WO2016093668A2 - 일체형 유전자 치료 유도만능줄기세포 제작방법 - Google Patents

일체형 유전자 치료 유도만능줄기세포 제작방법 Download PDF

Info

Publication number
WO2016093668A2
WO2016093668A2 PCT/KR2015/013622 KR2015013622W WO2016093668A2 WO 2016093668 A2 WO2016093668 A2 WO 2016093668A2 KR 2015013622 W KR2015013622 W KR 2015013622W WO 2016093668 A2 WO2016093668 A2 WO 2016093668A2
Authority
WO
WIPO (PCT)
Prior art keywords
ipsc
ipscs
fop
derived
cells
Prior art date
Application number
PCT/KR2015/013622
Other languages
English (en)
French (fr)
Other versions
WO2016093668A3 (ko
Inventor
정선구
권은정
정상균
김장환
Original Assignee
한국한의학연구원
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국한의학연구원, 한국생명공학연구원 filed Critical 한국한의학연구원
Publication of WO2016093668A2 publication Critical patent/WO2016093668A2/ko
Publication of WO2016093668A3 publication Critical patent/WO2016093668A3/ko

Links

Images

Definitions

  • the present invention relates to a method for producing iPSCs from genetically modified or disease models from a somatic cell line in one-step by combining induced pluripotent stem cell (iPSC) production elements and genetic engineering elements.
  • iPSC induced pluripotent stem cell
  • Zinc-finger nucleases ZFNs
  • transcriptional activator-like effector nucleases TALENs
  • short regressive repeat-Cas9 nuclease systems Genetic editing tools as powerful molecular scissors, including RNA-guided endonucleases (RGENs) from microbial clusters with a repeat-cas9 nuclease system, are bacteria.
  • RGENs RNA-guided endonucleases
  • the target genes can be effectively inserted, deleted or replaced from the genome. do.
  • iPSCs induced pluripotent stem cells
  • iPSCs are very similar to embryonic stem cells.
  • stem cells are constantly dividing while maintaining self-renewal.
  • iPSCs are capable of differentiating into a variety of cells, and many studies are underway to produce genetically engineered iPSCs by applying genetic engineering tools to iPCS.
  • Fibrodysplasia ossificans progressiva is a congenital disease that causes heterotopic ossification of connective and muscular tissues by autosomal dominant mutations in the ACVR1 gene. It is a disease that forms.
  • the ACVR1 gene encodes an activin A type I receptor, also called ALK2.
  • a representative mutant form of advanced osteoblastic dysplasia is ACVR1 p.R206H. Activated to cause the disease.
  • the present inventors can facilitate the production of iPSC, and during the experiment to solve the difficult problem of manufacturing a patient-derived iPSC, such as FOP, reprogramming episomal vector to induce the differentiation of adult somatic cells, and Genetically modified or mutagenic carriers can be introduced into adult somatic cells simultaneously to produce genetically corrected iPSCs or mutagenic disease model iPSCs, wherein the modified or mutagenic iPSCs have the same characteristics as other types of normal iPSCs. Or the present invention has been completed by confirming that they exhibit different characteristics.
  • a patient-derived iPSC such as FOP
  • Genetically modified or mutagenic carriers can be introduced into adult somatic cells simultaneously to produce genetically corrected iPSCs or mutagenic disease model iPSCs, wherein the modified or mutagenic iPSCs have the same characteristics as other types of normal iPSCs.
  • the present invention has been completed by confirming that they exhibit different characteristics.
  • iPSC pluripotent stem cell
  • the present invention provides a method for producing a genetically modified iPSC comprising:
  • iPSC induced pluripotent stem cell
  • the present invention also provides a method for preparing a genetically modified iPSC comprising:
  • Induced pluripotent stem cells were introduced into fibroblasts isolated from FOP patients simultaneously with any one selected from the group consisting of a reprogramming episomal vector, an sgRNA consisting of SEQ ID NO: 1, and an ssODN consisting of SEQ ID NO: 2 Preparing an induced pluripotent stem cell (iPSC); And
  • the present invention provides a method for producing a disease model iPSC comprising:
  • iPSC induced pluripotent stem cell
  • the method for producing induced puripotenet stem cells (iPSCs) with genetic modification by the one-step of the present invention is a reprogramming episomal vector that induces the differentiation of adult somatic cells, and genetic correction. Or by introducing mutagenic transporters into host cells at the same time to produce genetically corrected iPSCs or mutagenesis disease model iPSCs, wherein the iPSCs that have been genetically corrected or mutated have the same characteristics as other types of normal iPSCs, and By exhibiting different characteristics, it can be used for the screening of therapeutic agents or therapeutic agents for the treatment of diseases.
  • FIG. 1A shows TALEN and Hprt1 for preparing induced puripotenet stem cells (iPSCs) knocked out of hypoxanthine-guanine phosphoribosyltransferase 1 ( Hprt1 ).
  • FIG. 1b is a diagram showing the results of T7 endonuclease I (T7EI) assay performed with genomic DNA of TALEN plasmid transfected fibroblast cell line as a PCR product produced as a template .
  • T7EI T7 endonuclease I
  • 1C is a diagram illustrating a method of manufacturing iPSC in which Hprt1 is knocked out in one-step.
  • 1D is a diagram showing the results of a single-strand conformation polymorphism (SSCP) assay of clones induced with Hprt1 mutation.
  • SSCP single-strand conformation polymorphism
  • Figure 1e is a diagram confirming the sensitivity of the Hprt1 mutant-induced hypoxanthine aminopterin thymidine (HAT) medium and resistance to 6-thioguanine (6-thioguanine, 6-TG) .
  • Figure 1f is a diagram confirming the sequence of the clone induced the HCPt1 mutation by SSCP assay, or HAT or 6-TG treatment.
  • 2A is a diagram showing negative selection of Hprt1 mutant iPSCs:
  • ii negative or unscreened Hprt1 mutant iPSCs
  • 2B is a diagram showing the number of generated Hprt1 mutant iPSCs.
  • FIG. 2C shows the results of T7EI assay of PCR products obtained from normal or Hprt1 mutant iPSCs.
  • FIG. 3A shows a single-guided RNA (sgRNA) for the AAVS1 gene.
  • sgRNA single-guided RNA
  • FIG. 3b is a diagram showing the results of T7 endonuclease I (T7EI) assay performed with genomic DNA of sgRNA-introduced fibroblasts as a PCR product produced as a template.
  • T7EI T7 endonuclease I
  • Figure 3c is a diagram showing a method for producing iPSC introduced sgRNA in one-step (one-step).
  • 3D is a diagram showing the results of T7EI assay of PCR products obtained from iPSCs with normal or sgRNA introduced.
  • Figure 3e confirms the sequence of the clones in which gene deletion was caused by sgRNA.
  • Figure 4a is a diagram showing the colonies generated after induction of differentiation into iPSC by the conventional method from the FOP patient-derived cell line.
  • Figure 4b is a diagram showing the differentiation state of iPSC derived from FOP patients prepared by the conventional method.
  • Figure 4c is a diagram confirming the expression of pluripotency markers of iPSC derived from FOP patients prepared by the conventional method by semi-quantitative RT-PCR.
  • Figure 5a is a diagram confirming the expression of GFP 1 day after the introduction of the GFP expression vector into the iPSC derived from FOP patients.
  • Figure 5b is a diagram confirming the expression of GFP 15 days after the introduction of the GFP expression vector into the iPSC derived from FOP patients.
  • FIG. 5C is an enlarged view of FIG. 5B.
  • Figure 5d is a diagram showing the alkaline phosphatase (alkine phsphatase) and GFP expressing cell line shown in Figure 5c.
  • Figure 5e is a diagram showing the results of GFP expression and alkaline phosphatase staining of FOP patient-derived iPSC by introducing the GFP expression vector into the FOP patient-derived iPSC, and then treated with LDN-193189 by concentration.
  • FIG. 6A shows a single-guided RNA (sgRNA) for the ACVR1 gene.
  • sgRNA single-guided RNA
  • Figure 6b is a diagram showing the efficiency of homo-directed repair (HDR) of single-strand oligodeoxynucleotide (ssODN) template mediating FOP-derived fibroblasts.
  • HDR homo-directed repair
  • ssODN single-strand oligodeoxynucleotide
  • Figure 6c is a diagram showing the target efficiency of the sgRNA introduced into FOP-derived fibroblasts through deep sequencing.
  • Figure 6d is a diagram showing the target efficiency of ssODN introduced into FOP-derived fibroblasts through deep sequencing.
  • Figure 6e is a diagram showing a method for producing a genetically modified iPSC from FOP-derived fibroblasts.
  • Fig. 6F is a diagram showing the results of analyzing genotypes for finding candidate groups of iPSCs derived from genetically corrected FOP patients.
  • Figure 6g is a diagram showing the results of sequencing analysis of iPSCs derived from homologous Indian recovery FOP patients.
  • 7A is a diagram illustrating on-target and off-target candidate groups for ACVR1 sgRNA.
  • Figure 7b is a diagram showing the sequence of the primer binding site for PCR amplification and the sequence of ACVR1 and off-target candidate genes FILIP1L, RIC8A and BYSL to identify the off-target.
  • Figure 7c is a diagram showing the efficiency of the ACVR1 sgRNA and whether off-target via the T7 endonuclease assay method for off-target candidates.
  • FIG. 8 shows sequencing results of fibroblasts derived from FOP patients and genetically corrected iPSCs.
  • Figure 9a is a diagram confirming the expression of alkaline phosphatase in iPSCs derived from gene-corrected FOP patients.
  • Figure 9b is a diagram confirming the expression of multipotential markers in iPSCs derived from gene-corrected FOP patients.
  • Figure 9c is a diagram confirming the formation of teratoma using iPSC derived from the FOP patient genetically corrected.
  • 9D is a diagram showing the karyotype analysis results of iPSCs derived from FOP patients whose genes have been corrected.
  • Figure 10a is a diagram showing the results of von kossa staining for iPSC cultured in stem cell medium.
  • 10B is a diagram showing the present Cosa staining results for differentiated cells cultured in mineral differentiation conditions.
  • the term 'reprogramming episomal vector' refers to OCT4, shp53, SOX2, Klf4, Lin28 and L that can induce reverse differentiation in vectors that do not enter the chromosome, ie episomal vector.
  • it may mean a vector including any one or more transcriptional regulatory genes selected from the group consisting of OCT4, shp53, SOX2, Klf4, Lin28 and L-myc.
  • the vector may mean a vector including OCT4-shp53, a vector including Sox2-Klf4, and a vector including Lin28-L-myc, but is not limited thereto.
  • 'Lesch-nyhan syndrome' is a disease caused by the loss of the function of the hypoxanthine-guanine phosphorosyltransferase 1 (Hprt1) gene.
  • 'TALEN' refers to a system that cuts a DNA target site by a restriction enzyme to which a TAL effect DNA binding domain that specifically recognizes a DNA target site is bound. do.
  • FOP fibrodysplasia ossificans progressiva
  • sgRNA single-guided RNA
  • sgRNA RNA having complementarity to a target DNA sequence, consisting of crRNA and tracrRNA.
  • ssODN single-strand oligodeoxynucleotide
  • the present invention provides a method for producing a genetically modified iPSC comprising:
  • iPSC induced pluripotent stem cell
  • the subject can mean any animal, including humans, in whom a mutation has or is likely to occur.
  • the animal includes a human, and may be a mammal such as a cow, a horse, a sheep, a pig, a goat, a camel, an antelope, a dog, a cat, and the like, but is not limited thereto.
  • the subject of step 1) is preferably a patient with fibrodysplasia ossificans progressiva (FOP) or fanconi anemia, but is not limited thereto, and is applicable to all patients with a disease that may be caused by mutation of the gene. It is possible.
  • FOP fibrodysplasia ossificans progressiva
  • fanconi anemia but is not limited thereto, and is applicable to all patients with a disease that may be caused by mutation of the gene. It is possible.
  • the adult somatic cells of step 1) are preferably human-derived fibroblasts, but are not limited thereto, and all animal-derived somatic cells such as monkeys, pigs, horses, cows, sheep, dogs, cats, mice, and rabbits may be used.
  • the iPSC is preferably cultured under embryonic stem cell culture conditions generally used in the art, but is not limited thereto.
  • the reprogramming episome vector of step 1) preferably includes any one or more selected from the group consisting of Oct4, shp53, Sox2, Klf4, Lin28 and L-myc, but is not limited thereto.
  • the mutation correction carrier of step 1) includes gene scissors, and the gene scissors comprise ZFN (zinc-finger nuclease), TALEN (transcription activator-like effector nuclease) and RGEN (RNA-guided DNA endonuclease) It is preferred to include any one selected from the group, according to an embodiment of the present invention was carried out using RGEN.
  • the mutant correction carrier using the RGEN gene scissors preferably includes, but is not limited to, single-guided RNA (sgRNA) or single-strand oligodeoxynucleotide (ssODN). .
  • the sgRNA is composed of SEQ ID NO: 27 or preferably, but not limited to, ACVR1 p.R206H mutation.
  • the ssODN is preferably composed of SEQ ID NO: 28, or to repair the ACVR1 c.617G> A mutation, but is not limited thereto.
  • Genetically modified iPSC prepared by the above method is characterized in that the primary iPSC colonies are separated at 3 to 4 weeks after the cultivation to transfer to the matrigel-coated plate to continue the culture, but is not limited thereto.
  • the iPSC is preferably cultured in fibroblast medium for 48 hours and then replaced with stem cell medium to continue the culture, but not always limited thereto.
  • At least one of the alleles has a donor DNA inserted into the target, and at the same time, an indel mutation by algen is generated at another allele position. It is not limited.
  • Step 2) of selecting the iPSC prepared in step 1) may be selected by a method for confirming the genetic correction known in the art.
  • the inventors have used the ACVR1 p.R206H mutation to prepare iPSCs from cell lines derived from fibrodysplasia ossificans progressiva (FOP) patients using a one-step strategy.
  • Targeting single-guided RNA (sgRNA) or single-strand oligodeoxynucleotide (ssODN) templates with a reprogramming episomal vector to FOP patient-derived fibroblasts After introduction, it was confirmed that two bands cut from 292 bp PCR amplicons, each of which are 191 bp and 101 bp in length, were intentionally selected for the convenience of screening through genotyping, which is a consideration for donor DNA production.
  • the induced hidden mutations confirmed that the target efficiency of the donor DNA was about 6.5% (see Figure 6b).
  • the stem cells genetically-corrected by the one-step method from the FOP patient-derived cell line shows a similar form to the wild type iPSC, while FOP Stem cells prepared from patient-derived cells contained a large amount of minerals and were confirmed to have a strong black portion (see FIG. 10).
  • the iPSC manufacturing method of the present invention effectively produced iPSC from FOP patient-derived fibroblasts, which had been difficult to manufacture, and confirmed that it can be used for FOP treatment.
  • the present invention also provides a method for preparing a genetically modified iPSC comprising:
  • induced pluripotency by simultaneously introducing at least one selected from the group consisting of a reprogramming episomal vector, an sgRNA consisting of SEQ ID NO: 27 and an ssODN consisting of SEQ ID NO: 28, to fibroblasts isolated from FOP patients Preparing an induced pluripotent stem cell (iPSC); And
  • the present invention provides a method for producing a disease model iPSC comprising:
  • iPSC induced pluripotent stem cell
  • the adult somatic cells of step 1) are preferably human-derived fibroblasts, but are not limited thereto, and all animal-derived somatic cells such as monkeys, pigs, horses, cows, sheep, dogs, cats, mice, and rabbits may be used.
  • the iPSC is preferably cultured under embryonic stem cell culture conditions, but is not limited thereto.
  • the reprogramming episome vector of step 1) preferably expresses any one or more selected from the group consisting of Oct4, shp53, Sox2, Klf4, Lin28 and L-myc, but is not limited thereto.
  • the mutagenic transporter of step 1) comprises genetic scissors, and the genetic scissors comprise ZFN (zinc-finger nuclease), TALEN (transcription activator-like effector nuclease) and RGEN (RNA-guided DNA endonuclease) It is preferred to include any one selected from the group, according to the embodiment of the present invention was used to select TALEN.
  • the mutagenic carrier including the TALEN is preferably knocked out of hypoxanthine-guanine phosphoribosyltransferase 1 (Hprt1), but is not limited thereto, and knocks out TALEN to knock out Hprt1.
  • the gene sequence to be recognized preferably includes a sequence consisting of SEQ ID NO: 29 or SEQ ID NO: 30, but is not limited thereto.
  • the Hprt1 is preferably composed of SEQ ID NO: 31, but is not limited thereto.
  • the disease is most preferably Lesch-Nyhan syndrome, but a disease caused by mutation of a specific gene includes metabolic disease, cancer disease, brain disease, cardiovascular disease, blood disease, bone disease, etc. It is applicable to all hereditary diseases.
  • Genetically modified iPSC prepared by the above method is characterized in that the primary iPSC colonies are separated at 3 to 4 weeks after the cultivation to transfer to the matrigel-coated plate to continue the culture, but is not limited thereto.
  • the iPSC is preferably cultured in fibroblast medium for 48 hours and then replaced with stem cell medium to continue the culture, but not always limited thereto.
  • iPSCs induced pluripotent stem cells
  • Lesch-Nyhan syndrome induced pluripotent stem cells
  • hypoxanthine-guanine phosphoribosyltransferase 1 Hypoxanthine-Guanine Phosphoribosyltransferase 1, Hprt1 knockout vectors and reprogramming episomal vectors were simultaneously introduced into normal fibroblasts by electroporation.
  • Hpoxanthine-Guanine Phosphoribosyltransferase 1, Hprt1 knockout vectors and reprogramming episomal vectors were simultaneously introduced into normal fibroblasts by electroporation.
  • Hprt1 hypoxanthine-guanine phosphoribosyltransferase 1
  • Hprt1 knockout vectors and reprogramming episomal vectors were simultaneously introduced into normal fibroblasts by electroporation.
  • Hprt1 hypoxanthine-gu
  • genetically engineered iPSCs were selected from the cells produced by the above method, and the sequences near the mutations were analyzed. As a result, some of the clones showing Hprt1 resistance to 6-TG were resistant to 6-TG, and the single-stranded form was different from the normal form. In addition to exhibiting polymorphism (see FIG. 1D), it is possible to grow in Hypoxanthine-aminopterin thymidine medium (see FIG. 1E), and sequencing shows that the bases in the left and right arms of TALEN Insertion or deletion was confirmed (see FIG. 1F).
  • the method for producing a disease model iPSC of the present invention can be produced in a short time economically from the normal adult somatic cells, it can be useful for drug screening of specific diseases using the disease model iPSC.
  • Example 1> Using a one-step strategy Leshnihan syndrome( Lesch - Nyhan syndrome) Induced pluripotent stem cells (induced pluripotent stem cell, iPSC Manufacturing
  • Hprt1 Hypoxanthine-Guanine Phosphoribosyltransferase 1 linked to X-chromosome
  • a reprogramming episomal vector (Addgene, USA) was used, which was produced by Shinya Yamanaka, Japan, and the virus of Ebstein-B-virus (Ebstein-B-virus). It is a vector called pCXLE, which has introduced the gene EBNA-1, and has the characteristics of episomal character like a virus.
