WO2024058589A1 - 유전자 가위 넉-인을 이용하여 제조한 키메릭 항원 수용체 세포 및 이의 용도 - Google Patents

유전자 가위 넉-인을 이용하여 제조한 키메릭 항원 수용체 세포 및 이의 용도 Download PDF

Info

Publication number
WO2024058589A1
WO2024058589A1 PCT/KR2023/013872 KR2023013872W WO2024058589A1 WO 2024058589 A1 WO2024058589 A1 WO 2024058589A1 KR 2023013872 W KR2023013872 W KR 2023013872W WO 2024058589 A1 WO2024058589 A1 WO 2024058589A1
Authority
WO
WIPO (PCT)
Prior art keywords
knock
cancer
gene
cells
car
Prior art date
Application number
PCT/KR2023/013872
Other languages
English (en)
French (fr)
Inventor
장미희
이영은
윤한나
Original Assignee
한국과학기술연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국과학기술연구원 filed Critical 한국과학기술연구원
Publication of WO2024058589A1 publication Critical patent/WO2024058589A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/17—Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/463—Cellular immunotherapy characterised by recombinant expression
    • A61K39/4631—Chimeric Antigen Receptors [CAR]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C12N15/625—DNA sequences coding for fusion proteins containing a sequence coding for a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells

