WO2019103578A1 - 올리고뉴클레오티드 및 이를 포함하는 암의 예방 또는 치료용 약학적 조성물 - Google Patents

올리고뉴클레오티드 및 이를 포함하는 암의 예방 또는 치료용 약학적 조성물 Download PDF

Info

Publication number
WO2019103578A1
WO2019103578A1 PCT/KR2018/014732 KR2018014732W WO2019103578A1 WO 2019103578 A1 WO2019103578 A1 WO 2019103578A1 KR 2018014732 W KR2018014732 W KR 2018014732W WO 2019103578 A1 WO2019103578 A1 WO 2019103578A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
oligonucleotide
seq
double
present
Prior art date
Application number
PCT/KR2018/014732
Other languages
English (en)
French (fr)
Inventor
서민구
윤상원
고성렬
이준원
박병순
최은욱
Original Assignee
(주)프로스테믹스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)프로스테믹스 filed Critical (주)프로스테믹스
Publication of WO2019103578A1 publication Critical patent/WO2019103578A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/30—Nucleotides
    • C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs

Definitions

  • the present invention relates to oligonucleotides and pharmaceutical compositions capable of effectively preventing or treating cancer, including the oligonucleotides.
  • MicroRNAs are small non-coding RNAs composed of 18 to 25 nucleotides (nt) and bind to the 3'-untranslated region (UTR) of the target gene to regulate gene expression (Bartel DP (Lewis BP, et al., Cell 120: 15-20, 2005), intron, exon, or intergenic region, (Rodriguez, et al., Genome Res 14: 1902-1910, 2004).
  • miRNAs are transcribed by RNA polymerases into early miRNA molecules containing thousands of nucleotides (pri-miRNA).
  • the pri-miRNA is then used as a microprocessor (DroshaRNase endonuclease and DiGeorge syndrome region gene 8 protein, DGCR8) to form approximately 70 nt trunk loop intermediates, known as miRNA precursors.
  • DGCR8 DiGeorge syndrome region gene 8 protein
  • the pre-miRNA is then transferred from the nucleus to the cytoplasm via exoportin-5 (Exportin-5, EXP5) and the cofactor Ran-GTP, where the pre-miRNA is expressed by RNase endonuclease Dicer 18-25 nt mature miRNA duplexes (Lee Y, et al., EMBO J23: 4051-4060, 2004; Shenouda SK, et al., Cancer Metastasis Rev 28: 369-378, 2009).
  • Mature miRNA duplexes are integrated as single-stranded RNA with Argonaute protein into an RNA-induced silencing complex (RISC), which induces either truncation or translational inhibition of the target mRNA (Diederichs S, et al., Cell 131: 1097-1108, 2007; Hammond SM, et al., Nature 404: 293-296,2000; Martinez et al., Cell 110: 563-574, 2002).
  • miRNAs are associated with various biological processes involved in cancer development, including cancer cell proliferation and invasion, and miRNA expression is bi-directionally regulated in many types of cancer (Esquela-Kerscher A, et al., Nat Rev Cancer 6: 259-269 , 2006).
  • Cancer is one of the most common causes of death worldwide. Approximately 10 million new cases occur each year, accounting for approximately 12% of all deaths and the third leading cause of death.
  • breast cancer is the most common malignant tumor that causes more than 40,000 deaths every year in women. Early diagnosis is very important. However, despite the treatment of many known cancer treatment modalities, Has not been improved.
  • Chemotherapy a typical chemotherapy, has been used as the most effective therapy for treating cancer at present, either alone or in combination with other therapies such as radiation therapy.
  • cancer treatment drugs in chemotherapy depends on its ability to kill cancer cells, but it has the problem that it can act not only on cancer cells but also on ordinary cells when drugs are used.
  • Cancer stem cells are cancer cells with unlimited regenerative capacity.
  • the hypothesis that stem cells originate from the stem cells is that, in the late 1990s, a group of cancer stem cells that can become cancer stem cells in acute myeloid leukemia After transplantation, human leukemia was confirmed to be reproduced in mice, and after that, cancer stem cells were confirmed in breast cancer, and solid carcinoma was confirmed in stem cell.
  • Another object of the present invention is to provide a pharmaceutical composition including the oligonucleotide described above, which can prevent, ameliorate or treat cancer but also can prevent cancer resistance, metastasis or recurrence.
  • an oligonucleotide represented by any one of SEQ ID NOS: 1 to 10.
  • oligonucleotides represented by any one of SEQ ID NOs: 1, 3, 5, 7 and 9 or oligonucleotides having 90% or more, 91% or more, 92% or more, 93% or more, 94% Or more, 96% or more, 97% or more, 98% or more, or 99% or more homology with the nucleotide sequence of SEQ ID NO: And oligonucleotides that can be hybridized thereto.
  • ≪ RTI ID 0.0 > [0002] < / RTI >
  • oligonucleotides represented by any one of SEQ ID NOs: 2, 4, 6, 8 and 10 or oligonucleotides having 90% or more, 91% or more, 92% or more, 93% , 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology with the nucleotide sequence of SEQ ID NO: And oligonucleotides that can be hybridized thereto.
  • ≪ RTI ID 0.0 > [0002] < / RTI >
  • the " oligonucleotide" is a DNA, RNA or DNA / RNA hybrid molecule, more preferably an RNA molecule.
  • Hybridization in the present invention means that both strands of the oligonucleotide can form base pairs. Both strands of complementary oligonucleotides form base pairs in the Watson-Crick fashion to form double strands. In the present invention, when the base U is mentioned, it is possible to substitute with the base T unless otherwise stated.
  • the oligonucleotides may contain naturally occurring or modified, non-naturally occurring bases and may contain modified sugars, phosphates, and / or ends.
  • phosphate modifications include, but are not limited to, methyl phosphonate, phosphorothioate, phosphoramidate (bridged or non-bridged), phosphotriester and phosphorodithioate And can be used in any combination.
  • the RNA oligonucleotides have a phosphorothioate linkage, a phosphodiester linkage alone, or a combination of phosphodiester and phosphorothioate linkages.
  • the use of base modifications in the ordered sequence of the oligonucleotides should not interfere with the self-complementarity of the bases involved for Watson-Crick base pairing.
  • the modified base can be used without such limitation.
  • 2'-O-methyl-uridine and 2'-O-methyl-cytidine can be used outside of the rotatory sequence, while 5-bromo-2'-deoxycytidine It can be used both internally and externally.
  • Other modified nucleotides that can be used both internally and externally in the translated sequence include 7-deaza-8-aza-dG, 2-amino-dA, and 2-thio-dT.
  • the oligonucleotides may comprise phosphate-modified oligonucleotides, some of which are known to stabilize oligonucleotides. Accordingly, some embodiments of the invention include stabilized oligonucleotides.
  • the synthesis of oligonucleotides containing modified phosphate linkages or non-phosphate linkages is also known in the art (see, for example, Matteucci " Oligonucleotide Analogs: an Overview " in Oligonucleotides as Therapeutic Agents, (DJ Chadwick and G. Cardew, ed.) John Wiley and Sons, New York, NY, 1997).
  • a phosphor derivative (or modified phosphate group) that may be attached to a sugar or sugar analog moiety at an oligonucleotide is a monophosphate, a diphosphate, a triphosphate, an alkylphosphonate, a phosphorothioate, a phosphorodithioate, Formamidate, and the like.
  • phosphorothioate oligonucleotides is similar to that described above for naturally occurring oligonucleotides, except that the oxidation step is replaced by a sulfation step (see Zon " Oligonucleoside Phosphorothioates " in Protocols for Oligonucleotides and Analogs, Synthesis and Properties (Agrawal, ed.) Humana Press, pp. 165-190, 1993).
  • the oligonucleotides may comprise one or more ribonucleotides (containing ribose as the sole or major sugar component), deoxyribonucleotides (containing deoxyribose as the major sugar component), modified sugars or sugar analogs.
  • the sugar moiety may be pentose, deoxypentose, hexose, deoxyhexose, glucose, arabinose, xylose, lactic acid, and sugar analog cyclopentyl groups.
  • the sugar may be present in the form of a pyranosyl or furanosyl.
  • the sugar moiety is preferably a furanoside of ribose, deoxyribose, arabinose or 2'-O-alkyl (e.g., methyl, ethyl) ribose, Can be attached to the base in anomeric coordination.
  • the sugar variants include, but are not limited to, 2'-alkoxy (e.g., methoxy, ethoxy) -RNA analogs, 2'- amino- RNA analogs, 2'-fluoro-RNA, 2'- Or amino-RNA / DNA chimeras.
  • sugars or sugar analogs and the preparation of each nucleoside in which such a sugar or analogue is itself attached to a heterocyclic base are known and need not be described here.
  • the sugar variants can also be prepared in the preparation of the oligonucleotides of the present invention and combined with any phosphate modification.
  • the heterocyclic bases or nucleic acid bases incorporated into the oligonucleotides are not limited to naturally occurring main purines and pyrimidine bases (i.e., uracil, thymine, cytosine, adenine and guanine as mentioned above) Naturally occurring and synthetic variants.
  • the oligonucleotides of the present invention may include one or more of inosine, 2'-deoxyuridine and 2-amino-2'-deoxyadenosine.
  • Oligonucleotides of the present invention can be modified using a variety of strategies known in the art to produce various effects including, for example, improved in vitro and in vivo efficacy and stability.
  • artificial nucleic acids such as 2'-O-methyl-substituted RNA; 2'-fluoro-2'deoxy RNA, peptide nucleic acid (PNA); Morpholino; A locked nucleic acid (LNA); Uncharged nucleic acid (UNA); A crosslinked nucleic acid (BNA); Glycolic acid (GNA); And TRNA nucleic acid (TNA); More generally, nucleic acid analogs, such as bicyclic and tricyclic nucleoside analogs, which are structurally similar to naturally occurring RNA and DNA, but which are modified in one or more of the phosphate backbone, sugar or nucleobase portions of the naturally occurring molecule Respectively.
  • analogous nucleobases impart, among other things, different base pairing and base lamination properties. Examples thereof include universal bases capable of forming a pair with four kinds of canon bases. Examples of phosphate-sugar backbone analogs include PNA. Morpholino oligomeric compounds are described in Braasch et al., Biochemistry, 41 (14): 4503-4510 (2002) and U.S. Pat. Nos. 5,539,082, 5,714,331, 5,719,262 and 5,034,506.
  • the oligonucleotide can be modified by substitution at the terminal end with a chemical functional group. Substitution can be performed at the 3 'or 5' end of the oligonucleotide and is preferably performed at the 3 'end of both the sense and antisense strands of the monomer, but is not always limited thereto.
  • the chemical functional group includes, for example, a sulfhydryl group (-SH), a carboxyl group (-COOH), an amine group (-NH 2 ), a hydroxy group (-OH), a formyl group (-CHO) (-CO-), an ether group (-O-), an ester group (-COO-), a nitro group (-NO 2), azide group (-N 3) or a sulfonic acid group include a (-SO 3 H) .
  • a sulfhydryl group include, for example, a sulfhydryl group (-SH), a carboxyl group (-COOH), an amine group (-NH 2 ), a hydroxy group (-OH), a formyl group (-CHO) (-CO-), an ether group (-O-), an ester group (-COO-), a nitro group (-NO 2), azide group (-N 3) or a sulfonic acid group include a (-
  • a vector comprising an oligonucleotide or double-stranded oligonucleotide provided by the present invention; Or a host cell transformed from said vector.
  • the vector of the present invention preferably encodes the double-stranded oligonucleotides of the present invention in an expressible form.
  • the term " in an expressible form " means that, when introduced into a host cell, the vector expresses the molecule.
  • the vector comprises regulatory elements necessary for the expression of double stranded oligonucleotides.
  • the vector of the present invention may be used in the production of double stranded oligonucleotides of the present invention or may be used as an active ingredient for direct cancer therapy.
  • the vector of the present invention can be produced by, for example, cloning the CX sequence into an expression vector in which the regulatory sequence is functionally linked to the CX sequence in such a way as to permit expression of both strands (by transcription of the DNA molecule) (Lee, NS et al., Nat Biotechnol 2002 May, 20 (5): 500-5).
  • an RNA molecule that is an antisense strand among oligonucleotides of a double strand is transcribed by a first promoter (for example, a promoter sequence adjacent to the 3 'end of the cloned DNA) 2 promoter (e. G., A promoter sequence adjacent to the 5 ' end of the cloned DNA).
  • the sense strand and the antisense strand hybridize in vivo and produce a double stranded oligonucleotide molecule structure silencing the gene.
  • two vector constructs encoding the sense strand and the antisense strand of the double stranded oligonucleotide, respectively, are used to express the sense strand and the antisense strand, respectively, and then form a double strand oligonucleotide product.
  • the cloned sequence may encode a construct having a secondary structure (e. G., A hairpin), i. E., A single transcription product of the vector may comprise both the sense and complementary antisense sequences of the target gene have.
  • the vector of the present invention can be used to stably insert into the genome of a target cell (see Thomas KR & Capecchi MR, Cell 1987, 51: 503-12 for a description of homologous recombinant cassette vectors). See, for example, Wolff et al., Science 1990, 247: 1465-8, U.S. Patent 5,580,859; 5,589, 466; 5,804, 566; 5,739,118; 5,736,524; 5,679,647; And WO 98/04720.
  • DNA-based delivery techniques include delivery of "naked DNA”, facilitating (bupivicaine, polymer, peptide-mediated) delivery, cationic lipid complexes and particle- mediated ["gene gun”] or pressure-mediated delivery (see, for example, U.S. Patent No. 5,922,687).
  • the expression vector is preferably a non-viral vector or a viral vector.
  • the non-viral vector is a plasmid DNA.
  • the viral vector include lentivirus, retrovirus, But are not limited to, adenovirus, herpes virus, and avipox virus vectors.
  • the expression vector further comprises a selection marker in order to facilitate selection of the transformed cells.
  • Markers conferring selectable phenotypes such as, for example, drug resistance, resistance to nutritional requirements, cytotoxic agents or expression of surface proteins, such as green fluorescent protein, puromycin, neomycin, hygromycin, Histidine dehydrogenase (hisD) and guanine phosphoribosyltransferase (Gpt).
  • the host cell is preferably a somatic cell of a mammal including a human, more preferably a cell at a tissue site intended for human treatment, or a cancer cell or cancer stem cell at the site, but is not limited thereto.
  • the method for introducing the expression vector into the host cell may include a method of introducing the expression vector into the host cell by using a method such as G-fectin, Mirus TrasIT-TKO lipophilic reagent, lipofectin, lipofectamine, cellfectin, but are not limited to, cationic polymers, cationic micelles, cationic emulsions, or delivery reagents including liposomes, or may be introduced into cells or conjugated with biocompatible polymers such as polyethylene glycol to increase intracellular absorption.
  • a method such as G-fectin, Mirus TrasIT-TKO lipophilic reagent, lipofectin, lipofectamine, cellfectin, but are not limited to, cationic polymers, cationic micelles, cationic emulsions, or delivery reagents including liposomes, or may be introduced into cells or conjugated with biocompatible polymers such as polyethylene glycol to increase intracellular absorption.
  • a pharmaceutical composition for preventing or treating cancer or cancer stem cells comprising an oligonucleotide, a double-stranded oligonucleotide, a vector or a transformed host cell as an active ingredient, to provide.
  • a pharmaceutical composition for preventing or treating cancer metastasis comprising an oligonucleotide, a vector or a transformed host cell provided by the present invention as an active ingredient.
  • a method for preventing or treating cancer comprising administering to a subject in need thereof an effective amount of an oligonucleotide, a vector or a transformed host cell provided by the present invention.
  • a method for preventing or treating cancer metastasis comprising administering to a subject in need thereof an effective amount of an oligonucleotide, a vector or a transformed host cell provided by the present invention To a method of preventing or treating cancer metastasis.
  • a subject in need of treatment means a subject having or suspected of having a cancer or cancer metastasis and inhibiting the growth or proliferation of cancer or cancer stem cells, thereby preventing or improving cancer or metastasis Object.
  • the oligonucleotides, double-stranded oligonucleotides, expression vectors or transformed host cells can inhibit the proliferation or induce death of cancer cells or cancer stem cells, Specifically, it can inhibit expression of at least one of nanog and OCT4, which are stem cell related markers in cancer stem cells, or inhibit expression of CK18 and KRT20 in cancer stem cells. At least one expression may be increased to induce loss of stem cell function.
  • cancer stem cell refers to a cancer cell in a comprehensive sense having a stem cell-specific ability to regenerate or differentiate.
  • the term " cancer" refers to or indicates a physiological condition characterized by cell growth that is not typically regulated in mammals.
  • the cancer to be treated and prevented may be selected from the group consisting of melanoma, breast cancer, colon cancer, uterine cancer, fallopian tube cancer, ovarian cancer, gastric cancer, brain cancer, rectal cancer, small bowel cancer, rectal cancer, esophageal cancer, lymphadenocarcinoma, But it may be melanoma, breast cancer, lung cancer, or colon cancer, and may be used for differentiation and / or proliferation of tumors, and the like. But the cancer progression is not limited to the type of cancer stemming from cancer stem cells described in the present invention.
  • Cancer stem cells which can differentiate into cancer cells, are present in about 1 to 2% of malignant tumor tissues. They contain self-renewal, which is a characteristic of normal stem cells, and pluripotent, However, it is reported that the cell division activates cell division and it is differentiated into malignant tumor cells.
