WO2020138899A1 - 함초 추출물을 포함하는 골 질환 또는 갱년기 질환의 예방 또는 치료용 조성물 - Google Patents

함초 추출물을 포함하는 골 질환 또는 갱년기 질환의 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2020138899A1
WO2020138899A1 PCT/KR2019/018359 KR2019018359W WO2020138899A1 WO 2020138899 A1 WO2020138899 A1 WO 2020138899A1 KR 2019018359 W KR2019018359 W KR 2019018359W WO 2020138899 A1 WO2020138899 A1 WO 2020138899A1
Authority
WO
WIPO (PCT)
Prior art keywords
salicornia
extract
disease
bone
composition
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2019/018359
Other languages
English (en)
French (fr)
Inventor
박종환
최주희
김영민
조정용
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Industry Foundation of Chonnam National University
Original Assignee
Industry Foundation of Chonnam National University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020190154822A external-priority patent/KR20200080138A/ko
Application filed by Industry Foundation of Chonnam National University filed Critical Industry Foundation of Chonnam National University
Publication of WO2020138899A1 publication Critical patent/WO2020138899A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105—Plant extracts, their artificial duplicates or their derivatives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/21—Amaranthaceae (Amaranth family), e.g. pigweed, rockwort or globe amaranth
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A61P15/12—Drugs for genital or sexual disorders; Contraceptives for climacteric disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders

