WO2020116962A1 - 작약 추출물의 유산균 발효물을 유효성분으로 포함하는 당뇨병의 예방, 개선 또는 치료용 조성물 - Google Patents

작약 추출물의 유산균 발효물을 유효성분으로 포함하는 당뇨병의 예방, 개선 또는 치료용 조성물 Download PDF

Info

Publication number
WO2020116962A1
WO2020116962A1 PCT/KR2019/017107 KR2019017107W WO2020116962A1 WO 2020116962 A1 WO2020116962 A1 WO 2020116962A1 KR 2019017107 W KR2019017107 W KR 2019017107W WO 2020116962 A1 WO2020116962 A1 WO 2020116962A1
Authority
WO
WIPO (PCT)
Prior art keywords
lactic acid
acid bacteria
diabetes
extract
peony
Prior art date
Application number
PCT/KR2019/017107
Other languages
English (en)
French (fr)
Inventor
김창진
김춘식
이종민
오세량
박동진
김문옥
박미리
강동효
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Publication of WO2020116962A1 publication Critical patent/WO2020116962A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/65—Paeoniaceae (Peony family), e.g. Chinese peony
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105—Plant extracts, their artificial duplicates or their derivatives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/328—Foods, ingredients or supplements having a functional effect on health having effect on glycaemic control and diabetes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
    • A61K2236/10—Preparation or pretreatment of starting material
    • A61K2236/19—Preparation or pretreatment of starting material involving fermentation using yeast, bacteria or both; enzymatic treatment

Definitions

  • the present invention relates to a composition for preventing, improving, or treating diabetes comprising lactic acid bacteria fermentation product of peony extract as an active ingredient, and more specifically, preventing or treating diabetes comprising lactic acid bacteria fermentation product of peony extract as an active ingredient.
  • Diabetes mellitus is a type of metabolic disease in which insulin secretion is insufficient or normal function is not achieved, and is characterized by high blood glucose concentration.
  • Type 2 diabetes which is relatively insufficiency of insulin, is characterized by insulin resistance (the inability of cells to effectively burn glucose due to poor insulin function to lower blood sugar).
  • insulin resistance the inability of cells to effectively burn glucose due to poor insulin function to lower blood sugar.
  • type 2 diabetes seems to have a significant effect on environmental factors such as high calorie, high fat, high protein diet, lack of exercise, and stress due to westernization of diet, diabetes may occur due to defects in certain genes, pancreatic surgery, It can also be caused by infection or medication. In weak hyperglycemia, it is difficult for most patients to perceive symptoms as diabetes because they do not feel symptoms or are ambiguous.
  • type 1 diabetes insulin treatment is necessary, and the most effective treatment of type 2 diabetes is to achieve the optimal blood sugar level for the number of meals.
  • type 2 diabetes delayed absorption of monosaccharides through inhibition of ⁇ -glucosidase activity has been suggested as a beneficial strategy for the treatment of type 2 diabetes.
  • peony Paeonia lactiflora
  • peony is a perennial plant of the buttercup family, which grows mainly in the foothills or valleys.
  • stems stand up straight from one aeration, about 60cm high, without hair on leaves and stems.
  • Flowers bloom from May to June at the end of the stem, which is large and beautiful, and is cultivated about 10 cm in diameter.
  • the flower color varies from red to white, and there are many horticultural varieties.
  • the roots are used for medicines such as pain relief, abdominal pain, menstrual pain, amenorrhea, hemolysis, anemia, and bruises.
  • the peony root when used as a drug, it can be divided into red peony and count peony according to the pre-processing method.
  • the red peony is dried by removing the roots of the beard, and the county is removed by removing the roots of the beard and boiled in boiling water, then removing the skin or boiled and dried again.
  • Korean Patent Publication No. 2016-0006812 discloses'a composition for preventing and treating diabetes including peony extract', and paeoniflorin is known as an indicator of peony or peony extract, but their diabetes There was a limitation that was not sufficient to exhibit a physiologically effective effect of the related activity.
  • the present inventors were studying to find an effective method for the treatment of diabetes by metabolizing or improving peony extract, and when fermenting the peony extract with Leuconostoc sp. LN180020 (KCTC 13719BP) isolated from kimchi Oniflorin was converted to another substance, and the present invention was completed by confirming that the anti-diabetic activity of the lactic acid bacteria fermentation product of the peony extract containing it was significantly improved compared to that of other lactic acid bacteria.
  • LN180020 KCTC 13719BP
  • an object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of diabetes, including the lactic acid bacteria fermentation product of the peony ( Paeonia lactiflora ) extract as an active ingredient.
  • compositions for the prevention or treatment of diabetes consisting of lactic acid bacteria fermentation product of the peony ( Paeonia lactiflora ) extract as an active ingredient.
  • compositions for preventing or treating diabetes consisting essentially of an lactic acid bacteria fermentation product of Paeonia lactiflora extract as an active ingredient.
  • Another object of the present invention is to provide a food composition for preventing or improving diabetes, which includes the lactic acid bacteria fermentation product of the peony extract as an active ingredient.
  • a food composition for preventing or improving diabetes consisting of an lactic acid bacteria fermentation product of a peony extract as an active ingredient.
  • a food composition for preventing or improving diabetes consisting essentially of the lactic acid bacteria fermentation product of peony extract as an active ingredient.
  • Another object of the present invention (a) injecting a lactic acid bacteria in the genus Leuconostoc sp. And (b) to provide a method for converting the peony florin in peony or peony extract comprising the step of culturing and fermenting the product of step (a).
  • Another object of the present invention is to provide a use of a composition comprising a lactic acid bacteria fermentation product of a peony (Paeonia lactiflora) extract for preparing a therapeutic agent for diabetes as an active ingredient.
  • a composition comprising a lactic acid bacteria fermentation product of a peony (Paeonia lactiflora) extract for preparing a therapeutic agent for diabetes as an active ingredient.
  • Another object of the present invention is to provide a method of treating diabetes comprising administering to a subject in need thereof an effective amount of a composition comprising a lactic acid bacteria fermentation product of a peony (Paeonia lactiflora) extract as an active ingredient.
  • a composition comprising a lactic acid bacteria fermentation product of a peony (Paeonia lactiflora) extract as an active ingredient.
  • the present invention provides a pharmaceutical composition for the prevention or treatment of diabetes, including the lactic acid bacteria fermentation product of peony extract as an active ingredient.
  • the present invention provides a pharmaceutical composition for the prevention or treatment of diabetes consisting of lactic acid bacteria fermentation product of peony extract as an active ingredient.
  • the present invention provides a pharmaceutical composition for preventing or treating diabetes consisting essentially of an lactic acid bacteria fermentation product of a peony extract as an active ingredient.
  • the present invention provides a food composition for preventing or improving diabetes, including the lactic acid bacteria fermentation product of the peony extract as an active ingredient.
  • the present invention provides a food composition for preventing or improving diabetes consisting of an lactic acid bacteria fermentation product of a peony extract as an active ingredient.
  • the present invention provides a food composition for preventing or improving diabetes consisting essentially of an lactic acid bacteria fermentation product of a peony extract as an active ingredient.
  • the present invention comprises the steps of (a) inoculating a composition containing peoniflorin Leuconostoc sp. lactic acid bacteria; And (b) provides a method of converting the peony florin in peony or peony extract comprising the step of culturing and fermenting the obtained product of step (a).
  • the present invention provides the use of a composition comprising a lactic acid bacteria fermentation product of a peony (Paeonia lactiflora) extract as an active ingredient for preparing a preparation for the treatment of diabetes.
  • a composition comprising a lactic acid bacteria fermentation product of a peony (Paeonia lactiflora) extract as an active ingredient for preparing a preparation for the treatment of diabetes.
  • the present invention provides a method of treating diabetes comprising administering to a subject in need thereof an effective amount of a composition comprising a lactic acid bacteria fermentation product of a Paeonia lactiflora extract as an active ingredient.
  • the present invention provides a pharmaceutical composition for the prevention or treatment of diabetes, including the fermentation product of lactic acid bacteria of peony extract as an active ingredient.
  • peony' refers to the root of a plant having the scientific name Paeonia lactiflora , preferably the root of Paeonia lactiflora used as a medicinal material.
  • Peony as a medicinal herb is also called Paeoniae Radix or Peony root, and more specifically, it represents the root of the peony Paeonia lactiflora Pallas or other related plants (peony and Paeoniaceae) used as medicinal sites.
  • Peony extract may be extracted by a solvent extraction method known in the art.
  • the extraction solvent is not limited thereto, but water, a lower alcohol having 1 to 6 carbon atoms (C1) to 6 (C6), an organic solvent, or a mixed solvent thereof may be used.
  • the lower alcohol having 1 to 6 carbon atoms (C1) (C6) is not limited thereto, but may be methanol, ethanol, alcohol, propanol, isopropanol, butanol, pentanol, hexanol, and the organic solvent is not limited thereto.
  • the alcohol may be a form in which a small amount of water (for example, 95% ethanol, 99% ethanol) is added to reflect physicochemical properties such as hygroscopicity.
  • the extraction temperature and time are not particularly limited as long as the purpose of extraction of the active ingredient is achieved, but can be extracted for 10 minutes to 12 hours at 30°C to 121°C. It may also be extracted by pressing to facilitate extraction of the active ingredient during extraction. Meanwhile, the extraction may be performed by supercritical extraction or subcritical extraction using an appropriate solvent such as carbon dioxide.
  • treatment' or'improvement' refers to suppressing the occurrence or recurrence of a disease, alleviating symptoms, reducing the direct or indirect pathological consequences of the disease, reducing the rate of disease progression, improving, improving, alleviating, or improving the disease state. Means prognosis.
  • prevention' used in the present invention means all actions that suppress the onset of disease or delay the progression.
  • diabetes which is the target of treatment or prevention, is a metabolic disorder syndrome characterized by hyperglycemia caused by defects in insulin hormone deficiency or insulin resistance, which are produced in the beta cells of the pancreas, and both.
  • diabetes can be divided into insulin-dependent diabetes (IDDM, Type 1) and insulin-independent diabetes (NIDDM, Type 2) caused by insulin resistance and insulin secretion damage.