  • OCT4-shp53, Sox2-Klf4, and Lin28-L-myc are paired with each other in this empty vector.
  • OCT4-shp53 OCT4 is expressed by CAG promoter and shp53 is expressed by U6 promoter. They are all controlled by the CAG promoter.
  • TALEN for knocking out 2 ⁇ g of X-chromosome linked hypoxanthine-guanine phosphoribosyltransferase 1 Vector (FIG. 1A), and a reprogramming episomal vector for reprogramming of 1.5 ⁇ g of cells, were added using a Neon electroporator to produce 1,200 V, 30 ms, 2 ⁇ pulses.
  • Conditions were simultaneously introduced into the fibroblast line using electroporation. After introduction, the cells were cultured in fibroblast medium (DMEM medium containing 10% FBS) for 48 hours, and the genetic engineering efficiency was found to be about 10% as shown in FIG.
  • FIG. 1B After 48 hours of culturing the prepared cells in fibroblast medium, the cells were cultured by replacing with stem cell medium (mTesR1). After 2 weeks of culture in stem cell medium, when immature iPSCs were formed, 1 ⁇ 6-thioguanine was added to the stem cell medium to continue the culture, and the medium was replaced daily for 5 days.
  • stem cell medium mTesR1
  • pre-iPSCs pre-iPSCs
  • 6-thioguanine 6-thioguanine
  • 21 Hprt1 resistant to 6-TG Mutant clones were isolated by hand using a tip, and PCR amplification produced by degenerating the single-stranded PCR product (denaturation) was confirmed by electrophoresis on a single-stranded polymorphic gel (gel).
  • the PCR amplicon obtained by PCR by sequencing the sequence near the mutation induced by TALEN in the same manner as pTOP TA V2 was cloned into the M13 universal primer present in the T vector. After sequencing was performed using an automatic sequence analyzer, the resulting analysis was compared with the original wild type sequence and confirmed the insertion or deletion of nucleotides in the vicinity of the spacers cut by a pair of TALENs.
  • FIG. 1D As a result, as shown in FIG. 1D, some of the clones with Hprt1 removed and resistant to 6-TG exhibited a single-stranded polymorphism of normal to other forms (FIG. 1D), as well as hypoxanthine aminopterin It was confirmed that the growth in thymidine (Hypoxanthine-aminopterin thymidine) medium (Fig. 1e).
  • sequencing confirmed the insertion or deletion of bases in the space between the left and right arms of the TALEN (FIG. 1F).
  • T7 Endonuclease I T7 endonuclease I, T7E1
  • T7 endonuclease assays were performed using the genetically engineered iPSCs selected in Example ⁇ 1-2> to determine whether mutations were generated in the selected clones.
  • mutant clone candidates and wild-type cell lines mutation predicted sites were amplified by PCR.
  • wild-type cell line-derived products are mixed with each of the mutant clone candidate-derived products, and then lowered by 2 per second from the first 95 to 25 to form a type 2 double strand (heteroduplex), and the type 2 formed T7E1 2 units (unit) on the strands for 20 minutes and electrophoresis on 2% agarose gel (agarose gel) was confirmed this.
  • the method for producing Leishny syndrome model cell line of the present invention can produce efficient genetically engineered iPSC in 3-4 weeks in a short time by producing iPSC from somatic cells and at the same time inducing disease specific genetic modification.
  • Example 2 Humans using a one-step strategy foreskin Human foreskin fibroblasts, hFFn ) from iPSC Produce
  • a single-guided RNA (sgRNA) targeting AAVS1 safe-harbor locus was constructed (FIG. 3A).
  • sgRNA single-guided RNA
  • an episomal vector (Addgene, USA) in which OCT4-shp53, Sox2-Klf4, and Lin28-L-myc were paired with each other was used.
  • the sgRNA targeting the AAVS1 safe-harbor locus was produced by Tulzen (Korea).
  • the sgRNA was constructed to include a protospacer adjacent motif (PAM) sequence (SEQ ID NO: 32: CTCCCTCCCAGGATCCTCTCTGG) in the sgRNA sequence.
  • PAM protospacer adjacent motif
  • sgRNA consisting of tracrRNA and crRNA
  • the U6 promoter present in the sgRNA plasmid was used.
  • the CAG promoter was replaced with the CMV promoter present in the original plasmid encoding Cas9-endonuclease.
  • the method for preparing iPSCs into which sgRNAs are introduced is as follows.
  • human foreskin fibroblasts were treated with 0.05%% TrypLE TM express (Invitrogen) and trypsinized, and then washed with DPBS. After diluting 1 ⁇ 10 6 of the human foreskin fibroblasts (hFFn) in 150 ⁇ l of R-butter, 1.5 ⁇ g of each episomal vector, 1.5 ⁇ g Cas9-encoding plasmid, and 1.5 ⁇ g AAVS1 -sgRNA was added. The additives were introduced into human foreskin fibroblasts using electroporation at 1,200 V, 30 ms, 2x pulses using a Neon electroporator with 10 or 100 ⁇ l tips. After introduction, the cells were cultured in fibroblast medium (DMEM medium containing 10% FBS) for 48 hours.
  • DMEM medium containing 10% FBS
  • the genetic engineering efficiency was found to be about 34% (FIG. 3B).
  • T7 Endonuclease I T7 endonuclease I, T7E1
  • fibroblast medium After 48 hours of culturing the cells prepared according to Example 2-1 in fibroblast medium, cells were cultured by replacing with stem cell medium (mTesR1), and the medium was replaced every day. Three weeks after incubation in stem cell media, primary iPSC colonies were transferred to 96-well plates, respectively, for differentiation. This was incubated until colonies filled 80% of each well (FIG. 3C). Fifty iPSC clones were selected from the cultured primary iPSCs and subjected to a T7 endonuclease assay according to Examples 1-3 to determine whether mutations were generated in the selected clones.
  • the mutation efficiency was found to be 82% (FIG. 3D), indicating that most of the isolated clones were mutated in AAVS1 safe-harbor locus by the sgRNA.
  • the following method was performed to prepare iPSCs using somatic cells isolated from FOP patients with genetic variation in ACVR1 p.R206H.
  • fibroblast lines derived from 1 ⁇ 10 6 FOP patients were diluted with 150 ⁇ l of R-buffer for electroporation, followed by three reprogramming episomal vectors: hOCT4-shp53, hSox2-hKLF4 and hL. 1.5 ⁇ g of each mixture of -myc-hLin28 was diluted and added to the FOP patient-derived fibroblast line. Then, the cell line was incubated in fibroblast medium (DMEM medium containing 10% FBS) for 48 hours at 1,200 V, 30 ms and 2x pulses in a Neon electroporator, and then in mTesR1, a stem cell formation medium. Stem cells were formed by continuous culture for 3 to 4 weeks.
  • DMEM medium containing 10% FBS fetal bovine serum
  • 6-well tissue culture plates were coated with 0.1% gelatin in a 37 incubator, followed by attaching CF-1 culture helper cells treated with 1 ⁇ 10 4 mitomycine per well, followed by D after 24 hours. After washing the feeder cells attached to the wells with PBS, 1 x 10 3 iPSCs were incubated thereon. After 7 days of culture, the cultured iPSCs were fixed for 1 minute with 10% formaldehyde and washed 2 to 3 times with 0.1% TBS to remove the formaldehyde.
  • an alkaline phosphatase staining kit (Sigma, USA) was prepared according to the manufacturer's protocol. Specifically, 1 ml sodium nitrate is added to 1 ml FRV-alkaline solution and gently mixed to prepare a diazonium salt. Two minutes after the diazonium salt solution was prepared, the diazonium salt solution and 1 mL of naphthol AS-BI alkaline solution were sequentially added to 45 mL of distilled water. The prepared solution was treated in a fixed iPSC, left at room temperature (25) for 15 minutes, washed with tap water, and observed with an optical microscope and a digital camera.
  • the FOP patient-derived iPSC cell line was properly attached by the MEF-cultured cells, but only partially stained that the FOP patient-derived iPSC cell line was still not helped by the MEF-cultured cell. It was confirmed by alkaline phosphatase staining. This indicates that the FOP patient-derived iPSC cell line prepared by the known method does not recover as a stem cell even in the state of co-culture with MEF-cultured helper cells, which is the most ideal undifferentiated condition (Fig. 4b right).
  • each cell line is treated with trizol (trizol, Invitrogen, USA) to extract the total RNA, using RNAeasy minikit (Qiagen, USA) RNA was purified according to the protocol.
  • CDNA was synthesized according to the manufacturer's protocol using the iScrpit TM cDNA synthesis kit (Biorad, USA) using 2 ⁇ g of the purified RNA as a template, and the running temperature was 42. Then, quantification was performed using the generated PCR product, and 10 ng of cDNA was used for each quantitative PCR in terms of the amount of RNA used for the initial reaction.
  • PCR conditions used in the quantitative analysis was repeated for 20 to 40 times to 95 1 minutes, 58 1 minutes, 72 1 minutes, and the exponential phase for each gene was determined.
  • the control group GAPDH was repeated 21 times, the other genes were repeated 36 times, 10 ⁇ l of the resulting PCR amplicon was loaded on 2% agarose gel and confirmed by EtBr staining.
  • Primers used for each gene quantification are as follows.
  • Genetic correction was performed based on iPSC cells prepared from FOP patient-derived cell lines. Before attempting genetic correction in the iPSC, a genetic engineering tool should be introduced using electroporation, and its efficiency was checked using a GFP expression vector. In order to introduce a GFP expression vector into FPS patient-derived iPSCs, a large amount of cells (at least 1 x 10 5 cells) in undifferentiated state are required. Difficult to introduce GFP expression vectors into 1 x 10 6 FOP patient derived iPSC cells.
  • GFP was introduced into FOP patient derived iPSC cells using electroporation as described in Comparative Example ⁇ 1-1>.
  • iPSC cell lines prepared from FOP patient-derived cell lines expressed similar amounts of GFP to wild-type iPSCs after 1 day of transfection, but on day 15, wild-type iPSCs were expressed in stem cell colonies 48) better.
  • GFP expression (12 total) was also well formed in the colonies formed, whereas in the iPSC cell line constructed with FOP patient-derived cell lines, it was confirmed that 1 to 2 stem cell colonies were formed (FIGS. 5B to 5D). ).
  • the cause of FOP is caused by the sustained activity of Alk2, a mutant protein of ACVR1, which is difficult to form GFP-expressing stem cell colonies after the introduction of the GFP expression vector and treatment with LDN-193189, the ALk2 inhibitor. It was confirmed (Fig. 5e). This indicates that it is difficult to introduce genetic manipulation tools for gene therapy into cells based on iPSCs prepared from FOP patient derived cell lines by known methods.
  • the sgRNA was produced by Tulgen (Korea) to include a protospacer adjacent motif (PAM) sequence (SEQ ID NO: 15: CACACTCCAACAGTGTAATCTGG) in the sgRNA sequence targeting the treatment site for gene therapy of ACVR1 mutation. Thereafter, the T7E1 assay was performed using the method of Example ⁇ 1-3>.
  • PAM protospacer adjacent motif
  • the single-guided RNA produced by the above method cleaved the target by the sgRNA-cas9 endonuclease in HEK293 cells, and also confirmed the cleavage of the target gene in the fibroblasts of FOP patients. .
  • Single-stranded oligodeoxynucleotide templates were prepared as donor DNA for homology-directed repair (HDR).
  • the donor DNA was ordered and made from the Integrated DNA Technology (IDT) company with ssODN consisting of a total of 90 residues, and the position of the donor DNA was mutated because it is intended to correct the ACVR1 c.617G> A mutation.
  • the donor DNA was sequenced with a total of 90 residues on both sides, based on the positions and residues expected to be cut by RGEN.
  • the manufactured ssODN considers three parts largely.
  • the c.617 mutant alanine site contains a wild-type residue because it must be replaced with a wild-type guanine.
  • the donor provided for the calibration.
  • Another mutation could occur in the DNA, which intentionally caused a silent mutation in the PAM sequence so that the calibrated donor was not affected by agen, and third, the genotyping of the final calibrated clone. For screening with), a hidden mutation was induced at the same residue, including a second consideration for the restriction enzyme Hpy188I to recognize.
  • Fibroblasts isolated from FOP patients were subjected to the reprogramming episomal vector prepared in Example ⁇ 1-1>, and sgRNA and ssODN prepared in Examples ⁇ 3-1> and ⁇ 3-2>.
  • simultaneous introduction using electroporation to obtain a portion of iPSC whose gene has been corrected, and extracting genomic DNA to confirm target efficiency of donor DNA, PCR ampoule around the calibration site Lycon was synthesized.
  • the target efficiency of the donor DNA was about 6.5% because the Hpy188I recognition residue was present in the hidden mutation intentionally induced for the convenience of screening through genotyping analysis, which is a consideration in donor DNA production as described above.
  • the efficiency was determined by measuring the intensity of the bands cut in Image J software.
  • on-target including amplicon and three off-target were PCR amplified using hot-start Taq polymerase and SolgTM h-Taq DNA polymerase (SolGent, South Korea).
  • PCR primers used for amplification of each amplicon are shown in Table 2 below.
  • the amplicons were manipulated with a barcoded sequence module, an Illumina Miseq platform for sequencing, adapter ligation, and PCR reactions via 5′-terminal kination. Paired-end reads obtained by multiple parallel sequencing using the Miseq platform were verified against wild type for each amplicon using the BLAST program. Deletion of deletions in less than 20 bases from Pam was determined to have occurred, and the number was confirmed using a Perl script.
  • the deletion region was observed only when the ALK2 primer was used, and the indel frequency of mALK2-hDF was about 8% (excluding 2.1% ssODN-mediated homology-directed target). 6c).
  • the efficiency of ssODN-mediated HDT was found to be 2.1% (FIG. 6D).
  • Example 4> prepared from FOP patient derived cells iPSC Confirm
  • the cells cultured in Example ⁇ 3-5> were extracted DNA of the genome using half of each well, and the PCR amplicon was amplified by using the extracted DNA as a template.
  • PCR 95 5 minutes; 5 repetitions (95 1 min, 62 1 min, 72 1 min); 5 repetitions (95 1 min, 60 1 min, 72 1 min); 25 repetitions (95 1 min, 58 1 min, 72 1 min); 72 was carried out under conditions of 5 minutes, wherein the primer sequence used was a primer (5'-TTTCCCCTTGTCTTAAACCAC-3 ') as shown in SEQ ID NO: 24 to recognize the flanking region of the donor DNA and a primer (5' to SEQ ID NO: 25).
  • Hpy188I was treated for a total of 88 clones in order to confirm whether the PCR amplicon obtained by performing the PCR with -CAAGTTCAGGTGCTCCAACATT-3 ') by the donor DNA.
  • the targeting frequency was confirmed to be about 9%.
  • the targeting frequency was confirmed to be about 9%.
  • one allele was substituted with the allele of the donor DNA and at the same time an indel mutation by algen was generated at the other allele position.
  • the remaining two of the eight clones containing the donor # 13 and # 81 clones had wild type sequences in both alleles. Algen did not affect the wild type allele, but acted only on the mutant allele, so that donor DNA mediated HDR occurred exactly at the mutant allele position (FIG. 6G).
  • PCR amplicons were purified and inserted into a pTOP TA V2 (Engineics, South Korea) vector, and the PCR amplicons were inserted. Sequences were analyzed using known primers for M13 present in the isolated pTOP TA V2 vector (FIG. 6G). In order to confirm the genetic correction of the clones confirmed that the gene was corrected in Example ⁇ 4-1>, the PCR amplicon was purified and primers (5'-AAAAGCAGATTTTCCAAGTTCCA-3 ') described in SEQ ID NO: 26 were used. Sequence analysis was commissioned.
  • the iPSC derived from the genetically modified FOP patient is similar to the wild type iPSC, and was cultured without any limitation in culture.
  • Alkaline phosphatase staining was performed as described in Comparative Example ⁇ 1-2> to confirm the expression of alkaline phosphatase in iPSCs derived from genetically modified FOP patients induced by the method of ⁇ Example 3>.
  • OCT4, SOX2, LIN28A, ESG1, GDF3, DNMT3B genes known as typical multipotential markers in iPSCs derived from genetically modified FOP patients induced by the method of ⁇ Example 3> was described in Comparative Example ⁇ 1-3>. This was confirmed by performing a semi-quantitative RT-PCR as described.
  • the iPSC was subcutaneously injected into NOD-SCID mice to determine whether teratoma was formed by iPSCs derived from genetically modified FOP patients induced by the method of ⁇ Example 3>. Specifically, 3 ⁇ 10 5 iPSCs were suspended in stem cell culture medium (mTeSR1) present with 30% matrigel (BD Biosciences) and injected subcutaneously in NOD-SCID mice. Teratomas were obtained 6 weeks after transplantation, fixed in paraffin for 16 hours, treated with 16% formalin, and then sequentially divided into 5 micron sections. All sections were stained with hematoxylin and iosin. All animal care and experiments were conducted under KRIBB IACUC approval.
  • mTeSR1 stem cell culture medium
  • matrigel BD Biosciences
  • teratomas different from the three germ layers including neural rosette (ectoderm), adipocytes (mesoderm), and epithelial cells (endoderm), such as the intestine, were formed (FIG. 9C).
  • neural rosette ectoderm
  • adipocytes meoderm
  • epithelial cells endoderm
  • iPSCs derived from genetically corrected FOP patients have a general karyotype as shown in FIG. 9D (FIG. 9D).
  • FOP is a disease that shows a tendency to ossify while containing minerals in cells, the most basic unit constituting muscle or connective tissue. It was confirmed by the von Kossa staining method that the genetic correction effect of the genetically treated stem cells produced in somatic cells derived from FOP patients compared to the untreated stem cells derived from FOP patients.
  • each 5 x 10 4 stem cells were cultured in a 24-well tissue culture plate coated with Matrigel (matrigel). 24 hours after incubation, mineral differentiation medium [4 ⁇ M dexamethasone (Sigma, Sigma, USA), 50 ⁇ g / ml L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate (L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate, sigma, US), 50 ⁇ g / ml ⁇ -glycerolphosphate disodium salt hydrate ( ⁇ -glycerophosphate disodium salt hydrat, Sigma, USA), and DMEM with 20% FBS] induced differentiation for 7 days or 14 days, respectively.
  • mineral differentiation medium [4 ⁇ M dexamethasone (Sigma, Sigma, USA)
  • 50 ⁇ g / ml L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate, sigma, US
  • Samples obtained by date were fixed in 10% formaldehyde for 5 minutes, washed 2 to 3 times with tap water, stained with 5% silver nitrate for 30 minutes, and washed again with tap water 2 to 3 times. Then, after reacting with 5% sodium carbonate and 10% formaldehyde solution for 2 minutes, it was confirmed to turn black by the reaction, and the image was taken with a digital camera.
  • the stem cells genetically corrected from the FOP patient-derived cell line through a one-step method showed a similar form to the wild-type iPSC, whereas a large amount of stem cells prepared from the FOP patient-derived cells.
  • the dark part appeared strong by containing minerals (FIG. 10).
  • the iPSC preparation method of the present invention effectively produced iPSC from FOP patient-derived fibroblasts, which had been difficult to manufacture, and confirmed that it can be used for FOP treatment.
  • the application of the above technique in the development of cell therapy products through gene therapy with intractable genetic diseases can effectively reduce costs, time, labor, etc. It will be possible to perform universal customized treatments.
  • the method effectively secures mutant clones. can do.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Transplantation (AREA)
  • Developmental Biology & Embryology (AREA)