Definitions

  • the present invention was made by Task No. 2017R1D1A1A02019106 under the support of the Ministry of Science, ICT and Future Planning, and the research institute specialized in the project is the Korea Research Foundation, the research project name is "Basic Researcher Support Project (SGER)", and the research project name is "PRMTs-based osteoporosis. Examination of regulatory mechanisms and regulation of expression of Melatonin's PRMTs", the host organization is Chonnam National University, and the study period is 2016.06.01 ⁇ 2020.05.31.
  • SGER Basic Researcher Support Project
  • the present invention relates to a composition for the prevention, treatment or improvement of bone disease or climacteric disease, including the extract of the herb.
  • Osteoporosis is a disease in which the bone mass decreases due to various causes and the risk of fractures continues to increase due to the deterioration of the microstructure of bone tissue.
  • osteoporosis is a condition in which the minerals (particularly calcium) and the substrate constituting bone are reduced, and the balance of bone formation is broken, so that the osteoclast action is increased than the osteoclast action.
  • the inside of the normal bone has a dense structure like a mesh, but in the case of osteoporosis, the gap between the structures is widened and the microstructure becomes thinner, so that the bone is easily fractured even with a small impact.
  • Osteoporosis is largely classified into primary osteoporosis and secondary osteoporosis.
  • Primary osteoporosis includes postmenopausal osteoporosis, age-related osteoporosis, and idiopathic osteoporosis.
  • Secondary osteoporosis is caused by a disease or drug regardless of age.
  • menopausal symptoms appear in menopausal women. It is a disease caused by decreased secretion of estrogen, a female hormone that functions in various ways, such as blood circulation, weight control, and bone management. The same symptoms are seen in estrogen deficiency patients.
  • bone metastasis occurs in various cancer patients, and, for example, bone metastasis observed in breast cancer is mostly osteolytic metastasis that destroys bone. It is known that breast cancer cells do not directly affect bone, but rather by stimulating osteoclasts.
  • Hamcho Salicornia spp.
  • Hamcho is a typical annual edible and medicinal salt plant that grows domestically as a perennial plant of the quince family.
  • Hamcho has been used as a folk medicine for a long time, and has been used for vision loss, indigestion, gastrointestinal disease, hepatitis, kidney disease, etc., and has been scientifically proven to have antioxidant, anti-diabetic, anti-cancer, anti-hypertensive, anti-hyperlipidemic and skin whitening effects.
  • the present inventors have made extensive efforts to develop natural-derived compositions for the treatment and improvement of bone diseases or menopausal diseases. As a result, the present inventors showed that the extract of Hamcho ( Salicornia spp. ) showed an inhibitory effect on the production of TRAP-positive multinuclear cells, and also increased upon differentiation as a result of confirming the expression of the osteoclast-related genes TRAP, Cathepsin K, DC-STAMP and NFATc1.
  • the gene expression was reduced by the treatment of the herbal extract of hot water, and in the osteoporosis animal model induced by ovarian resection, the present invention was completed by confirming the effect of inhibiting the weight gain and reducing the bone density due to the intake of the herbal extract of the hot water.
  • Another object of the present invention is to provide a food composition for preventing or ameliorating bone disease, including the extract of the herb.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating menopausal disease, including a herbal extract.
  • Another object of the present invention is to provide a food composition for preventing or improving menopausal disease, including a herbal extract.
  • Another object of the present invention is to provide a method for preventing, treating, or improving bone disease of the herbal extract.
  • Another object of the present invention is to provide a method for preventing, treating or improving menopausal disease of the herbal extract.
  • One aspect of the present invention relates to a pharmaceutical composition for preventing or treating bone disease, including the extract of Hamcho ( Salicornia spp. ).
  • the present inventors as a result of diligent research efforts to develop a natural-derived composition for the treatment and improvement of bone disease, showed that the extract of Hamcho has been shown to inhibit the production of TRAP-positive multinuclear cells, and also genes related to osteoclasts, TRAP, Cathepsin K As a result of confirming the expression of DC-STAMP and NFATc1, it was confirmed that the increased gene expression during differentiation was decreased by treatment with the extract of the herbal extract, and also in the osteoporosis animal model induced by ovarian resection surgery, the effect of suppressing the weight gain due to the ingestion of the extract of the herbal extract and bone density The reduction inhibitory effect was confirmed.
  • composition of the present invention can prevent or treat bone diseases.
  • bone disease includes a condition or disease resulting from the loss of activity of osteoblasts or excessive production and/or migration of osteoclasts and diseases of lowering bone mass.
  • the bone mass-lowering disease refers to a condition or disease in which bone mass decreases with symptoms such as a decrease in bone density and degradation of bone tissue, and bone target diseases and cancer cells due to estrogen reduction in menopause. Bone loss caused by osteoclasts activated by may also be included in the scope of the present invention.
  • the bone diseases are osteoporosis, osteomalacia, osteoarthritis, Paget's disease, fibrous ostitis, adynamic bone disease, metabolic bone Disease (metabolic bone disease, MBD), bone damage due to bone metastasis of cancer cells, periodontal disease (periodontal disease), fracture, osteopenia, or osteogenic dysfunction (osteogenesis imperfect), but may not be limited to this.
  • cancer in bone damage caused by bone metastasis of cancer cells is breast cancer, stomach cancer, lung cancer, ovarian cancer, liver cancer, rectal cancer, bronchial cancer, nasopharyngeal cancer, larynx cancer, pancreatic cancer, bladder cancer, colon cancer, cervical cancer, endometrial cancer, Brain cancer, prostate cancer, bone cancer, skin cancer, thyroid cancer, leukemia, non-Hodgkin's lymph node cancer, parathyroid cancer, and ureter cancer may be included, and may be, for example, metastatic bone cancer.
  • Osteoporosis in the present invention includes primary osteoporosis (primary osteoporosis) and secondary osteoporosis (secondary osteoporosis).
  • the primary osteoporosis may include postmenopausal osteoporosis, age-related osteoporosis, or idiopathic osteoporosis, but is not limited thereto.
  • secondary osteoporosis is a disease (endocrine disease, gastrointestinal disease, malignant tumor) or drug (adrenal cortical hormone, anti-cancer chemotherapy, thyroid hormone, anticonvulsant, anticoagulant, methotrexate, cyclosporin regardless of age) cyclosporine), GnRH), alcohol, smoking or accidents, but are not limited thereto.
  • Another aspect of the present invention relates to a pharmaceutical composition for the prevention or treatment of menopausal disease, which includes the herbal extract.
  • menopausal in this specification means, especially in the case of women, around 50 years of age entering menopause due to a sharp decrease in ovarian function. As menopause continues, the secretion of estrogen, a female hormone, decreases, increasing the risk of developing various menopausal syndromes.
  • menopausal diseases include osteoporosis, weight gain, menopausal cardiovascular disease, abdominal obesity, fatty liver, hot flashes, sweating, skin dryness, vaginal dryness, vaginal atrophy, lower urethral atrophy, vaginitis, cystitis, urination pain, urine, concentration Disorder, short-term memory impairment, anxiety, nervousness, memory loss, muscle pain and joint pain may be one or more selected from the group consisting of, but is not limited thereto.
  • Menopausal cardiovascular disease in the present invention may be caused by thrombosis, for example, selected from the group consisting of stroke, myocardial infarction, brain hemorrhage, heart failure, cerebral thrombosis, heart attack, vascular restenosis, and arteriosclerosis. It may be one or more, but is not limited thereto.
  • treatment refers to all actions in which symptoms of bone disease are improved or cured by administration of a composition according to the present invention.
  • prevention in the present specification means all actions to suppress or delay the symptoms of bone disease by administration of the composition according to the present invention.
  • improvement refers to any action related to the condition in which the bone disease is being treated, such as reducing the severity of symptoms, delaying the progression or worsening of symptoms, or improving symptoms.
  • Hamcho is Salicornia herbacea , Salicornia europaea , Salicornia perennans , Salicornia procumbens ( Salicornia procumbens ), Salicornia maritima , Salicornia bigelovii , Salicornia depressa , Salicornia rubra , Salicornia rubra , Salicornia praecox (Salicornia praecox), raised cor California Senegal alkylene sheath (Salicornia senegalensis), raised cor California Perry Erie (Salicornia perrieri), raised cor California Parkinson star Barranquilla (Salicornia pachystachya), raised cor Niamey sharply Ana (Salicornia meyeriana), raised cor It may be one or more selected from the group consisting of nia uniflor
  • extract has a meaning commonly used in the art as a crude extract, but broadly also includes a fraction in which an extract is additionally fractionated. That is, the extract of Hamcho not only is obtained using an extraction solvent, but also includes those obtained by additionally applying a purification process. For example, a fraction obtained by passing the extract through an ultrafiltration membrane having a constant molecular weight cut-off value, separation by various chromatography (made for separation according to size, charge, hydrophobicity or affinity), etc. The fraction obtained through the purification method is also included in the herbal extract of the present invention.
  • the herbaceous ( Salicornia spp. ) extract may be extracted by adding a polar solvent as a herbaceous extraction solvent, but is not limited thereto.
  • the seaweed may be extracted after drying and slicing, but is not limited thereto.
  • the polar solvent used in the extraction method of the present invention may be one or more selected from the group consisting of water, alcohol, acetic acid, dimethyl-formamide (DMFO) and dimethyl sulfoxide (DMSO), but is not limited thereto.
  • the alcohol may be one or more selected from the group consisting of methanol, ethanol, propanol, butanol, normal-propanol, iso-propanol and normal-butanol, but is not limited thereto.
  • the polar solvent is one or more solvents selected from the group consisting of water and lower alcohol having 1 to 3 carbon atoms.
  • the polar solvent is water, methanol or ethanol.
  • a hot water extraction method when extracting seaweed, a hot water extraction method, a cold needle extraction method, a reflux extraction method, a normal temperature extraction method, or an ultrasonic extraction method may be used, but is not limited thereto.
  • water of 20 to 40 times the weight of the seaweed may be added and extracted at 80°C to 110°C for 3 to 5 hours.
  • water can be added to the seaweed to extract for 3 to 5 hours at 80°C to 100°C.
  • water can be added to the seaweed and extracted at 90° C. for 4 hours.
  • ethanol may be extracted for 5 to 10 days by adding ethanol of 20 to 40 times the weight of the seaweed. According to another embodiment of the present invention, ethanol can be extracted for 7 days by adding ethanol to the seaweed.
  • the herbal extract may be prepared in powder form by additional processes such as distillation under reduced pressure and freeze drying or spray drying.
  • composition of the present invention may include an organic solvent extract fraction obtained by purifying only an extract soluble in a specific organic solvent from a water extract or an alcohol extract of vinegar.
