107개를 함유하나, 이에 한정되지 않는다.
또한, 본 발명의 miRNA를 포함하는 발현 벡터 또는 형질 전환체를 유효성분으로 함유하는 조성물의 유효 용량은 체중 1 ㎏당 벡터의 경우에는 0.05 내지 12.5 ㎎/㎏, 재조합 바이러스의 경우에는 107 내지 1011 바이러스 입자(105 내지 109 IU)/㎏, 세포의 경우에는 103 내지 106 세포/㎏이고, 구체적으로 벡터의 경우에는 0.1 내지 10 ㎎/㎏, 재조합 바이러스의 경우에는 108 내지 1010 입자(106 내지 108 IU)/㎏, 세포의 경우에는 102 내지 105 세포/㎏이며, 하루 2 내지 3회 투여될 수 있다. 상기와 같은 조성은 반드시 이에 한정되는 것은 아니고, 환자의 상태 및 질환의 발병 정도에 따라 변할 수 있다.
본 발명에서 제공하는 miRNA는 암 세포뿐만 아니라 암 줄기세포의 성장을 효과적으로 억제하여 암을 예방 및/또는 치료할 수 있으며, 더 나아가서는 암의 내성, 전이 및 재발 또한 방지할 수 있다.
도 1a는 본 발명의 실시예 1에서 MCF7 유방암 세포에 본 발명에 따른 miRNA를 처리한 후 세포 생존율을 분석한 결과를 그래프로 나타낸 것이다.
도 1b는 본 발명의 실시예 1에서 BT474 유방암 세포에 본 발명에 따른 miRNA를 처리한 후 세포 생존율을 분석한 결과를 그래프로 나타낸 것이다.
도 2a는 본 발명의 실시예 2에서 BT474 유방암 줄기세포에 본 발명에 따른 miRNA를 처리한 후 상대적 콜로니 수의 변화를 분석한 결과를 그래프로 나타낸 것이다.
도 2b는 본 발명의 실시예 2에서 HCT15 대장암 줄기세포에 본 발명에 따른 miRNA를 처리한 후 상대적 콜로니 수의 변화를 분석한 결과를 그래프로 나타낸 것이다.
도 3a는 본 발명의 실시예 3에서 SK-MEL-28 흑색종 세포에 본 발명에 따른 hsa-miR-6514-5p miRNA를 처리한 후 세포 생존율을 분석한 결과를 그래프로 나타낸 것이다.
도 3b는 본 발명의 실시예 3에서 SK-MEL-28 흑색종 세포에 본 발명에 따른 hsa-miR-503-3p의 miRNA를 처리한 후 세포 생존율을 분석한 결과를 그래프로 나타낸 것이다.
도 3c는 본 발명의 실시예 3에서 SK-MEL-28 흑색종 세포에 양성 대조군인 hsa-miR-34a를 처리한 후 세포 생존율을 분석한 결과를 그래프로 나타낸 것이다.
도 4a는 본 발명의 실시예 4에서 NCI-H460 폐암 세포에 본 발명에 따른 hsa-miR-6514-5p miRNA를 처리한 후 세포 생존율을 분석한 결과를 그래프로 나타낸 것이다.
도 4b는 본 발명의 실시예 4에서 NCI-H460 폐암 세포에 본 발명에 따른 hsa-miR-503-3p의 miRNA를 처리한 후 세포 생존율을 분석한 결과를 그래프로 나타낸 것이다.
도 4c는 본 발명의 실시예 4에서 NCI-H460 폐암 세포에 양성 대조군인 hsa-miR-34a를 처리한 후 세포 생존율을 분석한 결과를 그래프로 나타낸 것이다.
도 5a는 본 발명의 실시예 5에서 BT474 유방암 줄기세포에 본 발명에 따른 miRNA를 처리한 후 줄기능(stemness) 관련 유전자인 NANOG의 발현 수준의 변화를 분석한 결과를 그래프로 나타낸 것이다.
도 5b는 본 발명의 실시예 5에서 BT474 유방암 줄기세포에 본 발명에 따른 miRNA를 처리한 후 줄기능(stemness) 관련 유전자인 OCT4의 발현 수준의 변화를 분석한 결과를 그래프로 나타낸 것이다.
도 5c는 본 발명의 실시예 5에서 BT474 유방암 줄기세포에 본 발명에 따른 miRNA를 처리한 후 줄기능(stemness) 관련 유전자인 CK18의 발현 수준의 변화를 분석한 결과를 그래프로 나타낸 것이다.