  • Cancer stem cells are distinguished from other cancer cells and cancer stem cell markers of cancer stem cells are known to be various cancer-specific stem cell markers as shown in Table 1 below have.
  • the cancer stem cells to be subject to growth inhibition in the present invention may include all of the above-described stem cells of cancer, and in particular may be breast cancer stem cells, melanoma stem cells, lung cancer stem cells or colon cancer stem cells.
  • the above-mentioned cancer stem cells constantly self-renew and can make tumors with less than 1,000 cells in an experimental animal model and possess the ability as malignant tumor cells.
  • cancer treatment and radiation therapy which is a cancer treatment
  • the removal of cancer stem cells is gradually being recognized as a barometer of success or failure of cancer treatment.
  • cancer can be recurred from remaining cancer stem cells if cancer cells are killed by using various conventional treatment methods such as surgery, radiation therapy, and chemotherapy, .
  • a chemotherapy targeting cancer stem cells capable of regenerating tumors and a treatment protocol for treating cancer based thereon In order to prevent the recurrence of such cancer, there is an increasing interest in the development of a chemotherapy targeting cancer stem cells capable of regenerating tumors and a treatment protocol for treating cancer based thereon.
  • cancer stem cells in normal tissues regulate cell growth and differentiation by self-renewal mechanism, but cancer stem cells are affected by tumor microenvironmental factors around the tumor cells, resulting in abnormal self-renewal and It has been suggested that the rapid accumulation of cancer by activating the maintenance pathway leads to malignancy, resistance to chemotherapy and ultimately cancer recurrence. However, the mechanism of tumor microenvironmental factors that control the accumulation and maintenance of cancer stem cells has not yet been investigated.
  • prevention may include, without limitation, any act that blocks cancer symptoms using the pharmaceutical composition of the present invention, or inhibits or delays cancer symptoms.
  • treatment may include, without limitation, any action that improves or alleviates the symptoms of cancer using the pharmaceutical composition of the present invention.
  • the oligonucleotide, the expression vector, the transformant or the pharmaceutical composition of the present invention can be administered in combination with other anticancer agents, thereby further enhancing the growth inhibitory effect on cancer cells and cancer stem cells.
  • anticancer agent examples include nitrogene mustard, imatinib, oxaliplatin, rituximab, elotinib, neratinib, lapatinib, zetitib, bandetanib, nilotinib, semathanib, conservinib, acitinib, Corticosteroids, cisplatin, cetuximab, bismuth alum, asparaginase, tretinoin, hydroxycarbamides, corticosteroids, rheumatoid arthritis, rheumatoid arthritis, rheumatoid arthritis, Amlodipine, amitriptyline, amitriptyline, amitriptyline, amlodipine, amlodipine, amlodipine, amlodipine, amlodipine, amlodipine, amlodipine, amlodipine, amlodipine, amlodipine
  • the oligonucleotide, the expression vector, the transformant or the pharmaceutical composition may be in the form of a capsule, a tablet, a granule, an injection, an ointment, a powder or a beverage.
  • the oligonucleotide, the expression vector, The composition or pharmaceutical composition may be characterized in that it is intended for humans.
  • the oligonucleotides, expression vectors, transformants or pharmaceutical compositions of the present invention are not limited to these, but may be formulated into oral preparations such as powders, granules, capsules, tablets and aqueous suspensions, external preparations, suppositories, May be formulated in the form of sterile injectable solutions.
  • the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier may be a binder, a lubricant, a disintegrant, an excipient, a solubilizing agent, a dispersing agent, a stabilizer, a suspending agent, a coloring matter, a perfume or the like in the case of oral administration.
  • a solubilizing agent, an isotonic agent, a stabilizer and the like may be mixed and used.
  • a base, an excipient, a lubricant, a preservative and the like may be used.
  • Formulations of the pharmaceutical compositions of the present invention may be prepared in a variety of ways by mixing with a pharmaceutically acceptable carrier as described above.
  • oral administration may be in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc.
  • they may be formulated in unit dosage ampoules or in multiple dosage forms have.
  • suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltoditol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil. Further, it may further include a filler, an anticoagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent, an antiseptic, and the like.
  • the routes of administration of the oligonucleotides, expression vectors, transformants or pharmaceutical compositions according to the present invention may be, but are not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, , Intraperitoneal, intranasal, intestinal, topical, sublingual or rectal. Oral or parenteral administration is preferred.
  • parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.
  • the pharmaceutical compositions of the present invention may also be administered in the form of suppositories for rectal administration.
  • the oligonucleotides, expression vectors, transformants or pharmaceutical compositions of the present invention can be used to determine the activity, age, body weight, general health, sex, diet, time of administration, route of administration, rate of excretion, drug formulation and prevention or treatment
  • the severity of the particular disease, and the dosage of the pharmaceutical composition varies depending on the condition of the patient, the body weight, the severity of the disease, the drug form, the administration route and the period of time. However, And may be administered at 0.0001 to 50 mg / kg or 0.001 to 50 mg / kg per day. The administration may be carried out once a day or divided into several times. The dose is not intended to limit the scope of the invention in any way.
  • the pharmaceutical composition according to the present invention can be formulated into pills, dragees, capsules, solutions, gels, syrups, slurries, suspensions.
  • the expression vector containing the oligonucleotide of the present invention specifically, to contain from 0.01 to 500 mg, and more particularly containing 0.1 to 300 mg, for a recombinant virus comprising the miRNA of the invention, in particular 10 3 to 10 12 IU contain (10 to 10 10 PFU), than one containing a particular 10 5 to 10 10 IU, but not limited thereto.
  • the host cell transformed with the vector of the present invention specifically contains 10 3 to 10 8 , more specifically 10 4 to 10 7 , but is not limited thereto.
  • the effective dose of the expression vector containing the oligonucleotide of the present invention or the composition containing the transformed host cell as an active ingredient is 0.05 to 12.5 mg / kg in the case of the vector per 1 kg of body weight, 10 7 to 10 11 viral particles (10 5 to 10 9 IU) / kg in the case of cells, 10 3 to 10 6 cells / kg in the case of cells, specifically 0.1 to 10 mg / kg in the case of vectors, 10 8 to 10 10 particles, the case of (10 6 to 10 8 IU) / kg, cells, and 10 2 to 10 5 cells / kg, it may be administered twice or three times a day.
  • Such composition is not necessarily limited to this, and may vary depending on the condition of the patient and the severity of the disease.
  • the double-stranded oligonucleotide may be a naked double strand oligonucleotide molecule combined with a delivery reagent, or a recombinant plasmid or viral vector expressing double-stranded oligonucleotides , ≪ / RTI >
  • Suitable delivery reagents for administration in combination with the double-stranded oligonucleotides of the present invention include, but are not limited to, Mirus Transit TKO lipophilic reagent, LipoTrust TM SR, lipofectin, lipofectamine, For example, cellfectins or polycations (e.g., lysine), liposomes, collagen or atelocollagen.
  • a preferred delivery reagent is a liposome.
  • Liposomes can aid delivery of double-stranded nucleic acid molecules to specific tissues, such as the retina or tumor tissue, and may increase the half-life in the blood of double-stranded nucleic acid molecules.
  • Liposomes suitable for use in the present invention are formed from standard vesicle-forming lipids and are generally formed of neutral or negatively charged phospholipids and sterols such as cholesterol ). The choice of lipid is usually determined by considering factors such as the size of the desired liposome and the half-life of the liposome in the blood circulation.
  • a variety of methods for preparing liposomes are known, see for example Szoka et al., Ann Rev Biophys Bioeng 1980,9: 467; U.S. Patent No. 4,235,871; 4,501, 728; 4,837,028; 5,019,369 may be used herein by reference in its entirety.
  • the vectors expressing the double stranded oligonucleotides of the present invention have been described above.
  • the vector expressing the double-stranded oligonucleotides of the present invention can be used directly or in combination with a Mirus Transit LT1 fat soluble reagent, LipoTrust TMSR, lipofectin, lipofectamine, cellfectin, polycation (E.g., polylysine) or liposome or collagen, atelocollagen, etc. may be administered in combination with appropriate delivery reagents.
  • Methods for delivering recombinant viral vectors, which express double-stranded oligonucleotides of the invention, to a patient's cancerous area are within the skill of the art.
  • the double stranded oligonucleotides of the present invention may be administered to a subject by any method suitable for delivering double stranded oligonucleotides to a cancerous region.
  • the double-stranded nucleic acid molecule may be administered by gene gun, electroporation, or other suitable parenteral or intramuscular route of administration.
  • Suitable intestinal administration routes in the present invention include oral, rectal or intranasal delivery.
  • suitable parenteral administration routes include, but are not limited to, intravenous administration (e.g., intravenous bolus injection, intravenous infusion, intra-arterial bolus injection, intra- (e.g., intraarterial infusion and catheter instillation with vasculature), peri-and peritoneal injection (e.g., intratumoral or intratumoral injection, intraretinal injection or subretinal injection), subcutaneous injection or subcutaneous injection (Such as by osmotic pumps), direct treatment around the area or area of the cancer, such as catheter or other means of installation (e.g., retinal pellet) Suppository or implants comprising porous, non-porous or gelatinous material), and inhalation. Injections or infusions of double-stranded nucleic acid molecules or vectors may be administered to the site or area of the cancer It is preferred to administer to.
  • intravenous administration
  • the double stranded oligonucleotides of the present invention may be administered in single or multiple doses.
  • the injections may be administered by a single sustained dose or by multiple infusions.
  • the direct injection of the agent into the tissue is preferably around the cancer site or around the cancer. Multi-injection around cancer tissue or cancer is particularly preferred.
  • the double-stranded oligonucleotides provided in the present invention can be stably introduced into the human body to effectively inhibit the growth of cancer cells or cancer stem cells, thereby preventing and / or treating cancer, and further, the resistance, metastasis, .
  • FIG. 1 is a graph showing the results of measurement of changes in cell survival rate of SK-MEL28 cancer cells treated with double-stranded oligoribonucleotides according to the present invention in an embodiment of the present invention.
  • FIG. 2 is a graph showing the results of measurement of changes in the number of colonies after treatment of SK-MEL28 cancer stem cells with the double-stranded oligoribonucleotide according to the present invention in one embodiment of the present invention.
  • FIG. 3 is a graph showing the results of analysis of SK-MEL28 cancer stem cells by treating the double-stranded oligoribonucleotides according to the present invention with SK-MEL28 cancer stem cells according to an embodiment of the present invention.
  • FIG. 4 is a graph showing the expression levels of Nanog, a gene related to the stemness of cancer stem cells, after SK-MEL28 cancer stem cells were treated with double-stranded oligoribonucleotides according to the present invention. The results of the analysis are shown in the graph.
  • FIG. 5 is a graph showing changes in the expression level of TYRP1, a gene whose expression is suppressed in cancer stem cells, after treatment of SK-MEL28 cancer stem cells according to the present invention with double-stranded oligoribonucleotides according to an embodiment of the present invention The results are shown graphically.
  • FIG. 6 is a graph showing the results of treatment of SK-MEL28 cancer cells with double stranded oligoribonucleotides according to the present invention and measuring the concentration (GI 50 ) at which 50% The results are shown graphically.
  • FIG. 7 is a graph showing the results obtained by measuring the concentration (GI 50 ) at which the death of 50% cancer cells can be induced after treating the double-stranded oligoribonucleotide according to the present invention with Malme-3m cancer cells in an embodiment of the present invention The results are shown graphically.
  • FIG. 8 is a graph showing the results of measuring the concentration (GI 50 ) capable of inducing the death of 50% cancer cells after treating the double stranded oligoribonucleotide according to the present invention with A549 cancer cells according to an embodiment of the present invention. As shown in the graph.
  • FIG. 9 is a graph showing the results of treatment of NCI-H460 cancer cells with double stranded oligoribonucleotides according to the present invention and measuring the concentration (GI 50 ) at which 50% The results are shown graphically.
  • oligonucleotides represented by any one of SEQ ID NOs: 1, 3, 5, 7 and 9 or oligonucleotides having 90% or more, 91% or more, 92% or more, 93% or more, 94% Or more, 96% or more, 97% or more, 98% or more, or 99% or more homology with the nucleotide sequence of SEQ ID NO: And oligonucleotides that can be hybridized thereto.
  • ≪ RTI ID 0.0 > [0002] < / RTI >
  • oligonucleotides represented by any one of SEQ ID NOs: 2, 4, 6, 8 and 10 or oligonucleotides having 90% or more, 91% or more, 92% or more, 93% , 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology with the nucleotide sequence of SEQ ID NO: And oligonucleotides that can be hybridized thereto.
  • ≪ RTI ID 0.0 > [0002] < / RTI >
  • a method for preventing or treating cancer or cancer stem cells comprising an oligonucleotide, a double-stranded oligonucleotide, a vector containing the same, or a host cell transformed from the vector, A pharmaceutical composition for therapeutic use is provided.
  • SK-MEL28, MALME-3M, A549 and NCI-H460 cancer cell lines were purchased from ATCC and cultured.
  • SK-MEL28 cancer cell lines were cultured in DMEM / F12 medium supplemented with B27 supplement and growth factors (FGF and EGF 20 ng / mL) to induce cancer stem cells. Only cells expressing the cancer stem cell marker CD44 + were selected and cultured for about 2 weeks.
  • SK-MEL28 cancer cells and cancer stem cells prepared in Preparative Example 2 were introduced with 5 kinds of double-stranded oligoribonucleotides prepared in Preparation Example 1 for 9 days using lipofectamine, and the cell viability The changes are shown in Fig.
  • the survival rate of the cancer cells and cancer stem cells was significantly reduced by treating the cancer cells and cancer stem cells with the oligoribonucleotides according to the present invention.
  • the double-stranded oligoribonucleotides according to the present invention have the effect of inhibiting proliferation and inducing the death of cancer cells and cancer stem cells.
  • the 5 double-stranded oligoribonucleotides of Preparation Example 1 were introduced into SK-MEL28 cancer cells and cancer stem cells prepared in Preparative Example 2, respectively, in the same manner as in Example 1, and the changes in the number of colonies were compared 2.
  • the double stranded oligoribonucleotides according to the present invention have excellent effects of inhibiting proliferation and inducing apoptosis of cancer cells and cancer stem cells.
  • the double-stranded oligoribonucleotide according to the present invention can effectively inhibit the cell infiltration ability of cancer cells and cancer stem cells.
  • RNA was isolated by harvesting, and cDNA was synthesized, and the real-time amplification cycle of Nanog and TYRP1 genes was quantified and quantified by the qPCR technique using the primers shown in Table 3 below. The results are shown in FIGS. 4 and 5.
  • FIG. 4 The results are shown in FIGS. 4 and 5.
  • Nanog a gene related to stemness
  • the double-stranded oligoribonucleotide according to the present invention has an effect of losing the stemness of cancer stem cells.
  • the cancer cell was treated with the oligoribonucleotide according to the present invention, and the concentration of the cancer cell was reduced to about 50%.
  • the double stranded oligoribonucleotides according to the present invention are excellent in inhibiting proliferation and inducing the death of cancer cells.
  • the present invention relates to a method for effectively preventing, ameliorating or treating cancer using oligonucleotides.
  • SEQ ID NO: 1 5'-uauggaguggaaaacaauacccc-3 '
  • SEQ ID NO: 2 5'-gggguauuguuuuccacuccaua-3 '
  • SEQ ID NO: 3 5'-uauggaguggacuuucagcuggcccuggcagcggaaacaauacccc-3 '
  • SEQ ID NO: 4 5'-gggguauuguuuccgcugccagggccagcugaaaguccacuccaua-3 '
  • SEQ ID NO: 5 5'-uauggaguggaaaacaauaccca-3 '
  • SEQ ID NO: 6 5'-uggguauuguuuuccacuccaua-3 '
  • SEQ ID NO: 7 5'-uauggaguggacaacaauaccgc-3 '
  • SEQ ID NO: 8 5'-uggguauuguuuuccacuccagg-3 '
  • SEQ ID NO: 9 5'-uauggaguggacuuucagcuggcauuuggucucgugcucugggguauuguuuccgcugccagg-3 '
  • SEQ ID NO: 10 5'- ccuggcagcggaaacaauaccccagugagcgaguucuuacagagccagcugaaaguccacuccaua-3 '