  • IDDM insulin-dependent diabetes
  • NIDDM insulin-independent diabetes
  • Type 2 diabetes various complications such as heart disease, intestinal disease, ophthalmic disease, neurological disease, stroke, etc. occur, which cause chronic neurological disease and cardiovascular disease due to elevated blood sugar and insulin levels over a long period of time. And short-term hypoglycemia and hyperglycemia reactions that cause acute complications.
  • Diabetes mellitus causes chronic and persistent hyperglycemia, as well as lipid and protein metabolism disorders.
  • the condition is diverse and is directly attributed to hyperglycemia, including diabetic peripheral neuropathy, diabetic retinopathy, diabetic nephropathy, diabetic cataract, keratosis, diabetic arteriosclerosis in the retina, kidney, nerve, cardiovascular system, and the like.
  • the diabetes in the present invention includes diabetes or diabetes complications due to diabetes, and more specifically, may be type 1 diabetes, type 2 diabetes, or gestational diabetes.
  • diabetic complications it may be a disease caused by the destruction or deterioration of Langerhans islet cells, and a disease caused by an increase in blood glucose concentration, but is not limited thereto, but is not limited to, diabetic peripheral neuropathy, diabetic retinopathy, diabetic nephropathy, Diabetic cataract, keratosis, diabetic arteriosclerosis.
  • the'lactic acid bacteria' may be Leuconostoc citreum or Leuconostoc sp. LN180020 having a deposit number of KCTC 13719BP, preferably Leuconostoc of a deposit number of KCTC 13719BP. ( Leuconostoc sp.) LN180020.
  • The'lactic acid bacteria' is characterized by having a bioconversion ability to convert the paniflorine.
  • lactic acid bacteria derived from kimchi were isolated to search for useful lactic acid bacteria.
  • Lactobacillus genus Lactobacillus
  • Petit O Rhodococcus genus Pediococcus
  • Wei Cellar in Wei Cellar in
  • flow Pocono stock in Leuconostoc
  • 39 kinds (species) contained in the Enterococcus genus Enterococcus
  • the isolated lactic acid bacteria strain was inoculated into a peony hot water extract and fermented to prepare a lactic acid bacteria fermentation product of the peony extract, and a strain in which the paeoniflorin was bioconverted was explored. As a result, it was confirmed that the peak of about 15 minutes, which is expected to be peoniflorin specifically in one of the isolated strains, decreases, and that the peak of the new material increases at 14.2 minutes.
  • This strain was identified and named Leuconostoc sp. LN180020 strain, and deposited with the Korea Resource Center (KCTC) as of November 20, 2018 (Accession No.: KCTC 13719BP).
  • KCTC Korea Resource Center
  • the fermentation product of LN180020 in the genus Leuconostok has anti-diabetic activity through cytotoxicity and the ability to absorb glucose from myocytes, and whether this anti-diabetic activity is also caused by fermentation of other lactic acid bacteria.
  • the cytotoxicity did not appear in the fermented product of lactic acid bacteria, only the fermented product of LN180020 in Leuconostock showed anti-diabetic activity.
  • the fermentation product of LN180020 in the Leuconostock of the present invention functions to increase glucose absorption into muscle cells, which has anti-diabetic activity.
  • the pharmaceutical composition according to the present invention may be variously formulated according to the route of administration by a method known in the art with a pharmaceutically acceptable carrier for the treatment of diabetes.
  • the carrier includes all kinds of solvents, dispersion media, oil-in-water or water-in-oil emulsions, aqueous compositions, liposomes, microbeads, and microsomes.
  • the pharmaceutical composition according to the present invention may be administered to a patient in a pharmaceutically effective amount, that is, an amount sufficient to prevent or alleviate symptoms and treat diabetes.
  • a typical daily dosage may be administered in the range of about 0.01 to 1000 mg/kg, preferably, in the range of about 1 to 100 mg/kg.
  • the pharmaceutical composition of the present invention may be administered once or several times within a preferred dosage range.
  • the dosage of the pharmaceutical composition according to the present invention can be appropriately selected by a person skilled in the art according to the administration route, administration target, age, sex weight, individual difference, and disease state.
  • the route of administration may be administered orally or parenterally.
  • the parenteral administration method is not limited to this, but is not limited to intravenous, intramuscular, arterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, sublingual, rectal, or pancreatic. It may be intra-administration, but is not limited thereto, and most preferably, may be administered orally.
  • suitable oral administration carrier include sugars including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol, and starches including corn starch, wheat starch, rice starch and potato starch, cellulose, etc.
  • Fillers such as cellulose, gelatin, polyvinylpyrrolidone, and the like may be included, including methyl cellulose, sodium carboxymethyl cellulose, and hydroxypropyl methyl cellulose.
  • cross-linked polyvinylpyrrolidone, agar, alginic acid or sodium alginate may be added as a disintegrant.
  • the pharmaceutical composition may further include an anti-coagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent and a preservative.
  • composition of the present invention when administered parenterally, may be formulated according to methods known in the art in the form of injections, transdermal administrations, and nasal inhalants, together with suitable parenteral carriers.
  • the pharmaceutical composition can be administered by any device capable of transporting the active substance to target cells.
  • Preferred modes of administration and preparations are intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, or drip injections.
  • injectables include aqueous solvents such as physiological saline solutions or ring gel solutions, vegetable oils, higher fatty acid esters (e.g., oleic acid, etc.), and non-aqueous solvents such as alcohols (e.g., ethanol, benzyl alcohol, propylene glycol or glycerin).
  • Stabilizer to prevent deterioration e.g., ascorbic acid, sodium hydrogen sulfite, sodium pyrosulfite, BHA, tocopherol, EDTA, etc.
  • emulsifier e.g., buffer for pH adjustment, to prevent microbial growth
  • a pharmaceutical carrier such as a preservative (eg, phenyl mercuric nitrate, chimerosal, benzalkonium chloride, phenol, cresol, benzyl alcohol, etc.).
  • suitable carriers include, but are not limited to, solvents or dispersion media including water, ethanol, polyols (eg, glycerol, propylene glycol and liquid polyethylene glycol, etc.), mixtures thereof and/or vegetable oils.
  • suitable carriers include Hanks' solution, Ringer's solution, phosphate buffered saline (PBS) with triethanol amine or sterile water for injection, isotonic solutions such as 10% ethanol, 40% propylene glycol and 5% dextrose. Etc. can be used.
  • the injection may additionally include an isotonic agent such as sugar or sodium chloride in most cases.
  • compositions according to the invention may include one or more buffers (e.g. saline or PBS), carbohydrates (e.g. glucose, mannose, sucrose or dextran), antioxidants, bacteriostatic agents, chelating agents (e.g. For example, EDTA or glutathione), adjuvants (eg, aluminum hydroxide), suspending agents, thickening agents and/or preservatives may be further included.
  • buffers e.g. saline or PBS
  • carbohydrates e.g. glucose, mannose, sucrose or dextran
  • antioxidants e.g. glucose, mannose, sucrose or dextran
  • bacteriostatic agents e.g. For example, EDTA or glutathione
  • adjuvants e.g. aluminum hydroxide
  • suspending agents e.g. aluminum hydroxide
  • thickening agents and/or preservatives may be further included.
  • composition of the present invention can be formulated using methods known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal.
  • composition of the present invention may be administered alone or in combination with a known compound having an effect of treating diabetes.
  • the present invention provides a food composition for preventing or improving diabetes, which contains the fermented lactic acid bacteria of the peony extract as an active ingredient.
  • the food composition of the present invention includes all forms of functional food, nutritional supplement, health food, and food additives.
  • Food compositions of this type can be prepared in various forms according to conventional methods known in the art.
  • lactic acid bacteria fermentation products of peony extract may be prepared in the form of tea, juice, and drink, and liquefied, granulated, encapsulated, and powdered to be consumed.
  • it can be prepared in the form of a composition by mixing with the lactic acid bacteria fermentation of the peony extract and a known active ingredient known to be effective in diabetes.
  • functional foods include, but are not limited to, beverages (including alcoholic beverages), fruits and processed foods thereof (e.g. canned fruits, canned fruits, jams, marmalades, etc.), fish, meat, and processed foods thereof (e.g.
  • lactic acid bacteria fermentation product of peony extract to protein, retort food, frozen food, various seasonings (eg, miso, soy sauce, sauce, etc.).
  • lactic acid bacteria fermentation product of the peony extract in the form of an additive, it may be prepared and used in the form of a powder or a concentrate.
  • the preferred content of the fermentation product of lactic acid bacteria in the peony extract in the food composition of the present invention is not limited to this, but is preferably 0.1 to 90% by weight in the final manufactured food. More preferably, the food composition containing the lactic acid bacteria fermentation product of the peony extract of the present invention as an active ingredient, in particular, can be prepared in the form of a health functional food or dietary supplement by mixing with an active ingredient known to be effective in diabetes. have.
  • the health functional food composition for preventing or improving diabetes of the present invention contains lactic acid bacteria fermentation product of a peony extract that promotes glucose absorption into muscle cells as an active ingredient, and is excellent in preventing or improving diabetes. do.
  • LN180020 lactobacillus in Leuconostock was identified through 16S rRNA sequencing, and a new substance that showed an increase in anti-diabetic activity was attempted.
  • LN180020 lactic acid bacteria in the genus Leuconostoc showed the highest homology of the sequence of Leuconostoc citreum ( L. citreum ) and 16S rRNA. It was found that the bioconversion to a new useful ingredient material.
  • the present invention provides a method for converting paoniflorine in a composition comprising paoniflorine comprising the following steps:
  • step (B) step of culturing the obtained product of step (a) to ferment.
  • the composition containing paoniflorine may be an extract of a raw material containing paoniflorine, and preferably may be an extract of a peony or peony plant (Paeonia).
  • the composition comprising paoniflorine may be liquid.
  • Leukonostoc sp. lactic acid bacteria in the method for converting paoniflorin of the present invention preferably has Leukonostoc citreum or a deposit number KCTC having a bioconversion ability to convert paniflorine.