Abstract

본 발명은 유도만능줄기세포(induced pluripotent stem cell, iPSC) 제작 요소 및 유전자 치료 요소를 결합한 원-스텝(one-step) 방법을 통해 환자 유래 체세포주로부터 유전자 치료된 유도만능줄기세포를 제작하는 방법에 관한 것으로, 상기 원-스텝(one-step)에 의해 유전적 변형을 갖는 유도만능줄기세포(induced puripotenet stem cell, iPSC) 제조방법은 성체 체세포의 역분화를 유도하는 리프로그래밍 에피좀 벡터, 및 유전자 교정 또는 돌연변이 유발 전달체를 동시에 숙주세포로 도입하여 유전자 교정된 iPSC 또는 돌연변이 유발된 질환모델 iPSC를 제조할 수 있고, 상기 유전자가 교정되거나, 돌연변이가 유발된 iPSC가 다른 종류의 정상형의 iPSC와 동일한 특징 및 상이한 특징을 나타냄으로써 질환치료용 세포치료제 또는 치료물질의 스크리닝에 사용할 수 있다.

Description

일체형 유전자 치료 유도만능줄기세포 제작방법
본 발명은 유도만능줄기세포(induced pluripotent stem cell, iPSC) 제작 요소 및 유전자 조작 요소를 결합하여 원-스텝(one-step)으로 체세포주로부터 유전자 교정 또는 질환모델의 iPSC 제조방법에 관한 것이다.
정밀한 유전자 조작 기술의 발달은 유전자 연구(genetic study)뿐만 아니라, 더욱 효과적으로 의료에의 적용을 촉진하였다. 징크-핑거 뉴클레아제(zinc-finger nucleases, ZFN), 전사 활성화인자-성 작동인자 뉴클레아제(transcription activator-like effector nucleases, TALEN), 및 짧은 회귀성 반복-카스9 뉴클레아제 시스템(short palindromic repeat-cas9 nuclease system)을 규칙적으로 갖는 미생물 무리(microbial cluster)로부터의 RNA-안내 엔도뉴클라제(RNA-guided endonucleases, RGEN)를 포함하는 강력한 분자 가위로서의 유전자 조작 도구(genome editing tool)는 박테리아 인공 염색체(bacterial artificial chromosome)를 기초로 한 상동 재조합(homologous recombination)을 응용한 방법과 더불어, 표적 유전자를 게놈(genome)으로부터 효과적으로 삽입(insert), 제거(delete) 또는 치환(replace)할 수 있도록 한다.
유도만능줄기세포(induced pluripotent stem cell, iPSC)의 발견은 자가유래의 줄기세포 이식(autologous stem cell transplantation) 및 인간 질병 모델의 새로운 전략을 위한 새로운 길을 열었고, 이는 신경질환, 혈액기형, 척수손상, 심장질환, 당뇨 및 관절염과 같은 다양한 범위의 질환에 적용될 수 있을 것이다. 게다가, 질환 모델로써의 iPSC는 상기 서술한 유전자 조작 도구와 결합할 때 더욱 유용할 것이다. 최근 연구에 의하면 세포 대체치료(cell replacement therapy) 또는 기전 연구를 통한 질병의 발병 매커니즘 연구에 적용하기 위해 유전자 조작 도구를 사용하여 유전자-변형 iPSC가 제조되었으며, 또한 상기 iPSC의 유전자 조작 효율을 증가시키기 위한 방법도 연구되고 있다(Daisy A, et al., Nature, 481: 295-305, 2012).
이와 같이, 유전자 조작 도구를 이용하여 배아줄기세포(embryonic stem cells)와 매우 유사한 인간 iPSC를 제조할 수 있는 이유는 줄기세포가 자기재생(self-renewal)을 유지하면서 끊임없이 분열하는 점 때문이다. 게다가, 무기한으로 자랄 수 있는 다양한 종류의 세포주가 있음에도 iPSC가 다양한 세포로의 분화할 수 있는 능력이 있어, iPCS에 유전자 조작도구를 적용하여 유전자 조작된 iPSC를 제조하기 위해 많은 연구가 진행 중에 있다(Matthias Stadtfeld et al., Science, 322(5903): 945-949, 2008). 그러나, 기존의 유전자 조작 도구를 iPSC에 적용하기 위해서는 일반적으로 유도만능줄기세포를 제작하고, 제작된 유도만능줄기세포에 유전자 조작도구를 도입해야 하는 단계를 거쳐야 하는 단점이 있다. 즉, 노동력, 비용, 시간 투여 등의 번거로운 과정이 필요하다.
진행성 골화성 섬유이형성증(fibrodysplasia ossificans progressiva, FOP)은 선천성 질환으로 ACVR1 유전자에 상염색체 우성 돌연변이(autosomal dominant mutation)에 의해 결합조직(connective tissue) 및 근육조직(muscle tissue)의 이소성골화(heterotopic ossification)를 형성하는 질환이다. ACVR1 유전자는 제 1형 액티빈 A 수용체(activin A type I receptor)를 암호화하고 있고, ALK2라고도 불리는데, 진행성 골화성 섬유이형성증의 대표적인 돌연변이 형태는 ACVR1 p.R206H이며, 이 유전자에서 발현된 수용체 단백질이 활성화되어 이 질환을 유발한다.
FOP 환자로부터 유래된 iPSC의 제조 시에는 환자유래 세포의 ACVR1 p.R206H에 유전적 변이가 나타남으로써 iPSC 생산 단계에서 이례적으로 콜로니(colony)가 확인되었다 하더라도, 이 콜로니는 줄기세포로써 비정형성을 나타내며, 상기 iPSC를 미분화상태(undifferentiated status)로 유지하는 것이 어렵다고 알려져 있다. 따라서, FOP 환자 유래의 iPSC에 유전자 조작 도구를 도입하는 것은 제한이 있고, 이는 연구자들로 하여금 FOP 유래 체세포에 직접적인 유전자 조작을 적용하기 위해 다른 방법을 시도하게 만든다.
이에, 본 발명자들은 iPSC의 제조를 용이하게 할 수 있고, FOP와 같이 환자 유래 iPSC의 제조가 어려운 문제를 해결하고자 실험을 수행하던 중, 성체 체세포의 역분화를 유도하는 리프로그래밍 에피좀 벡터, 및 유전자 교정 또는 돌연변이 유발 전달체를 동시에 성체 체세포로 도입하여 유전자 교정된 iPSC 또는 돌연변이 유발된 질환모델 iPSC를 제조할 수 있고, 상기 유전자가 교정되거나, 돌연변이가 유발된 iPSC가 다른 종류의 정상적인 iPSC와 동일한 특징 또는 상이한 특징을 나타냄을 확인함으로써 본 발명을 완성하였다.
본 발명의 목적은 유도만능줄기세포(induced pluripotent stem cell, iPSC) 제작 요소 및 유전자 치료 요소를 결합한 원-스텝(one-step) 방법을 통해 환자 유래 체세포주로부터 유전자 치료된 유도만능줄기세포, 및 유전자 기능 연구를 위해 체세포로부터 유전자 편집된 유도만능줄기세포를 제작하는 방법을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 하기를 포함하는 유전자 교정된 iPSC의 제조방법을 제공한다:
1) 개체에서 분리된 성체 체세포에 리프로그래밍 에피좀 벡터(reprogramming episomal vector) 및 돌연변이 교정 전달체를 동시에 도입하여 유도만능줄기세포(induced pluripotent stem cell, iPSC)를 제조하는 단계; 및
2) 상기 단계 1)의 제조된 iPSC를 선별하는 단계.
또한, 본 발명은 하기를 포함하는 유전자 교정된 iPSC의 제조방법을 제공한다:
1) FOP 환자에서 분리된 섬유아세포에 리프로그래밍 에피좀 벡터(reprogramming episomal vector), 서열번호 1로 구성되는 sgRNA 및 서열번호 2로 구성되는 ssODN으로 구성된 군으로부터 선택된 어느 하나를 동시에 도입하여 유도만능줄기세포(induced pluripotent stem cell, iPSC)를 제조하는 단계; 및
2) 상기 단계 1)의 제조된 iPSC를 선별하는 단계.
아울러, 본 발명은 하기를 포함하는 질환모델 iPSC의 제조방법을 제공한다:
1) 분리된 성체 체세포에 리프로그래밍 에피좀 벡터 및 돌연변이 유발 전달체를 동시에 도입하여 유도만능줄기세포(induced pluripotent stem cell, iPSC)를 제조하는 단계; 및
2) 상기 단계 1)의 제조된 iPSC를 선별하는 단계.
본 발명의 원-스텝(one-step)에 의해 유전적 변형을 갖는 유도만능줄기세포(induced puripotenet stem cell, iPSC) 제조방법은 성체 체세포의 역분화를 유도하는 리프로그래밍 에피좀 벡터, 및 유전자 교정 또는 돌연변이 유발 전달체를 동시에 숙주세포로 도입하여 유전자 교정된 iPSC 또는 돌연변이 유발된 질환모델 iPSC를 제조할 수 있고, 상기 유전자가 교정되거나, 돌연변이가 유발된 iPSC가 다른 종류의 정상형의 iPSC와 동일한 특징 및 상이한 특징을 나타냄으로써 질환치료용 세포치료제 또는 치료물질의 스크리닝에 사용할 수 있다.
도 1a는 히포크산틴-구아닌 포스포리보실전이효소 1(Hypoxanthine-Guanine Phosphoribosyltransferase 1, Hprt1)가 녹아웃(knockout)된 유도만능줄기세포(induced puripotenet stem cell, iPSC)를 제조하기 위한 TALEN 및 Hprt1 서열의 쌍을 나타내는 도이다.
도 1b는 TALEN 플라스미드가 형질감염된 섬유아세포주의 게노믹(genomic) DNA를 주형으로 생산된 PCR 산물로 수행한 T7 엔도뉴클레아제 I(T7 endonuclease I, T7EI) 어세이(assay) 결과를 나타내는 도이다.
도 1c는 원-스텝(one-step)으로 Hprt1가 녹아웃된 iPSC 제조방법을 나타내는 도이다.
도 1d는 Hprt1 돌연변이가 유발된 클론의 단일-가닥 구조다형성(single-strand conformation polymorphism, SSCP) 어세이 결과를 나타내는 도이다.
도 1e는 Hprt1 돌연변이가 유발된 클론의 히포크산틴 아미노프테린 티미딘(Hypoxanthine-aminopterin thymidine, HAT) 배지에서의 민감성 및 6-티오구아닌(6-thioguanine, 6-TG)에 저항성을 확인한 도이다.
도 1f는 SSCP 어세이, 또는 HAT 또는 6-TG 처리에 의한 Hprt1 돌연변이가 유발된 클론의 서열을 확인한 도이다.
도 2a는 Hprt1 돌연변이 iPSC의 네거티브 선별(negative selection)을 나타내는 도이다:
i: 인간 섬유아세포;
ii: 네거티브 선별되거나 선별되지 않은 Hprt1 돌연변이 iPSC;
iii: 6-TG 처리 1일 후; 및
iV: 6-TG 처리 5일 후.
도 2b는 생성된 Hprt1 돌연변이 iPSC의 수를 확인한 도이다.
도 2c는 정상형 또는 Hprt1 돌연변이 iPSC로부터 수득된 PCR 산물의 T7EI 어세이 결과를 나타내는 도이다.
도 3a는 AAVS1 유전자를 위한 단일-가이드 RNA(single-guided RNA, sgRNA)를 나타내는 도이다.
도 3b는 sgRNA가 도입된 섬유아세포의 게놈 (genomic) DNA를 주형으로 생산된 PCR 산물로 수행한 T7 엔도뉴클레아제 I(T7 endonuclease I, T7EI) 어세이(assay) 결과를 나타내는 도이다.
도 3c는 원-스텝(one-step)으로 sgRNA가 도입된 iPSC 제조방법을 나타내는 도이다.
도 3d는 정상형 또는 sgRNA가 도입된 iPSC로부터 수득된 PCR 산물의 T7EI 어세이 결과를 나타내는 도이다.
도 3e는 sgRNA에 의해 유전자 결실이 일어난 클론의 서열을 확인한 것이다.
도 4a는 FOP 환자 유래 세포주로부터 기존의 방법으로 iPSC로 분화유도 후 생성된 콜로니를 나타내는 도이다.
도 4b는 기존의 방법으로 제조된 FOP 환자 유래 iPSC의 분화 상태를 나타내는 도이다.
도 4c는 기존의 방법으로 제조된 FOP 환자 유래 iPSC의 전분화능 마커의 발현을 세미-정량(semi-quantitative) RT-PCR로 확인한 도이다.
도 5a는 FOP 환자 유래 iPSC에 GFP 발현 벡터를 도입하고 1일 후, GFP의 발현을 확인한 도이다.
도 5b는 FOP 환자 유래 iPSC에 GFP 발현 벡터를 도입하고 15일 후, GFP의 발현을 확인한 도이다.
도 5c는 도 5b를 확대하여 나타낸 도이다.
도 5d는 도 5c에서 보이는 알칼리 포스파타제(alkine phsphatase)와 GFP 발현 세포주를 나타내는 도이다.
도 5e는 FOP 환자 유래 iPSC에 GFP 발현 벡터를 도입한 후, LDN-193189를 농도별로 처리하여 FOP 환자 유래 iPSC의 GFP 발현 및 알칼리 포스파타제 염색 결과를 나타내는 도이다.
도 6a는 ACVR1 유전자를 위한 단일-가이드 RNA(single-guided RNA, sgRNA)를 나타내는 도이다.
도 6b는 FOP 유래 섬유아세포에 단일-가닥 올리고데옥시뉴클레오티드(single-strand oligodeoxynucleotide, ssODN) 주형매개의 복구상동인도복구(homology-directed repair, HDR) 효율을 나타내는 도이다.
도 6c는 심층 염기서열 분석을 통해 FOP 유래 섬유아세포에 도입된 sgRNA의 표적 효율을 나타내는 도이다.
도 6d는 심층 염기서열 분석을 통해 FOP 유래 섬유아세포에 도입된 ssODN의 표적 효율을 나타내는 도이다.
도 6e는 FOP 유래 섬유아세포로부터 유전자 교정된 iPSC를 제조하는 방법을 나타내는 도이다.
도 6f는 유전자 교정된 FOP 환자 유래 iPSC의 후보군을 찾기 위한 유전형을 분석한 결과를 나타내는 도이다.
도 6g는 상동인도복구된 FOP 환자 유래 iPSC의 서열 분석 결과를 나타낸 도이다.
도 7a는 ACVR1 sgRNA에 대한 온-타겟(on-target)과 오프-타겟(off-target) 후보군을 나타내는 도이다.
도 7b는 오프-타겟을 확인하기 위해 ACVR1과 오프-타겟 후보 유전자인 FILIP1L, RIC8A 및 BYSL의 서열과 PCR 증폭을 위한 프라이머 결합 부위를 나타내는도이다.
도 7c는 오프-타겟 후보군들에 대한 T7 엔도뉴클레아제 어세이 방법을 통해 오프-타겟 여부 및 ACVR1 sgRNA의 효율을 나타내는 도이다.
도 8은 FOP 환자 유래 섬유아세포 및 유전자 교정된 iPSC의 서열분석 결과를 나타내는 도이다.
도 9a는 유전자가 교정된 FOP 환자 유래 iPSC에서 알칼리 포스파타제의 발현을 확인한 도이다.
도 9b는 유전자가 교정된 FOP 환자 유래 iPSC에서 다분화능 마커의 발현을 확인한 도이다.
도 9c는 유전자가 교정된 FOP 환자 유래 iPSC를 이용하여 기형종의 형성을 확인한 도이다.
도 9d는 유전자가 교정된 FOP 환자 유래 iPSC의 핵형 분석 결과를 나타내는 도이다.
도 10a는 줄기세포배지에서 배양한 iPSC에 대한 본 코사(von kossa) 염색 결과를 나타내는 도이다.
도 10b는 미네랄 분화 조건에서 배양한 분화세포에 대한 본 코사 염색 결과를 나타내는 도이다.
이하, 본 발명의 용어를 설명한다.
본 명세서에 사용된 용어 '원-스텝(one-step)은 리프로그래밍(reprogramming) 및 유전자 편집(gene-editing)을 동시에 도입하는 것을 의미한다.
본 명세서에 사용된 용어 '리프로그래밍 에피좀 벡터(reprogramming episomal vector)'는 염색체에 유입되지 않은 벡터, 즉, 에피좀 벡터에서 역분화를 유도할 수 있는 OCT4, shp53, SOX2, Klf4, Lin28 및 L-myc과 같은 전사조절 유전자가 발현될 수 있도록 제작된 벡터를 의미한다.
예를 들어, OCT4, shp53, SOX2, Klf4, Lin28 및 L-myc로 이루어지는 군에서 선택되는 어느 하나 이상의 전사조절 유전자를 포함하는 벡터를 의미할 수 있다.
상기 벡터는 OCT4-shp53를 포함하는 벡터, Sox2-Klf4를 포함하는 벡터, 및 Lin28-L-myc를 포함하는 벡터를 의미할 수 있으나, 이에 한정하지 않는다.
