WO2021145703A1 - 알츠하이머 예방 또는 치료용 약학적 조성물 및 이의 용도 - Google Patents

알츠하이머 예방 또는 치료용 약학적 조성물 및 이의 용도 Download PDF

Info

Publication number
WO2021145703A1
WO2021145703A1 PCT/KR2021/000550 KR2021000550W WO2021145703A1 WO 2021145703 A1 WO2021145703 A1 WO 2021145703A1 KR 2021000550 W KR2021000550 W KR 2021000550W WO 2021145703 A1 WO2021145703 A1 WO 2021145703A1
Authority
WO
WIPO (PCT)
Prior art keywords
stem cells
gene
hif1an
engineered
wild
Prior art date
Application number
PCT/KR2021/000550
Other languages
English (en)
French (fr)
Inventor
신은지
이강인
이나희
장종욱
이나경
나덕렬
이재영
Original Assignee
주식회사 툴젠
사회복지법인 삼성생명공익재단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 툴젠, 사회복지법인 삼성생명공익재단 filed Critical 주식회사 툴젠
Priority to US17/792,771 priority Critical patent/US20230053781A1/en
Priority to EP21740676.8A priority patent/EP4091635A4/en
Publication of WO2021145703A1 publication Critical patent/WO2021145703A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0075—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0668—Mesenchymal stem cells from other natural sources
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0306—Animal model for genetic diseases
    • A01K2267/0312—Animal model for Alzheimer's disease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/11—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (1.14.11)
    • C12Y114/1103—Hypoxia-inducible factor-asparagine dioxygenase (1.14.11.30)