도 6a는 본 발명의 실시예 5에서 HCT15 대장암 줄기세포에 본 발명에 따른 miRNA를 처리한 후 줄기능(stemness) 관련 유전자인 NANOG의 발현 수준의 변화를 분석한 결과를 그래프로 나타낸 것이다.
도 6b는 본 발명의 실시예 5에서 HCT15 대장암 줄기세포에 본 발명에 따른 miRNA를 처리한 후 줄기능(stemness) 관련 유전자인 OCT4의 발현 수준의 변화를 분석한 결과를 그래프로 나타낸 것이다.
도 6c는 본 발명의 실시예 5에서 HCT15 대장암 줄기세포에 본 발명에 따른 miRNA를 처리한 후 줄기능(stemness) 관련 유전자인 KRT20의 발현 수준의 변화를 분석한 결과를 그래프로 나타낸 것이다.
도 7a는 본 발명의 실시예 6에서 SK-MEL-28 흑색종 줄기세포에 본 발명에 따른 miRNA를 처리한 후 줄기능(stemness) 관련 유전자인 NANOG의 발현 수준의 변화를 분석한 결과를 그래프로 나타낸 것이다.
도 7b는 본 발명의 실시예 6에서 SK-MEL-28 흑색종 줄기세포에 본 발명에 따른 miRNA를 처리한 후 줄기능(stemness) 관련 유전자인 OCT4의 발현 수준의 변화를 분석한 결과를 그래프로 나타낸 것이다.
도 8은 본 발명의 실시예 7에서 SK-MEL-28 흑색종 세포에 본 발명에 따른 miRNA를 처리한 후 마트리겔을 통과하여 트랜스웰 밑면에 부착된 침윤 암 세포의 수를 나타낸 것이다.
도 9는 본 발명의 실시예 7에서 SK-MEL-28 흑색종 세포에 본 발명에 따른 miRNA를 처리한 후 마트리겔을 통과하여 트랜스웰 밑면에 부착된 침윤 암 세포의 사진을 나타낸 것이다.
도 10은 본 발명의 실시예 8에서 NCI-H460 폐암 세포에 본 발명에 따른 miRNA를 처리한 후 마트리겔을 통과하여 트랜스웰 밑면에 부착된 침윤 암 세포의 수를 나타낸 것이다.
도 11은 본 발명의 실시예 8에서 NCI-H460 폐암 세포에 본 발명에 따른 miRNA를 처리한 후 마트리겔을 통과하여 트랜스웰 밑면에 부착된 침윤 암 세포의 사진을 나타낸 것이다.
본 발명의 일 구현 예에 따르면, 서열번호 1 내지 3 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효 성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물에 관한 것이다.
본 발명의 다른 구현 예에 따르면, 서열번호 1 내지 3 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효 성분으로 포함하는 암 줄기세포의 성장 억제용 약학적 조성물에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 서열번호 1 내지 3 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효 성분으로 포함하는 암의 전이의 예방 또는 치료용 약학적 조성물에 관한 것이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예
[준비예 1] miRNA의 준비
하기 표 2에 나타낸 염기 서열로 표시되는 3종의 miRNA를 합성하였다.
miRNA 종류 염기서열
hsa-miR-328-3p miRNA CUGGCCCUCUCUGCCCUUCCGU(서열번호 4)
hsa-miR-6514-5p miRNA UAUGGAGUGGACUUUCAGCUGGC(서열번호 5)
hsa-miR-503-3p miRNA GGGGUAUUGUUUCCGCUGCCAGG(서열번호 6)
[준비예 2] 암 세포 및 암 줄기세포의 준비