  • an organic solvent for example, hexane, chloroform, A conventional fractionation process using ethyl acetate, etc.
  • a non-polar solvent or an extract fraction soluble in the polar solvent can be obtained after adding a water extract or about 0.001 to 100 times, preferably 1 to 50 times the volume (v/w%) water of the weight of the extract of alcohol.
  • an organic solvent for example, hexane, chloroform, A conventional fractionation process using ethyl acetate, etc.
  • Non-polar solvents usable in the fraction separation method of the present invention are hexane, chloroform, ethyl acetate, acetone, acetonitrile, methyl acetate, fluoroalkane, pentane, 2,2,4-trimethylpentane, decane, cyclohexane, cyclo Pentane, diisobutylene, 1-pentene, 1-chlorobutane, 1-chloropentane, o-xylene, diisopropyl ether, 2-chloropropane, toluene, 1-chloropropane, chlorobenzene, benzene, diethyl Ether, diethyl sulfide, dichloromethane, 1,2-dichloroethane, anneal, diethylamine, ether, carbon tetrachloride and THF.
  • Polar solvents usable in the fraction separation method of the present invention include water, alcohol, acetic acid, dimethyl-formamide (DMFO) and dimethyl sulfoxide (DMSO), but are not limited thereto.
  • the alcohol usable in the fraction separation method is methanol, ethanol, propanol, butanol, normal-propanol, iso-propanol, normal-butanol, 1-pentanol, 2-butoxyethanol and ethylene glycol. It may be one or more selected, but is not limited thereto.
  • the term "comprising as an active ingredient” refers to those containing sufficient amounts to achieve the efficacy or activity of the extract ( Salicornia spp. ), or a fraction thereof, a compound isolated from the fraction or salts thereof. it means.
  • Quantitative upper limit of the herbal extract, fractions or compounds contained in the composition of the present invention can be carried out by those skilled in the art within a suitable range.
  • the composition of the invention may be a pharmaceutical composition.
  • the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier is commonly used in the formulation, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, Polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like, but is not limited thereto.
  • the pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetener, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).
  • composition of the present invention may be administered orally or parenterally, and in the case of parenteral administration, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, and the like.
  • Suitable dosages of the pharmaceutical compositions of the present invention include factors such as formulation method, mode of administration, patient's age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion and response sensitivity, and degree of bone loss in the patient. Varied by the field, usually skilled physicians can readily determine and prescribe a dose effective for the desired treatment or prevention.
  • the daily dosage of the pharmaceutical composition of the present invention is 0.001 to 10,000 mg/kg.
  • the pharmaceutical composition of the present invention may be administered from 0.1 to 100 mg/kg once to several times a day, depending on the degree of bone loss of the patient.
  • the pharmaceutical composition of the present invention is prepared in a unit dose form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by those skilled in the art to which the present invention pertains. Or it can be manufactured by incorporating into a multi-dose container.
  • the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or may be in the form of ex, powder, granule, tablet, or capsule, and may further include a dispersant or stabilizer.
  • Another aspect of the present invention relates to a food composition for preventing or improving bone disease or climacteric disease, which includes the herbal extract.
  • composition of the present invention is a food composition
  • it may be prepared in the form of powder, granule, tablet, capsule or beverage.
  • various foods such as candy, beverages, gum, tea, vitamin complexes, and health supplements.
  • the food composition of the present invention may include, as an active ingredient, a herbal extract, an organic solvent fraction, a compound separated from the fraction, or salts thereof, as well as ingredients commonly added in food preparation, for example, protein Contains carbohydrates, fats, nutrients, seasonings and flavoring agents.
  • carbohydrates include monosaccharides such as glucose and fructose; Disaccharides such as maltose, sucrose, oligosaccharides, etc.; And polysaccharides, for example, conventional sugars such as dextrin, cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • flavoring agents natural flavoring agents (taumatin, stevia extract (for example rebaudioside A, glycyrrhizine, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used.
  • natural flavoring agents tacmatin, stevia extract (for example rebaudioside A, glycyrrhizine, etc.)
  • synthetic flavoring agents sacharin, aspartame, etc.
  • citric acid liquid fructose
  • sugar glucose
  • acetic acid malic acid
  • fruit juice worm extract
  • jujube extract licorice extract
  • administration means providing a given substance to a subject in any suitable way.
  • the route of administration of the composition for preventing, improving or treating bone diseases of the present invention can be administered orally or parenterally through all general routes as long as the target tissue can be reached.
  • the composition of the present invention may be administered using any device capable of delivering an active ingredient to target cells.
  • Subject in the present specification is not particularly limited, for example, human, monkey, cow, horse, sheep, pig, chicken, turkey, quail, cat, dog, mouse, rat, rabbit, or Guinea pigs, preferably mammals, more preferably humans.
  • the present invention relates to a composition for preventing, treating or improving bone disease or climacteric disease, comprising a herb extract, a fraction thereof or an active compound for inhibiting osteoclast differentiation isolated therefrom.
  • a composition for preventing, treating or improving bone disease or climacteric disease comprising a herb extract, a fraction thereof or an active compound for inhibiting osteoclast differentiation isolated therefrom.
  • an osteoclast differentiation inhibitory efficacy verification experiment and an ovarian ablation experiment were conducted.
  • the herbal extract can provide the efficacy of preventing, treating or improving bone disease by inhibiting osteoclast differentiation without having cytotoxicity.
  • 1 is a graph and picture showing the effect of inhibiting the differentiation of the extract of Hamcho from mouse macrophages to osteoclasts.
  • Figure 2 is a graph and picture showing the inhibitory effect on the differentiation of mouse ethanol extract from mouse macrophages to osteoclasts.
  • Figure 3 is a diagram showing the inhibitory effect of the expression of osteoclast differentiation-related gene expression of Hamcho hot water extract.
  • Figure 4 is a graph showing the inhibitory effect on weight gain induced by osteoporosis of the hot water extract of Hamcho.
  • Figure 5 is a graph showing the inhibitory effect on the decrease in bone density induced by osteoporosis of hot water extract of Hamcho.
  • FIG. 6 is a graph showing the inhibitory effect of Hamcho hydrothermal extract on blood lipid and cholesterol levels induced by osteoporosis.
  • It relates to a pharmaceutical composition for the prevention or treatment of bone disease, including the extract ( Salicornia spp. ).
  • the extracts were filtered under reduced pressure using a reduced pressure flask.
  • the concentrated herbal extract was freeze-dried and stored at -20°C.
  • Example 2 Experiment on the effect of preventing or treating bone disease using a herbal extract
  • Macrophages isolated from mouse bone marrow were dispensed into 12 well plates at a density of 2 x 10 5 /well and cultured for 24 hours. Subsequently, after replacing the medium with FBS, 1% penicillin streptomycin, and macrophage colony stimulating factor (M-CSF), herbal extract of hot water (10, 50 and 100 ug/ml) and ethanol extract (10, 50 and 100 ug/ml) were treated for 2 hours. Thereafter, 100 ng/ml of RANKL (Receptor activator of nuclear factor kappa-B ligand) was treated and reacted for 24 hours. Cells were differentiated for 6 days while repeating the above method (medium exchange, treatment with herbal extracts, and RANKL).
  • M-CSF macrophage colony stimulating factor
  • the nucleus was stained by adding a chromogenic substrate of the TRAP staining kit (KAMIYA BIOMEDICAL COMPANY) to TRAP (Tartrate resistance acid phosphatase), a cytochemical marker of osteoclasts. Nucleated cells with three or more nuclei were observed, imaged and quantified.
  • Macrophages bind to RANK and differentiate into TRAP positive cells. When stimulated with TRAP-positive cells with inflammatory factors such as RANKL or TNF- ⁇ , the cells fuse together and differentiate into multinuclear TRAP-positive cells.
  • TRAP TRAP
  • DC-STAMP DC-STAMP
  • Cathepsin K Cathepsin K
  • NFATc1 NFATc1
  • BMDMs were cultured in a 12 well plate at a density of 2x10 5 /well for 24h, and the medium containing the herbal extract of hot water was treated for 2h. Subsequently, RANKL was treated to induce differentiation.
  • RNA was isolated using a TRIzol solution, and cDNA was synthesized using RT premix based on the RNA quantitative value.
  • the synthesized cDNA was amplified through Real time PCR using a primer.
  • the primers used are as shown in Table 1 below, and the relative amounts were compared with that of Mouse TRAP, DC-STAMP, Cathepsin K, and NFATc1 and compared to the control gene GAPDH.
  • RANKL When RANKL is treated with macrophages, it binds to RANK and differentiates into TRAP-positive multinucleated osteoclasts. In addition, it activates NFATc1, a transcription factor important for differentiation into osteoclasts, and increases the expression of TRAP, Cathepsine K, and DC-STAMP involved in osteoclastogenesis.
  • the extract reduces the activity of NFATc1, a transcription factor, and reduces the expression of osteoclast differentiation related genes TRAP, DC-STAMP, and Cathepsin K, thereby inhibiting differentiation into osteoclasts.
  • C57BL/6 female 7 weeks old were used as the experimental animals. It was kept in a plastic cage in an environment set at a temperature of 22 ⁇ 2°C, a relative humidity of 50 ⁇ 10%, and a 12 hour contrast cycle. The ovarian resection for osteoporosis induction was adapted to the breeding conditions in the same environment for about 1 week.
  • the ovarian surgical site was epilated and disinfected.
  • the surgical site was incised about 1 cm and the ovaries were checked along the uterus, taking care not to damage the other organs, and then the ovaries were ligated with a suture thread to remove both ovaries.
  • each organ was repositioned into the abdominal cavity and then closed with a suture thread.
  • Bone density measurement BMD (Bone mineral density), BV/TV (Bone volume/tissue volume), Tb using micro computed tomography (CT) that provides high-resolution image data compared to previous simple radiographs or computed tomography .
  • CT micro computed tomography
  • Th Trabecular thickness
  • Tb.N Trabecular number
  • the specimen In the micro CT, the specimen is rotated by 0.9o and taken 200 times to 180o.
  • the X-ray exposure time during 0.9o rotation is 5.9 seconds, and the obtained file is a micro CT reconstruction program (NRecon; SkyScan, Aartselaar, Belgium). ) To reconstruct the cross-section image, and then reconstructed the image using a micro CT imaging program (Data Viewer; SkyScan, Aartselaar, Belgium).
  • T-col total cholesterol
  • TG triglyceride
  • HDL-C high density lipoprotein
  • LDL-C low density lipoprotein
  • the present invention relates to a composition for the prevention, treatment or improvement of bone disease or climacteric disease, including the extract of the herb.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Mycology (AREA)
  • Botany (AREA)
  • Food Science & Technology (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Medical Informatics (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Biotechnology (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Polymers & Plastics (AREA)
  • Nutrition Science (AREA)
  • Endocrinology (AREA)
  • Reproductive Health (AREA)
  • Medicines Containing Plant Substances (AREA)