Definitions

  • the present application relates to a pharmaceutical composition for treating Alzheimer's disease comprising stem cells (SC) having high adaptability in hypoxic conditions as an active ingredient and uses thereof.
  • SC stem cells
  • AD Alzheimer's disease
  • brain neurons neural cells
  • thinking abilities such as computational power, language ability, temporal and spatial comprehension, and judgment are gradually lowered.
  • Alzheimer's disease is one of the chronic neurodegenerative diseases and accounts for 60-70% of the causes of dementia.
  • apoptosis of neurons is observed in the limbic pathway that commonly controls memory.
  • a probable cause of the progressive loss of cognitive function, a major characteristic of AD patients, is the abnormal accumulation of A (Amyloid beta).
  • Stem cell therapy is a drug used for the purpose of treating, diagnosing, and preventing disease. Unlike classical drug therapy, stem cell therapy is a new type of cell therapy in which stem cells collected from the human body are manipulated outside the body and injected back into the patient. . It can be used for prevention, symptom relief, or treatment of intractable diseases, etc. through regeneration, repair, and recovery of damaged tissues and cells. Stem cells are in the spotlight as a therapeutic agent because they have the ability to self-renew and reduce the cumbersome treatment process or frequency, which is a problem with conventional gene therapy.
  • stem cells have problems such as immune rejection, erratic differentiation by migrating to other tissues, and the possibility that stem cells can turn into cancer cells.
  • stem cells can turn into cancer cells.
  • Patent Document 0001 COMPOSITION FOR CLEAVING A TARGET DNA COMPRISING A GUIDE RNA SPECIFIC FOR THE TARGET DNA AND CAS PROTEIN-ENCODING NUCLEIC ACID OR CAS PROTEIN, AND USE THEREOF (International Publication Number WO 2014/065596 A1).
  • Non-Patent Document 0001 Mahon PC, Hirota K, Semenza GL.
  • FIH-1 a novel protein that interacts with HIF-1alpha and VHL to mediate repression of HIF-1 transcriptional activity. Genes Dev. 2001;15(20):2675-2686. doi:10.1101/gad.924501.
  • An object of the present specification is to provide a pharmaceutical composition for treating Alzheimer's disease comprising artificially engineered stem cells as an active ingredient.
  • An object of the present specification is to provide a method for treating Alzheimer's disease using an artificially engineered stem cell and/or a pharmaceutical composition for treating Alzheimer's disease comprising the artificially engineered stem cell as an active ingredient.
  • An object of the present specification is to provide a method for preparing a pharmaceutical composition for treating Alzheimer's disease comprising artificially engineered stem cells as an active ingredient.
  • An object of the present specification is to provide the use of a pharmaceutical composition for treating Alzheimer's disease comprising artificially engineered stem cells as an active ingredient.
  • the present specification provides a pharmaceutical composition for treating Alzheimer's disease comprising artificially engineered stem cells as an active ingredient, wherein the artificially engineered stem cells include: Engineered HIF1AN gene having an indel in wild-type HIF1AN gene , wherein the sequence of the engineered HIF1AN gene is different from the sequence of the wild-type HIF1AN gene, wherein in the engineered stem cell, the expression level of FIH-1 is lower than that of the wild-type cell, It is characterized in that the expression level of HIF ⁇ in the matured stem cells is higher than in the wild-type cells.
  • the indel of the engineered HIF1AN gene is characterized in that it is located in the exon 1 region of the wild-type HIF1AN gene.
  • the artificially engineered stem cells are characterized in that the artificially engineered mesenchymal stem cells.
  • the pharmaceutical composition is characterized in that the dosage form for brain tissue administration.
  • the brain tissue is characterized in that the hippocampus or CPu (caudate putamen).
  • the present specification provides a pharmaceutical composition for the treatment of Alzheimer's disease comprising an artificially engineered stem cell as an active ingredient, wherein the artificially engineered stem cell includes an engineered HIF1AN gene,
  • the engineered HIF1AN gene The sequence does not include one or more sequences selected from the group consisting of SEQ ID NOs: 1 to 9, and the expression level of FIH-1 in the engineered stem cells is lower than in wild-type cells, wherein the engineered stem cells In the cell, the expression level of HIF ⁇ is characterized in that it is higher than that of the wild-type cell.
  • the present specification provides a method for treating Alzheimer's disease, comprising: administering a pharmaceutical composition comprising an artificially engineered stem cell as an active ingredient into a subject, wherein the artificially engineered stem cell is a wild-type HIF1AN gene comprising an engineered HIF1AN gene having an indel within, wherein the sequence of the engineered HIF1AN gene is different from the sequence of the wild-type HIF1AN gene, wherein, in the engineered stem cell, the expression level of FIH-1 is higher than that of the wild-type cell Characterized in that it is low, and in the engineered stem cells, the expression level of HIF ⁇ is higher than in the wild-type cells.
  • the administration of the pharmaceutical composition is characterized in that the pharmaceutical composition is directly injected into the brain tissue of the subject.
  • the brain tissue is characterized in that the hippocampus or CPu (caudate putamen).
  • the indel of the engineered HIF1AN gene is characterized in that it is located in the exon 1 region of the wild-type HIF1AN gene.
  • the artificially engineered stem cells are characterized in that the artificially engineered mesenchymal stem cells.
  • the present specification provides a method for treating Alzheimer's disease, comprising: administering a pharmaceutical composition comprising artificially engineered stem cells as an active ingredient into a subject, wherein the artificially engineered stem cells are engineered HIF1AN a gene, wherein the sequence of the engineered HIF1AN gene does not include one or more sequences selected from the group consisting of SEQ ID NOs: 1 to 9, and in the engineered stem cells, the expression level of FIH-1 is higher than that of wild-type cells. Characterized in that it is lower, in the engineered stem cells, the expression level of HIF ⁇ is higher than in the wild-type cells.
  • the present specification provides an Alzheimer's disease treatment use of artificially engineered stem cells, wherein the Alzheimer's disease treatment use comprises administering a pharmaceutical composition comprising the artificially engineered stem cells as an active ingredient in a subject, wherein the artificial The engineered stem cells include: an engineered HIF1AN gene having an indel in the wild-type HIF1AN gene, wherein the sequence of the engineered HIF1AN gene is different from the sequence of the wild-type HIF1AN gene, wherein in the engineered stem cell , characterized in that the expression level of FIH-1 is lower than in wild-type cells, and in the engineered stem cells, the expression level of HIF ⁇ is higher than in the wild-type cells.
  • the administration of the pharmaceutical composition is characterized in that the pharmaceutical composition is directly injected into the brain tissue of the subject.
  • the brain tissue is characterized in that the hippocampus or CPu (caudate putamen).
  • the engineered HIF1AN gene is characterized in that the indel of the wild-type HIF1AN gene is located in the exon 1 region of the HIF1AN gene.
  • the artificially engineered stem cells are characterized in that the artificially engineered mesenchymal stem cells.
  • the present specification provides an Alzheimer's disease treatment use of artificially engineered stem cells, wherein the Alzheimer's disease treatment use comprises administering a pharmaceutical composition comprising the artificially engineered stem cells as an active ingredient in a subject, wherein the artificial The engineered stem cell includes the engineered HIF1AN gene, and the sequence of the engineered HIF1AN gene does not include one or more sequences selected from the group consisting of SEQ ID NOs: 1 to 9, and in the engineered stem cell, FIH-
  • the expression level of 1 is characterized in that it is lower than in the wild-type cells, and in the engineered stem cells, the expression level of HIF ⁇ is higher than in the wild-type cells.
  • an artificially engineered stem cell for manufacturing a therapeutic agent for Alzheimer's disease
  • the artificially engineered stem cell comprising: an engineered HIF1AN gene having an indel in a wild-type HIF1AN gene, wherein the The sequence of the engineered HIF1AN gene is different from the sequence of the wild-type HIF1AN gene, wherein in the engineered stem cell, the expression level of FIH-1 is lower than that in the wild-type cell, and in the engineered stem cell , characterized in that the expression level of HIF ⁇ is higher than that of the wild-type cells.
  • the Alzheimer's disease therapeutic agent is characterized in that the dosage form for brain tissue administration.
  • the brain tissue is characterized in that the hippocampus or CPu (caudate putamen).
  • the indel of the wild-type HIF1AN gene is characterized in that it is located in the exon 1 region of the HIF1AN gene.
  • the artificially engineered stem cells are characterized in that the artificially engineered mesenchymal stem cells.
  • the present specification provides the use of artificially engineered stem cells for manufacturing a therapeutic agent for Alzheimer's disease, wherein the artificially engineered stem cells include an engineered HIF1AN gene, and the sequence of the engineered HIF1AN gene is SEQ ID NO: It does not contain one or more sequences selected from the group consisting of 1 to 9, and in the engineered stem cells, the expression level of FIH-1 is lower than in wild-type cells, and in the engineered stem cells, The expression level of HIF ⁇ is characterized in that it is higher than that of the wild-type cells.
  • the present application may provide a stable and effective Alzheimer's disease therapeutic agent or therapeutic pharmaceutical composition and a Alzheimer's disease treatment method using the same.
  • the present application relates to a pharmaceutical composition for relieving or treating Alzheimer's disease symptoms including mesenchymal stem cells (MSC) containing one or more knocked-out HIF1AN genes, which have high adaptability or viability in a hypoxic environment, as an active ingredient can provide
  • MSC mesenchymal stem cells
  • 1 is experimental data confirming whether or not genetic manipulation is performed after treatment with a composition for genetic manipulation targeting a part of the nucleotide sequence of the hHIF1AN gene. Specifically, the indel (InDel) generation rate was confirmed when the guide nucleic acid was changed.
  • Figure 2 shows the screening of cells suitable for this experiment through deep sequencing after treating the hHIF1AN gene manipulation composition to MSC.
  • FIG. 3 is data comparing mRNA expression levels transcribed from HIF1AN gene in cells selected through deep sequencing in FIG. 2 using qRT-PCR.
  • SFM serum free medium
  • 5 is a schematic diagram of an in-vivo experiment targeting C57BL/6 and 5xFAD mice.
  • FIG. 6 is a graph showing the experimental results of measuring the viability of MSCs in which the HIF1AN gene is knocked out by qPCR in an in-vivo experiment targeting C57BL/6 mice.
  • FIG. 7 is a graph showing the experimental results of measuring the viability of MSCs in which the HIF1AN gene is knocked out by qPCR in an in-vivo experiment targeting 5xFAD mice.
  • the term “about” refers to a reference amount, level, value, number, frequency, percent, dimension, size, amount, weight or length of 30, 25, 20, 25, 10, 9, 8, 7 , means an amount, level, value, number, frequency, percent, dimension, size, amount, weight or length varying by 6, 5, 4, 3, 2 or 1%.
  • the symbols A, T, C, G and U are interpreted as meanings understood by those of ordinary skill in the art. It may be properly interpreted as a base, a nucleoside, or a nucleotide on DNA or RNA according to context and technology.
  • nucleoside when it means a base, it can be interpreted as adenine (A), thymine (T), cytosine (C), guanine (G), or uracil (U) itself, respectively, and when it means a nucleoside, Can be interpreted as adenosine (A), thymine (T), cytidine (C), guanosine (G) or uridine (U), respectively, and if it means a nucleotide in the sequence, it includes each of the above nucleosides should be construed as meaning a nucleotide that
  • engineered is a term used to distinguish substances, molecules, etc. having a composition already existing in nature, and means that artificial modifications are applied to the substances, molecules, etc.
  • engineered gene it refers to a gene in which an artificial change has been made to the composition of a gene existing in nature.
  • the term includes all meanings recognized by those skilled in the art, and may be appropriately interpreted according to the context.
  • Wild-type means that a gene comprising a naturally occurring nucleotide sequence and a protein expressed from the gene have normal functional properties. Wild-type genes are most frequently observed in the population. If the term "wild-type” is used herein in reference to an artificially engineered (engineered) gene, and/or cell, it means an artificially engineered gene, and/or non-artificially engineered gene, and/or a homologous "non-artificially engineered” cell. "It can be interpreted to mean a gene containing a naturally occurring nucleotide sequence and a cell having the same. In addition, the term includes all meanings recognized by those skilled in the art, and may be appropriately interpreted according to the context.
  • knockout or “knockout gene” means that the protein expressed by the wild-type gene cannot be produced through transcription and/or translation.
  • a cell comprising the knocked-out gene A may not express the mRNA and/or protein expressed by the wild-type gene A.
  • the cell including the knocked-out gene A may be one in which only one of the genes A present in the cell is knocked out, or two or more genes are knocked out.
  • the term includes all meanings recognized by those skilled in the art, and may be appropriately interpreted according to the context.
  • the expression “knockdown” or “knockdown gene” means expressing a substance in an amount smaller than that of a wild-type gene.
  • a cell comprising the knocked down gene A may express a smaller amount of mRNA than the mRNA expressed by the wild-type gene A.
  • a cell in which the A gene is knocked down may be one in which only one of the genes A present in the cell is knocked down, or two or more genes are knocked down.
  • the term includes all meanings recognized by those skilled in the art, and may be appropriately interpreted according to the context.
  • the term “expression level” refers to how well expressed products such as mRNA and/or protein from a particular gene are expressed. In general, when the expression level of a specific gene in a cell is high, the amount of mRNA and/or a specific protein expressed from the specific gene contained in the cell, or the concentration of the expression product in the cytoplasm is high. Conversely, when the expression level of a specific gene in a cell is low, the amount of mRNA and/or a specific protein expressed from the specific gene included in the cell, or the concentration of the expression product in the cytoplasm is low.
  • the comparison target when “expression level is high” or “expression level is low”, the comparison target may be interpreted as a homogeneous, wild-type cell, unless the comparison target is otherwise specified.
  • quantitative indicators serving as comparative standards should be interpreted as most appropriate in context. For example, an absolute amount, a relative amount, and/or a concentration of each cell may be a comparison criterion, but is not limited thereto.
  • the expression product (mRNA, protein, etc.) of the gene a in the first cell is The absolute amount, the relative amount, and/or the concentration may be higher than the expression product of the a gene in the cell.
  • the term includes all meanings recognized by those skilled in the art, and may be appropriately interpreted according to the context.
  • AD Alzheimer's disease
  • brain neurons neural cells
  • thinking abilities such as computational power, language ability, temporal and spatial comprehension, and judgment.
  • Alzheimer's disease is one of the chronic neurodegenerative diseases and accounts for 60-70% of the causes of dementia.
  • neuronal cell death is observed in the limbic pathway that commonly controls memory.
  • a probable cause of the progressive loss of cognitive function is the abnormal accumulation of A (Amyloid beta).
  • cells are administered directly to the site for the treatment of diseases or regeneration of damaged tissues or organs.
  • cells capable of expressing a therapeutic substance or cells having intact functions are used as the cells to be administered.
  • Cells administered to a specific site can achieve the above therapeutic or regenerative purpose by surviving for a long period of time at the site of administration and performing a normal function.
  • Stem cell therapy is a drug used for the purpose of treating, diagnosing, and preventing disease. Unlike classical drug therapy, stem cell therapy is a new type of cell therapy in which stem cells collected from the human body are manipulated outside the body and injected back into the patient. . It can be used for prevention, symptom relief, or treatment of intractable diseases through regeneration, repair, and recovery of damaged tissues and cells. Stem cells are attracting attention as therapeutic agents because they have the ability to self-renew and reduce the cumbersome treatment process or frequency, which is a problem with conventional gene therapy.
  • HIF1 Hydrophilia-Inducible Factor 1
  • HIF1 protein is a transcriptional regulator of a gene that plays a role in creating an environment in which cells can survive by being involved in angiogenesis, vascularization, and energy metabolism in a hypoxic environment.
  • HIF1 ⁇ and HIF1 there is HIF1 ⁇ and HIF1 are encoded by the HIF1A and HIF1B genes, respectively. Therefore, in order for cells to survive in a hypoxic environment, the expression level of the HIF1 protein or its subunits must be high or its activity must be maintained high.
  • FIH-1 is a protein encoded by the HIF1AN gene and is a protein involved in the post-translational control of HIF1 ⁇ . More specifically, FIH-1 is an Asparaginyl hydroxylase. FIH-1 plays a role in reducing the activity of HIF1 by interfering with the interaction between HIF1 ⁇ and the nuclear receptor activator p300/CBP. Since FIH-1 even works under severe hypoxia, it corresponds to a protein directly related to cell survival under hypoxic environment.
  • AD prevention and treatment agents using neurotoxic inhibitors such as production inhibitors or antioxidants have been developed.
  • ABT-418 currently a nicotin receptor agonist; Muscarin receptor agonist Xanomeline, YM-796; Desferrioxamine, Clioquinol, metal chelators; Aducanumab, Bapineuzumab, CAD106, Gantenerumab, Solanezumab, which are amyloid beta inhibitors; BACE( -site amyloid precursor protein cleaving enzyme) inhibitors AZD3293, E2609, JNJ-54861911, MK-8931; TRx-0237, a tau protein inhibitor; intranasal insulin; Pioglitazone, a PPAR- ⁇ receptor agonist; Although Nilvadipine, a dihydropyridine calcium channel blocker, is being developed, the effect is still to the extent of alleviating some pathological symptoms
  • a stem cell therapeutic agent for AD prevention and treatment.
  • a stem cell therapeutic agent for AD prevention and treatment.
  • the administered cells die quickly due to the environment specially maintained in the body.
  • a typical reason for cell death is that i) the environment cultured outside the body is different from the environment inside the body, or ii) the administered site in the body is maintained in a hypoxic environment (hypoxia). Therefore, in order to apply a stem cell therapeutic agent to the prevention and treatment of AD, it is required to solve the problem that the administered cells die in a hypoxic environment.
  • composition for treating Alzheimer's disease comprises
  • a pharmaceutical composition for treating Alzheimer's disease comprising artificially engineered stem cells as an active ingredient.
  • the pharmaceutical composition includes stem cells artificially engineered with wild-type HIF1AN gene.
  • the artificially engineered stem cells are characterized in that the expression level of mRNA and/or FIH-1 protein transcribed by the HIF1AN gene is lower than that of wild-type cells, whereby the intracellular HIF ⁇ expression level, and/or activity level It has a characteristic that is higher than that of wild-type cells.
  • the pharmaceutical composition for treating Alzheimer's disease disclosed herein may include a pharmaceutically acceptable carrier, etc. in addition to the artificially engineered stem cells, and may be variously formulated or formulated.
  • the pharmaceutical composition for treating Alzheimer's disease may include artificially engineered stem cells containing the engineered HIF1AN gene as an active ingredient.
  • the engineered HIF1AN gene may have an indel in the wild-type HIF1AN gene.
  • the sequence of the engineered HIF1AN gene may be different from the sequence of the wild-type HIF1AN gene.
  • the expression level of FIH-1 may be lower than in wild-type cells.
  • the expression level and/or activity level of HIF1 ⁇ may be lower than that of wild-type cells.
  • the artificially engineered stem cells disclosed herein are embryonic stem cells, neural stem cells, mesenchymal stem cells, adult stem cells, for example, fat, uterus, which have improved viability in a hypoxic environment. , bone marrow, liver, muscle, placenta, nerve, umbilical cord blood, or tissue-derived stem cells such as skin (epithelium). or induced pluripotent stem cells (iPSCs).
  • the artificially engineered stem cells may be mesenchymal stem cells (MSCs).
  • the artificially engineered stem cells may be mesenchymal stem cells derived from human Wharton's jelly.
  • the artificially engineered stem cells may be mesenchymal stem cells negative for CD34, and/or CD45 markers. In one embodiment, the artificially engineered stem cells may be mesenchymal stem cells positive for CD73, and/or CD90 markers.
  • a wild-type HIF1AN gene expressing a substance that inhibits transcription, expression, and/or activity of HIF1 protein is artificially edited.
  • the cell contains a HIF1AN gene engineered on a genomic sequence, and has a reduced ability to express a substance that inhibits the transcription, expression, and/or activity of the HIF1 protein in the cell.
  • the cell may comprise engineered HIF1AN.
  • the HIF1AN gene may be a human HIF1AN gene, but is not limited thereto.
  • the sequence of the engineered HIF1AN gene is different from the sequence of the wild-type HIF1AN gene.
  • the engineered HIF1AN gene is characterized in that it has a sequence different from that of the wild-type HIF1AN gene.
  • the engineered HIF1AN gene may not be able to express the material expressed by the unengineered wild-type HIF1AN gene.
  • the engineered HIF1AN gene may express a material expressed by the wild-type HIF1AN gene less than that of the wild-type gene. In this case, the material expressed by the wild-type HIF1AN gene may be FIH-1 protein.
  • the engineered HIF1AN gene may be a mutation of the wild-type HIF1AN gene.
  • the mutant form may be an artificially generated mutation, not a mutation already existing in nature.
  • the engineered HIF1AN gene may be a knock-out of the corresponding wild-type HIF1AN gene.
  • the engineered HIF1AN gene may be a knock-down of the corresponding wild-type HIF1AN gene.
  • the engineered HIF1AN gene may be one in which one or more nucleotides are inserted, deleted, substituted, and/or inverted compared to the corresponding wild-type HIF1AN gene.
  • the engineered HIF1AN gene may include an indel in the corresponding wild-type HIF1AN gene.
  • the indel is generated by a non-homologous end joining (NHEJ) mechanism in the cell, and one or more nucleotides in the wild-type gene may be inserted, deleted, and/or substituted by the NHEJ mechanism.
  • NHEJ non-homologous end joining
  • the expression "including an indel in the gene” refers to an insertion, deletion, and/or substitution of one or more nucleotides in the wild-type gene, and/or a result thereof.