  • 13719BP Liu Kono stock in (Leuconostoc sp.) can be LN180020, and preferably the deposit number KCTC 13719BP Liu Kono stock in (Leuconostoc sp.) may be LN180020.
  • the amount of lactic acid bacteria to be inoculated can be added to the lactic acid bacteria strain of 1 x 10 8 to 1 x 10 11 to the composition itself or to a medium containing the composition, or to a culture medium of pre-cultured lactic acid bacteria at 1-5% (v/v).
  • Culture of step (b) after inoculation of lactic acid bacteria in the genus Leuconostock according to the present invention may be performed by a method for culturing lactic acid bacteria known in the art.
  • a medium composed of a carbon source, a nitrogen source, vitamins and minerals, or whey medium using milk components, skim milk medium, or the like can be used as the culture medium.
  • the medium for producing the culture of the present invention one or more selected from the group consisting of glucose, sucrose, maltose, fructose, lactose, xylose, galactose, arabinose, and combinations thereof, It is preferably one or more selected from the group consisting of sucrose, fructose, glucose, galactose, arabinose, and lactose, and more preferably glucose.
  • the nitrogen source in the medium for producing the culture of the present invention is one selected from the group consisting of yeast extract, soytone, peptone, beef extract, tryptone, casitone, and combinations thereof. It is the above, Preferably it is one or more selected from the group which consists of yeast extract, peptone, tryptone, and soytone, More preferably, it is a yeast extract or soytone.
  • the culture and fermentation of lactic acid bacteria may be performed according to milk-containing media and culture conditions known in the art. Those skilled in the art can be easily adjusted and used according to the selected strain. Various such methods have been disclosed in various literature (eg, James et al., Biochemical Engineering, Prentice-Hall International Editions). Depending on the cell growth method, the suspension culture and the adhesion culture can be used in batch, fed-batch, and continuous culture methods depending on the culture method.
  • the conversion of the paniflorine results in the conversion of the paniflorine to another active substance, resulting in a reduction of the paniflorine.
  • the present invention provides the use of a composition comprising a lactic acid bacteria fermentation product of a peony (Paeonia lactiflora) extract for preparing a therapeutic agent for diabetes as an active ingredient.
  • a composition comprising a lactic acid bacteria fermentation product of a peony (Paeonia lactiflora) extract for preparing a therapeutic agent for diabetes as an active ingredient.
  • the present invention provides a method of treating diabetes comprising administering to a subject in need thereof an effective amount of a composition comprising a lactic acid bacteria fermentation product of a Paeonia lactiflora extract as an active ingredient.
  • The'effective amount' of the present invention when administered to an individual, refers to an amount that improves, treats, prevents, detects, diagnoses, or suppresses or reduces diabetes mellitus, and the'individual' is an animal, preferably a mammal. In particular, it may be an animal including humans, and may be cells, tissues, organs, etc. derived from animals. The subject may be a patient in need of the effect.
  • The'treatment' of the present invention broadly refers to improving diabetes or symptoms of diabetes, which may include treating, substantially preventing, or improving the condition of diabetes, and one that results from the diabetes Alleviate, cure, or prevent symptoms or most symptoms, but are not limited thereto.
  • the term'comprising' of the present invention is used in the same way as'containing' or'as a feature', and does not exclude additional component elements or method steps not mentioned in the composition or method. .
  • the term'consisting of' means excluding additional elements, steps or ingredients, which are not described separately.
  • the term'consisting essentially of' means that in the scope of the composition or method, it includes the component elements or steps described, as well as component elements or steps that do not materially affect the basic properties thereof.
  • the peony extract lactic acid bacteria fermentation product of the present invention can effectively increase the glucose absorption rate by moving glucose to muscle cells, and there is no side effect on the human body using peony and kimchi-derived lactic acid bacteria derived from natural materials, thereby preventing and improving diabetes Or, it is expected to be useful in therapeutic foods and medicines.
  • FIG. 1A and 1B are HPLC chromatograms showing the content of an indicator substance and a new useful substance in a fermented lactic acid bacteria fermented (FIG. 1B) of a non-fermented peony extract (FIG. 1A) and a peony extract.
  • FIGS. 2A to 2D are results of confirming cell viability and relative glucose uptake of lactic acid bacteria fermentation products and non-fermented peony extracts of peony extract into muscle cells
  • FIGS. 2A and 2B show leukonostock Leuconostoc sp.LN180020 (KCTC 13719BP) is a result of treating a lactic acid bacteria fermentation product of a peony extract
  • FIGS. 2C and 2D show Lactobacillus plantarum subsp. plantarum (Df2) LN180155 or Lactobacillus paraplantarum ( Lactobacillus paraplantarum KACC 12373; Df3) is the result of treating the lactic acid bacteria fermentation product of the peony extract fermented. INS; Insulin (porcine insulin).
  • FIG. 3 is a schematic diagram of the analysis of the system of Leuconostoc sp. LN180020 (KCTC 13719BP).
  • Figure 4 is a non-fermented peony extract (non-fermented) and peony extract fermentation (fermented) of the peony extract, respectively, before and after bioconversion peony indicator material (paoniflorin, paeoniflorin) and bioconversion after separation and purification of LC-MS This is the result.
  • lactic acid bacteria derived from kimchi In order to separate vegetable lactic acid bacteria derived from kimchi, various samples of kimchi are diluted stepwise with sterile water, plated on MRS (Man Rogosa and Sharpe) medium, incubated at 28°C for 2 days, and then lactic acid bacteria are separated through morphological features. The isolated strains were identified through 16s rRNA sequence analysis and stored at -70°C using 20% glycerol.
  • Lactobacillus genus Lactobacillus
  • Petit O Rhodococcus genus Pediococcus
  • Wei Cellar in Wei Cellar in
  • flow Pocono stock in Leuconostoc
  • 39 kinds (species) contained in the Enterococcus genus Entererococcus Dog strains were isolated.
  • the peony extract, or one of the peony indicator components of the peony is known to have diabetes-related activity, but it was determined that the therapeutic activity of diabetes is not sufficient. I wanted to search.
  • LN180020 in the Leuconostock among the isolated strains specifically decreases the peak around 15 minutes, which is expected to be phonyflorin, and increases the peak of the new material at 14.2 minutes (see FIGS. 1A and 1B). .
  • the lactic acid bacteria fermentation product of the peony extract in mouse L6 myotube was treated by concentration (3 and 30 ⁇ g/ml) and MTT assay was performed after 24 hours. .
  • glucose uptake was measured by measuring [ 14 C]2-deoxy-D-glucose-6-phosphate, which was absorbed into mouse L6 progenitor cells and converted into a form.
  • 100 nM concentration of insulin porcine insulin
  • the content of [ 14 C]2-deoxy-D-glucose-6-phosphate in L6 myoblasts was increased by about 55% to 80% compared to the untreated control. It was confirmed that the fermentation peony extract treatment group increased by about 25-35%. This indicates that when the peony extract is fermented using lactic acid bacteria, the anti-diabetic activity can be increased by promoting glucose absorption into muscle cells compared to the non-fermented peony extract.
  • 100 nM of insulin (porcine insulin) used as a positive control group has an anti-diabetic effect almost equal to 10 ⁇ M (3.57 ⁇ g/ml) of rosiglitazone, which is actually used as a therapeutic agent for diabetes.
  • the content of [ 14 C]2-deoxy-D-glucose-6-phosphate in the group treated with the lactic acid bacteria fermentation product of the peony extract of ml) was similar to that of the insulin 100 nM treatment group, and the peony extract of high concentration (30 ⁇ g/ml)
  • the content of [ 14 C]2-deoxy-D-glucose-6-phosphate in the group treated with lactic acid bacteria fermentation was significantly increased compared to the insulin 100 nM treatment group (FIG. 2B).
  • Lactobacillus plantarum subsp. did not have a significant effect on cell proliferation in both the untreated control group and the lactic acid bacteria fermentation product group of peony extract in mouse L6 root canal cells. It was found that the lactic acid bacteria fermentation product of the peony extract fermented with plantarum (Df2) or Lactobacillus paraplantarum (Df3) had no cytotoxicity (FIG. 2C ).
  • the glucose absorption rate was the same as in Example 4-2, except that the Df2 and Df3 were treated with 3, 10, 30, and 100 ⁇ g/ml, respectively. It was measured.
  • muscle cells are compared to the lactic acid bacteria fermentation products of the non-fermented peony extract and the peony extract fermented with other lactic acid bacteria. It has been shown that it can increase the anti-diabetic activity by promoting the absorption of glucose.
  • Leuconostoc sp. LN180020 (KCTC 13719BP) of the genus Leuconostoc of the present invention was additionally identified, and a new substance was shown to increase anti-diabetic activity.
  • Primer sequence information Primer name Base sequence (5' ⁇ 3') 27F-1492R_F AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 2) 27F-1492R_R CGGTTACCTTGTTACGACTT (SEQ ID NO: 3)
  • the nucleotide sequence of the 16S rRNA of LN180020 in Leuconostock was confirmed through BigDye (R) Terminator v3.1 Cycle Sequencing Kits (Applied Biosystems). Refer to ncbi.nlm.nih.gov/), EzTaxon-e server (https://www.eztaxon-e.ezcloud.net/) and LPSN (https://www.bacterio.net/nocardioides.html) databases The sequence comparison analysis was performed using BioEdit v7.2.6.1, MEGA7 program.
  • the genus LN180020 showed the highest 16S rRNA sequence homology to 99.86% with L. citreum AT. L. citreum ATCC 49370T, followed by L. holzapfelii BFE 7000 T and 99.78%; L. lactis JCM 6123 T and L. palmae TMW 2.694 T and 98.92%; L. kimchii IMSNU 11154 T and 98.49%; Leukono Stock Gelidum subsp. L. gelidum subsp. gasicomitatum LMG 18811 T and 98.14%; Leukonostock Mesenteroides subsp. L. mesenteroides subsp.
  • LC-MS Liquid chromatography mass spectrometry
  • the LC-MS analysis for the identification of the bioconverted material dissolved the supernatant in methanol and the HPLC system connected with the Turbolon Spray source (AB SCIEX, Singapore) and QTrap 3200 (Luna C18 (2), 100 X 2.0 mm, 3 ⁇ m; guard cartridge system, security guard #KJ 0-4282; Phenomenex, USA).