본 명세서에서 사용된 용어 '레쉬니한 신드롬(Lesch-nyhan syndrome)'은 히포크산틴-구아닌 포스포리보실전이효소 1(Hypoxanthine-Guanine Phosphoribosyltransferase 1, Hprt1) 유전자의 기능이 상실되어 나타나는 질환이다.
본 명세서에서 사용된 용어 '탈렌(TALEN)'은 DNA 표적 부위를 특이적으로 인지하는 TAL 영향 DNA 결합 도메인(TAL effect DNA binding domain)이 결합되어 있는 제한효소에 의해 DNA 표적 부위를 자르는 시스템을 의미한다.
본 명세서에 사용된 용어 '골화성 섬유이형성증(fibrodysplasia ossificans progressiva, FOP)'은 ACVR1 유전자의 돌연변이에 의한 기능성 획득(gain-of function)을 통해 계속적으로 BMP 신호전달이 유도되기 때문에, BMP 신호전달에 의한 뼈 발달이 촉진되어, 근육이나 연결조직들이 골화되는 질환이다.
본 명세서에 사용된 용어 '단일-가이드 RNA(single-guided RNA, sgRNA)'는 표적 DNA 서열에 상보성을 갖는 RNA로 crRNA 및 tracrRNA로 구성되어 있다.
본 명세서에 사용된 용어 '단일-가닥 올리고데옥시뉴클레오티드(single-strand oligodeoxynucleotide, ssODN)'는 한가닥의 DNA로 구성되어 있고, 비정상 염기(base)를 정상 염기로 교체하기 위하여 정상 유전자의 공여자(donor)로 사용된다.
이하, 본 발명을 상세히 설명한다.
상기목적을 달성하기 위하여, 본 발명은 하기를 포함하는 유전자 교정된 iPSC의 제조방법을 제공한다:
1) 개체에서 분리된 성체 체세포에 리프로그래밍 에피좀 벡터(reprogramming episomal vector) 및 돌연변이 교정 전달체를 동시에 도입하여 유도만능줄기세포(induced pluripotent stem cell, iPSC)를 제조하는 단계; 및
2) 상기 단계 1)의 제조된 iPSC를 선별하는 단계.
상기 개체는 돌연변이가 발생하거나 발생할 가능성이 있는 인간을 포함하는 모든 동물을 의미할 수 있다. 상기 동물은 인간을 포함하며, 소, 말, 양, 돼지, 염소, 낙타, 영양, 개, 고양이 등의 포유동물일 수 있으나, 이에 한정하지 않는다.
상기 단계 1)의 개체는 골화성 섬유이형성증(fibrodysplasia ossificans progressiva, FOP) 또는 판코니 빈혈(fanconi anemia) 환자인 것이 바람직하나 이에 한정하지 않으며, 유전자의 돌연변이에 의해 발생할 수 있는 질환의 환자이면 모두 적용가능하다.
상기 단계 1)의 성체 체세포는 인간 유래 섬유아세포인 것이 바람직하나 이에 한정하지 않으며, 원숭이, 돼지, 말, 소, 양, 개, 고양이, 생쥐, 토끼 등 모든 동물 유래 체세포를 모두 사용할 수 있다. 또한, 상기 iPSC의 배양은 당업계에서 일반적으로 사용되는 배아줄기세포 배양조건으로 배양되는 것이 바람직하나 이에 한정하지 않는다.
상기 단계 1)의 리프로그래밍 에피좀 벡터는 Oct4, shp53, Sox2, Klf4, Lin28 및 L-myc으로 구성된 군으로부터 선택되는 어느 하나 이상을 포함하는 것이 바람직하나 이에 한정하지 않는다.
상기 단계 1)의 돌연변이 교정 전달체는 유전자 가위를 포함하는 것이 바람직하고, 상기 유전자 가위는 ZFN(zinc-finger nuclease), TALEN(transcription activator-like effector nuclease) 및 RGEN(RNA-guided DNA endonuclease)으로 구성된 군으로부터 선택되는 어느 하나를 포함하는 것이 바람직하나, 본 발명의 실시예에 의하면 RGEN을 이용하여 수행하였다. 또한, 상기 RGEN 유전자 가위를 이용하는 돌연변이 교정 전달체는 단일-가이드 RNA(single-guided RNA, sgRNA) 또는 단일-가닥 올리고데옥시뉴클레오티드(single-strand oligodeoxynucleotide, ssODN)를 포함하는 것이 바람직하나 이에 한정하지 않는다.
상기 sgRNA는 서열번호 27로 구성되거나, ACVR1 p.R206H 돌연변이를 표적으로 하는 것이 바람직하나 이에 한정하지 않는다.
상기 ssODN은 서열번호 28으로 구성되거나, ACVR1 c.617G>A 돌연변이를 복구하기 위한 것이 바람직하나 이에 한정하지 않는다.
상기 방법으로 제조된 유전자 교정된 iPSC는 배양 후 3 내지 4주일 때 1차적인 iPSC 콜로니들을 분리하여 마트리겔(matrigel)이 코팅된 플레이트로 옮겨 배양을 지속하는 것을 특징으로 하나 이에 한정하지 않는다. 또한, 상기 iPSC는 섬유아세포 배지에 48시간 동안 배양한 후, 줄기세포 배지로 교체하여 배양을 지속하는 것이 바람직하나 이에 한정하지 않는다.
또한, 상기 방법으로 제조된 유전자 교정된 iPSC는 대립 유전자 중에 적어도 하나는 공여체 DNA가 표적에 삽입되어 있고, 동시에 다른 대립유전자 위치에 알젠에 의한 삽입-결실(indel) 돌연변이가 생성되는 것이 바람직하나 이에 한정하지 않는다.
상기 단계 1)에서 제조된 iPSC를 선별하는 상기 단계 2)는 당업계에서 공지된 유전자 교정 여부를 확인하는 방법으로 선별할 수 있다.
본 발명의 바람직한 실시예에서, 본 발명자들은 원-스텝(one-step) 전략을 이용하여 골화성 섬유이형성증(fibrodysplasia ossificans progressiva, FOP) 환자 유래 세포주로부터 iPSC를 제조하기 위하여, ACVR1 p.R206H 돌연변이를 표적으로 하는 단일-가이드 RNA(single-guided RNA, sgRNA) 또는 단일-가닥 올리고데옥시뉴클레오티드(single-strand oligodeoxynucleotide, ssODN) 주형을 리프로그래밍 에피좀 벡터와 함께 전기천공법으로 FOP 환자 유래 섬유아세포에 도입한 뒤, 이를 확인한 결과 292 bp 길이의 PCR 앰플리콘으로부터 각각 191 bp 및 101 bp 길이로 잘린 두 개의 밴드가 확인되었으며, 공여체 DNA 제작시 고려사항인 유전형질 분석을 통한 스크리닝의 편의를 위해 의도적으로 유발한 숨은 돌연변이를 통해 공여체 DNA의 표적 효율성이 약 6.5%임을 확인하였다(도 6b 참조).
또한, 상기 방법으로 제조된 유전자 교정된 FOP 환자 유래 iPSC의 유전형을 분석한 결과, 유전형을 확인한 88개의 클론 중 8개의 클론은 대립 유전자 중에 적어도 하나는 공여체 DNA가 표적에 삽입되어 있었고, 표적 빈도(targeting frequency)는 약 9%로 확인되었고(도 6g 참조), 서열분석 결과, FOP 환자에서 돌연변이된 잔기가 야생형의 공여자 DNA로 치환된 것을 확인하였다(도 8 참조).
또한, 본 발명의 유전자 교정된 FOP 환자 유래 iPSC의 알칼리 포스파타제의 발현을 확인한 결과, 유전자가 교정된 FOP 환자 유래 iPSC에서 강한 알칼리 포스파타제의 발현이 관찰되었다(도 9a 참조). 다분화능 마커의 발현을 확인한 결과 SOX2 및 DNMT3B의 발현이 FOP 환자 유래 iPSC에서는 감소하였으나, 유전자가 교정된 FOP 환자 유래 iPSC에서는 정상형과 유사한 정도로 강하게 발현하였으며(도 9b 참조), 핵형을 분석한 결과, 유전자 교정된 FOP 환자 유래 iPSC가 일반적인 핵형을 가지고 있음을 확인하였다(도 9c).
또한, 본 발명의 유전자 교정된 FOP 환자 유래 iPSC의 유전자 교정 효과를 확인한 결과, FOP 환자 유래 세포주로부터 원스텝(one-step) 방법을 통해 유전자 교정된 줄기세포는 야생형 iPSC와 유사한 형태를 보이는 반면, FOP 환자 유래 세포로부터 제작된 줄기세포의 경우 다량의 미네랄을 함유하여 검은 부분이 강하게 나타나는 것을 확인하였다(도 10 참조).
결론적으로, 본 발명의 iPSC 제조방법은 기존에 제작이 어려웠던 FOP 환자 유래 섬유아세포로부터 효과적으로 iPSC를 제조하였고, 이를 FOP 치료에 사용할 수 있음을 확인하였다.
또한, 본 발명은 하기를 포함하는 유전자 교정된 iPSC의 제조방법을 제공한다:
1) FOP 환자에서 분리된 섬유아세포에 리프로그래밍 에피좀 벡터(reprogramming episomal vector), 서열번호 27로 구성되는 sgRNA 및 서열번호 28으로 구성되는 ssODN으로 구성된 군으로부터 선택된 어느 하나 이상을 동시에 도입하여 유도만능줄기세포(induced pluripotent stem cell, iPSC)를 제조하는 단계; 및
2) 상기 단계 1)의 제조된 iPSC를 선별하는 단계.
아울러, 본 발명은 하기를 포함하는 질환모델 iPSC의 제조방법을 제공한다:
1) 분리된 성체 체세포에 리프로그래밍 에피좀 벡터 및 돌연변이 유발 전달체를 동시에 도입하여 유도만능줄기세포(induced pluripotent stem cell, iPSC)를 제조하는 단계; 및
2) 상기 단계 1)의 제조된 iPSC를 선별하는 단계.
상기 단계 1)의 성체 체세포는 인간 유래 섬유아세포인 것이 바람직하나 이에 한정하지 않으며, 원숭이, 돼지, 말, 소, 양, 개, 고양이, 생쥐, 토끼 등 모든 동물 유래 체세포를 모두 사용할 수 있다. 또한, 상기 iPSC의 배양은 배아줄기세포 배양조건으로 배양되는 것이 바람직하나 이에 한정하지 않는다.
상기 단계 1)의 리프로그래밍 에피좀 벡터는 Oct4, shp53, Sox2, Klf4, Lin28 및 L-myc으로 구성된 군으로부터 선택되는 어느 하나 이상을 발현하는 것이 바람직하나 이에 한정하지 않는다.
상기 단계 1)의 돌연변이 유발 전달체는 유전자 가위를 포함하는 것이 바람직하고, 상기 유전자 가위는 ZFN(zinc-finger nuclease), TALEN(transcription activator-like effector nuclease) 및 RGEN(RNA-guided DNA endonuclease)으로 구성된 군으로부터 선택되는 어느 하나를 포함하는 것이 바람직하나, 본 발명의 실시예에 의하면 TALEN을 선택하여 사용하였다. 또한, 상기 TALEN을 포함하는 돌연변이 유발 전달체는 히포크산틴-구아닌 포스포리보실전이효소 1(Hypoxanthine-Guanine Phosphoribosyltransferase 1, Hprt1)을 녹아웃시키는 것이 바람직하나, 이에 한정하지 않으며, Hprt1을 녹아웃시키기 위해 TALEN에 인식되는 유전자 서열은 서열번호 29 또는 서열번호 30로 구성된 서열을 포함하는 것이 바람직하나 이에 한정하지 않는다.
상기 Hprt1은 서열번호 31으로 구성된 것이 바람직하나 이에 한정하지 않는다.
상기 질환은 레쉬니한 증후군(Lesch-Nyhan syndrome)인 것이 가장 바람직하나, 특정 유전자의 돌연변이에 의해 발생하는 질환으로 대사질환, 암 질환, 뇌질환, 심혈관 질환, 혈액질환, 골질환 등을 모두 포함하는 모든 유전질환에 적용가능하다.
상기 방법으로 제조된 유전자 교정된 iPSC는 배양 후 3 내지 4주일 때 1차적인 iPSC 콜로니들을 분리하여 마트리겔(matrigel)이 코팅된 플레이트로 옮겨 배양을 지속하는 것을 특징으로 하나 이에 한정하지 않는다. 또한, 상기 iPSC는 섬유아세포 배지에 48시간 동안 배양한 후, 줄기세포 배지로 교체하여 배양을 지속하는 것이 바람직하나 이에 한정하지 않는다.
본 발명의 바람직한 실시예에서, 본 발명자들은 원-스텝(one-step) 전략을 이용한 레쉬니한 증후군(Lesch-Nyhan syndrome)의 특징을 갖는 유도만능줄기세포(induced pluripotent stem cell, iPSC)를 제조하기 위하여, 히포크산틴-구아닌 포스포리보실전이효소 1(Hypoxanthine-Guanine Phosphoribosyltransferase 1, Hprt1) 녹아웃 벡터 및 리프로그래밍 에피좀 벡터(reprogramming episomal vector)를 동시에 전기천공법으로 정상형의 섬유아세포에 도입하였고, 그 결과 약 10%의 효율로 유전자 조작이 일어난 것을 확인하였고(도 1b 참조), 알칼리 포스파타제 염색 결과 상기 방법으로 제조된 일부 클론에서 리프로그래밍과 동시에 유전자 조작이 동시에 수행되었고, 그 효율은 대조군과 비교하여 36%로 나타났다(도 1c 및 도 2a 참조).
또한, 상기 방법으로 생성된 세포로부터 유전자 조작된 iPSC를 선별하여 돌연변이 부근의 서열을 분석하여 이를 확인한 결과, Hprt1이 제거되어 6-TG에 저항성을 나타내는 클론들의 일부가 정상형에서 다른 형태의 단일-가닥 구조다형성을 나타낼 뿐만 아니라(도 1d 참조), 히포크산틴 아미노프테린 티미딘(Hypoxanthine-aminopterin thymidine) 배지에서 성장이 가능하고(도 1e 참조), 서열분석 결과 TALEN의 왼쪽 및 오른쪽 팔에서 염기들의 삽입 또는 결실을 확인하였다(도 1f 참조).
아울러, T7 엔도뉴클레아제 I(T7 endonuclease I, T7E1) 어세이(assay)를 통한 유전자 조작된 iPSC를 확인한 결과, 재생된 DNA 혼합생산물(mixture product)이 모두 T7E1에 의해 잘림으로써(도 2c 참조), 모든 분리된 클론들이 TALEN에 의해 돌연변이가 일어났음을 확인하였다.
결론적으로, 본원발명의 질환모델 iPSC의 제조방법은 정상형의 성체 체세포로부터 단시간에 경제적으로 질환모델 iPSC를 제조할 수 있으므로, 상기 질환모델 iPSC를 이용한 특정 질환의 약물 스크리닝에 유용하게 사용될 수 있다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명의 내용을 예시하는 것일 뿐, 본 발명의 범위가 하기 실시예에 의해 한정되는 것은 아니다.
< 실시예 1> 원-스텝(one-step) 전략을 이용한 레쉬니한 증후군( Lesch - Nyhan syndrome)의 특징을 갖는 유도만능줄기세포 (induced pluripotent stem cell, iPSC )의 제조
<1-1> 히포크산틴 -구아닌 포스포리보실전이효소 1의 녹아웃 및 리프로그래밍에피좀 벡터의 도입
X-염색체와 연결된 히포크산틴-구아닌 포스포리보실전이효소 1(Hypoxanthine-Guanine Phosphoribosyltransferase 1, Hprt1)의 결핍에 의해 발생하는 레쉬니한 증후군의 유전적 특징을 갖는 세포주를 다음과 같은 방법으로 제조하였고, 상기 세포주를 제조하기 위해 리프로그래밍 에피좀 벡터(reprogramming episomal vector, Addgene, 미국)를 사용하였는데, 이는 일본의 신야 야마나카에 의해 제조된 것으로 앱스테인-B-바이러스(Ebstein-B-virus)의 바이러스 유전자인 EBNA-1이 도입된 pCXLE라는 벡터인데, 바이러스처럼 에피좀의 성격을 나타내는 특징이 있다. 이 빈 벡터에 OCT4-shp53, Sox2-Klf4, Lin28-L-myc이 각각 짝을 이루어 존재하고, 특히 OCT4-shp53의 경우 OCT4는 CAG 프로모터에 의해, shp53은 U6 프로모터에 의해 발현되며 그 외 나머지 유전자들은 모두 CAG 프로모터의 조절을 받는다.
구체적으로, 1 x 106 개의 섬유아 세포주를 150 ㎕의 R-버터에서 희석한 후, 2 ㎍의 X-염색체 연결된 히포크산틴-구아닌 포스포리보실전이효소 1을 녹아웃(knock out) 시키기 위한 TALEN 벡터(vector)(도 1a), 및 1.5 ㎍의 세포의 리프로그래밍(reprogramming)을 위한 리프로그래밍 에피좀 벡터(reprogramming episomal vector)를 첨가하여 Neon 전기천공기를 사용하여 1,200 V, 30 ms, 2x pulses의 조건으로 전기천공법을 이용하여 상기 섬유아 세포주에 동시에 도입하였다. 도입 후, 48시간 동안 섬유아세포 배지(10% FBS가 포함된 DMEM 배지)에 배양하였고, 도 1b에 나타난 바와 같이 유전자 조작 효율은 약 10%인 것으로 확인되었다(도 1b). 상기 제조된 세포를 섬유아세포 배지에 배양한 48시간 후, 줄기세포 배지(mTesR1)로 교체하여 세포를 배양하였다. 줄기세포 배지에서 배양 2주 후, 미성숙한 iPSC가 형성되면 1x 6-티오구아닌(6-thioguanine)을 줄기세포 배지에 첨가하여 배양을 지속하고, 배지는 5일 동안 매일 교체였다.