  • the engineered A gene including an indel in the wild-type A gene may have one or more nucleotides inserted at any position of the wild-type A gene.
  • the engineered A gene including an indel in the wild-type A gene may have one or more nucleotides deleted at any position in the wild-type A gene.
  • the engineered A gene including an indel in the wild-type A gene may be one in which one or more nucleotides at any position in the wild-type A gene are substituted with another.
  • the artificially engineered stem cell is characterized in that a wild-type HIF1AN gene expressing a substance that inhibits transcription, expression, and/or activity of HIF1 protein has been artificially edited, which is characterized in that one or more regions within the wild-type HIF1AN gene are engineered means it has been At this time, the engineered region in the wild-type HIF1AN gene is not particularly limited as long as it can achieve the above object.
  • the artificially engineered stem cell may have an exon region, an intron region, and/or a regulatory region in the wild-type HIF1AN gene edited.
  • the artificially engineered stem cell is a wild-type HIF1AN gene, in which one or more regions selected from exon 1, exon 2, exon 3, exon 4, exon 5, t, and exon N are artificially edited, engineered HIF1AN gene.
  • N is an arbitrary integer.
  • the artificially engineered stem cell is a wild-type HIF1AN gene in which one or more regions selected from intron 1, intron 2, intron 3, intron 4, intron 5, t, and intron M are artificially edited, engineering HIF1AN gene.
  • M is an arbitrary integer.
  • the cell may include an engineered HIF1AN gene in which the exon 1 region in the wild-type HIF1AN gene is artificially edited.
  • the artificially engineered stem cells provided herein may be artificially edited one or more sequences selected from SEQ ID NOs: 1 to 9 in the HIF1AN gene.
  • the artificially engineered stem cell may include an engineered HIF1AN gene, and the engineered HIF1AN gene sequence may not include one or more sequences selected from SEQ ID NOs: 1 to 9. In other words, a sequence identical to one or more sequences selected from SEQ ID NOs: 1 to 9 among the sequences of the engineered HIF1AN gene may not exist.
  • the wild-type HIF1AN gene expressing a substance that inhibits the expression of HIF1 protein is artificially engineered, so that the wild-type HIF1AN gene cannot express the substance expressed by the wild-type HIF1AN gene, or it expresses less. characterized in that Therefore, the expression level of the negative regulator of HIF1 expression in the cells is reduced than in the wild-type cells.
  • the substance inhibiting the expression of the HIF1 protein may be the FIH-1 protein.
  • the artificially engineered stem cell is characterized in that it has an engineered HIF1AN gene having an indel in the wild-type HIF1AN gene, and the mRNA sequence expressed in the engineered HIF1AN gene is expressed in the wild-type HIF1AN gene. It may be different from the sequence of the mRNA.
  • the artificially engineered stem cell is characterized in that it has an engineered HIF1AN gene having an indel in the wild-type HIF1AN gene, and the mRNA sequence expressed in the engineered HIF1AN gene is expressed in the wild-type HIF1AN gene.
  • the expression level of the mRNA expressed in the engineered HIF1AN gene is higher than the expression level of the mRNA expressed in the wild-type HIF1AN gene in the wild-type cell. can be low
  • the artificially engineered stem cells may be cells in which the amount of mRNA expressed from the HIF1AN gene is reduced. In one embodiment, in the artificially engineered stem cells, the expression level of mRNA expressed from the HIF1AN gene may be lower than in wild-type cells.
  • the concentration of mRNA and/or FIH-1 expressed from HIF1AN contained in the cell is a wild-type cell May be lower than the concentrations contained within.
  • the expression level of mRNA and/or FIH-1 expressed from HIF1AN in the cell is in the wild-type cell may be lower than the expression level.
  • the artificially engineered stem cells have a mRNA expression level from the wild-type HIF1AN gene of about 0.9 times, about 0.85 times, about 0.8 times, about 0.75 times, about 0.7 times, about 0.65 times, about 0.6 times, about 0.55 times, about 0.5 times, about 0.45 times, about 0.4 times, about 0.35 times, about 0.3 times, about 0.25 times, about 0.2 times, about 0.15 times, about 0.10 times, about 0.05 times , about 0.04 times, about 0.03 times, about 0.02 times, or about 0.01 times or less.
  • the artificially engineered stem cells may exhibit mRNA expression levels within the two numerical ranges selected in the previous sentence compared to wild-type cells. For example, the artificially engineered stem cells may exhibit an mRNA expression level of about 0.6 to about 0.7 times that of wild-type cells.
  • the artificially engineered stem cells have a FIH-1 expression level of about 0.9 times, about 0.85 times, about 0.8 times, about 0.75 times, about 0.7 times, about 0.65 times, about 0.6 compared to the wild-type cells. times, about 0.55 times, about 0.5 times, about 0.45 times, about 0.4 times, about 0.35 times, about 0.3 times, about 0.25 times, about 0.2 times, about 0.15 times, about 0.10 times, about 0.05 times, about 0.04 times, about 0.03 times, about 0.02 times, or about 0.01 times or less.
  • the artificially engineered stem cells may exhibit FIH-1 expression levels within the two numerical ranges selected in the previous sentence compared to wild-type cells. For example, the artificially engineered stem cells may exhibit a FIH-1 expression level of about 0.6-fold to about 0.7-fold compared to wild-type cells.
  • the cells having high adaptability under a hypoxic environment disclosed herein have a high level of intracellular HIF1 ⁇ expression or high activity of HIF1 ⁇ .
  • the cells having a high adaptability to the hypoxic environment may have a higher HIF1 ⁇ expression level than the wild-type cells.
  • the HIF1 ⁇ expression level may be the amount and/or concentration of HIF1 ⁇ in the cell, but is not limited thereto.
  • the cells having a high adaptability to the hypoxic environment may exhibit a higher activity of HIF1 ⁇ than the wild-type cells.
  • the artificially engineered stem cells have a HIF1 ⁇ expression level of about 1.1 times, about 1.2 times, about 1.3 times, about 1.4 times, about 1.5 times, about 1.6 times, about 1.7 times compared to wild-type cells. , about 1.8 times, about 1.9 times, about 2.0 times, about 2.1 times, about 2.2 times, about 2.3 times, about 2.4 times, about 2.5 times, about 2.6 times, about 2.7 times, about 2.8 times, about 2.9 times, or about 3.0 times or more.
  • the artificially engineered stem cells may exhibit HIF1 ⁇ expression levels within the two numerical ranges selected in the immediately preceding sentence compared to wild-type cells.
  • the artificially engineered stem cells may exhibit a HIF1 ⁇ expression level of about 1.1 to about 1.5 times that of wild-type cells.
  • the artificially engineered stem cells have an activity level of HIF1 ⁇ of about 1.1 times, about 1.2 times, about 1.3 times, about 1.4 times, about 1.5 times, about 1.6 times, about 1.7 times compared to wild-type cells. , about 1.8 times, about 1.9 times, about 2.0 times, about 2.1 times, about 2.2 times, about 2.3 times, about 2.4 times, about 2.5 times, about 2.6 times, about 2.7 times, about 2.8 times, about 2.9 times, or about 3.0 times or more.
  • the artificially engineered stem cells may exhibit HIF1 ⁇ activity levels within the two numerical ranges selected in the immediately preceding sentence compared to wild-type cells. For example, the artificially engineered stem cells may exhibit a HIF1 ⁇ activity level of about 1.1 times to about 1.5 times that of wild-type cells.
  • the artificially engineered stem cells may be cultured in a hypoxic environment.
  • the artificially engineered stem cells may be pre-conditioned in a hypoxic environment in vitro or in vivo. At this time, by pre-conditioning in a hypoxic environment, it can have higher adaptability or viability in a hypoxic environment.
  • the artificially engineered stem cells disclosed herein are characterized by showing improved adaptability or viability in a hypoxic environment.
  • the "low oxygen environment” means in a gaseous environment containing a low concentration of oxygen (O 2 ).
  • the artificially engineered stem cells disclosed herein are characterized in that they survive for a longer period of time than the wild-type cells in a hypoxic environment.
  • the hypoxic environment is about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, or about 21% or less of O 2 percent concentration.
  • the eggplant may mean a gaseous environment.
  • the hypoxic environment may be an environment that artificially mimics the hypoxic environment.
  • the hypoxic environment may be an environment in which reactive oxidative stress (ROS) commonly occurring in the hypoxic environment is artificially induced by treating H 2 O 2 .
  • ROS reactive oxidative stress
  • the number of surviving cells with high adaptability under the hypoxic environment is the number of surviving wild-type cells About 1.01 times, about 1.02 times, about 1.03 times, about 1.04 times, about 1.05 times, about 1.06 times, about 1.07 times, about 1.08 times, about 1.09 times, about 1.1 times, about 1.15 times, about 1.2 times, about 1.25 times, about 1.3 times, about 1.35 times, about 1.4 times, about 1.45 times, about 1.5 times, about 1.55 times, about 1.6 times, about 1.65 times, about 1.7 times, about 1.75 times, about 1.8 times , about 1.85 times, about 1.9 times, about 1.95 times, about 2.0 times, about 2.1 times, about 2.2 times, about 2.3 times, about 2.4 times, about 2.5 times, about 2.6 times, about 2.7 times, about 2.8 times, about 2.9 times, about 3.0 times,
  • the number of surviving artificially engineered stem cells may be a number within two numerical ranges selected in the immediately preceding sentence compared to the number of surviving wild-type cells.
  • the number of surviving artificially engineered stem cells may be about 1.5 to about 2.5 times the number of surviving wild-type cells.
  • the predetermined time is about 10 minutes, about 30 minutes, about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 6 hours, about 8 hours, about 12 hours, about 24 hours, about 48 hours, about 72 hours, about 98 hours, about 120 hours, about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, or about a month or more.
  • the predetermined time may be a period within two numerical ranges selected in the immediately preceding sentence. For example, the predetermined time may be about 3 hours to about 12 hours.
  • the pharmaceutical composition for treating Alzheimer's disease may further include a pharmaceutically acceptable carrier in addition to the artificially engineered stem cells.
  • the pharmaceutically acceptable carrier is a lubricant, wetting agent, sweetening agent, flavoring agent, emulsifying agent, suspending agent, preservative, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin , calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, saline, PBS (phosphate) buffered saline) and/or medium, but is not limited thereto.
  • parenteral administration includes nasal administration, eye drop administration, intravenous injection, intramuscular injection, intraperitoneal injection, transdermal administration, subcutaneous injection, intravenous injection, intramuscular injection, brain tissue injection, hippocampus injection, caudate putamen ( CPu) intra-injection, intra-articular injection, intra-chondral injection, or intrathoracic injection, etc., but are not limited thereto.
  • the active ingredient cells in order to formulate the pharmaceutical composition into a formulation for parenteral administration, may be mixed with water together with a stabilizer or buffer to prepare a solution or suspension. Furthermore, it can be prepared in ampoules or vial unit dosage form.
  • the pharmaceutical composition may contain adjuvants such as preservatives, stabilizers, wetting agents or emulsification accelerators, salts and/or buffers for regulating osmotic pressure, and other therapeutically useful substances, according to conventional methods. It can be formulated according to phosphorus mixing, granulation or coating method.
  • the pharmaceutical composition for treating Alzheimer's disease is generally used in a method of direct or indirect administration to brain tissue.
  • the stem cells which are the active ingredients of the pharmaceutical composition, are subjected to a hypoxic environment in the brain tissue. Therefore, in the case of general stem cells, since they are easily killed in a hypoxic environment, it is difficult to see the therapeutic effect even when used for the treatment of Alzheimer's disease.
  • the engineered stem cells which are the active ingredients of the pharmaceutical composition for treating Alzheimer's disease provided by the present invention, are characterized by being able to survive better in a hypoxic environment, and thus survive longer when administered to brain tissue to treat the intended treatment.
  • the advantage is that it can be effective.
  • the pharmaceutical composition may be used for preventing, alleviating symptoms, and/or treating Alzheimer's disease.
  • the present specification provides an artificially engineered stem cell, or a method for treating Alzheimer's disease using a pharmaceutical composition comprising the artificially engineered stem cell as an active ingredient.
  • the Alzheimer's disease treatment method comprises administering to a subject the artificially engineered stem cells, or a pharmaceutical composition comprising the artificially engineered stem cells as an active ingredient.
  • the pharmaceutical composition comprising the artificially engineered stem cells as an active ingredient is administered to a subject, it can provide a significant therapeutic effect while surviving for a long time in a hypoxic environment of the administration site.
  • the Alzheimer's disease treatment method may include administering a pharmaceutical composition comprising artificially engineered stem cells in a subject as an active ingredient.
  • the subject may be a human and/or an animal.
  • the administration of the pharmaceutical composition may be a direct injection of the pharmaceutical composition into the brain tissue of the subject.
  • the brain tissue may be the hippocampus or caudate putamen (CPu).
  • composition for treating Alzheimer's disease comprises
  • the Alzheimer's disease treatment method may include administering a pharmaceutical composition comprising artificially engineered stem cells as an active ingredient in a subject.
  • the pharmaceutical composition is the same as described in the paragraph "Pharmaceutical composition for treating Alzheimer's disease”.
  • the Alzheimer's disease treatment method is administered to a human, and/or an animal suffering from Alzheimer's disease.
  • the Alzheimer's disease treatment method may include administering a pharmaceutical composition comprising the artificially engineered stem cells as an active ingredient to humans and/or animals. In one embodiment, the Alzheimer's disease treatment method may include administering to a human a pharmaceutical composition comprising the artificially engineered stem cells as an active ingredient. In one embodiment, the Alzheimer's disease treatment method may include administering a pharmaceutical composition comprising the artificially engineered stem cells as an active ingredient to a human suffering from Alzheimer's disease.
  • the pharmaceutical composition comprising the artificially engineered stem cells as an active ingredient may be administered parenterally to the subject.
  • the Alzheimer's treatment method includes intravenous injection, intramuscular injection, intraperitoneal injection, transdermal administration, subcutaneous injection, intravenous injection, intramuscular injection, Injection into brain tissue, injection into the hippocampus, and/or injection into the caudate putamen (CPu) may include the process of administering to the subject.
  • the Alzheimer's treatment method directly injects a pharmaceutical composition comprising the artificially engineered stem cells as an active ingredient into the brain tissue, hippocampus, and/or caudate putamen (CPu) of the subject. ) may include
  • a suitable dosage of the pharmaceutical composition is determined by factors such as formulation method, administration mode, patient's age, weight, sex, medical condition, food, administration time, administration route, excretion rate, and response sensitivity. These vary, and an ordinarily skilled practitioner can readily determine and prescribe a dosage effective for the desired treatment or prophylaxis.
  • the pharmaceutical composition may be used alone or in combination with surgery, radiation therapy, hormone therapy, chemotherapy, a method using a biological response modifier, and/or an antibody treatment method.
  • the amount of amyloid beta accumulated in the subject's brain tissue may be reduced.
  • the amyloid beta may be insoluble or soluble amyloid beta.
  • the symptoms of Alzheimer's disease in the subject may be alleviated, the symptoms of Alzheimer's disease may be improved, the rate of progression of Alzheimer's disease may be alleviated, and/or Alzheimer's disease may be treated.
  • the artificially engineered stem cells can be prepared by introducing a composition for genetic manipulation of stem cells into stem cells, and adding a pharmaceutically acceptable carrier to the artificially engineered stem cells, or adding an appropriate adjuvant.
  • a pharmaceutical composition comprising artificially engineered stem cells as an active ingredient can be prepared.
  • composition for genetic manipulation of stem cells Composition for genetic manipulation of stem cells
  • composition comprising a CRISPR/Cas9 system that can be used to produce the artificially engineered stem cells.
  • the composition comprising the CRISPR/Cas9 system is designed to recognize and edit a target sequence in a suitable cell so as to display the genotype and/or phenotype of the artificially engineered stem cell.
  • the composition for genetic manipulation of stem cells may include a Cas9 protein or a DNA encoding the same, and a guide RNA or a DNA encoding the same.
  • the Cas9 protein may be a Cas9 protein derived from Streptococcus pyogenes.
  • the sequence of the guide RNA may be a sequence selected from the group consisting of SEQ ID NOs: 22 to 30.
  • the present specification discloses a method for producing the artificially engineered stem cells.
  • the method for producing the artificially engineered stem cells includes introducing the composition for genetic manipulation of stem cells into stem cells.
  • the genetic manipulation method may be performed on stem cells isolated from an organism in vitro or ex vivo.
  • the organism may be a human or an animal, but is not limited thereto.
  • the artificially engineered stem cell manufacturing method may include introducing a composition for genetic manipulation of stem cells into stem cells.
  • the composition for genetic manipulation of stem cells may be the one described in the paragraph "Composition for genetic manipulation of stem cells”.
  • the artificially engineered stem cell manufacturing method comprises introducing a composition for genetic manipulation of stem cells comprising ribonucleoprotein (RNP) to which Cas9 protein and guide RNA are bound into stem cells. can do.
  • the artificially engineered stem cell production method comprises introducing a composition for genetic manipulation of stem cells comprising DNA encoding a Cas9 protein and DNA encoding a guide RNA in the form of a single vector into stem cells can do.
  • Formulation and formulation of a pharmaceutical composition for treating Alzheimer's disease - known methods can be used
  • a pharmaceutically acceptable carrier is added to the artificially engineered stem cells, or an appropriate adjuvant is used. may be added, and/or formulated or formulated.
  • the method for preparing the pharmaceutical composition by adding or adding an appropriate substance to the active ingredient and treating it appropriately is not particularly limited as long as it does not impair the Alzheimer's disease treatment effect of the artificially engineered stem cells.
  • to prepare a pharmaceutical composition by adding a pharmaceutically acceptable carrier to the artificially engineered stem cells adding an appropriate adjuvant, and/or formulating or formulating a pharmaceutical composition to those skilled in the art. A known method can be used.
  • MSC derived from human Wharton's jelly was supplied and used from a GMP (Good Manufacturing Practice) facility in Samsung Seoul Hospital. MSCs were cultured in MEM alpha 1x media (Gibco, Rockville, MD) containing 10% FBS (fetal bovine serum, Gibco) and Gentamicin 0.05 mg/mL (Thermo Fisher Scientific) at 37°C and 5% CO2 conditions. .
  • MEM alpha 1x media Gibco, Rockville, MD
  • FBS fetal bovine serum, Gibco
  • Gentamicin 0.05 mg/mL Thermo Fisher Scientific
  • RNA was transcribed in vitro using MEGA short script T7 kit (Ambion) according to the manufacturer's instructions.
  • a template for sgRNA was prepared through annealing and extension of two complementary oligonucleotides.
  • the guide domain sequence of gRNA is shown in Table 1 below.
  • the sequence of the nucleotides (crRNA repeat sequence, linker (GAAA), and tracrRNA) linked to each guide domain is SEQ ID NO: 19.
  • the full-length sequence of the sgRNA is shown in Table 2 below.
  • MSCs were transduced with the Amaxa P1 Primary Cell 4D Nucleofector kit using Program EW-104 according to the manufacturer's instructions. Specifically, 4 x 10 5 cells were transduced with Cas9 protein (4 ⁇ g) premixed with ex vivo transcribed sgRNA (4 ⁇ g) after incubation at room temperature for 10 minutes.
  • Phusion polymerase (New England BioLabs) was used to amplify genomic DNA segments covering the target and potential non-target sites. Paired-end sequencing of the PCR amplicon products was performed using Illumina MiSeq.
  • mice C57BL/6, 7-8 weeks old
  • 2 ⁇ 10 5 cells (2 ⁇ 10 5 /5 ⁇ L) of human-derived mesenchymal stem cells were administered to the hippocampus of normal mice.
  • a stereotaxic device (Harvard apparatus, USA), after taking the coordinates based on bregma (A/P -2.06 mm, M/L -1.3 mm, and D/V -2.0 mm), the left side at a rate of 0.5 ⁇ L/min It was administered to the hippocampus.
  • stem cells without gene editing technology (naive MSC) and stem cells with gene editing technology applied but without a target gene (AAVS1 MSC) were administered.
  • PCR conditions were as follows: a total of 40 cycles, 95°C (10 min), 95°C (15 sec), 68°C (30 sec), and 72°C (30 sec).
  • a stereotaxic apparatus (Harvard apparatus, USA), after taking the coordinates based on bregma (A/P -2.06 mm, M/L ⁇ 1.3 mm, and D/V -2.0 mm), the left side at a rate of 0.5 ⁇ L/min and the right hippocampus.
  • bregma A/P -2.06 mm, M/L ⁇ 1.3 mm, and D/V -2.0 mm
  • PCR conditions were as follows: a total of 40 cycles, 95°C (10 min), 95°C (15 sec), 68°C (30 sec), and 72°C (30 sec).
  • Stem cells were administered to the hippocampus of an Alzheimer's disease mouse in the same manner as in Experimental Example 3-3, and 2 weeks later, the Alzheimer's disease mouse was euthanized by coronary perfusion, and then the brain was extracted.
  • the extracted brain tissue was crushed using a medicine bowl, and then soluble protein was extracted.
  • To extract the soluble protein the crushed brain tissue was dissolved in homogenization buffer (20mM Tris pH 7.4, 250 mM sucrose, 1mM EDTA, 1mM EGTA, 1 ⁇ protease inhibitor cocktail) and centrifuged at 10,000 g at 4°C for 1 hour. The upper supernatant was separated and used for soluble protein detection.
  • a 42 ELISA Kit (Thermo Scientific, USA) was used to determine the difference in the expression of amyloid protein in each sample. Soluble A 2 ⁇ g of each sample was used to confirm expression.
  • HIF1AN K/O stem cells showed improved viability under hypoxic environment, and when administered to brain tissue, it was confirmed that the amount of amyloid beta was significantly decreased, thereby confirming the therapeutic effect of Alzheimer's disease. . Since there is no proper cell therapy for Alzheimer's disease, the invention disclosed in the present application will be useful in the art as a symptom relief or therapeutic agent for Alzheimer's disease.
  • the present application provides a stable and effective Alzheimer's disease therapeutic agent or therapeutic pharmaceutical composition, and a Alzheimer's disease treatment method using the same.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Epidemiology (AREA)
  • Psychiatry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Hospice & Palliative Care (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Hematology (AREA)
  • Virology (AREA)
  • Rheumatology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