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 서열번호 1 내지 10 중 어느 하나로 표시되는 올리고뉴클레오티드; 이를 포함하는 발현 벡터; 또는 상기 발현 벡터로 형질 전환된 숙주 세포를 유효 성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물에 관한 것이다. 본 발명에서 제공하는 올리고뉴클레오티드는 암 세포뿐만 아니라 암 줄기세포의 성장을 효과적으로 억제하여 암을 예방 및/또는 치료할 수 있으며, 더 나아가서는 암의 내성, 전이 및 재발 또한 방지할 수 있다.

Description

올리고뉴클레오티드 및 이를 포함하는 암의 예방 또는 치료용 약학적 조성물
본 발명은 올리고뉴클레오티드 및 이를 포함하여 암을 효과적으로 예방 또는 치료할 수 있는 약학적 조성물에 관한 것이다.
마이크로RNA(miRNA)는 18~25 뉴클레오티드(nucleotide, nt)로 구성된 작은 비-암호화 RNA로서, 표적 유전자의 3'-비번역 부위(untranslated region, UTR)에 결합하여 유전자 발현을 조절하고(Bartel DP, et al., Cell 116: 281-297, 2004; Lewis BP, et al., Cell 120: 15-20, 2005), 인트론(intron), 엑손(exon) 또는 유전자 간 부위(intergenic region)로부터 공정된다(Rodriguez A, et al., Genome Res14: 1902-1910, 2004). 첫째로, miRNA는 수천 개의 뉴클레오티드를 포함하는 초기 miRNA(pri-miRNA) 분자 내로 RNA 폴리머라아제 에 의해 전사된다. 그런 다음, pri-miRNA는 miRNA 전구체로 알려진 대략 70 nt 줄기 고리 중간체를 형성하기 위해 마이크로프로세서[DroshaRNase 엔도뉴클레아제 및 디조지증후군 부위 유전자 8 단백질(DroshaRNase endonuclease and DiGeorge syndrome region gene 8 protein, DGCR8)]에 의해 연속적으로 공정된다(Lee Y, et al., EMBO J21: 4663-4670, 2000; Zeng Y, et al., Proc Natl Acad Sci U S A100: 9779-9784, 2003). 그런 다음, pre-miRNA는 엑소폴틴-5(Exportin-5, EXP5)와 공동인자 Ran-GTP를 통해 핵으로부터 세포질로 이동되고, 여기서 pre-miRNA는 RNase 엔도뉴클레아제 다이서에 의해 18-25 nt 성숙 miRNA 듀플렉스(duplexe)로 공정된다(Lee Y, et al., EMBO J23: 4051-4060, 2004; Shenouda SK, et al., Cancer Metastasis Rev28: 369-378, 2009). 성숙 miRNA 듀플렉스는 RNA-유도 침묵 복합체(RNA-induced silencing complex, RISC) 내로 아르고노트(Argonaute) 단백질과 단일 가닥 RNA로서 통합되고, 이는 표적 mRNA의 절단 또는 번역 억제 중 어느 하나를 유도한다(Diederichs S, et al., Cell131: 1097-1108, 2007; Hammond SM, et al., Nature404: 293-296, 2000; Martinez et al., Cell 110: 563-574, 2002). miRNA는 암세포의 증식 및 침윤을 포함하는 암 발달과 관련된 다양한 생물학적 공정과 관련되고, miRNA 발현은 많은 유형의 암에서 양방향으로 조절된다(Esquela-Kerscher A, et al., Nat Rev Cancer6: 259-269, 2006).
암은 전세계적으로 가장 보편적인 사망원인 중의 하나이다. 약 천만 건의 새로운 케이스가 매년 발생하며, 전체 사망원인의 약 12%를 차지하여 세 번째로 많은 사망의 원인이 되고 있다.
암 중에서도 유방암은 여성에게 있어서 매년 40,000명 이상의 사망의 원인이 되는 가장 보편적인 악성 종양으로서 조기 진단이 매우 중요하나, 이미 알려져 있는 많은 항암치료제의 치료에도 불구하고 암이 많이 진행된 경우나 전이된 경우 생존율이 향상되지 못한 실정이다.
대표적인 항암 요법인 화학 요법(chemotherapy)은, 단독으로 또는 방사능 요법과 같은 다른 치료법과 조합하여 현재 암을 치료하기 위한 가장 효율적인 치료법으로 사용되고 있다. 그러나, 화학 요법에서 암 치료 약물의 효능은 암 세포를 죽일 수 있는 능력에 따르나, 약물 사용시 암 세포뿐만 아니라 일반적인 세포에도 작용할 수 있다는 문제가 있다.
암 줄기세포(cancer stem cell)는 무제한 재생능력을 가진 암 세포로서 줄기세포에서 종양이 기원할 것이라는 가설은, 90년대 말 급성 골수성 백혈병에서 암 줄기세포가 될 수 있는 일단의 세포를 면역억제 쥐에 이식하여 사람의 백혈병이 쥐에서 재현됨이 발표되면서 확고하게 되었고, 이후 유방암에서 암 줄기세포를 증명하면서 고형 암종에서도 줄기세포의 존재를 확신하게 되었다.
악성 종양이 보이는 다양한 이질성이 줄기세포의 다양한 분화성과 일치하며, 많은 표적치료에도 불구하고 끊임없이 발현되는 암 세포의 약물 저항성은 줄기세포의 기본 특성과 일치하는데 이로써 종양의 발생과 줄기세포를 연관지어 생각할 수 있으며, 암 줄기세포는 새로운 표적 치료 분야가 될 수 있다.
암 줄기세포 가설에 근거하여 여러 치료 방법들이 고안되었는데, 그 중 많이 알려진 방법은 암 줄기세포의 자가재생 경로를 이용하는 방법이다. 이러한 치료에서 중요한 점은 정상 줄기세포의 자가재생은 유지하면서 암 줄기세포의 자가재생만을 표적으로 해야 하는 것이다. 예로서 Notch 신호는 감마 세크레타제(gamma secretase)라는 효소에 의해 진행되는데, 이에 대한 억제제(gamma secretase inhibitor)를 Notch1이 과발현된 유방암에 사용하면 종양 억제 효과를 달성할 수 있다. Hedgehog 신호 체계를 표적으로 할 경우에도 항암 효과를 보인다는 최근 보고가 있는데, Hedgehog 억제제인 사이클로파민(cyclopamine)을 종양을 이종이식(tumor xenograft)한 동물에 투여했을 때 극적으로 종양이 위축되었다는 것이다. 그 밖에도, PI3K/AKT, MAPK, JAK2/STAT3 신호 경로(signaling pathway)와 관련 있다고 알려져 있다.
그러나, 지금까지 암 줄기세포에 대한 연구에는 제한성도 많고, 종양의 형성이나 유지에서의 역할에 대해서는 아직까지 확실하게 밝혀진 것은 없다. 정상 줄기세포에는 손상을 주지 않으면서 암 줄기세포만을 표적으로 하는 치료를 효율적으로 수행하기 위해서는 암 줄기세포의 유지와 조절에 중요한 분자생물학적인 특성이나 그 조절 경로에 대한 지식과 이해가 필요하다.
현재까지 암 줄기세포를 직접적으로 타겟팅하는 항암제나 천연물 유래 추출물의 연구는 거의 없는 실정이다. 종래의 기술은 암 줄기세포의 직접적인 타겟 유전자를 억제하는 실험으로 암 줄기세포를 억제하거나 암 줄기세포의 상위 신호전달 단백질을 억제하여 암 줄기세포를 억제하는 연구들이 진행되었다. 그러나 많은 종양 환자에 있어서 종양유전자의 변이나 단백질의 변이로 이러한 타겟팅 실험이 어려움이 많다.
따라서, 암 줄기세포에 대한 약물의 선택성을 개선하는 것은 항암 약물에 의한 화학 요법의 효능을 증가시킴으로써 약물을 더 낮은 용량으로 사용하게 하는 것을 분명히 가능하게 할 것이다. 그러므로, 암 치료 및 예방을 위하여 암 줄기세포의 성장을 선택적으로 억제할 수 있는 개선된 접근법이 요구된다.
본 발명의 일 목적은 암을 예방, 개선 또는 치료할 수 있는 올리고뉴클레오티드를 제공하는 것을 목적으로 한다.
본 발명의 다른 목적은 상기한 올리고뉴클레오티드를 포함하여 암을 예방, 개선 또는 치료할 수 있을 뿐만 아니라, 암의 내성, 전이 또는 재발 또한 방지할 수 있는 약학적 조성물을 제공하고자 한다.
본 발명의 또 다른 목적은 상기한 올리고뉴클레오티드를 포함하여 암을 예방, 개선 또는 치료할 수 있을 뿐만 아니라, 암의 내성, 전이 또는 재발 또한 방지할 수 있는 방법을 제공하고자 한다.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
본 발명의 일 구현 예에 따르면, 서열번호 1 내지 10 중 어느 하나로 표시되는 올리고뉴클레오티드에 관한 것이다.
본 발명의 다른 구현 예에 다르면, 서열번호 1, 3, 5, 7 및 9 중 어느 하나로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드; 및 이에 혼성화될 수 있는 올리고뉴클레오티드를 포함하는, 이중 가닥의 올리고뉴클레오티드에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 서열번호 2, 4, 6, 8 및 10 중 어느 하나로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드; 및 이에 혼성화될 수 있는 올리고뉴클레오티드를 포함하는, 이중 가닥의 올리고뉴클레오티드에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 서열번호 1로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드; 및 서열번호 2로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드를 포함하는, 이중 가닥의 올리고뉴클레오티드에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 서열번호 3으로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드; 및 서열번호 4로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드를 포함하는, 이중 가닥의 올리고뉴클레오티드에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 서열번호 5로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드; 및 서열번호 6으로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드를 포함하는, 이중 가닥의 올리고뉴클레오티드에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 서열번호 7로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드; 및 서열번호 8으로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드를 포함하는, 이중 가닥의 올리고뉴클레오티드에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 서열번호 9로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드; 및 서열번호 10로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드를 포함하는, 이중 가닥의 올리고뉴클레오티드에 관한 것이다.
본 발명에서 상기 "올리고뉴클레오티드"는 DNA, RNA 또는 DNA/RNA 하이브리드 분자이며, 보다 바람직하게는 RNA 분자일 수 있다.
본 발명에서 "혼성화"라 함은 올리고뉴클레오타이드의 양 가닥이 염기쌍을 형성할 수 있음을 의미한다.　상보적 올리고뉴클레오타이드의 양 가닥은 왓슨-크릭 방식으로 염기쌍을 형성하여 이중 가닥을 형성한다. 본 발명에서 염기 U가 언급되는 경우, 별다른 언급이 없는 한 염기 T로 치환 가능하다.
본 발명에서 상기 올리고뉴클레오티드는 자연 발생 또는 변형된, 비-자연 발생 염기를 함유할 수 있고, 변형된 당, 포스페이트, 및/또는 말단을 함유할 수 있다. 예를 들어, 포스포디에스테르 연결 이외에도, 포스페이트 변형은 메틸 포스포네이트, 포스포로티오에이트, 포스포르아미데이트 (가교 또는 비-가교), 포스포트리에스테르 및 포스포로디티오에이트를 포함하나, 이에 제한되지는 않고, 임의의 조합으로 사용될 수 있다. 일부 실시양태에서, 상기 RNA 올리고뉴클레오티드는 포스포로티오에이트 연결 단독, 포스포디에스테르 연결 단독, 또는 포스포디에스테르 및 포스포로티오에이트 연결의 조합을 갖는다.
관련 기술분야에 공지된 당 변형, 예컨대 2'-알콕시-RNA 유사체, 2'-아미노-RNA 유사체, 2'-플루오로-DNA, 및 2'-알콕시- 또는 아미노-RNA/DNA 키메라 및 본원에 기재된 다른 것이 또한 제조되고 임의의 포스페이트 변형과 조합될 수 있다. 염기 변형의 예는 상기 올리고뉴클레오티드의 시토신 (예를 들어, 5-브로모시토신, 5-클로로시토신, 5-플루오로시토신, 5-아이오도시토신)의 C-5 및/또는 C-6에 대한 전자-끄는 모이어티의 첨가 및 본 발명의 올리고뉴클레오티드의 우라실 (예를 들어, 5-브로모우라실, 5-클로로우라실, 5-플루오로우라실, 5-아이오도우라실)의 C-5 및/또는 C-6에 대한 전자-끄는 모이어티의 첨가를 포함하나 이에 제한되지는 않는다. 상기 언급된 바와 같이, 상기 올리고뉴클레오티드의 회문식 서열에서의 염기 변형의 사용은 왓슨-크릭 염기 쌍형성을 위해 수반된 염기의 자기-상보성을 방해하여서는 안 된다. 그러나, 회문식 서열의 외부에서, 변형된 염기는 이러한 제한 없이 사용될 수 있다. 예를 들어, 2'-O-메틸-우리딘 및 2'-O-메틸-시티딘은 회문식 서열의 외부에서 사용될 수 있는 반면에, 5-브로모-2'-데옥시시티딘은 회문식 서열 내부 및 외부 둘 다에서 사용될 수 있다. 회문식 서열의 내부 및 외부 둘 다에서 사용될 수 있는 다른 변형된 뉴클레오티드는 7-데아자-8-아자-dG, 2-아미노-dA, 및 2-티오-dT를 포함한다.