  • the column was maintained at 25° C. at a flow rate of 1.0 ml/min HPLC water (B) containing 100% methanol (A) and 0.04% trifluoroacetic acid, and the sample was 15% for the first 5 minutes.
  • the concentration of methanol was sequentially increased from 15% to 100% from 5 to 20 minutes, maintained at 100% methanol for 20 to 25 minutes, and 100% to 15% from 25 to 35 minutes. The methanol concentration was reduced until then, and it was measured while maintaining with 15% methanol for 5 minutes (Table 2).
  • HPLC conditions HPLC retention time (min) A; MeOH(%) B; Water(%) 0-5 15 85 5-20 15-100 85-0 20-25 100 0 25-35 100-15 0-85 35-40 15 85
  • the indicator material was reduced around 15 minutes of retention time of the peony extract fermentation (FIGS. 1A and 1B) and new utility at about 14.2 minutes. It was confirmed that the peak corresponding to the component increased.
  • each of the corresponding peaks was developed using a thin layer chromatography method using silica gel 60G F254 glass plate in methanol:chloroform (1.5:5).
  • a powder was prepared by mixing the above components and filling the gas-tight fabric.
  • Fermentation product 100 mg of peony extract according to the present invention 100 mg of peony extract according to the present invention
  • tablets were prepared by tableting according to a conventional tablet manufacturing method.
  • Fermentation product 100 mg of peony extract according to the present invention 100 mg of peony extract according to the present invention
  • the capsules were prepared by filling the gelatin capsules according to a conventional capsule preparation method.
  • Fermentation product of peony extract according to the invention 1 g
  • Fermentation product 150 mg of peony extract according to the present invention 150 mg of peony extract according to the present invention

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Chemical & Material Sciences (AREA)
  • Diabetes (AREA)
  • Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Mycology (AREA)
  • Botany (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Endocrinology (AREA)
  • Obesity (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Emergency Medicine (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medical Informatics (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Epidemiology (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines Containing Plant Substances (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)

Abstract

본 발명은 작약 추출물의 유산균 발효물을 유효성분으로 포함하는 당뇨병의 예방, 개선, 또는 치료용 조성물에 관한 것으로, 보다 상세하게는 작약 추출물의 유산균 발효물을 유효성분으로 포함하는 당뇨병의 예방 또는 치료용 약학 조성물, 식품 조성물 및 패오니플로린의 전환 방법에 관한 것이다.

Description

작약 추출물의 유산균 발효물을 유효성분으로 포함하는 당뇨병의 예방, 개선 또는 치료용 조성물
본 출원은 2018년 12월 6일에 출원된 대한민국 특허출원 제10-2018-0155698호를 우선권으로 주장하고, 상기 명세서 전체는 본 출원의 참고문헌이다.
본 발명은 작약 추출물의 유산균 발효물을 유효성분으로 포함하는 당뇨병의 예방, 개선, 또는 치료용 조성물에 관한 것으로, 보다 상세하게는 작약 추출물의 유산균 발효물을 유효성분으로 포함하는 당뇨병의 예방 또는 치료용 약학 조성물, 식품 조성물 및 패오니플로린의 전환 방법에 관한 것이다.
당뇨병은 인슐린의 분비량이 부족하거나 정상적인 기능이 이루어지지 않는 대사질환의 일종으로, 혈중 포도당의 농도가 높아지는 고혈당을 특징으로 한다.
당뇨병은 제1형과 제2형으로 구분되는데, 제1형 당뇨병은 이전에 '소아 당뇨병'이라고 불렸었으며, 인슐린을 전혀 생산하지 못하는 것이 원인이 되어 발생하는 질환이다. 인슐린이 상대적으로 부족한 제2형 당뇨병은 인슐린 저항성(insulin resistance; 혈당을 낮추는 인슐린 기능이 떨어져 세포가 포도당을 효과적으로 연소하지 못하는 것)을 특징으로 한다. 제2형 당뇨는 식생활의 서구화에 따른 고열량, 고지방, 고단백의 식단, 운동 부족, 스트레스 등 환경적인 요인이 크게 작용하는 것으로 보이지만, 이 외에 특정 유전자의 결함에 의해서도 당뇨병이 생길 수 있으며, 췌장 수술, 감염, 약제에 의해서도 생길 수 있다. 약한 고혈당에서는 대부분의 환자들이 증상을 느끼지 못하거나 모호해서 당뇨병이라고 인지하기 어렵다. 혈당이 증가하면 갈증이 나서 물을 많이 마시게 되고, 소변량이 늘어 화장실을 자주 가게 되며 체중도 감소하게 된다. 오랜 기간 동안 고혈당 상태가 유지되면 신체에서 망막병증, 신기능 장애, 신경병증(저림, 통증) 등의 여러 합병증이 발생하거나 심혈관계 질환의 위험이 높아지게 된다.
제1형 당뇨병의 경우에는 인슐린 치료가 필요하며, 제2형 당뇨병의 가장 효과적인 치료는 식사 수 최적의 혈당치를 달성하도록 하는 것이다. 특히, α-글루코시다아제(α-glucosidase) 활성 억제를 통한 단당류의 흡수지연은 제2형 당뇨병 치료에 유익한 전략으로 제시되고 있다.
한편, 작약( Paeonia lactiflora)은 미나리아재비과의 여러해살이풀로 주로 산기슭이나 골짜기에서 자란다. 줄기는 여러 개가 한 포기에서 나와 곧게 서고 높이 60cm 정도이며 잎과 줄기에 털이 없다. 뿌리는 여러 개가 나오지만 가늘고 양끝이 긴 뾰족한 원기둥 모양으로 굵다. 꽃은 5～6월에 줄기 끝에 1개가 피는데 크고 아름다우며 재배한 것은 지름 10cm 정도이다. 꽃색은 붉은색, 흰색 등 다양하며 많은 원예 품종이 있다. 뿌리는 진통, 복통, 월경통, 무월경, 토혈, 빈혈, 타박상 등의 약재로 쓰인다. 또한 작약 뿌리를 약제로 사용할 경우 선가공 방법에 따라 적작약과 백작약으로 구분할 수 있다. 적작약은 수염뿌리를 제거해서 말린 것이고, 백작약은 수염뿌리를 제거하고 끓는 물에 삶은 후 외피를 제거하거나 다시 삶아 말린 것이다.
한편, 한국공개특허 제2016-0006812호에는 '작약 추출물을 포함하는 당뇨 예방 및 치료용 조성물'이 개시되어 있고, 작약 또는 작약 추출물의 지표물질로 패오니플로린(paeoniflorin)이 알려져 있으나, 이들의 당뇨 관련 활성을 생리적으로 유효한 효과를 나타내기에는 충분하지 못한 한계가 있었다.
이에 본 발명자들은 작약 추출물을 대사 또는 개량하여 당뇨의 치료에 효과적인 방법을 찾기 위하여 연구하던 중, 김치로부터 분리된 류코노스톡 속 ( Leuconostoc sp.) LN180020(KCTC 13719BP)로 작약 추출물을 발효시키는 경우 패오니플로린이 다른 물질로 전환되고, 이를 포함하는 작약 추출물의 유산균 발효물이 다른 유산균에 의한 발효물과 대비하여 항당뇨 활성이 현저하게 개선됨을 확인하여 본 발명을 완성하였다.
따라서, 본 발명의 목적은 작약( Paeonia lactiflora) 추출물의 유산균 발효물을 유효성분으로 포함하는 당뇨병의 예방 또는 치료용 약학 조성물을 제공하는 것이다.
또한 작약( Paeonia lactiflora) 추출물의 유산균 발효물을 유효성분으로 이루어지는 당뇨병의 예방 또는 치료용 약학 조성물을 제공하는 것이다.
또한 작약( Paeonia lactiflora) 추출물의 유산균 발효물을 유효성분으로 필수적으로 이루어지는 당뇨병의 예방 또는 치료용 약학 조성물을 제공하는 것이다.
본 발명의 다른 목적은 작약 추출물의 유산균 발효물을 유효성분으로 포함하는 당뇨병의 예방 또는 개선용 식품 조성물을 제공하는 것이다.
또한 작약 추출물의 유산균 발효물을 유효성분으로 이루어지는 당뇨병의 예방 또는 개선용 식품 조성물을 제공하는 것이다.
또한 작약 추출물의 유산균 발효물을 유효성분으로 필수적으로 이루어지는 당뇨병의 예방 또는 개선용 식품 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 (a) 페오니플로린을 포함하는 조성물에 류코노스톡 속( Leuconostoc sp.) 유산균을 접종하는 단계; 및 (b) 상기 (a) 단계의 수득물을 배양하여 발효시키는 단계를 포함하는 작약 또는 작약 추출물에서 패오니플로린의 전환 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 당뇨병의 치료용 제제를 제조하기 위한 작약(Paeonia lactiflora) 추출물의 유산균 발효물을 유효성분으로 포함하는 조성물의 용도를 제공하는 것이다.
본 발명의 또 다른 목적은 작약(Paeonia lactiflora) 추출물의 유산균 발효물을 유효성분으로 포함하는 조성물의 유효량을 이를 필요로 하는 개체에 투여하는 단계를 포함하는 당뇨병의 치료 방법을 제공하는 것이다.
상기와 같은 목적을 달성하기 위하여, 본 발명은 작약 추출물의 유산균 발효물을 유효성분으로 포함하는 당뇨병의 예방 또는 치료용 약학 조성물을 제공한다.
또한 본 발명은 작약 추출물의 유산균 발효물을 유효성분으로 이루어지는 당뇨병의 예방 또는 치료용 약학 조성물을 제공한다.
또한 본 발명은 작약 추출물의 유산균 발효물을 유효성분으로 필수적으로 이루어지는 당뇨병의 예방 또는 치료용 약학 조성물을 제공한다.
본 발명의 다른 목적을 달성하기 위하여, 본 발명은 작약 추출물의 유산균 발효물을 유효성분으로 포함하는 당뇨병의 예방 또는 개선용 식품 조성물을 제공한다.