ATCC로부터 MCF-7, BT474, HCT15 및 SK-MEL-28 암 세포주를 구매한 뒤 B27 supplement와 성장 인자(FGF 및 EGF 20 ng/mL)가 첨가된 DMEM/F12 배지에서 배양하며 암 줄기세포를 유도하였다. 암 줄기세포 마커인 CD44+가 발현된 세포 만을 선별하여 약 2주 동안 배양하였다.
또한, 그 외의 암 세포로 NCI-H460 암 세포주를 준비하였다.
[실시예 1] 암 세포 및 암 줄기세포의 생존율 평가
리포펙타민(lipofectamine)을 이용하여 상기 준비예 2에서 준비된 MCF-7 및 BT474 유방암 줄기세포 각각에 상기 준비예 1에서 준비된 3종의 miRNA를 48 시간 동안 도입한 뒤 세포 생존율의 변화를 비교하여 도 1a 및 1b에 나타내었다. 단, 음성 대조군으로는 아무런 처리를 하지 않았고, 양성 대조군으로는 5-플루오로우라실(5-FU)(Sigma, USA)을 처리하였다.
도 1a 및 1b에서 보는 바와 같이, 유방암 줄기세포에 본 발명에 따른 miRNA를 처리하자 유방암 줄기세포의 생존율이 현저히 감소하는 것을 확인할 수 있었다.
이를 통하여 본 발명에 따른 miRNA는 암 세포, 혹은 암 줄기세포의 성장 및 증식 억제 및 사멸 유도 효과가 있음을 알 수 있다.
[실시예 2] 암 세포 및 암 줄기세포의 증식 억제 평가
상기 실시예 1과 동일한 방법으로 상기 준비예 2에서 준비된 BT474 유방암 줄기세포 및 HCT15 대장암 줄기세포 각각에 상기 준비예 1의 3종의 miRNA를 도입한 뒤 콜로니 수의 변화를 비교하여 도 2a 및 2b에 나타내었다. 단, 음성 대조군으로는 아무런 처리를 하지 않았고, 양성 대조군으로는 5-플루오로우라실(5-FU)(Sigma, USA)을 처리하였다.
도 2a 및 2b에서 보는 바와 같이, 유방암 줄기세포 및 대장암 줄기세포 각각에 본 발명에 따른 miRNA를 처리하자 암 줄기세포의 콜로니 수가 현저히 감소하는 것을 확인할 수 있었다.
이를 통하여 본 발명에 따른 miRNA는 암 세포, 혹은 암 줄기세포의 성장 및 증식 억제 및 사멸 유도 효과가 있음을 알 수 있다.
[실시예 3] 암 세포의 생존율 평가
리포펙타민(lipofectamine)을 이용하여 상기 준비예 2에서 준비한 SK-MEL-28 흑색종 세포에 상기 준비예 1에서 준비한 hsa-miR-6514-5p 및 hsa-miR-503-3p의 miRNA를 48 시간 동안 도입한 뒤 처리 농도에 따른 세포 생존율의 변화를 비교하여 도 3a 내지 3c에 나타내었고, 상기 흑색종 세포에 대한 IC50와 전체 흑색종 세포의 사멸을 위한 최종 농도를 측정하여 그 결과를 하기 표 3에 나타내었다. 단, 음성 대조군으로는 아무런 처리를 하지 않았고, 양성 대조군으로는 임상 1상에 진입한 유일한 miRNA mimic 기반 치료제인 miR-34a를 사용하였다.
구분 IC50(nM) Final Conc. (nM)
miR34a 1.715 1715
hsa-miR-6514-5p 0.6800 680
hsa-miR-503-3p 0.02280 22
도 3a 내지 3c 및 표 3에서 보는 바와 같이, 흑색종 세포에 본 발명에 따른 miRNA를 처리하자 흑색종 세포의 생존율이 현저히 감소하였으며, 양성 대조군인 miR-34a를 처리한 경우보다 낮은 농도에서 흑색종 세포의 생존율을 현저히 억제하는 것을 확인할 수 있었다.
이를 통하여 본 발명에 따른 miRNA는 암 세포의 성장 및 증식 억제 및 사멸 유도 효과가 있음을 알 수 있다.
[실시예 4] 암 세포의 생존율 평가