Definitions

  • the present invention relates to chimeric antigen receptor (CAR) cells manufactured using gene scissors knock-in and their use, and more specifically, to TGFBR2 (TGF beta receptor 2) knock-in.
  • CAR chimeric antigen receptor
  • TGFBR2 TGF beta receptor 2
  • CAR-T cells chimeric antigen receptor-T cells
  • Anti-CD19 CAR-T cells have shown significant therapeutic efficacy in the treatment of hematological malignancies, and two products received FDA approval in 2017.
  • CAR-T cells targeting various tumor-related antigens have failed to show favorable clinical outcomes in patients with solid tumors (Na Tang et.al., JCI Insight, 27;5(4):e133977 , 2020).
  • BCMA B cell maturation antigen
  • MM myeloma
  • ICANS immune effector cell-associated neurologic syndrome
  • CRS cytokine release syndrome
  • CAR NK cells have shown several advantages over CAR T cells that may improve efficiency and safety, and the first clinical use of CD19 CAR-NK cells in patients with relapsed/refractory lymphoid malignancies was CAR. -The persistence of NK cells was demonstrated (Ali Bashiri Dezfouli et. al., Cells, 1;10(12):3390,2021).
  • the immunosuppressive tumor microenvironment that exists in solid tumors includes numerous cell types in addition to cancer cells as well as extracellular matrix components and inflammatory mediators.
  • immune effector cells introduced with CAR genes are subject to many inhibitory cells and molecules that can impair their survival, activation, proliferation, and effector functions.
  • the TGFBR2 gene was knocked down using gene scissors.
  • -Out natural killer cells were shown to have increased anticancer effects in glioblastoma multiforme (GBM) (Hila Shaim et.al., J Clin Invest., 131(14):e142116, 2021).
  • the negative effects of TGF- ⁇ are eliminated by knocking out TGFBR2 using the CRISPR/Cas9 system, and at the same time, the cancer cell-related antigen is targeted at the site where the TGFBR2 gene was knocked out.
  • CAR-NK cells were produced by knocking in the CAR gene, and it was confirmed that the CAR-NK cells produced by the method of the present invention had an excellent cancer cell killing effect, and the present invention was completed.
  • the purpose of the present invention is to provide a single guide RNA (sgRNA) for TGFBR2 (TGF beta receptor 2) knock-out and a TGFBR2 knock-out method using the same.
  • sgRNA single guide RNA
  • the present invention provides a TGFBR2 (TGF beta receptor 2) comprising one or more single guides selected from the group consisting of single guide RNAs (sgRNAs) represented by the base sequences of SEQ ID NO: 1 to SEQ ID NO: 6. ) Provides a single guide RNA for knock-out.
  • TGFBR2 TGF beta receptor 2
  • sgRNAs single guide RNAs
  • the present invention provides a single guide RNA for TGFBR2 knock-out.
  • TGFBR2 TGF beta receptor 2 knock-out, comprising any one gene scissors selected from the group consisting of Cas9 protein, base sequence encoding Cas9 protein, Cpf1 protein, and base sequence encoding Cpf1 protein.
  • TGFBR2 TGF beta receptor 2 knock-out, comprising any one gene scissors selected from the group consisting of Cas9 protein, base sequence encoding Cas9 protein, Cpf1 protein, and base sequence encoding Cpf1 protein.
  • the present invention provides at least one single guide RNA for TGFBR2 knock-out selected from the group consisting of single guide RNAs represented by the base sequences of SEQ ID NO: 1 to SEQ ID NO: 6, and
  • TGFBR2 knock-out method comprising treating human-derived cells with any one gene scissors selected from the group consisting of a Cas9 protein, a base sequence encoding the Cas9 protein, a Cpf1 protein, and a base sequence encoding the Cpf1 protein. do.
  • the human-derived cells are selected from the group consisting of T cells, natural killer (NK) cells, macrophages, monocytes, and dendritic cells. It may be any one immune effector cell.
  • the single guide RNA and gene scissors are delivered to immune effector cells through electroporation or a gene transfer vector, and the electroporation is performed at 1000 V to 2500 V, 5 ms to 50 ms. , and 1 pulse to 5 pulse conditions, and the gene delivery vector may be a plasmid, viral vector, or non-viral vector.
  • DNA construct for chimeric antigen receptor (CAR) knock-in specific for cancer cell antigens containing a base sequence encoding an intracellular signal transduction domain provides.
  • CAR chimeric antigen receptor
  • the present invention also provides a DNA fragment containing the above DNA construct.
  • the promoter may be pSFFV, pCMV, or pEF1A, and preferably may be pSFFV represented by the base sequence of SEQ ID NO: 13.
  • the cancer cell antigen is mesothelin (MSLN), CD22, CD19, HER2 (human epidermal growth factor receptor type 2), GD2, folate receptor, and MUC1 (Mucin 1). ), ErbB2 (Erythroblastic oncogene B-2 gene), EphA2 (EPH receptor A2), or EGFR (Epidermal growth factor receptor).
  • MSLN mesothelin
  • HER2 human epidermal growth factor receptor type 2
  • GD2 human epidermal growth factor receptor type 2
  • GD2 human epidermal growth factor receptor type 2
  • MUC1 Mocogen 1).
  • ErbB2 Epidermal growth factor receptor type 2 gene
  • EphA2 EphA2
  • EGFR Extracellular growth factor receptor
  • the transmembrane domain consists of CD8 ⁇ , CD4, CD28, CD137, CD80, CD86, CD152, PD1, NKG2D, 41BB, 2B4, NKp30, NKp44, NKp46, NKG2C and OX40.
  • the co-stimulatory domain is any one selected from the group consisting of CD28, OX-40, ICOS, NKG2D, 4-1BB, 2B4, NKp30, NKp44, NKp46 and NKG2C, and the intracellular signaling domain may be of CD3 ⁇ origin.
  • the signal peptide is represented by the amino acid sequence of SEQ ID NO: 14
  • the transmembrane domain is CD8 represented by the amino acid sequence of SEQ ID NO: 20
  • the co-stimulatory domain is SEQ ID NO: It is 4-1BB represented by the amino acid sequence of SEQ ID NO: 22, and the intracellular signaling domain may be CD3 ⁇ represented by the amino acid sequence of SEQ ID NO: 24.
  • a base sequence encoding FLAG represented by the amino acid sequence of SEQ ID NO: 16 This may be additionally included.
  • a base sequence encoding an HA (homology arm)-tag may be additionally included at the 5'-end and 3'-end of the polynucleotide.
  • the base sequence encoding the HA (homology arm)-tag may be 200bp to 1500bp.
  • a poly A sequence or a DNA nuclear targeting sequence may be additionally included at the 3'-end of the polynucleotide.
  • the present invention provides (1) at least one single guide RNA for TGFBR2 knock-out selected from the group consisting of single guide RNAs represented by the base sequences of SEQ ID NO: 1 to SEQ ID NO: 6;
  • the immune effector cells may be T cells, natural killer (NK) cells, macrophages, monocytes, or dendritic cells.
  • the single guide RNA, gene scissors, and DNA fragment are delivered to immune effector cells through electroporation or a gene transfer vector, and the electroporation is performed at 1000 V to 2500 V for 5 ms. Processing is performed under the conditions of ⁇ 50 ms and 1 pulse ⁇ 5 pulse, and the gene delivery vector may be a plasmid, viral vector, or non-viral vector.
  • the single guide RNA, gene scissors, and DNA fragments are treated with IL-2, IL-15, IL-21, and TGF- ⁇ 1 before or after treating the immune effector cells.
  • Immune effector cells may be additionally treated with one or more cytokines selected from the group consisting of.
  • the present invention provides immune effector cells prepared by the above method in which the TGFBR2 expression gene is knocked out and the chimeric antigen receptor gene specific for a cancer cell antigen is knocked in.
  • the present invention provides a pharmaceutical composition for preventing or treating cancer containing the immune effector cells.
  • the cancer is squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, squamous cell carcinoma of the lung, mesothelial cancer, peritoneal cancer, hepatocellular carcinoma, gastrointestinal cancer, pancreatic cancer, and glioma.
  • TGFBR2 expression in NK cells was effectively suppressed by single guide RNA (sgRNA) for TGFBR2 knock-out.
  • sgRNA single guide RNA
  • the negative effects of TGF- ⁇ are eliminated by knocking out TGFBR2 using the CRISPR/Cas9 system, and at the same time, a CAR gene targeting cancer cell-related antigens is installed at the site where the TGFBR2 gene was knocked out.
  • CAR-NK cells with knock-in were manufactured, and it was confirmed that CAR-NK cells prepared by the method of the present invention had an excellent cancer cell killing effect.
  • the immune effector cells of the present invention in which the TGFBR2 expression gene is knocked out and the chimeric antigen receptor gene specific for cancer cell antigen is knocked in can be usefully used as a composition for preventing or treating cancer.
  • FIG. 1 is a schematic diagram showing various crRNA (CRISPR RNA) target locations within the TGFBR2 gene location.
  • CRISPR RNA crRNA
  • Figure 2 shows data comparing the editing efficiency of sgRNA sequences for double knock-out using the T7E1 assay.
  • Figures 3a to 3g show data confirming the degree of decreased expression of the editing gene using FACS.
  • Figure 4 is data confirming the assassination effect of TGFBR2 knock-out NK cells according to the sgRNA target location
  • Figure 4A is a schematic diagram of the experiment
  • Figure 4B is data confirming the TGFBR2 knock-out efficiency
  • Figure 4C is data confirming the assassination effect of NK cells. This is confirmed data.
  • Figures 5a to 5g show data confirming the expression level of the CD107a marker, a degranulation marker, in TGFBR2 knock-out NK cells according to the sgRNA target location.
  • Figure 6 shows data confirming the degree of reduction of Phospho-Smad2/3 (p-Smad2/3) in TGFBR2 knock-out NK cells according to the sgRNA target location.
  • Figure 7 is data confirming the gene editing efficiency based on the T7E1 assay according to various electroporation conditions.
  • Figures 8a to 8f are data confirming the FACS-based gene editing efficiency according to various electroporation conditions.
  • Figures 9a to 9e show data comparing the survival rate of primary NK cells according to various electroporation conditions.
  • FIG 10 is a schematic diagram showing the DNA construct and production process for inserting a chimeric antigen receptor (CAR) gene for mesothelin (MSLN) cancer antigen targeting.
  • CAR chimeric antigen receptor
  • Figure 11 is data confirming the knock-in efficiency of the CAR gene according to the knock-in of the CAR gene after single sgRNA or double sgRNA knock-out.
  • Figure 11a is a schematic diagram showing the experimental process and
  • Figure 11b is CAR using the junction PCR method. This is data confirming the knock-in efficiency of the gene.
  • Figure 12 is a comparison of CAR gene knock-in and TGFBR2 knock-out efficiencies according to sgRNA input amount and electroporation conditions, and is data comparing CAR gene knock-in efficiency using the junction PCR method and T7E1 assay.
  • Figures 13a to 13j show data comparing CAR gene knock-in efficiency according to sgRNA input amount and electroporation conditions using a FACS-based surface CAR protein detection method.
  • Figure 14 shows data comparing CAR gene knock-in and TGFBR2 knock-out efficiencies according to various material treatment conditions using junction PCR and T7E1 assay.
  • Figures 15a to 15k show data comparing the CAR gene knock-in efficiency according to various material processing conditions using a FACS-based surface CAR protein detection method.
  • Figure 16 is data confirming the CAR gene knock-in efficiency according to the cytokine combination
  • Figure 16a is the knock-in efficiency of the CAR gene using the junction PCR method
  • Figure 16b is data comparing the assassination effect of CAR-NK cells. am.
  • Figure 17 shows data comparing the CAR gene knock-in efficiency according to the HA length (300, 500, 700, 1000 bp) in the DNA construct for CAR gene insertion using the junction PCR method.
  • Figure 18 shows data confirming the cancer cell killing effect due to wild-type (wild)-CAR gene and mutant-CAR gene knock-in
  • Figure 18a shows wild-type (wild)-CAR gene and mutant-CAR gene DNA.
  • Construct schematic diagram Figure 18b is the knock-in efficiency of the CAR gene using the junction PCR method
  • Figure 18c is the degree of reduction in surface TGFBR2 expression of CAR-NK cells
  • Figure 18d is data confirming the assassination effect of CAR-NK cells. .
  • Figure 19 shows data confirming the CAR gene knock-in efficiency according to the insertion of a poly A sequence and an additional DNA nuclear targeting sequence (DTS) at the 3'-end of the CAR gene knock-in DNA construct.
  • Figure 19a shows poly A sequence; Or, it is a schematic diagram of the CAR gene DNA construct into which the poly A sequence and the DTS sequence of SV40, CREB, or GRE are inserted, and Figures 19b to 19d show the CAR gene knock-in efficiency according to the insertion of these sequences using FACS-based surface CAR protein. This is data compared by detection method.
  • Figure 20 shows data comparing the knock-in efficiency of the CAR gene using a viral vector using a FACS-based surface CAR protein detection method.
  • the present invention provides a TGFBR2 (TGF beta receptor 2) knock-out method comprising at least one single guide selected from the group consisting of single guide RNAs (sgRNAs) represented by the base sequences of SEQ ID NO: 1 to SEQ ID NO: 6. out) relates to a single guide RNA.
  • TGFBR2 TGF beta receptor 2
  • sgRNAs single guide RNAs
  • the present invention provides a single guide RNA for TGFBR2 knock-out.
  • TGFBR2 TGF beta receptor 2 knock-out, comprising any one gene scissors selected from the group consisting of Cas9 protein, base sequence encoding Cas9 protein, Cpf1 protein, and base sequence encoding Cpf1 protein.
  • TGFBR2 TGF beta receptor 2 knock-out, comprising any one gene scissors selected from the group consisting of Cas9 protein, base sequence encoding Cas9 protein, Cpf1 protein, and base sequence encoding Cpf1 protein.
  • the present invention provides at least one single guide RNA for TGFBR2 knock-out selected from the group consisting of single guide RNAs represented by the base sequences of SEQ ID NO: 1 to SEQ ID NO: 6, and
  • TGFBR2 knock-out method comprising treating human-derived cells with any one gene scissors selected from the group consisting of a Cas9 protein, a base sequence encoding the Cas9 protein, a Cpf1 protein, and a base sequence encoding the Cpf1 protein. do.
  • the human-derived cell is any one immune effector cell selected from the group consisting of T cells, natural killer (NK) cells, macrophages, monocytes, and dendritic cells. You can.
  • the single guide RNA and gene scissors are delivered to immune effector cells through electroporation or gene transfer vector, and the electroporation is performed under the conditions of 1000 V to 2500 V, 5 ms to 50 ms, and 1 pulse to 5 pulse.
  • the gene transfer vector may be a plasmid, viral vector, or non-viral vector.
  • the present invention provides (1) at least one single guide RNA for TGFBR2 knock-out selected from the group consisting of single guide RNAs represented by the base sequences of SEQ ID NO: 1 to SEQ ID NO: 6;
  • the present invention provides immune effector cells prepared by the above method in which the TGFBR2 expression gene is knocked out and the chimeric antigen receptor gene specific for a cancer cell antigen is knocked in.
  • the present invention provides a pharmaceutical composition for preventing or treating cancer containing the immune effector cells.
  • the negative effects of TGF- ⁇ are eliminated by knocking out TGFBR2 using the CRISPR/Cas9 system, and at the same time, the cancer cell-related antigen is targeted at the site where the TGFBR2 gene was knocked out.
  • CAR-NK cells were prepared by knocking in the CAR gene.
  • the present invention provides a TGFBR2 (TGF beta receptor 2) knock-out method comprising at least one single guide selected from the group consisting of single guide RNAs (sgRNAs) represented by the base sequences of SEQ ID NO: 1 to SEQ ID NO: 6. It is about a single guide RNA for knock-out.
  • sgRNAs single guide RNAs
  • the present invention provides a single guide RNA for TGFBR2 knock-out.
  • TGFBR2 TGF beta receptor 2 knock-out, comprising any one gene scissors selected from the group consisting of Cas9 protein, base sequence encoding Cas9 protein, Cpf1 protein, and base sequence encoding Cpf1 protein. It relates to a composition for use.
  • single guide RNA refers to a naturally occurring version of a two-piece guide RNA complex consisting of a single continuous sequence.
  • a simplified single guide RNA is used to instruct the Cas9 protein to bind and cut specific DNA sequences for genome editing.
  • knock-out refers to modifying or removing a specific gene in a base sequence so that it cannot be expressed
  • knock-in refers to modifying or removing a specific gene from a base sequence so that it cannot be expressed. It means being introduced into the host's genome so that it can be expressed.
  • Gene Editing is an artificial restriction endonuclease that recognizes a specific gene base sequence in the genome and cuts the DNA at the corresponding site, and is used for gene editing (genome editing) in human, animal and plant cells. editing), and gene scissor technology is divided into 1st generation zinc finger nucleases (ZFN: Zinc Finger Nuleases) and 2nd generation TALEN (Tranion Activator-Like Effector Nucleases) depending on the type of enzyme used to cut out a specific base. ), and is divided into 3rd generation CRISPR (CRISPR/Cas9 or CRISPR/Cpf1).
  • ZFN Zinc Finger Nuleases
  • TALEN Tranion Activator-Like Effector Nucleases
  • sgRNA a component of CRISPR (clustered regulatory interspaced short palindromic repeat), has the ability to recognize 20bp of a specific DNA base sequence, and the Cas9 protein or Cpf1 protein cleaves the specific DNA bound to the sgRNA.
  • CRISPR RNA crRNA
  • sgRNA sequences were designed as shown in Table 1. did.
  • sgRNA (TGFBR2-T1), represented by the base sequence of SEQ ID NO: 1, is a signal peptide (SP) portion of the TGFBR2 gene
  • sgRNA (TGFBR2-T2), represented by the base sequence of SEQ ID NO: 2
  • the sgRNA (TGFBR2-T3) represented by the nucleotide sequence of SEQ ID NO: 3 and the sgRNA (TGFBR2-T4) represented by the nucleotide sequence of SEQ ID NO: 4 are the extracellular domain (ECD) portion of the TGFBR2 gene and the nucleotide sequence of SEQ ID NO: 5.
  • the sgRNA (TGFBR2-T5) represented by the base sequence and the sgRNA (TGFBR2-T6) represented by the base sequence of SEQ ID NO: 6 target the intracellular domain (ICD) portion.
  • T1 + T2 sgRNA combination T3 + T4 sgRNA combination, and T5 + T6 sgRNA combination.
  • primary NK cells natural killer cells
  • TGFBR2 protein expression was reduced to a high level upon treatment with T1 + T2 sgRNA or T5 + T6 sgRNA ( Figures 3a-3g).
  • the present invention provides at least one single guide RNA for TGFBR2 knock-out selected from the group consisting of single guide RNAs represented by the base sequences of SEQ ID NO: 1 to SEQ ID NO: 6, and
  • TGFBR2 knock-out method comprising treating human-derived cells with any one gene scissors selected from the group consisting of Cas9 protein, base sequence encoding Cas9 protein, Cpf1 protein, and base sequence encoding Cpf1 protein. will be.
  • the human-derived cells may be any human-derived cells that express TGFBR2, and are preferably T cells, natural killer (NK) cells, macrophages, monocytes, and dendritic cells. It may be any one immune effector cell selected from the group consisting of dendritic cells.
  • the single guide RNA and gene scissors can be delivered to immune effector cells through electroporation or gene transfer vector.
  • the electroporation is performed under the conditions of 1000 V to 2500 V, 5 ms to 50 ms, and 1 pulse to 5 pulse, preferably under the conditions of 1600 V to 1900 V, 10 ms to 20 ms, and 1 pulse to 3 pulse.
  • 1600 V to 1700 V, 10 ms to 20 ms, and 1 pulse to 3 pulse conditions can be processed.
  • the gene transfer vector may be a plasmid, a viral vector, or a non-viral vector
  • the viral vector may be an adenovirus, a retrovirus, or an adeno-associated virus (AAV).
  • Nonviral vectors include macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
  • the present invention is another consistent point
  • DNA construct for knock-in of a chimeric antigen receptor (CAR) specific for cancer cell antigen containing a base sequence encoding an intracellular signal transduction domain It is about (construct).
  • CAR chimeric antigen receptor
  • CARs generally refers to a fusion protein containing an extracellular domain that has the ability to bind an antigen and one or more intracellular domains.
  • CARs are chimeric antigen receptors - a core part of immune effector cells, and may include an antigen-binding domain, a transmembrane domain, a co-stimulatory domain, and an intracellular signaling domain.
  • promoter refers to the minimal sequence sufficient to direct transcription. Additionally, promoter constructs sufficient to cause regulatable promoter-dependent gene expression induced by cell type-specific or external signals or agents may be included, and these constructs may be located in the 5' or 3' portion of the gene. . Both conservative and inducible promoters are included. Promoter sequences may be from prokaryotes, eukaryotes, or viruses. The promoter may be pSFFV, pCMV or pEF1A.
  • the pSFFV promoter represented by the nucleotide sequence of SEQ ID NO: 13 was used, and if necessary, 90% or more, 93% or more of the nucleotide sequence of SEQ ID NO: 13. , may include sequences that are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical.
  • the term “signal peptide” generally refers to a peptide chain for guiding protein delivery.
  • the signal peptide may be a short peptide having a length of 5 to 30 amino acids.
  • the DNA construct of the present invention may include a base sequence encoding a signal peptide represented by the amino acid sequence of SEQ ID NO: 14, and more preferably, the base sequence may be represented by SEQ ID NO: 15.
  • a base sequence encoding FLAG represented by the amino acid sequence of SEQ ID NO: 16 is provided between the base sequence encoding the signal peptide and the base sequence encoding the cancer cell antigen-binding domain. This may be additionally included, and preferably the base sequence may be represented by SEQ ID NO: 17.
  • the term “cancer cell antigen-binding domain” generally refers to a domain capable of specifically binding to a cancer cell antigen protein.
  • the cancer cell antigen-binding domain includes mesothelin (MSLN), CD22, CD19, HER2 (human epidermal growth factor receptor type 2), GD2, folate receptor, and MUC1 (MSLN) expressed on the surface of cancer cells. It may contain antibodies or fragments thereof that can specifically bind to Mucin 1), ErbB2 (Erythroblastic oncogene B-2 gene), EphA2 (EPH receptor A2), or EGFR (Epidermal growth factor receptor) polypeptides or fragments thereof.
  • MSLN mesothelin
  • CD22 CD19
  • HER2 human epidermal growth factor receptor type 2
  • GD2 human epidermal growth factor receptor type 2
  • MUC1 MSLN
  • the DNA construct of the present invention may include a base sequence encoding the mesothelin-binding domain represented by the amino acid sequence of SEQ ID NO: 18, and more preferably, the base sequence may be represented by SEQ ID NO: 19. .
  • binding domain refers to “extracellular domain,” “extracellular binding domain,” and “antigen-specific binding domain.” "and “extracellular antigen-specific binding domain” may be used interchangeably and refer to a CAR domain or fragment that has the ability to specifically bind to a target antigen.
  • the “transmembrane domain” generally refers to a CAR domain that passes through the cell membrane and is connected to an intracellular signaling domain to play a role in signaling.
  • the transmembrane domain may be derived from a protein selected from the group consisting of CD8 ⁇ , CD4, CD28, CD137, CD80, CD86, CD152, PD1, NKG2D, 41BB, 2B4, NKp30, NKp44, NKp46, NKG2C and OX40.
  • the DNA construct of the present invention may include a base sequence encoding CD8 represented by the amino acid sequence of SEQ ID NO: 20, and more preferably, the base sequence may be represented by SEQ ID NO: 21.
  • the “costimulatory domain” generally refers to an intracellular domain capable of providing immunostimulatory molecules, which are cell surface molecules necessary for an effective response to antigens in lymphocytes.
  • the costimulatory domains described above may include costimulatory domains selected from the group consisting of CD28, OX-40, ICOS, NKG2D, 41BB, 2B4, NKp30, NKp44, NKp46 and NKG2C.
  • the DNA construct of the present invention may include a base sequence encoding 4-1BB represented by the amino acid sequence of SEQ ID NO: 22, and more preferably, the base sequence may be represented by SEQ ID NO: 23.
  • intracellular signal transduction domain generally refers to a domain located inside a cell and capable of transmitting signals.
  • the intracellular signaling domain is the intracellular signaling domain of a chimeric antigen receptor.
  • the intracellular signaling domain can be selected from the CD3 ⁇ intracellular domain, CD28 intracellular domain, CD28 intracellular domain, 4-1BB intracellular domain, and OX40 intracellular domain.
  • the DNA construct of the present invention may include a base sequence encoding CD3 ⁇ represented by the amino acid sequence of SEQ ID NO: 24, and more preferably, the base sequence may be represented by SEQ ID NO: 25.
  • the DNA construct is a structure in which the base sequences encoding each are arranged in the following order: pSFFV promoter - signal peptide - FLAG - mesothelin-binding domain - CD8 - 4-1BB - CD3 ⁇ , for TGFBR2 knock-out of the present invention. It is characterized by insertion into the region knocked out by sgRNA.
  • a base sequence encoding HA may be included at the 5'-end and 3'-end of the DNA construct, and the length of the base sequence encoding HA is 200bp to 1500bp, preferably. May be 300bp to 1000bp, more preferably 500bp to 1000bp.
  • the HA length was 700bp.
  • the knock-in efficiency increased in the case of 1000bp (FIG. 17).
  • the knock-in efficiency of the wild-type CAR gene DNA construct As a result of confirming the knock-in efficiency of the wild-type (wild)-CAR gene and the mutant (mutant)-CAR gene DNA construct, the knock-in efficiency of the wild-type CAR gene DNA construct ( It was confirmed that the degree of reduction in surface TGFBR2 expression of etched NK cells (FIG. 18b), the degree of reduction in surface TGFBR2 expression of etched NK cells (FIG. 18c), and the assassination effect of etched NK cells (FIG. 18d) were all excellent.
  • a polyadenylation sequence may be included at the 3'-end of the DNA construct.
  • the term “poly A site” or “poly A sequence” refers to a DNA sequence that directs both termination and polyadenylation of the nascent RNA transcript by RNA polymerase II.
  • Polyadenylation sequences may improve mRNA stability by adding a poly A tail to the 3' end of the coding sequence, contributing to increased translation efficiency. Because transcripts lacking the poly A tail are unstable and rapidly degraded, efficient polyadenylation of recombinant transcripts is desirable.
  • the 3'-end of the DNA construct of the present invention may contain a poly A sequence including the base sequence of SEQ ID NO: 43.
  • a DNA nuclear targeting sequence may be further included at the 3'-end of the DNA construct.
  • DTS is a recognition sequence for a cell-endogenous DNA-binding protein, and the use of DTS in the vector can also increase the ability to localize the vector to the nucleus.
  • DTS can be selected from SV40 enhancer, NF ⁇ B, CREB and GRE.
  • the 3'-end of the DNA construct of the present invention includes SV40 DTS containing the base sequence of SEQ ID NO: 44, CREB DTS containing the base sequence of SEQ ID NO: 45, and GRE containing the base sequence of SEQ ID NO: 46. DTS, or combinations thereof may be included.
  • the poly A sequence and DTS when both the poly A sequence and DTS are included at the 3'-end of the DNA construct, the poly A sequence and DTS may be sequentially included in the direction from the 5'-end to the 3'-end.
  • the present invention provides a DNA fragment ( It is about Fragment.
  • the DNA fragment may be in the form of ssDNA or dsDNA. Additionally, DNA fragments can be delivered using electroporation or gene delivery vectors.
  • the present invention provides: (1) at least one single guide RNA for TGFBR2 knock-out selected from the group consisting of single guide RNAs represented by the base sequences of SEQ ID NO: 1 to SEQ ID NO: 6;
  • (3) comprising the step of processing a DNA construct or a DNA fragment thereof for knock-in of a chimeric antigen receptor (CAR) specific for the cancer cell antigen to an immune effector cell, It relates to a method of producing immune effector cells in which the TGFBR2 expression gene is knocked out and the chimeric antigen receptor gene specific for a cancer cell antigen is knocked in.
  • CAR chimeric antigen receptor
  • the present invention relates to immune effector cells prepared by the above method in which the TGFBR2 expression gene is knocked out and the chimeric antigen receptor gene specific for a cancer cell antigen is knocked in.
  • the immune effector cells may be T cells, natural killer (NK) cells, macrophages, monocytes, or dendritic cells, and are preferably natural killer (NK) cells.
  • NK natural killer
  • Immune effector cells for producing immune effector cells expressing a chimeric antigen receptor (CAR) can be obtained from a subject, wherein the “subject” is a living organism (e.g., a mammal) against which an immune response can be elicited. Includes. Examples of subjects include humans, dogs, cats, mice, rats, and transgenic species thereof.
  • the sgRNA can be used as a mixture of one type or two types of sgRNA, and can be treated at a concentration of 40 to 400 pmol.
  • the single guide RNA, gene scissors, and DNA fragment are delivered to immune effector cells through electroporation or gene transfer vector, and the electroporation is performed at 1000 V to 2500 V, 5 ms to 50 ms, and 1 pulse.
  • the gene delivery vector may be a plasmid, viral vector, or non-viral vector.
  • the electroporation is performed under the conditions of 1000 V to 2500 V, 5 ms to 50 ms, and 1 pulse to 5 pulse, preferably under the conditions of 1600 V to 1900 V, 10 ms to 20 ms, and 1 pulse to 3 pulse.
  • 1600 V to 1700 V, 10 ms to 20 ms, and 1 pulse to 3 pulse conditions can be processed.
  • Cytokines can be further treated with immune effector cells.
  • treatment may be performed with IL-21, a combination of IL-2 + IL-21, or a combination of IL-21 + TGF- ⁇ 1, and more preferably, treatment may be performed with IL-21 alone.
  • the cytokines can be treated using cytokine-expressing feeder cells or cytokine-secreting cells, if necessary.
  • composition for preventing or treating cancer comprising an immune effector with TGFBR2 expression gene knock-out and CAR gene knock-in
  • the present invention provides a pharmaceutical composition for preventing or treating cancer, comprising immune effector cells in which the TGFBR2 expression gene is knocked out and the chimeric antigen receptor gene specific for a cancer cell antigen is knocked in. .
  • the cancer cell antigen may be CD22, CD19, or mesothelin (MSLN), preferably mesothelin, and the cancer or tumor may be a normal control group, or a cancer or cancer overexpressing mesothelin compared to normal cells. It's a tumor. More specifically, squamous cell cancer, small cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, squamous cell carcinoma of the lung, mesothelial cancer, peritoneal cancer, hepatocellular carcinoma, gastrointestinal cancer, pancreatic cancer, glioma, cervical cancer, ovarian cancer, liver cancer, and bladder cancer.
  • MSLN mesothelin
  • hepatocellular carcinoma consisting of hepatocellular carcinoma, breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney cancer, prostate cancer, vulvar cancer, thyroid cancer, liver carcinoma, leukemia and other lymphoproliferative disorders, and various types of head and neck cancer.
  • hepatocellular carcinoma consisting of hepatocellular carcinoma, breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney cancer, prostate cancer, vulvar cancer, thyroid cancer, liver carcinoma, leukemia and other lymphoproliferative disorders, and various types of head and neck cancer.
  • hepatocellular carcinoma consisting of hepatocellular carcinoma, breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney cancer, prostate cancer, vulvar cancer, thyroid cancer, liver carcinoma, leukemia and other lymphoproliferative disorders, and various types of head and neck cancer.
  • CRISPR RNA crRNA
  • sgRNA sequences were designed as shown in Table 1.
  • TGFBR2-T1 CCTGAGCAGCCCCCCGACCCA SP (384 - 403) SEQ ID NO: 1 TGFBR2-T2 (+) CCCACCGCACGTTCAGAAGT ECD (454 - 473) SEQ ID NO: 2 TGFBR2-T3 (+) CCCCTACCATGACTTTATTC ECD (775 - 794) SEQ ID NO: 3 TGFBR2-T4 (-) ATTGCACTCATCAGAGCTAC ECD (870 - 889) SEQ ID NO: 4 TGFBR2-T5 (-) GCTTCTGCTGCCGGTTAACG ICD (1027 - 1046) SEQ ID NO: 5 TGFBR2-T6 (+) GCCCATTGAGCTGGACACCC ICD (1183 - 1202) SEQ ID NO: 6
  • the sgRNA (TGFBR2-T1) represented by the nucleotide sequence of SEQ ID NO: 1 is the signal peptide (SP) portion of the TGFBR2 gene
  • the sgRNA (TGFBR2-T2) represented by the nucleotide sequence of SEQ ID NO: 2 is the signal peptide (SP) portion of the TGFBR2 gene.
  • the sgRNA (TGFBR2-T3) expressed by the base sequence and the sgRNA (TGFBR2-T4) expressed by the base sequence of SEQ ID NO: 4 are composed of the extracellular domain (ECD) part of the TGFBR2 gene with the base sequence of SEQ ID NO: 5.
  • the indicated sgRNA (TGFBR2-T5) and the sgRNA (TGFBR2-T6) indicated by the base sequence of SEQ ID NO: 6 target the intracellular domain (ICD) portion.
  • T1 sgRNA and T2 sgRNA combination T1 + T2
  • T3 sgRNA and T4 sgRNA combination in Table 1
  • T5 sgRNA and T6 sgRNA combination T5 + T6
  • human PBMC cells were co-cultured with irradiated K562-GE (mbIL18/21 overexpressed K562) cells for 3 weeks under conditions treated with IL-2 and IL-15 cytokines to obtain primary NK cells. .
  • genomic DNA was extracted from primary NK cells using the QiAmp DNA mini kit (qiagen), and PCR amplicon containing the edited portion was obtained using each corresponding primer.
  • Primer sequences for PCR amplicon amplification Amplicon Primer sequence sequence number T1+T2 GTTGAGTGAGTCACTCGC SEQ ID NO: 7 CTCAAACTTCCCTTTCGG SEQ ID NO: 8 T3+T4 GTCTGCTCCAGGTGATGTTTAT SEQ ID NO: 9 GGGCCTGAGAATCTGCATTTA SEQ ID NO: 10 T5+T6 GCAGGGGATGACGAAC SEQ ID NO: 11 CTGCCCACTGTTAGCC SEQ ID NO: 12
  • the expression level of the target gene, TGFBR2 was measured using FACS.
  • NK cells were treated with gene scissors for 72 hours in the same manner as in Example 2, and then NK cells were obtained and transferred to a tube for FACS measurement, and then washed with PBS.
  • stain with Live/dead dye eBioscienceTM Fixable Viability Dye eFluorTM 506
  • IC fixation buffer 100 ⁇ l
  • dye at room temperature in dark conditions 100 ⁇ l
  • APC anti-human TGFBR2 antibody APC anti-human TGFBR2 antibody, 5 ⁇ l
  • perm buffer 100 ⁇ l
  • the NK cells treated with the gene scissors were stained with TGFbR2-APC (1:100, Biolegend) antibody, and then FACS analysis was performed. did.
  • TGFBR2 protein expression was reduced to about 82% and 81.4% based on population when treated with T1 + T2 sgRNA or T5 + T6 sgRNA.
  • NK cells were electroporated (1800 V, 20 ms, 1 pulse) with spCas9 gene scissors protein in the same manner as in Example 2 with sgRNA (T1 + T2) and sgRNA (T5 + T6), and then IL- Edited primary NK cells were cultured in RPMI1640 medium containing 2 and IL-15 cytokines.
  • each edited primary NK cell (Effector; E) was treated with TGF-b1 cytokine at a concentration of 10 ng/ml, and then on the 8th day, at 37°C and 5% CO2 humidified conditions. and luciferase overexpressing-AsPC1 cancer cells (Target; T) were co-cultured at a 2:1 ratio. For co - culture, 5 The assassination capacity of NK cells was compared.
  • Luciferase was measured using the Nano-Glo® Luciferase Assay System kit, and the fluorescence signal for Luc-AsPC1 cells was detected using the GloMax® equipment according to the manufacturer's protocol in the following process.
  • Target cells were lysed using a lysis buffer, centrifuged at 13,000 rpm, 15 to 20 minutes, 4°C, and the buffer included in Promega (cat.no.N1110): Substrate was mixed at 50%: Mixed in 2 proportions. After adding 50 ⁇ l of each target cell eluate and 50 ⁇ l of buffer/substrate mixture into each 96-well, fluorescence was measured and quantified to confirm the cancer cell killing effect.
  • 52 ⁇ l of nuclease free buffer was added to prepare a Cas9 RNP complex.
  • Primary NK cells were suspended in T buffer at 2 M/60 ⁇ l, then Cas9 RNP (60 ⁇ l) was added to the primary NK cells (60 ⁇ l), and gene editing was performed by electroporation under the conditions of 1800 V, 20 ms, 1 pulse. was delivered.
  • NK cells edited by the above method were cultured in RPMI1640 medium containing IL-2 and IL-15 cytokines, and TGF-b (10 ng/ml) was additionally added on days 5 and 6.
  • TGF-b 10 ng/ml
  • the edited NK cells were co-cultured with the luciferase-expressing AsPC1 cancer cells (0.25M cells/1 ml, using RPMI1640 medium) inoculated in a 24-well plate the previous day at a 2:1 ratio.
  • IL-2 and APC-anti-human CD107a antibodies (5 ⁇ l) mixed to a final volume of 1 ml were added to 0.25 ml of RPMI (011-51) medium.
  • primary NK cells were treated with PMA (2.5 ⁇ g/ml) and ionomycin (0.5 ⁇ g/ml) and co-cultured in the same manner as above.
  • BFA 5 ⁇ g/ml
  • monensin 6 ⁇ g/ml
  • the edited NK cells were treated with TGF-b1 (10 ng/ml) for 3 hours, and then Western blotting was performed to determine the TGF-b1 signaling process ( The phosphorylation levels of SMAD2/3 proteins in Figure 6) were compared.
  • Cas9 RNP (T5+T6 sgRNA) complex in primary NK cells was prepared in the same manner as in Example 2, and used to prepare 4 electroporation conditions (1600 V, 10 ms, 3 pulse/1800 V, 20 ms, 1
  • the editing effect according to pulse/1850 V, 10 ms, 2 pulse/1900 V, 20 ms, 1 pulse) was compared using the T7E1 assay.
  • Cas9 RNP (T5+T6 sgRNA) complex in primary NK cells was prepared in the same manner as in Example 2, and used to prepare 5 electroporation conditions (1600 V, 10 ms, 3 pulse; 1600 V, 20 ms, 1 pulse).
  • the editing effect according to (pulse; 1700 V, 10 ms, 3 pulse; 1700 V, 20 ms, 1 pulse; 1800 V, 20 ms, 1 pulse) was compared through FACS analysis. FACS analysis was performed in the same manner as Example 3.
  • Cas9 RNP (T5+T6 sgRNA) complex in primary NK cells was prepared in the same manner as in Example 2, and used to prepare 5 electroporation conditions (1600 V, 10 ms, 3 pulse; 1600 V, 20 ms, 1 pulse). Primary NK cell survival rate was confirmed according to pulse; 1700 V, 10 ms, 3 pulse; 1700 V, 20 ms, 1 pulse; 1800 V, 20 ms, 1 pulse).
  • NK cells were harvested on the 5th day after electroporation, and then FACS analysis was performed using eBioscienceTM Fixable Viability Dye eFluorTM 506 dye staining for live/dead population analysis.
  • a CAR gene knock-in DNA construct was designed to target mesothelin.
  • the CAR knock-quote DNA construct of the present invention includes pSFFV promoter (SEQ ID NO: 13) - signal peptide (SEQ ID NO: 14) - FLAG (SEQ ID NO: 16) - mesothelin-binding domain (SS) scFv, SEQ ID NO: 18) - CD8 (SEQ ID NO: 20) - 4-1BB (SEQ ID NO: 22) - CD3 ⁇ (SEQ ID NO: 24)
  • SEQ ID NO: 26 A structure in which the base sequences encoding each are arranged in the following order (SEQ ID NO: 26), the present invention It is inserted into the region knocked out by the sgRNA for TGFBR2 knock-out, and a 200bp to 1500bp long base sequence encoding HA (homology arm) is added to the 5'-end and 3'-end of the DNA construct.
  • a vector containing the CAR knock-quote DNA construct To prepare a vector containing the CAR knock-quote DNA construct, first pCMV3 vector was cut with Spe1 and Xba1 enzymes, and then the 5'-HA fragment, CAR knock-quote DNA construct and 3 were added. Each '-HA fragment was synthesized and a vector was prepared through infusion cloning. In addition, DNA fragments were prepared so that the 5'-HA and 3'-HA lengths were 300bp (SEQ ID NO: 27), 500bp (SEQ ID NO: 28), 700bp (SEQ ID NO: 29), and 1000 bp (SEQ ID NO: 30).
  • PCR primer sequences for amplifying DNA fragments according to HA length HA size Primer sequence sequence number 300bp TTTCCCCATCAGAATATAACACCAg SEQ ID NO: 31 GCAGGTCCTCCCAGC SEQ ID NO: 32 500bp AAGGAAGAGCAGGGGATGAC SEQ ID NO: 33 AGCCAGGTCATCCACAGAC SEQ ID NO: 34 700bp AGTTCCCTGTCCGTGG SEQ ID NO: 35 CATTAGCAAAAATGCTCAGGc SEQ ID NO: 36 1000bp TCTCCCTGTCACCCATGGG SEQ ID NO: 37 TTACTTTCAATGTTCAAGGCATTG SEQ ID NO: 38
  • a Cas9 RNP complex was prepared by mixing sgRNA (T6) and sgRNA (T5 + T6) with spCas9 in the same manner as in Example 2, and then CAR knock-quote DNA with an HA length of 700 bp prepared in Example 8.
  • DNA fragments (500 ng) containing the construct were treated together with primary NK cells and electroporated under the conditions of 1600 V, 10 ms, 3 pulses.
  • Genomic DNA was extracted from CAR-NK cells, and 5' junction PCR was performed using the primers in Table 4 to secure a PCR amplicon containing the edited gene.
  • the amount of sgRNA (T6) was set to 40 pmol, 100 pmol, and 400 pmol, respectively, in the same manner as in Example 9.
  • Primary NK cells were treated using a DNA fragment containing a CAR knock-quote DNA construct with an HA length of 700bp, under the conditions of 1600 V, 10 ms, 3 pulses and 1800 V, 20 ms, 1 pulse, respectively. Electroporation was performed.
  • Genomic DNA was extracted from CAR-NK cells, and 5' junction PCR was performed in the same manner as in Example 9 using the primers in Table 4. Additionally, 5' junction PCR was performed in the same manner as in Example 2 using the primers in Table 5. T7E1 assay was performed.
  • Primer sequence for PCR amplicon amplification when HA is 700bp
  • Primer sequence sequence number CCCAATGTCCTGAGCTTAGATAA SEQ ID NO: 39
  • the T7E1 assay confirmed that the gene was effectively knocked out by sgRNA treatment under all conditions.
  • the amount of PCR amplicon was highest when 400 pmol of sgRNA was treated under the conditions of 1600 V, 10 ms, and 3 pulse.
  • FACS analysis was performed to compare the level of surface CAR protein expression expressed on CAR-NK cell membranes.
  • the mesothelin antibody expression rate was found to be highest when 400 pmol of sgRNA was electroporated under the conditions of 1600 V, 10 ms, and 3 pulses.
  • a Cas9 RNP complex was prepared by mixing 400 pmol of sgRNA (T6) with spCas9 in the same manner as in Example 2, and then mixed with Cas9 RNP and Example 8.
  • Primary NK cells were treated with DNA fragments containing the prepared CAR knock-quote DNA construct with an HA length of 700bp, and electroporated under the conditions of 1600 V, 10 ms, and 3 pulses.
  • edited primary NK cells were incubated with valnemulin (1 ⁇ M), IL-21 (400 ng/ml), IL-2 (200 IU/ml)/IL-21 (400 ng/ml), and IL-2 ( The cells were cultured in medium containing 200 IU/ml)/IL-15 (10 ng/ml)/IL-21 (400 ng/ml), respectively, and the medium was changed after 48 hours.
  • Genomic DNA was extracted from CAR-NK cells, and 5' junction PCR was performed in the same manner as in Example 9 using the primers in Table 4. Additionally, 5' junction PCR was performed in the same manner as in Example 2 using the primers in Table 5. T7E1 assay was performed.
  • FACS analysis was performed by the method of Example 10-2 above.
  • a Cas9 RNP complex was prepared by mixing 400 pmol of sgRNA (T6) with spCas9 in the same manner as in Example 2, and then Cas9 RNP and the CAR knock-quote DNA construct with an HA length of 700 bp prepared in Example 8 were mixed.
  • the DNA fragment containing the cells was treated with primary NK cells and electroporated under the conditions of 1600 V, 10 ms, and 3 pulses. At this time, as shown in Figure 16a, IL-21 and/or TGF- ⁇ 1 were treated separately before or after electroporation.
  • Genomic DNA was extracted from CAR-NK cells, and 5' junction PCR was performed in the same manner as in Example 9 using the primers in Table 4. Additionally, 5' junction PCR was performed in the same manner as in Example 2 using the primers in Table 5. T7E1 assay was performed.
  • a Cas9 RNP complex was prepared by mixing 400 pmol of sgRNA (T6) with spCas9 in the same manner as in Example 2, and then the Cas9 RNP and the 5'-HA and 3'-HA prepared in Example 8 were 300bp in length. , DNA fragments containing CAR gene knock-quote DNA constructs of 500bp, 700bp, and 1000bp were respectively treated with primary NK cells and electroporated under the conditions of 1600 V, 10 ms, and 3 pulses.
  • Genomic DNA was extracted from CAR-NK cells, and 5' junction PCR was performed in the same manner as Example 9 using the primers in Table 6.
  • a wild type DNA fragment containing the CAR gene knock-in DNA construct with a length of 1000 bp 5'-HA and 3'-HA prepared in Example 8 was used, and as a mutant, a CAR gene knock-quote DNA construct vector with the 4-1BB base sequence and CD3 ⁇ base sequence removed was prepared and used.
  • a Cas9 RNP complex was prepared by mixing 400 pmol of sgRNA (T6) with spCas9 in the same manner as in Example 2, and then vectors containing Cas9 RNP and the wild-type and mutant CAR gene knock-in DNA constructs were added to each primary Wild-type CAR-NK cells and mutant CAR-NK cells were prepared by treating NK cells and electroporating them at 1600 V, 10 ms, 3 pulse conditions.
  • Genomic DNA was extracted from CAR-NK cells, and 5' junction PCR was performed in the same manner as Example 9 using the primers in Table 5.
  • the SV40 poly A sequence (SEQ ID NO: 43) shown in Table 7 below is added to the 3'-end of the DNA construct.
  • the DTS sequence additionally included the SV40 sequence (SEQ ID NO: 44), the CREB sequence (SEQ ID NO: 45), or the GRE sequence (SEQ ID NO: 46).
  • a DNA fragment encoding HA (homology arm) with a length of 1000 bp was inserted into the 5'-end and 3'-end of this DNA construct.
  • a vector containing the CAR knock-quote DNA construct was prepared in the same manner as in Example 8.
  • DTS DNA nuclear targeting sequence division base sequence sequence number
  • Poly A sequence and DNA nuclear targeting sequence (DTS) division base sequence sequence number
  • Poly A sequence AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA 43
  • DTS SV40 GGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCA
  • CREB TGACGTCAAGATCTA 45
  • GRE GGTACATTTTGTTCTAGAACAAAATGTACCGGTACATTTTGTTCTGGTACATTTTGTTCT 46
  • Cas9-sgRNA ribonucleoprotein (RNP) complex (Cas9 RNP complex)
  • sgRNA 100pmol/ ⁇ , 4 ⁇ l, total 400pmol
  • RT room temperature
  • 244.4 fmol of DNA construct and nuclease free buffer were added to make a total of 52 ⁇ l.
  • PBNK cells were suspended in T buffer at 2M/60 ⁇ l, Cas9 RNPs (60 ⁇ l) and cells (60 ⁇ l) were collected, and then electroporator (neon electroporator) was used under the conditions of 1820V, 20 ms, 1 pulse. After rotary electroporation, electroporation was performed once under the conditions of 500V, 10ms, and 1 pulse.
  • electroporator non electroporator
  • NK cells on days 5, 9, and 19 after culturing in an incubator 37°C, CO 2 5%
  • 0.5 ⁇ g of biotin-conjugated MSLN ECD protein was added to 100 ⁇ l of PBS solution at a cell count of 1 were incubated with NK cells in dark conditions at 4°C for 20 minutes.
  • 100 ⁇ l of a PBS solution containing 0.08 ⁇ g of streptavidin-PE antibody was added and reacted under the same conditions.
  • FACS analysis was performed to compare the level of surface CAR protein expression expressed on CAR-NK cell membranes.
  • CAR gene knock-in in order to confirm whether CAR gene knock-in is performed efficiently even when a viral vector is used as a delivery vector for the CAR gene knock-in DNA construct, CAR gene knock-in is performed in cells using an adeno-associated virus (AAV) vector. Knock-in and then knock-out using Cas9 RNP (AAV ⁇ KO), or knock-out using Cas9 RNP in cells and then knock-in the CAR gene using an adeno-associated virus (AAV) vector (KO ⁇ AAV). carried out.
  • AAV adeno-associated virus
  • sgRNA 100 pmol/ ⁇ , 4 ⁇ l, total 400 pmol
  • sgRNA single guide RNA