본 발명에서 상기 올리고뉴클레오티드는 포스페이트-변형된 올리고뉴클레오티드를 포함할 수 있으며, 그의 일부는 올리고뉴클레오티드를 안정화시키는 것으로 공지되어 있다. 따라서, 본 발명의 일부 실시양태는 안정화된 올리고뉴클레오티드를 포함한다. 변형된 포스페이트 연결 또는 비-포스페이트 연결을 함유하는 올리고뉴클레오티드의 합성은 또한 관련 기술분야에 공지되어 있다 (예를 들어, 문헌 [Matteucci "Oligonucleotide Analogs: an Overview" in Oligonucleotides as Therapeutic Agents, (D.J. Chadwick and G. Cardew, ed.) John Wiley and Sons, New York, NY, 1997] 참조). 올리고뉴클레오티드에서 당 또는 당 유사체 모이어티에 부착될 수 있는 인 유도체 (또는 변형된 포스페이트 기)는, 모노포스페이트, 디포스페이트, 트리포스페이트, 알킬포스포네이트, 포스포로티오에이트, 포스포로디티오에이트, 포스포르아미데이트 등일 수 있다. 상기-언급된 포스페이트 유사체의 제조 및 뉴클레오티드, 변형된 뉴클레오티드 및 올리고뉴클레오티드로의 그의 혼입은 이미 그 자체로 널리 기재되어 있다 (예를 들어, 문헌 [Peyrottes et al., Nucleic Acids Res, 24:1841-1848, 1996; Chaturvedi et al., Nucleic Acids Res, 24:2318-2323, 1996; 및 Schultz et al., Nucleic Acids Res, 24:2966-2973, 1996] 참조). 예를 들어, 포스포로티오에이트 올리고뉴클레오티드의 합성은 산화 단계가 황화 단계에 의해 대체된다는 것을 제외하고는 자연 발생 올리고뉴클레오티드에 대해 상기 기재된 것과 유사하다 (Zon "Oligonucleoside Phosphorothioates" in Protocols for Oligonucleotides and Analogs, Synthesis and Properties (Agrawal, ed.) Humana Press, pp. 165-190, 1993).
본 발명에서 상기 올리고뉴클레오티드는 하나 이상의 리보뉴클레오티드 (단독 또는 주요 당 성분으로서 리보스 함유), 데옥시리보뉴클레오티드 (주요 당 성분으로서 데옥시리보스 함유), 변형된 당 또는 당 유사체를 포함할 수 있다. 따라서, 리보스 및 데옥시리보스 이외에도, 당 모이어티는 펜토스, 데옥시펜토스, 헥소스, 데옥시헥소스, 글루코스, 아라비노스, 크실로스, 릭소스, 및 당 유사체 시클로펜틸기일 수 있다. 당은 피라노실 또는 푸라노실 형태로 존재할 수 있다. 본 발명의 상기 올리고뉴클레오티드에서, 당 모이어티는 바람직하게는 리보스, 데옥시리보스, 아라비노스 또는 2'-O-알킬(예: 메틸, 에틸)리보스의 푸라노시드이고, 당은 각 헤테로시클릭 염기에 아노머 배위로 부착될 수 있다. 당 변형은 2'-알콕시(예: 메톡시, 에톡시)-RNA 유사체, 2'-아미노-RNA 유사체, 2'-플루오로-RNA, 2'-플루오로-DNA, 및 2'-알콕시- 또는 아미노-RNA/DNA 키메라를 포함하나, 이에 제한되지는 않는다. 이들 당 또는 당 유사체 및 이러한 당 또는 유사체가 그 자체로 헤테로시클릭 염기 (핵산 염기)에 부착되는 각 뉴클레오시드의 제조는 공지되어 있고, 따라서 여기서 기재될 필요는 없다. 당 변형은 또한 본 발명의 올리고뉴클레오티드의 제조에서 제조되고 임의의 포스페이트 변형과 조합될 수 있다.
본 발명에서 상기 올리고뉴클레오티드에 혼입된 헤테로시클릭 염기, 또는 핵산 염기는 자연 발생 주요 퓨린 및 피리미딘 염기 (즉 상기 언급된 바와 같은 우라실, 티민, 시토신, 아데닌 및 구아닌) 뿐만 아니라, 상기 주요 염기의 자연 발생 및 합성 변형일 수 있다. 따라서, 본 발명의 올리고뉴클레오티드는 이노신, 2'-데옥시우리딘 및 2-아미노-2'-데옥시아데노신 중 하나 이상을 포함할 수 있다.
본 발명의 올리고뉴클레오티드는 예를 들면 시험관 내 및 생체 내 개선된 효력 및 안정성을 포함한 각종 효과를 생성하는 것으로 당업계에 공지된 다양한 전략을 사용하여 변형될 수 있다. 그러한 전략 중에서 인공 핵산, 예를 들면 2'-O-메틸-치환된 RNA; 2'-플루오로-2'데옥시 RNA, 펩티드 핵산(PNA); 모르폴리노; 로킹된 핵산(LNA); 비로킹된 핵산(UNA); 가교된 핵산(BNA); 글리콜 핵산(GNA); 및 트레오스 핵산(TNA); 보다 일반적으로 핵산 유사체, 예를 들면 비시클릭 및 트리시클릭 뉴클레오시드 유사체이며, 이는 천연 발생 RNA 및 DNA와 구조적으로 유사하지만, 천연 발생 분자의 포스페이트 백본, 당 또는 핵염기 부분 중 하나 이상에서의 변형을 갖는다. 통상적으로, 유사체 핵염기는 무엇보다도 상이한 염기쌍 형성 및 염기 적층 성질을 부여한다. 그의 예는 4종의 캐논(canon) 염기와 쌍을 형성할 수 있는 보편적인 염기를 포함한다. 포스페이트-당 백본 유사체의 예는 PNA를 포함한다. 모르폴리노계 올리고머 화합물은 문헌[Braasch et al., Biochemistry, 41(14): 4503-4510 (2002)] 및 미국 특허 제5,539,082호, 제5,714,331호, 제5,719,262호 및 제5,034,506호에 기재되어 있다.
본 발명에서 상기 올리고뉴클레오티드는 말단 단부에서 화학적 작용성 기로의 치환에 의하여 변형될 수 있다. 치환은 올리고뉴클레오티드의 3' 또는 5' 단부에서 수행될 수 있으며, 단량체의 센스 및 안티센스 가닥 둘다의 3' 단부에서 수행되는 것이 바람직하지만, 항상 이에 제한되는 것은 아니다. 화학적 작용기는 예를 들면 술프히드릴 기(-SH), 카르복실 기(-COOH), 아민 기(-NH2), 히드록시 기(-OH), 포르밀 기(-CHO), 카르보닐 기(-CO-), 에테르 기(-O-), 에스테르 기(-COO-), 니트로 기(-NO2), 아지드 기(-N3) 또는 술폰산 기(-SO3H)를 포함할 수 있다.
본 발명의 다른 구현 예에 따르면, 본 발명에서 제공하는 올리고뉴클레오티드 또는 이중 가닥의 올리고뉴클레오티드를 포함하는 벡터; 또는 상기 벡터로부터 형질 전환된 숙주 세포에 관한 것이다.
본 발명의 벡터는, 바람직하게는 발현 가능한 형태로 본 발명의 이중 가닥의 올리고뉴클레오티드를 암호화한다. 본 명세서에 있어서, 용어 「발현 가능한 형태(in an expressible form)」는 숙주 세포에 도입할 경우, 그 벡터가 그 분자를 발현되는 것을 의미한다. 바람직한 태양으로는, 벡터는 이중 가닥의 올리고뉴클레오티드의 발현에 필요한 조절 요소를 포함한다. 본 발명의 벡터는 본 발명의 이중 가닥의 올리고뉴클레오티드의 생산에 사용되거나, 직접 암 치료를 위한 활성 성분으로서 사용될 수 있다.
본 발명의 벡터는, 예를 들면, 양쪽 가닥의 발현을 허용하는 방법으로(DNA 분자의 전사에 의해), 조절 서열이 CX 서열에 기능적으로 연결되어 있는 발현 벡터내로 CX 서열을 클로닝하는 방법에 의해, 제작될 수 있다(Lee NS et al., Nat Biotechnol 2002 May ,20(5):500-5). 예를 들면, 이중 가닥의 올리고뉴클레오티드 중 안티센스 가닥인 RNA 분자는 제1 프로모터(예를 들면, 클로닝된 DNA의 3'말단에 인접하는 프로모터 서열)에 의해 전사되고, 센스 가닥인 RNA 분자는, 제2 프로모터(예를 들면, 클로닝된 DNA의 5'말단에 인접하는 프로모터 서열)에 의해 전사된다. 센스 가닥과 안티 센스 가닥은, 생체내에서 혼성화하고, 해당 유전자를 침묵(silencing)하는 이중 가닥의 올리고뉴클레오티드 분자 구조물을 생성한다. 혹은, 각각 이중 가닥의 올리고뉴클레오티드의 센스 가닥과 안티 센스 가닥을 암호화하는 두개의 벡터 구조물은, 센스 가닥과 안티 센스 가닥을 각각 발현하고, 그 후 이중 가닥의 올리고뉴클레오티드 축물을 형성하기 위해서 이용된다. 게다가, 클로닝된 서열은 ２차구조(예를 들면 헤어핀)를 갖는 구조물을 암호화할 수 있으며, 다시 말해서, 벡터의 단일 전사 산물은 표적유전자의 센스 서열 및 상보적 안티 센스 서열의 모두를 포함할 수 있다.
본 발명의 벡터는, 표적세포의 게놈에 안정적으로 삽입시키기 위해서 이용될 수 있다(상동적 재조합 카세트 벡터의 설명에 관해서 Thomas KR & Capecchi MR, Cell 1987,51:503-12 참조). 예를 들면, Wolff et al., Science 1990,247:1465-8, 미국 특허 제5,580,859호; 제5,589,466호; 제5,804,566호; 제5,739,118호; 제5,736,524호; 제5,679,647호; 및 WO98/04720을 참조할 수 있다. DNA 베이스의 송달 기술의 예는, 「naked DNA」, 촉진성 [부피비카인(bupivicaine), 폴리머, 펩티드 매개(peptide-mediated)] 송달, 양이온의 지방질 복합체(cationic lipid complexes) 및 입자매개(particle-mediated) ["유전자총(gene gun)"] 또는 압력매개 전달(pressure-mediated delivery) (예를 들면, 미국 특허 제5,922,687호를 참조)을 포함한다.
본 발명에서 상기 발현 벡터는 비바이러스성 벡터 또는 바이러스성 벡터인 것이 바람직하고, 비바이러스성 벡터로는 플라스미드 DNA인 것이 바람직하며, 바이러스성 벡터로는 렌티바이러스(lentivirus), 레트로바이러스(retrovirus), 아데노바이러스(adenovirus), 허피스바이러스(herpes virus) 및 아비폭스바이러스(avipox virus) 벡터 등을 사용할 수 있으나, 이에 제한되는 것은 아니다.
또한, 본 발명에서 상기 발현 벡터는, 형질 전환된 세포의 선별을 용이하게 하기 위하여 선별 마커를 추가로 포함하는 것이 바람직하다. 예를 들어, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들, 예를 들어 녹색 형광 단백질, 퓨로마이신, 네오마이신, 하이그로마이신, 히스티디놀 디하이드로게나제(hisD) 및 구아닌 포스포리보실트랜스퍼라제(Gpt) 등을 예시할 수 있다.
본 발명에서 숙주 세포는 인간을 포함한 포유류의 체세포인 것이 바람직하고, 인간의 치료를 목적하는 조직 부위의 세포이거나, 그 부위의 암 세포 또는 암 줄기세포인 것이 더욱 바람직하나 이에 한정되지 않는다.
또한, 본 발명에서 상기 발현 벡터를 숙주 세포에 도입하기 위한 방법으로는 G-fectin, Mirus TrasIT-TKO 지질친화성 시약, 리포펙틴, 리포펙타민, 셀펙틴(cellfectin), 양이온성 인지질 나노입자, 양이온성 고분자, 양이온성 미셀, 양이온성 에멀젼 또는 리포좀을 포함하는 전달시약과 함께 세포 내로 도입되거나, 폴리에틸렌글리콜과 같은 생체적합성 고분자를 접합하여 세포 내 흡수를 증가시킬 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 다른 구현 예에 따르면, 본 발명에서 제공하는 올리고뉴클레오티드, 이중 가닥의 올리고뉴클레오티드, 벡터 또는 형질 전환된 숙주 세포를 유효성분으로 포함하는 암 또는 암 줄기세포의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 또 다른 구현 예에 따르면, 본 발명에서 제공하는 올리고뉴클레오티드, 벡터 또는 형질 전환된 숙주 세포를 유효성분으로 포함하는 암의 전이의 예방 또는 치료용 약학적 조성물에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 암을 예방 또는 치료하기 위하여, 치료를 필요로 하는 대상체에 본 발명에서 제공하는 올리고뉴클레오티드, 벡터 또는 형질 전환된 숙주 세포를 유효량으로 투여하는 단계를 포함하는, 암의 예방 또는 치료 방법에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 암의 전이를 예방 또는 치료하기 위하여, 치료를 필요로 하는 대상체에 본 발명에서 제공하는 올리고뉴클레오티드, 벡터 또는 형질 전환된 숙주 세포를 유효량으로 투여하는 단계를 포함하는, 암의 전이의 예방 또는 치료 방법에 관한 것이다.
본 발명에서 상기 "치료를 필요로하는 대상체"란 암 또는 암 전이의 증상이 있거나 의심되어, 암 또는 암 줄기세포의 성장 또는 증식을 억제하는 등으로 암 또는 암 전이를 예방, 개선 또는 치료가 필요한 대상체일 수 있다.
본 발명에서 제공하는 올리고뉴클레오티드, 이중 가닥의 올리고뉴클레오티드, 발현 벡터 또는 형질 전환된 숙주 세포는 암 세포 또는 암 줄기세포의 증식을 억제하거나 사멸을 유도할 수 있고, 혹은 암 줄기세포의 줄기세포능(stemness)을 억제할 수 있으며, 구체적으로는 암 줄기세포에 있어서 줄기세포능(stemness) 관련 마커인 nanog 및 OCT4 중 적어도 하나의 발현을 억제하거나, 암 줄기세포에서 그 발현이 억제되는 CK18 및 KRT20 중 적어도 하나의 발현은 증가시켜 줄기세포능을 상실하도록 유도할 수 있다.
일반적으로 “암 줄기세포”란 줄기세포 특유의 능력인 자가재생이나 분화능력을 가지고 있는 포괄적인 의미의 암 세포를 의미한다.
본 발명에서 상기 "암"은 포유류에서 전형적으로 조절되지 않는 세포 성장으로 특징 지어진 생리적 상태를 나타내거나 가리킨다. 치료 및 예방 대상이 되는 암은 그 발생 부위에 따라 흑색종, 유방암, 대장암, 자궁암, 나팔관암, 난소암, 위암, 뇌암, 직장암, 소장암, 직장암, 식도암, 임파선암, 담낭암, 폐암, 피부암, 신장암, 방광암, 혈액암, 췌장암, 전립선암, 갑상선암, 내분비선암, 구강암, 간암 등 일 수 있으나, 바람직하게는 흑색종, 유방암, 폐암 또는 대장암일 수 있으며, 종양의 분화 및/또는 증식 등 암의 진행이 본 발명에서 기술하는 암 줄기세포에 의존적인 암의 종류라면 이에 제한되지 않는다.
이러한 암 세포로 분화할 수 있는 암 줄기세포는 악성 종양 조직 내에 1 ~ 2% 정도로 존재하며 정상줄기세포의 특성인 자가복제 능력 (self-renewal)과 다른 세포로 분화 할 수 있는 전분화능 (pluripotent)을 가지고 있으나 자가 조절 기능에 이상이 있어 세포분열 활성화로 세포 수를 증가하게 되고 스스로 악성 종양 세포로 분화하는 것으로 보고되었다.