또한 본 발명은 작약 추출물의 유산균 발효물을 유효성분으로 이루어지는 당뇨병의 예방 또는 개선용 식품 조성물을 제공한다.
또한 본 발명은 작약 추출물의 유산균 발효물을 유효성분으로 필수적으로 이루어지는 당뇨병의 예방 또는 개선용 식품 조성물을 제공한다.
본 발명의 또 다른 목적을 달성하기 위하여, 본 발명은 (a) 페오니플로린을 포함하는 조성물에 류코노스톡 속( Leuconostoc sp.) 유산균을 접종하는 단계; 및 (b) 상기 (a) 단계의 수득물을 배양하여 발효시키는 단계를 포함하는 작약 또는 작약 추출물에서 패오니플로린의 전환 방법을 제공한다.
본 발명의 또 다른 목적을 달성하기 위하여, 본 발명은 당뇨병의 치료용 제제를 제조하기 위한 작약(Paeonia lactiflora) 추출물의 유산균 발효물을 유효성분으로 포함하는 조성물의 용도를 제공한다.
본 발명의 또 다른 목적을 달성하기 위하여, 본 발명은 작약(Paeonia lactiflora) 추출물의 유산균 발효물을 유효성분으로 포함하는 조성물의 유효량을 이를 필요로 하는 개체에 투여하는 단계를 포함하는 당뇨병의 치료 방법을 제공한다.
이하 본 발명을 상세히 설명한다.
본 발명은 작약 추출물의 유산균 발효물을 유효성분으로 포함하는 당뇨병의 예방 또는 치료용 약학 조성물을 제공한다.
본 명세서에서 '작약'은 학명 Paeonia lactiflora를 가지는 식물의 뿌리, 바람직하게는 약재로 사용되는 Paeonia lactiflora의 뿌리를 의미하는 것이다. 약재로서의 작약은 Paeoniae Radix 또는 Peony root라고 불리기도 하며, 보다 상세하게는 약용부위로 사용되는 작약 Paeonia lactiflora Pallas 또는 기타동속근연식물 (작약과 Paeoniaceae)의 뿌리를 나타낸다.
작약 추출물은 당업계에 공지된 용매 추출법에 의해 추출될 수 있다. 추출 용매로는 이에 제한되지는 않으나, 물, 탄소수 1(C1) 내지 6개(C6)의 저급 알콜, 유기용매 또는 이들의 혼합용매를 사용할 수 있다. 탄소수 1(C1) 내지 6개(C6)의 저급 알콜은 이에 제한되지는 않으나, 메탄올, 에탄올, 주정, 프로판올, 이소프로판올, 부탄올, 펜탄올, 헥산올일 수 있고, 유기용매는 이에 제한되지는 않으나, 아세톤, 에틸아세테이드, n-핵산, 디에틸에테르, 아세톤, 벤젠일 수 있다. 바람직하게는 물 또는 탄소수 1 내지 6개의 알콜 또는 이의 혼합용매로 추출할 수 있고, 더 바람직하게는 물, 에탄올 또는 주정일 수 있다. 알콜에는 흡습성 등 물리화학적 성질을 반영하기 위하여 소량의 물(예를 들어, 95% 에탄올, 99% 에탄올의 형태)이 첨가된 형태일 수도 있다.
추출온도 및 시간은 활성성분의 추출의 목적이 달성되는 한 특별히 제한되지는 않으나, 30℃ 내지 121℃에서 10분 내지 12시간동안 추출할 수 있다. 추출시 활성성분의 추출을 용이하게 하기 위하여 가압하여 추출할 수도 있다. 한편, 추출은 이산화탄소 등 적절한 용매를 사용하여 초임계 추출 또는 아임계 추출에 의할 수도 있다.
본 명세서에서 ‘치료’ 또는 ‘개선’은 질환의 발생 또는 재발 억제, 증상의 완화, 질병의 직접 또는 간접적인 병리학적 결과의 감소, 질병 진행 속도의 감소, 질병 상태의 개선, 호전, 완화 또는 개선된 예후를 의미한다. 본 발명에서 사용되는 용어 ‘예방’은 질환의 발병을 억제시키거나 진행을 지연시키는 모든 행위를 의미한다.
본 발명에서 치료 또는 예방의 대상인 ‘당뇨병’은 췌장의 베타 세포에서 생성되는 인슐린 호르몬 부족 또는 인슐린 저항성의 이상과 나아가 이러한 두 가지 모두의 결함으로 발생하는 고혈당을 특징으로 하는 대사장애증후군이다. 이러한 당뇨병은 인슐린 의존형 당뇨병(IDDM, Type 1)과 인슐린 저항 및 인슐린 분비 손상에 의해 발생하는 인슐린 비의존형 당뇨병(NIDDM, Type 2)으로 나눌 수 있다. 제1형과 제2형 당뇨병 모두에서 심장 질환, 장 질환, 안과 질환, 신경 질환, 뇌졸중 등과 같은 다양한 합병증이 발생하게 되는데, 이는 장시간 동안 혈당과 인슐린 수준이 상승하여 만성신경질환과 심혈관질환이 발생하게 되고 단시간의 저혈당과 고혈당 반응으로 급성 합병증을 야기시키게 되는 것이다. 당뇨병은 고혈당이 만성으로 지속되면서 당질 대사뿐만 아니라 지질 및 단백질 대사 장애도 함께 일으킨다. 그 병태는 다양하며 직접 고혈당에 기인하는 것으로 망막, 신장, 신경, 심혈관계 등에서 당뇨병성 말초신경장해, 당뇨병성 망막증, 당뇨병성 신증, 당뇨병성 백내장, 각막증, 당뇨병성 동맥경화증 등이 있다.
이에 따라, 본 발명에서의 당뇨병은 당뇨병 또는 당뇨병에 의한 당뇨합병증도 포함하며, 보다 구체적으로는 제1형 당뇨병, 제2형 당뇨병, 임신성 당뇨병일 수 있다. 당뇨합병증의 경우 랑게르한스섬 세포의 파괴 혹은 기능저하로 인한 질환 및 혈중 글루코오스 농도의 상승으로 인한 질환일 수 있으며, 구체적으로는 이에 제한되지는 아니하나 당뇨병성 말초신경장해, 당뇨병성 망막증, 당뇨병성 신증, 당뇨병성 백내장, 각막증, 당뇨병성 동맥경화증일 수 있다.
본 발명에서 ‘유산균’은 류코노스톡 시트레움( Leuconostoc citreum) 또는 기탁번호가 KCTC 13719BP인 류코노스톡 속( Leuconostoc sp.) LN180020일 수 있으며, 바람직하게는 기탁번호가 KCTC 13719BP인 류코노스톡 속( Leuconostoc sp.) LN180020일 수 있다. 상기 ‘유산균’은 패오니플로린을 전환시키는 생물전환능을 가지고 있는 것을 특징으로 한다.
본 발명의 일 실시예에서는 유용한 유산균을 탐색하기 위해서 김치 유래의 식물성 유산균을 분리하였다. 그 결과, 락토바실러스 속( Lactobacillus), 페티오코커스 속( Pediococcus), 웨이셀라 속( Weissella), 류코노스톡 속( Leuconostoc) 및 엔테로코커스 속( Enterococcus)에 포함되는 39종(species)의 193개의 균주가 분리되었다.
본 발명의 일 실시예에서는 분리된 유산균 균주를 작약의 열수 추출물에 접종하고 이를 발효시켜 작약 추출물의 유산균 발효물을 제조하였고, 발효물에서 패오니플로린 (paeoniflorin)이 생물전환되는 균주를 탐색하였다. 그 결과 분리된 균주 중 1종에서 특이적으로 패오니플로린으로 예상되는 약 15분 근처의 피크가 줄어들고 14.2분에서 새로운 물질이 피크가 증가하는 것을 확인하였다.
이 균주를 동정하여 류코노스톡 속( Leuconostoc sp.) LN180020 균주로 명명하였고, 생물자원센터(KCTC)에 2018년 11월 20일자로 기탁하였다(기탁번호: KCTC 13719BP).
본 발명의 일 실시예에서는 류코노스톡 속 LN180020의 발효물이 세포독성과 근원세포의 포도당 흡수능을 통해 항-당뇨 활성을 가지는지와 이러한 항-당뇨 활성이 다른 유산균의 발효에 의해서도 나타나는지를 확인하였다. 그 결과 유산균의 발효물에는 세포독성이 나타나지는 않았으나, 항-당뇨 활성에 있어서는 류코노스톡 속 LN180020의 발효물만이 유의하게 효과를 나타내었다. 특히 본 발명의 류코노스톡 속 LN180020의 발효물은 근육 세포로의 포도당 흡수를 증가시키는 기능을 하는 것을 확인할 수 있었고, 이는 항-당뇨 활성을 가지는 것을 나타낸다.
본 발명에 따른 약학 조성물은 당뇨병 치료를 위해 약학적으로 허용되는 담체와 함께 당업계에 공지된 방법으로 투여 경로에 따라 다양하게 제형화될 수 있다. 상기 담체로는 모든 종류의 용매, 분산매질, 수중유 또는 유중수 에멀젼, 수성 조성물, 리포좀, 마이크로비드 및 마이크로좀이 포함된다.
상기 본 발명에 따른 약학 조성물은 약학적으로 유효한 양, 즉 당뇨병을 예방하거나 증상을 완화하고 치료하기 충분한 양으로 환자에게 투여될 수 있다. 예를 들어 일반적인 1일 투여량으로는 약 0.01 내지 1000㎎/㎏의 범위로 투여될 수 있으며, 바람직하게는, 약 1 내지 100mg/kg의 범위로 투여될 수 있다. 본 발명의 약학 조성물은 바람직한 투여량 범위 내에서 1회 또는 수회로 분할 투여할 수 있다. 또한 본 발명에 따른 약학 조성물의 투여량은 투여 경로, 투여 대상, 연령, 성별 체중, 개인차 및 질병 상태에 따라 통상의 기술자가 적절하게 선택할 수 있다.