리포펙타민(lipofectamine)을 이용하여 상기 준비예 2에서 준비한 NCI-H460 폐암 세포에 상기 준비예 1에서 준비한 hsa-miR-6514-5p 및 hsa-miR-503-3p의 miRNA를 48 시간 동안 도입한 뒤 처리 농도에 따른 세포 생존율의 변화를 비교하여 도 4a 내지 4c에 나타내었고, 상기 폐암 세포에 대한 IC50와 전체 폐암 세포의 사멸을 위한 최종 농도를 측정하여 그 결과를 하기 표 4에 나타내었다. 이때, 음성 대조군으로는 아무런 처리를 하지 않았고, 양성 대조군으로는 miR-34a를 사용하였다.
구분 IC50(nM) Final Conc. (nM)
miR34a 0.01030 10
hsa-miR-6514-5p 0.01718 17
hsa-miR-503-3p 0.003044 3
도 4a 내지 4c 및 표 4에서 보는 바와 같이, 폐암 세포에 본 발명에 따른 miRNA를 처리한 경우 양성 대조군인 miR-34a를 처리한 경우와 동등 이상의 수준으로 폐암 세포의 생존율을 현저히 감소시키는 것을 확인할 수 있었다.
이를 통하여 본 발명에 따른 miRNA는 암 세포의 성장 및 증식 억제 및 사멸 유도 효과가 있음을 알 수 있다.
[실시예 5] 암 줄기세포의 줄기세포능 억제 평가
상기 실시예 1과 동일한 방법으로 상기 준비예 2에서 준비된 BT474 암 줄기세포 및 HCT15 암 줄기세포 각각에 상기 준비예 1의 3종의 miRNA를 도입한 뒤 miRNA가 도입된 암 줄기세포를 수확(harvesting)하여 NANOG, OCT4, CK18 및 KRT20의 RNA를 분리한 뒤 cDNA를 합성하고 하기 표 5에 나타낸 프라이머를 이용하여 qPCR 기법을 통해 유전자의 실시간 증폭되는 사이클(cycle)을 수치화해 정량화 하였다. 그 결과는 도 5a 내지 5c 및 도 6a 내지 6c와 같다. 단, 음성 대조군으로는 아무런 처리를 하지 않았고, 양성 대조군으로는 나파부카신(napabucasin)(Abcam, USA)을 처리하였다.
프라이머 이름 프라이머 서열
Nanog Forward CCCCAGCCTTTACTCTTCCTA
Reverse CCAGGTTGAATTGTTCCAGGTC
OCT4 Forward GTGTTCAGCCAAAAGACCATCT
Reverse GGCCTGCATGAGGGTTTCT
CK18 Forward TGAGACGTACAGTCCAGTCCTT
Reverse GCTCCATCTGTAGGGCGTAG
KRT20 Forward AGGAGACCAAGGCCCGTTA
Reverse ATCAGTTGGGCCTCCAGAGA
GAPDH Forward AATCCCATCACCATCTTCCA
Reverse TGGACTCCACGACGTACTCA
도 5a 내지 5b 및 도 6a 내지 6b에서 보는 바와 같이, BT474 유방암 줄기세포 및 HCT15 대장암 줄기세포에 본 발명에 따른 miRNA를 처리하자 줄기능(stemness)과 관련된 유전자인 NANOG 및 OCT14의 발현 수준이 현저히 저감된 것을 확인할 수 있었고, 도 5c 및 도 6c에서 보는 바와 같이, 암 줄기세포에서 그 발현이 억제된 CK18 및 KRT20의 발현 수준은 증가한 것을 볼 수 있다.
이를 통하여 본 발명에 따른 miRNA는 암 줄기세포의 줄기세포능(stemness)을 상실하도록 하는 효과가 있음을 알 수 있다.
[실시예 6] 암 줄기세포의 줄기세포능 억제 평가
상기 실시예 1과 동일한 방법으로 상기 준비예 2에서 준비된 SK-MEL-28 흑색종 줄기세포에 상기 준비예 1에서 준비한 hsa-miR-6514-5p 및 hsa-miR-503-3p의 miRNA를 도입한 뒤 miRNA가 도입된 암 줄기세포를 수확(harvesting)하여 NANOG 및 OCT4의 RNA를 분리한 뒤 cDNA를 합성하고 상기 실시예 5의 표 5에 나타낸 프라이머를 이용하여 qPCR 기법을 통해 유전자의 실시간 증폭되는 사이클(cycle)을 수치화해 정량화 하였다. 그 결과는 도 7a 내지 7b로 나타내었다. 단, 음성 대조군으로는 아무런 처리를 하지 않았고, 양성 대조군으로는 miR-34a를 사용하였다.