Abstract

본 발명은 함초(Salicornia spp.) 추출물을 포함하는 골 질환 또는 갱년기 질환의 예방 또는 치료용 약제학적 조성물에 관한 것이다. 상세하게는 천연원료인 함초 추출물을 함유하는 조성물을 제조하고, 이를 이용하여 독성 및 부작용 없이 인체에 안전하게 사용될 수 있는 골 질환 또는 갱년기 질환의 예방 또는 치료용 약제학적 조성물, 또는 골 질환 또는 갱년기 질환의 예방 또는 개선용 건강기능식품으로 응용할 수 있다.

Description

함초 추출물을 포함하는 골 질환 또는 갱년기 질환의 예방 또는 치료용 조성물
본 발명은 미래창조과학부의 지원 하에서 과제번호 2017R1D1A1A02019106에 의해 이루어진 것으로서, 상기 과제의 연구관리전문기관은 한국연구재단, 연구사업명은 "기본연구자지원사업 (SGER)", 연구과제명은 "PRMTs 기반 골다공증 발병 조절 기전 규명 및 Melatonin의 PRMTs 발현 조절 규명", 주관기관은 전남대학교, 연구기간은 2016.06.01 ~ 2020.05.31이다.
본 특허출원은 2018년 12월 26일에 대한민국 특허청에 제출된 대한민국 특허출원 제10-2018-0169399호, 및 2019년 11월 27일에 대한민국 특허청에 제출된 대한민국 특허출원 제10-2019-0154822호에 대하여 우선권을 주장하며, 상기 특허출원의 개시 사항은 본 명세서에 참조로서 삽입된다.
본 발명은 함초 추출물을 포함하는 골 질환 또는 갱년기 질환의 예방, 치료 또는 개선용 조성물에 관한 것이다.
골다공증(osteoporosis)은 여러 가지 원인에 의하여 뼈의 질량이 감소하고 뼈 조직의 미세구조의 퇴화로 골절 위험이 지속적으로 증가하는 질환이다. 특히, 골다공증은 뼈를 구성하는 미네랄(특히 칼슘)과 기질이 감소한 상태이며, 골재형성의 균형이 깨져서 파골작용이 조골작용보다 증가된 상태에서 발생한다. 정상적인 뼈 내부는 그물망처럼 치밀한 구조를 이루고 있으나, 골다공증의 경우에는 구조 사이의 간격이 넓어지고 미세구조가 얇아져 약해짐으로써 조그만 충격에도 뼈가 쉽게 골절될 수 있는 상태로 진행된다.
골다공증은 크게 일차성 골다공증(primary osteoporosis)과 이차성 골다공증(secondary osteoporosis)으로 분류된다. 일차성 골다공증은 폐경 후 골다공증(postmenopausal osteoporosis), 노인성 골다공증(age-related osteoporosis), 및 특발성 골다공증(idiopathic osteoporosis)을 포함한다. 이차성 골다공증(secondary osteoporosis)은 연령에 상관없이 질병이나 약물로 인해 발생한다.
갱년기의 여성에게서는 여러 폐경 증후들이 나타나는데, 혈액순환, 체중조절, 뼈 관리를 돕는 등의 다양한 기능을 하는 여성호르몬인 에스트로겐의 분비가 저하되면서 발병하는 질환으로 갱년기가 아니더라도 난소 절제, 난소 기능저하 등 다른 원인에 의한 에스트로겐 결핍 환자에서도 동일한 증상이 나타난다.
특히 에스트로겐의 감소로 인하여 뼈에서 칼슘이 빠져나가 뼈의 질량이 감소하고, 구멍이 많아져 골 손실이 증가하므로 골다공증의 발병률이 높아지게 된다. 폐경기 이후 후기 변화는 증상이 나타나기까지 다소 시간이 걸릴 수 있으므로 문제를 쉽게 자각하지 못하는 경우가 많다. 최근 보건복지부 국민 건강 통계에 따르면, 30세 이상에서 골다공증 유병률이 남성은 1%, 여성은 9%로 나타나, 여성 유병률이 남성 대비 9 배나 높게 나타났다.
한편, 다양한 암 환자에게서는 골전이가 일어나고, 예컨대 유방암에서 관찰되는 골 전이는 대부분 뼈를 파괴하는 골 용해성 골 전이(osteolytic metastasis)이다. 이는 유방암 세포가 뼈에 직접적인 영향을 미치는 것이 아니라 파골세포를 자극함으로써 일어나는 것으로 알려져 있다.
위와 같은 골 질환 또는 갱년기 질환을 치료하기 위해, 천연물로부터 질병을 예방 또는 억제할 수 있는 생리활성 물질에 대한 연구가 진행되고 있다. 특히 생리활성물질의 보고 알려진 해양식물의 탐색에 관한 연구 및 해조류로부터 질병을 억제하거나 개선시킬 수 있는 소재를 찾으려는 연구가 활발히 진행되고 있다.
함초 (Salicornia spp.)는 명아주 과의 한해살이 풀로 국내 자생하는 대표적인 식용 및 약용 염생식물이다. 함초는 오랫동안 민간약으로 시력저하, 소화불량, 위장병, 간염, 신장병 등에 사용되어 왔고, 항산화, 항당뇨, 항암, 항고혈압, 항고지혈증, 피부미백 효과가 있음이 과학적으로 입증되어오고 있다.
그러나, 함초 추출물의 골다공증 예방 또는 치료 효과를 대상으로 한 구체적인 연구 및 이의 생리활성 유효성분에 대해서는 알려진 바가 없는 실정이다. 본 발명자들은 함초 추출물이 파골세포 분화억제 활성을 나타내는 것을 확인하여, 이를 골 질환 치료용 조성물로 제안한다.
본 발명자들은 골 질환 또는 갱년기 질환의 치료 및 개선을 위한 천연물-유래의 조성물을 개발하고자 예의 연구 노력하였다. 그 결과 본 발명자들은 함초(Salicornia spp.) 추출물이 TRAP 양성인 다핵세포의 생성 억제효과를 나타냈고, 또한 파골세포와 관련된 유전자인 TRAP, Cathepsin K, DC-STAMP 그리고 NFATc1의 발현 확인 결과 분화 시 증가된 유전자 발현이 함초 열수 추출물 처리에 의해 감소됨을 확인하였고, 또한 난소절제수술로 유도된 골다공증 동물 모델에서는 함초 열수 추출물 섭취로 인해 체중 증가 억제 효과 및 골밀도 감소 억제 효과를 확인함으로써 본 발명을 완성하게 되었다.
따라서 본 발명의 목적은 함초 추출물을 포함하는 골 질환 예방 또는 치료용 약제학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은 함초 추출물을 포함하는 골 질환 예방 또는 개선용 식품 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 함초 추출물을 포함하는 갱년기 질환 예방 또는 치료용 약제학적 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 함초 추출물을 포함하는 갱년기 질환 예방 또는 개선용 식품 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 함초 추출물의 골 질환 예방, 치료 또는 개선 용도를 제공하는 것이다.
본 발명의 또 다른 목적은 함초 추출물의 갱년기 질환 예방, 치료 또는 개선 용도를 제공하는 것이다.
본 발명의 일 양태는 함초(Salicornia spp.) 추출물을 포함하는 골 질환 예방 또는 치료용 약제학적 조성물에 관한 것이다.
본 발명자들은 골 질환 치료 및 개선을 위한 천연물-유래의 조성물을 개발하고자 예의 연구 노력한 결과, 함초 추출물이 TRAP 양성인 다핵세포의 생성 억제효과를 나타냈고, 또한 파골세포와 관련된 유전자인 TRAP, Cathepsin K, DC-STAMP 그리고 NFATc1의 발현 확인 결과 분화 시 증가된 유전자 발현이 함초 열수 추출물 처리에 의해 감소됨을 확인하였고, 또한 난소절제수술로 유도된 골다공증 동물 모델에서는 함초 열수 추출물 섭취로 인해 체중 증가 억제 효과 및 골밀도 감소 억제 효과를 확인하였다.
본 발명의 조성물은 골 질환을 예방 또는 치료할 수 있다.
본 명세서에서 용어 "골 질환"은 조골세포의 활성 손실 또는 파골세포의 과다한 생성 및/또는 이동으로 인해 나타나는 상태 또는 질병 및 골량 저하 질환을 포함한다.
본 발명에 있어서 상기 골량 저하 질환이란 골 밀도의 저하, 골 조직의 열화(degradation) 등의 증상을 수반하는 골량의 저하가 나타나는 상태 또는 질환을 의미하며, 갱년기의 에스트로겐 저하로 인한 골 대상성 질환 및 암세포에 의해 활성화되는 파골세포에 의한 골 손실도 본 발명의 범주에 포함될 수 있다.
본 발명에 있어서 상기 골 질환은 골다공증(osteoporosis), 골연화증(osteomalacia), 골관절염(osteoarthritis), 파제트병(Paget's disease), 섬유성 골염(fibrous ostitis), 무형성 골질환(adynamic bone disease), 대사성 골질환(metabolic bone disease, MBD), 암세포의 골전이에 의한 뼈의 손상, 치주질환(periodontal disease), 골절, 골감소증 또는 골형성 부전증(osteogenesis imperfect)인 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서 암세포의 골전이에 의한 뼈의 손상에서 암은 유방암, 위암, 폐암, 난소암, 간암, 직장암, 기관지암, 비인두암, 후두암, 췌장암, 방광암, 결장암, 자궁경부암, 자궁내막 암, 뇌암, 전립선암, 골암, 피부암, 갑상선암, 백혈병, 비-호지킨(non-Hodgkin) 임파선암, 부갑상선암 및 요관암을 포함하는 것일 수 있으며, 예를 들어, 전이성 골암인 것일 수 있다.
본 발명에 있어서 골다공증은 일차성 골다공증(primary osteoporosis) 및 이차성 골다공증(secondary osteoporosis)을 포함한다.
본 발명에 있어서 상기 일차성 골다공증은 폐경 후 골다공증(postmenopausal osteoporosis), 노인성 골다공증(age-related osteoporosis) 또는 특발성 골다공증(idiopathic osteoporosis)을 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서 이차성 골다공증은 연령에 상관없이 질병 (내분비질환, 위장관질환, 악성종양)이나 약물 (부신피질호르몬, 항암화학요법, 갑상선호르몬, 항경련제, 항응고제, 메토트렉사트(methotrexate), 사이클로스포린(cyclosporine), GnRH 등), 알코올, 흡연 또는 사고 등으로 인해 발생할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 다른 일 양태는, 함초 추출물을 포함하는 갱년기 질환 예방 또는 치료용 약제학적 조성물에 관한 것이다.
본 명세서상의 용어 "갱년기"는 특히 여성의 경우에서 난소 기능의 급격한 저하로 인한 폐경기에 접어드는 50세 전후를 의미한다. 폐경기의 지속에 따라 여성호르몬인 에스트로겐의 분비가 감소하면서 각종 갱년기 증후군들의 발병 위험이 높아진다.
본 발명에 있어서 갱년기 질환은 골다공증, 체중 증가, 갱년기성 심혈관계 질환, 복부 비만, 지방간, 안면홍조, 발한, 피부건조, 질건조증, 질위축, 하부 요도 위축, 질염, 방광염, 배뇨통, 급뇨, 집중장애, 단기 기억장애, 불안, 신경과민, 기억력 감퇴, 근육통 및 관절통으로 이루어진 군으로부터 선택되는 1종 이상일 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서 갱년기성 심혈관계 질환은 혈전생성에 의해서 유발되는 것일 수 있으며, 예를 들어, 뇌졸중, 심근경색, 뇌출혈, 심부전증, 뇌혈전증, 심장마비, 혈관재협착 및 동맥경화증으로 이루어진 군으로부터 선택되는 1종 이상일 수 있으나, 이에 한정되는 것은 아니다.
본 명세서에서 용어 "치료"는 본 발명에 따른 조성물의 투여로 골 질환의 증상이 호전되거나 완치되는 모든 행위를 의미한다. 또한, 본 명세서에서 용어 "예방"은 본 발명에 따른 조성물의 투여로 골 질환의 증상을 억제 또는 지연시키는 모든 행위를 의미한다.