1997년 백혈병에서 암 줄기세포(cancer stem cell)의 존재가 밝혀진 이래로 (Blood, 1997), 유방암 (PNAS, 2003), 뇌종양 (Nature, 2004), 전립선암 (Cancer Res, 2005), 대장암 (Nature, 2007), 흑색종 (Nature, 2008)에서도 암 줄기세포가 존재한다는 증거들이 제시되었고. 종양에 포함되어있는 소수의 암 줄기세포가 종양의 악성화, 항암저항성 및 재발의 주된 원인으로 부각되었다.
암 줄기세포들은 다른 암 세포들과 구별되는 표지 인자(marker)가 존재하며, 암 줄기세포의 표지 인자(cancer stem cell marker)로는 하기 표 1과 같이 다양한 암 종 특이적인 암 줄기세포 표지 인자가 알려져 있다.
암종 암 줄기세포 표지인자 출처
교모세포종 CD133
신장암 CD105, CD133 Contemp Oncol (Pozn). 2015; 19(1A): A44-A51
갑상선암 ABCG2, MRP1, LRP 및 CXCR4 J Clin Pathol. 2014 Feb;67(2):125-33
급성골수성백혈병 (AMM) CD34+/CD38-
다발성골수종 (multiple myeloma) CD133-
유방암 CD44+/CD24-/low Breast Cancer Res. 2007; 9(3): 303
대장암 CD133+
전립선암 CD44+/α2β1hi/CD133+
흑색종 (melanoma) ABCB5+
본 발명에서 성장 억제의 대상이 되는 암 줄기세포로는 상기 열거된 암의 줄기세포를 모두 포함할 수 있고, 특히 유방암 줄기세포, 흑색종 줄기세포, 폐암 줄기세포 또는 대장암 줄기세포일 수 있다.
상기한 암 줄기세포들은 끊임없이 자기 재생(self-renewal)을 하며, 실험 동물 모델에서 천개 미만의 적은 세포수로도 종양을 만들 수 있으며 악성 종양 세포로서의 능력을 보유하고 있다. 또한 암 치료법인 항암제 치료와 방사선 치료에 놀라울 정도로 저항성을 가지고 있어, 암 줄기세포의 제거는 암 치료의 성패를 가늠할 수 있는 바로미터로 점차 인식 되고 있다. 최근에는 수술, 방사선 치료, 항암화학요법 등 기존의 여러 치료방법을 이용해 암 세포들을 사멸시키더라도 암 줄기세포들을 모두 사멸시키지 못한다면 남아있는 암 줄기세포들로부터 다시 암이 재발할 수 있다는 것으로 인식되고 있다. 이러한 암의 재발을 방지하기 위하여 종양을 재생성할 수 있는 능력을 가진 암 줄기세포를 타겟으로 하는 화학요법 및 이를 바탕으로 암을 치료하고자 하는 치료프로토콜 개발에 관심이 높아지고 있다.
정상 조직에서의 줄기세포는 자가 재생 (self-renewal) 기전에 의해 세포 성장과 분화를 조절하지만, 암 줄기세포는 종양세포 주변의 종양 미세환경 인자에 영향을 받아 비정상적인 자가분열(Self-renewal) 및 유지(maintenance) 경로를 활성화하여 급격히 집적됨으로써 악성화 되고 항암치료에 대한 저항성을 획득하게 되며 궁극적으로 암의 재발을 야기한다고 제시되고 있다. 그러나 아직까지 암 줄기세포의 집적 및 유지를 조절하는 종양 미세 환경 인자의 실체와 상호작용에 대한 구체적인 기전 연구는 진행되지 못하고 있다.
본 발명에서, "예방"은 본 발명의 약학적 조성물을 이용하여 암 증상을 차단하거나, 암 증상의 억제 또는 지연시키는 모든 행위라면 제한없이 포함할 수 있다.
본 발명에서, "치료"는 본 발명의 약학적 조성물을 이용하여 암 증상이 호전되거나 이롭게 되는 모든 행위라면 제한없이 포함할 수 있다.
본 발명의 올리고뉴클레오티드, 발현 벡터, 형질 전환체 또는 약학적 조성물은 다른 항암제와도 추가로 병용 투여할 수 있으며, 이를 통해서 암 세포 및 암 줄기세포에 대한 성장 억제 효과를 더욱 증강시킬 수 있다.
여기서 상기 항암제로는 나이트로젠 머스타드, 이마티닙, 옥살리플라틴, 리툭시맙, 엘로티닙, 네라티닙, 라파티닙, 제피티닙, 반데타닙, 니로티닙, 세마사닙, 보수티닙, 악시티닙, 세디라닙, 레스타우르티닙, 트라스투주맙, 게피티니브, 보르테조밉, 수니티닙, 카보플라틴, 베바시주맙, 시스플라틴, 세툭시맙, 비스쿰알붐, 아스파라기나제, 트레티노인, 하이드록시카바마이드, 다사티닙, 에스트라머스틴, 겜투주맵오조가마이신, 이브리투모맙튜세탄, 헵타플라틴, 메칠아미노레불린산, 암사크린, 알렘투주맙, 프로카르바진, 알프로스타딜, 질산홀뮴 키토산, 젬시타빈, 독시플루리딘, 페메트렉세드, 테가푸르, 카페시타빈, 기메라신, 오테라실, 아자시티딘, 메토트렉세이트, 우라실, 시타라빈, 플루오로우라실, 플루다가빈, 에노시타빈, 플루타미드, 데시타빈, 머캅토푸린, 티오구아닌, 클라드리빈, 카르모퍼, 랄티트렉세드, 도세탁셀, 파클리탁셀, 이리노테칸, 벨로테칸, 토포테칸, 비노렐빈, 에토포시드, 빈크리스틴, 빈블라스틴, 테니포시드, 독소루비신, 이다루비신, 에피루비신, 미톡산트론, 미토마이신, 블레로마이신, 다우노루비신, 닥티노마이신, 피라루비신, 아클라루비신, 페프로마이신, 템시롤리무스, 테모졸로마이드, 부설판, 이포스파미드, 사이클로포스파미드, 멜파란, 알트레트민, 다카바진, 치오테파, 니무스틴, 클로람부실, 미토락톨, 레우코보린, 트레토닌, 엑스메스탄, 아미노글루테시미드, 아나그렐리드, 나벨빈, 파드라졸, 타목시펜, 토레미펜, 테스토락톤, 아나스트로졸, 레트로졸, 보로졸, 비칼루타미드, 로무스틴 및 카르무스틴으로 이루어진 군에서 선택된 1종 이상을 사용할 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 있어서, 상기 올리고뉴클레오티드, 발현 벡터, 형질 전환체 또는 약학적 조성물은 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태임을 특징으로 할 수 있으며, 상기 올리고뉴클레오티드, 발현 벡터, 형질 전환체 또는 약학적 조성물은 인간을 대상으로 하는 것을 특징으로 할 수 있다.
본 발명의 올리고뉴클레오티드, 발현 벡터, 형질 전환체 또는 약학적 조성물은 이들로 한정되는 것은 아니지만, 각각 통상의 방법에 따라 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 본 발명의 약학적 조성물은 약제적으로 허용 가능한 담체를 포함할 수 있다. 약제학적으로 허용되는 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. 본 발명의 약학적 조성물의 제형은 상술한 바와 같은 약제학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서(elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형할 수 있다.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.
본 발명에 따른 올리고뉴클레오티드, 발현 벡터, 형질 전환체 또는 약학적 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장이 포함된다. 경구 또는 비경구 투하가 바람직하다.
본 발명에서, "비경구"는 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골내 주사 또는 주입기술을 포함한다. 본 발명의 약학적 조성물은 또한 직장 투여를 위한 좌제의 형태로 투여될 수 있다.
본 발명의 올리고뉴클레오티드, 발현 벡터, 형질 전환체 또는 약학적 조성물은 사용된 특정 화합물의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여시간, 투여경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 약학적 조성물의 투여량은 환자의 상태, 체중, 질병의 정도, 약물 형태, 투여 경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있고, 1일 0.0001 내지 50mg/kg 또는 0.001 내지 50mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. 본 발명에 따른 의약 조성물은 환제, 당의정, 캡슐, 액제, 겔, 시럽, 슬러리, 현탁제로 제형될 수 있다.
본 발명의 올리고뉴클레오티드를 포함하는 발현 벡터의 경우 구체적으로 0.01 내지 500 mg을 함유하고, 보다 구체적으로 0.1 내지 300 mg을 함유하며, 본 발명의 miRNA를 포함하는 재조합 바이러스의 경우, 구체적으로 103~1012 IU(10 내지 1010 PFU)를 함유하고, 보다 구체적으로 105 내지 1010 IU를 함유하나, 이에 한정되지 않는다.
또한, 본 발명의 벡터가 형질 전환된 숙주 세포의 경우, 구체적으로 103 내지 108 개를 함유하고, 보다 구체적으로 104 내지 107개를 함유하나, 이에 한정되지 않는다.
또한, 본 발명의 올리고뉴클레오티드를 포함하는 발현 벡터 또는 형질 전환된 숙주 세포를 유효성분으로 함유하는 조성물의 유효 용량은 체중 1 ㎏당 벡터의 경우에는 0.05 내지 12.5 ㎎/㎏, 재조합 바이러스의 경우에는 107 내지 1011 바이러스 입자(105 내지 109 IU)/㎏, 세포의 경우에는 103 내지 106 세포/㎏이고, 구체적으로 벡터의 경우에는 0.1 내지 10 ㎎/㎏, 재조합 바이러스의 경우에는 108 내지 1010 입자(106 내지 108 IU)/㎏, 세포의 경우에는 102 내지 105 세포/㎏이며, 하루 2 내지 3회 투여될 수 있다. 상기와 같은 조성은 반드시 이에 한정되는 것은 아니고, 환자의 상태 및 질환의 발병 정도에 따라 변할 수 있다.
한편, 본 발명에서 상기 이중 가닥의 올리고뉴클레오티드는, 딜리버리(delivery) 시약으로 조합시킨 나이중 가닥 올리고뉴클레오티드 분자(naked double strand oligonucleotide molecule)로, 또는 이중 가닥의 올리고뉴클레오티드를 발현되는 재조합 플라스미드 혹은 바이러스 벡터로 대상에 투여할 수 있다.
본 발명의 이중 가닥의 올리고뉴클레오티드로 조합시켜서 투여하기 위한 적절한 전달(delivery) 시약은, Mirus Transit TKO 지방가용성시약(lipophilic reagent), LipoTrustTM SR, 리포펙틴(lipofectin), 리포펙타민(lipofectamine), 셀펙틴(cellfectin) 또는 폴리양이온(polycations) (예를 들면 폴리 라이신(lysine)), 리포솜(liposome), 콜라겐 또는 아텔로콜라겐(atelocollagen)을 포함한다. 바람직한 딜리버리(delivery) 시약은 리포솜(liposome)이다.
리포솜(liposome)은, 망막 또는 종양 조직 등의 특정한 조직에 이중 가닥 핵산분자의 송달을 보조할 수 있고, 이중가닥 핵산분자의 혈액내 반감기를 증대시킬 수도 있다. 본 발명의 사용에 적합한 리포솜(liposome)은, 표준적인 소포형성 지방질(standard vesicle-forming lipid)로부터 형성되고, 일반적으로 중성 또는 음전하를 띄는 포스포리피드(negatively charged phospholipids) 및 콜레스테롤과 같은 스테롤(sterol)을 포함한다. 지방질의 선택은, 통상, 원하는 리보솜(liposome)의 크기 및 혈액 순환에 있어서의 리보솜(liposome)의 반감기 같은 요소를 고려해서 정해진다. 리보솜(liposome)을 준비하기 위한 각양각색인 방법이 공지되어 있으며, 예를 들면 Szoka et al., Ann Rev Biophys Bioeng 1980,9:467; 미국 특허 제4,235,871호; 제4,501,728호; 제4,837,028호; 제5,019,369호는 그 전체가 참조로 본 명세서에 사용될 수 있다.
본 발명의 이중 가닥의 올리고뉴클레오티드를 발현되는 벡터는 상기에서 기술하였다. 본 발명의 이중 가닥의 올리고뉴클레오티드를 발현하는 벡터는, 직접 또는, Mirus Transit LT1 지방가용성시약, LipoTrustTMSR, 리포펙틴(lipofectin), 리포펙타민(lipofectamine), 셀펙틴(cellfectin), 폴리야이온(polycation) (예를 들면 폴리 라이신(lysine)) 또는 리보솜(liposome) 또는 콜라겐, 아텔로콜라겐(atelocollagen)등이 적절한 송달(delivery) 시약으로 조합되어서 투여될 수 있다. 본 발명의 이중 가닥의 올리고뉴클레오티드를 발현하는, 재조합 바이러스 벡터를 환자의 암 영역에 송달하는 방법은, 본 기술분야의 기술의 범위내이다.
본 발명의 이중 가닥의 올리고뉴클레오티드는, 이중 가닥의 올리고뉴클레오티드를 암 영역에 송달하는데 적합한 어떠한 방법으로 대상에 투여될 수 있다. 예를 들면, 이중가닥 핵산분자는 유전자총, 전기충격법(electroporation) 혹은 다른 적절한 비경구적 또는 장내 투여 경로에 의해 투여될 수 있다.
본 발명에서 적절한 장내 투여 경로는, 경구, 직장 또는 비강내 송달을 포함한다. 적절한 비경구 투여 경로는, 정맥내 투여 (예를 들면 정맥내 볼루스 주사(intravenous bolus injection), 정맥주입(intravenous infusion), 동맥내 볼루스 주사(intra-arterial bolus injection), 동맥주입((intra-arterial infusion) 및 맥관구조(vasculature)로 도뇨관 점적(catheter instillation)), 조직 주위 및 조직내 주입 (예를 들면 종양 주위 또는 종양 내 주사, 망막 내 주사 또는 망막 하 주사), 피하 주사 또는 피하주입을 포함하는 침전(deposition)(삼투압 펌프에 의한 것과 같이), 암의 영역 또는 부위주위에의 직접적인 처치, 예를 들면 도뇨관(catheter) 또는 다른 설치 수단 (예를 들면, 망막 소환약(retinal pellet), 좌약(suppository) 또는 다공성, 비다공성 혹은 젤라틴성 물질을 포함하는 임플란트(implant)), 및 흡입을 포함한다. 이중가닥 핵산분자 혹은 벡터의 주사 또는 주입은 암의 부위 혹은 그 주변에 투여하는 것이 바람직하다.