도 7a 내지 7b에서 보는 바와 같이, SK-MEL-28 흑색종 줄기세포에 본 발명에 따른 miRNA를 처리하자 줄기능(stemness)과 관련된 유전자인 NANOG 및 OCT14의 발현 수준이 현저히 감소된 것을 확인할 수 있었다.
이를 통하여 본 발명에 따른 miRNA는 암 줄기세포의 줄기세포능(stemness)을 상실하도록 하는 효과가 있음을 알 수 있다.
[실시예 7] 암 세포의 침윤 억제능 평가
상기 준비예 2에서 준비한 SK-MEL-28 흑색종 세포에 상기 준비예 1의 hsa-miR-6514-5p 및 hsa-miR-503-3p의 miRNA를 도입하고, 50 μl의 0.1X 마트리겔(matrigel)(Corning, USA)을 코팅한 트랜스웰(transwell)(Corning, USA)에 2일간 배양하였다. 그 후, 마트리겔을 통과하여 트랜스웰 밑면에 부착된 침윤 암 세포를 관찰하였다. 각 세포 별 침윤 암 세포의 수와 암 세포의 사진을 측정한 결과를 도 8 및 9에 나타내었다. 단, 음성 대조군으로는 아무런 처리를 하지 않았고, 양성 대조군으로는 miR-34a를 사용하였다.
도 8 및 9에서 보는 바와 같이, 흑색종 세포에 본 발명에 따른 miRNA를 처리한 경우 무처리한 음성 대조군 또는 miR-34a를 처리한 경우보다 침윤 세포의 수가 현저히 감소한 것을 확인할 수 있었고, 특히 도 8에 의하면 흑색종 세포에 본 발명에 따른 miRNA를 처리한 경우 음성 대조군 대비 침윤한 세포의 수가 대략 90% 정도 감소하였고, 양성 대조군 대비 대략 75% 감소한 것을 확인할 수 있었다.
이를 통하여 본 발명에 따른 miRNA는 암 세포의 전이 억제 효과가 있음을 알 수 있다.
[실시예 8] 암 세포의 침윤 억제능 평가
상기 준비예 2에서 준비한 NCI-H460 폐암 세포에 상기 준비예 1의 hsa-miR-6514-5p 및 hsa-miR-503-3p의 miRNA를 도입하고, 50 μl의 0.1X 마트리겔(matrigel)(Corning, USA)을 코팅한 트랜스웰(transwell)(Corning, USA)에 2일간 배양하였다. 그 후, 마트리겔을 통과하여 트랜스웰 밑면에 부착된 침윤 암 세포를 관찰하였다. 각 세포 별 침윤 암 세포의 수와 암 세포의 사진을 측정한 결과를 도 10 및 11에 나타내었다. 단, 음성 대조군으로는 아무런 처리를 하지 않았고, 양성 대조군으로는 miR-34a를 사용하였다.
도 10 및 11에서 보는 바와 같이, 폐암 세포에 본 발명에 따른 miRNA를 처리한 경우 무처리한 음성 대조군 또는 miR-34a를 처리한 경우보다 침윤 세포의 수가 현저히 감소한 것을 확인할 수 있었고, 특히 도 10에 의하면 폐암 세포에 본 발명에 따른 miRNA를 처리한 경우 음성 대조군 대비 침윤한 세포의 수가 대략 60% 정도 감소하였고, 양성 대조군 대비 대략 40% 감소한 것을 확인할 수 있었다.
이를 통하여 본 발명에 따른 miRNA는 암 세포의 전이 억제 효과가 있음을 알 수 있다.
본 발명은 암을 예방, 개선 또는 치료할 수 있는 약학적 조성물에 관한 것이다.
서열번호 1: UGGCCCU
서열번호 2: AUGGAGU
서열번호 3: GGGUAUU
서열번호 4: CUGGCCCUCUCUGCCCUUCCGU
서열번호 5: UAUGGAGUGGACUUUCAGCUGGC
서열번호 6: GGGGUAUUGUUUCCGCUGCCAGG