그 결과, 형질감염 20일 후, 상기 방법으로 제조된 클론에서 TALEN 매개의 Hprt1 유전자의 제거에 의해 6-티오구아닌(6-thioguanine, 6-TG)에 저항성을 나타내는 일부 전-iPSC(pre-iPSC) 클론을 선별하였고, 줄기세포에 특이적으로 염색되는 알칼리 포스파타제의 활성을 통해 그 효율을 쉽게 검증할 수 있었다(도 1c 및 도 2a). 이들 중 일부는 리프로그래밍과 동시에 유전자 조작이 동시에 수행되었고, 그 효율은 대조군과 비교하여 36%로 나타났다.
<1-2> 생성된 세포로부터 유전자 조작된 iPSC의 선별 및 확인
상기 실시예 <1-1>의 과정에서 제조된 클론으로부터 전-iPSC를 단일-가닥 구조다형성(single-strand conformational pattern) 방법에 따라 선별하였다.
구체적으로, 6-TG에 저항성을 나타내는 21개의 Hprt1 돌연변이 클론을 팁(tip)을 사용하여 손으로 분리한 뒤, PCR 증폭하여 생성된 PCR 산물을 단일-가닥으로 변성(denaturation)하여 단일-가닥 구조다형성 젤(gel)에 전기영동하여 이를 확인하였다. 또한, TALEN에 의해 유발된 돌연변이 부근의 서열을 상기와 같은 방법으로 PCR하여 수득된 PCR 앰플리콘(amplicon)을 pTOP TA V2라는 벡터에 클로닝한 후, T 벡터에 존재하는 M13 유니버샬(universal) 프라이머를 이용하여 오토매틱 서열 분석기를 사용하여 서열 분석을 수행한 뒤, 결과 분석은 원래 야생형 서열과 비교하였으며 한쌍의 TALEN에 의해 잘린 스페이서(spacer) 부근에서 뉴클레오티드의 삽입 또는 결실을 확인하였다.
그 결과, 도 1d에 나타난 바와 같이, Hprt1이 제거되어 6-TG에 저항성을 나타내는 클론들의 일부가 정상형에서 다른 형태의 단일-가닥 구조다형성을 나타낼 뿐만 아니라(도 1d), 히포크산틴 아미노프테린 티미딘(Hypoxanthine-aminopterin thymidine) 배지에서 성장이 가능함을 확인하였다(도 1e).
또한, 서열분석 결과, TALEN의 왼쪽 및 오른쪽 팔(arm) 사이의 공간에서 염기들의 삽입 또는 결실을 확인하였다(도 1f).
<1-3> T7 엔도뉴클레아제 I(T7 endonuclease I, T7E1 ) 어세이(assay)를 통한 유전자 조작된 iPSC의 확인
상기 실시예 <1-2>에서 선별된 유전자 조작된 iPSC를 사용하여 T7 엔도뉴클레아제 어세이를 수행하여 선별된 클론에 돌연변이가 생성되었는지 여부를 확인하였다.
구체적으로, 돌연변이 클론 후보 및 야생형 세포주로부터 게노믹(genomic) DNA를 분리한 후, 돌연변이 예상 부위를 PCR을 수행하여 증폭하였다. 상기 증폭된 PCR 산물들로부터 야생형 세포주 유래 산물을 각각의 돌연변이 클론 후보 유래 산물들과 섞어준 뒤, 최초 95에서부터 25까지 초당 2씩 낮춰 2형이중가닥(heteroduplex) 모양을 형성시키고, 형성된 2형이중가닥에 T7E1 2 유닛(unit)을 20분간 처리한 뒤 2% 아가로스 겔(agarose gel)에 전기영동하여 이를 확인하였다.
그 결과, 재생된 DNA 혼합생산물(mixture product)이 모두 T7E1에 의해 잘린것을 확인하였고(도 2c), 이는 상기 모든 분리된 클론들이 TALEN에 의해 돌연변이가 일어났음을 나타낸다.
따라서, 본 발명의 레쉬니한 증후군 모델 세포주 제조방법은 체세포로부터 iPSC를 제조하면서 동시에 질환 특이적 유전자 변형을 유발시킴으로써 효율적인 유전자 조작된 iPSC를 3 내지 4주의 단시간에 제조할 수 있다.
< 실시예 2> 원-스텝(one-step) 전략을 이용한 인간 포피 섬유아세포(human foreskin fibroblasts, hFFn ) 로부터 iPSC의 제조
<2-1> AAVS1 safe-harbor locus를 표적으로 하는 단일-가이드 RNA(single-guided RNA, sgRNA )의 도입
리프로그래밍과 유전자 조작 단계를 포함하는 상기 원-스텝 전략의 효율성을 측정하기 위해, AAVS1 safe-harbor locus 를 표적으로 하는 단일-가이드 RNA(single-guided RNA, sgRNA)를 제작하였다(도 3a). 역분화줄기세포 제작을 위해 사용되는 벡터로는 OCT4-shp53, Sox2-Klf4, Lin28-L-myc이 각각 짝을 이루어 존재하는 에피좀 벡터(Addgene, 미국)를 사용하였다. 상기 AAVS1 safe-harbor locus 를 표적으로 하는 sgRNA는 툴젠(대한민국)에 의뢰하여 제작하였다. 상기 sgRNA는 sgRNA 서열에 팸(protospacer adjacent motif, PAM) 서열(서열번호 32: CTCCCTCCCAGGATCCTCTCTGG)을 포함하도록 제작하였다.
tracrRNA와 crRNA로 구성된 sgRNA의 발현을 위해 sgRNA 플라스미드에 존재하는 U6 프로모터를 사용하였다. CAG 프로모터는 Cas9-엔도뉴클리아제를 인코딩하는 원래의 플라스미드에 존재하는 CMV 프로모터로 대체하였다. sgRNA가 도입된 iPSCs를 제조하는 방법은 다음과 같다.
구체적으로, 인간 포피 섬유아세포(human foreskin fibroblasts, hFFn)에 0.05% % TrypLETM express (Invitrogen)를 처리하여 트립신화 한 후, DPBS를 사용하여 세척하였다. 1 × 106 의 상기 인간 포피 섬유아세포(human foreskin fibroblasts, hFFn)를 150 ㎕의 R-버터에서 희석한 후, 1.5 μg의 각각의 상기 에피좀 벡터, 1.5 μg Cas9-encoding 플라스미드, 및 1.5 μg AAVS1-sgRNA를 첨가하였다. 10 또는 100 μl 팁과 함께 Neon 전기천공기를 사용하여 1,200 V, 30 ms, 2x pulses의 조건으로 전기천공법을 이용하여 상기 첨가물을 인간 포피 섬유아세포에 도입하였다. 도입 후, 48시간 동안 섬유아세포 배지(10% FBS가 포함된 DMEM 배지)에 배양하였다.
그 결과, 도 3b에 나타난 바와 같이 유전자 조작 효율은 약 34%인 것으로 확인되었다(도 3b).
<2-2> T7 엔도뉴클레아제 I(T7 endonuclease I, T7E1 ) 어세이(assay)를 통한 유전자 조작된 iPSC의 확인
상기 실시예 2-1에 따라 제조된 세포를 섬유아세포 배지에 배양한지 48시간 후, 줄기세포 배지(mTesR1)로 교체하여 세포를 배양하였으며, 상기 배지는 매일 교체하였다. 줄기세포배지에서 배양한지 3주 후, 분화를 위해 1차 iPSC 콜로니를 각각 96-웰 플레이트에 옮겼다. 콜로니가 각 웰의 80% 를 채울때까지 이를 배양하였다(도 3c). 상기 배양된 1차 iPSC에서 50개의 iPSC 클론을 선별하여 상기 실시예 1-3에 따라 T7 엔도뉴클레아제 어세이를 수행하여, 선별된 클론에 돌연변이가 생성되었는지 여부를 확인하였다.
그 결과, 돌연변이 효율이 82%임을 확인하였고(도 3d), 이는 대부분의 분리된 클론들이 상기 sgRNA에 의해 AAVS1 safe-harbor locus 에서 돌연변이가 일어났음을 나타낸다.
<2-3> 서열분석
염기서열 분석 결과, 팸 근처에서 indel(삽입 또는 결실) 돌연변이가 일어났음을 확인하였다(도 3e).
< 비교예 1> 공지된 방법으로 진행성 골화성 섬유이형성증 ( fibrodysplasia ossificans progressiva , FOP) 환자 유래 세포주로부터 iPSC의 제조
<1-1> FOP 환자 유래 세포주로부터 iPSC로의 분화 유도
ACVR1 p.R206H에 유전적 변이를 갖는 FOP 환자로부터 분리한 체세포를 이용하여 iPSC를 제조하기 위하여 하기와 같은 방법을 수행하였다.
구체적으로, 1 x 106개의 FOP 환자에서 유래한 섬유아세포주를 전기 천공법을 위해 R-버퍼 150 ㎕로 희석한 뒤, 3 종류의 리프로그래밍 에피좀 벡터인 hOCT4-shp53, hSox2-hKLF4 및 hL-myc-hLin28를 각각 1.5 ㎍씩 섞은 것을 희석하여 상기 FOP 환자 유래 섬유아세포주에 첨가하였다. 그런 다음, 상기 세포주를 Neon 전기천공기에서 1,200 V, 30 ms 및 2x pulses 조건으로 48시간 동안 섬유아세포 배지(10% FBS가 포함되어 있는 DMEM 배지)에 배양한 후에, 줄기세포 형성 전용배지인 mTesR1에서 3 내지 4주간 지속적으로 배양하여 줄기세포를 형성하였다.
그 결과, 도 4a에 나타난 바와 같이 리프로그래밍이 진행된 이후 선택할 수 있는 적절한 크기의 콜로니(colony)가 형성된 것을 확인하였다(도 4a). 대부분의 상기 콜로니들은 일반적이지 않은 형태 및 약한 알칼리 포스파타제(alkaline phosphatase) 활성을 나타내고 있음에도 불구하고 이들 콜로니로부터 12개를 무작위적으로 선택하여 계대배양을 지속하였다.
<1-2> FOP 환자 유래 세포주로부터 제작된 iPSC에 배양 보조세포의 공급
상기 비교예 <1-1>에서 유도된 FOP 환자 유래 iPSC 세포의 비정형적인 미분화 상태가 개선될 수 있도록, 일반적으로 사용되고 있는 MEF-배양보조세포(MEF-feeder cell)를 함께 공배양(coculture)한 뒤, FOP 환자 유래 iPSC 세포의 분화를 알칼리 포스파타제 염색으로 확인하였다.
구체적으로, 6-웰 조직배양 플레이트에 0.1% 젤라틴으로 37 인큐베이터에서 코팅한 후 웰 당 1 x 104개의 마이토마이신(mitomycine)이 처리된 CF-1 배양보조세포를 붙여주고, 24시간 후 D-PBS로 웰에 붙어있는 배양보조세포를 세척한 후 1 x 103개의 iPSC를 그 위에서 배양하였다. 배양 7일 후, 상기 배양된 iPSC를 10% 포름알데히드로 1분간 고정하고, 0.1% TBS로 2 내지 3회 세척하여 상기 포름알데히드를 제거하였다.
한편, 제조사의 프로토콜대로 알칼리 포스파타제 염색 키트(시그마, 미국)를 제조하였다. 구체적으로, 1 ㎖ 질산나트륨(sodium nitrate)를 1 ㎖ FRV-알칼리 용액에 넣고 부드럽게 섞어 다이아조늄염(diazonium salt)을 제조한다. 상기 다이아조늄염 용액을 제조하고 2분 후, 상기 다이아조늄염 용액 및 1 ㎖의 나프톨(naphthol) AS-BI 알칼리 용액을 45 ㎖의 증류수에 순차적으로 첨가하였다. 상기 제조된 용액을 고정된 iPSC에 처리하여 상온(25)에서 15분간 방치한 뒤 수돗물로 세척하고, 이를 광학현미경 및 디지털카메라로 관찰하였다.
그 결과, 도 4b에 나타난 바와 같이 FOP 환자 유래 iPSC 세포주가 MEF-배양보조세포에 의해 적절히 부착되었으나, FOP 환자 유래 iPSC 세포주는 MEF-배양보조세포에 의해 여전히 도움을 받지 못하고 있음을 일부분만 염색된 알칼리 포스파타제 염색 결과로 확인할 수 있었다. 이는 공지된 방법으로 제조된 FOP 환자 유래 iPSC 세포주는 가장 이상적인 미분화조건인 MEF-배양보조세포와의 공배양 상태에서조차 줄기세포로서 회복이 되지 않음을 나타낸다(도 4b 오른쪽).
<1-3> FOP 환자 유래 세포주로부터 제작된 iPSC의 전분화능 유전자 발현 확인
상기 실시예 <1-1>에서 유도된 FOP 환자 유래 iPSC 세포의 전분화능을 야생형 iPSC 세포와 비교하기 위하여, 전분화능 유전자의 발현을 세미-정량(semi-quantitative) RT-PCR으로 확인하였다.
구체적으로, 세미-정량 RT-PCR을 수행하기 위하여 각각의 세포주를 트리졸(trizol, 인비트로젠, 미국)로 처리하여 전체 RNA를 추출하고, RNAeasy 미니키트(퀴아젠, 미국)를 사용하여 제조사의 프로토콜대로 RNA를 정제하였다. 상기 정제된 RNA 2 ㎍을 주형으로 iScrpit™ cDNA 합성키트(바이오래드, 미국)를 사용하여 제조사의 프로토콜대로 cDNA를 합성하였고, 이때 수행 온도는 42였다. 그리고나서, 생성된 PCR 산물을 사용하여 정량을 수행하였으며, 최초 반응에 사용한 RNA의 양을 환산하여 10 ng의 cDNA가 각각의 정량 PCR에 사용되었다. 정량분석에 사용된 PCR 조건은 95 1분, 58 1분, 72 1분으로 하여 20 내지 40회로 이를 반복하였으며, 각각의 유전자에 대한 지수기(exponential phase)를 결정하였다. 대조군인 GAPDH의 경우 21회를 반복하였고, 다른 유전자에 대해서는 36회를 반복하였으며, 그 결과 생성된 PCR 앰플리콘의 10 ㎕를 2%의 아가로스 겔에 로딩하여 EtBr 염색으로 확인하였다. 각각의 유전자 정량을 위해 사용된 프라이머는 하기와 같다.
유전자 서열(5'3') 방향 서열번호
OCT4 AAGCTCCTGAAGCAGAAGAGGA 정방향 1
ATGGTCGTTTGGCTGAATACCT 역방향 2
SOX2 TGGACTTCTTTTTGGGGGACTA 정방향 3
GCAAAGCTCCTACCGTACCACT 역방향 4
LIN28A AAAGGAAAGAGCATGCAGAAGC 정방향 5
AAGTAGGTTGGCTTTCCCTGTG 역방향 6
ESG1 TCGTGGTTTACGGCTCCTATTT 정방향 7
TCACTTCATCCAAGGGCCTAGT 역방향 8
GDF3 TGTACTTCGCTTTCTCCCAGAC 정방향 9
TTCCCTTTCTTTGATGGCAGAC 역방향 10
DNMT3B TCTCACGGTTCCTGGAGTGTAA 정방향 11
GTAGGTTGCCCCAGAAGTATCG 역방향 12
GAPDH CCTCAACGACCACTTTGTCAAG 정방향 13
TCTTCCTCTTGTGCTCTTGCTG 역방향 14
그 결과, 도 4c에 나타난 바와 같이 야생형의 iPSC 세포와 비교하여 SOX2 및 DNMT3B의 발현이 낮은 것으로 나타났다(도 4c).
<1-4> FOP 환자 유래 세포주로 제작된 iPSC에서 유전자 도입시 미분화 유지능력 확인
FOP 환자 유래 세포주로 제작된 iPSC 세포를 바탕으로 유전자 교정을 시행하고자 하였다. 상기 iPSC에서 유전자 교정을 시도하기 전 전기천공법을 이용하여 유전자 조작 도구를 도입해야하는데, 그 효율을 GFP 발현 벡터를 이용해 점검하였다. FOP 환자 유래 iPSC에 GFP 발현벡터를 도입하기 위해서는 많은 양(적어도 1 x 105개의 세포들)의 미분화상태의 세포들이 필요하나, 상기 결과에서 나타난 바와 같이 FOP 환자 유래 iPSC가 미분화 상태를 유지하는 것이 어려워 1 x 106개의 FOP 환자 유래 iPSC 세포에 GFP 발현 벡터를 도입하였다.
구체적으로, FOP 환자 유래 iPSC 세포에 GFP를 비교예 <1-1>에 기재된 바와 같이 전기천공법을 사용하여 도입하였다.
그 결과, 도 5e에 나타난 바와 같이 FOP 환자 유래 세포주로 제작된 iPSC 세포주의 경우, 형질감염 1일 후 야생형 iPSC와 비슷한 양의 GFP가 발현되고 있었으나, 도입 15일째에는 야생형 iPSC가 줄기세포 콜로니(총 48개)를 더 잘 형성함을 확인하였다. 또한, 야생형 iPSC의 경우 형성된 콜로니에서 GFP 발현(총 12개)도 잘 되는 반면, FOP 환자 유래 세포주로 제작된 iPSC 세포주의 경우 1 내지 2개의 줄기세포 콜로니가 형성된 것을 확인하였다(도 5b 내지 도 5d).
또한, FOP의 원인은 ACVR1의 돌연변이 단백질인 Alk2의 지속적인 활성에 의해 나타나는데, GFP 발현 벡터를 도입한 뒤, ALk2 억제제인 LDN-193189를 처리하였음에도 불구하고, 여전히 GFP 발현되는 줄기세포 콜로니를 형성하기 어려운 것을 확인하였다(도 5e). 이는 공지된 방법에 의해 FOP 환자 유래 세포주로부터 제작한 iPSC를 바탕으로 유전자 치료를 위한 유전자 조작도구를 세포 내로 도입하는 것이 어렵다는 점을 나타낸다.
< 실시예 3> 원-스텝(one-step) 전략을 이용한 골화성 섬유이형성증 ( fibrodysplasia ossificans progressiva , FOP) 환자 유래 세포주로부터 iPSC의 제조