본 발명의 이중 가닥의 올리고뉴클레오티드는 단일 용량 혹은 복수 용량으로 투여할 수 있다. 본 발명의 이중 가닥의 올리고뉴클레오티트가 주입되는 경우, 주입은 단일 유지된 용량(single sustained dose) 또는 다중 주입(multiple infusion)에 의해 투여할 수 있다. 조직에의 직접적인 약제의 주사는, 암의 부위 또는 암 주위가 바람직하다. 암 조직 또는 암 주위에 다중 주사는, 특히 바람직하다.
본 발명에서 제공하는 이중 가닥의 올리고뉴클레오티드는 안정적으로 인체 내에 도입되어 암 세포 또는 암 줄기세포의 성장을 효과적으로 억제하여 암을 예방 및/또는 치료할 수 있으며, 더 나아가서는 암의 내성, 전이 및 재발 또한 방지할 수 있다.
도 1은 본 발명의 일 실시예에서 SK-MEL28 암 세포에 본 발명에 따른 이중 가닥의 올리고리보뉴클레오티드를 처리한 뒤 상기 암 세포의 세포 생존율의 변화를 측정한 결과를 그래프로 나타낸 것이다.
도 2는 본 발명의 일 실시예에서 SK-MEL28 암 줄기세포에 본 발명에 따른 이중 가닥의 올리고리보뉴클레오티드를 처리한 뒤 콜로니의 수의 변화를 측정한 결과를 그래프로 나타낸 것이다.
도 3은 본 발명의 일 실시예에서 SK-MEL28 암 줄기세포에 본 발명에 따른 이중 가닥의 올리고리보뉴클레오티드를 처리한 뒤 상기 암 줄기세포의 세포 침윤능을 분석한 결과를 그래프로 나타낸 것이다.
도 4는 본 발명의 일 실시예에서 SK-MEL28 암 줄기세포에 본 발명에 따른 이중 가닥의 올리고리보뉴클레오티드를 처리한 뒤 상기 암 줄기세포의 줄기능(stemness)과 관련된 유전자인 Nanog의 발현 수준의 변화를 분석한 결과를 그래프로 나타낸 것이다.
도 5는 본 발명의 일 실시예에서 SK-MEL28 암 줄기세포에 본 발명에 따른 이중 가닥의 올리고리보뉴클레오티드를 처리한 뒤 상기 암 줄기세포에서 발현이 억제되는 유전자인 TYRP1의 발현 수준의 변화를 분석한 결과를 그래프로 나타낸 것이다.
도 6은 본 발명의 일 실시예에서 SK-MEL28 암 세포에 본 발명에 따른 이중 가닥의 올리고리보뉴클레오티드를 처리한 뒤 암 세포 50%의 사멸을 유도할 수 있는 농도(GI50)를 측정하여 그 결과를 그래프로 나타낸 것이다.
도 7은 본 발명의 일 실시예에서 Malme-3m 암 세포에 본 발명에 따른 이중 가닥의 올리고리보뉴클레오티드를 처리한 뒤 암 세포 50%의 사멸을 유도할 수 있는 농도(GI50)를 측정하여 그 결과를 그래프로 나타낸 것이다.
도 8은 본 발명의 일 실시예에서 A549 암 세포에 본 발명에 따른 이중 가닥의 올리고리보뉴클레오티드를 처리한 뒤 암 세포 50%의 사멸을 유도할 수 있는 농도(GI50)를 측정하여 그 결과를 그래프로 나타낸 것이다.
도 9는 본 발명의 일 실시예에서 NCI-H460 암 세포에 본 발명에 따른 이중 가닥의 올리고리보뉴클레오티드를 처리한 뒤 암 세포 50%의 사멸을 유도할 수 있는 농도(GI50)를 측정하여 그 결과를 그래프로 나타낸 것이다.
본 발명의 다른 구현 예에 다르면, 서열번호 1, 3, 5, 7 및 9 중 어느 하나로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드; 및 이에 혼성화될 수 있는 올리고뉴클레오티드를 포함하는, 이중 가닥의 올리고뉴클레오티드에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 서열번호 2, 4, 6, 8 및 10 중 어느 하나로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드; 및 이에 혼성화될 수 있는 올리고뉴클레오티드를 포함하는, 이중 가닥의 올리고뉴클레오티드에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 서열번호 1로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드; 및 서열번호 2로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드를 포함하는, 이중 가닥의 올리고뉴클레오티드에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 서열번호 3으로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드; 및 서열번호 4로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드를 포함하는, 이중 가닥의 올리고뉴클레오티드에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 서열번호 5로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드; 및 서열번호 6으로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드를 포함하는, 이중 가닥의 올리고뉴클레오티드에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 서열번호 7로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드; 및 서열번호 8으로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드를 포함하는, 이중 가닥의 올리고뉴클레오티드에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 서열번호 9로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드; 및 서열번호 10로 표시되는 올리고뉴클레오티드 또는 이와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 염기서열로 이루어지는 올리고뉴클레오티드를 포함하는, 이중 가닥의 올리고뉴클레오티드에 관한 것이다.
본 발명의 다른 구현 예에 따르면, 본 발명에서 제공하는 올리고뉴클레오티드, 이중 가닥의 올리고뉴클레오티드, 이를 포함하는 벡터 또는 상기 벡터로부터 형질 전환된 숙주 세포를 유효성분으로 포함하는 암 또는 암 줄기세포의 예방 또는 치료용 약학적 조성물을 제공한다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예
[준비예 1] 올리고리보뉴클레오타이드의 준비
하기 표 2에 나타낸 염기 서열로 표시되는 5종의 이중 가닥의 올리고리보뉴클레오타이드를 합성하였다.
올리고리보뉴클레오타이드 종류 염기서열
PSI-50A-2.3 uauggaguggaaaacaauacccc (서열번호 1)
gggguauuguuuuccacuccaua (서열번호 2)
PSI-50B-2.3 uauggaguggacuuucagcuggcccccauaacaaaggcgacggucc (서열번호 3)
ggaccgucgccuuuguuaugggggccagcugaaaguccacuccaua (서열번호 4)
PSI-50C-2.3 uauggaguggaaaacaauaccca (서열번호 5)
uggguauuguuuuccacuccaua (서열번호 6)
PSI-50D-2.3 uauggaguggacaacaauaccgc (서열번호 7)
uggguauuguuuuccacuccagg (서열번호 8)
PSI-50E-2.3 uauggaguggacuuucagcuggcauuuacgagucgugcucugggguauuguuuccgcugccagg(서열번호 9)
ccuggcagcggaaacaauaccccagugagcgaguucuuacagagccagcugaaaguccacuccaua(서열번호 10)
[준비예 2] 암 세포 및 암 줄기세포의 준비
ATCC로부터 SK-MEL28, MALME-3M, A549, NCI-H460 암 세포주를 구매한 뒤 배양하였다. SK-MEL28 암세포주는 B27 supplement와 성장 인자(FGF 및 EGF 20 ng/mL)가 첨가된 DMEM/F12 배지에서 배양하며 암 줄기세포를 유도하였다. 암 줄기세포 마커인 CD44+가 발현된 세포 만을 선별하여 약 2주 동안 배양하였다.
[실시예 1] 암 세포 및 암 줄기세포의 생존율 평가
리포펙타민(lipofectamine)을 이용하여 상기 준비예 2에서 준비된 SK-MEL28 암 세포 및 암 줄기세포에 상기 준비예 1에서 준비된 5종의 이중 가닥의 올리고리보뉴클레오타이드를 9일 동안 도입한 뒤 세포 생존율의 변화를 비교하여 도 1에 나타내었다.
도 1에서 보는 바와 같이, 암 세포 및 암 줄기세포에 본 발명에 따른 올리고리보뉴클레오타이드를 처리하자 상기 암 세포 및 암 줄기세포의 생존율이 현저히 감소하는 것을 확인할 수 있었다.
이를 통하여 본 발명에 따른 이중 가닥의 올리고리보뉴클레오타이드는 암 세포 및 암 줄기세포의 증식 억제 및 사멸 유도 효과가 있음을 알 수 있다.
[실시예 2] 암 줄기세포의 증식 억제 평가
상기 실시예 1과 동일한 방법으로 상기 준비예 2에서 준비된 SK-MEL28 암 세포 및 암 줄기세포 각각에 상기 준비예 1의 5종의 이중 가닥의 올리고리보뉴클레오타이드를 도입한 뒤 콜로니 수의 변화를 비교하여 도 2에 나타내었다.
도 2에서 보는 바와 같이, 암 세포 및 암 줄기세포에 본 발명에 따른 올리고리보뉴클레오타이드를 처리하자 상기 암 세포 및 암 줄기세포의 콜로니 수가 현저히 감소하는 것을 확인할 수 있었다.
이를 통하여 본 발명에 따른 이중 가닥의 올리고리보뉴클레오타이드는 암 세포 및 암 줄기세포의 증식 억제 및 사멸 유도 효과가 매우 뛰어남을 알 수 있다.
[실시예 3] 암 줄기세포의 전이 억제 평가
상기 실시예 1과 동일한 방법으로 상기 준비예 2에서 준비된 SK-MEL28 암 세포 및 암 줄기세포에 상기 준비예 1에서 얻어진 5종의 이중 가닥의 올리고리보뉴클레오타이드를 도입한 뒤 세포의 침윤능의 변화를 비교하여 도 3에 나타내었다
도 3에서 보는 바와 같이, 암 세포 및 암 줄기세포에 본 발명에 따른 올리고리보뉴클레오타이드를 처리하자 암 줄기세포의 세포 침윤능이 현저히 감소하는 것을 확인할 수 있었다.
이를 통하여 본 발명에 따른 이중 가닥의 올리고리보뉴클레오타이드는 암 세포 및 암 줄기세포의 세포 침윤능을 효과적으로 억제할 수 있는 것을 알 수 있다.
[실시예 4] 암 줄기세포의 분화 유도 평가
상기 실시예 1과 동일한 방법으로 상기 준비예 2에서 준비된 SK-MEL28 암세포 및 암 줄기세포 각각에 상기 준비예 1의 5종의 올리고리보뉴클레오타이드를 도입한 뒤 올리고리보뉴클레오타이드가 도입된 암 줄기세포를 수확(harvesting)하여 RNA를 분리한 뒤 cDNA를 합성하고 하기 표 3에 나타낸 프라이머를 이용하여 qPCR 기법을 통해 Nanog 및 TYRP1 유전자의 실시간 증폭되는 사이클(cycle)을 수치화해 정량화 하였다. 그 결과는 도 4 및 도 5와 같다.
프라이머 이름 프라이머 서열
Nanog Forward CCCCAGCCTTTACTCTTCCTA
Reverse CCAGGTTGAATTGTTCCAGGTC
TYRP1 Forward TGGCCAAGTCGGGAGTTTAG
Reverse CATACTGCGTCTGGCACGAA
GAPDH Forward AATCCCATCACCATCTTCCA
Reverse TGGACTCCACGACGTACTCA
도 4에서 보는 바와 같이, SK-MEL28 암 줄기세포에 본 발명에 따른 올리고리보뉴클레오타이드를 처리하자 줄기능(stemness)과 관련된 유전자인 Nanog의 발현 수준이 현저히 저감된 것을 확인할 수 있었다.
한편, 도 5에서 보는 바와 같이, 암 줄기세포에서 그 발현이 억제된 TYRP1의 발현 수준은 증가한 것을 볼 수 있다.
이를 통하여 본 발명에 따른 이중 가닥의 올리고리보뉴클레오타이드는 암 줄기세포의 줄기세포능(stemness)을 상실하도록 하는 효과가 있음을 알 수 있다.
[실험예 5] 암 세포의 증식 억제 평가
리포펙타민(lipofectamine)을 이용하여 상기 준비예 1에서 준비된 SK-MEL28, Malme-3m, A549, NCI-H460 암 세포 각각에 상기 실시예 1 내지 5의 5종의 이중 가닥의 올리고리보뉴클레오타이드를 농도별(0.01, 1, 10, 100, 1000, 10000 nM)로 도입한 뒤 세포 생존율의 변화를 측정하여 그 결과를 각각 도 6 내지 도 9에 나타내었다.
도 6 내지 도 9에서 보는 바와 같이, 암 세포에 본 발명에 따른 올리고리보뉴클레오타이드를 처리하자 상기 암 세포가 50% 정도 사멸되는 물질 농도가 매우 낮은 것을 확인할 수 있었다.
이를 통하여 본 발명에 따른 이중 가닥의 올리고리보뉴클레오타이드는 암 세포의 증식 억제 및 사멸 유도 효과가 매우 뛰어남을 알 수 있다.
본 발명은 올리고뉴클레오티드를 이용하여 암을 효과적으로 예방, 개선 또는 치료하는 방법에 관한 것이다.
서열번호 1: 5'-uauggaguggaaaacaauacccc-3'
서열번호 2: 5'-gggguauuguuuuccacuccaua-3'
서열번호 3: 5'-uauggaguggacuuucagcuggcccuggcagcggaaacaauacccc-3'
서열번호 4: 5'-gggguauuguuuccgcugccagggccagcugaaaguccacuccaua-3'
서열번호 5: 5'-uauggaguggaaaacaauaccca-3'
서열번호 6: 5'-uggguauuguuuuccacuccaua-3'
서열번호 7: 5'-uauggaguggacaacaauaccgc-3'
서열번호 8: 5'-uggguauuguuuuccacuccagg-3'
서열번호 9: 5'-uauggaguggacuuucagcuggcauuuacgagucgugcucugggguauuguuuccgcugccagg-3'
서열번호 10: 5'- ccuggcagcggaaacaauaccccagugagcgaguucuuacagagccagcugaaaguccacuccaua-3'