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Cell Biology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Hematology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Oncology (AREA)
  • Virology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 유전자 가위 넉-인(knock-in)을 이용하여 제조한 키메릭 항원 수용체(chimeric antigen receptor; CAR) 세포 및 이의 용도에 관한 것으로, 보다 상세하게는 TGFBR2(TGF beta receptor 2) 넉-아웃(knock-out)용 단일 가이드 RNA(sgRNA), 암 세포에 특이적인 키메릭 항원 수용체, 및 TGFBR2 발현 유전자가 넉-아웃되고 암 세포에 특이적인 키메릭 항원 수용체 유전자가 넉-인된 면역 이펙터 세포 제조방법에 관한 것이다.

Description

유전자 가위 넉-인을 이용하여 제조한 키메릭 항원 수용체 세포 및 이의 용도
본 발명은 유전자 가위 넉-인(knock-in)을 이용하여 제조한 키메릭 항원 수용체(chimeric antigen receptor; CAR) 세포 및 이의 용도에 관한 것으로, 보다 상세하게는 TGFBR2(TGF beta receptor 2) 넉-아웃(knock-out)용 단일 가이드RNA(sgRNA), 암 세포에 특이적인 키메릭 항원 수용체, 및 TGFBR2 발현 유전자가 넉-아웃되고 암 세포에 특이적인 키메릭 항원 수용체 유전자가 넉-인된 면역 이펙터 세포 제조방법에 관한 것이다.
최근 몇 년 동안 키메릭 항원 수용체-T 세포(CAR-T 세포)를 이용한 암 치료 치료제 개발이 진행되고 있다. 항-CD19 CAR-T 세포는 혈액 악성종양 치료에서 현저한 치료 효과를 보였으며, 2017년에는 두가지 제품이 FDA 승인을 받았다. 그러나 많은 시도에도 불구하고 다양한 종양 관련 항원을 표적으로 하는 CAR-T 세포는 고형 종양 환자에서 유리한 임상 결과를 보여주지 못하였다 (Na Tang et.al., JCI Insight, 27;5(4):e133977, 2020).
2021년에는 B 세포 성숙 항원(BCMA) 특이적 CAR-T 세포가 다발성 골수종(multiple myeloma; MM) 치료제로 승인되었으나, 상대적으로 높은 비용과 시간 소모적 생산, 고형 종양으로의 불충분한 도입, 면역 이펙터(immune effector) 세포 관련 신경 증후군(immune effector cell-associated neurologic syndrome; ICANS) 및 사이토카인 방출 증후군(cytokine release syndrome; CRS)을 포함한 유도된 세포 독성 효과와 같은 문제점이 있다. 따라서 CAR 활동을 보호하고 강화하면서 상기와 같은 문제를 해결하는 것이 중요하며, 다른 면역 세포 플랫폼(예, γ/δ T 세포, NKT 세포) 중에서 자연살해(natural killer; NK) 세포가 CAR를 이용한 유전공학의 대안으로 간주되고 있다. CAR NK 세포는 CAR T 세포에 비해 효율성과 안전성을 향상시킬 수 있는 몇 가지 장점을 나타내었으며, 재발성/불응성 림프성 악성 종양을 앓고 있는 환자에서 CD19 CAR-NK 세포의 첫 번째 임상 사용은 CAR-NK 세포의 지속성을 입증하였다 (Ali Bashiri Dezfouli et. al., Cells, 1;10(12):3390,2021).
한편, 고형 종양에 존재하는 면역억제성 종양 미세 환경(tumor microenvironment; TME)은 암 세포뿐만 아니라 세포외 기질 성분 및 염증 매개체 외에도 수많은 세포 유형을 포함한다. 이러 복잡한 미세 환경에서 CAR 유전자가 도입된 면역 이펙터 세포는 생존, 활성화, 증식 및 효과 기능을 손상시킬 수 있는 많은 억제 세포 및 분자의 영향을 받게 되며, 최근 연구에서는 유전자 가위를 이용하여 TGFBR2 유전자가 넉-아웃된 자연살해 세포가 다형성 교모세포종(glioblastoma multiforme; GBM)에서의 항암 효과가 증가한 것으로 나타났다 (Hila Shaim et.al., J Clin Invest.,131(14):e142116, 2021).
이에, 본 발명에서는 CRISPR/Cas9 시스템을 사용하여 TGFBR2를 넉-아웃(knock-out)함으로써 TGF-β의 부정적인 영향을 제거함과 동시에, TGFBR2 유전자가 넉-아웃된 자리에 암 세포 관련 항원을 표적으로 하는 CAR 유전자를 넉-인(knock-in) 시킨 CAR-NK 세포를 제조하였으며, 본 발명의 방법으로 제조한 CAR-NK 세포의 암 세포 살상 효과가 우수한 것을 확인하고, 본 발명을 완성하였다.
따라서, 본 발명의 목적은 TGFBR2(TGF beta receptor 2) 넉-아웃(knock-out)용 단일 가이드 RNA(sgRNA) 및 이를 이용한 TGFBR2 넉-아웃 방법을 제공하는 데 있다.
상기 목적을 달성하기 위해, 본 발명은, 서열번호 1 내지 서열번호 6의 염기서열로 표시되는 단일 가이드 RNA(sgRNA)로 구성된 군에서 선택된 어느 하나 이상의 단일 가이드를 포함하는, TGFBR2(TGF beta receptor 2) 넉-아웃(knock-out)용 단일 가이드 RNA를 제공한다.
또한, 본 발명은 상기 TGFBR2 넉-아웃용 단일 가이드 RNA; 및
Cas9 단백질, Cas9 단백질을 코딩하는 염기서열, Cpf1 단백질 및 Cpf1 단백질을 코딩하는 염기서열로 구성된 군에서 선택된 어느 하나의 유전자 가위를 포함하는, TGFBR2(TGF beta receptor 2) 넉-아웃(knock-out)용 조성물을 제공한다.
또한, 본 발명은 서열번호 1 내지 서열번호 6의 염기서열로 표시되는 단일 가이드 RNA로 구성된 군에서 선택된 어느 하나 이상의 TGFBR2 넉-아웃용 단일 가이드 RNA, 및
Cas9 단백질, Cas9 단백질을 코딩하는 염기서열, Cpf1 단백질 및 Cpf1 단백질을 코딩하는 염기서열로 구성된 군에서 선택된 어느 하나의 유전자 가위를 인간 유래 세포에 처리하는 단계를 포함하는, TGFBR2 넉-아웃 방법을 제공한다.
본 발명의 구체적인 일실시예에 있어서, 상기 인간 유래 세포는 T 세포, 자연살해(natural killer; NK) 세포, 대식세포(macrophage), 단핵구(monocyte) 및 수지상 세포(Dendritic Cell)으로 구성된 군에선 선택된 어느 하나의 면역 이펙터 세포일 수 있다.
본 발명의 구체적인 또 다른 일실시예에 있어서, 상기 단일 가이드 RNA 및 유전자 가위는 전기천공 또는 유전자 전달 벡터를 통해 면역 이펙터 세포에 전달되며, 상기 전기천공은 1000 V ~ 2500 V, 5 ms ~ 50 ms, 및 1 pulse ~ 5 pulse 조건으로 처리하고, 상기 유전자 전달 벡터는 플라스미드, 바이러스성 벡터 또는 비바이러스성 벡터일 수 있다.
다른 목적을 달성하기 위해, 본 발명은,
프로모터를 코딩하는 염기서열;
신호 펩타이드(signal peptide)를 코딩하는 염기서열;
암 세포 항원-결합도메인을 코딩하는 염기서열;
막관통 도메인(transmembrane domain)을 코딩하는 염기서열;
공동자극 도메인(costimulatory domain)을 코딩하는 염기서열; 및
세포 내 신호전달 도메인(intracellular signal transduction domain)을 코딩하는 염기서열을 포함하는, 암 세포 항원에 특이적인 키메릭 항원 수용체(chimeric antigen receptor: CAR) 넉-인(knock-in)용 DNA 컨스트럭트를 제공한다.
본 발명은 또한 상기 DNA 컨스트럭트를 포함하는 DNA 절편(Fragment)을 제공한다.
본 발명의 바람직한 일실시예에 있어서, 상기 프로모터는 pSFFV, pCMV 또는 pEF1A일 수 있으며, 바람직하게는 서열번호 13의 염기서열로 표시되는 pSFFV일 수 있다.
본 발명의 바람직한 다른 일실시예에 있어서, 암 세포 항원은 메소텔린(mesothelin; MSLN), CD22, CD19, HER2(human epidermal growth factor receptor type2), GD2, 엽산수용체(Folate receptor), MUC1(Mucin 1), ErbB2(Erythroblastic oncogene B-2 gene), EphA2(EPH receptor A2) 또는 EGFR(Epidermal growth factor receptor)일 수 있으며, 바람직하게 암 세포 항원-결합도메인은 서열번호 18의 아미노산 서열로 표시되는 메소텔린-결합도메인일 수 있다.
본 발명의 바람직한 또 다른 일실시예에 있어서, 상기 막관통 도메인은 CD8α, CD4, CD28, CD137, CD80, CD86, CD152, PD1, NKG2D, 41BB, 2B4, NKp30, NKp44, NKp46, NKG2C 및 OX40로 구성된 군에서 선택된 어느 하나이며, 상기 공동자극 도메인은 CD28, OX-40, ICOS, NKG2D, 4-1BB, 2B4, NKp30, NKp44, NKp46 및 NKG2C로 구성된 군에서 선택된 어느 하나이고, 상기 세포 내 신호전달 도메인은 CD3ζ 유래일 수 있다.
본 발명의 바람직한 또 다른 일실시예에 있어서, 상기 신호 펩타이드는 서열번호 14의 아미노산 서열로 표시되고, 상기 막관통 도메인은 서열번호 20의 아미노산 서열로 표시되는 CD8이며, 상기 공동자극 도메인은 서열번호 22의 아미노산 서열로 표시되는 4-1BB이고, 상기 세포 내 신호전달 도메인은 서열번호 24의 아미노산 서열로 표시되는 CD3ζ일 수 있다.
본 발명의 바람직한 또 다른 일실시예에 있어서, 상기 신호 펩타이드를 코딩하는 염기서열 및 암 세포 항원-결합도메인을 코딩하는 염기서열 사이에, 서열번호 16의 아미노산 서열로 표시되는 FLAG를 코딩하는 염기서열이 추가로 포함될 수 있다.
본 발명의 바람직한 또 다른 일실시예에서, 상기 폴리뉴클레오타이드 5'-말단 및 3'-말단에 HA(homology Arm)-태그를 코딩하는 염기서열이 추가로 포함될 수 있다.
본 발명의 바람직한 또 다른 일실시예에서, 상기 HA(homology Arm)-태그를 코딩하는 염기서열은 200bp ~ 1500bp일 수 있다.
본 발명의 바람직한 또 다른 일실시예에서, 상기 폴리뉴클레오타이드 3'-말단에 poly A 서열 또는 DNA 핵 표적 서열(DNA nuclear targeting sequence; DTS)이 추가로 포함될 수 있다.
또 다른 목적을 달성하기 위해, 본 발명은 (1) 서열번호 1 내지 서열번호 6의 염기서열로 표시되는 단일 가이드 RNA로 구성된 군에서 선택된 어느 하나 이상의 TGFBR2 넉-아웃용 단일 가이드 RNA;
(2) Cas9 단백질, Cas9 단백질을 코딩하는 염기서열, Cpf1 단백질 및 Cpf1 단백질을 코딩하는 염기서열로 구성된 군에서 선택된 어느 하나의 유전자 가위; 및
(3) 상기 암 세포 항원에 특이적인 키메릭 항원 수용체(chimeric antigen receptor: CAR) 넉-인(knock-in)용 DNA 컨스트럭트 또는 이의 DNA 절편을 면역 이펙터 세포에 처리하는 단계를 포함하는, TGFBR2 발현 유전자가 넉-아웃되고 암 세포 항원에 특이적인 키메릭 항원 수용체 유전자가 넉-인된 면역 이펙터 세포 제조방법을 제공한다.
본 발명의 바람직한 일실시예에 있어서, 상기 면역 이펙터 세포는 T 세포, 자연살해(natural killer; NK) 세포, 대식세포(macrophage), 단핵구(monocyte) 또는 수지상 세포(Dendritic Cell)일 수 있다.
본 발명의 구체적인 또 다른 일실시예에 있어서, 상기 단일 가이드 RNA, 유전자 가위 및 DNA 절편은 전기천공 또는 유전자 전달 벡터를 통해 면역 이펙터 세포에 전달되며, 상기 전기천공은 1000 V ~ 2500 V, 5 ms ~ 50 ms, 및 1 pulse ~ 5 pulse 조건으로 처리하고, 상기 유전자 전달 벡터는 플라스미드, 바이러스성 벡터 또는 비바이러스성 벡터일 수 있다.
본 발명의 바람직한 또 다른 일실시예에 있어서, 상기 단일 가이드 RNA, 유전자 가위 및 DNA 절편을 면역 이펙터 세포에 처리하기 전 또는 후에, IL-2, IL-15, IL-21, 및 TGF-β1으로 구성된 군에서 선택된 어느 하나 이상의 사이토카인을 면역 이펙터 세포에 추가로 처리할 수 있다.
또한, 본 발명은 상기 방법으로 제조한 TGFBR2 발현 유전자가 넉-아웃되고 암 세포 항원에 특이적인 키메릭 항원 수용체 유전자가 넉-인된 면역 이펙터 세포를 제공한다.
또한, 본 발명은 상기 면역 이펙터 세포를 포함하는 암 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 바람직한 일실시예에 있어서, 상기 암은 편평세포암, 소세포 폐암, 비소세포 폐암, 폐의 선암종, 폐의 편평세포 암종, 중피암, 복막암, 간세포성암, 위장암, 췌장암, 신경교종, 자궁경부암, 난소암, 간암, 방광암, 간세포암, 유방암, 결장암, 결장직장암, 자궁내막 또는 자궁 암종, 타액선 암종, 신장암, 전립선암, 외음부암, 갑상선암, 간 암종, 백혈병 및 다른 림프구증식성 장애, 및 두경부암으로 구성된 군에서 선택된 어느 하나일 수 있다.
본 발명에서는 TGFBR2 넉-아웃용 단일 가이드 RNA(sgRNA)에 의해 NK 세포의 TGFBR2 발현이 효과적으로 억제되는 것을 확인하였다. 또한, CRISPR/Cas9 시스템을 사용하여 TGFBR2를 넉-아웃(knock-out)함으로써 TGF-β의 부정적인 영향을 제거함과 동시에, TGFBR2 유전자가 넉-아웃된 자리에 암 세포 관련 항원을 표적으로 하는 CAR 유전자를 넉-인(knock-in) 시킨 CAR-NK 세포를 제조하였으며, 본 발명의 방법으로 제조한 CAR-NK 세포의 암 세포 살상 효과가 우수한 것을 확인하였다.
따라서, 본 발명의 TGFBR2 발현 유전자가 넉-아웃되고 암 세포 항원에 특이적인 키메릭 항원 수용체 유전자가 넉-인된 면역 이펙터 세포는 암의 예방 또는 치료를 위한 조성물로 유용하게 활용할 수 있다.
도 1은 TGFBR2 유전자 위치내 다양한 crRNA(CRISPR RNA) 타겟 위치를 나타낸 모식도이다.
도 2는 이중 넉-아웃을 위한 sgRNA 서열의 에디팅 효율을 T7E1 어세이를 이용하여 비교한 데이터이다.
도 3a 내지 3g는 에디팅 유전자에 대한 발현 감소정도를 FACS를 이용하여 확인한 데이터이다.
도 4는 sgRNA 표적 위치에 따른 TGFBR2 넉-아웃 NK 세포의 암살상 효과를 확인한 데이터로, 도 4a는 실험 모식도, 도 4b는 TGFBR2 넉-아웃 효율 확인 데이터 및 도 4c는 NK 세포의 암살상 효과를 확인한 데이터이다.
도 5a 내지 5g는 sgRNA 표적 위치에 따른 TGFBR2 넉-아웃 NK 세포의 탈과립마커(degranulation marker)인 CD107a 마커의 발현정도를 확인한 데이터이다.
도 6은 sgRNA 표적 위치에 따른 TGFBR2 넉-아웃 NK 세포 내 Phospho-Smad2/3(p-Smad2/3) 감소 정도를 확인한 데이터이다.
도 7은 다양한 전기천공 조건에 따른 T7E1 어세이 기반 유전자 에디팅 효율을 확인한 데이터이다.
도 8a 내지 8f는 다양한 전기천공 조건에 따른 FACS 기반 유전자 에디팅 효율을 확인한 데이터이다.
도 9a 내지 9e는 다양한 전기천공 조건에 따른 primary NK 세포의 생존율을 비교한 데이터이다.
도 10은 메소텔린(mesothelin; MSLN 암 항원 표적을 위한 키메릭 항원 수용체(chimeric antigen receptor: CAR) 유전자 삽입용 DNA 컨스트럭트(construct) 및 제작과정을 나타낸 모식도이다.
도 11은 단독 sgRNA 또는 이중 sgRNA 넉-아웃 후 CAR 유전자의 넉-인에 따른 CAR 유전자의 넉-인 효율을 확인한 데이터로, 도 11a는 실험과정을 나타낸 모식도 및 도 11b는 Junction PCR 방법을 이용한 CAR 유전자의 넉-인 효율을 확인한 데이터이다.
도 12는 sgRNA 투입양과 전기천공 조건에 따른 CAR 유전자 넉-인 및 TGFBR2 넉-아웃 효율을 비교한 것으로, Junction PCR 방법 및 T7E1 어세이로 CAR 유전자 넉-인 효율을 비교한 데이터이다.
도 13a 내지 13j는 sgRNA 투입양 및 전기천공 조건에 따른 CAR 유전자 넉-인 효율을 FACS 기반 표면(surface) CAR 단백질 검출 방법으로 비교한 데이터이다.
도 14는 다양한 물질 처리 조건에 따른 CAR 유전자 넉-인 및 TGFBR2 넉-아웃 효율을 Junction PCR 및 T7E1 어세이를 이용하여 비교한 데이터이다.
도 15a 내지 15k는 다양한 물질 처리 조건에 따른 CAR 유전자 넉-인 효율을 FACS 기반 표면(surface) CAR 단백질 검출 방법으로 비교한 데이터이다.
도 16은 사이토카인 조합에 따른 CAR 유전자 넉-인 효율을 확인한 데이터로, 도 16a는 Junction PCR 방법을 이용한 CAR 유전자의 넉-인 효율 및 도 16b는 CAR-NK 세포의 암살상 효과를 비교한 데이터이다.
도 17은 CAR 유전자 삽입용 DNA 컨스트럭트 내 HA 길이(300, 500, 700, 1000bp)에 따른 CAR 유전자 넉-인 효율을 Junction PCR 방법으로 비교한 데이터이다.
도 18은 야생형(wild)-CAR 유전자 및 돌연변이(mutant)-CAR 유전자 넉-인에 따른 암세포 살상 효과를 확인한 데이터로, 도 18a는 야생형(wild)-CAR 유전자 및 돌연변이(mutant)-CAR 유전자 DNA 컨스트럭트 모식도, 도 18b는 Junction PCR 방법을 이용한 CAR 유전자의 넉-인 효율, 도 18c는 CAR-NK 세포의 표면 TGFBR2 발현 감소정도 및 도 18d는 CAR-NK 세포의 암살상 효과를 확인한 데이터이다.
도 19는 CAR 유전자 넉-인용 DNA 컨스트럭트의 3'-말단에 poly A 서열과, 추가로 DNA 핵 표적화 서열(DTS) 삽입에 따른 CAR 유전자 넉-인 효율을 확인한 데이터로, 도 19a는 poly A 서열; 또는 poly A 서열과 SV40, CREB 또는 GRE의 DTS 서열이 삽입된 CAR 유전자 DNA 컨스트럭트 모식도이고, 도 19b 내지 19d는 이러한 서열 삽입에 따른 CAR 유전자 넉-인 효율을 FACS 기반 표면(surface) CAR 단백질 검출 방법으로 비교한 데이터이다.
도 20은 바이러스성 벡터를 이용해 CAR 유전자의 넉-인 효율을 FACS 기반 표면(surface) CAR 단백질 검출 방법으로 비교한 데이터이다.
본 발명은, 서열번호 1 내지 서열번호 6의 염기서열로 표시되는 단일 가이드 RNA(sgRNA)로 구성된 군에서 선택된 어느 하나 이상의 단일 가이드를 포함하는, TGFBR2(TGF beta receptor 2) 넉-아웃(knock-out)용 단일 가이드 RNA에 관한 것이다.
또한, 본 발명은 상기 TGFBR2 넉-아웃용 단일 가이드 RNA; 및
Cas9 단백질, Cas9 단백질을 코딩하는 염기서열, Cpf1 단백질 및 Cpf1 단백질을 코딩하는 염기서열로 구성된 군에서 선택된 어느 하나의 유전자 가위를 포함하는, TGFBR2(TGF beta receptor 2) 넉-아웃(knock-out)용 조성물을 제공한다.
또한, 본 발명은 서열번호 1 내지 서열번호 6의 염기서열로 표시되는 단일 가이드 RNA로 구성된 군에서 선택된 어느 하나 이상의 TGFBR2 넉-아웃용 단일 가이드 RNA, 및
Cas9 단백질, Cas9 단백질을 코딩하는 염기서열, Cpf1 단백질 및 Cpf1 단백질을 코딩하는 염기서열로 구성된 군에서 선택된 어느 하나의 유전자 가위를 인간 유래 세포에 처리하는 단계를 포함하는, TGFBR2 넉-아웃 방법을 제공한다.
본 발명에서 상기 인간 유래 세포는 T 세포, 자연살해(natural killer; NK) 세포, 대식세포(macrophage), 단핵구(monocyte) 및 수지상 세포(Dendritic Cell)으로 구성된 군에선 선택된 어느 하나의 면역 이펙터 세포일 수 있다.
본 발명에서 상기 단일 가이드 RNA 및 유전자 가위는 전기천공 또는 유전자 전달 벡터를 통해 면역 이펙터 세포에 전달되며, 상기 전기천공은 1000 V ~ 2500 V, 5 ms ~ 50 ms, 및 1 pulse ~ 5 pulse 조건으로 처리하고, 상기 유전자 전달 벡터는 플라스미드, 바이러스성 벡터 또는 비바이러스성 벡터일 수 있다.
또한, 본 발명은 (1) 서열번호 1 내지 서열번호 6의 염기서열로 표시되는 단일 가이드 RNA로 구성된 군에서 선택된 어느 하나 이상의 TGFBR2 넉-아웃용 단일 가이드 RNA;
(2) Cas9 단백질, Cas9 단백질을 코딩하는 염기서열, Cpf1 단백질 및 Cpf1 단백질을 코딩하는 염기서열로 구성된 군에서 선택된 어느 하나의 유전자 가위; 및