투여 경로로는 경구적 또는 비경구적으로 투여될 수 있다. 비경구적인 투여방법으로는 이에 한정되지는 않으나 정맥 내, 근육 내, 동맥 내, 골수 내, 경막 내, 심장 내, 경피, 피하, 복강 내, 비강 내, 장관, 국소, 설하, 직장, 또는 췌장 내 투여일 수 있으나, 이에 제한되지 않으며, 가장 바람직하게는 경구적으로 투여될 수 있다.
본 발명의 약학 조성물을 경구 투여하는 경우, 적합한 경구 투여용 담체와 함께 당업계에 공지된 방법에 따라 분말, 과립, 정제, 환제, 당의정제, 캡슐제, 액제, 겔제, 시럽제, 현탁액, 웨이퍼 등의 형태로 제형화할 수 있다. 적합한 담체의 예로는 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨 및 말티톨 등을 포함하는 당류와 옥수수 전분, 밀 전분, 쌀 전분 및 감자 전분 등을 포함하는 전분류, 셀룰로즈, 메틸 셀룰로즈, 나트륨 카르복시메틸셀룰로오즈 및 하이드록시프로필메틸셀룰로즈 등을 포함하는 셀룰로즈류, 젤라틴, 폴리비닐피롤리돈 등과 같은 충전제가 포함될 수 있다. 또한, 경우에 따라 가교결합 폴리비닐피롤리돈, 한천, 알긴산 또는 나트륨 알기네이트 등을 붕해제로 첨가할 수 있다. 나아가, 상기 약학 조성물은 항응집제, 윤활제, 습윤제, 향료, 유화제 및 방부제 등을 추가로 포함할 수 있다.
또한, 비경구적으로 투여하는 경우, 본 발명의 약학 조성물은 적합한 비경구용 담체와 함께 주사제, 경피투여제 및 비강 흡입제 등의 형태로 당 업계에 공지된 방법에 따라 제형화될 수 있다.
또한, 약학 조성물은 활성 물질이 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수 있다. 바람직한 투여방식 및 제제는 정맥 주사제, 피하 주사제, 피내 주사제, 근육 주사제 또는 점적 주사제 등이다. 주사제는 생리식염액 또는 링겔액 등의 수성 용제, 식물유, 고급 지방산 에스테르 (예로, 올레인산에칠 등), 알코올류(예로, 에탄올, 벤질알코올, 프로필렌글리콜 또는 글리세린 등) 등의 비수성 용제 등을 이용하여 제조할 수 있고, 변질 방지를 위한 안정화제 (예로, 아스코르빈산, 아황산수소나트륨, 피로아황산나트륨, BHA, 토코페롤, EDTA 등), 유화제, pH 조절을 위한 완충제, 미생물 발육을 저지하기 위한 보존제 (예로, 질산페닐수은, 치메로살, 염화벤잘코늄, 페놀, 크레솔, 벤질알코올 등) 등의 약제학적 담체를 포함할 수 있다.
상기 주사제의 경우에는 반드시 멸균되어야 하며 박테리아 및 진균과 같은 미생물의 오염으로부터 보호되어야 한다. 주사제의 경우 적합한 담체의 예로는 이에 한정되지는 않으나, 물, 에탄올, 폴리올(예를 들어, 글리세롤, 프로필렌 글리콜 및 액체 폴리에틸렌 글리콜 등), 이들의 혼합물 및/또는 식물유를 포함하는 용매 또는 분산매질일 수 있다. 보다 바람직하게는, 적합한 담체로는 행크스 용액, 링거 용액, 트리에탄올 아민이 함유된 PBS(phosphate buffered saline) 또는 주사용 멸균수, 10% 에탄올, 40% 프로필렌 글리콜 및 5% 덱스트로즈와 같은 등장 용액 등을 사용할 수 있다. 상기 주사제를 미생물 오염으로부터 보호하기 위해서는 파라벤, 클로로부탄올, 페놀, 소르빈산, 티메로살 등과 같은 다양한 항균제 및 항진균제를 추가로 포함할 수 있다. 또한, 상기 주사제는 대부분의 경우 당 또는 나트륨 클로라이드와 같은 등장화제를 추가로 포함할 수 있다.
그 밖의 약학적으로 허용되는 담체로는 당업계에 공지되어 있는 것을 참고로 할 수 있다.
본 발명에 따른 약학 조성물은 하나 이상의 완충제(예를 들어, 식염수 또는 PBS), 카보하이트레이트(예를 들어, 글루코스, 만노즈, 슈크로즈 또는 덱스트란), 항산화제, 정균제, 킬레이트화제(예를 들어, EDTA 또는 글루타치온), 아쥬반트(예를 들어, 알루미늄 하이드록사이드), 현탁제, 농후제 및/또는 보존제를 추가로 포함할 수 있다.
또한, 본 발명의 약학 조성물은 포유동물에 투여된 후 활성 성분의 신속, 지속 또는 지연된 방출을 제공할 수 있도록 당업계에 공지된 방법을 사용하여 제형화될 수 있다.
또한, 본 발명의 약학 조성물은 단독으로 투여하거나, 당뇨병 치료의 효과가 있는 공지의 화합물과 병용하여 투여할 수 있다.
한편, 본 발명은 작약 추출물의 유산균 발효물을 유효성분으로 포함하는 당뇨병의 예방 또는 개선용 식품 조성물을 제공한다.
본 발명의 식품 조성물은 기능성 식품(functional food), 영양보조제(nutritional supplement), 건강식품(health food) 및 식품 첨가제(food additives) 등의 모든 형태를 포함한다.
상기 유형의 식품 조성물은 당업계에 공지된 통상적인 방법에 따라 다양한 형태로 제조할 수 있다. 이에 한정되지 않지만 예를 들면, 건강식품으로는 작약 추출물의 유산균 발효물을 차, 쥬스 및 드링크의 형태로 제조하여 음용할 수 있도록 액상화, 과립화, 캡슐화 및 분말화하여 섭취할 수 있다. 또한, 작약 추출물의 유산균 발효물과 당뇨병에 효과가 있다고 알려진 공지의 활성 성분과 함께 혼합하여 조성물의 형태로 제조할 수 있다. 또한, 기능성 식품으로는 이에 한정되지 않지만 음료(알콜성 음료 포함), 과실 및 그의 가공식품(예: 과일통조림, 병조림, 잼, 마말레이드 등), 어류, 육류 및 그 가공식품(예: 햄, 소시지 콘비이프 등), 빵류 및 면류(예: 우동, 메밀국수, 라면, 스파게티, 마카로니 등), 과즙, 각종 드링크, 쿠키, 엿, 유제품(예: 버터, 치즈 등), 식용식물유지, 마아가린, 식물성 단백질, 레토르트 식품, 냉동식품, 각종 조미료(예: 된장, 간장, 소스 등) 등에 작약 추출물의 유산균 발효물을 첨가하여 제조할 수 있다. 또한, 작약 추출물의 유산균 발효물을 첨가제의 형태로 사용하기 위해서는 분말 또는 농축액 형태로 제조하여 사용할 수 있다.
본 발명의 식품 조성물 중 작약 추출물의 유산균 발효물의 바람직한 함유량으로는 이에 한정되지 않지만 바람직하게는 최종적으로 제조된 식품 중 0.1 내지 90 중량%이다. 더 바람직하게는, 본 발명의 작약 추출물의 유산균 발효물을 유효성분으로 포함하는 식품 조성물은 특히, 당뇨병에 효과가 있는 것으로 알려진 활성 성분과 함께 혼합하여 건강기능식품 또는 식이보충제의 형태로 제조될 수 있다.
본 발명의 당뇨병의 예방 또는 개선용 건강기능식품 조성물은, 근육세포로의 포도당 흡수를 촉진시키는 작약 추출물의 유산균 발효물을 유효성분으로 함유하고 있어, 당뇨병의 예방 또는 개선에 효과가 우수한 것을 특징으로 한다.
한편, 본 발명의 일실시예에서는 류코노스톡 속 LN180020 유산균을 16S rRNA 염기서열 분석을 통해서 동정하고, 항당뇨 활성이 증가를 보이게한 새로운 물질을 동정하고자 하였다. 그 결과 류코노스톡 속 LN180020 유산균은 류코노스톡 시트레움( L. citreum)과 가장 높은 16S rRNA 서열 상동성을 보였고 작약 추출물의 지표물질인 분자량 480.3의 패오니플로린(paeoniflorin)이 감소하고 분자량 642.3의 새로운 유용성분 물질로 생물 전환되는 것을 알 수 있었다.
따라서, 본 발명은 하기 단계를 포함하는 패오니플로린을 포함하는 조성물에서 패오니플로린의 전환 방법을 제공한다:
(a) 패오니플로린을 포함하는 조성물에 류코노스톡 속( Leuconostoc sp.) 유산균을 접종하는 단계; 및
(b) 상기 (a) 단계의 수득물을 배양하여 발효시키는 단계.
본 발명에서 패오니플로린을 포함하는 조성물은 패오니플로린을 포함하는 원물의 추출물일 수 있으며, 바람직하게는 작약 또는 작약속 (Paeonia) 식물의 추출물일 수 있다. 배양을 용이하게 하기 위하여 바람직하게는 패오니플로린을 포함하는 조성물은 액상일 수 있다.
본 발명의 패오니플로린의 전환 방법에서 류코노스톡 속( Leuconostoc sp.) 유산균은 바람직하게는 패오니플로린을 전환시키는 생물전환능을 가지고 있는 류코노스톡 시트레움( Leuconostoc citreum) 또는 기탁번호가 KCTC 13719BP인 류코노스톡 속( Leuconostoc sp.) LN180020일 수 있으며, 바람직하게는 기탁번호가 KCTC 13719BP인 류코노스톡 속( Leuconostoc sp.) LN180020일 수 있다.
접종하는 유산균의 양은 1 x 10 8 내지 1 x 10 11의 유산균 균주를 조성물 자체 또는 조성물이 포함된 배지에 첨가하거나 전배양된 유산균 배양액을 1 내지 5%(v/v)정도로 첨가할 수 있다.