Claims (20)

  1. 서열번호 1 내지 10 중 어느 하나로 표시되는 올리고뉴클레오티드.
  2. 서열번호 1, 3, 5, 7 및 9 중 어느 하나로 표시되는 올리고뉴클레오티드 및 이에 혼성화될 수 있는 올리고뉴클레오티드를 포함하는, 이중 가닥의 올리고뉴클레오티드.
  3. 서열번호 2, 4, 6, 8 및 10 중 어느 하나로 표시되는 올리고뉴클레오티드 및 이에 혼성화될 수 있는 올리고뉴클레오티드를 포함하는, 이중 가닥의 올리고뉴클레오티드.
  4. 제2항에 있어서,
    서열번호 1로 표시되는 올리고뉴클레오티드 및 서열번호 2로 표시되는 올리고뉴클레오티드를 포함하는, 이중 가닥의 올리고뉴클레오티드.
  5. 제2항에 있어서,
    서열번호 3으로 표시되는 올리고뉴클레오티드 및 서열번호 4로 표시되는 올리고뉴클레오티드를 포함하는, 이중 가닥의 올리고뉴클레오티드.
  6. 제2항에 있어서,
    서열번호 5로 표시되는 올리고뉴클레오티드 및 서열번호 6으로 표시되는 올리고뉴클레오티드를 포함하는, 이중 가닥의 올리고뉴클레오티드.
  7. 제2항에 있어서,
    서열번호 7로 표시되는 올리고뉴클레오티드 및 서열번호 8로 표시되는 올리고뉴클레오티드를 포함하는, 이중 가닥의 올리고뉴클레오티드.
  8. 제2항에 있어서,
    서열번호 9로 표시되는 올리고뉴클레오티드 및 서열번호 10으로 표시되는 올리고뉴클레오티드를 포함하는, 이중 가닥의 올리고뉴클레오티드.
  9. 제2항에 있어서,
    상기 올리고뉴클레오티드는 DNA, RNA 또는 DNA/RNA 하이브리드 분자인, 이중 가닥의 올리고뉴클레오티드.
  10. 제2항에 있어서,
    상기 올리고뉴클레오티드는,
    인산 뼈대 구조 (phosphate backbone structure)가 황 원소로 치환한 형태인 모노포스페이트(monophosphate), 디포스페이트(diphosphate), 트리포스페이트(triphosphate), 알킬포스포네이트(alkylphosphonate), 포스포로티오에이트(phosphorothioate), 포스포로디티오에이트(phosphorodithioate), 포스포르아미데이트(phosphoramidate) 구조가 포함하는 형태;
    DNA, PNA(petide nucleic acids), LNA(locked nucleic acid), UNA(unlocked nucleic acid), BNA(bridged nucleic acid), GNA(glycol nucleic acid) 또는 TNA(threose nucleic acid) 분자로 치환된 형태; 또는
    당의 2'수산화기가 메틸가, 에틸기, 메톡시기, 에톡시기, 아미노기 또는 플루오르기로 치환된 형태인, 이중 가닥의 올리고뉴클레오티드.
  11. 제2항 내지 제10항 중 어느 한 항의 이중 가닥의 올리고뉴클레오티드를 포함하는 벡터.
  12. 제11항의 벡터로부터 형질 전환된 숙주 세포.
  13. 제1항의 올리고뉴클레오티드를 유효 성분으로 포함하는 암 또는 암 줄기세포의 예방 또는 치료용 약학적 조성물.
  14. 제2항 내지 제10항 중 어느 한 항의 이중 가닥의 올리고뉴클레오티드를 유효 성분으로 포함하는 암 또는 암 줄기세포의 예방 또는 치료용 약학적 조성물.
  15. 제14항에 있어서,
    상기 암은 흑색종, 유방암, 대장암, 자궁암, 나팔관암, 난소암, 위암, 뇌암, 직장암, 소장암, 직장암, 식도암, 임파선암, 담낭암, 폐암, 피부암, 신장암, 방광암, 혈액암, 췌장암, 전립선암, 갑상선암, 내분비선암, 구강암 및 간암으로 이루어진 군에서 선택되는, 약학적 조성물.
  16. 제1항의 올리고뉴클레오티드를 유효 성분으로 포함하는 암의 전이의 예방 또는 치료용 약학적 조성물.
  17. 제2항 내지 제10항 중 어느 한 항의 이중 가닥의 올리고뉴클레오티드를 유효 성분으로 포함하는 암의 전이의 예방 또는 치료용 약학적 조성물.
  18. 제17항에 있어서,
    상기 암은 흑색종, 유방암, 대장암, 자궁암, 나팔관암, 난소암, 위암, 뇌암, 직장암, 소장암, 직장암, 식도암, 임파선암, 담낭암, 폐암, 피부암, 신장암, 방광암, 혈액암, 췌장암, 전립선암, 갑상선암, 내분비선암, 구강암 및 간암으로 이루어진 군에서 선택되는, 약학적 조성물.
  19. 암을 예방 또는 치료하기 위하여, 치료를 필요로 하는 대상체에 제2항 내지 제10항 중 어느 한 항의 이중 가닥의 올리고뉴클레오티드를 유효량으로 투여하는 단계를 포함하는, 암의 예방 또는 치료 방법.
  20. 암의 전이를 예방 또는 치료하기 위하여, 치료를 필요로 하는 대상체에 제2항 내지 제10항 중 어느 한 항의 이중 가닥의 올리고뉴클레오티드를 유효량으로 투여하는 단계를 포함하는, 암의 전이의 예방 또는 치료 방법.
PCT/KR2018/014732 2017-11-27 2018-11-27 올리고뉴클레오티드 및 이를 포함하는 암의 예방 또는 치료용 약학적 조성물 WO2019103578A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20170159669 2017-11-27
KR10-2017-0159669 2017-11-27