Claims (27)

  1. 서열번호 1 내지 3 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효 성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서,
    상기 miRNA는 서열번호 1 내지 3 중 어느 하나로 표시되는 염기서열을 포함하며 총 14 내지 29개의 연속적인 염기서열로 이루어지는, 약학적 조성물.
  3. 제1항에 있어서,
    상기 miRNA는,
    (1) hsa-miR-328-3p miRNA, hsa-miR-6514-5p miRNA 및 hsa-miR-503-3p miRNA로 이루어진 군에서 선택된 1종 이상의 miRNA; 및
    (2) 상기 서열번호 1 내지 3 중 어느 하나로 표시되는 염기서열은 포함하되, 상기 (1)의 염기 서열과 상동성이 90% 이상인 염기서열로 이루어진 miRNA; 중 적어도 하나를 포함하는, 약학적 조성물.
  4. 제3항에 있어서,
    상기 hsa-miR-328-3p miRNA는 서열번호 4의 염기서열로 구성되는 것인, 약학적 조성물.
  5. 제3항에 있어서,
    상기 hsa-miR-6514-5p miRNA는 서열번호 5의 염기서열로 구성되는 것인, 약학적 조성물.
  6. 제3항에 있어서,
    상기 hsa-miR-503-3p miRNA는 서열번호 6의 염기서열로 구성되는 것인, 약학적 조성물.
  7. 제1항에 있어서,
    상기 miRNA를 구성하는 핵산 분자 중 적어도 하나는,
    인산 뼈대 구조 (phosphate backbone structure)가 황 원소로 치환한 형태인 포스포로사이오에이트 (phosphorothiolate) 구조가 포함하는 형태;
    DNA, PNA(petide nucleic acids) 또는 LNA(locked nucleic acid) 분자로 치환된 형태; 또는
    당의 2'수산화기가 메틸화, 메톡시화 또는 플르오르화 구조로 치환된 형태인, 약학적 조성물.
  8. 제1항에 있어서,
    상기 miRNA는 miRNA 전구체(miRNA precursor), 일차 miRNA (pri-miRNA) 또는 플라스미드 (plasmid) 형태의 miRNA 전구체인, 약학적 조성물.
  9. 제1항에 있어서,
    상기 miRNA는 단일 가닥 또는 이중 가닥의 형태인, 약학적 조성물.
  10. 제1항에 있어서,
    상기 약학적 조성물은 암 세포 또는 암 줄기세포의 증식 억제 또는 사멸을 유도하거나, 암 줄기세포의 줄기세포능(stemness)을 억제하거나, 상기 암 세포 또는 암 줄기세포의 전이를 억제하는, 약학적 조성물.
  11. 제1항에 있어서,
    상기 약학적 조성물은 NANOG 및 OCT4 중 적어도 하나의 발현을 억제하거나, CK18 및 KRT20 중 적어도 하나의 발현은 증가시키는, 약학적 조성물.
  12. 제1항에 있어서,
    상기 암은 유방암, 대장암, 자궁암, 나팔관암, 난소암, 위암, 뇌암, 두경부암, 직장암, 소장암, 식도암, 임파선암, 담낭암, 폐암, 피부암, 신장암, 방광암, 혈액암, 췌장암, 전립선암, 갑상선암, 내분비선암, 구강암, 간암 및 혈액암으로 이루어진 군에서 선택되는, 약학적 조성물.
  13. 제1항에 있어서,
    상기 발현 벡터는 비바이러스성 벡터 또는 바이러스성 벡터인, 약학적 조성물.
  14. 서열번호 1 내지 3 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효 성분으로 포함하는 암 줄기세포의 성장 억제용 약학적 조성물.
  15. 제14항에 있어서,
    상기 miRNA는 서열번호 1 내지 3 중 어느 하나로 표시되는 염기서열을 포함하며 총 14 내지 29개의 연속적인 염기서열로 이루어지는, 약학적 조성물.
  16. 제14항에 있어서,
    상기 miRNA는,