(3) 상기 암 세포 항원에 특이적인 키메릭 항원 수용체(chimeric antigen receptor: CAR) 넉-인(knock-in)용 DNA 컨스트럭트 또는 이의 DNA 절편을 면역 이펙터 세포에 처리하는 단계를 포함하는, TGFBR2 발현 유전자가 넉-아웃되고 암 세포 항원에 특이적인 키메릭 항원 수용체 유전자가 넉-인된 면역 이펙터 세포 제조방법을 제공한다.
또한, 본 발명은 상기 방법으로 제조한 TGFBR2 발현 유전자가 넉-아웃되고 암 세포 항원에 특이적인 키메릭 항원 수용체 유전자가 넉-인된 면역 이펙터 세포를 제공한다.
또한, 본 발명은 상기 면역 이펙터 세포를 포함하는 암 예방 또는 치료용 약학적 조성물을 제공한다.
이하, 본 발명을 상세하게 설명한다.
유전자 가위를 이용하면 특정 유전자 게놈 위치에 정확히 CAR 유전자의 넉-인(knock-in)이 가능하며, 원하지 않은 유전자를 제거함과 동시에 CAR 유전자를 삽입하여 항암 효과의 시너지를 유도할 수 있다. 나아가 NK 세포를 사용하여 CAR-NK 세포를 제작함으로써 대량생산을 용이하게 할 수 있는 장점이 있으나, NK 세포 내 TGF-β 신호전달에 의해 NK 세포의 활성이 저하되고, 암살상 효과가 감소하게 되는 문제점이 있다.
이에, 본 발명에서는 CRISPR/Cas9 시스템을 사용하여 TGFBR2를 넉-아웃(knock-out)함으로써 TGF-β의 부정적인 영향을 제거함과 동시에, TGFBR2 유전자가 넉-아웃된 자리에 암 세포 관련 항원을 표적으로 하는 CAR 유전자를 넉-인(knock-in) 시킨 CAR-NK 세포를 제조하였다.
TGFBR2 넉-아웃용 sgRNA
본 발명은 일관점에서, 서열번호 1 내지 서열번호 6의 염기서열로 표시되는 단일 가이드 RNA(sgRNA)로 구성된 군에서 선택된 어느 하나 이상의 단일 가이드를 포함하는, TGFBR2(TGF beta receptor 2) 넉-아웃(knock-out)용 단일 가이드 RNA에 관한 것이다.
본 발명은 다른 일관점에서, 상기 TGFBR2 넉-아웃용 단일 가이드 RNA; 및
Cas9 단백질, Cas9 단백질을 코딩하는 염기서열, Cpf1 단백질 및 Cpf1 단백질을 코딩하는 염기서열로 구성된 군에서 선택된 어느 하나의 유전자 가위를 포함하는, TGFBR2(TGF beta receptor 2) 넉-아웃(knock-out)용 조성물에 관한 것이다.
본 발명에서, 용어 "단일-가이드 RNA(single guide RNA)"는 자연적으로 발생하는 2-피스 가이드 RNA 복합체의 버전으로 단일 연속 서열로 구성되었다. 단순화된 단일 가이드 RNA는 Cas9 단백질이 게놈 편집을 위해 특정 DNA 서열을 결합하고 절단하도록 지시하는 데 사용된다.
본 발명에서, 용어 "넉-아웃(knock-out)"은 염기서열 중 특정 유전자가 발현될 수 없도록 이를 변형 또는 제거하는 것을 의미하며, "넉-인(knock-in)"은 특정 외래 유전자가 발현될 수 있도록 숙주의 게놈 상에 도입되는 것을 의미한다.
본 발명에서, 용어 "유전자 가위(Genome Editing)"는 유전체(게놈)에서 특정한 유전자 염기서열을 인지하여 해당 부위의 DNA를 절단하는 인공 제한효소(restriction endonuclease)로서 인간 및 동식물 세포의 유전자 교정(genome editing)에 사용되며, 유전자가위 기술은 특정 염기를 잘라내는 데 활용하는 효소의 종류에 따라 1세대 징크핑거 뉴클레이즈(ZFN: Zinc Finger Nuleases)와 2세대 탈렌(TALEN: Tranion Activator-Like Effector Nucleases), 3세대 크리스퍼(CRISPR/Cas9 또는 CRISPR/Cpf1)로 나뉜다. CRISPR(clustered regulatory interspaced short palindromic repeat)의 구성성분인 sgRNA는 특정 DNA 염기배열 20bp를 인식할 수 있는 능력을 가지고 있고, Cas9 단백질 또는 Cpf1 단백질은 sgRNA와 결합한 특정 DNA을 절단한다.
본 발명의 일실시예에서, 도 1에 나타난 바와 같이, TGFBR2 유전자(NCBI Gene ID: 7048) 위치 내 6종의 crRNA(CRISPR RNA) 부분을 선정하고, 표 1과 같이 6종의 sgRNA 서열을 디자인하였다.
구체적으로, 서열번호 1의 염기서열로 표시되는 sgRNA(TGFBR2-T1)는 TGFBR2 유전자의 시그널 펩타이드(signal peptide; SP) 부분을, 서열번호 2의 염기서열로 표시되는 sgRNA(TGFBR2-T2), 서열번호 3의 염기서열로 표시되는 sgRNA(TGFBR2-T3) 및 서열번호 4의 염기서열로 표시되는 sgRNA(TGFBR2-T4)는 TGFBR2 유전자의 세포외 도메인(extracellular domain; ECD) 부분을, 서열번호 5의 염기서열로 표시되는 sgRNA(TGFBR2-T5) 및 서열번호 6의 염기서열로 표시되는 sgRNA(TGFBR2-T6)는 세포내 도메인(intracellular domain; ICD) 부분을 타겟으로 한다.
본 발명의 다른 일실시예에서, 이중 넉-아웃(double knock-out)을 위한 sgRNA 서열에 대한 에디팅 효율을 비교하고자, T1 + T2 sgRNA 조합, T3 + T4 sgRNA 조합, 및 T5 + T6 sgRNA 조합으로 자연 살해 세포(primary NK 세포)에 대한 에디팅 효율을 확인한 결과, 두 종류의 sgRNA 처리에 의해 효과적으로 유전자가 넉-아웃되었음을 확인하였다 (도 2). 특히, T1 + T2 sgRNA 또는 T5 + T6 sgRNA 처리 시 TGFBR2 단백질 발현이 높은 수준으로 감소한 것을 확인하였다 (도 3a-3g).
본 발명의 또 다른 일실시예에서, sgRNA 표적 위치에 따른 TGFBR2 넉-아웃 NK 세포의 암살상 효과를 확인한 결과, TGFBR2 유전자내 세포외 도메인(ECD) 부분이 넉-아웃된 NK 세포에 비해, 세포내 도메인(ICD) 부분이 넉-아웃된 NK 세포의 암살상 효과(도 4b-4c), 탈과립마커(degranulation marker)인 CD107a 마커 발현 정도(도 5a-5g) 및 인산화된 smad2/3(p-Smad2/3)의 감소 정도(도 6)가 높은 것으로 나타났다.
본 발명의 또 다른 일실시예에서, 다양한 전기천공 조건에 따른 유전자 에디팅 효율을 확인한 결과, 5가지 전기천공 조건(1600 V, 10 ms, 3 pulse; 1600 V, 20 ms, 1 pulse; 1700 V, 10 ms, 3 pulse; 1700 V, 20 ms, 1 pulse; 1800 V, 20 ms, 1 pulse) 중에서, 1600 V, 10 ms, 3 pulse 조건과 1700 V, 20 ms, 1 pulse 조건에서 에디팅 효율이 높은 것으로 나타났다 (도 7 및 도 8a-8f). 또한, 상기 5가지 전기천공 조건에 따른 primary NK 세포의 생존율을 비교한 결과, 5가지 조건모두 NK 세포 생존율에는 영향을 미치지 않는 것으로 확인되었다.
본 발명은 또 다른 일관점에서, 서열번호 1 내지 서열번호 6의 염기서열로 표시되는 단일 가이드 RNA로 구성된 군에서 선택된 어느 하나 이상의 TGFBR2 넉-아웃용 단일 가이드 RNA, 및
Cas9 단백질, Cas9 단백질을 코딩하는 염기서열, Cpf1 단백질 및 Cpf1 단백질을 코딩하는 염기서열로 구성된 군에서 선택된 어느 하나의 유전자 가위를 인간 유래 세포에 처리하는 단계를 포함하는, TGFBR2 넉-아웃 방법에 관한 것이다.
본 발명에 있어서, 상기 인간 유래 세포는 TGFBR2를 발현하는 모든 인간 유래 세포 일 수 있으며, 바람직하게는 T 세포, 자연살해(natural killer; NK) 세포, 대식세포(macrophage), 단핵구(monocyte) 및 수지상 세포(Dendritic Cell)으로 구성된 군에선 선택된 어느 하나의 면역 이펙터 세포일 수 있다.
본 발명에 있어서, 상기 단일 가이드 RNA 및 유전자 가위는 전기천공 또는 유전자 전달 벡터를 통해 면역 이펙터 세포에 전달될 수 있다.
상기 전기천공은 1000 V ~ 2500 V, 5 ms ~ 50 ms, 및 1 pulse ~ 5 pulse 조건으로, 바람직하게는 1600 V ~ 1900 V, 10 ms ~ 20 ms, 및 1 pulse ~ 3 pulse 조건으로, 더 바람직하게는 1600 V ~ 1700 V, 10 ms ~ 20 ms, 및 1 pulse ~ 3 pulse 조건 처리할 수 있다.
상기 유전자 전달 벡터는 플라스미드, 바이러스성 벡터 또는 비바이러스성 벡터일 수 있으며, 바이러스성 벡터는 아데노바이러스(Adenovirus), 레트로바이러스(Retrovirus) 또는 아데노연관바이러스(Adeno-Associated Virus, AAV)일 수 있다. 비바이러스성 벡터는 거대분자 복합체, 나노캡슐, 마이크로구체, 비드, 및 수중유 에멀젼, 미셀, 혼합된 미셀, 및 리포솜을 비롯한 지질-기반 시스템을 포함한다.
암 항원 표적을 위한 CAR 유전자 넉-인용 DNA 컨스트럭트
본 발명은 또 다른 일관점에서,
프로모터를 코딩하는 염기서열;
신호 펩타이드(signal peptide)를 코딩하는 염기서열;
암 세포 항원-결합도메인을 코딩하는 염기서열;
막관통 도메인(transmembrane domain)을 코딩하는 염기서열;
공동자극 도메인(costimulatory domain)을 코딩하는 염기서열; 및
세포 내 신호전달 도메인(intracellular signal transduction domain)을 코딩하는 염기서열을 포함하는, 암 세포 항원에 특이적인 키메릭 항원 수용체(chimeric antigen receptor: CAR) 넉-인(knock-in)용 DNA 컨스트럭트(construct)에 관한 것이다.
본 발명에서, 용어 "키메릭 항원 수용체 (CAR)"는 일반적으로 항원 및 하나 이상의 세포 내 도메인과 결합하는 능력을 갖는 세포 외 도메인을 함유하는 융합 단백질을 지칭한다. CAR는 키메릭 항원 수용체 - 면역 이펙터 세포의 핵심 부분이며, 항원 결합 도메인, 막 관통 도메인, 공동 자극 도메인 및 세포 내 신호 전달 도메인을 포함할 수 있다.
본 발명에서, 용어 "프로모터"는 전사를 지시하기에 충분한 최소 서열을 의미한다. 또한, 세포 유형 특이적 또는 외부의 신호 또는 제제에 의해 유도되는 조절 가능한 프로모터 의존적 유전자를 발현하도록 하는 데 충분한 프로모터 구성이 포함될 수 있으며, 이러한 구성들은 유전자의 5' 또는 3' 부분에 위치할 수 있다. 보존적 프로모터 및 유도적 프로모터 둘 다 포함된다. 프로모터 서열은 원핵 생물, 진핵생물 또는 바이러스로부터 유래될 수 있다. 프로모터는 pSFFV, pCMV 또는 pEF1A일 수 있으며, 바람직하게, 본 발명에서는 서열번호 13의 염기서열로 표시되는 pSFFV 프로모터를 사용하였으며, 필요에 따라 상기 서열번호 13의 염기서열과 90% 이상, 93% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상 동일한 서열을 포함할 수 있다.
본 발명에서, 용어 "신호 펩타이드(signal peptide)"는 일반적으로 단백질 전달을 안내하기 위한 펩타이드 사슬을 지칭한다. 신호 펩타이드는 5 내지 30 개의 아미노산 길이를 갖는 짧은 펩타이드일 수 있다. 바람직하게 본 발명의 DNA 컨스트럭트에는 서열번호 14의 아미노산 서열로 표시되는 신호 펩타이드를 코딩하는 염기서열이 포함될 수 있으며, 더 바람직하게 상기 염기서열은 서열번호 15로 표시될 수 있다.
본 발명에 있어서, CAR 발현 여부를 확인하기 위해, 신호 펩타이드를 코딩하는 염기서열 및 암 세포 항원-결합도메인을 코딩하는 염기서열 사이에, 서열번호 16의 아미노산 서열로 표시되는 FLAG를 코딩하는 염기서열이 추가로 포함될 수 있으며, 바람직하게 상기 염기서열은 서열번호 17로 표시될 수 있다.
본 발명에서, 용어 "암 세포 항원-결합 도메인"은 일반적으로 암 세포 항원 단백질에 특이적으로 결합할 수 있는 도메인을 지칭한다. 예를 들어, 암 세포 항원-결합 도메인은 암 세포 표면에 발현되는 메소텔린(mesothelin; MSLN), CD22, CD19, HER2(human epidermal growth factor receptor type2), GD2, 엽산수용체(Folate receptor), MUC1(Mucin 1), ErbB2(Erythroblastic oncogene B-2 gene), EphA2(EPH receptor A2) 또는 EGFR(Epidermal growth factor receptor) 폴리펩타이드 또는 이의 단편에 특이적으로 결합할 수 있는 항체 또는 이의 단편을 함유할 수 있다. 바람직하게, 본 발명의 DNA 컨스트럭트에는 서열번호 18의 아미노산 서열로 표시되는 메소텔린-결합도메인을 코딩하는 염기서열이 포함될 수 있으며, 더 바람직하게 상기 염기서열은 서열번호 19로 표시될 수 있다.
본 발명에서, 용어 "결합 도메인(binding domain)"은 "세포 외 도메인(extracellular domain)", "세포 외 결합 도메인(extracellular binding domain)", "항원-특이적 결합 도메인(antigen-specific binding domain)" 및 "세포 외 항원-특이적 결합 도메인(extracellular antigen-specific biding domain)"은 상호 교환적으로 사용될 수 있으며, 표적 항원에 특이적으로 결합하는 능력을 갖는CAR 도메인 또는 단편을 지칭한다.
본 발명에 있어서, 상기 "막관통 도메인(transmembrane domain)"은 일반적으로 세포막을 통과하고 세포 내 신호전달 도메인에 연결되어 신호전달의 역할을 하는 CAR의 도메인을 지칭한다. 상기 막관통 도메인은 CD8α, CD4, CD28, CD137, CD80, CD86, CD152, PD1, NKG2D, 41BB, 2B4, NKp30, NKp44, NKp46, NKG2C 및 OX40로 구성된 군에서 선택되는 단백질로부터 유래될 수 있다. 바람직하게, 본 발명의 DNA 컨스트럭트에는 서열번호 20의 아미노산 서열로 표시되는 CD8를 코딩하는 염기서열이 포함될 수 있으며, 더 바람직하게 상기 염기서열은 서열번호 21로 표시될 수 있다.
본 발명에 있어서, 상기 "공동 자극 도메인(costimulatory domain)"은 일반적으로 림프구의 항원에 대한 효과적인 반응에 필요한 세포 표면 분자인 면역 자극 분자를 제공할 수 있는 세포 내 도메인을 지칭한다. 상기 기재된 공동자극 도메인(costimulatory domain)은 CD28, OX-40, ICOS, NKG2D, 41BB, 2B4, NKp30, NKp44, NKp46 및 NKG2C으로 구성된 군에서 선택된 공동 자극 도메인을 포함할 수 있다. 바람직하게, 본 발명의 DNA 컨스트럭트에는 서열번호 22의 아미노산 서열로 표시되는 4-1BB를 코딩하는 염기서열이 포함될 수 있으며, 더 바람직하게 상기 염기서열은 서열번호 23으로 표시될 수 있다.
본 발명에 있어서, "세포 내 신호전달 도메인(intracellular signal transduction domain)"은 일반적으로 세포 내부에 위치하고 신호를 전달할 수 있는 도메인을 지칭한다. 본 발명에서, 세포 내 신호전달 도메인은 키메라 항원 수용체의 세포 내 신호전달 도메인이다. 예를 들어, 세포 내 신호전달 도메인은 CD3ζ 세포 내 도메인, CD28 세포 내 도메인, CD28 세포 내 도메인, 4-1BB 세포 내 도메인 및 OX40 세포 내 도메인으로부터 선택될 수 있다. 바람직하게, 본 발명의 DNA 컨스트럭트에는 서열번호 24의 아미노산 서열로 표시되는 CD3ζ를 코딩하는 염기서열이 포함될 수 있으며, 더 바람직하게 상기 염기서열은 서열번호 25로 표시될 수 있다.
본 발명에서는 도 10의 모식도에 나타난 바와 같이 메소텔린 표적을 위한 CAR 유전자 넉-인용 DNA 컨스트럭트를 설계하였다. 구체적으로, DNA 컨스트럭트는 pSFFV 프로모터 - 시그널펩타이드 - FLAG - 메소텔린-결합도메인 - CD8 - 4-1BB - CD3ζ 순서로 각각을 코딩하는 염기서열이 배열된 구조로, 본 발명의 TGFBR2 넉-아웃용 sgRNA에 의해 넉-아웃된 부분에 삽입되는 것을 특징으로 한다.
본 발명에 있어서, 상기 DNA 컨스트럭트 5'-말단 및 3'-말단에 HA(homology Arm)를 코딩하는 염기서열이 포함될 수 있으며, HA를 코딩하는 염기서열의 길이는 200bp ~ 1500bp, 바람직하게는 300bp ~ 1000bp, 더 바람직하게는 500bp ~ 1000bp일 수 있다.
본 발명의 또 다른 일구현예에서, CAR 유전자 넉-인용 DNA 컨스트럭트를 포함하는 벡터(donor DNA)내 HA(homology Arm) 길이에 따른 CAR 유전자 넉-인 효율을 확인한 결과, HA 길이가 700bp 또는 1000bp인 경우 넉-인 효율이 증가한 것을 확인하였다 (도 17).
본 발명의 또 다른 일구현예에서, 야생형(wild)-CAR 유전자 및 돌연변이(mutant)-CAR 유전자 DNA 컨스트럭트 넉-인 효율을 확인한 결과, 야생형 CAR 유전자 DNA 컨스트럭트의 넉-인 효율(도 18b), 에티딩된 NK 세포의 표면 TGFBR2 발현 감소정도(도 18c), 및 에티딩된 NK 세포의 암살상 효과(도 18d)가 모두 우수한 것을 확인하였다.
본 발명에 있어서, 상기 DNA 컨스트럭트 3'-말단에 폴리아데닐화 서열(poly A 서열)이 포함될 수 있다. 여기서, 상기 "poly A 부위" 또는 "poly A 서열"이라는 용어는, RNA 폴리머라제 II에 의한 초기 RNA 전사체의 종결과 폴리아데닐화 둘 모두를 지시하는 DNA 서열을 나타낸다. 폴리아데닐화 서열은 poly A 테일을 암호 서열의 3' 말단에 부가하는 방식으로 mRNA 안정성을 향상시켜, 증가된 번역 효율에 기여할 수 있다. poly A 테일이 결여된 전사체는 불안정하고 신속하게 분해되기 때문에, 재조합 전사체의 효율적인 폴리아데닐화가 바람직하다. 본 발명에서 상기 벡터에 사용될 수 있는 poly A 신호의 예시적인 예에는, 이상적인 poly A 서열(예를 들어, AATAAA, ATTAAA, AGTAAA), 소 성장호르몬 poly A 서열(BGHpA), 토끼 β-글로빈 poly A 서열(rβgpA), 또는 당업계에 알려진 또 다른 적합한 이종 또는 내인성 poly A 서열이 포함된다. 바람직하게, 본 발명의 DNA 컨스트럭트의 3'-말단에는 서열번호 43의 염기서열을 포함하는 poly A 서열이 포함될 수 있다.
본 발명의 또 다른 일구현예에서, CAR 유전자 넉-인용 DNA 컨스트럭트의 3'-말단에 poly A 서열의 삽입 여부에 따른 CAR 유전자 넉-인 효율을 확인한 결과, poly A 서열이 삽입된 경우 넉-인 효율이 증가한 것을 확인하였다 (도 19b-19d).
본 발명에 있어서, 상기 DNA 컨스트럭트 3'-말단에 DNA 핵 표적화 서열(DNA nuclear targeting sequence: DTS)이 더 포함될 수 있다. 본 발명에서, DTS는 세포 내인성 DNA-결합 단백질에 대한 인식 서열로서, 벡터 내 DTS의 이용은 또한 벡터를 핵에 국재화시키는 능력을 증가시킬 수 있다. 예를 들어, DTS는 SV40 인핸서(enhancer), NFκB, CREB 및 GRE로부터 선택될 수 있다. 바람직하게, 본 발명의 DNA 컨스트럭트의 3'-말단에는 서열번호 44의 염기서열을 포함하는 SV40 DTS, 서열번호 45의 염기서열을 포함하는 CREB DTS, 서열번호 46의 염기서열을 포함하는 GRE DTS, 또는 이들의 조합이 포함될 수 있다.
본 발명에 있어서, 상기 DNA 컨스트럭트 3'-말단에 poly A 서열과 DTS가 모두 포함되는 경우, 5'-말단에서 3'-말단의 방향으로 poly A 서열 및 DTS가 순차로 포함될 수 있다.
본 발명의 또 다른 일구현예에서, CAR 유전자 넉-인용 DNA 컨스트럭트의 3'-말단에 poly A 서열 및 DTS 서열의 삽입 여부에 따른 CAR 유전자 넉-인 효율을 확인한 결과, poly A 서열과 함께 SV40, CREB 또는 GRE의 DTS 서열이 삽입된 경우, CAR의 넉-인 효율이 증가한 것을 확인하였다 (도 19b-19d).
본 발명은 또 다른 관점에서, 본 발명의 암 세포 항원에 특이적인 키메릭 항원 수용체(chimeric antigen receptor: CAR) 넉-인(knock-in)용 DNA 컨스트럭트(construct)를 포함하는 DNA 절편(Fragment)에 관한 것이다.
본 발명에 있어서, 상기 DNA 절편은 ssDNA 또는 dsDNA 형태일 수 있다. 또한, DNA 절편의 전달은 전기천공 또는 유전자 전달 벡터를 이용할 수 있다.
TGFBR2 발현 유전자 넉-아웃 및 CAR 유전자 넉-인된 면역 이펙터 세포
본 발명은 또 다른 일관점에서, (1) 서열번호 1 내지 서열번호 6의 염기서열로 표시되는 단일 가이드 RNA로 구성된 군에서 선택된 어느 하나 이상의 TGFBR2 넉-아웃용 단일 가이드 RNA;