본 명세서는 저산소 조건에서 높은 적응력을 갖는 줄기세포(stem cell, SC)를 유효성분으로 하는 알츠하이머 병 치료용 약학적 조성물 및 이의 용도를 제공한다. 구체적으로, 본 명세서에서는 저산소환경에서 적응력 또는 생존력이 높은, 하나 이상의 넉아웃 된 HIF1AN 유전자를 포함하는 중간엽 줄기세포(mesenchymal stem cell, MSC)를 유효성분으로 포함하는 알츠하이머 병 증상완화 또는 치료용도의 약학적 조성물이 개시된다.

Description

알츠하이머 예방 또는 치료용 약학적 조성물 및 이의 용도
본 출원은 저산소 조건에서 높은 적응력을 갖는 줄기세포(stem cell, SC) 를 유효성분으로 하는 알츠하이머 병 치료용 약학적 조성물 및 이의 용도에 관한 것이다.
알츠하이머 병(Alzheimer's Disease, AD)은 학습이나 기억에 관계하는 대뇌의 뉴런(신경세포)이 죽음에 이름으로써 기억을 잃고, 계산력, 언어능력, 시공간 이해력, 그리고 판단력 등의 사고력이 점차 낮아지는 질환이다. 알츠하이머 병은 만성 신경퇴행성 질환의 하나로 치매(dementia)를 유발하는 원인의 60~70%를 차지하고 있다. 알츠하이머 병의 원인은 잘 알려져 있지 않으나, 공통적으로 기억을 관장하는 변연계 신경 경로(limbic pathway)에서 신경세포의 사멸이 관찰되는 소견을 보인다. AD 환자의 주요 특징인 인지 작용의 점진적 상실의 유력한 원인은 비정상적으로 축적된 A
Figure PCTKR2021000550-appb-I000001
(Amyloid beta)에 의한 것으로 보인다.
최근, 상기 알츠하이머 병의 치료에 있어서 줄기세포를 적용하고자 하는 시도가 있다.
줄기세포 치료제란 질병의 치료, 진단 및 예방의 목적으로 사용하는 의약품으로, 고전적 약물 치료와는 다르게 인체에서 채취한 줄기 세포를 체외에서 조작하여 환자에게 다시 주입하는 새로운 방식의 세포치료제의 한 종류이다. 손상된 조직 및 세포의 재생 및 복구, 회복을 통해 난치성 질환 등 예방, 증상완화 또는 치료에 사용될 수 있다. 줄기세포는 자가분열(self-renewal) 능력을 가져 기존의 유전자 치료의 문제인 번거로운 치료 과정 또는 횟수를 줄일 수 있기 때문에 치료제로서 각광을 받고 있다.
다만, 줄기세포를 이용한 치료는 면역 거부 반응, 다른 조직으로 이 동하여 엉뚱하게 분화하는 문제 그리고 줄기세포가 암세포로 변할 수 있는 문제 등을 가지고 있다. 뿐만 아니라, 환자에게 주입된 줄기세포가 안정적으로 생착하여 증식하는 효율이 낮은 문제도 가지고 있다.
[선행기술문헌]
[특허문헌] (특허문헌 0001) COMPOSITION FOR CLEAVING A TARGET DNA COMPRISING A GUIDE RNA SPECIFIC FOR THE TARGET DNA AND CAS PROTEIN-ENCODING NUCLEIC ACID OR CAS PROTEIN, AND USE THEREOF (International Publication Number WO 2014/065596 A1).
[비특허문헌] (비특허문헌 0001) Mahon PC, Hirota K, Semenza GL. FIH-1: a novel protein that interacts with HIF-1alpha and VHL to mediate repression of HIF-1 transcriptional activity. Genes Dev. 2001;15(20):2675-2686. doi:10.1101/gad.924501.
본 명세서에서는 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 알츠하이머 병 치료용 약학적 조성물을 제공하고자 한다.
본 명세서에서는 인위적으로 조작된 줄기세포 및/또는 상기 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 알츠하이머 병 치료용 약학적 조성물을 사용하는 알츠하이머 병 치료 방법을 제공하고자 한다.
본 명세서에서는 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 알츠하이머 병 치료용 약학적 조성물을 제조하는 방법을 제공하고자 한다.
본 명세서에서는 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 알츠하이머 병 치료용 약학적 조성물의 용도를 제공하고자 한다.
본 명세서에서는 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 알츠하이머 병 치료용 약학적 조성물을 제공하며, 상기 인위적으로 조작된 줄기세포는 다음을 포함한다: 야생형 HIF1AN 유전자 내에 인델을 가지는 엔지니어링 된 HIF1AN 유전자, 이때, 상기 엔지니어링 된 HIF1AN 유전자의 서열은 상기 야생형 HIF1AN 유전자의 서열과 다르고, 이때, 상기 조작된 줄기세포 내에서, FIH-1의 발현 수준은 야생형 세포에 비해 더 낮은 것을 특징으로 하고, 상기 조작된 줄기세포 내에서, HIFα의 발현 수준은 상기 야생형 세포에 비해 더 높은 것을 특징으로 함.
일 실시예로, 상기 엔지니어링 된 HIF1AN 유전자가 가진 인델은 상기 야생형 HIF1AN 유전자의 엑손 1 영역에 위치하는 것을 특징으로 한다.
일 실시예로, 상기 인위적으로 조작된 줄기세포는 인위적으로 조작된 중간엽 줄기세포인 것을 특징으로 한다.
일 실시예로, 상기 약학적 조성물은 뇌조직 투여용 제형인 것을 특징으로 한다.
일 실시예로, 상기 뇌조직은 해마 또는 CPu(caudate putamen)인 것을 특징으로 한다.
본 명세서에서는 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 알츠하이머 병 치료용 약학적 조성물을 제공하며, 상기 인위적으로 조작된 줄기세포는 엔지니어링 된 HIF1AN 유전자를 포함하고, 이때, 상기 엔지니어링 된 HIF1AN 유전자의 서열은 서열번호 1 내지 9로 이뤄진 군에서 선택된 하나 이상의 서열을 포함하지 않고, 상기 조작된 줄기세포 내에서, FIH-1의 발현 수준은 야생형 세포에 비해 더 낮은 것을 특징으로 하고, 상기 조작된 줄기세포 내에서, HIFα의 발현 수준은 상기 야생형 세포에 비해 더 높은 것을 특징으로 한다.
본 명세서에서는 다음을 포함하는 알츠하이머 병 치료 방법을 제공한다: 대상 내에 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 약학적 조성물을 투여하는 것, 이때, 상기 인위적으로 조작된 줄기세포는 야생형 HIF1AN 유전자 내에 인델을 가지는 엔지니어링 된 HIF1AN 유전자를 포함하고, 상기 엔지니어링 된 HIF1AN 유전자의 서열은 야생형 HIF1AN 유전자의 서열과 다르고, 이때, 상기 조작된 줄기세포 내에서, FIH-1의 발현 수준은 야생형 세포에 비해 더 낮은 것을 특징으로 하고, 상기 조작된 줄기세포 내에서, HIFα의 발현 수준은 상기 야생형 세포에 비해 더 높은 것을 특징으로 함.
일 실시예로, 상기 약학적 조성물의 투여는 상기 대상의 뇌 조직에 약학적 조성물을 직접 주입하는 것을 특징으로 한다.
일 실시예로, 상기 뇌 조직은 해마 또는 CPu(caudate putamen)인 것을 특징으로 한다.
일 실시예로, 상기 엔지니어링 된 HIF1AN 유전자가 가진 인델은 상기 야생형 HIF1AN 유전자의 엑손 1 영역에 위치하는 것을 특징으로 한다.
일 실시예로, 상기 인위적으로 조작된 줄기세포는 인위적으로 조작된 중간엽 줄기세포인 것을 특징으로 한다.
본 명세서에서는 다음을 포함하는 알츠하이머 병 치료 방법을 제공한다: 대상 내에 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 약학적 조성물을 투여하는 것, 이때, 상기 인위적으로 조작된 줄기세포는 엔지니어링 된 HIF1AN 유전자를 포함하고, 상기 엔지니어링 된 HIF1AN 유전자의 서열은 서열번호 1 내지 9로 이뤄진 군에서 선택된 하나 이상의 서열을 포함하지 않고, 상기 조작된 줄기세포 내에서, FIH-1의 발현 수준은 야생형 세포에 비해 더 낮은 것을 특징으로 하고, 상기 조작된 줄기세포 내에서, HIFα의 발현 수준은 상기 야생형 세포에 비해 더 높은 것을 특징으로 함.
본 명세서에서는 인위적으로 조작된 줄기세포의 알츠하이머 병 치료 용도를 제공하며, 상기 알츠하이머 병 치료 용도는 대상 내에 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 약학적 조성물을 투여하는 것을 포함하고, 상기 인위적으로 조작된 줄기세포는 다음을 포함한다: 야생형 HIF1AN 유전자 내에 인델을 가지는 엔지니어링 된 HIF1AN 유전자, 이때, 상기 엔지니어링 된 HIF1AN 유전자의 서열은 상기 야생형 HIF1AN 유전자의 서열과 다르고, 이때, 상기 조작된 줄기세포 내에서, FIH-1의 발현 수준은 야생형 세포에 비해 더 낮은 것을 특징으로 하고, 상기 조작된 줄기세포 내에서, HIFα의 발현 수준은 상기 야생형 세포에 비해 더 높은 것을 특징으로 함.
일 실시예로, 상기 약학적 조성물의 투여는 상기 대상의 뇌 조직에 약학적 조성물을 직접 주입하는 것을 특징으로 한다.
일 실시예로, 상기 뇌 조직은 해마 또는 CPu(caudate putamen)인 것을 특징으로 한다.
일 실시예로, 상기 엔지니어링 된 HIF1AN 유전자는 상기 야생형 HIF1AN 유전자가 가지는 인델은 상기 HIF1AN 유전자의 엑손 1 영역에 위치하는 것을 특징으로 한다.
일 실시예로, 상기 인위적으로 조작된 줄기세포는 인위적으로 조작된 중간엽 줄기세포인 것을 특징으로 한다.
본 명세서에서는 인위적으로 조작된 줄기세포의 알츠하이머 병 치료 용도를 제공하며, 상기 알츠하이머 병 치료 용도는 대상 내에 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 약학적 조성물을 투여하는 것을 포함하고, 상기 인위적으로 조작된 줄기세포는 엔지니어링 된 HIF1AN 유전자를 포함하고, 상기 엔지니어링 된 HIF1AN 유전자의 서열은 서열번호 1 내지 9로 이뤄진 군에서 선택된 하나 이상의 서열을 포함하지 않고, 상기 조작된 줄기세포 내에서, FIH-1의 발현 수준은 야생형 세포에 비해 더 낮은 것을 특징으로 하고, 상기 조작된 줄기세포 내에서, HIFα의 발현 수준은 상기 야생형 세포에 비해 더 높은 것을 특징으로 한다.
본 명세서에서는 인위적으로 조작된 줄기세포의 알츠하이머 병 치료제를 제조하기 위한 용도를 제공하며, 상기 인위적으로 조작된 줄기세포는 다음을 포함한다: 야생형 HIF1AN 유전자 내에 인델을 가지는 엔지니어링 된 HIF1AN 유전자, 이때, 상기 엔지니어링 된 HIF1AN 유전자의 서열은 상기 야생형 HIF1AN 유전자의 서열과 다르고, 이때, 상기 조작된 줄기세포 내에서, FIH-1의 발현 수준은 야생형 세포에 비해 더 낮은 것을 특징으로 하고, 상기 조작된 줄기세포 내에서, HIFα의 발현 수준은 상기 야생형 세포에 비해 더 높은 것을 특징으로 함.
일 실시예로, 상기 알츠하이머 병 치료제는 뇌조직 투여용 제형인 것을 특징으로 한다.
일 실시예로, 상기 뇌조직은 해마 또는 CPu(caudate putamen)인 것을 특징으로 한다.
일 실시예로, 상기 야생형 HIF1AN 유전자가 가지는 인델은 상기 HIF1AN 유전자의 엑손 1 영역에 위치하는 것을 특징으로 한다.
일 실시예로, 상기 인위적으로 조작된 줄기세포는 인위적으로 조작된 중간엽 줄기세포인 것을 특징으로 한다.
본 명세서에서는 인위적으로 조작된 줄기세포의 알츠하이머 병 치료제를 제조하기 위한 용도를 제공하며, 이때, 상기 인위적으로 조작된 줄기세포는 엔지니어링 된 HIF1AN 유전자를 포함하고, 상기 엔지니어링 된 HIF1AN 유전자의 서열은 서열번호 1 내지 9로 이뤄진 군에서 선택된 하나 이상의 서열을 포함하지 않고, 상기 조작된 줄기세포 내에서, FIH-1의 발현 수준은 야생형 세포에 비해 더 낮은 것을 특징으로 하고, 상기 조작된 줄기세포 내에서, HIFα의 발현 수준은 상기 야생형 세포에 비해 더 높은 것을 특징으로 한다.
본 출원은 안정적이고 효과적인 알츠하이머 병 치료제 또는 치료용도 약학적 조성물 및 이를 이용한 알츠하이머 병 치료방법을 제공할 수 있다.
본 출원은 저산소환경에서 적응력 또는 생존력이 높은, 하나 이상의 넉아웃 된 HIF1AN 유전자를 포함하는 중간엽 줄기세포(mesenchymal stem cell, MSC)를 유효성분으로 포함하는 알츠하이머 병 증상완화 또는 치료용도의 약학적 조성물을 제공할 수 있다.
도 1은 hHIF1AN 유전자의 뉴클레오타이드 서열 일부를 타겟으로 하는 유전자 조작용 조성물을 처리한 뒤, 유전자 조작 여부를 확인한 실험데이터이다. 구체적으로, 가이드 핵산을 달리한 때 인델(InDel) 발생비율을 확인한 것이다.
도 2는 hHIF1AN 유전자 조작용 조성물을 MSC에 처리한 뒤, deep sequencing 을 통해 본 실험에 적합한 세포를 스크리닝 한 것이다.
도 3은 도 2에서 deep sequencing을 통해 선별된 세포 내에서 HIF1AN 유전자 로부터 전사되는 mRNA 발현량을 qRT-PCR을 이용하여 비교한 자료이다.
도 4는 저산소의 상황에서 흔히 발생하는 산화적 스트레스(reactive oxidative stress; ROS)를 과산화수소 (hydrogen peroxide; H₂O₂) 로 유도하여 MSC의 증식 능력 변화를 측정한 실험 결과로서, CCK-8 assay를 통해 생존 세포된 세포의 수를 측정한 그래프이다. 본 자료에서 SFM이란 serum free medium을 의미한다.
도 5는 C57BL/6 그리고 5xFAD 마우스를 대상으로 하는 in-vivo 실험을 도식화한 것이다.
도 6은 C57BL/6 마우스를 대상으로 하는 in-vivo 실험에서 HIF1AN 유전자가 넉 아웃 된 MSC의 생존량을 qPCR로 측정한 실험결과를 나타낸 그래프이다.
도 7은 5xFAD 마우스를 대상으로 하는 in-vivo 실험에서 HIF1AN 유전자가 넉아웃 된 MSC의 생존량을 qPCR로 측정한 실험결과를 나타낸 그래프이다.
도 8은 5xFAD 마우스를 대상으로 하는 in-vivo 실험에서 대조군 (naive/AAVS1)에 비해 HIF1AN K/O 줄기세포를 투여한 그룹에서 soluble A
Figure PCTKR2021000550-appb-I000002
발현이 감소하였는지 확인한 그래프이다.
이하, 첨부된 도면을 참조하여, 발명의 내용을 특정한 구현예와 예시들을 통해 더욱 상세하게 설명한다. 상기 첨부된 도면은 발명의 일부 구현예를 포함하지만, 모든 구현예를 포함하고 있지는 않다는 점에 유의해야 한다. 본 명세서에 의해 개시되는 발명의 내용은 다양하게 구현될 수 있으며, 여기에 설명되는 특정 구현예로 제한되지 않는다. 이러한 구현예들은 본 명세서에 적용되는 법적 요건을 만족시키기 위해 제공되는 것으로 보아야 한다. 본 명세서에 개시된 발명이 속한 기술분야에 있어 통상의 기술자라면, 본 명세서에 개시된 발명의 내용에 대한 많은 변형 및 다른 구현예들을 떠올릴 수 있을 것이다. 따라서, 본 명세서에서 개시된 발명의 내용은 여기에 기재된 특정 구현예로 제한되지 않으며, 이에 대한 변형 및 다른 구현예들도 청구범위 내에 포함되는 것으로 이해되어야 한다.
용어의 정의
약
본 명세서에서 사용되는 "약"이라는 용어는 참조 양, 수준, 값, 수, 빈도, 퍼센트, 치수, 크기, 양, 중량 또는 길이에 대해 30, 25, 20, 25, 10, 9, 8, 7, 6, 5, 4, 3, 2 또는 1% 정도로 변하는 양, 수준, 값, 수, 빈도, 퍼센트, 치수, 크기, 양, 중량 또는 길이를 의미한다.
A, T, C, G, 및 U의 의미
본 명세서에서 사용되는 A, T, C, G 및 U 기호는 당업계 통상의 기술자가 이해하는 의미로 해석된다. 문맥 및 기술에 따라 DNA 또는 RNA 상에서 염기, 뉴클레오사이드 또는 뉴클레오타이드로 적절히 해석될 수 있다. 예를 들어, 염기를 의미하는 경우는 각각 아데닌(A), 티민(T), 시토신(C), 구아닌(G) 또는 우라실(U) 자체로 해석될 수 있고, 뉴클레오사이드를 의미하는 경우는 각각 아데노신(A), 티민(T), 시티딘(C), 구아노신(G) 또는 유리딘(U)으로 해석될 수 있으며, 서열에서 뉴클레오타이드를 의미하는 경우는 상기 각각의 뉴클레오사이드를 포함하는 뉴클레오타이드를 의미하는 것으로 해석되어야 한다.
엔지니어링 된
본 명세서에서 사용되는 "엔지니어링 된"이란 용어는 자연계에 이미 존재하는 구성을 가진 물질, 분자 등과 구분하기 위해 사용하는 용어로, 상기 물질, 분자 등에 인위적인 변형이 가해진 것을 의미한다. 예를 들어, "엔지니어링 된 유전자"의 경우, 자연계에 존재하는 유전자의 구성에 인위적인 변경이 가해진 유전자를 의미한다. 또한, 상기 용어는 당업계 통상의 기술자가 인식할 수 있는 의미를 모두 포함하며, 문맥에 따라 적절히 해석될 수 있다.
야생형의
"야생형"은 자연적으로 발생하는 염기서열을 포함하는 유전자 및 그 유전자로부터 발현되는 단백질이 정상적인 기능적 특성을 지니는 것을 의미한다. 야생형 유전자는 집단에서 가장 빈번하게 관찰된다. 본 명세서에서 "야생형"이라는 용어가 인위적으로 조작된(엔지니어링 된) 유전자, 및/또는 세포와 대비해 사용된다면, 이는 인위적으로 조작된 유전자, 및/또는 세포와 상응하는 동종의 "인위적으로 조작되지 않은" 자연적으로 발생하는 염기서열을 포함하는 유전자 및 이를 가지는 세포를 의미하는 것으로 해석될 수 있다. 또한, 상기 용어는 당업계 통상의 기술자가 인식할 수 있는 의미를 모두 포함하며, 문맥에 따라 적절히 해석될 수 있다.
넉아웃(knock-out)
본 명세서에서 사용되는 "넉아웃", 혹은 "넉아웃된 유전자"라는 표현은, 야생형 유전자가 발현하는 단백질을 전사 및/또는 번역 과정을 거쳐 생성하지 못하는 것을 의미한다. 예를 들어, 넉아웃된 유전자 A를 포함하는 세포는 야생형 유전자 A에 의해 발현되는 mRNA 및/또는 단백질을 발현하지 못하는 것 일 수 있다. 넉아웃 된 A 유전자를 포함하는 세포란 세포 내 존재하는 유전자 A 중 하나 만 넉아웃 된 것일 수 있고, 두 개 이상 넉아웃 된 것일 수 있다. 또한, 상기 용어는 당업계 통상의 기술자가 인식할 수 있는 의미를 모두 포함하며, 문맥에 따라 적절히 해석될 수 있다.
넉다운(knock-down)
본 명세서에서 사용되는 "넉다운", 혹은 "넉다운 된 유전자" 라는 표현은, 야생형 유전자보다 적은 양으로 물질을 발현하는 것을 의미한다. 예를들어, 넉다운된 유전자 A를 포함하는 세포는 야생형 유전자 A 에 의해 발현되는 mRNA보다 적은 양의 mRNA를 발현하는 것일 수 있다. A 유전자가 넉다운된 세포란 세포 내 존재하는 유전자 A 중 하나만 넉다운 된 것일 수 있고, 두 개 이상 넉다운 된 것일 수 있다. 또한, 상기 용어는 당업계 통상의 기술자가 인식할 수 있는 의미를 모두 포함하며, 문맥에 따라 적절히 해석될 수 있다.
발현 수준(expression level)
본 명세서에서 사용되는 "발현 수준"이라는 용어는, 특정 유전자로부터 발현된 산물, 예를 들어 mRNA 및/또는 단백질이 얼마나 잘 발현되는지를 의미한다. 일반적으로 세포 내 특정 유전자의 발현 수준이 높은 경우, 세포 내에 포함된 상기 특정 유전자로부터 발현된 mRNA 및/또는 특정 단백질의 양, 또는 세포질 내 상기 발현 산물의 농도가 높은 것으로 나타난다. 반대로 세포 내 특정 유전자의 발현 수준이 낮은 경우, 세포 내에 포함된 상기 특정 유전자로부터 발현된 mRNA 및/또는 특정 단백질의 양, 또는 세포질 내 상기 발현 산물의 농도가 낮은 것으로 나타난다. 본 명세서에서 "발현 수준이 높다" 혹은 "발현 수준이 낮다"고 쓰는 경우, 비교 대상이 달리 명시되지 않는 한, 그 비교 대상은 동종의, 야생형의 세포라고 해석할 수 있다. 또한, 비교 기준이 되는 정량적인 지표는 문맥 상 가장 적합한 것으로 해석되어야 한다. 예를 들어, 각 세포의 절대량, 상대량, 및/또는 농도가 비교 기준이 될 수 있으나, 이에 제한되는 것은 아니다. 예를 들어, 제1 세포 내에서 a 유전자의 발현 수준이, 제2 세포 내에서 a 유전자의 발현 수준보다 높다고 표현하는 경우, 제1 세포 내의 a 유전자의 발현 산물(mRNA, 단백질 등)이 제2 세포 내의 a 유전자의 발현 산물보다 절대량이 더 많거나, 상대량이 더 많거나, 및/또는 농도가 더 높을 수 있다. 또한, 상기 용어는 당업계 통상의 기술자가 인식할 수 있는 의미를 모두 포함하며, 문맥에 따라 적절히 해석될 수 있다.
배경기술 - 알츠하이머 병
알츠하이머병(Alzheimer's Disease, AD)은 학습이나 기억에 관계하 는 대뇌의 뉴런(신경세포)이 죽음에 이름으로써 기억을 잃고, 계산력, 언어능력, 시공간 이해력, 그리고 판단력 등의 사고력이 점차 낮아지는 질환이다. 알츠하이머 병은 만성 신경퇴행성 질환의 하나로 치매(dementia)를 유발하는 원인의 60~70%를 차지하고 있다. 알츠하이머 병의 원인은 잘 알려져 있지 않으나, 공통적으로 기억 을 관장하는 변연계 신경 경로(limbic pathway)에서 신경세포의 사멸이 관찰되는 소견을 보인다. AD 환자의 주요 특징인 인지 작용의 점진적 상실의 유력한 원인은 비정상적으로 축적된 A
Figure PCTKR2021000550-appb-I000003
(Amyloid beta)에 의한 것으로 보인다.
배경기술 - 세포 치료제
세포 치료제의 개념
최근에 질병의 치료, 진단 및 예방 등의 목적으로 세포를 치료제로서 사용하는 방법이 주목되고 있다. 일반적으로 질병의 치료 또는 망가진 조직이나 기관의 재생을 위하여 그 해당부위에 직접 세포를 투여한다. 투여되는 세포로서 치료물질을 발현할 수 있는 세포 또는 본래 기능을 온전히 가지는 세포를 사용한다. 특정 부위에 투여된 세포는 투여된 부위에서 오랜 기간 생존하여 정상적인 기능을 수행함으로써 상기 치료 또는 재생 목적을 달성할 수 있다.
줄기세포 치료제
줄기세포 치료제란 질병의 치료, 진단 및 예방의 목적으로 사용하는 의약품으로, 고전적 약물 치료와는 다르게 인체에서 채취한 줄기 세포를 체외에서 조작하여 환자에게 다시 주입하는 새로운 방식의 세포치료제의 한 종류이다. 손상 된 조직 및 세포의 재생 및 복구, 회복을 통해 난치성 질환 등 예방, 증상완화 또 는 치료에 사용될 수 있다. 줄기세포는 자가분열(self-renewal) 능력을 가져 기존의 유전자 치료의 문제인 번거로운 치료 과정 또는 횟수를 줄일 수 있기 때문에 치료 제로서 각광을 받고 있다.
다만, 줄기세포를 이용한 치료는 면역 거부 반응, 다른 조직으로 이동하여 엉뚱하게 분화하는 문제 그리고 줄기세포가 암세포로 변할 수 있는 문제 등을 가지고 있다. 뿐만 아니라, 환자에게 주입된 줄기세포가 안정적으로 생착하여 증식하는 효율이 낮은 문제도 가지고 있다.
배경기술 - HIF1 단백질 및 그 활성을 저해하는 인자
HIF1 단백질
저산소환경에서 놓인 세포는 생존하기 위하여 다량의 HIF1(Hypoxia- Inducible Factor 1) 단백질을 발현한다는 사실이 알려져 있다. HIF1 단백질이란 저산소 환경에서 혈관신생(angiogenesis, vascularization), 에너지대사(energy metabolism) 등에 관여하여 세포가 생존할 수 있는 환경을 만드는 역할을 하는 유전자의 전사조절인자(transcriptional regulator)로서, 서브 유닛으로 HIF1α 및 HIF1