Publications (1)

Publication Number Publication Date
WO2019103578A1 true WO2019103578A1 (ko) 2019-05-31

Family

ID=66630734

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/014732 WO2019103578A1 (ko) 2017-11-27 2018-11-27 올리고뉴클레오티드 및 이를 포함하는 암의 예방 또는 치료용 약학적 조성물

Country Status (2)

Country Link
KR (1) KR102145176B1 (ko)
WO (1) WO2019103578A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20140060134A (ko) * 2012-11-09 2014-05-19 경북대학교 산학협력단 miR-186, miR-216b, miR-337-3p 및 miR-760를 유효성분으로 포함하는 암의 예방 또는 치료용 조성물
US20150272981A1 (en) * 2013-03-15 2015-10-01 Mirna Therapeutics, Inc. Combination cancer treatments utilizing micrornas and egfr-tki inhibitors
US20160017321A1 (en) * 2012-06-21 2016-01-21 Micromedmark Biotech Co., Ltd. Method for expressing, secreting and transferring functional micrornas/sirnas and application thereof
KR20160103949A (ko) * 2015-02-25 2016-09-02 (주)바이오니아 마이크로 rna 를 유효 성분으로 포함하는 암 치료용 약학 조성물

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2755674A4 (en) * 2011-09-12 2015-04-08 Tau Therapeutics Llc ANTAGONISTS OF PRODUCTS OF THE HS-459642-UNIGEN CLUSTER TO AVOID PROLIFERATION, DEVELOPMENT, OR DIFFERENTIATION OF STEM CELLS WITH CANCER STEM CELLS
EP2970970B1 (en) * 2013-03-14 2018-12-12 Andes Biotechnologies Global, Inc. Antisense oligonucleotides for treatment of cancer stem cells
JP2019509297A (ja) * 2016-03-23 2019-04-04 ザ・トラスティーズ・オブ・コロンビア・ユニバーシティ・イン・ザ・シティ・オブ・ニューヨーク ヒト間葉系幹細胞（ｈＭＳＣ）からギャップジャンクションを介するオリゴ送達に基づく癌治療

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160017321A1 (en) * 2012-06-21 2016-01-21 Micromedmark Biotech Co., Ltd. Method for expressing, secreting and transferring functional micrornas/sirnas and application thereof
KR20140060134A (ko) * 2012-11-09 2014-05-19 경북대학교 산학협력단 miR-186, miR-216b, miR-337-3p 및 miR-760를 유효성분으로 포함하는 암의 예방 또는 치료용 조성물
US20150272981A1 (en) * 2013-03-15 2015-10-01 Mirna Therapeutics, Inc. Combination cancer treatments utilizing micrornas and egfr-tki inhibitors
KR20160103949A (ko) * 2015-02-25 2016-09-02 (주)바이오니아 마이크로 rna 를 유효 성분으로 포함하는 암 치료용 약학 조성물

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
POLIOUDAKIS, D. ET AL.: "MiR-503 Represses Human Cell Proliferation and Directly Targets the Oncogene DDHD2 by Non-canonical Target Pairing", BMC GENOMICS, vol. 16, no. 1, 2015, pages 40, XP021212760 *

Also Published As

Publication number Publication date
KR102145176B1 (ko) 2020-08-18
KR20190062291A (ko) 2019-06-05

Similar Documents

Publication Publication Date Title
CN103080314B (zh) 显性突变基因表达抑制剂
US9732347B2 (en) Methods and compositions for the specific inhibition of androgen receptor by double-stranded RNA
JP6983343B2 (ja) Ｔｇｆ−ｒシグナリング阻害剤としてのアンチセンス−オリゴヌクレオチド
EP2970968B1 (en) Bridged bicyclic nucleosides
EP3037538B1 (en) Methods and compositions for the specific inhibition of beta-catenin by double-stranded rna
EP2379083A2 (en) Extended dicer substrate agents and methods for the specific inhibition of gene expression
KR20110044277A (ko) 안티센스 올리고누클레오티드에 의한 톨-유사 수용체 ３ 발현의 조절
CN115666659A (zh) 稳定性增加的修饰的寡核苷酸的合成
KR20150004414A (ko) Kras-관련 질환을 치료하기 위한 유기 조성물
JP2024041845A (ja) ホスホロジチオアートヌクレオシド間結合を含むギャップマーオリゴヌクレオチド
JP2023139252A (ja) 新規のチオホスホラミダイト
WO2012145582A2 (en) Methods and compositions for the specific inhibitions of egfr by double-stranded rna
JP2024041886A (ja) ホスホロジチオアートヌクレオシド間結合を含むオリゴヌクレオチド
KR20110039381A (ko) 안티센스 올리고누클레오티드에 의한 톨-유사 수용체 7 발현의 조절
KR102110103B1 (ko) 암의 예방 또는 치료용 약학적 조성물
TW201119681A (en) Compositions and methods for inhibiting expression of KIF10 genes
WO2019103578A1 (ko) 올리고뉴클레오티드 및 이를 포함하는 암의 예방 또는 치료용 약학적 조성물
WO2021039879A1 (ja) 胃癌分子標的核酸医薬
KR102418779B1 (ko) 신규한 miRNA 유사체 및 이의 용도
JP6934695B2 (ja) 核酸医薬とその使用
JP2021505175A (ja) Ｆｎｄｃ３ｂの発現を調節するためのオリゴヌクレオチド
WO2023127848A1 (ja) Ｅｂｖ関連疾患を標的とする核酸医薬
KR102680316B1 (ko) 안티센스 올리고뉴클레오타이드
JP2021510525A (ja) Ｅｒｃ１発現を調節するためのオリゴヌクレオチド

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18881663

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18881663

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 18881663

Country of ref document: EP

Kind code of ref document: A1

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 19/01/2021)

122 Ep: pct application non-entry in european phase

Ref document number: 18881663

Country of ref document: EP

Kind code of ref document: A1