(2) Cas9 단백질, Cas9 단백질을 코딩하는 염기서열, Cpf1 단백질 및 Cpf1 단백질을 코딩하는 염기서열로 구성된 군에서 선택된 어느 하나의 유전자 가위; 및
(3) 상기 암 세포 항원에 특이적인 키메릭 항원 수용체(chimeric antigen receptor: CAR) 넉-인(knock-in)용 DNA 컨스트럭트 또는 이를 DNA 절편을 면역 이펙터 세포에 처리하는 단계를 포함하는, TGFBR2 발현 유전자가 넉-아웃되고 암 세포 항원에 특이적인 키메릭 항원 수용체 유전자가 넉-인된 면역 이펙터 세포 제조방법에 관한 것이다.
본 발명은 또 다른 일관점에서, 상기 방법으로 제조한 TGFBR2 발현 유전자가 넉-아웃되고 암 세포 항원에 특이적인 키메릭 항원 수용체 유전자가 넉-인된 면역 이펙터 세포에 관한 것이다.
본 발명에 있어서, 상기 면역 이펙터 세포는 T 세포, 자연살해(natural killer; NK) 세포, 대식세포(macrophage), 단핵구(monocyte) 또는 수지상 세포(Dendritic Cell)일 수 있으며, 바람직하게는 자연살해(NK) 세포일 수 있다.
키메릭 항원 수용체(CAR)를 발현하는 면역 이펙터 세포 제조를 위한 면역 이펙터 세포는 대상체로 부터 수득할 수 있으며, 상기 "대상체"는 면역 반응이 도출될 수 있는 살아있는 유기체 (예를 들어, 포유동물)를 포함한다. 대상체의 예는 인간, 개, 고양이, 마우스, 래트, 및 그의 트랜스제닉 종을 포함한다.
본 발명에 있어서, 상기 sgRNA는 한 종류 또는 두 종류의 sgRNA를 혼합하여 사용할 수 있으며, 40 ~ 400 pmol 농도로 처리될 수 있다.
본 발명에 있어서, 상기 단일 가이드 RNA, 유전자 가위 및 DNA 절편은 전기천공 또는 유전자 전달 벡터를 통해 면역 이펙터 세포에 전달되며, 상기 전기천공은 1000 V ~ 2500 V, 5 ms ~ 50 ms, 및 1 pulse ~ 5 pulse 조건으로 처리하고, 상기 유전자 전달 벡터는 플라스미드, 바이러스성 벡터 또는 비바이러스성 벡터일 수 있다.
상기 전기천공은 1000 V ~ 2500 V, 5 ms ~ 50 ms, 및 1 pulse ~ 5 pulse 조건으로, 바람직하게는 1600 V ~ 1900 V, 10 ms ~ 20 ms, 및 1 pulse ~ 3 pulse 조건으로, 더 바람직하게는 1600 V ~ 1700 V, 10 ms ~ 20 ms, 및 1 pulse ~ 3 pulse 조건 처리할 수 있다.
본 발명의 일실시예에서, 도 11의 모식도에 나타난 바와 같이, sgRNA를 단독(single K.O & CAR K.I) 처리, 또는 sgRNA를 이중(double K.O & CAR K.I) 처리하였을 때, CAR 유전자 넉-인 효율을 비교한 결과, 단독 또는 이중 sgRNA 모두 효율적으로 CAR 유전자가 넉-인되는 것을 확인하였다.
본 발명의 다른 실시예에서, sgRNA 투입양 및 전기천공 조건에 따른 CAR 유전자 넉-인 효율을 비교한 결과, 400 pmol의 sgRNA를 1600 V, 10 ms, 및 3 pulse 조건으로 전기천공하였을 때, 가장 높은 넉-인 효율을 보이는 것을 확인하였다 (도 12 및 도 13a-13j).
본 발명에 있어서, 상기 단일 가이드 RNA, 유전자 가위 및 DNA 절편을 면역 이펙터 세포에 처리하기 전 또는 후에, IL-2, IL-15, IL-21, 및 TGF-β1로 구성된 군에서 선택된 어느 하나 이상의 사이토카인을 면역 이펙터 세포에 추가로 처리할 수 있다. 바람직하게는 IL-21, IL-2 + IL-21 조합, 또는 IL-21 + TGF-β1 조합으로 처리할 수 있으며, 더 바람직하게는 IL-21 단독으로 처리할 수 있다. 또한, 상기 사이토카인은 필요에 따라 사이토카인 발현 피더세포(feeder cell) 또는 사이토카인 분비 세포를 이용하여 처리할 수 있다.
본 발명의 또 다른 실시예에서, 다양한 물질 처리에 따른 CAR 유전자 넉-인 효율을 비교하기 위해, 발네물린(Valnemulin), IL-21, IL-2 + IL-21, 및 IL-2 + IL-15 + IL-21을 각각 처리한 결과, IL-21 또는 IL-2 + IL-21 처리에 의해 CAR 유전자 넉-인 효율이 크게 증가한 것을 확인하였으며(도 14 및 도 15a-15k), 사이토카인 조합에 따른 CAR 유전자 넉-인 효율을 확인한 결과, IL-21 전처리 또는 IL-21 + TGF-β1 전처리에 의해 CAR 유전자 넉-인 효율이 증가하였으며, 특히 IL-21 전처리의 경우 CAR 유전자가 넉-인된 NK 세포의 암살상 효과가 증가하였다 (도 16a-16b).
TGFBR2 발현 유전자 넉-아웃 및 CAR 유전자 넉-인된 면역 이펙터를 포함하는 암 예방 또는 치료용 조성물
본 발명은 또 다른 일관점에서, TGFBR2 발현 유전자가 넉-아웃되고 암 세포 항원에 특이적인 키메릭 항원 수용체 유전자가 넉-인된 면역 이펙터 세포를 포함하는 암 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명에 있어서, 상기 암 세포 항원은 CD22, CD19 또는 메소텔린(mesothelin; MSLN), 바람직하게 메소텔린일 수 있으며, 상기 암 또는 종양은 정상 대조군, 또는 정상 세포에 비해 메소텔린이 과발현된 암 또는 종양이다. 보다 구체적으로 편평세포암, 소세포 폐암, 비소세포 폐암, 폐의 선암종, 폐의 편평세포 암종, 중피암, 복막암, 간세포성암, 위장암, 췌장암, 신경교종, 자궁경부암, 난소암, 간암, 방광암, 간세포암, 유방암, 결장암, 결장직장암, 자궁내막 또는 자궁 암종, 타액선 암종, 신장암, 전립선암, 외음부암, 갑상선암, 간 암종, 백혈병 및 다른 림프구증식성 장애, 및 다양한 유형의 두경부암으로 구성된 군에서 선택될 수 있다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다.
그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예 1] TGFBR2 유전자 위치내 다양한 crRNA 부분 선정 및 sgRNA 서열 디자인
본 발명에서는 도 1에 나타난 바와 같이, TGFBR2 유전자(NCBI Gene ID:7048) 위치 내 6종의 crRNA(CRISPR RNA) 부분을 선정하고, 표 1과 같이 6종의 sgRNA 서열을 디자인하였다.
TGFBR2 넉-아웃용 sgRNA
sgRNA sequence Targeted domain 서열번호
TGFBR2-T1 (-) CCTGAGCAGCCCCCGACCCA SP (384 - 403) 서열번호 1
TGFBR2-T2 (+) CCCACCGCACGTTCAGAAGT ECD (454 - 473) 서열번호 2
TGFBR2-T3 (+) CCCCTACCATGACTTTATTC ECD (775 - 794) 서열번호 3
TGFBR2-T4 (-) ATTGCACTCATCAGAGCTAC ECD (870 - 889) 서열번호 4
TGFBR2-T5 (-) GCTTCTGCTGCCGGTTAACG ICD (1027 - 1046) 서열번호 5
TGFBR2-T6 (+) GCCCATTGAGCTGGACACCC ICD (1183 - 1202) 서열번호 6
서열번호 1의 염기서열로 표시되는 sgRNA(TGFBR2-T1)는 TGFBR2 유전자의 시그널 펩타이드(signal peptide; SP) 부분을, 서열번호 2의 염기서열로 표시되는 sgRNA(TGFBR2-T2), 서열번호 3의 염기서열로 표시되는 sgRNA(TGFBR2-T3) 및 서열번호 4의 염기서열로 표시되는 sgRNA(TGFBR2-T4)는 TGFBR2 유전자의 세포외 도메인(extracellular domain; ECD) 부분을, 서열번호 5의 염기서열로 표시되는 sgRNA(TGFBR2-T5) 및 서열번호 6의 염기서열로 표시되는 sgRNA(TGFBR2-T6)는 세포 내 도메인(intracellular domain; ICD) 부분을 타겟으로 한다.
[실시예 2] sgRNA 조합에 따른 에디팅 효율 비교 - T7E1 어세이
본 발명에서는 이중 넉-아웃(double knock-out)을 위한 sgRNA 조합에 따른 에디팅 효율을 비교하고자, 상기 표 1의 "T1 sgRNA 및 T2 sgRNA 조합(T1 + T2)", "T3 sgRNA 및 T4 sgRNA 조합(T3 + T4)", 및 "T5 sgRNA 및 T6 sgRNA 조합(T5 + T6)"으로 자연 살해 세포(primary NK 세포)에 대한 에디팅 효율을 확인하였다.
먼저, 인간 PBMC 세포를 방사능 조사된 K562-GE(mbIL18/21 overexpressed K562) 세포와 함께 IL-2 및 IL-15 사이토카인이 처리된 조건에서 3주간 공배양하여 일차(primary) NK 세포를 수득하였다.
그 다음, Cas9-sgRNA 리보핵산 단백질(ribonucleoprotein; RNP) 복합체(Cas9 RNP 복합체)를 제조하기 위해 각 해당 sgRNA(400 pmole) 및 spCas9(1 ㎍／㎕, 4 ㎕ = 24.2pmol)를 섞은 후, 상온(RT)에서 20분 동안 반응시켰다. 그 후, 100 ㎕ Cas9 RNP 복합체 및 2 X 106 개의 일차 NK 세포를 함께 섞은 후 전기천공기(neon Electroporator)를 이용하여 1800V, 20 ms, 1 pulse 조건에서 전기천공방법으로 유전자 가위를 전달하였다.
본 발명의 sgRNA 조합에 따른 에디팅 효과를 확인하기 위해, T7E1 어세이 실험을 수행하였다. 먼저, QiAmp DNA mini kit(qiagen)를 이용하여 일차 NK 세포로 부터 게놈 DNA를 추출하고, 해당되는 각각의 프라이머를 이용하여 에디팅된 부분을 포함하는 PCR 엠플리콘(amplicon)을 확보하였다.
PCR 엠플리콘 증폭용 프라이머 서열
Amplicon Primer sequence 서열번호
T1+T2 GTTGAGTGAGTCACTCGC 서열번호 7
CTCAAACTTCCCTTTCCGG 서열번호 8
T3+T4 GTCTGCTCCAGGTGATGTTTAT 서열번호 9
GGGCCTGAGAATCTGCATTTA 서열번호 10
T5+T6 GCAGGGGATGACGAAC 서열번호 11
CTGCCCACTGTTAGCC 서열번호 12
그 다음, 각 200 ng PCR 엠플리콘, 10 x NEB buffer (2 ㎕, NEB)이 총 19 ㎕가 되도록 혼합한 다음, PCR 기계를 이용하여 혼성화(hybridization)를 진행하였다(초기 변성 95℃, 5분 -> 2단계 어닐링 95 ~ 85℃, -2℃/초, 85 ~ 25℃, -0.1℃/초, 홀드 4℃). 그리고, 혼성화된 DNA(hybridization DNA, 19 ㎕)와 T7E1 엔자임(NEB, M0302) 1 ㎕를 함께 15분간 37℃에서 반응시킨 후 전기영동을 실시한 후, 에디팅된 밴드(Band)를 gel-DOC 기계를 이용하여 확인하였다.
그 결과, 도 2에 나타난바와 같이, sgRNA 처리에 의해 효과적으로 유전자가 넉-아웃되었음을 확인하였다 (도 2).
[실시예 3] sgRNA 조합에 따른 에디팅 효율 비교 - FACS
이중 넉-아웃(double knock-out)을 위한 sgRNA 조합에 따른 에디팅
효율을 비교하기 위해 표적유전자인 TGFBR2 발현 정도를 FACS를 이용하여 측정하였다.
먼저, 상기 실시예 2와 같은 방법으로 NK 세포에 유전자가위를 72시간 동안 처리한 후, NK세포를 수득하여 FACS 측정용 튜브에 옮긴 다음, PBS로 세척 하였다. 그 다음, Live/dead dye(eBioscience™ Fixable Viability Dye eFluor™ 506)로 4℃, 암 조건에서 20분간 염색하고 PBS로 세척한 후, 100 ㎕의 IC 고정버퍼(fixation buffer)를 넣어 실온, 암 조건에서 20분 동안 반응시켰다. 펌/워시 버퍼(Perm/wash buffer)로 2번 세척한 후, APC 항-인간 TGFBR2 항체(APC anti-human TGFBR2 antibody, 5 ㎕) / 펌 버퍼(perm buffer, 100 ㎕)를 처리하고 상온, 암 조건에서 20분 동안 염색하였다. 펌/워시 버퍼로 2번 세척한 후 PBS 100 ~ 200 ㎕으로 현탁시킨 후 FACS 분석을 수행하였다.
또한, 일차 NK 세포(primary NK cell)에서 세포막에 위치하는 TGFBR2 발현을 확인하기 위해, 상기 유전자가위 처리된 NK 세포를 TGFbR2-APC(1:100, Biolegend) 항체로 염색한 다음, FACS 분석을 수행하였다.
그 결과, 도 3a 내지 3g에 나타난 바와 같이, T1 + T2 sgRNA 또는 T5 + T6 sgRNA 처리시 퍼퓰레이션(population) 기준으로 약 82% 및 81.4%로 TGFBR2 단백질 발현이 감소한 것으로 확인되었다.
[실시예 4] sgRNA 표적 위치에 따른 TGFBR2 넉-아웃 NK 세포 효능 비교 - 암살상 효과 확인
일차 NK 세포에 sgRNA(T1+T2) 및 sgRNA(T5+T6)를 실시예 2와 같은 방법으로 spCas9 유전자 가위 단백질과 함께 전기천공(1800 V, 20 ms, 1 pulse)을 진행한 후, IL-2 및 IL-15 사이토카인이 포함된 RPMI1640 배지에서 에디팅된 일차 NK 세포를 배양하였다.
전기천공 후 6일과 7일째에 TGF-b1 사이토카인을 10 ng/ml 농도로 각각 처리한 후, 8일째 되는 날 37℃, 5% CO2 가습 조건에서 각각의 에디팅된 일차 NK 세포 (Effector; E)와 루시퍼레이즈(luciferase) 과발현-AsPC1 암세포(Target; T)를 2:1 비율로 공배양을 진행하였다. 공배양을 위해 48-웰 플레이트에 5 X 104 개의 Luc-AsPC1 세포와 1 X 105 개의 일차 NK 세포를 공배양하였으며, 공배양 24 시간 및 48시간 후에 루시퍼레이즈 레벨 변화를 측정하여 암세포에 대한 NK 세포의 암살상능을 비교하였다.
루시퍼레이즈 측정은 Nano-Glo® Luciferase Assay System kit를 사용하였으며, Luc-AsPC1 세포에 대한 형광 시그널은 GloMax® 장비를 사용하여 제조사의 프로토콜에 따라 다음의 과정으로 검출하였다. 용해 버퍼를 이용하여 타겟 세포를 용해시킨 다음, 13,000rpm, 15 ~ 20분, 4℃ 조건에서 원심분리 한 후, 프로메가(Promega, cat.no.N1110)에 포함되어 있는 버퍼 : 기질을 50:2 비율로 섞어주었다. 각각의 표적 세포 용출액 50 ㎕ 및 버퍼/기질 혼합액 50 ㎕을 96-웰 각각 넣은 후 형광을 측정하고, 이를 정량화하여 암세포 살상 효과를 확인하였다.
그 결과, 도 4a 내지 4c에 나타난 바와 같이, TGFBR2 유전자내 세포외 도메인(ECD) 부분이 넉-아웃된 NK 세포에 비해, 세포내 도메인(ICD) 부분이 넉-아웃된 NK 세포의 암살상 효과가 우수한 것을 확인하였다.
[실시예 5] sgRNA 표적 위치에 따른 TGFBR2 넉-아웃 NK 세포 효능 비교 - NK 세포 탈과립마커 발현 확인
먼저, sgRNA(T1+T2) 및 sgRNA(T5+T6) 각각(100pmol/λ, 4 ㎕, 총 400pmol)을 spCas9(1 ㎍／㎕, 4 ㎕ = 24.2pmol)와 섞은 후, 상온(RT)에서 20분 동안 반응시킨 다음, 뉴클레이즈 프리 버퍼(nuclease free buffer) 52 ㎕를 첨가하여 Cas9 RNP 복합체를 제조하였다. 일차 NK 세포는 T 버퍼로 2 M/60 ㎕이 되게 현탁시킨 다음, 일차 NK 세포(60 ㎕)에 Cas9 RNP(60 ㎕)를 첨가하고 1800V, 20 ms, 1 pulse 조건에서 전기천공방법으로 유전자 가위를 전달하였다.
상기 방법으로 에디팅된 일차 NK 세포는 IL-2 및 IL-15 사이토카인이 포함된 RPMI1640 배지에서 배양하였으며, 5일 및 6일째 TGF-b(10 ng/㎖)를 추가로 첨가하였다. 배양 7일째에, 전날 24-웰 플레이트에 접종된 루시퍼레이즈 발현 AsPC1 암세포(0.25M cells/1 ㎖, RPMI1640 배지 사용)에 에디팅된 NK 세포를 2 : 1 비율로 공배양하였다. 추가로 0.25 ㎖의 RPMI(011-51) 배지에 최종 부피가 1 ㎖이 되도록 혼합한 IL-2 및 APC-항-인간 CD107a 항체(5 ㎕)를 첨가하였다.
양성대조군으로 일차 NK 세포에 PMA(2.5 ㎍/㎖) 및 이오노마이신(Ionomycin, 0.5 ㎍/㎖)을 처리하여 상기와 같은 방법으로 공배양하였다.
공배양 1시간 후, BFA(5 ㎍/㎖) 및 모넨신(monensin; 6 ㎍/㎖)을 첨가하고 5시간 동안 배양한 다음, 세포를 수확하여 PBS로 세척하고 Live/Dead dye 및 CD56 항체로 염색한 후 FACS 분석을 수행하였다.
그 결과, 도 5a 내지 5g에 나타난 바와 같이, TGFBR2 유전자내 세포외 도메인(ECD) 부분이 넉-아웃된 NK 세포에 비해, 세포내 도메인(ICD) 부분이 넉-아웃된 NK 세포의 탈과립마커(degranulation marker)인 CD107a 마커 발현 정도가 증가한 것으로 확인되었다.
[실시예 6] sgRNA 표적 위치에 따른 TGFBR2 넉-아웃 NK 세포 효능 비교 - NK 세포 내 p-Smad2/3 감소 확인
상기 실시예 5와 같은 방법으로 유전자가위 처리 5일 후, 에디팅된 NK 세포에 TGF-b1(10 ng/㎖)를 3 시간 동안 처리한 다음, 웨스턴 블라팅을 수행하여 TGF-b1 신호전달 과정(도 6)에 있는 SMAD2/3 단백질의 인산화 정도 비교하였다.
먼저, 각 1 x 106 개의 NK 세포에 용해버퍼(Lysis buffer; 40mM Tris-HCL(pH7.4), 120mM NaCl, 1mM EDTA, 1% triton-100, 10mM Na-pyrophosphate, 50mM NaF, 1.5mM Na-orthovanadate, 1X protease inhibitor)를 첨가하여 세포용해물을 수득한 후, 샘플링하여 웨스턴 블랏팅을 위한 샘플을 제작하였다. 상기 샘플을 SDS-PAGE에 전기영동하고 이를 니트로셀룰로스 막에 이동시킨 후, 탈지분유를 이용하여 블락킹하였다. 다음으로, 1차 항체를 처리하기 위해 상기 막에 1:1000 비율로 희석된 항-SMAD2/3 항체(CST #8685, cell signaling technology, 미국) 및 항-p-SMAD2/3 항체(CST#8828, cell signaling technology, 미국), 및 1:5000 비율로 희석된 항-β-액틴 항체(SantaCruz)를 각각 처리한 후 4℃에서 하룻밤 동안 반응시켰다. 그 다음 막을 세척한 후, 상기 1차 항체에 결합할 수 있는 HRP(horseradish peroxidase)-결합 2차 항체(1:5000)를 처리하고 실온에서 2시간 동안 반응시켰다. 이후 웨스턴 ECL 기질(Thermo scientific)을 사용하여 화학 발광에 의해 밴드를 가시화시킨 후, 상기 수득한 발광 이미지를 Chemidoc(biorad)으로 분석하였다.
그 결과, 도 6에 나타난 바와 같이, TGFBR2 유전자내 세포외 도메인(ECD) 부분이 넉-아웃된 NK 세포에 비해, 세포내 도메인(ICD) 부분이 넉-아웃된 NK 세포에서 인산화된 smad2/3(p-Smad2/3)의 감소 정도가 높은 것으로 나타났다.
[실시예 7] 다양한 전기천공 조건에 따른 에디팅 효율 확인 - T7E1 어세이 기반
7-1 : T7E1 어세이 분석
상기 실시예 2와 동일한 방법으로 일차 NK 세포 내 Cas9 RNP (T5+T6 sgRNA) 복합체를 제조하고, 이를 이용하여 4가지 전기천공 조건 (1600 V, 10 ms, 3 pulse/1800 V, 20 ms, 1 pulse/1850 V, 10 ms, 2 pulse/1900 V, 20 ms, 1 pulse)에 따른 에디팅 효과를 T7E1 어세이로 비교하였다.
그 결과, 도 7에 나타난 바와 같이, T7E1 어세이로 확인하였을 때, 전기천공 조건에 따른 에디팅 효율을 유사한 것을 확인되었다.
7-2 : FACS 분석
상기 실시예 2와 동일한 방법으로 일차 NK 세포 내 Cas9 RNP (T5+T6 sgRNA) 복합체를 제조하고, 이를 이용하여 5가지 전기천공 조건 (1600 V, 10 ms, 3 pulse; 1600 V, 20 ms, 1 pulse; 1700 V, 10 ms, 3 pulse; 1700 V, 20 ms, 1 pulse; 1800 V, 20 ms, 1 pulse)에 따른 에디팅 효과를 FACS 분석을 통해 비교하였다. FACS 분석은 실시예 3과 동일한 방법으로 수행하였다.
그 결과, 도 8a 내지 8f에 나타난 바와 같이, 1600 V, 10 ms, 3 pulse 조건과 1700 V, 20 ms, 1 pulse 조건에서 에디팅 효율이 높은 것으로 나타났다.
7-3 : 전기천공 조건에 따른 NK 세포 생존율 확인
상기 실시예 2와 동일한 방법으로 일차 NK 세포 내 Cas9 RNP (T5+T6 sgRNA) 복합체를 제조하고, 이를 이용하여 5가지 전기천공 조건(1600 V, 10 ms, 3 pulse; 1600 V, 20 ms, 1 pulse; 1700 V, 10 ms, 3 pulse; 1700 V, 20 ms, 1 pulse; 1800 V, 20 ms, 1 pulse)에 따른 일차 NK 세포 생존율을 확인하였다.