Figure PCTKR2021000550-appb-I000004
가 있다. HIF1α 및 HIF1
Figure PCTKR2021000550-appb-I000005
는 각각 HIF1A 및 HIF1B 유전자에 의하여 암호화된다. 따라서, 저산소 환경 하 세포가 생존하기 위해서는, HIF1 단백질, 또는 그 서브 유닛들의 발현 수준이 높거나, 그 활성이 높게 유지되어야 한다.
HIF1 단백질 활성을 저해하는 인자 - FIH1
FIH-1은 HIF1AN 유전자에 의하여 암호화된 단백질이고 HIF1α의 post-translational control에 관여하는 단백질이다. 보다 구체적으로 FIH-1은 Asparaginyl hydroxylase이다. FIH-1은 HIF1α와 핵수용체활성화인자인 p300/CBP 사이에 상호작용하는 것을 방해함으로써 HIF1의 활성을 감소시키는 역할을 한다. 심지어 FIH-1는 심한 저산소 환경(severe hypoxia) 하에서도 작동(working)하므로 저산소환경하에서 세포의 생존과 직결된 단백질에 해당한다.
종래 기술의 한계점
현재까지 AD에 관한 연구는, 주로 세크레타제 저해제와 같은 A
Figure PCTKR2021000550-appb-I000006
생성 억제제 또는 항산화제 같은 신경세포 독성 저해제들을 이용한 AD 예방 및 치료 제가 개발되었다. 현재 Nicotin receptor agonist인 ABT-418; Muscarin receptor agonist인 Xanomeline, YM-796; Metal chelator인 Desferrioxamine, Clioquinol; 아밀로이드베타 억제제인 Aducanumab, Bapineuzumab , CAD106, Gantenerumab, Solanezumab; BACE(
Figure PCTKR2021000550-appb-I000007
-site amyloid precursor protein cleaving enzyme) 억제제인 AZD3293, E2609, JNJ-54861911, MK-8931; Tau 단백질 억제제인 TRx-0237; Intranasal insulin; PPAR-γ 수용체 작용제인 Pioglitazone; dihydropyridine calcium channel blocker인 Nilvadipine 등이 개발되고 있으나, 아직 효과가 약간의 병리적 증상을 완화 또는 진행 정도를 늦추는 정도로 생겨 미미하거나 자체의 독성 때문에 실제 적용이 어려운 물질이 대부분이어서 안정적이고 효과적인 AD 치료제의 개발이 시급하다.
최근, AD 예방 및 치료에 전술한 세포 치료제, 구체적으로 줄기세포 치료제를 도입하려는 시도가 있었다. 그러나, 체외에서 치료 등을 위한 세포를 선별하여 증식한 뒤, 상기 세포를 체내에 투여하는 경우, 체내에서 특수하게 유지되는 환경에 의하여 빠른 시일 내에 투여된 세포가 사멸하는 문제가 발생한다. 세포가 사멸하는 대표적인 이유는 i) 체외에서 배양되는 환경과 체내의 환경이 서로 다르거나, ii) 체내의 투여된 부위가 저산소환경(hypoxia)으로 유지되기 때문이다. 따라서, AD 예방 및 치료에 줄기세포 치료제를 적용하기 위해서는, 투여된 세포가 저산소환경 하 사멸하는 문제를 해결할 것이 요구된다.
알츠하이머 병 치료용 약학적 조성물
개괄
본 명세서에서는 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 알츠하이머 병 치료용 약학적 조성물을 개시한다. 상기 약학적 조성물은 야생형 HIF1AN 유전자가 인위적으로 조작된 줄기세포를 포함한다. 상기 인위적으로 조작된 줄기세포는 HIF1AN 유전자에 의해 전사되는 mRNA 및/또는 FIH-1 단백질의 발현 수준이 야생형 세포에 비해 낮은 것을 특징으로 하며, 이에 의해 세포 내 HIFα의 발현 수준, 및/또는 활성 수준이 야생형 세포에 비해 높다는 특징을 가진다. 본 명세서에서 개시되는 상기 알츠하이머 병 치료용 약학적 조성물은 상기 인위적으로 조작된 줄기세포 외에도 약학적으로 허용되는 담체 등을 포함할 수 있으며, 다양하게 제제화, 또는 제형화 된 것일 수 있다.
일 구현예로, 상기 알츠하이머 병 치료용 약학적 조성물은 엔지니어링 된 HIF1AN 유전자를 포함하는, 인위적으로 조작된 줄기세포를 유효성분으로 포함할 수 있다. 일 구현예로, 상기 엔지니어링 된 HIF1AN 유전자는 야생형의 HIF1AN 유전자 내에 인델을 가지는 것일 수 있다. 이때, 상기 엔지니어링 된 HIF1AN 유전자의 서열은 상기 야생형의 HIF1AN 유전자의 서열과 다를 수 있다. 일 구현예로, 상기 인위적으로 조작된 줄기세포 내에서, FIH-1의 발현 수준은 야생형 세포에 비해 더 낮을 수 있다. 일 구현예로, 상기 인위적으로 조작된 줄기세포 내에서, HIF1α의 발현 수준 및/또는 활성 수준은 야생형 세포에 비해 더 낮을 수 있다.
인위적으로 조작된 줄기세포 1 - 세포 종류
일 구현예로, 본 명세서에서 개시하는 인위적으로 조작된 줄기세포는 저산소환경에서 향상된 생존능(viability)을 가지는 배아 줄기세포, 신경 줄기세포, 중간엽 줄기세포, 성체 줄기세포, 예를 들면 지방, 자궁, 골수, 간, 근육, 태반, 신경, 제대혈 또는 피부(상피) 등의 조직 유래 줄기세포일 수 있다. 또는 유도 만능 줄기 세포(iPSC) 일 수 있다. 일 구현예로, 상기 인위적으로 조작된 줄기세포는 중간엽 줄기세포(mesenchymal stem cell, MSC)일 수 있다. 일 구현예로, 상기 인위적으로 조작된 줄기세포는 인간 와튼 젤리 유래 중간엽 줄기세포일 수 있다. 일 구현예로, 상기 인위적으로 조작된 줄기세포는 CD34, 및/또는 CD45 마커에 대해 음성인 중간엽 줄기세포일 수 있다. 일 구현예로, 상기 인위적으로 조작된 줄기세포는 CD73, 및/또는 CD90 마커에 대해 양성인 중간엽 줄기세포일 수 있다.
인위적으로 조작된 줄기세포 2 - 엔지니어링 된 HIF1AN 포함
상기 인위적으로 조작된 줄기세포에서는 HIF1 단백질의 전사, 발현, 및/또는 활성을 저해하는 물질을 발현하는 야생형 HIF1AN 유전자가 인위적으로 편집되어 있는 것을 특징으로 한다. 달리 표현해, 상기 세포는 게놈 서열 상에서 엔지니어링 된 HIF1AN 유전자를 포함하고, 세포 내 HIF1 단백질의 전사, 발현, 및/또는 활성을 저해하는 물질을 발현하는 기능이 감소되어 있다.
일 구현예로, 상기 세포는 엔지니어링 된 HIF1AN을 포함할 수 있다. 이때, 상기 HIF1AN 유전자는 인간 HIF1AN 유전자일 수 있으나, 이에 제한되는 것은 아니다. 이때, 상기 엔지니어링 된 HIF1AN 유전자의 서열은 야생형 HIF1AN 유전자의 서열과 다르다.
인위적으로 조작된 줄기세포 3 - 엔지니어링 된 HIF1AN의 특징
상기 엔지니어링 된 HIF1AN 유전자는 야생형의 HIF1AN 유전자와 다른 서열을 가지는 것을 특징으로 한다. 상기 엔지니어링 된 HIF1AN 유전자는 엔지니어링 되지 않은 야생형의 HIF1AN 유전자가 발현하는 물질을 발현하지 못할 수 있다. 상기 엔지니어링 된 HIF1AN 유전자는 야생형의 HIF1AN 유전자가 발현하는 물질을 야생형의 유전자에 비해 더 적게 발현할 수 있다. 이때, 상기 야생형의 HIF1AN 유전자가 발현하는 물질은 FIH-1 단백질일 수 있다.
일 구현예로, 상기 엔지니어링 된 HIF1AN 유전자는 야생형의 HIF1AN 유전자의 돌연변이(mutation) 형태일 수 있다. 이때, 상기 돌연변이 형태는 자연계에 이미 존재하는 돌연변이가 아닌, 인위적으로 생성된 돌연변이 일 수 있다.
일 구현예로, 상기 엔지니어링 된 HIF1AN 유전자는 이와 대응되는 야생형 HIF1AN 유전자가 넉아웃(knock-out) 된 것일 수 있다.
일 구현예로, 상기 엔지니어링 된 HIF1AN 유전자는 이와 대응되는 야생형 HIF1AN 유전자가 넉다운(knock-down) 된 것일 수 있다.
일 구현예로, 상기 엔지니어링 된 HIF1AN 유전자는 이와 대응되는 야생형 HIF1AN 유전자와 비교해 하나 이상의 뉴클레오타이드가 삽입, 결실, 치환, 및/또는 역위된 것일 수 있다.
일 구현예로, 상기 엔지니어링 된 HIF1AN 유전자는 이와 대응되는 야생형 HIF1AN 유전자 내에 인델을 포함하는 것일 수 있다. 이때, 상기 인델은 세포 내의 NHEJ(Non-homologous end joining) 메커니즘에 의해 발생하는 것으로, 상기 NHEJ 메커니즘에 의해 상기 야생형 유전자 내의 하나 이상의 뉴클레오타이드가 삽입, 결실, 및/또는 치환될 수 있다. 이때, 상기 "유전자 내에 인델을 포함한다"는 표현은 상기 야생형 유전자 내의 하나 이상의 뉴클레오타이드가 삽입, 결실, 및/또는 치환된 것, 및/또는 그 결과물을 일컫는다.
예를 들어, 야생형의 A 유전자 내에 인델을 포함하는, 엔지니어링 된 A 유전자는 상기 야생형의 A 유전자의 임의의 위치에 하나 이상의 뉴클레오타이드가 삽입된 것일 수 있다. 또 다른 예를 들어, 야생형의 A 유전자 내에 인델을 포함하는, 엔지니어링 된 A 유전자는 상기 야생형의 A 유전자 내 임의의 위치의 하나 이상의 뉴클레오타이드가 결실된 것일 수 있다. 또 다른 예를 들어, 야생형의 A 유전자 내에 인델을 포함하는, 엔지니어링 된 A 유전자는 상기 야생형의 A 유전자 내 임의의 위치의 하나 이상의 뉴클레오타이드가 다른 것으로 치환된 것일 수 있다.
인위적으로 조작된 줄기세포 4 - 엔지니어링 된 HIF1AN 영역
상기 인위적으로 조작된 줄기세포는 HIF1 단백질의 전사, 발현, 및/또는 활성을 저해하는 물질을 발현하는 야생형 HIF1AN 유전자가 인위적으로 편집된 것을 특징으로 하며, 이는 상기 야생형 HIF1AN 유전자 내의 하나 이상의 영역이 엔지니어링 된 것을 의미한다. 이때, 상기 야생형 HIF1AN 유전자 내의 엔지니어링 된 영역은 상기한 목적을 달성할 수 있는 영역이라면 특별히 제한되지 않는다.
일 구현예로, 상기 인위적으로 조작된 줄기세포는 상기 야생형 HIF1AN 유전자 내 엑손 영역, 인트론 영역 및/또는 조절 영역이 편집된 것일 수 있다.
일 구현예로, 상기 인위적으로 조작된 줄기세포는 야생형 HIF1AN 유전자의, 엑손 1, 엑손 2, 엑손 3, 엑손 4, 엑손 5, 쪋, 및 엑손 N에서 선택된 하나 이상의 영역이 인위적으로 편집된, 엔지니어링 된 HIF1AN 유전자를 포함할 수 있다. 이때, 상기 N은 임의의 정수이다. 일 구현예로, 상기 인위적으로 조작된 줄기세포는 야생형 HIF1AN 유전자의, 인트론 1, 인트론 2, 인트론 3, 인트론 4, 인트론 5, 쪋, 및 인트론 M에서 선택된 하나 이상의 영역이 인위적으로 편집된, 엔지니어링 된 HIF1AN 유전자를 포함할 수 있다. 이때, 상기 M은 임의의 정수이다.
일 구현예로, 상기 세포는 야생형의 HIF1AN 유전자 내의 엑손 1 영역이 인위적으로 편집된, 엔지니어링 된 HIF1AN 유전자를 포함할 수 있다.
인위적으로 조작된 줄기세포 5 - 엔지니어링 된 HIF1AN 서열 예시
일 구현예로, 본 명세서에서 제공하는 인위적으로 조작된 줄기세포는 HIF1AN 유전자 내 서열번호 1 내지 9에서 선택된 하나 이상의 서열이 인위적으로 편집된 것일 수 있다. 일 구현예로, 상기 인위적으로 조작된 줄기세포는 엔지니어링 된 HIF1AN 유전자를 포함하고, 상기 엔지니어링 된 HIF1AN 유전자의 서열은 서열번호 1 내지 9에서 선택된 하나 이상의 서열을 포함하지 않을 수 있다. 달리 표현해, 상기 엔지니어링 된 HIF1AN 유전자의 서열 중 서열번호 1 내지 9에서 선택된 하나 이상의 서열과 일치하는 서열은 존재하지 않을 수 있다.
인위적으로 조작된 줄기세포 6 - 엔지니어링 된 HIF1AN의 발현 산물
본 명세서에서 개시하는 인위적으로 조작된 줄기세포는, HIF1 단백질의 발현을 저해하는 물질을 발현하는 야생형 HIF1AN 유전자가 인위적으로 조작되어, 상기 야생형 HIF1AN 유전자가 발현하는 물질을 발현하지 못하거나, 더 적게 발현하는 것을 특징으로 한다. 따라서, 상기 세포는 HIF1 단백질의 발현을 저해하는 물질(negative regulator of HIF1 expression)의 발현량이 야생형의 세포보다 감소되어 있다. 이때, 상기 HIF1 단백질의 발현을 저해하는 물질(negative regulator of HIF1 expression)은 FIH-1 단백질일 수 있다.
일 구현예로, 상기 인위적으로 조작된 줄기세포는 야생형 HIF1AN 유전자 내에 인델을 가지는, 엔지니어링 된 HIF1AN 유전자를 가지는 것을 특징으로 하며, 상기 엔지니어링 된 HIF1AN 유전자에서 발현되는 mRNA의 서열은 상기 야생형 HIF1AN 유전자에서 발현되는 mRNA의 서열과 상이할 수 있다. 일 구현예로, 상기 인위적으로 조작된 줄기세포는 야생형 HIF1AN 유전자 내에 인델을 가지는, 엔지니어링 된 HIF1AN 유전자를 가지는 것을 특징으로 하며, 상기 엔지니어링 된 HIF1AN 유전자에서 발현되는 mRNA의 서열은 상기 야생형 HIF1AN 유전자에서 발현되는 mRNA의 서열과 동일하고, 이때, 상기 인위적으로 조작된 줄기세포 내에서, 상기 엔지니어링 된 HIF1AN 유전자에서 발현되는 mRNA의 발현 수준은 야생형 세포 내의, 야생형 HIF1AN 유전자에서 발현되는 mRNA의 발현 수준에 비해 더 낮을 수 있다.
일 구현예로, 상기 인위적으로 조작된 줄기세포는 HIF1AN 유전자로부터 발현되는 mRNA 양이 감소된 세포일 수 있다. 일 구현예로, 상기 인위적으로 조작된 줄기세포 내에서, HIF1AN 유전자로부터 발현되는 mRNA의 발현 수준은 야생형 세포에 비해 더 낮을 수 있다.
일 구현예로, 상기 인위적으로 조작된 줄기세포는 HIF1AN 유전자 내에 인델을 가지는, 엔지니어링 된 HIF1AN 유전자를 포함할 때, 상기 세포 내 포함된 HIF1AN으로부터 발현되는 mRNA 및/또는 FIH-1의 농도는 야생형 세포 내 포함된 농도보다 더 낮을 수 있다. 일 구현예로, 상기 인위적으로 조작된 줄기세포는 HIF1AN 유전자 내에 인델을 가지는, 엔지니어링 된 HIF1AN 유전자를 포함할 때, 상기 세포 내 HIF1AN으로부터 발현되는 mRNA 및/또는 FIH-1의 발현 수준은 야생형 세포 내 발현 수준보다 더 낮을 수 있다.
인위적으로 조작된 줄기세포 7 - 엔지니어링 된 HIF1AN의 발현 산물 관련 정량 지표 예시
일 구현예로, 상기 인위적으로 조작된 줄기세포는 야생형 HIF1AN 유전자로부터 발현되는 mRNA의 발현 수준이 야생형의 세포에 비해 약 0.9배, 약 0.85배, 약 0.8배, 약 0.75배, 약 0.7배, 약 0.65배, 약 0.6배, 약 0.55배, 약 0.5배, 약 0.45배, 약 0.4배, 약 0.35배, 약 0.3배, 약 0.25배, 약 0.2배, 약 0.15배, 약 0.10배, 약 0.05배, 약 0.04배, 약 0.03배, 약 0.02배, 또는 약 0.01배 이하일 수 있다. 일 구현예로, 상기 인위적으로 조작된 줄기세포는 야생형의 세포와 비교해 바로 이전 문장에서 선택된 두 수치범위 내의 mRNA 발현 수준을 나타낼 수 있다. 예를 들어, 상기 인위적으로 조작된 줄기세포는 야생형의 세포와 비교해 약 0.6배 내지 약 0.7배의 mRNA 발현 수준을 나타낼 수 있다.
일 구현예로, 상기 인위적으로 조작된 줄기세포는 FIH-1 발현 수준이 야생형의 세포에 비해 약 0.9배, 약 0.85배, 약 0.8배, 약 0.75배, 약 0.7배, 약 0.65배, 약 0.6배, 약 0.55배, 약 0.5배, 약 0.45배, 약 0.4배, 약 0.35배, 약 0.3배, 약 0.25배, 약 0.2배, 약 0.15배, 약 0.10배, 약 0.05배, 약 0.04배, 약 0.03배, 약 0.02배, 또는 약 0.01배 이하일 수 있다. 일 구현예로, 상기 인위적으로 조작된 줄기세포는 야생형의 세포와 비교해 바로 이전 문장에서 선택된 두 수치범위 내의 FIH-1 발현 수준을 나타낼 수 있다. 예를 들어, 상기 인위적으로 조작된 줄기세포는 야생형의 세포와 비교해 약 0.6배 내지 약 0.7배의 FIH-1 발현 수준을 나타낼 수 있다.
인위적으로 조작된 줄기세포 8 - HIFα 단백질 발현 수준
본 명세서에서 개시하는 저산소 환경 하 높은 적응력을 가지는 세포는 세포 내 HIF1α 발현 수준이 높거나, HIF1α의 활성이 높게 나타난다.
일 구현예로, 상기 저산소 환경 하 높은 적응력을 가지는 세포는 야생형의 세포에 비해 HIF1α 발현 수준이 높을 수 있다. 이때, 상기 HIF1α 발현 수준은 세포 내 HIF1α의 양, 및/또는 농도일 수 있으나, 이에 제한되는 것은 아니다.
일 구현예로, 상기 저산소 환경 하 높은 적응력을 가지는 세포는 야생형의 세포에 비해 HIF1α의 활성이 높게 나타날 수 있다.
인위적으로 조작된 줄기세포 9 - HIFα 단백질 발현 수준 관련 정량 지표 예시
일 구현예로, 상기 인위적으로 조작된 줄기세포는 HIF1α의 발현 수준이 야생형의 세포에 비해 약 1.1배, 약 1.2배, 약 1.3배, 약 1.4배, 약 1.5배, 약 1.6배, 약 1.7배, 약 1.8배, 약 1.9배, 약 2.0배, 약 2.1배, 약 2.2배, 약 2.3배, 약 2.4배, 약 2.5배, 약 2.6배, 약 2.7배, 약 2.8배, 약 2.9배, 또는 약 3.0배 이상일 수 있다. 일 구현예로, 상기 인위적으로 조작된 줄기세포는 야생형의 세포와 비교해 바로 이전 문장에서 선택된 두 수치범위 내의 HIF1α 발현 수준을 나타낼 수 있다. 예를 들어, 상기 인위적으로 조작된 줄기세포는 야생형의 세포와 비교해 약 1.1배 내지 약 1.5배의 HIF1α 발현 수준을 나타낼 수 있다.
일 구현예로, 상기 인위적으로 조작된 줄기세포는 HIF1α의 활성 수준이 야생형의 세포에 비해 약 1.1배, 약 1.2배, 약 1.3배, 약 1.4배, 약 1.5배, 약 1.6배, 약 1.7배, 약 1.8배, 약 1.9배, 약 2.0배, 약 2.1배, 약 2.2배, 약 2.3배, 약 2.4배, 약 2.5배, 약 2.6배, 약 2.7배, 약 2.8배, 약 2.9배, 또는 약 3.0배 이상일 수 있다. 일 구현예로, 상기 인위적으로 조작된 줄기세포는 야생형의 세포와 비교해 바로 이전 문장에서 선택된 두 수치범위 내의 HIF1α 활성 수준을 나타낼 수 있다. 예를 들어, 상기 인위적으로 조작된 줄기세포는 야생형의 세포와 비교해 약 1.1배 내지 약 1.5배의 HIF1α 활성 수준을 나타낼 수 있다.
인위적으로 조작된 줄기세포 10 - 세포 배양 환경
일 구현예로, 상기 인위적으로 조작된 줄기세포는 저산소환경에서 배양된 것 일 수 있다. 일 구현예로, 상기 인위적으로 조작된 줄기세포는 in vitro 또는 in vivo 상의 저산소환경에서 pre-conditioning 된 것 일 수 있다. 이 때, 저산소환경에서 pre-conditioning 함으로써 저산소환경 하에서 더 높은 적응력 또는 생존력을 갖게될 수 있다.
인위적으로 조작된 줄기세포의 특징 1 - 저산소 환경 하 높은 생존율
본 명세서에서 개시하는 인위적으로 조작된 줄기세포는 저산소 환경에서 개선된 적응력, 또는 생존력을 보이는 것을 특징으로 한다. 이때, "저산소 환경"이란 낮은 농도의 산소(O2)를 포함하는 기체환경 하에 있는 것을 의미한다. 결과적으로, 상기 인위적으로 조작된 줄기세포가 살아있는 유기체(예를 들어, 인간)의 체내에 주입되는 경우, 개선된 적응력 또는 생존력을 보인다.
일 구현예로, 본 명세서에서 개시하는 인위적으로 조작된 줄기세포는 저산소 환경 하 야생형의 세포보다 더 오랜 기간 생존하는 것을 특징으로 한다.
인위적으로 조작된 줄기세포의 특징 2 - 저산소 환경 하 높은 생존율의 정량 지표 예시
일 구현예로, 상기 저산소 환경은 약 1%, 약 2%, 약 3%, 약 4%, 약 5%, 약 6%, 약 7%, 약 8%, 약 9%, 약 10%, 약 11%, 약 12%, 약 13%, 약 14%, 약 15%, 약 16%, 약 17%, 약 18%, 약 19%, 약 20%, 또는 약 21% 이하의 O2 퍼센트농도를 가지는 기체 환경을 의미할 수 있다. 일 구현예로, 상기 저산소 환경은 인위적으로 상기 저산소환경을 모방한(mimetic) 환경일 수 있다. 일 구현예로, 상기 저산소 환경은 H2O2를 처리하여 인위적으로 상기 저산소 환경에서 흔히 발생하는 산화적 스트레스(reactive oxidative stress; ROS)를 유도한 환경일 수 있다.
일 구현예로, 하나 이상의, 본 명세서에서 개시하는 인위적으로 조작된 줄기세포 및 야생형의 세포를 동일한 저산소 환경 하 일정 시간 두었을 때, 살아남은 상기 저산소 환경 하 높은 적응력을 가지는 세포의 수가 살아남은 상기 야생형의 세포의 수에 비해 약 1.01배, 약 1.02배, 약 1.03배, 약 1.04배, 약 1.05배, 약 1.06배, 약 1.07배, 약 1.08배, 약 1.09배, 약 1.1배, 약 1.15배, 약 1.2배, 약 1.25배, 약 1.3배, 약 1.35배, 약 1.4배, 약 1.45배, 약 1.5배, 약 1.55배, 약 1.6배, 약 1.65배, 약 1.7배, 약 1.75배, 약 1.8배, 약 1.85배, 약 1.9배, 약 1.95배, 약 2.0배, 약 2.1배, 약 2.2배, 약 2.3배, 약 2.4배, 약 2.5배, 약 2.6배, 약 2.7배, 약 2.8배, 약 2.9배, 약 3.0배, 약 4배, 약 5배, 또는 약 10배 이상일 수 있다. 일 구현예로, 상기 살아남은 인위적으로 조작된 줄기세포의 수는 상기 살아남은 야생형 세포의 수에 비해 바로 이전 문장에서 선택된 두 수치범위 이내의 숫자일 수 있다. 예를 들어, 상기 살아남은 인위적으로 조작된 줄기세포의 수는 상기 살아남은 야생형 세포 수의 약 1.5배 내지 약 2.5배일 수 있다.
일 구현예로, 상기 일정 시간은 약 10분, 약 30분, 약 1시간, 약 2시간, 약 3시간, 약 4시간, 약 6시간, 약 8시간, 약 12시간, 약 24시간, 약 48시간, 약 72시간, 약 98시간, 약 120시간, 약 1주, 약 2주, 약 3주, 약 4주, 또는 약 한 달 이상의 기간일 수 있다. 일 구현예로, 상기 일정 시간은 바로 이전 문장에서 선택된 두 수치범위 이내의 기간일 수 있다. 예를 들어, 상기 일정 시간은 약 3시간 내지 약 12시간일 수 있다.
약학적으로 허용되는 담체
일 구현예로, 본 명세서에서 제공하는 알츠하이머 병 치료용 약학적 조성물은 상기 인위적으로 조작된 줄기세포 외에 약학적으로 허용되는 담체를 더 포함할 수 있다. 이때, 상기 약학적으로 허용되는 담체는 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘, 미네랄 오일, 식염수, PBS(phosphate buffered saline) 및/또는 배지일 수 있으나, 이에 제한되지 않는다.
약학적 조성물의 제제
일 구현예로, 상기 약학적 조성물은 비경구 투여 형태로 제형화 될 수 있다. 이때, 비경구 투여는 비강 투여, 점안 투여, 정맥 내 주입, 근육 주입, 복강주입, 경피 투여, 피하주사, 정맥주사, 근육내 주사, 뇌조직 내 주사, 해마(hippocampus) 내 주사, caudate putamen(CPu) 내 주사, 관절 내 주사, 연골 내 주사 또는 흉부 내 주입하는 방법 등을 포함하나, 이에 제한되지 않는다.