본 발명에 따른 류코노스톡 속 유산균의 접종 후의 (b)단계의 배양은 당업계에 공지된 유산균 배양방법에 의할 수 있다. 아울러, 배양배지로는 탄소원, 질소원, 비타민 및 미네랄로 구성된 배지 또는 유성분을 이용한 유청배지, 탈지유 배지 등을 사용할 수 있다. 본 발명의 배양물 생산을 위한 배지에서 상기 탄소원으로 이용 가능한 것은, 글루코스, 수크로스, 말토스, 프럭토스, 락토스, 자일로스, 갈락토스, 아라비노스 및 이들의 조합으로 구성된 군으로부터 선택된 하나 이상이며, 바람직하게는 수크로스, 프럭토스, 글루코스, 갈락토스, 아라비노스 및 락토스로 구성된 군으로부터 선택된 하나 이상이며, 보다 바람직하게는 글루코스이다. 본 발명의 배양물 생산을 위한 배지에서 상기 질소원으로 이용 가능한 것은, 효모 추출물, 소이톤(soytone), 펩톤, 비프 추출물(beef extract), 트립톤, 카시톤 및 이들의 조합으로 구성된 군으로부터 선택된 하나 이상이며, 바람직하게는 효모 추출물, 펩톤, 트립톤 및 소이톤으로 구성된 군으로부터 선택된 하나 이상이며, 보다 바람직하게는 효모 추출물 또는 소이톤이다.
유산균의 배양 및 발효는 당업계에 알려진 밀크 포함 배지와 배양조건에 따라 이루어질 수 있다. 이러한 과정은 당업자라면 선택되는 균주에 따라 용이하게 조정하여 사용할 수 있다. 이러한 다양한 방법은 다양한 문헌(예를 들면, James et al., Biochemical Engineering, Prentice-Hall International Editions)에 개시되어 있다. 세포의 성장방식에 따라 현탁배양과 부착배양을 배양방법에 따라 회분식과 유가식 및 연속배양식의 방법을 이용할 수 있다.
본 발명에서 패오니플로린의 전환은 패오니플로린이 다른 활성 물질로 변환되는 것으로 결과적으로 패오니플로린이 감소된다.
본 발명은 당뇨병의 치료용 제제를 제조하기 위한 작약(Paeonia lactiflora) 추출물의 유산균 발효물을 유효성분으로 포함하는 조성물의 용도를 제공한다.
본 발명은 작약(Paeonia lactiflora) 추출물의 유산균 발효물을 유효성분으로 포함하는 조성물의 유효량을 이를 필요로 하는 개체에 투여하는 단계를 포함하는 당뇨병의 치료 방법을 제공한다.
본 발명의 상기 ‘유효량’이란 개체에게 투여하였을 때, 당뇨의 개선, 치료, 예방, 검출, 진단 또는 당뇨의 억제 또는 감소 효과를 나타내는 양을 말하며, 상기‘개체’란 동물, 바람직하게는 포유동물, 특히 인간을 포함하는 동물일 수 있으며, 동물에서 유래한 세포, 조직, 기관 등일 수도 있다. 상기 개체는 상기 효과가 필요한 환자(patient) 일 수 있다.
본 발명의 상기 ‘치료’는 당뇨 또는 당뇨의 증상을 개선시키는 것을 포괄적으로 지칭하고, 이는 당뇨를 치유하거나, 실질적으로 예방하거나, 또는 상태를 개선시키는 것을 포함할 수 있으며, 상기 당뇨로부터 비롯된 한 가지 증상 또는 대부분의 증상을 완화시키거나, 치유하거나 예방하는 것을 포함하나, 이에 제한되는 것은 아니다.
본 발명의 용어 ‘~을 포함하는(comprising)’이란 ‘함유하는’ 또는 ‘특징으로 하는’과 동일하게 사용되며, 조성물 또는 방법에 있어서, 언급되지 않은 추가적인 성분 요소 또는 방법 단계 등을 배제하지 않는다. 용어 ‘~로 이루어지는(consisting of)’이란 별도로 기재되지 않은 추가적인 요소, 단계 또는 성분 등을 제외하는 것을 의미한다. 용어 ‘필수적으로 이루어지는(consisting essentially of)’이란 조성물 또는 방법의 범위에 있어서, 기재된 성분 요소 또는 단계와 더불어 이의 기본적인 특성에 실질적으로 영향을 미치지 않는 성분 요소 또는 단계 등을 포함하는 것을 의미한다.
따라서, 본 발명의 작약 추출물 유산균 발효물은 포도당을 근육세포로 이동시켜 포도당 흡수율을 효과적으로 증가시킬 수 있고, 천연 소재인 작약과 김치 유래의 유산균을 사용하여 인체에 부작용이 없으므로, 당뇨병의 예방, 개선 또는 치료용 식품 및 의약품에 유용하게 활용될 수 있을 것으로 기대된다.
도 1a 및 도 1b는 비발효 작약 추출물(non-fermented, 도 1a) 및 작약 추출물의 유산균 발효물(fermented, 도 1b) 내의 지표 물질과 새로운 유용물질의 함량을 나타내는 HPLC 크로마토그램이다.
도 2a 내지 도 2d는 작약 추출물의 유산균 발효물 및 비발효 작약 추출물의 세포 독성(cell viability) 및 근육세포로의 포도당 흡수율(relative glucose uptake)을 확인한 결과로, 도 2a 및 도 2b는 류코노스톡 속( Leuconostoc sp.) LN180020(KCTC 13719BP)으로 발효시킨 작약 추출물의 유산균 발효물을 처리한 결과이고, 도 2c 및 도 2d는 락토바실러스 플란타룸 아종 플란타룸( Lactobacillus plantarum subsp. plantarum; Df2) LN180155 또는 락토바실러스 파라플란타룸( Lactobacillus paraplantarum KACC 12373; Df3)으로 발효시킨 작약 추출물의 유산균 발효물을 처리한 결과이다. INS; 인슐린(porcine insulin).
도 3은 류코노스톡 속( Leuconostoc sp.) LN180020(KCTC 13719BP)의 계통을 분석한 계통도이다.
도 4는 비발효 작약 추출물(non-fermented) 및 작약 추출물의 유산균 발효물(fermented)에서 각각 생물전환 전의 작약 지표 물질(패오니플로린, paeoniflorin)과 생물전환 후 물질을 분리, 정제하여 LC-MS을 수행한 결과이다.
이하, 본 발명을 실시예에 의해 상세히 설명한다.
단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
<실시예 1>
김치로부터 식물성 유산균의 분리
김치 유래의 식물성 유산균을 분리하기 위해, 멸균수를 이용하여 다양한 김치원 시료를 단계적으로 희석하고 MRS(Man Rogosa and Sharpe) 배지에 도말하여 28℃에서 2일간 배양한 후 형태학적 특징을 통해 유산균을 분리하였으며, 16s rRNA 서열 분석을 통해 분리된 균주를 동정하고 20% 글리세롤을 이용하여 -70℃에서 보관하였다.
균주 동정 결과, 락토바실러스 속( Lactobacillus), 페티오코커스 속( Pediococcus), 웨이셀라 속( Weissella), 류코노스톡 속( Leuconostoc) 및 엔테로코커스 속( Enterococcus)에 포함되는 39종(species)의 193개의 균주가 분리되었다.
<실시예 2>
작약 추출물의 유산균 발효물 제조
건조된 작약 뿌리를 파쇄하여 분말화한 후 분말 중량 대비 10배의 물을 혼합하여 121℃에서 15분 동안 열수 추출하였으며, 상기 열수 추출물에 탄산나트륨(Na 2CO 3)을 처리하여 pH 3.6~6.8로 맞추었다. 유산균은 28℃에서 48시간 동안 배양한 후 6×10 9 CFU/㎖의 농도로 작약 열수 추출물에 접종한 후 28℃에서 48시간 동안 정치 발효시켜 상등액(작약 추출물의 유산균 발효물)을 수득하였다. 이 후 수득한 작약 추출물 및 작약 추출물의 유산균 발효물을 감압농축하여 분말화하였다.
<실시예 3>
패오니플로린 대사능을 보유한 유산균 균주의 동정
작약의 추출물이나 작약의 지표성분 중 하나인 패오니플로린 (paeoniflorin)은 당뇨 관련 활성이 알려져 있으나 당뇨병의 치료 활성은 충분하지는 않다고 판단되었기 때문에 본 발명자들은 작약 내 지표성분의 생물전환 활성을 가진 균주를 탐색하고자 하였다.
이러한 균주의 탐색을 위해 작약 건조 중량 1g에 10배의 (w/v) 물을 첨가하여 121도에서 15분간 추출하여 작약 추출물을 제조하였고, 실시예 1에서 분리된 각 균주들을 2 x 10 9 CFU/ml 농도로 접종하여 28도 배양실에서 48시간 정치배양 하였다. 이 후 배양물 (상등액)을 50% 에탄올로 추출하여 TSK-GEL ODS-100V 5㎛ column (4.6mm×15cm)을 이용한 HPLC를 통해 UV 235nm, 15~100% methanol gradient 조건 하에서 크로마토그램 변화를 분석하였다 (도 1a 및 도 1b 참조).
그 결과 분리된 균주 중 류코노스톡 속 LN180020이 특이적으로 패오니플로린으로 예상되는 약 15분 근처의 피크가 줄어들고 14.2분에서 새로운 물질이 피크가 증가하는 것을 확인 하였다 (도 1a 및 도 1b 참조).
<실시예 4>
작약 추출물의 류코노스톡 속( Leuconostoc sp.) LN180020 발효물의 세포 독성 및 항당뇨 효과 확인
<4-1> 세포 독성 확인
작약 추출물의 유산균 발효물의 세포 독성을 확인하기 위해, 마우스 L6 근관세포(myotube)에서 작약 추출물의 유산균 발효물을 농도별(3 및 30 ㎍／㎖)로 처리하고 24시간 이후에 MTT 분석법을 수행하였다.