본 명세서에서 용어 "개선"은 골 질환이 치료되는 상태와 관련된 파라미터, 예를 들면 증상의 정도를 감소시키거나 증상의 진행 또는 악화를 지연시키거나 증상을 호전시키는 모든 행위를 의미한다.
본 발명에 있어서 함초(Salicornia spp.)는 살리코르니아 헤르바세아(Salicornia herbacea), 살리코르니아 유로파에아(Salicornia europaea), 살리코르니아 페렌난스(Salicornia perennans), 살리코르니아 프로쿰벤스(Salicornia procumbens), 살리코르니아 마리티마(Salicornia maritima), 살리코르니아 비겔로비(Salicornia bigelovii), 살리코르니아 데프레사(Salicornia depressa), 살리코르니아 루브라(Salicornia rubra), 살리코르니아 프라에콕스(Salicornia praecox), 살리코르니아 세네갈렌시스(Salicornia senegalensis), 살리코르니아 페리에리(Salicornia perrieri), 살리코르니아 파키스타키야(Salicornia pachystachya), 살리코르니아 메예리아나(Salicornia meyeriana), 살리코르니아 유니플로라(Salicornia uniflora), 또는 살리코르니아 브라키아타(Salicornia brachiate) 로 구성된 군에서 선택되는 1종 이상인 것일 수 있으나, 이에 한정되는 것은 아니다.
본 명세서에서 사용되는 용어 "추출물"은 당업계에서 조추출물(crude extract)로 통용되는 의미를 갖지만, 광의적으로는 추출물을 추가적으로 분획(fractionation)한 분획물도 포함한다. 즉, 함초 추출물은 추출용매를 이용하여 얻은 것뿐만 아니라, 여기에 정제과정을 추가적으로 적용하여 얻은 것도 포함한다. 예컨대, 상기 추출물을 일정한 분자량 컷-오프 값을 갖는 한외 여과막을 통과시켜 얻은 분획, 다양한 크로마토그래피 (크기, 전하, 소수성 또는 친화성에 따른 분리를 위해 제작된 것)에 의한 분리 등, 추가적으로 실시된 다양한 정제 방법을 통해 얻어진 분획도 본 발명의 함초 추출물에 포함되는 것이다.
본 발명에 있어서 함초(Salicornia spp.) 추출물은 함초 추출용매로서 극성 용매를 가하여 추출한 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서 함초는 건조 및 세절한 후 추출하는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 추출방법에서 사용되는 극성 용매는 물, 알코올, 아세트산, DMFO(dimethyl-formamide) 및 DMSO(dimethyl sulfoxide)로 이루어진 군에서 선택된 1종 이상인 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서 상기 알코올은 메탄올, 에탄올, 프로판올, 부탄올, 노말-프로판올, 이소-프로판올 및 노말-부탄올로 이루어진 군에서 선택된 1종 이상인 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 따르면, 상기 극성 용매는 물 및 탄소수 1 내지 3의 저급알코올로 구성된 군에서 선택되는 1 이상의 용매이다. 본 발명의 다른 구현예에 따르면, 상기 극성용매는 물, 메탄올 또는 에탄올이다.
본 발명에서 함초 추출 시, 열수 추출법, 냉침 추출법, 환류추출법, 상온 추출법 또는 초음파 추출법을 사용할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 따르면, 함초의 20배 내지 40 배 중량의 물을 가하여 80℃ 내지 110℃에서 3 내지 5시간 동안 추출할 수 있다. 본 발명의 다른 구현예에 따르면, 함초에 물을 가하여 80℃ 내지 100℃에서 3 내지 5시간 동안 추출할 수 있다. 본 발명의 특정 구현예에 따르면, 함초에 물을 가하여 90℃에서 4시간 동안 추출할 수 있다.
본 발명의 일 구현예에 따르면, 함초의 20배 내지 40 배 중량의 에탄올을 가하여 5일 내지 10일 동안 에탄올 추출할 수 있다. 본 발명의 다른 구현예에 따르면, 함초에 에탄올을 가하여 7일 동안 에탄올 추출할 수 있다.
본 발명에 있어서 함초 추출물은 감압 증류 및 동결 건조 또는 분무 건조 등과 같은 추가적인 과정에 의해 분말 상태로 제조될 수 있다.
한편, 본 발명의 조성물은 함초의 물 추출물 또는 알코올 추출물로부터, 특정 유기 용매에 가용한 추출물만을 정제하여 수득한 유기용매 추출 분획물을 포함할 수 있다.
예를 들어, 함초의 물 추출물 또는 알코올 추출물 중량의 약 0.001 내지 100배, 바람직하게는 1 내지 50배 부피 (v/w%)의 물을 가한 후, 유기용매(예를 들어, 헥산, 클로로포름, 에틸아세테이트 등)를 이용한 통상적인 분획과정을 수행하여 비극성 용매 또는 극성 용매에 가용한 추출 분획물을 수득할 수 있다.
본 발명의 분획물 분리방법에서 사용 가능한 비극성 용매는, 헥산, 클로로포름, 에틸아세테이트, 아세톤, 아세토나이트릴, 메틸아세테이트, 플루오로알칸, 펜탄, 2,2,4-트리메틸펜탄, 데칸, 사이클로헥산, 사이클로펜탄, 디이소부틸렌, 1-펜텐, 1-클로로부탄, 1-클로로펜탄, o-자일렌, 디이소프로필에테르, 2-클로로프로판, 톨루엔, 1-클로로프로판, 클로로벤젠, 벤젠, 디에틸 에테르, 디에틸 설파이드, 디클로로메탄, 1,2-디클로로에탄, 어닐린, 디에틸아민, 에테르, 사염화탄소 및 THF를 포함하며, 이에 한정되는 것은 아니다.
본 발명의 분획물 분리방법에서 사용 가능한 극성 용매는 물, 알코올, 아세트산, DMFO(dimethyl-formamide) 및 DMSO(dimethyl sulfoxide)를 포함하며, 이에 한정되는 것은 아니다.
본 발명에 있어서 상기 분획물 분리방법에서 사용 가능한 알코올은 메탄올, 에탄올, 프로판올, 부탄올, 노말-프로판올, 이소-프로판올, 노말-부탄올, 1-펜탄올, 2-부톡시에탄올 및 에틸렌글리콜로 이루어진 군에서 선택된 1종 이상인 것일 수 있으나, 이에 한정되는 것은 아니다.
본 명세서에서 용어 "유효성분으로 포함하는"이란, 함초(Salicornia spp.) 추출물, 또는 이의 분획물, 분획물로부터 분리된 화합물 또는 이의 염(salts)의 효능 또는 활성을 달성하는 데 충분한 양을 포함하는 것을 의미한다. 본 발명의 조성물에 포함된 함초 추출물, 이의 분획물 또는 화합물의 양적 상한은 당업자가 적절한 범위 내에서 선택하여 실시할 수 있다.
본 발명의 일 구현예에 따르면, 본 발명의 조성물은 약제학적 조성물일 수 있다.
본 발명의 약제학적 조성물은 약제학적으로 허용되는 담체를 포함할 수 있다.
상기 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다.
본 발명의 약제학적 조성물은 경구 또는 비경구로 투여할 수 있고, 비경구 투여인 경우에는 정맥내 주입, 피하 주입, 근육 주입, 복강 주입, 경피 투여 등으로 투여할 수 있다.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성, 환자의 골 손실 정도와 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 소망하는 치료 또는 예방에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다. 본 발명의 일 구현예에 따르면, 본 발명의 약제학적 조성물의 1일 투여량은 0.001 내지 10,000 ㎎/㎏이다. 본 발명의 다른 구현예에 따르면, 본 발명의 약제학적 조성물은 환자가 갖는 골 손실 정도 등에 따라, 0.1 내지 100 ㎎/㎏을 1일 1회 내지 수회 투여할 수 있다.
본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화 함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
본 발명의 또 다른 양태는, 함초 추출물을 포함하는 골 질환 또는 갱년기 질환 예방 또는 개선용 식품 조성물에 관한 것이다.
본 발명의 조성물이 식품 조성물인 경우에는 분말, 과립, 정제, 캡슐 또는 음료 등의 형태로 제조될 수 있다. 예컨대 캔디류의 각종 식품류, 음료, 껌, 차, 비타민 복합제, 또는 건강보조 식품류 등이 있다.
본 발명의 식품 조성물은 유효성분으로서 함초 추출물, 유기용매 분획물, 분획물로부터 분리된 화합물 또는 이의 염(salts)뿐만 아니라, 식품 제조 시에 통상적으로 첨가되는 성분을 포함할 수 있으며, 예를 들어, 단백질, 탄수화물, 지방, 영양소, 조미제 및 향미제를 포함한다. 상술한 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스, 올리고당 등; 및 폴리사카라이드, 예를 들어 덱스트린, 사이클로덱스트린 등과 같은 통상적인 당 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 향미제로서 천연 향미제 (타우마틴, 스테비아 추출물 (예를 들어 레바우디오시드 A, 글리시르히진 등)) 및 합성 향미제(사카린, 아스파르탐 등)를 사용할 수 있다. 예컨대, 본 발명의 식품 조성물이 드링크제로 제조되는 경우에는 본 발명의 추출물 또는 화합물 이외에 구연산, 액상과당, 설탕, 포도당, 초산, 사과산, 과즙, 두충 추출액, 대추 추출액, 감초 추출액 등을 추가로 포함할 수 있다.
본 명세서에서 용어 "투여"는 임의의 적절한 방법으로 대상(subject)에게 소정의 물질을 제공하는 것을 의미한다. 본 발명의 골 질환 예방, 개선 또는 치료용 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 일반적인 모든 경로를 통하여 경구 또는 비경구 투여될 수 있다. 또한, 본 발명의 조성물은 유효성분을 표적 세포로 전달할 수 있는 임의의 장치를 이용해 투여될 수도 있다.
본 명세서에서 "투여 대상(subject)"은, 특별히 한정되는 것은 아니지만, 예를 들어, 인간, 원숭이, 소, 말, 양, 돼지, 닭, 칠면조, 메추라기, 고양이, 개, 마우스, 쥐, 토끼 또는 기니아 피그를 포함하고, 바람직하게는 포유류, 보다 바람직하게는 인간을 의미한다.
본 발명은 함초 추출물, 이의 분획물 또는 이로부터 분리된 파골세포 분화억제 활성 화합물을 포함하는 골질환 또는 갱년기 질환의 예방, 치료 또는 개선용 조성물에 관한 것이다. 본 발명에서 골 질환 또는 갱년기 질환의 예방에 대한 함초 추출물의 활용성과 가능성을 확인하고자 골 질환을 유도하는 파골세포 분화 억제 효능 검증 실험 및 난소 절제 실험을 진행하였다. 함초 추출물은 세포독성을 가지지 않으면서 파골세포의 분화를 억제시킴으로써 골 질환을 예방, 치료 또는 개선하는 효능을 제공할 수 있다.
도 1은 함초 열수 추출물의 마우스 대식세포로부터 파골세포로의 분화에 대한 억제 효과를 나타낸 그래프 및 그림이다.
도 2는 함초 에탄올 추출물의 마우스 대식세포로부터 파골세포로의 분화에 대한 억제 효과를 나타낸 그래프 및 그림이다.
도 3은 함초 열수 추출물의 파골세포 분화 유도 관련 유전자 발현에 대한 억제 효과를 나타낸 그림이다.
도 4는 함초 열수 추출물의 골다공증으로 유도된 체중 증가에 대한 억제 효과를 나타낸 그래프이다.
도 5는 함초 열수 추출물의 골다공증으로 유도된 골밀도 감소에 대한 억제 효과를 나타낸 그래프이다.