    (1) hsa-miR-328-3p miRNA, hsa-miR-6514-5p miRNA 및 hsa-miR-503-3p miRNA로 이루어진 군에서 선택된 1종 이상의 miRNA; 및
    (2) 상기 서열번호 1 내지 3중 어느 하나로 표시되는 염기서열은 포함하되, 상기 (1)의 염기 서열과 상동성이 90% 이상인 염기서열로 이루어진 miRNA; 중 적어도 하나를 포함하는, 약학적 조성물.
  17. 제16항에 있어서,
    상기 hsa-miR-328-3p miRNA는 서열번호 4의 염기서열로 구성되는 것인, 약학적 조성물.
  18. 제16항에 있어서,
    상기 hsa-miR-6514-5p miRNA는 서열번호 5의 염기서열로 구성되는 것인, 약학적 조성물.
  19. 제16항에 있어서,
    상기 hsa-miR-503-3p miRNA는 서열번호 6의 염기서열로 구성되는 것인, 약학적 조성물.
  20. 제14항에 있어서,
    상기 miRNA를 구성하는 핵산 분자 중 적어도 하나는,
    인산 뼈대 구조 (phosphate backbone structure)가 황 원소로 치환한 형태인 포스포로사이오에이트 (phosphorothiolate) 구조가 포함하는 형태;
    DNA, PNA(petide nucleic acids) 또는 LNA(locked nucleic acid) 분자로 치환된 형태; 또는
    당의 2'수산화기가 메틸화, 메톡시화 또는 플르오르화 구조로 치환된 형태인, 약학적 조성물.
  21. 제14항에 있어서,
    상기 miRNA는 miRNA 전구체(miRNA precursor), 일차 miRNA (pri-miRNA) 또는 플라스미드 (plasmid) 형태의 miRNA 전구체인, 약학적 조성물.
  22. 제14항에 있어서,
    상기 암은 유방암, 대장암, 자궁암, 나팔관암, 난소암, 위암, 뇌암, 두경부암, 직장암, 소장암, 식도암, 임파선암, 담낭암, 폐암, 피부암, 신장암, 방광암, 혈액암, 췌장암, 전립선암, 갑상선암, 내분비선암, 구강암, 간암 및 혈액암으로 이루어진 군에서 선택되는, 약학적 조성물.
  23. 제14항에 있어서,
    상기 발현 벡터는 비바이러스성 벡터 또는 바이러스성 벡터인, 약학적 조성물.
  24. 서열번호 1 내지 3 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효 성분으로 포함하는 암의 전이의 예방 또는 치료용 약학적 조성물.
  25. 암을 예방 또는 치료하기 위하여, 치료를 필요로 하는 대상체에 서열번호 1 내지 3 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효량으로 투여하는 단계를 포함하는, 암의 예방 또는 치료 방법.
  26. 암 줄기세포의 성장을 억제하기 위하여, 치료를 필요로 하는 대상체에 서열번호 1 내지 3 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효량으로 투여하는 단계를 포함하는, 암 줄기세포의 성장 억제 방법.
  27. 암의 전이를 예방 또는 치료하기 위하여, 치료를 필요로 하는 대상체에 서열번호 1 내지 3 중 어느 하나의 염기서열로 표시되는 종자 서열(seed sequence)을 포함하는 miRNA; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 형질 전환체를 유효량으로 투여하는 단계를 포함하는, 암의 전이의 예방 또는 치료 방법.
PCT/KR2018/006865 2017-06-16 2018-06-18 암의 예방 또는 치료용 약학적 조성물 WO2018231034A2 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/623,249 US20210139895A1 (en) 2017-06-16 2018-06-18 Pharmaceutical composition for preventing or treating cancer