일 구현예로, 상기 약학적 조성물을 비경구 투여용 제형으로 제제화하기 위하여 유효 성분인 세포를 안정제 또는 완충제와 함께 물에 혼합하여 용액 또는 현탁액으로 제조할 수 있다. 더 나아가 이를 앰플 또는 바이알 단위 투여형으로 제조할 수 있다. 일 구현예로, 상기 약학적 조성물은 방부제, 안정화제, 수화제 또는 유화 촉진제, 삼투압 조절을 위한 염 및/또 는 완충제 등의 보조제, 및 기타 치료적으로 유용한 물질을 함유할 수 있으며, 통상적인 방법인 혼합, 과립화 또는 코팅 방법에 따라 제제화 할 수 있다.
알츠하이머 병 치료용 약학적 조성물의 장점
본 명세서에서 제공하는 알츠하이머 병 치료용 약학적 조성물은 일반적으로 뇌 조직에 직접, 간접적으로 투여하는 방식으로 사용된다. 이때, 상기 약학적 조성물의 유효성분인 줄기세포는 상기 뇌 조직 내에서 저산소 환경에 처하게 된다. 따라서, 일반적인 줄기세포의 경우, 저산소 환경 내에서 쉽게 사멸하게 되므로, 알츠하이머 병 치료 용도로 사용되더라도 치료 효과를 보는 것이 힘들다.
이와 비교할 때, 본 발명에서 제공하는 알츠하이머 병 치료용 약학적 조성물의 유효성분인 조작된 줄기세포는 저산소 환경에서 더 잘 생존할 수 있는 것이 특징이므로, 뇌 조직에 투여되었을 때 더 오래 살아남아 의도하는 치료 효과를 낼 수 있는 것이 장점이다.
약학적 조성물의 용도
상기 약학적 조성물은 알츠하이머 병의 예방, 증상 완화, 및/또는 치료용 용도로 사용될 수 있다.
알츠하이머 병 치료 방법
개괄
본 명세서에서는 인위적으로 조작된 줄기세포, 또는 상기 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 약학적 조성물을 사용한 알츠하이머 병 치료 방법을 제공한다. 상기 알츠하이머 병 치료 방법은 상기 인위적으로 조작된 줄기세포, 또는 상기 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 약학적 조성물을 대상에 투여하는 것을 포함한다. 상기 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 약학적 조성물이 대상에게 투여되는 경우, 투여 부위의 저산소 환경에서 오랜 기간 생존하면서 현저한 치료효과를 제공할 수 있다.
일 구현예로, 상기 알츠하이머 병 치료 방법은 대상 내에 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 약학적 조성물을 투여하는 것을 포함할 수 있다. 일 구현예로, 상기 대상은 인간 및/또는 동물일 수 있다. 일 구현예로, 상기 약학적 조성물의 투여는 상기 대상의 뇌 조직에 약학적 조성물을 직접 주입하는 것일 수 있다. 이때, 상기 뇌 조직은 해마 또는 CPu(caudate putamen)일 수 있다.
알츠하이머 병 치료용 약학적 조성물
상기 알츠하이머 병 치료 방법은 대상 내에 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 약학적 조성물을 투여하는 것을 포함할 수 있다. 이때, 상기 약학적 조성물은 "알츠하이머 병 치료용 약학적 조성물" 단락에서 설명된 것과 동일한 것이다.
투여 대상
상기 알츠하이머 병 치료 방법은 알츠하이머 병을 앓고 있는 인간, 및/또는 동물을 투여 대상으로 한다.
일 구현예로, 상기 알츠하이머 병 치료 방법은 상기 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 약학적 조성물을 인간 및/또는 동물에 투여하는 것을 포함할 수 있다. 일 구현예로, 상기 알츠하이머 병 치료 방법은 상기 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 약학적 조성물을 인간에 투여하는 것을 포함할 수 있다. 일 구현예로, 상기 알츠하이머 병 치료 방법은 상기 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 약학적 조성물을 알츠하이머 병에 걸린 인간에 투여하는 것을 포함할 수 있다.
투여 부위 및 방법
상기 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 약학적 조성물은 대상에 비경구 투여될 수 있다. 일 구현예로, 상기 알츠하이머 치료 방법은 상기 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 약학적 조성물을 정맥 내 주입, 근육 주입, 복강주입, 경피 투여, 피하주사, 정맥주사, 근육내 주사, 뇌조직 내 주입, 해마(hippocampus) 내 주입, 및/또는 caudate putamen(CPu) 내 주입하는 방법으로 대상에 투여하는 과정을 포함할 수 있다. 일 구현예로, 상기 알츠하이머 치료 방법은 상기 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 약학적 조성물을 대상의 뇌조직, 해마(hippocampus), 및/또는 caudate putamen(CPu)에 직접 주입(injection)하는 것을 포함할 수 있다.
투여량
일 구현예로, 상기 약학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 소망하는 치료 또는 예방에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다.
병용 치료 방법 예시
일 구현예로, 상기 약학적 조성물은 단독으로, 또는 수술, 방사선 치료, 호르몬 치료, 화학 치료, 생물학적 반응 조절제를 사용하는 방법, 및/또는 항체 치료방법과 병용하여 사용할 수 있다.
알츠하이머 병 치료 방법 수행 결과
상기 알츠하이머 병 치료 방법 수행 결과, 대상의 뇌 조직에 축 적된 아밀로이드 베타의 양이 감소될 수 있다. 이때, 상기 아밀로이드 베타는 insoluble 또는 soluble 아밀로이드 베타일 수 있다. 그 결과 상기 알츠하이머 병 치료 방법 수행 결과, 대상의 알츠하이머 병의 증상이 완화되거나, 알츠하이머 병의 증상이 개선되거나, 알츠하이머 병의 진행 속도가 완화되거나, 및/또는 알츠하이머 병이 치료될 수 있다.
알츠하이머 병 치료용 약학적 조성물 제조 방법
개괄
이하, 본 명세서에서 개시하는 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 약학적 조성물의 제조 방법을 설명한다. 상기 인위적으로 조작된 줄기세포는 줄기세포 유전자 조작용 조성물을 줄기세포 내에 도입함으로써 제조될 수 있으며, 상기 인위적으로 조작된 줄기세포에 약학적으로 허용되는 담체를 첨가하거나, 적절한 어쥬번트(adjuvant)를 추가하거나, 및/또는 제형화 내지 제제화하여 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 약학적 조성물을 제조할 수 있다.
줄기세포 유전자 조작용 조성물
본 명세서에서는 상기 인위적으로 조작된 줄기세포를 제조하기 위해 사용할 수 있는, CRISPR/Cas9 시스템을 포함하는 조성물을 개시한다. 상기 CRISPR/Cas9 시스템을 포함하는 조성물은 상기 인위적으로 조작된 줄기세포의 유전자형, 및/또는 표현형을 나타낼 수 있도록, 적합한 세포 내 표적 서열을 인지하고 이를 편집할 수 있도록 설계된 것이다.
일 구현예로, 상기 줄기세포 유전자 조작용 조성물은 Cas9 단백질 또는 이를 암호화하는 DNA, 및 가이드 RNA 또는 이를 암호화하는 DNA를 포함할 수 있다. 이때, 상기 Cas9 단백질은 스트렙토코커스 피오게네스(Streptococcus pyogenes) 유래 Cas9 단백질일 수 있다. 이때, 상기 가이드 RNA의 서열은 서열번호 22 내지 30으로 이뤄진 군에서 선택된 서열일 수 있다.
인위적으로 조작된 줄기세포 제조 방법
본 명세서에서는 상기 인위적으로 조작된 줄기세포를 제조하는 방법을 개시한다. 상기 인위적으로 조작된 줄기세포를 제조하는 방법 상기 줄기세포 유전자 조작용 조성물을 줄기세포 내에 도입하는 과정을 포함한다.
일 구현예로, 상기 유전자 조작 방법은 생체외(in vitro)에서, 유기체에서 분리된 줄기세포에 대해(ex vivo) 수행될 수 있다. 이때, 상기 유기체는 인간 또는 동물일 수 있으나, 이에 제한되는 것은 아니다.
일 구현예로, 상기 인위적으로 조작된 줄기세포 제조 방법은 줄기세포 유전자 조작용 조성물을 줄기세포 내로 도입하는 것을 포함할 수 있다. 이때, 상기 줄기세포 유전자 조작용 조성물은 "줄기세포 유전자 조작용 조성물" 단락에서 설명된 것일 수 있다.
일 구현예로, 상기 인위적으로 조작된 줄기세포 제조 방법은, Cas9 단백질 및 가이드 RNA가 결합된 리보뉴클레오프로틴(ribonucleoprotein; RNP)을 포함하는 줄기세포 유전자 조작용 조성물을 줄기세포 내에 도입하는 것을 포함할 수 있다. 일 구현예로, 상기 인위적으로 조작된 줄기세포 제조 방법은, Cas9 단백질을 암호화하는 DNA 및 가이드 RNA를 암호화하는 DNA가 단일 벡터 형태로 포함된 줄기세포 유전자 조작용 조성물을 줄기세포 내에 도입하는 것을 포함할 수 있다.
알츠하이머 병 치료용 약학적 조성물 제형화 및 제제화 - 공지된 방법 사용 가능
상기 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 알츠하이머 병 치료용 약학적 조성물을 제조하기 위해, 상기 인위적으로 조작된 줄기세포에 약학적으로 허용되는 담체를 첨가하거나, 적절한 어쥬번트(adjuvant)를 추가하거나, 및/또는 제형화 내지 제제화 할 수 있다. 이때, 상기 유효성분에 적절한 물질을 첨가하거나 추가하고, 또 적절히 처리하여 약학적 조성물을 만드는 방법은, 상기 인위적으로 조작된 줄기세포의 알츠하이머 병 치료 효과를 해치지 않는 방법이라면 특별히 제한되지 않는다. 일 구현예로, 상기 인위적으로 조작된 줄기세포에 약학적으로 허용되는 담체를 첨가하거나, 적절한 어쥬번트(adjuvant)를 추가하거나, 및/또는 제형화 내지 제제화하여 약학적 조성물을 제조하기 위해 당업자에게 공지된 방법을 사용할 수 있다.
실험예
이하, 실험예 및 실시예를 통해 본 명세서가 제공하는 발명에 대해 더욱 상세히 설명한다. 이들 실시예는 오로지 본 명세서에 의해 개시되는 내용을 예시하기 위한 것으로, 본 명세서에 의해 개시되는 내용의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실험예 1 HIF1AN 넉아웃된 MSC의 제조
실험예 1-1 중간엽 줄기세포 배양
인간 와튼 젤리로부터 유래한 MSC는 삼성서울병원 내 GMP (Good Manufacturing Practice) 시설에서 공급받아 사용하였다. MSC는 10% FBS(fetal bovine serum, Gibco) 및 Gentamicin 0.05 mg/mL (Thermo Fisher Scientific) 이 포함되어 있는 MEM alpha 1x media (Gibco, Rockville, MD) 배지를 37℃및 5% CO2 조건하에서 배양하였다.
실험예 1-2 가이드 RNA 제조
RNA는 MEGA short script T7 kit (Ambion)를 이용하여 제조사의 지침에 따라 생체 외 전사하였다. sgRNA에 대한 주형 (template)은 두 상보적인 올리 고 뉴클레오티드의 결합 (annealing) 및 신장 (extension)을 통해 제조하였다. gRNA의 가이드 도메인 서열은 아래 표 1에 나타나있다.
Label Guide Domain (5' to 3') SEQ ID NO. PAM Indel (%) Target Sequence Location (Exon)
Sp-hHIF1AN sgRNA1 GAAGCUAUAACUGCGCAACU 10 GGG 51.8 1
Sp-hHIF1AN sgRNA2 GGAAGCUAUAACUGCGCAAC 11 UGG 9.5 1
Sp-hHIF1AN sgRNA3 GCAGUUAUAGCUUCCCGACU 12 AGG 14.3 1
Sp-hHIF1AN sgRNA4 GACGCGGAAUGGGCCUAGUC 13 GGG 2 1
Sp-hHIF1AN sgRNA5 AGACGCGGAAUGGGCCUAGU 14 CGG 7.3 1
Sp-hHIF1AN sgRNA6 CUCUGACUCAGACGCGGAAU 15 GGG 7.2 1
Sp-hHIF1AN sgRNA7 GGGUCGCUCUGACUCAGACG 16 CGG 20.6 1
Sp-hHIF1AN sgRNA8 GUCUGAGUCAGAGCGACCCC 17 CGG 26.5 1
Sp-hHIF1AN sgRNA9 CAAUAAGCUCCUCUGCCCGG 18 GGG 59.8 1
상기 각각의 가이드 도메인과 연결된 뉴클레오타이드(crRNA 반복 서열, 링커(GAAA), 및 tracrRNA)의 서열은 서열번호 19이다. 상기 sgRNA의 전장 서열은 아래 표 2에 나타나있다.
Label Guide RNA (5' to 3') SEQ ID NO.
Sp-hHIF1AN sgRNA1 GAAGCUAUAACUGCGCAACUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU 22
Sp-hHIF1AN sgRNA2 GGAAGCUAUAACUGCGCAACGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU 23
Sp-hHIF1AN sgRNA3 GCAGUUAUAGCUUCCCGACUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU 24
Sp-hHIF1AN sgRNA4 GACGCGGAAUGGGCCUAGUCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU 25
Sp-hHIF1AN sgRNA5 AGACGCGGAAUGGGCCUAGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU 26
Sp-hHIF1AN sgRNA6 CUCUGACUCAGACGCGGAAUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU 27
Sp-hHIF1AN sgRNA7 GGGUCGCUCUGACUCAGACGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU 28
Sp-hHIF1AN sgRNA8 GUCUGAGUCAGAGCGACCCCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU 29
Sp-hHIF1AN sgRNA9 CAAUAAGCUCCUCUGCCCGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU 30
실험예 1-3 CRISPR/Cas9 시스템의 MSC 내로의 형질도입 (Transfection)
MSC는 제조사의 지침에 따라 Program EW-104를 이용하여 Amaxa P1 Primary Cell 4D Nucleofector kit로 형질도입 하였다. 구체적으로, 4 x 105 개의 세포에 생체 외 전사된 sgRNA (4μg)와 함께 미리 혼합된 Cas9 단백질 (4μg)을 상온에서 10분동안 인큐베이션한 후 형질도입 하였다.
실험예 1-4 표적화 딥시퀀싱 (Targeted deep sequencing)
Phusion polymerase (New England BioLabs)를 이용하여 표적 및 잠 재적인 비표적 위치를 포괄하는 유전체 DNA 절편 (segment)을 증폭시켰다. Illumina MiSeq를 이용하여 상기 PCR 앰플리콘 산물을 쌍-말단 서열분석 (paired￢end sequencing)하였다.
이러한 결과를 통해, CRISPR/Cas9 시스템을 이용하여 성공적으로 HIF1AN 서열 내 인위적으로 인델(indel)을 도입시켰음을 확인하였다(도 1 및 도 2).
실험예 2 HIF1AN 넉아웃된 MSC의 생존율 (Viability) 측정
실험예 1에서 수득한 상기 HIF1AN 넉아웃된 MSC가 생존율 (viability)을 가지는지 확인하기 위해서, 저산소의 상황에서 흔히 발생하는 산화적 스트레스(reactive oxidative stress; ROS)로부터 MSC의 증식 능력 변화를 측정하였다. 산화적 스트레스 반응을 유도하는 H2O2(hydrogen peroxide)를 처리하기 24시 간 전 96 well plate의 각 well에 1Х104의 세포로 배양하였다. 24시간 후에 serum free 배지에 500 μM의 H2O2를 첨가하여 배양하였다. H2O2처리 72시간 후 세포의 생존율을 보기 위해 CCK-8 cell proliferation kit (Dojindo, Japan )를 이용하여 세포의 생존율을 측정하였다(도 4). 그 결과, 산화적 스트레스 반응을 유도하는 H2O2 (hydrogen peroxide)를 처리한 환경에서 상기 HIF1AN이 넉아웃된 MSC가 대조군보다 생존율이 향상되었음을 확인하였다.
실험예 3 HIF1AN 넉아웃(K/O)된 MSC의 알츠하이머 치료 효과
실험예 3-1 정상 마우스에 대해 MSC 투여
마우스 뇌 내부에 MSC 투여 후, 대조군과 HIF1AN K/O 줄기세포의 뇌내 잔존량 차이를 확인하고자 실험을 수행하였다. 동물 모델로서는 정상 마우스 (C57BL/6, 7-8 주령)를 사용하였다. 먼저, 2 Х 105 세포 수 (2 Х 105/5μL)의 인간 유래 중간엽 줄기세포를 정상 마우스의 해마에 투여하였다. Stereotaxic기기 (Harvard apparatus, USA) 를 이용하여, bregma를 기준으로 좌표를 잡은 후 (A/P -2.06 mm, M/L -1.3 mm, and D/V -2.0 mm) 0.5 μL/min 속도로 왼쪽 해마에 투여하였다. 대조군으로는 유전자 편집기술을 사용하지 않은 줄기세포 (naive MSC)와 유전자 편집 기술을 적용하되 타겟 유전자가 없는 줄기세포 (AAVS1 MSC)를 투여하였다.
실험예 3-2 정상 마우스에 투여한 세포의 잔존량 측정
투여 1주일 후에, 정상 마우스를 관동맥 관류로 안락사 시킨 후, 뇌를 적출하였다. 적출된 뇌조직을 균질기(homogenizer)를 사용해 파쇄한 후, Gentra puregene kit (QIAGEN, USA)를 사용하여 genomic DNA를 추출하였다. 마우스 뇌조직에서 인간 유래 줄기세포의 잔존량을 확인하기 위해 인간 특이적 DNA sequence를 검출할 수 있는 ALU element를 이용하여 real time PCR을 진행하였다. Primer 정보는 다음과 같다: ALU forward: 5' - CAT GGT GAA ACC CCG TCT CTA - 3' (서열번호 31), ALU reverse: 5' - GCC TCA GCC TCC CGA GTA G -3' (서열번호 32). Primer와 SYBR green master mix (Life Technologies, USA)를 섞은 혼합액에 각 샘플 DNA를 20ng씩 넣고 real time PCR을 진행하였다. PCR 조건은 다음과 같다: 총 40 cycles, 95°C (10 분), 95°C (15 초), 68°C (30 초), and 72°C (30 초).
그 결과 naive 그리고 AAVS1 대조군에 비해 HIF1AN K/O 줄기세포의 잔존량이 각각 8.9그리고 7.6배 더 높았다 (도 6).
실험예 3-3 알츠하이머 병 마우스 모델에 MSC 투여
마우스 뇌 내부에 MSC 투여 후, 대조군에 비해 HIF1AN K/O 줄기세포의 뇌내 잔존량 차이를 확인하고자 실험을 수행하였다. 동물 모델로서는 알츠하이머 병 마우스(5xFAD, 7-8 개월령)를 사용하였다. 먼저, 2 Х 105세포 수 (2 Х 105/5μL)의 인간 유래 중간엽 줄기세포를 알츠하이머 병 마우스인 5xFAD의 해마에 투여하였다. Stereotaxic기기 (Harvard apparatus, USA)를 이용하여, bregma를 기준으로 좌표를 잡은 후 (A/P -2.06 mm, M/L ±1.3 mm, and D/V -2.0 mm) 0.5 μL/min 속도로 왼쪽 및 오른쪽 해마에 투여하였다. 대조군으로는 유전자 편집기술을 사용하지 않은 줄기세포 (naive MSC)와 유전자 편집 기술을 적용하되 타겟 유전자가 없는 줄기세포 (AAVS1 MSC)를 투여하였다.
실험예 3-4 알츠하이머 병 마우스 모델에 투여한 세포의 잔존량 측정
투여 2주일 후에, 5xFAD 마우스를 관동맥 관류로 안락사 시킨 후, 뇌를 적출하였다. 적출된 뇌조직을 균질기 (homogenizer)를 사용해 파쇄한 후, Gentra puregene kit (QIAGEN, USA)를 사용하여 genomic DNA를 추출하였다. 마우스 뇌조직에서 인간 유래 줄기세포의 잔존량을 확인하기 위해 인간 특이적 DNA sequence를 검출할 수 있는 ALU element를 이용하여 real time PCR을 진행하였다. Primer 정보는 다음과 같다: ALU forward: 5' - CAT GGT GAA ACC CCG TCT CTA - 3' (서열번호 31), ALU reverse: 5' - GCC TCA GCC TCC CGA GTA G -3' (서열번호 32). Primer와 SYBR green master mix (Life technologies, USA)를 섞은 혼합액에 각 샘 플 DNA를 20ng씩 넣고 real time PCR을 진행하였다. PCR 조건은 다음과 같다: 총 40 cycles, 95°C (10 분), 95°C (15 초), 68°C (30 초), and 72°C (30 초).
그 결과 naive 그리고 AAVS1 대조군에 비해 HIF1AN K/O 줄기세포의 잔존량이 더 높았다 (도 7).
실험예 3-5 알츠하이머 병 마우스 모델에서 HIF1AN K/O 줄기세포의 치료 효과 분석
상기 실험예 3-3과 동일한 방법으로 줄기세포를 알츠하이머 병 마우스 해마에 투여한 뒤, 2주일 후에 알츠하이머 병 마우스를 관동맥 관류로 안락사 시킨 후, 뇌를 적출하였다. 적출된 뇌조직은 약사발을 사용해 파쇄한 후, soluble 단백질을 추출하였다. Soluble 단백질을 추출하기 위해 파쇄한 뇌조직을 homogenization buffer (20mM Tris pH 7.4, 250 mM sucrose, 1mM EDTA, 1mM EGTA, 1Хprotease inhibitor cocktail)에 용해한 후 4°C 10,000 g에 1시간 동안 원심 분리를 하였다. 위 상층액을 따로 분리하여 soluble 단백질 검출에 사용하였다. A
Figure PCTKR2021000550-appb-I000008
42 ELISA Kit (Thermo Scientific, USA)를 사용하여 각 샘플에서 아밀로이드 단백질의 발현 차이를 확인하였다. Soluble A
Figure PCTKR2021000550-appb-I000009
발현 여부를 확인하기 위해 각 샘플을 2μg 사용하였다.
그 결과, 대조군 (naive/AAVS1)에 비해 HIF1AN K/O 줄기세포를 투여한 그룹에서 soluble A
Figure PCTKR2021000550-appb-I000010
발현이 유의미하게 감소하였다(도 8).
이러한 결과들을 통해, HIF1AN K/O 줄기세포는 저산소환경 하에서 향상된 생존능을 보임을 확인하였고, 뇌조직에 투여하는 경우 아밀로이드 베타의 양이 유의미하게 감소함을 확인하여 알츠하이머 병 치료 효과가 있음을 확인하였다. 알츠하이머 병에 대해서는 아직 제대로 된 세포치료제가 없는 바, 앞으로 본 출원에서 개시된 발명은 당업계에서 알츠하이머 병 증상완화 또는 치료제로서 유용할 것이다.
본 출원은 안정적이고 효과적인 알츠하이머 병 치료제 또는 치료용도 약학적 조성물 및 이를 이용한 알츠하이머 병 치료방법을 제공한다.