도 6은 함초 열수 추출물의 골다공증으로 유도된 혈중 지질 및 콜레스테롤 수치에 대한 억제 효과를 나타낸 그래프이다.
함초(Salicornia spp.) 추출물을 포함하는 골 질환 예방 또는 치료용 약제학적 조성물에 관한 것이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1: 함초 열수 및 에탄올 추출물의 제조
함초 (Salicornia herbacea L.)는 대한민국 (주)다사랑으로부터 구매하여 사용하였다.
건조된 함초 100 g에 증류수 3 L를 가하여 약탕기에서 90℃로 4시간 동안 가열하여 열수 추출하였다.
한편, 건조된 함초 50 g에 에탄올 1.5 L를 가하여 일주일 동안 에탄올 추출하였다.
상기 추출물들을 감압플라스크를 이용하여 감압 여과하였다.
상기 감압 여과한 추출물을 농축용 수기에 1/3 정도 채운 다음, 가열 수조(Heating bath)의 온도를 각각 40℃(열수추출물) 및 35℃(에탄올추출물)로 설정한 뒤, 10분 동안 감압농축기를 작동시켰다. 1차 농축 이후에 압력을 제거하고 동일한 방법으로 2차 농축을 실시하였다.
농축한 함초 추출물은 동결 건조하여 -20℃에서 보관하였다.
실시예 2: 함초 추출물을 이용한 골 질환 예방 또는 치료 효과에 대한 실험
2-1. 함초 열수 추출물 및 에탄올 추출물의 파골세포 분화에 대한 억제 평가 (TRAP staining)
마우스 골수에서 분리한 대식세포를 12 웰(well) 플레이트에 2 x 105/웰의 밀도로 분주하여 24시간 동안 배양하였다. 이어, FBS, 1% 페니실린 스트렙토마이신, 및 대식세포 집락자극인자(macrophage colony stimulating factor, M-CSF)가 첨가된 배지로 교체해준 후 함초 열수 추출물(10, 50 및 100 ug/ml) 및 에탄올 추출물(10, 50 및 100 ug/ml)을 2시간 동안 처리하였다. 이후 RANKL (Receptor activator of nuclear factor kappa-B ligand) 100 ng/ml을 처리하여 24시간 동안 반응시켰다. 위의 방법(배지교체, 함초추출물 처리, 및 RANKL 처리)을 반복하면서 세포를 6일 동안 분화시켰다.
이후 파골세포의 세포 화학적 표지효소인 TRAP (Tartrate resistance acid phosphatase)에 TRAP 염색키트(KAMIYA BIOMEDICAL COMPANY)의 발색성 기질을 첨가하여 핵을 염색을 하였다. 핵이 3개 이상으로 다핵화 된 세포를 관찰하고 이미지화 및 수치화 하였다.
대식세포는 RANK에 결합하여 TRAP 양성 세포로 분화하게 된다. TRAP 양성 세포에 RANKL, 또는 TNF-α와 같은 염증인자로 자극하면 세포끼리 융합되어 다핵형 TRAP 양성 세포로 분화된다.
도 1 및 2에서 확인할 수 있듯이, 본 실험에서 대식세포에 RANKL을 처리했을 때 파골세포로의 분화가 증가하였으며, 함초 열수 추출물 및 에탄올 추출물 처리에 의해서 파골세포의 수가 현저히 감소하였다. 상기 결과로서, 함초 열수 추출물 및 에탄올 추출물은 파골세포로의 분화를 억제시킴을 확인할 수 있었다.
2-2. 함초 열수 추출물의 파골세포 분화 유도 유전자 발현에 대한 억제 평가 (Real time PCR)
함초 열수 추출물을 마우스 대식세포에 처리하여 TRAP, DC-STAMP, Cathepsin K, NFATc1에 대한 유전자 발현(gene expression)을 Real-time PCR을 통해 확인하였다. BMDMs을 12 웰 플레이트(well plate)에 2x105/well의 밀도로 24h 동안 배양하고, 함초 열수 추출물이 포함된 배지를 2h 동안 처리해주었다. 이후 RANKL을 처리하여 분화를 유도하였다.
위와 같은 방법으로 3일 동안 분화시킨 후 TRIzol 용액을 이용하여 세포내 RNA를 분리하고, RNA 정량 값을 토대로 RT premix를 이용하여 cDNA를 합성하였다. 합성된 cDNA는 프라이머(primer)를 이용하여 Real time PCR을 통해 증폭시켰다.
사용된 프라이머는 하기 표 1과 같으며, Mouse TRAP, DC-STAMP, Cathepsin K, NFATc1이고 대조군(Control) 유전자인 GAPDH와 비교하여 상대적 양을 비교하였다.
서열번호 명칭 서열 (5'-3')
1 TRAP 정방향 프라이머 CTGGAGTGCACGATGCCAGCGACA
2 TRAP 역방향 프라이머 TCCGTGCTCGGCGATGGACCAGA
3 DC-STAMP 정방향 프라이머 CCAAGGAGTCGTCCATGATT
4 DC-STAMP 역방향 프라이머 GGCTGCTTTGATCGTTTCTC
5 Cathepsin K 정방향 프라이머 GGCCAACTCAAGAAGAAAAC
6 Cathepsin K 역방향 프라이머 GTGCTTGCTTCCCTTCTGG
7 NFATc1 정방향 프라이머 CTCGAAAGACAGTGGAGCAT
8 NFATc1 역방향 프라이머 CGGCTGCCTTCCGTCTCATAG
대식세포에 RANKL을 처리하면 RANK에 결합하여 TRAP 양성인 다핵화된 파골세포로 분화된다. 또한 파골세포로 분화하는데 중요한 전사 인자인 NFATc1을 활성화 시키고 파골세포분화기전 (osteoclastogenesis)에 관여하는 TRAP, Cathepsine K, DC-STAMP의 발현을 증가시킨다.
도 3과 표 2에서 확인할 수 있듯이, RANKL 처리에 의하여 증가된 TRAP, Cathepsin K, DC-STAMP, NFATc1의 발현은 함초 열수 추출물의 처리에 의해서 감소하였다.
RANKL - - + +
함초 열수 추출물(SHW) - + - +
TRAP 1 6.3 471 55
Cathepsin K 1 4 3465 443
DC-STAMP 1 1 308 85
NFATc1 1 1 15 3
이로부터 상기 추출물이 전사인자인 NFATc1의 활성을 감소시키고, 파골세포분화기전 관련 유전자인 TRAP, DC-STAMP, Cathepsin K의 발현을 감소시킴으로써, 파골세포로의 분화를 억제시킴을 확인할 수 있었다.
2-3. 함초 열수 추출물의 난소 절제술을 이용한 골다공증 유도 동물모델에 대한 골밀도 감소 억제 효과 평가
실험동물로는 C57BL/6 계 암컷 7주령을 사용하였다. 온도 22±2℃, 상대습도 50±10%, 12시간 명암 주기로 설정된 환경의 플라스틱 케이지에서 사육하였다. 골다공증유발을 위한 난소 절제 이전에 동일 환경에서 약 1주 정도 사육 조건에 적응시켰다.
졸레틸(Zoletil)과 럼펀(lumpun)을 근육 주사하여 마취한 후 난소 수술부위를 제모하고 소독하였다. 수술부위를 1 cm 가량 절개하고 다른 장기에 손상이 가해지지 않도록 주의하여 자궁을 따라 난소를 확인한 후 봉합용 실로 난소를 결찰한 뒤 양측의 난소를 모두 절제하였다. 난소 절제 후 각 장기를 복강 내로 재위치 시킨 뒤 봉합용 실로 봉합하였다.
실험동물 그룹은 회복된 마우스를 무작위로 나눈 후 매일 경구투여 실시하는 것으로 설정하였다(군(Group) = G1; Sham / G2; OVX / G3; OVX + 함초 열수 추출물 200 mg/kg / G4; OVX + 함초 열수 추출물 400 mg/kg). 12주 후 부검을 실시하였고, 실험 종료 시점의 최종 체중을 측정하였다.
표 3 및 도 4에서 확인할 수 있듯이, OVX 수술로 인해 G2 OVX 그룹의 체중이 G1 Sham 그룹보다 유의적으로 증가하는 것으로 확인되었다. 하지만 함초 열수 추출물 400 mg/kg을 먹인 그룹에서는 G2 OVX 그룹보다 유의적으로 체중이 감소되는 것을 확인하였다. 함초 열수 추출물을 200 mg/kg 먹인 그룹에서는 G2 OVX 그룹보다 체중이 감소되는 경향이 보이나 유의적인 차이는 아니었다.
그룹 G1 G2 G3 G4
체중(kg) 25 28.8 27.8 24.7
난소 절제에 의하여 호르몬이 결핍된 마우스(OVX)로부터 갱년기 여성에게서 나타날 수 있는 체중 증가 현상이 관찰되었고, 함초 추출물을 경구투여함에 따라 회복하는 것을 확인하였다. 이로부터 호르몬 결핍에 의해 유발되는 성인질병에 대하여 함초 추출물이 치료 또는 개선의 효과가 있는 것으로 볼 수 있었다.
골밀도 측정은 이전의 단순 방사선 사진 촬영법이나 컴퓨터 단층 촬영법에 비해 고해상도 영상자료를 제공하는 마이크로 CT (micro computed tomography)를 이용하여 BMD(Bone mineral density), BV/TV(Bone volume/tissue volume), Tb.Th(Trabecular thickness) 그리고 Tb.N(Trabecular number)을 정량화하여 분석하였다.
마이크로 CT는 시편이 0.9º씩 회전하여 180º까지 200회를 촬영하게 되는데 0.9º씩 회전하는 동안의 X선속 노출 시간은 5.9초이며, 획득된 파일은 마이크로 CT 재구성 프로그램(NRecon; SkyScan, Aartselaar, Belgium)을 이용해 횡단면 영상을 재구성한 다음 마이크로 CT 영상 프로그램(Data Viewer; SkyScan, Aartselaar, Belgium)을 이용하여 영상을 재형성하여 얻었다
표 4 및 도 5에서 확인할 수 있듯이, G2 OVX 그룹에서 골 밀도와 관련된 모든 지표들이 G1 Sham 그룹보다 유의적으로 감소되었음을 확인하였다. 반면, 함초 열수 추출물을 농도별로 먹인 두 그룹 G3, G4 그룹에서는 G2 그룹보다 유의적으로 증가됨을 확인하였고 이는 난소 절제수술로 유도된 골밀도 감소에 대해 함초 열수 추출물 섭취로 인해 예방됨을 확인하였다.
그룹 G1 G2 G3 G4
BMD 0.113 0.045 0.06 0.06
BV/TV 14 0.3175 2.402 3.045
Tb.Th 91.738 54.215 69.84 77.622
Tb.N 0.001517 0.000055 0.000318 0.000403
2-4. 함초 열수 추출물의 난소 절제술을 이용한 골다공증 유도 동물모델에 대한 혈중 생화학적 검사
생화학적지표 분석(serum)을 위해서는 OVX 그룹으로부터 실험 종료 후 부검 시 혈액을 수집하고, 수집된 혈액은 8000 rpm 20 min에서 원심분리하여 혈청을 분리하여 준비하였다. 혈청에서 T-col(total cholesterol), TG(triglyceride), HDL-C(high density lipoprotein), LDL-C(low density lipoprotein)을 분석하였다.
표 5 및 도 6에서 확인할 수 있듯이, G2 OVX 그룹에서 성인질병과 관련된 지표인 LDL-C의 수치가 유의적으로 높았으나 함초 추출물 섭취에 의해 감소되는 것을 확인하였다. 이는 난소 절제수술로 증가된 LDL-C의 수치는 함초 열수 추출물 섭취로 인해 예방됨을 확인하였다.
그룹 G1 G2 G3 G4
T-col 81 106.8 106.25 91.66
TG 106.4 110 106.5 90
HDL-C 60.72 80.98 79.55 67.56
LDL-C 11.3 16.38 14.425 10.4
난소 절제에 의하여 호르몬이 결핍된 마우스(OVX)로부터 갱년기 여성에게서 나타날 수 있는 혈액 지표상의 유의적인 변화가 관찰되었고, 함초 추출물을 경구투여함에 따라 회복하는 것을 확인하였다. 이로부터 호르몬 결핍에 의해 유발되는 성인질병에 대하여 함초 추출물이 치료 또는 개선의 효과가 있는 것으로 볼 수 있었다.
본 발명은 함초 추출물을 포함하는 골 질환 또는 갱년기 질환의 예방, 치료 또는 개선용 조성물에 관한 것이다.