전기천공 후 5일째 되는 날에 NK 세포를 수확한 다음, live/dead population 분석을 위해 eBioscience™ Fixable Viability Dye eFluor™ 506 dye 염색을 이용하여 FACS 분석을 수행하였다.
그 결과, 도 9a 내지 9e에 나타난 바와 같이, 상기 5가지 전기천공 조건 모두 NK 세포 생존율에는 영향을 미치지 않는 것으로 확인되었다.
[실시예 8] 암 항원 표적을 위한 CAR 유전자 넉-인용 DNA 컨스트럭트 제작
본 발명에서는 메소텔린 표적을 위한 CAR 유전자 넉-인용 DNA 컨스트럭트를 설계하였다.
도 10의 모식도에 나타난 바와 같이, 본 발명의 CAR 넉-인용 DNA 컨스트럭트는 pSFFV 프로모터(서열번호 13) - 시그널펩타이드(서열번호 14)- FLAG(서열번호 16) - 메소텔린-결합도메인(SS scFv, 서열번호 18) - CD8(서열번호 20) - 4-1BB(서열번호 22) - CD3ζ(서열번호 24) 순서로 각각을 코딩하는 염기서열이 배열된 구조(서열번호 26)로, 본 발명의 TGFBR2넉-아웃용 sgRNA에 의해 넉-아웃된 부분에 삽입되며, DNA 컨스트럭트 5'-말단 및 3'-말단에 HA(homology Arm)를 코딩하는 200bp ~ 1500bp 길이의 염기서열을 추가로 포함한다.
CAR 넉-인용 DNA 컨스트럭트를 포함하는 벡터를 제조하기 위해, 먼저 pCMV3 벡터를 이용하여 Spe1, Xba1 엔자임으로 자른 후, 5'-HA 절편(fragment), CAR 넉-인용 DNA 컨스트럭트 및 3'-HA 절편을 각각 합성하여 인퓨젼 클로닝(infusion cloning)을 통해 벡터를 제조하였다. 또한, 5'-HA 및 3'-HA 길이는 300bp(서열번호 27), 500bp(서열번호 28), 700bp(서열번호 29), 1000bp(서열번호 30)이 되도록 DNA 절편을 각각 제조하였다.
HA 길이에 따른 DNA 절편 증폭용 PCR 프라이머 서열
HA size Primer sequence 서열번호
300bp TTTCCCCATCAGAATATAACACCAg 서열번호 31
GCAGGTCCTCCCAGC 서열번호 32
500bp AAGGAAGAGCAGGGGATGAC 서열번호 33
AGCCAGGTCATCCACAGAC 서열번호 34
700bp AGTTCCCTGTCCGTGG 서열번호 35
CATTAGCAAAAATGCTCAGGc 서열번호 36
1000bp TCTCCCTGTCACCCATGGG 서열번호 37
TTACTTTCAATGTTCAAGGCATTG 서열번호 38
그 다음, PCR을 통해 암 항원 표적을 위한 CAR 유전자 넉-인용 DNA 컨스트럭트가 포함된 DNA 절편(fragment)을 수득하기 위해, 각 HA 길이별로 특이적인 프라이머를 상기 표 3과 같이 제작하여 PCR을 이용한 각 엠플리콘을 획득한 다음, 겔 일루션 키트(Gel elution kit)를 이용하여 각각에 해당하는 DNA 절편을 정제하여 확보하였다.
[실시예 9] sgRNA 단독 또는 이중 처리에 의한 CAR 유전자 넉-인 효율 비교
본 발명에서는 도 11a의 모식도에 나타난 바와 같이, sgRNA를 단독(single K.O & CAR K.I) 처리, 또는 sgRNA를 이중(double K.O & CAR K.I) 처리하였을 때, CAR 유전자 넉-인 효율을 비교하고자 하였다.
먼저, 실시예 2와 동일한 방법으로 sgRNA(T6) 및 sgRNA(T5+T6)를 각각 spCas9와 혼합하여 Cas9 RNP 복합체를 제조한 다음, 실시예 8에서 제조한 HA 길이가 700bp인 CAR 넉-인용 DNA 컨스트럭트를 포함하는 DNA 절편(500 ng)를 함께 일차 NK 세포에 처리하여 1600 V, 10 ms, 3 pulse 조건으로 전기천공하였다.
CAR-NK 세포로 부터 게놈 DNA를 추출하고, 표 4의 프라이머를 이용하여 5' junction PCR을 수행하여 에디팅된 유전자를 포함하는 PCR 엠플리콘을 확보하였다.
HA 700bp 일 때 5' junction PCR 프라이머 서열
Primer sequence 서열번호
CCCAATGTCCTGAGCTTAGATAA 서열번호 39
GCTTATCGTCGTCATCCTTG 서열번호 40
그 결과, 도 11에 나타난 바와 같이, 단독 또는 이중 sgRNA 모두 효율적으로 CAR 유전자가 넉-인되는 것을 확인하였다.
[실시예 10] sgRNA 투입양 및 전기천공 조건에 따른 CAR 유전자 넉-인 효율 비교
본 발명에서는 sgRNA 투입양 및 전기천공 조건에 따른 CAR 유전자 넉-인 효율을 비교하기 위해, 상기 실시예 9와 동일한 방법으로 sgRNA(T6)양이 각각 40 pmol, 100 pmol 및 400 pmol이 되도록 실시예 8의 HA 길이가 700bp인 CAR 넉-인용 DNA 컨스트럭트를 포함하는 DNA 절편을 이용하여 일차 NK 세포에 처리하였으며, 1600 V, 10 ms, 3 pulse 및 1800 V, 20 ms, 1 pulse 조건으로 각각 전기천공 하였다.
10-1 : 5' junction PCR 분석
CAR-NK 세포로 부터 게놈 DNA를 추출하고, 표 4의 프라이머를 이용하여 실시예 9와 동일한 방법으로 5' junction PCR을 수행하였으며, 또한, 표 5의 프라이머를 이용하여 실시예 2와 동일한 방법으로 T7E1 어세이를 수행하였다.
HA 700bp 일 때 PCR 엠플리콘 증폭용 프라이머 서열
Primer sequence 서열번호
CCCAATGTCCTGAGCTTAGATAA 서열번호 39
GAGCAGAAAGGACTGAGTACAA 서열번호 41
그 결과, 도 12에 나타난 바와 같이, T7E1 어세이 결과 모든 조건에서 sgRNA 처리에 의해 효과적으로 유전자가 넉-아웃되었음을 확인하였다. 또한, 5' junction PCR 분석에서는 400 pmol의 sgRNA를 1600 V, 10 ms, 3 pulse 조건으로 처리하였을 때, PCR 엠플리콘 양이 가장 많은 것을 확인하였다.
10-2 : FACS 기반 표면 CAR 단백질 검출
CAR-NK 세포막에서 발현되는 표면 CAR 단백질 발현 정도를 비교하기 위해 FACS 분석을 수행하였다.
먼저, NK 세포를 수확한 다음, 비오틴-컨쥬게이티드된 MSLN(메소텔린) ECD 단백질 0.5 ㎍이 포함된 100 ㎕ PBS 용액과 1 X 106 개의 NK 세포와 함께 4 ℃에서 20분간 암 조건에서 반응시켰다. 그 다음, PBS로 세척한 후 0.08 ㎍ 스트렙트아비딘(streptavidin)-PE 항체가 포함된 100 ㎕ PBS 용액을 추가로 첨가하여 상기와 같은 조건에서 반응시키고 세척한 다음, FACS 분석을 수행하였다.
그 결과, 도 13a 내지 13j에 나타난 바와 같이, 400 pmol의 sgRNA를 1600 V, 10 ms, 및 3 pulse 조건으로 전기천공하였을 때, 메소텔린 항체 발현율이 가장 높은 것으로 나타났다.
[실시예 11] 다양한 물질 처리에 따른 CAR 유전자 넉-인 효율 비교
다양한 물질 처리에 따른 CAR 유전자 넉-인 효율을 비교하기 위해, 실시예 2와 동일한 방법으로 400 pmol의 sgRNA(T6)와 spCas9와 혼합하여 Cas9 RNP 복합체를 제조한 다음, Cas9 RNP 및 실시예 8에서 제조한 HA 길이가 700bp인 CAR 넉-인용 DNA 컨스트럭트를 포함하는 DNA 절편과 함께 일차 NK 세포에 처리하였으며, 1600 V, 10 ms, 3 pulse 조건으로 각각 전기천공 하였다.
전기천공 후, 에디팅된 일차 NK 세포를 발네물린(Valnemulin, 1μM), IL-21(400ng/㎖), IL-2(200IU/㎖)/IL-21(400ng/㎖), 및 IL-2(200IU/㎖)/IL-15(10ng/㎖)/IL-21(400ng/㎖)이 각각 포함된 배지에서 배양한 다음, 48시간 후에 배지를 교환하였다.
11-1 : 5' junction PCR 분석
CAR-NK 세포로 부터 게놈 DNA를 추출하고, 표 4의 프라이머를 이용하여 실시예 9와 동일한 방법으로 5' junction PCR을 수행하였으며, 또한, 표 5의 프라이머를 이용하여 실시예 2와 동일한 방법으로 T7E1 어세이를 수행하였다.
그 결과, 도 14에 나타난 바와 같이, IL-21를 처리한 경우 PCR 엠플리콘 양이 가장 많은 것으로 나타났다.
11-2 : FACS 기반 표면 CAR 단백질 검출
CAR-NK 세포막에서 발현되는 표면 CAR 단백질 발현 정도를 비교하기 위해 FACS 분석을 상기 실시예 10-2의 방법으로 수행하였다.
그 결과, 도 15a 내지 15k에 나타난 바와 같이, IL-2/IL-21를 처리한 경우, 메소텔린 항체 발현율이 가장 높은 것으로 나타났다.
[실시예 12] 사이토카인 조합 및 처리 시점에 따른 CAR 유전자 넉-인 효율 비교
본 발명에서는 IL-21, TGF-β1 조합 및 처리 시점에 따른 CAR 유전자 넉-인 효율을 비교하고자 하였다.
실시예 2와 동일한 방법으로 400 pmol의 sgRNA(T6)와 spCas9와 혼합하여 Cas9 RNP 복합체를 제조한 다음, Cas9 RNP 및 실시예 8에서 제조한 HA 길이가 700bp인 CAR 넉-인용 DNA 컨스트럭트를 포함하는 DNA 절편을 일차 NK 세포에 처리하고 1600 V, 10 ms, 3 pulse 조건으로 전기천공하였다. 이 때, 도 16a에 나타난 바와 같이 IL-21 및/또는 TGF-β1을 전기천공 전 또는 후로 나누어서 처리하였다.
12-1 : 5' junction PCR 분석
CAR-NK 세포로 부터 게놈 DNA를 추출하고, 표 4의 프라이머를 이용하여 실시예 9와 동일한 방법으로 5' junction PCR을 수행하였으며, 또한, 표 5의 프라이머를 이용하여 실시예 2와 동일한 방법으로 T7E1 어세이를 수행하였다.
그 결과, 도 16a에 나타난 바와 같이, 전기 천공 전에 IL-21 또는 IL-21/TGF-β1를 처리하였을 때, CAR 유전자 넉-인 효율이 증가한 것으로 확인되었다.
12-2 : CAR-NK 세포의 암살상 효과 확인
상기 실시예 4와 동일한 방법으로 CAR-NK 세포의 암살상 효과를 확인하였다.
그 결과, 도 16b에 나타난 바와 같이 전기 천공 전에 IL-21를 처리한 경우, CAR 유전자가 넉-인된 NK 세포의 암살상 효과가 현저하게 증가한 것을 확인하였다.
[실시예 13] HA 길이에 따른 CAR 유전자 넉-인 효율 비교
본 발명에서는 CAR 유전자 넉-인용 DNA 컨스트럭트를 포함하는 벡터(donor DNA)내 HA(homology Arm) 길이에 따른 CAR 유전자 넉-인 효율을 확인하고자 하였다.
실시예 2와 동일한 방법으로 400 pmol의 sgRNA(T6)와 spCas9와 혼합하여 Cas9 RNP 복합체를 제조한 다음, Cas9 RNP 및 상기 실시예 8에서 제조한, 5'-HA 및 3'-HA 길이가 300bp, 500bp, 700bp 및 1000bp인 CAR 유전자 넉-인용 DNA 컨스트럭트를 포함하는 DNA 절편을 각각 일차 NK 세포에 처리하여 1600 V, 10 ms, 3 pulse 조건으로 전기천공하였다.
CAR-NK 세포로 부터 게놈 DNA를 추출하고, 표 6의 프라이머를 이용하여 실시예 9와 동일한 방법으로 5' junction PCR을 수행하였다.
HA 1000bp 일 때 5` junction PCR 프라이머 서열
Primer sequence 서열번호
CTATTTCACCAGAGCCAACAAGG 서열번호 42
GCTTATCGTCGTCATCCTTG 서열번호 40
그 결과, 도 17에 나타난 바와 같이, HA 길이가 700bp 또는 1000bp인 경우 넉-인 효율이 증가한 것을 확인하였다.
[실시예 14] 야생형(WT)/돌연변이(mutant) CAR 유전자 넉-인에 따른 암살상 효과 비교
본 발명에서는 야생형(wild)-CAR 유전자 및 돌연변이(mutant)-CAR 유전자 넉-인용 DNA 컨스트럭트에 따른 유전자 넉-인 효율을 비교하였다.
먼저, 도 18a의 모식도에 나타난 바와 같이, 야생형(wild)으로 상기 실시예 8에서 제조한 5'-HA 및 3'-HA 길이가 1000bp인 CAR 유전자 넉-인용 DNA 컨스트럭트를 포함하는 DNA 절편을 사용하였으며, 돌연변이(mutant)는 4-1BB 염기서열 및 CD3ζ 염기서열이 제거된 CAR 유전자 넉-인용 DNA 컨스트럭트 벡터를 제조하여 사용하였다.
실시예 2와 동일한 방법으로 400 pmol의 sgRNA(T6)와 spCas9와 혼합하여 Cas9 RNP 복합체를 제조한 다음, Cas9 RNP 및 상기 야생형 및 돌연변이 CAR 유전자 넉-인용 DNA 컨스트럭트를 포함하는 벡터를 각각 일차 NK 세포에 처리하여 1600 V, 10 ms, 3 pulse 조건으로 전기천공하여 야생형 CAR-NK 세포 및 돌연변이 CAR-NK 세포를 제조하였다.
14-1 : 5' junction PCR 분석
CAR-NK 세포로 부터 게놈 DNA를 추출하고, 표 5의 프라이머를 이용하여 실시예 9와 동일한 방법으로 5' junction PCR를 수행하였다.
그 결과, 도 18b에 나타난 바와 같이, 야생형 CAR-NK 세포 및 돌연변이 CAR-NK 세포의 넉-인 효율은 비슷한 것으로 나타났다.
14-2 : FACS 기반 표면 TGFBR2 단백질 검출
CAR-NK 세포막에서 발현되는 표면 TGFBR2 단백질 발현 정도를 비교하기 위해 FACS 분석을 상기 실시예 7-2의 방법으로 수행하였다.
그 결과, 도 18c에 나타난 바와 같이, 야생형 CAR-NK 세포 및 돌연변이 CAR-NK 세포의 TGFBR2 발현 감소정도 역시 비슷한 것으로 확인되었다.
14-3 : CAR-NK 세포의 암살상 효과 확인
상기 실시예 4와 동일한 방법으로 CAR-NK 세포의 암살상 효과를 확인하였다.
그 결과, 도 18d에 나타난 바와 같이, 돌연변이에 비해 야생형 CAR-NK 세포의 암살상 효과가 현저하게 우수한 것을 확인하였다.
[실시예 15] DTS(DNA nuclear Targeting Sequence) 추가에 따른 CAR 유전자 넉-인 효율 비교
본 발명에서는 CAR 유전자 넉-인용 DNA 컨스트럭트의 3'-말단에 poly A 서열과, 추가로 DNA 핵 표적화 서열(DTS) 삽입에 따른 CAR 유전자 넉-인 효율을 확인하고자 하였다.
실시예 8과 같이 CAR 유전자 넉-인용 DNA 컨스트럭트를 제작하되, 도 19a의 모식도에 나타낸 바와 같이, DNA 컨스트럭트 3'-말단에 하기 표 7에 나타낸 SV40 poly A 서열(서열번호 43) 단독, 혹은 이러한 염기 서열과 함께 DTS 서열로 SV40 서열(서열번호 44), CREB 서열(서열번호 45) 또는 GRE 서열(서열번호 46)을 추가로 포함하도록 하였다. 이러한 DNA 컨스트럭트 5'-말단 및 3'-말단에 길이가 1000bp인 HA(homology Arm)를 코딩하는 DNA 절편을 삽입하였다. 이후, 실시예 8과 동일한 방법으로 CAR 넉-인용 DNA 컨스트럭트를 포함하는 벡터를 제조하였다.
Poly A 서열 및 DNA 핵 표적 서열(DTS)
구분 염기서열 서열번호
Poly A 서열 AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA 43
DTS SV40 GGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCA 44
CREB TGACGTCAAGATCTA 45
GRE GGTACATTTTGTTCTAGAACAAAATGTACCGGTACATTTTGTTCTGGTACATTTTGTTCT 46
그 다음, Cas9-sgRNA 리보핵산 단백질(ribonucleoprotein; RNP) 복합체(Cas9 RNP 복합체)를 제조하기 위해, sgRNA(100pmol/λ, 4 ㎕, total 400pmol)와, Cas9(1 ㎍/㎕, 4 ㎕=24.2pmol)를 섞은 후, 상온(RT)에서 20분 동안 반응시켰다. 그 후, 넉-아웃 조건으로 244.4fmol의 DNA 컨스트럭트 및 뉴클레이즈 프리 버퍼(nuclease free buffer)의 합이 52 ㎕가 되도록 첨가하였다. PBNK 세포를 T 버퍼로 2M/60㎕가 되게 현탁시킨 뒤 Cas9 RNP(60 ㎕)와 세포(60 ㎕)를 석은 후, 전기천공기(neon Electroporator)를 이용하여 1820V, 20 ms, 1 pulse 조건에서 1회 전기천공 후, 500V, 10ms, 1pulse 조건으로 1회 전기천공을 진행하였다.
인큐베이터(37 ℃, CO2 5%)에서 배양 후 5일, 9일 및 19일째에 NK 세포를 획득한 뒤, 비오틴-컨쥬게이트 MSLN ECD 단백질 0.5 ㎍을 PBS 용액 100 ㎕에서 1 X 106 세포수의 NK 세포와 함께 4 ℃에서 20분간 암 조건에서 인큐베이션하였다. 세척 후, 0.08 ㎍의 스트렙타비딘-PE 항체를 포함하는 PBS 용액 100 ㎕을 추가한 뒤 같은 조건에서 반응시켰다. CAR-NK 세포막에서 발현되는 표면 CAR 단백질 발현 정도를 비교하기 위해 FACS 분석을 수행하였다.
그 결과, 도 19b 내지 19d에 나타난 바와 같이, CAR DNA 컨스트럭트의 3'-말단에 poly A 서열이나, poly A 서열과 SV40, CREB 또는 GRE 등의 DTS 서열을 추가로 삽입하는 경우 NK 세포에서 메소텔린 항체 발현율이 증가된 것으로 나타났다.
[실시예 16] 바이러스성 벡터에 의한 CAR 유전자 넉-인 효율 비교
본 발명에서는 CAR 유전자 넉-인용 DNA 컨스트럭트의 전달 벡터로 바이러스성 벡터를 사용한 경우에도 CAR 유전자 넉-인이 효율적으로 이루어지는 지 확인하기 위하여, 세포에 아데노연관바이러스(AAV) 벡터를 이용해 CAR 유전자를 넉-인 후 Cas9 RNP를 이용한 넉-아웃(AAV → KO)하거나, 세포에 Cas9 RNP를 이용한 넉-아웃 후 아데노연관바이러스(AAV) 벡터를 이용해 CAR 유전자를 넉-인(KO → AAV)을 수행하였다.
구체적으로, "KO → AAV"로 표기되는, TGFBR2 넉-아웃 후 AAV를 이용한 CAR 유전자 넉-인을 진행한 경우는, 실시예 15와 동일한 방법으로 sgRNA(100pmol/λ, 4 ㎕, total 400pmol)와 Cas9(1 ㎍/㎕, 4 ㎕=24.2pmol)를 혼합하여 Cas9 RNP 복합체를 제조한 다음, Cas9 RNP를 PBMC 세포에 처리하여 1820V 20ms 1 pulse 조건에서 1회, 500V 10ms 1pulse 조건으로 1회 진행하는 조건으로 전기천공하였다. 넉-아웃 샘플 중 0.1 M(6 ㎕)만 96 웰 플레이트에 접종한 뒤, 200ul에서 아데노연관바이러스 양을 제외한 양만큼의 배지를 첨가한 후, 인큐베이터(37 ℃, CO2 5%)에서 30분 동안 인큐베이션하였다. 이후 상기 실시예 8에서 제조한 5'-HA 및 3'-HA 길이가 1000bp인 CAR 유전자 넉-인용 DNA 컨스트럭트를 포함하는 DNA 절편을 클로닝한 아데노연관바이러스(AAV)를 넣어준 뒤, 원심분리(400g, 90분, 32 ℃)를 진행하고, 인큐베이터에서 배양하였다.
다음으로, "AAV → KO"로 표기되는, AAV를 이용한 CAR 유전자 넉-인 후 TGFBR2 넉-아웃을 진행한 경우는, 일차 NK 세포 0.1 M을 96 웰 플레이트에 접종한 뒤 상기와 같이 클로닝된 아데노연관바이러스를 섞은 후 총 200 ㎕ 배지에 넣었다. 원심분리(400g, 90분, 32 ℃) 후 인큐베이터에서 하루 동안 배양한 뒤, 다음 날 세포를 획득하여 상기 "KO → AAV"에서와 동일한 방법으로 Cas9 RNP 복합체를 이용해 넉-아웃을 진행하였다.
그 외의 대조군으로는 상기 "KO → AAV"에서와 동일한 방법으로 Cas9 RNP 복합체를 이용해 넉-아웃만 진행하거나, AAV 벡터를 이용해 CAR 유전자 넉-인만 진행하였다.
각 군에서 배양 7일째 되는날 NK 세포를 획득 후, 비오틴-컨쥬게이트 MSLN ECD 단백질 1 ㎍을 PBS 용액 100 ㎕에서 1 X 106 NK 세포와 함께 4 ℃에서 20분간 암 조건에서 인큐베이션하였다. 세척 후, 0.08 ㎍의 스트렙타비딘-PE 항체를 포함하는 PBS 용액 100 ㎕을 추가한 뒤 같은 조건에서 반응시켰다. CAR-NK 세포막에서 발현되는 표면 CAR 단백질 발현 정도를 비교하기 위해 FACS 분석을 수행하였다.
그 결과, 도 20에 나타난 바와 같이, 바이러스성 벡터인 AAV 벡터를 이용하여도 NK 세포에 CAR 유전자가 넉-인되어 NK 세포막에 메소텔린 항체가 발현되는 것을 볼 수 있었고, 상기한 방법으로 CAR 유전자 넉-인과 함께 본 발명에 따른 Cas9 RNP 복합체로 TGFBR2 넉-아웃을 함께 수행할 경우 CAR 유전자 넉-인 효율이 더욱 증가된 것을 볼 수 있었다. 다만, 이 경우에도 TGFBR2 넉-아웃 후 AAV 벡터를 이용해 CAR 유전자 넉-인의 순서로 진행한 세포에서 메소텔린 항체의 발현이 가장 높았다.
TGFBR2(TGF beta receptor 2) 넉-아웃(knock-out)용 단일 가이드RNA(sgRNA), 암 세포에 특이적인 키메릭 항원 수용체, 및 TGFBR2 발현 유전자가 넉-아웃되고 암 세포에 특이적인 키메릭 항원 수용체 유전자가 넉-인된 면역 이펙터 세포 제조방법에 관한 것이다.