Claims (24)

  1. 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 알츠하이머 병 치료용 약학적 조성물로,
    상기 인위적으로 조작된 줄기세포는 다음을 포함함:
    야생형 HIF1AN 유전자 내에 인델을 가지는 엔지니어링 된 HIF1AN 유전자,
    이때, 상기 엔지니어링 된 HIF1AN 유전자의 서열은 상기 야생형 HIF1AN 유전자의 서열과 다르고,
    이때, 상기 조작된 줄기세포 내에서, FIH-1의 발현 수준은 야생형 세포에 비해 더 낮은 것을 특징으로 하고,
    상기 조작된 줄기세포 내에서, HIFα의 발현 수준은 상기 야생형 세포에 비해 더 높은 것을 특징으로 함.
  2. 제 1항에 있어서, 상기 엔지니어링 된 HIF1AN 유전자가 가진 인델은 상기 야생형 HIF1AN 유전자의 엑손 1 영역에 위치하는 것을 특징으로 하는 약학적 조성물.
  3. 제 1항에 있어서, 상기 인위적으로 조작된 줄기세포는 인위적으로 조작된 중간엽 줄기세포인 것을 특징으로 하는 약학적 조성물.
  4. 제 1항에 있어서, 상기 약학적 조성물은 뇌조직 투여용 제형인 것을 특징으로 하는 약학적 조성물.
  5. 제 4항에 있어서, 상기 뇌조직은 해마 또는 CPu(caudate putamen)인 것을 특징으로 하는 약학적 조성물.
  6. 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 알츠하이머 병 치료용 약학적 조성물로,
    상기 인위적으로 조작된 줄기세포는 엔지니어링 된 HIF1AN 유전자를 포함하고,
    이때, 상기 엔지니어링 된 HIF1AN 유전자의 서열은 서열번호 1 내지 9로 이뤄진 군에서 선택된 하나 이상의 서열을 포함하지 않고,
    상기 조작된 줄기세포 내에서, FIH-1의 발현 수준은 야생형 세포에 비해 더 낮은 것을 특징으로 하고,
    상기 조작된 줄기세포 내에서, HIFα의 발현 수준은 상기 야생형 세포에 비해 더 높은 것을 특징으로 함.
  7. 다음을 포함하는 알츠하이머 병 치료 방법:
    대상 내에 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 약학적 조성물을 투여하는 것,
    이때, 상기 인위적으로 조작된 줄기세포는 야생형 HIF1AN 유전자 내에 인델을 가지는 엔지니어링 된 HIF1AN 유전자를 포함하고,
    상기 엔지니어링 된 HIF1AN 유전자의 서열은 야생형 HIF1AN 유전자의 서열과 다르고,
    이때, 상기 조작된 줄기세포 내에서, FIH-1의 발현 수준은 야생형 세포에 비해 더 낮은 것을 특징으로 하고,
    상기 조작된 줄기세포 내에서, HIFα의 발현 수준은 상기 야생형 세포에 비해 더 높은 것을 특징으로 함.
  8. 제 7항에 있어서, 상기 약학적 조성물의 투여는 상기 대상의 뇌 조직에 약학적 조성물을 직접 주입하는 것을 특징으로 하는 알츠하이머 병 치료 방법.
  9. 제 8항에 있어서, 상기 뇌 조직은 해마 또는 CPu(caudate putamen)인 것을 특징으로 하는 알츠하이머 병 치료 방법.
  10. 제 7항에 있어서, 상기 엔지니어링 된 HIF1AN 유전자가 가진 인델은 상기 야생형 HIF1AN 유전자의 엑손 1 영역에 위치하는 것을 특징으로 하는 알츠하이머 병 치료 방법.
  11. 제 7항에 있어서, 상기 인위적으로 조작된 줄기세포는 인위적으로 조작된 중간엽 줄기세포인 것을 특징으로 하는 알츠하이머 병 치료 방법.
  12. 다음을 포함하는 알츠하이머 병 치료 방법:
    대상 내에 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 약학적 조성물을 투여하는 것,
    이때, 상기 인위적으로 조작된 줄기세포는 엔지니어링 된 HIF1AN 유전자를 포함하고,
    상기 엔지니어링 된 HIF1AN 유전자의 서열은 서열번호 1 내지 9로 이뤄진 군에서 선택된 하나 이상의 서열을 포함하지 않고,
    상기 조작된 줄기세포 내에서, FIH-1의 발현 수준은 야생형 세포에 비해 더 낮은 것을 특징으로 하고,
    상기 조작된 줄기세포 내에서, HIFα의 발현 수준은 상기 야생형 세포에 비해 더 높은 것을 특징으로 함.
  13. 인위적으로 조작된 줄기세포의 알츠하이머 병 치료 용도로,
    상기 알츠하이머 병 치료 용도는 대상 내에 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 약학적 조성물을 투여하는 것을 포함하고,
    상기 인위적으로 조작된 줄기세포는 다음을 포함함:
    야생형 HIF1AN 유전자 내에 인델을 가지는 엔지니어링 된 HIF1AN 유전자,
    이때, 상기 엔지니어링 된 HIF1AN 유전자의 서열은 상기 야생형 HIF1AN 유전자의 서열과 다르고,
    이때, 상기 조작된 줄기세포 내에서, FIH-1의 발현 수준은 야생형 세포에 비해 더 낮은 것을 특징으로 하고,
    상기 조작된 줄기세포 내에서, HIFα의 발현 수준은 상기 야생형 세포에 비해 더 높은 것을 특징으로 함.
  14. 제 13항에 있어서, 상기 약학적 조성물의 투여는 상기 대상의 뇌 조직에 약학적 조성물을 직접 주입하는 것을 특징으로 하는 인위적으로 조작된 줄기세포의 알츠하이머 병 치료 용도.
  15. 제 14항에 있어서, 상기 뇌 조직은 해마 또는 CPu(caudate putamen)인 것을 특징으로 하는 인위적으로 조작된 줄기세포의 알츠하이머 병 치료 용도.
  16. 제 13항에 있어서, 상기 엔지니어링 된 HIF1AN 유전자는 상기 야생형 HIF1AN 유전자가 가지는 인델은 상기 HIF1AN 유전자의 엑손 1 영역에 위치하는 것을 특징으로 하는 인위적으로 조작된 줄기세포의 알츠하이머 병 치료 용도.
  17. 제 13항에 있어서, 상기 인위적으로 조작된 줄기세포는 인위적으로 조작된 중간엽 줄기세포인 것을 특징으로 하는 인위적으로 조작된 줄기세포의 알츠하이머 병 치료 용도.
  18. 인위적으로 조작된 줄기세포의 알츠하이머 병 치료 용도로,
    상기 알츠하이머 병 치료 용도는 대상 내에 인위적으로 조작된 줄기세포를 유효성분으로 포함하는 약학적 조성물을 투여하는 것을 포함하고,
    상기 인위적으로 조작된 줄기세포는 엔지니어링 된 HIF1AN 유전자를 포함하고,
    상기 엔지니어링 된 HIF1AN 유전자의 서열은 서열번호 1 내지 9로 이뤄진 군에서 선택된 하나 이상의 서열을 포함하지 않고,
    상기 조작된 줄기세포 내에서, FIH-1의 발현 수준은 야생형 세포에 비해 더 낮은 것을 특징으로 하고,
    상기 조작된 줄기세포 내에서, HIFα의 발현 수준은 상기 야생형 세포에 비해 더 높은 것을 특징으로 함.
  19. 인위적으로 조작된 줄기세포의 알츠하이머 병 치료제를 제조하기 위한 용도로,
    상기 인위적으로 조작된 줄기세포는 다음을 포함함:
    야생형 HIF1AN 유전자 내에 인델을 가지는 엔지니어링 된 HIF1AN 유전자,
    이때, 상기 엔지니어링 된 HIF1AN 유전자의 서열은 상기 야생형 HIF1AN 유전자의 서열과 다르고,
    이때, 상기 조작된 줄기세포 내에서, FIH-1의 발현 수준은 야생형 세포에 비해 더 낮은 것을 특징으로 하고,
    상기 조작된 줄기세포 내에서, HIFα의 발현 수준은 상기 야생형 세포에 비해 더 높은 것을 특징으로 함.
  20. 제 19항에 있어서, 상기 알츠하이머 병 치료제는 뇌조직 투여용 제형인 것을 특징으로 하는 인위적으로 조작된 줄기세포의 알츠하이머 병 치료제를 제조하기 위한 용도.
  21. 제 20항에 있어서, 상기 뇌조직은 해마 또는 CPu(caudate putamen)인 것을 특징으로 하는 인위적으로 조작된 줄기세포의 알츠하이머 병 치료제를 제조하기 위한 용도.
  22. 제 19항에 있어서, 상기 야생형 HIF1AN 유전자가 가지는 인델은 상기 HIF1AN 유전자의 엑손 1 영역에 위치하는 것을 특징으로 하는 인위적으로 조작된 줄기세포의 알츠하이머 병 치료제를 제조하기 위한 용도.
  23. 제 19항에 있어서, 상기 인위적으로 조작된 줄기세포는 인위적으로 조작된 중간엽 줄기세포인 것을 특징으로 하는 인위적으로 조작된 줄기세포의 알츠하이머 병 치료제를 제조하기 위한 용도.
  24. 인위적으로 조작된 줄기세포의 알츠하이머 병 치료제를 제조하기 위한 용도로,
    이때, 상기 인위적으로 조작된 줄기세포는 엔지니어링 된 HIF1AN 유전자를 포함하고,
    상기 엔지니어링 된 HIF1AN 유전자의 서열은 서열번호 1 내지 9로 이뤄진 군에서 선택된 하나 이상의 서열을 포함하지 않고,
    상기 조작된 줄기세포 내에서, FIH-1의 발현 수준은 야생형 세포에 비해 더 낮은 것을 특징으로 하고,
    상기 조작된 줄기세포 내에서, HIFα의 발현 수준은 상기 야생형 세포에 비해 더 높은 것을 특징으로 함.
PCT/KR2021/000550 2020-01-14 2021-01-14 알츠하이머 예방 또는 치료용 약학적 조성물 및 이의 용도 WO2021145703A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US17/792,771 US20230053781A1 (en) 2020-01-14 2021-01-14 Pharmaceutical composition for preventing or treating alzheimer's and use thereof
EP21740676.8A EP4091635A4 (en) 2020-01-14 2021-01-14 PHARMACEUTICAL COMPOSITION FOR PREVENTING OR TREATING ALZHEIMER'S DISEASE AND USE THEREOF