<3-1> ACVR1 p. R206H 돌연변이를 표적으로 하는 단일-가이드 RNA(single-guided RNA, sgRNA )의 제작
상기 <실시예 1>의 레쉬니한 증후군의 특징을 갖는 iPSC 제작 방법을 적용하여 FOP 환자 유래의 세포주로부터 iPSC를 유도하기 위해 ACVR1 유전자의 6번째 엑손의 돌연변이 잔기를 표적으로 하는 단일-가이드 RNA를 제작하였다.
구체적으로, 상기 sgRNA는 ACVR1 돌연변이를 유전자 치료하기 위해 치료부위를 표적으로 하는 sgRNA 서열에 팸(protospacer adjacent motif, PAM) 서열(서열번호 15: CACACTCCAACAGTGTAATCTGG)을 포함하도록 툴젠(대한민국)에 의뢰하여 제작한 뒤, 이를 이용하여 상기 실시예 <1-3>의 방법으로 T7E1 어세이를 수행하였다.
그 결과, 상기의 방법으로 제작된 단일-가이드 RNA는 HEK293 세포에서 sgRNA-cas9 엔도뉴클레아제에 의한 표적을 절단하였고, 또한 FOP 환자의 섬유아세포에서도 위치 특이적으로 표적 유전자를 절단하는 것을 확인하였다.
<3-2> 단일-가닥 올리고데옥시뉴클레오티드 (single-strand oligodeoxynucleotide , ssODN) 주형의 제작
상동인도복구(homology-directed repair, HDR)를 위한 공여체 DNA로서 단일-가닥 올리고데옥시뉴클레오티드 주형을 제작하였다.
구체적으로, 공여체 DNA는 총 90개의 잔기로 이루어진 ssODN으로 Integrated DNA technology(IDT) 회사로부터 주문 및 제작되었고, 상기 제작된 공여체 DNA의 위치는 ACVR1 c.617G>A 돌연변이의 교정을 목적으로 하기 때문에 돌연변이 위치와 알젠(RGEN)에 의해 잘릴것으로 예상되는 잔기를 중심으로 양쪽으로 총 90개 잔기를 갖는 공여체 DNA의 서열을 정하였다.
그 결과, 도 6a에 나타난 바와 같이 ACVR1 c.617G>A 돌연변이를 복구하기 위하여, 제작된 ssODN은 크게 세 가지 부분을 고려하였다. 첫째, c.617 돌연변이된 알라닌(alanine) 부위를 야생형의 구아닌(guanine)으로 치환해야 하기 때문에 야생형 잔기를 포함하고 있고, 둘째, 유전자 교정이 되었다 하더라도 ACVR1의 알젠이 계속해서 작용할 경우 교정에 제공된 공여체 DNA에 또 다른 돌연변이가 발생할 수 있기 때문에 일단 교정된 공여체가 알젠에 의해 영향을 받지 않도록 팸 서열에 숨은 돌연변이(silent mutation)을 의도적으로 유발하였으며, 셋째, 최종적으로 교정된 클론을 유전형질 분석(genotyping)을 이용한 스크리닝을 위해 제한효소인 Hpy188I가 인식할 수 있도록 두 번째 고려사항을 포함하여 숨은 돌연변이를 같은 잔기에 유발하였다.
<3-3> sgRNA 및 ssODN의 FOP 환자의 섬유아세포로의 도입
FOP 환자로부터 분리한 섬유아세포에 상기 실시예 <1-1>에서 제조한 리프로그래밍 에피좀 벡터, 및 상기 실시예 <3-1> 및 <3-2>에서 제작된 sgRNA 및 ssODN을 상기 실시예 <1-1>에 기재된 바와 같이 전기 천공법을 이용하여 동시에 도입한 뒤 유전자가 교정된 iPSC의 일부를 수득하여 공여체 DNA의 표적 효율을 확인하기 위해 게놈 DNA를 추출하여 교정부위를 중심으로 PCR 앰플리콘을 합성하였다.
그 결과, PCR 앰플리콘에 제한효소인 Hpy188I를 처리한 결과, 도 6b에 나타난 바와 같이 아가로스 겔에서 292 bp 길이의 PCR 앰플리콘으로부터 각각 191 bp 및 101 bp 길이로 잘린 두 개의 밴드가 확인되었다(도 6b).
이는 상기 설명한 바와 같이 공여체 DNA 제작시 고려사항인 유전형질 분석을 통한 스크리닝의 편의를 위해 의도적으로 유발한 숨은 돌연변이에 Hpy188I 인식 잔기가 있기 때문에 효율적으로 공여체 DNA의 표적 효율성이 약 6.5%임을 확인하였다. 효율성은 이미지 J 소프트웨어(Image J software)에서 잘린 밴드의 강도(intensity)를 측정하여 결정하였다.
<3-4> 심층 염기서열(Deep sequencing) 분석
상기 <3-3>에 따라 제조된 sgRNA, 및 ssODN이 도입된 iPSC의 sgRNA의 표적 효율을 확인하기 위해 심층 염기서열(deep sequencing) 분석을 실시하였다.
구체적으로, hot-start Taq polymerase, SolgTM h-Taq DNA polymerase (SolGent, 대한민국)를 사용하여 앰플리콘을 포함하는 on-target과 3개의 off-target을 PCR 증폭하였다. 각 앰플리콘의 증폭을 위해 사용되는 PCR 프라이머는 하기 표 2와 같다. 상기 앰플리콘을 5'-말단 kination을 통한 서열반응, adaptor ligation, 및 PCR 반응에 필요한 Illumina Miseq platform인 바코드화된 서열 모듈로 조작하였다. Miseq platform을 사용하여 다중 병렬 시퀀싱에 의해 얻어진 paired -end 판독은 BLAST 프로그램을 사용하여 각각의 앰플리콘에 대한 야생형에 대비하여 확인하였다. 팸으로부터 20개 이내의 염기에서 결실부분이 나타나는 것을 돌연변이가 일어난 것으로 판단하였고, Perl 스크립트를 사용하여 그 수를 확인하였다.
유전자 서열(5'-3') 방향 서열번호
ACVR1/ALK2 ATCAGGAAGTGGCTCTGGTCTT 정방향 16
ACVR1/ALK2 TGCATATTACCCACAAAGAAAGGA 역방향 17
FILIP1L TCCAAAAAGAGAAGAAGAAAACG 정방향 18
FILIP1L GGTACCGTGCAGGTGTTGAT 역방향 19
RIC8A CTCCCTGCCCACAGAGACT 정방향 20
RIC8A GGACAGGATTCGGACACTCT 역방향 21
BYSL TCTCATCCTGGGCTCACAGT 정방향 22
BYSL CTTCCCGGAGGGTACAAGTG 역방향 23
그 결과, 다른 프라이머를 사용한 것과 달리, ALK2 프라이머를 사용한 경우에 한해 결실 부분이 나타남을 확인하였으며, mALK2-hDF에서 indel 빈도는 약 8%(2.1% ssODN-매개 homology-directed target 제외)로 나타났다(도 6c). 또한, ssODN-매개 HDT의 효율은 2.1%로 나타났다(도 6d).
<3-5> 세포의 배양
상기 실시예 <3-3>의 방법으로 생산된 세포주로부터 iPSC를 선별하기 위하여 세포를 배양하였다.
구체적으로, 공-형질감염(co-transfection) 후, 3 내지 4주일 때 1차적인 iPSC 콜로니들을 팁(tip)을 사용하여 손으로 분리한 뒤, 마트리겔이 코팅되어 있는 96-웰 플레이트에 옮겼다. 상기 방법으로 옮긴 세포는 100 ㎕의 줄기세포 배지인 mTesR1을 매일 갈아주면서 콜로니가 웰의 80%를 채울 때까지 이를 배양하였다(도 6e).
< 실시예 4> FOP 환자 유래 세포로부터 제조된 iPSC의 확인
<4-1> 유전형 분석( genotyping )
상기 <실시예 3>의 방법으로 제조 및 분화된 iPSC 세포주의 유전형을 분석하기 위해 다음과 같은 실험을 수행하였다.
구체적으로, 상기 실시예 <3-5>에서 배양된 세포를 각 웰의 절반을 사용하여 게놈의 DNA를 추출하였고, 상기 추출된 DNA를 주형으로 PCR 앰플리콘을 증폭하였다. PCR은 95 5분; 5회 반복(95 1분, 62 1분, 72 1분); 5회 반복(95 1분, 60 1분, 72 1분); 25회 반복(95 1분, 58 1분, 72 1분); 72 5분의 조건으로 수행되었으며, 이때 사용한 프라이머 서열은 공여체 DNA의 측면 부위를 인식하는 것으로 서열번호 24으로 기재되는 프라이머(5'-TTTCCCCTTGTCTTAAACCAC-3') 및 서열번호 25로 기재되는 프라이머(5'-CAAGTTCAGGTGCTCCAACATT-3')로 PCR을 수행하여 수득된 PCR 앰플리콘의 공여체 DNA에 의한 유전자 교정여부를 확인하기 위하여 총 88개 클론에 대하여 Hpy188I를 처리하였다.
그 결과, 도 6f에 나타난 바와 같이, 292 bp 길이의 PCR 앰플리콘으로부터 각각 191 bp 및 101 bp 길이로 잘린 두 개의 밴드를 갖는 클론들이 확인되었다(도 6f).
또한, 도 6g에 나타난 바와 같이, 유전형을 확인한 88개의 클론 중 8개의 클론은 대립 유전자 중에 적어도 하나는 공여체 DNA가 표적에 삽입되어 있었고, 표적 빈도(targeting frequency)는 약 9%로 확인되었다. 상기 8개의 HDR 클론 중 6개는 하나의 대립유전자가 공여체 DNA의 대립유전자로 치환되었고, 동시에 다른 대립유전자 위치에 알젠에 의한 삽입-결실(indel) 돌연변이가 생성되었다. 그러나, 상기 공여체가 들어간 8개 클론 중 나머지 2개인 #13 및 #81 클론은 양쪽 대립유전자에 모두 야생형의 서열을 갖고 있었다. 알젠이 야생형 대립유전자에 영향을 주지 않고, 돌연변이 대립유전자에만 작용하며, 그에 따라 공여체 DNA 매개의 HDR이 돌연변이 대립유전자 위치에 정확하게 발생하였다(도 6g).
<4-2> 서열분석
FOP 환자 유래의 iPSC 세포주에서 유전자 교정여부는 서열분석을 통해 확인하였다.
구체적으로, 상기 실시예 <4-1>에서 생성된 클론의 두 대립유전자 서열을 확인하기 위하여 PCR 앰플리콘을 정제하여 pTOP TA V2(엔지노믹스, 대한민국) 벡터에 삽입하였고, 상기 PCR 앰플리콘이 삽입된 pTOP TA V2 벡터에 존재하는 M13에 대한 공지된 프라이머를 사용하여 서열을 분석하였다(도 6g). 상기 실시예 <4-1>에서 유전자가 교정된 것으로 확인된 클론의 유전자 교정 여부를 확인하기 위해서는 PCR 앰플리콘을 정제하여 서열번호 26로 기재되는 프라이머(5'-AAAAGCAGATTTTCCAAGTTCCA-3')를 사용하여 서열 분석을 의뢰하였다.
그 결과, 도 8에 나타난 바와 같이 FOP 환자에서 돌연변이된 잔기가 야생형의 공여자 DNA로 치환된 것을 확인하였다(도 8).
또한, iPSC 세포주가 성장하는 동안 그 모습을 현미경으로 관찰한 결과, 유전자 교정된 FOP 환자 유래 iPSC가 야생형 iPSC와 비슷한 형태를 나타내는 것을 확인하였고, 배양에 어떠한 제한도 없이 배양되는 것을 확인하였다.
<4-3> 알칼리 포스파타제의 발현 확인
상기 <실시예 3>의 방법으로 유도된 유전자 교정된 FOP 환자 유래 iPSC에서 알칼리 포스파타제 발현여부를 확인하기 위하여 상기 비교예 <1-2>에 기재된 바와 같이 알칼리 포스파타제 염색을 수행하였다.
그 결과, 도 9a에 나타난 바와 같이 유전자가 교정된 FOP 환자 유래 iPSC에서 강한 알칼리 포스파타제의 발현을 확인한 반면, 유전자 교정을 수행하지 않은 FOP 환자 유래 iPSC에서는 알칼리 포스파타제의 발현이 약하게 나타나는 것을 확인하였다(도 9a).
<4-4> 다분화능 마커의 발현 확인
상기 <실시예 3>의 방법으로 유도된 유전자 교정된 FOP 환자 유래 iPSC에서 전형적인 다분화능 마커로 알려진 OCT4, SOX2, LIN28A, ESG1, GDF3, DNMT3B 유전자의 발현을 상기 비교예 <1-3>에 기재된 바와 같이 세미-정량 RT-PCR을 수행하여 이를 확인하였다.
그 결과, 도 9b에 나타난 바와 같이 SOX2 및 DNMT3B의 발현이 FOP 환자 유래 iPSC에서는 감소하였으나, 유전자가 교정된 FOP 환자 유래 iPSC에서는 강하게 발현하였고, 이는 야생형의 iPSC와 비슷한 수준이었다(도 9b).
<4-5> 기형종 형성의 확인
상기 <실시예 3>의 방법으로 유도된 유전자 교정된 FOP 환자 유래 iPSC에 의해 기형종(teratoma)이 형성되는지 여부를 확인하기 위해 상기 iPSC를 NOD-SCID 쥐에 피하주사하였다. 구체적으로, 3 × 105 iPSCs를 30% matrigel (BD Biosciences)과 함께 존재하는 줄기세포배양배지(mTeSR1) 에 현탁한 후, NOD-SCID 쥐의 피하로 주사하였다. 기형종은 이식 후 6주 째 수득하여 16시간 동안 파라핀에서 고정 후, 16% 포르말린을 처리한 다음, 5 마이크론 섹션으로 순차적으로 구분하였다. 모든 섹션을 헤마톡실린과 이오신으로 염색하였다. 모든 동물 관리와 실험은 KRIBB IACUC 승인 하에 실시하였다.
그 결과, 신경 로제트(외배엽), 지방 세포(중배엽), 및 창자와 같은 상피 세포(내배엽)을 포함하는 세가지 배엽과 상이한 기형종이 형성됨을 확인하였다(도 9c).
<4-6> 핵형( karyotype ) 분석
상기 <실시예 3>의 방법으로 유도한 유전자 교정된 FOP 환자 유래 iPSC를 20회 이상 계대 배양하여 T-25 조직 배양 플레이트의 85%가 가득 차게 배양한 뒤 이를 젠딕스(대한민국)에 핵형 분석을 의뢰하였다.
그 결과, 도 9d에 나타난 바와 같이 유전자 교정된 FOP 환자 유래 iPSC가 일반적인 핵형을 가지고 있음을 확인하였다(도 9d).
<4-7> FOP 환자 유래 세포주로부터 제작된 유전자 치료된 줄기세포의 유전자 교정 효과 확인
FOP 는 근육이나 결합조직 등을 구성하는 가장 기본 단위인 세포 내에 미네랄을 포함하면서 골화되는 경향을 보여 나타나는 질환이다. FOP 환자 유래 체세포에서 제작된 유전자 치료된 줄기세포의 유전자 교정효과가 FOP 환자 유래 치료안된 줄기세포와 비교하여 어느 정도 차이를 나타내는지 본코사(von Kossa) 염색방법을 통해 확인하였다.
구체적으로, 각각의 줄기세포 5 x 104개를 마트리겔(matrigel)이 코팅된 24-웰 조직배양 플레이트에서 배양하였다. 배양 24시간 후, 미네랄 분화배지[4 μM 덱사메타손(dexamethasone, 시그마, 미국), 50 ㎍/㎖ L-아스코르브산 2-포스페이트 세스퀴마그네슘 솔트 하이드레이트(L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate, 시그마, 미국), 50 ㎍/㎖ β-글리세롤포스페이트 디소듐 솔트 하이드레이트(β-glycerophosphate disodium salt hydrat, 시그마, 미국), 및 20% FBS가 첨가된 DMEM]에서 각각 7일 또는 14일간 분화를 유도하였다. 날짜별 수득한 샘플을 10% 포름알데하이드에 5분간 고정한 뒤, 수돗물로 2 내지 3회 세척 후, 5% 질산은(silver nitrate)으로 30분간 염색하고, 다시 수돗물로 2 내지 3회 세척하였다. 그리고나서, 5% 탄산나트륨(sodium carbonate) 및 10% 포름알데하이드 용액에 2분간 반응시킨 뒤, 상기 반응에 의해 검게 변한 것을 확인하고 디지털 카메라로 이미지를 촬영하였다.
그 결과, 도 10에 나타난 바와 같이 FOP 환자 유래 세포주로부터 원스텝(one-step) 방법을 통해 유전자 교정된 줄기세포는 야생형 iPSC와 유사한 형태를 보이는 반면, FOP 환자 유래 세포로부터 제작된 줄기세포의 경우 다량의 미네랄을 함유하여 검은 부분이 강하게 나타났다(도 10).
결론적으로, 본 발명의 iPSC 제조방법은 기존에 제작이 어려웠던 FOP 환자 유래 섬유아세포로부터 효과적으로 iPSC를 제조하였고, 이를 이용하여 FOP 치료에 사용할 수 있음을 확인하였다. 뿐만 아니라, 유도만능줄기세포 환자 맞춤형의 목적으로 제작되는 만큼, 난치성 유전질환에 의한 유전자 치료를 통한 세포 치료제 개발에 있어서 상기 기술방법을 적용하면 비용, 시간, 노동력 등을 획기적으로 줄일 수 있는 효율적이고 보편적인 맞춤형 치료를 수행할 수 있을 것이다. 한편, 유전자의 기능상실(loss of function)이나, 기능획득(gain of function)을 연구하는데 있어서 상기 사례로 제시한 Hprt1에 대한 레쉬니한 증후군의 경우처럼 본 방법을 적용하면 효율적으로 돌연변이 클론을 확보할 수 있다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시 예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (16)