Claims (21)

  1. 서열번호 1 내지 서열번호 6의 염기서열로 표시되는 단일 가이드 RNA(sgRN
    A)로 구성된 군에서 선택된 어느 하나 이상의 단일 가이드를 포함하는, TGFBR2(TGF beta receptor 2) 넉-아웃(knock-out)용 단일 가이드 RNA.
  2. 제1항의 TGFBR2(TGF beta receptor 2) 넉-아웃(knock-out)용 단일 가이드 RNA; 및
    Cas9 단백질, Cas9 단백질을 코딩하는 염기서열, Cpf1 단백질 및 Cpf1 단백질을 코딩하는 염기서열로 구성된 군에서 선택된 어느 하나의 유전자 가위를 포함하는, TGFBR2(TGF beta receptor 2) 넉-아웃(knock-out)용 조성물.
  3. 서열번호 1 내지 서열번호 6의 염기서열로 표시되는 단일 가이드 RNA로 구성된 군에서 선택된 어느 하나 이상의 TGFBR2 넉-아웃용 단일 가이드 RNA, 및
    Cas9 단백질, Cas9 단백질을 코딩하는 염기서열, Cpf1 단백질 및 Cpf1 단백질을 코딩하는 염기서열로 구성된 군에서 선택된 어느 하나의 유전자 가위를 인간 유래 세포에 처리하는 단계를 포함하는, TGFBR2(TGF beta receptor 2) 넉-아웃(knock-out) 방법.
  4. 제3항에 있어서,
    상기 인간 유래 세포는 T 세포, 자연살해(natural killer; NK) 세포, 대식세포(macrophage), 단핵구(monocyte) 및 수지상 세포(Dendritic Cell)으로 구성된 군에선 선택된 어느 하나의 면역 이펙터 세포인 것을 특징으로 하는, TGFBR2(TGF beta receptor 2) 넉-아웃(knock-out) 방법.
  5. 제3항에 있어서,
    상기 단일 가이드 RNA 및 유전자 가위는 전기천공 또는 유전자 전달 벡터를 통해 면역 이펙터 세포에 전달되며,
    상기 전기천공은 1000 V ~ 2500 V, 5 ms ~ 50 ms, 및 1 pulse ~ 5 pulse 조건으로 수행하고,
    상기 유전자 전달 벡터는 플라스미드, 바이러스성 벡터 또는 비바이러스성 벡터인 것을 특징으로 하는, TGFBR2(TGF beta receptor 2) 넉-아웃(knock-out) 방법.
  6. 프로모터를 코딩하는 염기서열;
    신호 펩타이드(signal peptide)를 코딩하는 염기서열;
    암 세포 항원-결합도메인을 코딩하는 염기서열;
    막관통 도메인(transmembrane domain)을 코딩하는 염기서열;
    공동자극 도메인(costimulatory domain)을 코딩하는 염기서열; 및
    세포 내 신호전달 도메인(intracellular signal transduction domain)을 코딩하는 염기서열을 포함하는, 암 세포 항원에 특이적인 키메릭 항원 수용체(chimeric antigen receptor: CAR) 넉-인(knock-in)용 DNA 컨스트럭트.
  7. 제6항에 있어서,
    상기 프로모터는 pSFFV, pCMV 또는 pEF1A인 것을 특징으로 하는, 암 세포 항
    원에 특이적인 키메릭 항원 수용체(chimeric antigen receptor: CAR) 넉-인(knock-in)용 DNA 컨스트럭트.
  8. 제6항에 있어서,
    상기 암 세포 항원은 메소텔린(mesothelin; MSLN), CD22, CD19, HER2(human epidermal growth factor receptor type2), GD2, 엽산수용체(Folate receptor), MUC1(Mucin 1), ErbB2(Erythroblastic oncogene B-2 gene), EphA2(EPH receptor A2) 또는 EGFR(Epidermal growth factor receptor)인 것을 특징으로 하는, 암 세포 항원에 특이적인 키메릭 항원 수용체(chimeric antigen receptor: CAR) 넉-인(knock-in)용 DNA 컨스트럭트.
  9. 제8항에 있어서,
    상기 암 세포 항원이 메소텔린(mesothelin; MSLN)인 경우,
    암 세포 항원-결합 도메인은 서열번호 18의 아미노산 서열로 표시되는 것을 특징으로 하는, 암 세포 항원에 특이적인 키메릭 항원 수용체(chimeric antigen receptor: CAR) 넉-인(knock-in)용 DNA 컨스트럭트.
  10. 제6항에 있어서,
    상기 막관통 도메인은 CD8α, CD4, CD28, CD137, CD80, CD86, CD152, PD1, NKG2D, 41BB, 2B4, NKp30, NKp44, NKp46, NKG2C 및 OX40로 구성된 군에서 선택된 어느 하나이며,
    상기 공동자극 도메인은 CD28, OX-40, ICOS, NKG2D, 41BB, 2B4, NKp30, NKp44, NKp46 및 NKG2C로 구성된 군에서 선택된 어느 하나이고, 상기 세포 내 신호전달 도메인은 CD3ζ 유래인 것을 특징으로 하는, 암 세포 항원에 특이적인 키메릭 항원 수용체(chimeric antigen receptor: CAR) 넉-인(knock-in)용 DNA 컨스트럭트.
  11. 제6항에 있어서,
    상기 신호 펩타이드는 서열번호 14의 아미노산 서열로 표시되고,
    상기 막관통 도메인은 서열번호 20의 아미노산 서열로 표시되는 CD8이며,
    상기 공동자극 도메인은 서열번호 22의 아미노산 서열로 표시되는 4-1BB이고,
    상기 세포 내 신호전달 도메인은 서열번호 24의 아미노산 서열로 표시되는 CD3ζ인 것을 특징으로 하는, 암 세포 항원에 특이적인 키메릭 항원 수용체(chimeric antigen receptor: CAR) 넉-인(knock-in)용 DNA 컨스트럭트.
  12. 제6항에 있어서,
    상기 신호 펩타이드를 코딩하는 염기서열 및 암 세포 항원-결합도메인을 코딩하는 염기서열 사이에, 서열번호 16의 아미노산 서열로 표시되는 FLAG를 코딩하는 염기서열이 추가로 포함되는 것을 특징으로 하는, 암 세포 항원에 특이적인 키메릭 항원 수용체(chimeric antigen receptor: CAR) 넉-인(knock-in)용 DNA 컨스트럭트.
  13. 제6항에 있어서,
    상기 DNA 컨스트럭트는 5'-말단 및 3'-말단에 HA(homology Arm) 태그를 코딩하는 200bp ~ 1500bp 길이의 염기서열이 추가로 포함되는 것을 특징으로 하는, 암 세포 항원에 특이적인 키메릭 항원 수용체(chimeric antigen receptor: CAR) 넉-인(knock-in)용 DNA 컨스트럭트.
  14. 제6항에 있어서,
    상기 DNA 컨스트럭트는 3'-말단에 poly A 서열 또는 DNA 핵 표적 서열(DNA nuclear targeting sequence; DTS)이 추가로 포함되는 것을 특징으로 하는, 암 세포 항원에 특이적인 키메릭 항원 수용체(chimeric antigen receptor: CAR) 넉-인(knock-in)용 DNA 컨스트럭트.
  15. (1) 서열번호 1 내지 서열번호 6의 염기서열로 표시되는 단일 가이드 RNA로 구성된 군에서 선택된 어느 하나 이상의 TGFBR2 넉-아웃용 단일 가이드 RNA;
    (2) Cas9 단백질, Cas9 단백질을 코딩하는 염기서열, Cpf1 단백질 및 Cpf1 단백질을 코딩하는 염기서열로 구성된 군에서 선택된 어느 하나의 유전자 가위; 및
    (3) 프로모터를 코딩하는 염기서열;
    신호 펩타이드(signal peptide)를 코딩하는 염기서열;
    암 세포 항원-결합도메인을 코딩하는 염기서열;
    막관통 도메인(transmembrane domain)을 코딩하는 염기서열;
    공동자극 도메인(costimulatory domain)을 코딩하는 염기서열; 및
    세포 내 신호전달 도메인(intracellular signal transduction domain)을 코딩하는 염기서열을 포함하는, 암 세포 항원에 특이적인 키메릭 항원 수용체(chimeric antigen receptor: CAR) 넉-인(knock-in)용 DNA 컨스트럭트 또는 이를 포함하는 DNA 절편을 면역 이펙터 세포에 처리하는 단계를 포함하는, TGFBR2 발현 유전자가 넉-아웃되고 암 세포 항원에 특이적인 키메릭 항원 수용체 유전자가 넉-인된 면역 이펙터 세포 제조방법.
  16. 제15항에 있어서,
    상기 면역 이펙터 세포는 T 세포, 자연살해(natural killer; NK) 세포, 대식세포(macrophage), 단핵구(monocyte) 및 수지상 세포(Dendritic Cell)으로 구성된군에선 선택된 어느 하나인 것을 특징으로 하는, TGFBR2 발현 유전자가 넉-아웃되고 암 세포 항원에 특이적인 키메릭 항원 수용체 유전자가 넉-인된 면역 이펙터 세포 제조방법.
  17. 제15항에 있어서,
    상기 단일 가이드 RNA, 유전자 가위 및 DNA 절편은 전기천공 또는 유전자 전달 벡터를 통해 면역 이펙터 세포에 전달되며,
    상기 전기천공은 1000 V ~ 2500 V, 5 ms ~ 50 ms, 및 1 pulse ~ 5 pulse 조건으로 수행하고,
    상기 유전자 전달 벡터는 플라스미드, 바이러스성 벡터 또는 비바이러스성 벡터인 것을 특징으로 하는, TGFBR2 발현 유전자가 넉-아웃되고 암 세포 항원에 특이적인 키메릭 항원 수용체 유전자가 넉-인된 면역 이펙터 세포 제조방법.
  18. 제15항에 있어서,
    상기 단일 가이드 RNA, 유전자 가위 및 DNA 절편을 면역 이펙터 세포에 처리하기 전 또는 후에, IL-2, IL-15, IL-21, 및 TGF-β1로 구성된 군에서 선택된 어느 하나 이상의 사이토카인을 면역 이펙터 세포에 추가로 처리하는 것을 특징으로 하는, TGFBR2 발현 유전자가 넉-아웃되고 암 세포 항원에 특이적인 키메릭 항원 수용체 유전자가 넉-인된 면역 이펙터 세포 제조방법.
  19. 서열번호 1 내지 서열번호 6의 염기서열로 표시되는 단일 가이드 RNA로 구성된 군에서 선택된 어느 하나 이상의 TGFBR2(TGF beta receptor 2) 넉-아웃(knock-out)용 단일 가이드 RNA에 의해 TGFBR2 발현 유전자가 넉-아웃되고, TGFBR2 발현 유전자가 넉-아웃된 자리에 제6항 내지 제13항 중 어느 한 항의 암 세포 항원에 특이적인 키메릭 항원 수용체(chimeric antigen receptor: CAR) 넉-인(knock-in)용 DNA 컨스트럭트가 삽입된 면역 이펙터 세포.
  20. 제19항의 면역 이펙터 세포를 유효성분으로 포함하는, 암 예방 또는 치료용 약학적 조성물.
  21. 제20항에 있어서,
    상기 암은 편평세포암, 소세포 폐암, 비소세포 폐암, 폐의 선암종, 폐의 편평세포 암종, 중피암, 복막암, 간세포성암, 위장암, 췌장암, 신경교종, 자궁경부암, 난소암, 간암, 방광암, 간세포암, 유방암, 결장암, 결장직장암, 자궁내막 또는 자궁 암종, 타액선 암종, 신장암, 전립선암, 외음부암, 갑상선암, 간 암종, 백혈병 및 다른 림프구증식성 장애, 및 두경부암으로 구성된 군에서 선택된 어느 하나인 것을 특징으로 하는, 암 예방 또는 치료용 약학적 조성물.
PCT/KR2023/013872 2022-09-16 2023-09-15 유전자 가위 넉-인을 이용하여 제조한 키메릭 항원 수용체 세포 및 이의 용도 WO2024058589A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2022-0117181 2022-09-16
KR20220117181 2022-09-16