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2017-0076793 2017-06-16
KR20170076793 2017-06-16

Publications (2)

Publication Number Publication Date
WO2018231034A2 true WO2018231034A2 (ko) 2018-12-20
WO2018231034A3 WO2018231034A3 (ko) 2019-04-11

Family

ID=64660657

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/006865 WO2018231034A2 (ko) 2017-06-16 2018-06-18 암의 예방 또는 치료용 약학적 조성물

Country Status (3)

Country Link
US (1) US20210139895A1 (ko)
KR (1) KR102110103B1 (ko)
WO (1) WO2018231034A2 (ko)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102418779B1 (ko) * 2018-12-12 2022-07-08 (주)프로스테믹스 신규한 miRNA 유사체 및 이의 용도
WO2021251526A1 (ko) * 2020-06-11 2021-12-16 주식회사 프로스테믹스 신규한 mirna 유사체 및 이의 용도

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2857881A1 (en) * 2004-11-12 2006-12-28 Asuragen, Inc. Methods and compositions involving mirna and mirna inhibitor molecules
WO2010056737A2 (en) * 2008-11-11 2010-05-20 Mirna Therapeutics, Inc. Methods and compositions involving mirnas in cancer stem cells
WO2012063894A1 (ja) * 2010-11-12 2012-05-18 国立大学法人愛媛大学 マイクロｒｎａのアンチセンスオリゴヌクレオチドを含む組成物
JP6144355B2 (ja) * 2012-11-26 2017-06-07 モデルナティエックス インコーポレイテッドＭｏｄｅｒｎａＴＸ，Ｉｎｃ． 化学修飾ｍＲＮＡ
RU2686313C2 (ru) * 2015-02-25 2019-04-25 Байонир Корпорейшн Фармацевтическая композиция для лечения рака, содержащая микроРНК в качестве активного ингредиента

Also Published As

Publication number Publication date
US20210139895A1 (en) 2021-05-13
KR20180137435A (ko) 2018-12-27
KR102110103B1 (ko) 2020-05-13
WO2018231034A3 (ko) 2019-04-11

Similar Documents

Publication Publication Date Title
JP2022023186A (ja) Ｎｍｔ２の後成的なサイレンシング
WO2012053741A9 (ko) Rna 간섭을 유도하는 핵산 분자 및 그 용도
WO2019050071A1 (ko) 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물
WO2012161545A9 (ko) 엡스타인바 바이러스 마이크로 알엔에이를 포함하는 세포사멸 촉진 또는 세포성장억제를 위한 조성물
WO2018231034A2 (ko) 암의 예방 또는 치료용 약학적 조성물
WO2011122889A2 (ko) miRNA의 발현 억제를 이용한 성체줄기세포의 노화 억제 방법
CN113573781A (zh) 5-卤代尿嘧啶修饰的微rna及其在癌症治疗中的用途
WO2015005669A1 (en) LIVER CANCER RELATED GENES-SPECIFIC siRNA, DOUBLE-STRANDED OLIGO RNA MOLECULES COMPRISING THE siRNA, AND COMPOSITION FOR PREVENTING OR TREATING CANCER COMPRISING THE SAME
KR101667169B1 (ko) 암 치료제
Mirzaei et al. Exosomes and MicroRNAs in biomedical science
Vispé et al. Consequences of combining siRNA-mediated DNA methyltransferase 1 depletion with 5-aza-2′-deoxycytidine in human leukemic KG1 cells
WO2019216489A1 (ko) 암의 예방 또는 치료용 약학적 조성물
US9006200B2 (en) MicroRNA-based approach to treating malignant pleural mesothelioma
KR102132198B1 (ko) Tert 프로모터 돌연변이에 특이적인 crispr 시스템 및 그의 이용
WO2021194179A1 (ko) Stat3 및 mtor를 이중 특이적으로 표적하는 핵산서열을 포함한 항암 바이러스
US20200071695A1 (en) Method and pharmaceutical composition for treating cancer
JP6195327B2 (ja) 修飾ｓｉＲＮＡ及びそれを含む医薬組成物
WO2021137506A1 (ko) Wdr34 억제제를 포함하는 암줄기세포 성장 억제용 조성물 및 그 용도
WO2010095879A2 (ko) 세포사멸 관련 유전자의 전사체에 결합하는 ｓｉＲＮＡ 및 이를 이용한 암 치료용 조성물
WO2013165061A1 (ko) Ｓｃｆ 또는 이의 수용체를 억제하는 물질을 포함하는 혈관 투과성 관련 질환의 치료 또는 예방용 조성물
WO2019103578A1 (ko) 올리고뉴클레오티드 및 이를 포함하는 암의 예방 또는 치료용 약학적 조성물
EP2654801B1 (en) Targeting glioma stem cells by sequence-specific functional inhibition of pro-survival oncomir-138
US20190055553A1 (en) Methods for identifying and targeting non-coding rna scaffolds
WO2020246717A1 (ko) Heres 발현 억제제를 포함하는 편평상피세포암 예방 또는 치료용 약학적 조성물
WO2022154636A1 (ko) Mir 145 억제제를 유효성분으로 포함하는 심근경색증의 치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18816999

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18816999

Country of ref document: EP

Kind code of ref document: A2

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 09/04/2020)

122 Ep: pct application non-entry in european phase

Ref document number: 18816999

Country of ref document: EP

Kind code of ref document: A2