1) 개체에서 분리된 성체 체세포에 리프로그래밍 에피좀 벡터(reprogramming episomal vector) 및 돌연변이 교정 전달체를 동시에 도입하여 유도만능줄기세포(induced pluripotent stem cell, iPSC)를 제조하는 단계; 및
2) 상기 단계 1)의 제조된 iPSC를 선별하는 단계를 포함하는 유전자 교정된 iPSC의 제조방법.
제1항에 있어서, 상기 단계 1)의 개체는 골화성 섬유이형성증(fibrodysplasia ossificans progressiva, FOP) 환자 또는 판코니 빈혈(fanconi anemia) 환자인 것을 특징으로 하는 유전자 교정된 iPSC의 제조방법.
제1항에 있어서, 상기 단계 1)의 성체 체세포는 섬유아세포인 것을 특징으로 하는 유전자 교정된 iPSC의 제조방법.
제1항에 있어서, 상기 단계 1)의 리프로그래밍 에피좀 벡터는 Oct4, shp53, Sox2, Klf4, Lin28 및 L-myc으로 구성된 군으로부터 선택되는 어느 하나 이상을 포함하는 것을 특징으로 하는 유전자 교정된 iPSC의 제조방법.
제1항에 있어서, 상기 단계 1)의 돌연변이 교정 전달체는 단일-가이드 RNA(single-guided RNA, sgRNA) 및 단일-가닥 올리고데옥시뉴클레오티드(single-strand oligodeoxynucleotide, ssODN)를 포함하는 것을 특징으로 하는 유전자 교정된 iPSC의 제조방법.
제5항에 있어서, 상기 sgRNA는 서열번호 27로 구성되는 것을 특징으로 하는 유전자 교정된 iPSC의 제조방법.
제5항에 있어서, 상기 sgRNA는 ACVR1 p.R206H 돌연변이를 표적으로 하는 것을 특징으로 하는 유전자 교정된 iPSC 제조방법.
제5항에 있어서, 상기 ssODN은 서열번호 28으로 구성되는 것을 특징으로 하는 유전자 교정된 iPSC의 제조방법.
제5항에 있어서, 상기 ssODN은 ACVR1 c.617G>A 돌연변이를 복구하기 위한 것을 특징으로 하는 유전자 교정된 iPSC 제조방법.
1) FOP 환자에서 분리된 섬유아세포에 리프로그래밍 에피좀 벡터(reprogramming episomal vector), 및 서열번호 27로 구성되는 sgRNA 또는 서열번호 28으로 구성되는 ssODN 중 어느 하나를 동시에 도입하여 유도만능줄기세포(induced pluripotent stem cell, iPSC)를 제조하는 단계; 및
2) 상기 단계 1)의 제조된 iPSC를 선별하는 단계를 포함하는 유전자 교정된 iPSC의 제조방법.
1) 분리된 성체 체세포에 리프로그래밍 에피좀 벡터 및 돌연변이 유발 전달체를 동시에 도입하여 유도만능줄기세포(induced pluripotent stem cell, iPSC)를 제조하는 단계; 및
2) 상기 단계 1)의 제조된 iPSC를 선별하는 단계를 포함하는 질환모델 iPSC의 제조방법.
제11항에 있어서, 상기 단계 1)의 성체 체세포는 섬유아세포인 것을 특징으로 하는 질환모델 iPSC의 제조방법.
제11항에 있어서, 상기 단계 1)의 리프로그래밍 에피좀 벡터는 Oct4, shp53, Sox2, Klf4, Lin28 및 L-myc으로 구성된 군으로부터 선택되는 어느 하나 이상을 발현하는 것을 특징으로 하는 질환모델 iPSC의 제조방법.
제11항에 있어서, 상기 단계 1)의 돌연변이 유발 전달체는 히포크산틴-구아닌 포스포리보실전이효소 1(Hypoxanthine-Guanine Phosphoribosyltransferase 1, Hprt1)을 녹아웃시키는 것을 특징으로 하는 질환모델 iPSC의 제조방법.
제14항에 있어서, 상기 Hprt1은 서열번호 31으로 구성된 것을 특징으로 하는 질환모델 iPSC의 제조방법.
제11항에 있어서, 상기 질환은 레쉬니한 증후군(Lesch-Nyhan syndrome)인 것을 특징으로 하는 질환모델 iPSC의 제조방법.
PCT/KR2015/013622 2014-12-12 2015-12-11 일체형 유전자 치료 유도만능줄기세포 제작방법 WO2016093668A2 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20140179767 2014-12-12
KR10-2014-0179767 2014-12-12