Claims (10)

  1. 함초(Salicornia spp.) 추출물을 포함하는 골 질환 예방 또는 치료용 약제학적 조성물.
  2. 함초(Salicornia spp.) 추출물을 포함하는 골 질환 예방 또는 개선용 식품 조성물.
  3. 제1항 또는 제2항에 있어서, 상기 함초 추출물은 물 및 탄소수 1 내지 3의 저급알코올로 이루어진 군으로부터 선택되는 1종 이상의 용매로 추출된 것인, 조성물.
  4. 제1항 또는 제2항에 있어서, 상기 함초는 살리코르니아 헤르바세아(Salicornia herbacea), 살리코르니아 유로파에아(Salicornia europaea), 살리코르니아 페렌난스(Salicornia perennans), 살리코르니아 프로쿰벤스(Salicornia procumbens), 살리코르니아 마리티마(Salicornia maritima), 살리코르니아 비겔로비(Salicornia bigelovii), 살리코르니아 데프레사(Salicornia depressa), 살리코르니아 루브라(Salicornia rubra), 살리코르니아 프라에콕스(Salicornia praecox), 살리코르니아 세네갈렌시스(Salicornia senegalensis), 살리코르니아 페리에리(Salicornia perrieri), 살리코르니아 파키스타키야(Salicornia pachystachya), 살리코르니아 메예리아나(Salicornia meyeriana), 살리코르니아 유니플로라(Salicornia uniflora) 및 살리코르니아 브라키아타(Salicornia brachiate)로 이루어진 군으로부터 선택되는 1종 이상인 것인, 조성물.
  5. 제1항 또는 제2항에 있어서, 상기 골 질환은 골다공증(osteoporosis), 골연화증(osteomalacia), 골관절염(osteoarthritis), 파제트병(Paget's disease), 섬유성 골염(fibrous ostitis), 무형성 골질환(adynamic bone disease), 대사성 골질환(metabolic bone disease, MBD), 암세포의 골전이에 의한 뼈의 손상, 치주질환(periodontal disease), 골절, 골감소증 및 골형성 부전증(osteogenesis imperfect)으로 이루어진 군으로부터 선택되는 1종 이상인 것인, 조성물.
  6. 함초(Salicornia spp.) 추출물을 포함하는 갱년기 질환 예방 또는 치료용 약제학적 조성물.
  7. 함초(Salicornia spp.) 추출물을 포함하는 갱년기 질환 예방 또는 개선용 식품 조성물.
  8. 제6항 또는 제7항에 있어서, 상기 함초 추출물은 물 및 탄소수 1 내지 3의 저급알코올로 이루어진 군으로부터 선택되는 1종 이상의 용매로 추출된 것인, 조성물.
  9. 제6항 또는 제7항에 있어서, 상기 함초는 살리코르니아 헤르바세아(Salicornia herbacea), 살리코르니아 유로파에아(Salicornia europaea), 살리코르니아 페렌난스(Salicornia perennans), 살리코르니아 프로쿰벤스(Salicornia procumbens), 살리코르니아 마리티마(Salicornia maritima), 살리코르니아 비겔로비(Salicornia bigelovii), 살리코르니아 데프레사(Salicornia depressa), 살리코르니아 루브라(Salicornia rubra), 살리코르니아 프라에콕스(Salicornia praecox), 살리코르니아 세네갈렌시스(Salicornia senegalensis), 살리코르니아 페리에리(Salicornia perrieri), 살리코르니아 파키스타키야(Salicornia pachystachya), 살리코르니아 메예리아나(Salicornia meyeriana), 살리코르니아 유니플로라(Salicornia uniflora) 및 살리코르니아 브라키아타(Salicornia brachiate)로 이루어진 군으로부터 선택되는 1종 이상인 것인, 조성물.
  10. 제6항 또는 제7항에 있어서, 상기 갱년기 질환은 골다공증(osteoporosis), 체중 증가, 갱년기성 심혈관계 질환, 복부 비만, 지방간, 안면홍조, 발한, 피부건조, 질건조증, 질위축, 하부 요도 위축, 질염, 방광염, 배뇨통, 급뇨, 집중장애, 단기 기억장애, 불안, 신경과민, 기억력 감퇴, 근육통 및 관절통으로 이루어진 군으로부터 선택되는 1종 이상인 것인, 조성물.
PCT/KR2019/018359 2018-12-26 2019-12-24 함초 추출물을 포함하는 골 질환 또는 갱년기 질환의 예방 또는 치료용 조성물 Ceased WO2020138899A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20180169399 2018-12-26
KR10-2018-0169399 2018-12-26
KR1020190154822A KR20200080138A (ko) 2018-12-26 2019-11-27 함초 추출물을 포함하는 골 질환 또는 갱년기 질환의 예방 또는 치료용 조성물
KR10-2019-0154822 2019-11-27