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0004615 2020-01-14
KR20200004615 2020-01-14

Publications (1)

Publication Number Publication Date
WO2021145703A1 true WO2021145703A1 (ko) 2021-07-22

Family

ID=76864535

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/000550 WO2021145703A1 (ko) 2020-01-14 2021-01-14 알츠하이머 예방 또는 치료용 약학적 조성물 및 이의 용도

Country Status (4)

Country Link
US (1) US20230053781A1 (ko)
EP (1) EP4091635A4 (ko)
KR (1) KR102616080B1 (ko)
WO (1) WO2021145703A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014065596A1 (en) 2012-10-23 2014-05-01 Toolgen Incorporated Composition for cleaving a target dna comprising a guide rna specific for the target dna and cas protein-encoding nucleic acid or cas protein, and use thereof
KR20190037145A (ko) * 2017-09-28 2019-04-05 주식회사 툴젠 유전자 발현 조절을 위한 인위적인 게놈 조작

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5993113B2 (ja) * 2011-01-31 2016-09-14 株式会社 バイオミメティクスシンパシーズ アルツハイマー病治療に向けたヒト脂肪組織由来間葉系幹細胞
WO2018199662A1 (ko) * 2017-04-26 2018-11-01 주식회사 툴젠 sRAGE를 분비하는 줄기세포를 포함하는 알츠하이머병의 예방 또는 치료용 약학 조성물

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014065596A1 (en) 2012-10-23 2014-05-01 Toolgen Incorporated Composition for cleaving a target dna comprising a guide rna specific for the target dna and cas protein-encoding nucleic acid or cas protein, and use thereof
KR20190037145A (ko) * 2017-09-28 2019-04-05 주식회사 툴젠 유전자 발현 조절을 위한 인위적인 게놈 조작

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
KIM SEUNGHEE, LEE MINJAE, CHOI YOON KYUNG: "The Role of a Neurovascular Signaling Pathway Involving Hypoxia-Inducible Factor and Notch in the Function of the Central Nervous System", BIOMOLECULES & THERAPEUTICS, KOREAN SOCIETY OF APPLIED PHARMACOLOGY, KR, vol. 28, no. 1, 1 January 2020 (2020-01-01), KR, pages 45 - 57, XP055828812, ISSN: 1976-9148, DOI: 10.4062/biomolther.2019.119 *
LEE HYUN JIK, JUNG YOUNG HYUN, CHOI GEE EUHN, KIM JUN SUNG, CHAE CHANG WOO, HAN HO JAE: "Role of HIF1 α Regulatory Factors in Stem Cells", INTERNATIONAL JOURNAL OF STEM CELLS, vol. 12, no. 1, 30 March 2019 (2019-03-30), pages 8 - 20, XP055828809, DOI: 10.15283/ijsc18109 *
LEE K., N. LEE, E. SHIN, N. LEE, J. CHANG, D. NA, J. LEE: "Enhancing the therapeutic potential of mesenchymal stem cell-based therapy via CRISPR/Cas9-based genome editing", CYTOTHERAPY, vol. 22, no. 5, 1 May 2020 (2020-05-01), pages S15 - S15, XP055828819 *
MAHON PCHIROTA KSEMENZA GL: "FIH-1: a novel protein that interacts with HIF-lalpha and VHL to mediate repression of HIF-1 transcriptional activity", GENES DEV, vol. 15, no. 20, 2001, pages 2675 - 2686, XP002254663, DOI: 10.1101/gad.924501
PAN WENXU, LIU CHUAN, ZHANG JIHANG, GAO XUBIN, YU SHIYONG, TAN HU, YU JIE, QIAN DEHUI, LI JIABEI, BIAN SHIZHU, YANG JIE, ZHANG CHE: "Association Between Single Nucleotide Polymorphisms in PPARA and EPAS1 Genes and High-Altitude Appetite Loss in Chinese Young Men", FRONTIERS IN PHYSIOLOGY, vol. 10, 1 January 2019 (2019-01-01), pages 59, XP055828815, DOI: 10.3389/fphys.2019.00059 *
See also references of EP4091635A4
ZHANG Z., YAN J., CHANG Y., SHIDU YAN S., SHI H.: "Hypoxia Inducible Factor-1 as a Target for Neurodegenerative Diseases", CURRENT MEDICINAL CHEMISTRY, BENTHAM, NL, vol. 18, no. 28, 1 October 2011 (2011-10-01), NL, pages 4335 - 4343, XP055828808, ISSN: 0929-8673, DOI: 10.2174/092986711797200426 *

Also Published As

Publication number Publication date
KR102616080B1 (ko) 2023-12-21
EP4091635A4 (en) 2024-02-21
KR20210092150A (ko) 2021-07-23
EP4091635A1 (en) 2022-11-23
US20230053781A1 (en) 2023-02-23

Similar Documents

Publication Publication Date Title
EP3498843B1 (en) Endonuclease targeting blood coagulation factor viii gene and composition for treating hemophilia comprising same
WO2018030608A1 (ko) Cas9 단백질 및 가이드 RNA의 혼성체를 함유하는 나노 리포좀 전달체 조성물
WO2019050071A1 (ko) 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물
WO2019231266A1 (ko) Hla 유전자가 제거된 인간 유도만능줄기세포 유래 중간엽줄기세포 및 그의 제조 방법
WO2023282688A1 (ko) 산화스트레스 저항성을 갖는 중간엽 줄기세포, 이의 제조방법 및 용도
WO2018088693A1 (ko) 2ｄｇ를 이용한 줄기세포 역량 향상 방법
WO2019147036A1 (ko) 뇌유래-신경영양인자를 발현하는 중간엽줄기세포 및 이의 용도
WO2023008933A1 (ko) 혈액 적합성을 갖는 중간엽 줄기세포, 이의 제조방법 및 용도
WO2021145703A1 (ko) 알츠하이머 예방 또는 치료용 약학적 조성물 및 이의 용도
WO2019066378A1 (ko) Factor viii 또는 factor ix 유전자가 녹아웃된 토끼, 이의 제조방법 및 그 용도
WO2023219434A1 (ko) 혈액 적합성을 갖는 혈관 내 이식용 세포, 이의 제조방법 및 용도
WO2020159191A1 (ko) Mls-stat3를 포함하는 면역질환의 예방 또는 치료용 조성물
WO2016117960A1 (ko) 면역질환 치료 효능을 갖는 grim19이 과발현된 중간엽줄기세포 및 이의 용도
WO2016093668A2 (ko) 일체형 유전자 치료 유도만능줄기세포 제작방법
WO2022131742A1 (ko) 소포체 스트레스 유발 물질로 처리된 세포 유래 엑소좀 및 이의 용도
WO2020122498A1 (ko) 클로날 줄기세포를 포함하는 췌장염 치료용 약학적 조성물
WO2021107234A1 (ko) Hiv 감염 치료 또는 예방을 위한 ccr5/cxcr4 유전자 동시 넉아웃 환자맞춤형 조혈모세포 및 이의 제조방법
WO2022114815A1 (ko) 트랜스-스플라이싱 아데노-연관 바이러스 벡터를 포함하는 프라임에디팅용 조성물
WO2021145700A1 (ko) 저산소 환경 하에서 높은 적응력을 가지는 세포 및 이의 용도
KR102089088B1 (ko) 혈액 응고인자 ⅷ의 교정용 조성물 및 이를 이용한 방법
WO2023167575A1 (ko) 저면역원성 줄기세포, 줄기세포로부터 분화되거나 유래된 저면역원성 세포 및 이의 제조방법
WO2022211604A1 (ko) Fe-fviii 변이 유전자로 교정된 줄기세포, 이로부터 분화된 내피 세포 및 이를 포함하는 혈우병 예방 또는 치료용 약제학적 조성물
WO2022035287A1 (ko) 체외에서 유전자 교정된 세포 및 이의 용도
WO2023008918A1 (ko) B2m 유전자의 발현이 저해된 유전적으로 조작된 줄기세포 및 이의 이용방법
WO2024054006A1 (ko) 신규한 유전체 세이프 하버 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21740676

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021740676

Country of ref document: EP

Effective date: 20220816