Publications (1)

Publication Number Publication Date
WO2024058589A1 true WO2024058589A1 (ko) 2024-03-21

Family

ID=90275331

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/013872 WO2024058589A1 (ko) 2022-09-16 2023-09-15 유전자 가위 넉-인을 이용하여 제조한 키메릭 항원 수용체 세포 및 이의 용도

Country Status (2)

Country Link
KR (1) KR20240040035A (ko)
WO (1) WO2024058589A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150031624A1 (en) * 2012-03-23 2015-01-29 Office of Health and Human Services, NIH Anti-mesothelin chimeric antigen receptors
JP2021502113A (ja) * 2017-11-01 2021-01-28 エディタス・メディシン，インコーポレイテッド 免疫療法のためのｔ細胞におけるｔｇｆｂｒ２のｃｒｉｓｐｒ−ｃａｓ９編集のための方法、組成物、および構成要素
KR20220004992A (ko) * 2019-03-29 2022-01-12 더 보드 오브 리젠츠 오브 더 유니버시티 오브 텍사스 시스템 Car-nk 세포의 생산 방법 및 이의 용도
KR20220016475A (ko) * 2019-05-01 2022-02-09 주노 쎄러퓨티크스 인코퍼레이티드 변형된 ｔｇｆｂｒ2 유전자 좌에서 재조합 수용체를 발현하는 세포, 관련 폴리뉴클레오티드 및 방법
KR20220111883A (ko) * 2021-02-03 2022-08-10 한국과학기술연구원 자연살해세포 특이적 CRISPR/Cas 시스템을 위한 융합 단백질 및 이의 용도

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150031624A1 (en) * 2012-03-23 2015-01-29 Office of Health and Human Services, NIH Anti-mesothelin chimeric antigen receptors
JP2021502113A (ja) * 2017-11-01 2021-01-28 エディタス・メディシン，インコーポレイテッド 免疫療法のためのｔ細胞におけるｔｇｆｂｒ２のｃｒｉｓｐｒ−ｃａｓ９編集のための方法、組成物、および構成要素
KR20220004992A (ko) * 2019-03-29 2022-01-12 더 보드 오브 리젠츠 오브 더 유니버시티 오브 텍사스 시스템 Car-nk 세포의 생산 방법 및 이의 용도
KR20220016475A (ko) * 2019-05-01 2022-02-09 주노 쎄러퓨티크스 인코퍼레이티드 변형된 ｔｇｆｂｒ2 유전자 좌에서 재조합 수용체를 발현하는 세포, 관련 폴리뉴클레오티드 및 방법
KR20220111883A (ko) * 2021-02-03 2022-08-10 한국과학기술연구원 자연살해세포 특이적 CRISPR/Cas 시스템을 위한 융합 단백질 및 이의 용도

Also Published As

Publication number Publication date
KR20240040035A (ko) 2024-03-27

Similar Documents

Publication Publication Date Title
WO2016021973A1 (ko) 캄필로박터 제주니 crispr/cas 시스템 유래 rgen을 이용한 유전체 교정
WO2015053523A1 (ko) 항체 발현용 바이시스트로닉 발현벡터 및 이를 이용한 항체의 생산 방법
WO2016021972A1 (en) Immune-compatible cells created by nuclease-mediated editing of genes encoding hla
WO2018217064A2 (ko) 형질전환된 t세포를 이용한 자연살해세포의 배양방법
WO2019182425A1 (ko) 신규 키메라 항원 수용체 암호화 유전자가 형질도입된 유전자 변형 nk 세포주 및 그의 용도
WO2018030874A1 (ko) 조작된 면역조절요소 및 이에 의해 변형된 면역 활성
WO2018208067A1 (ko) 인위적으로 조작된 조작면역세포
WO2011052883A9 (ko) Ｓｏｃｓ２ 유전자의 발현을 조절하여 자연 살해 세포를 활성화시키는 방법
Laski et al. Expression of a X. laevis tRNA Tyr gene in mammalian cells
WO2023277361A1 (ko) 메소텔린 특이적 항체 및 이의 용도
WO2012134215A2 (ko) 동물세포 발현벡터
WO2019143201A1 (ko) 재조합 백시니아 바이러스 및 이를 포함하는 약학 조성물
WO2024058589A1 (ko) 유전자 가위 넉-인을 이용하여 제조한 키메릭 항원 수용체 세포 및 이의 용도
WO2019132547A1 (ko) Chi3l1 억제제를 유효성분으로 하는 암의 폐 전이 예방 또는 치료용 약학 조성물
WO2019151771A1 (ko) Pd-l1 결합력이 증대된 pd-1 변이체
WO2020055187A1 (ko) 유전자가 변이된 세포의 사멸 유도 조성물 및 상기 조성물을 이용한 유전자가 변형된 세포 사멸 유도 방법
WO2022124839A1 (ko) 온-타겟 활성이 유지되고 오프-타겟 활성이 감소된 가이드 rna 및 이의 용도
WO2023282688A1 (ko) 산화스트레스 저항성을 갖는 중간엽 줄기세포, 이의 제조방법 및 용도
WO2019031804A9 (ko) 목적 유전자 발현 조절을 위한 대장균 및 코리네박테리움 글루타미쿰 셔틀 벡터
WO2021145700A1 (ko) 저산소 환경 하에서 높은 적응력을 가지는 세포 및 이의 용도
WO2022060155A1 (ko) 재조합 발생이 최소화된 유전자치료 벡터, 상기 벡터를 포함하는 재조합 레트로바이러스 및 상기 재조합 레트로바이러스를 포함하는 암의 예방 또는 치료용 약학 조성물
WO2016093668A2 (ko) 일체형 유전자 치료 유도만능줄기세포 제작방법
WO2023167575A1 (ko) 저면역원성 줄기세포, 줄기세포로부터 분화되거나 유래된 저면역원성 세포 및 이의 제조방법
WO2009145573A2 (ko) 아미노 말단의 메티오닌이 제거된 재조합 사람 변이 인터페론-베타 단백질을 생산하는 재조합 대장균 및 이의 제조방법
WO2015194770A1 (ko) Bst2 유전자의 기능이 상실된 세포주를 이용한 바이러스 감염 촉진 및 생산 증진 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23865885

Country of ref document: EP

Kind code of ref document: A1