Publications (1)

Publication Number Publication Date
WO2020138899A1 true WO2020138899A1 (ko) 2020-07-02

Family

ID=71129205

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/018359 Ceased WO2020138899A1 (ko) 2018-12-26 2019-12-24 함초 추출물을 포함하는 골 질환 또는 갱년기 질환의 예방 또는 치료용 조성물

Country Status (1)

Country Link
WO (1) WO2020138899A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20030005129A (ko) * 2002-12-13 2003-01-15 이종선 함초,오가피를 주제로 한 건강식품
WO2004035073A1 (en) * 2002-10-16 2004-04-29 Good Bio Ltd Composition for treating myeloid leukemia and increasing immunity comprising salicornia herbacea extracts
KR20180017755A (ko) * 2016-08-10 2018-02-21 안동대학교 산학협력단 함초 씨 추출물을 유효성분으로 함유하는 혈전증의 예방 또는 치료용 약학적 조성물 및 건강 기능 식품

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004035073A1 (en) * 2002-10-16 2004-04-29 Good Bio Ltd Composition for treating myeloid leukemia and increasing immunity comprising salicornia herbacea extracts
KR20030005129A (ko) * 2002-12-13 2003-01-15 이종선 함초,오가피를 주제로 한 건강식품
KR20180017755A (ko) * 2016-08-10 2018-02-21 안동대학교 산학협력단 함초 씨 추출물을 유효성분으로 함유하는 혈전증의 예방 또는 치료용 약학적 조성물 및 건강 기능 식품

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
KARADENIZ, F. ET AL.: "Effect of Salicomia herbacea on Osteoblastogenesis and Adipogenesis in Vitro", MARINE DRUGS, vol. 12, 2014, pages 5132 - 5147, XP055724363 *
KONG, C.-S. ET AL.: "Protective Effects of Salicornia herbacea on Osteoporosis and Adipogenesis", THE KOREAN SOCIETY FOR BIOTECHNOLOGY AND BIOENGINEERING CONFERENCE, 2013, pages 282 *

Similar Documents

Publication Publication Date Title
Osigwe et al. Apigenin: A methanol fraction component of Newbouldia laevis leaf, as a potential antidiabetic agent
KR102271821B1 (ko) 오를리스타트 및 아커만시아 뮤시니필라 eb-amdk19 균주를 포함하는 조성물
JP5038310B2 (ja) 骨疾患の予防及び／又は治療用医薬組成物、その組成物を含有する機能性食品もしくは健康食品、並びにその組成物を有効成分とする医薬製剤
KR102629635B1 (ko) 신규한 비피도박테리움 롱검 균주 및 이의 용도
JP6062065B2 (ja) 過敏性腸症候群を治療するためのアルピニア種抽出物
WO2017183902A1 (ko) 인진, 지유 및 울금 추출물 및 항바이러스제를 유효성분으로 포함하는 간질환 예방 또는 치료용 조성물
KR20140108621A (ko) 돌외의 지페노사이드 추출물을 포함하는 제2형 당뇨병, 비만 또는 고지혈증의 치료 또는 예방용 조성물
KR102210501B1 (ko) 근육질환 예방 또는 치료용 조성물
KR20210133909A (ko) 함초 추출물을 포함하는 골 질환 또는 갱년기 질환의 예방 또는 치료용 조성물
JP5166272B2 (ja) ヤマノイモ科植物の抽出物、及びこれを含む末梢神経障害の予防用または治療用の組成物
KR101485705B1 (ko) 향부자 추출물로부터 분리된 세스퀴테르페노이드계 화합물을 함유하는, 갱년기 질환의 예방 또는 치료용 조성물
KR102566433B1 (ko) 커피 실버스킨 추출물, 이의 분획물 또는 이로부터 분리된 화합물을 포함하는 근육질환의 예방 또는 치료용 조성물
CA2875908C (en) Extracts from mother-of-thyme and the use thereof
WO2020138899A1 (ko) 함초 추출물을 포함하는 골 질환 또는 갱년기 질환의 예방 또는 치료용 조성물
KR101621446B1 (ko) 감수 추출물 또는 이의 분획물을 함유하는 갑상선 질환의 예방 또는 치료용 조성물
WO2021040416A1 (ko) 비쑥 추출물을 유효성분으로 포함하는 골대사성 질환으로 유발된 골소실 예방 또는 치료용 약제학적 조성물
TWI438001B (zh) 用於治療糖尿病之植物萃取物及其製備方法
WO2016093613A2 (ko) 진피 추출물을 포함하는 이상 체중 감소 증상의 예방 또는 치료용 조성물
WO2018030650A1 (ko) 국화잎 추출물을 유효성분으로 포함하는 항비만 조성물
WO2019004626A1 (ko) 생약재 추출물을 유효성분으로 포함하는 폐경기 증후군의 예방 또는 치료용 조성물
WO2022098192A1 (ko) 한약복합추출물을 포함하는 악액질 예방 또는 치료용 조성물
KR20220136604A (ko) 배암차즈기 추출물 또는 이의 유래 화합물을 유효성분으로 포함하는 근위축 예방 또는 치료용 약학적 조성물
WO2021085741A1 (ko) 번행초를 유효성분으로 포함하는 알츠하이머성 치매 개선 또는 치료용 조성물
KR101655554B1 (ko) 택사 추출물, 이의 분획물 또는 이로부터 분리된 화합물을 포함하는 골질환의 예방 또는 치료용 약학적 조성물
KR100703596B1 (ko) 연수추출물 또는 그로부터 분리한캠프페롤-3-글루쿠로나이드를 함유하는 고지혈증의 예방 및치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19904883

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19904883

Country of ref document: EP

Kind code of ref document: A1