Publications (2)

Publication Number Publication Date
WO2016093668A2 true WO2016093668A2 (ko) 2016-06-16
WO2016093668A3 WO2016093668A3 (ko) 2016-08-04

Family

ID=56108334

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/013622 WO2016093668A2 (ko) 2014-12-12 2015-12-11 일체형 유전자 치료 유도만능줄기세포 제작방법

Country Status (2)

Country Link
KR (1) KR101796518B1 (ko)
WO (1) WO2016093668A2 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110331162A (zh) * 2019-06-12 2019-10-15 温州医科大学 一种主动脉夹层特异性诱导多能干细胞及其制备方法和应用

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4349967A1 (en) * 2021-06-02 2024-04-10 Korea Research Institute of Bioscience and Biotechnology Novel pluripotent cells

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PE20150336A1 (es) * 2012-05-25 2015-03-25 Univ California Metodos y composiciones para la modificacion de adn objetivo dirigida por arn y para la modulacion de la transcripcion dirigida por arn

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110331162A (zh) * 2019-06-12 2019-10-15 温州医科大学 一种主动脉夹层特异性诱导多能干细胞及其制备方法和应用

Also Published As

Publication number Publication date
WO2016093668A3 (ko) 2016-08-04
KR20160072795A (ko) 2016-06-23
KR101796518B1 (ko) 2017-11-14

Similar Documents

Publication Publication Date Title
WO2016111546A9 (ko) 혈액 응고인자 viii 유전자를 타겟으로 하는 엔도뉴클레아제 및 이를 포함하는 혈우병 치료용 조성물
WO2017061806A1 (en) Method for producing whole plants from protoplasts
WO2016021972A1 (en) Immune-compatible cells created by nuclease-mediated editing of genes encoding hla
WO2015163733A1 (en) A method of selecting a nuclease target sequence for gene knockout based on microhomology
WO2019231266A1 (ko) Hla 유전자가 제거된 인간 유도만능줄기세포 유래 중간엽줄기세포 및 그의 제조 방법
WO2010143917A2 (en) Targeted genomic rearrangements using site-specific nucleases
Senner The role of DNA methylation in mammalian development
Kremenskoy et al. Genome-wide analysis of DNA methylation status of CpG islands in embryoid bodies, teratomas, and fetuses
WO2013180395A1 (ko) 다능성 줄기세포의 제작, 유지, 증식을 증진하는 대사산물 및 이를 포함하는 조성물과 배양방법
US20100069251A1 (en) Methods for producing embryonic stem cells from parthenogenetic embryos
WO2016093668A2 (ko) 일체형 유전자 치료 유도만능줄기세포 제작방법
Chen et al. Genetic engineering of human embryonic stem cells for precise cell fate tracing during human lineage development
WO2022065689A1 (ko) 편집 효율이 향상된 프라임 편집 기반 유전자 교정용 조성물 및 이의 용도
WO2019235907A1 (ko) Crispr/cas9 시스템을 이용하여 플라보노이드 생합성 유전체를 편집하기 위한 조성물 및 이의 이용
WO2020184403A1 (ja) 培養細胞の生産方法
WO2020055187A1 (ko) 유전자가 변이된 세포의 사멸 유도 조성물 및 상기 조성물을 이용한 유전자가 변형된 세포 사멸 유도 방법
WO2020036445A1 (ko) 인위적 뉴클레아제를 생산하는 형질전환 동물 및 형질전환 배아
Wang et al. Control of gametophytic self-incompatibility in the African wild rice
WO2022211604A1 (ko) Fe-fviii 변이 유전자로 교정된 줄기세포, 이로부터 분화된 내피 세포 및 이를 포함하는 혈우병 예방 또는 치료용 약제학적 조성물
WO2016171625A1 (en) Targeting telomerase for cell therapy
WO2023080755A1 (ko) 크리스퍼 기반 염기교정 기술을 이용하여 줄기세포 유래 심근병증 모델 세포주 제조방법 및 이의 방법으로 제조된 심근병증 세포주
WO2023195781A1 (ko) 유전자 교정 단백질을 포함하는 대마 유전자 교정용 조성물 및 이를 이용한 대마 유전자 교정 방법
WO2024058589A1 (ko) 유전자 가위 넉-인을 이용하여 제조한 키메릭 항원 수용체 세포 및 이의 용도
WO2009145573A9 (ko) 아미노 말단의 메티오닌이 제거된 재조합 사람 변이 인터페론-베타 단백질을 생산하는 재조합 대장균 및 이의 제조방법
WO2020230976A1 (ko) 미분화 만능 줄기세포로부터 유전자 편집된 세포의 선별 방법

Legal Events

Date Code Title Description
NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15867685

Country of ref document: EP

Kind code of ref document: A2