그 결과, 마우스 L6 근관세포에서 무처리 대조군, 비발효 작약 추출물 처리군 및 작약 추출물의 유산균 발효물 처리군 모두에서 세포 증식에 별다른 영향을 미치지 않는 것을 확인하였고, 이를 통해 작약 추출물의 류코노스톡 속( Leuconostoc sp.) LN180020(KCTC 13719BP) 발효물은 세포독성이 없음을 알 수 있었다(도 2a).
<4-2> 항당뇨 효과 확인
작약 추출물의 유산균 발효물의 항당뇨 효과를 확인하기 위해 마우스 L6 근원세포(myoblast)를 24-웰 배양용기에 세포수 5×10 5 개/㎖로 분주한 후 2일에 한 번씩 분화배지(low glucose (5mM) DMEM, 2% Fetal Bovine Serum, 1% penicillin/streptomyc)로 교체해주며 배양하였다. 배양한지 7일째에 작약 추출물의 유산균 발효물을 농도별(3 및 30 ㎍/㎖)로 전처리하고 30분간 반응시킨 후 [ 14C]2-Deoxy-D-glucose를 처리하여 5분간 반응시켰다. 반응이 끝난 후 마우스 L6 근원세포로 흡수되어 형태가 전환된 [ 14C]2-deoxy-D-glucose-6-phosphate를 방사선 측정기로 측정하여 포도당 흡수율을 측정하였다. 양성 대조군으로는 100 nM 농도의 인슐린(porcine insulin)을 사용하였다.
그 결과, 작약 추출물의 유산균 발효물이 처리된 군에서는 L6 근원세포 내의 [ 14C]2-deoxy-D-glucose-6-phosphate 함량이 무처리 대조구에 비해 약 55%~80% 증가하였고, 비발효 작약 추출물 처리군에 비해 약 25~35% 증가한 것을 확인하였다. 이는 유산균을 이용하여 작약 추출물을 발효시킬 경우 비발효 작약 추출물에 비해 근육세포로의 포도당 흡수를 촉진시켜 항당뇨 활성을 증가시킬 수 있음을 나타내었다. 더욱이, 양성 대조군으로 사용된 인슐린(porcine insulin) 100 nM은 실제 당뇨 치료제로 사용되고 있는 로시글리타존(rosiglitazone) 10 μM(3.57 ㎍/㎖)과 거의 동등한 항당뇨 효과를 나타낸다고 볼 수 있는데, 저농도(3 ㎍/㎖)의 작약 추출물의 유산균 발효물을 처리한 군의 [ 14C]2-deoxy-D-glucose-6-phosphate 함량은 인슐린 100 nM 처리군과 유사하였고, 고농도(30 ㎍/㎖)의 작약 추출물의 유산균 발효물을 처리한 군의 [ 14C]2-deoxy-D-glucose-6-phosphate 함량은 인슐린 100 nM 처리군에 비해 유의적으로 증가하였다(도 2b).
<비교예 1>
작약 추출물의 타 유산균 발효물의 세포 독성 및 항당뇨 효과 확인
<1-1> 세포 독성 확인
락토바실러스 플란타룸 아종 플란타룸( Lactobacillus plantarum subsp. plantarum) LN180155(이하, Df2) 또는 락토바실러스 파라플란타룸( Lactobacillus paraplantarum KACC 12373; 이하, Df3)으로 발효시킨 작약 추출물의 유산균 발효물의 세포 독성을 확인하기 위해, 상기 Df2, Df3를 3, 10, 30, 100㎍/㎖로 각각 처리한 것을 제외하고는 상기 실시예 4-1에서와 동일하게 세포 독성을 확인하였다.
그 결과, 마우스 L6 근관세포에서 무처리 대조군 및 작약 추출물의 유산균 발효물 처리군 모두에서 세포 증식에 별다른 영향을 미치지 않는 것을 확인하였고, 이를 통해 락토바실러스 플란타룸 subsp. 플란타룸(Df2) 또는 락토바실러스 파라플란타룸(Df3)으로 발효시킨 작약 추출물의 유산균 발효물은 세포독성이 없음을 알 수 있었다(도 2c).
<1-2> 항당뇨 효과 확인
작약 추출물의 유산균 발효물의 항당뇨 효과를 확인하기 위해, 상기 Df2, Df3를 3, 10, 30, 100㎍/㎖로 각각 처리한 것을 제외하고는 상기 실시예 4-2에서와 동일하게 포도당 흡수율을 측정하였다.
그 결과, 양성 대조군으로 사용된 인슐린(porcine insulin) 100 nM을 처리한 군은 무처리 대조군에 비해 유의적으로 증가하였으나, 락토바실러스 플란타룸 subsp. 플란타룸 LN180155(Df2) 또는 락토바실러스 파라플란타룸(Df3)으로 발효시킨 작약 추출물의 유산균 발효물이 처리된 군에서는 L6 근원세포 내의 [ 14C]2-deoxy-D-glucose-6-phosphate 함량이 무처리 대조구와 거의 동일한 것을 확인하였다. 다만, 100 ㎍/㎖ 농도의 락토바실러스 파라플란타룸(Df3)으로 발효시킨 작약 추출물의 유산균 발효물을 처리한 군에서 L6 근원세포 내의 [ 14C]2-deoxy-D-glucose-6-phosphate 함량이 무처리 대조군에 비해 다소 증가하였으나 유의적 차이는 없었다(도 2d).
결과적으로 본 발명의 류코노스톡 속( Leuconostoc sp.) LN180020(KCTC 13719BP) 유산균을 이용하여 작약 추출물을 발효시킬 경우 비발효 작약 추출물 및 다른 유산균으로 발효시킨 작약 추출물의 유산균 발효물에 비해 근육세포로의 포도당 흡수를 촉진시켜 항당뇨 활성을 증가시킬 수 있음을 나타내었다. 이러한 효과는 패오니플로린이 류코노스톡 속( Leuconostoc sp.) LN180020(KCTC 13719BP) 유산균에 의해서 새로운 물질로 전환되어 항당뇨 활성이 증가된 것으로 보이며, 따라서, 본 발명의 작약 추출물 유산균 발효물은 당뇨병의 예방 또는 개선에 효과적일 것으로 사료되었다.
<실시예 5>
류코노스톡 속( Leuconostoc sp.) LN180020 유산균의 계통 분석
이에 본 발명의 류코노스톡 속( Leuconostoc sp.) LN180020(KCTC 13719BP) 유산균을 추가적으로 동정하고, 항당뇨 활성이 증가를 보이게한 새로운 물질을 동정하고자 하였다.
류코노스톡 속( Leuconostoc sp.) LN180020(KCTC 13719BP)의 계통 분석을 위해 류코노스톡 속 LN180020의 게놈 DNA를 추출하였다. 16S rRNA 유전자는 프라이머 세트(표 1)를 이용하여 증폭시켰으며, 16S rRNA의 염기 서열(서열번호 1)을 확인한 후 기존에 알려져 있는 류코노스톡 속 서열과 비교하였다.
프라이머 서열 정보
프라이머 명칭 염기서열 (5'→3')
27F-1492R_F AGAGTTTGATCCTGGCTCAG (서열번호 2)
27F-1492R_R CGGTTACCTTGTTACGACTT (서열번호 3)
상기 류코노스톡 속 LN180020의 16S rRNA 염기서열은 BigDye (R) Terminator v3.1 Cycle Sequencing Kits(Applied Biosystems)를 통해 확인하였고, 기존에 알려진 류코노스톡 속 서열은 NCBI 데이터베이스(https://www.ncbi.nlm.nih.gov/), EzTaxon-e server(https://www.eztaxon-e.ezcloud.net/) 및 LPSN( https://www.bacterio.net/nocardioides.html) 데이터베이스를 참조하였으며, 서열 비교 분석은 BioEdit v7.2.6.1, MEGA7 프로그램을 이용하여 수행하였다.
그 결과, 류코노스톡 속 LN180020은 류코노스톡 시트레움( L. citreum) ATCC 49370T와 99.86%로 가장 높은 16S rRNA 서열 상동성을 보였고, 그 다음으로 류코노스톡 홀잡펠리( L. holzapfelii) BFE 7000 T과 99.78%; 류코노스톡 락티스( L. lactis) JCM 6123 T 및 류코노스톡 팔마에( L. palmae) TMW 2.694 T와 98.92%; 류코노스톡 김치( L. kimchii) IMSNU 11154 T와 98.49%; 류코노스톡 겔리둠 subsp. 가시코미타툼( L. gelidum subsp. gasicomitatum) LMG 18811 T과 98.14%; 류코노스톡 메센테로이데스 subsp. 메센테로이데스( L. mesenteroides subsp. mesenteroides) ATCC 8293 T과 97.85%; 류코노스톡 슈도메센테로이데스(L. pseudomesenteroides) NRIC 1777 T과 97.71%; 및 류코토스톡 라피( L. rapi) LMG 27676 T과 97.63%의 16s rRNA 서열 상동성을 보였으며, 이를 통해 김치 유래 류코노스톡 속 LN180020은 류코노스톡 시트레움 ATCC 49370T와 계통학적으로 가장 가까운 종임을 알 수 있었다(도 3).
<실시예 6>
작약 추출물 유산균 발효물의 생물전환 성분 분석
상기 수득된 상등액에 동량의 에탄올을 첨가하여 추출한 후 TSK-GEL ODS-100V 5 ㎛ 컬럼(4.6 mm×15 cm), 25℃, UV 230 nm, 15~100% methanol gradient 조건으로 HPLC(High-performance liquid chromatography)를 수행하여 생물전환 유무를 분석하였다. 상기 생물전환된 물질 규명을 위한 LC-MS(Liquid chromatography mass spectrometry) 분석은 상등액을 메탄올에 용해시키고 Turbolon Spray source(AB SCIEX, Singapore)와 함께 QTrap 3200이 연결된 HPLC 시스템(Luna C18 (2), 100×2.0 mm, 3 μm; guard cartridge system, security guard #KJ 0-4282; Phenomenex, 미국)을 이용하여 수행되었다. 컬럼은 100% 메탄올(A) 및 0.04% 트리플루오로아세트산(trifluoroacetic acid)을 함유하는 HPLC water(B)를 1.0 ㎖/min의 유속으로 25℃에서 유지시켰으며, 샘플은 처음 5분 동안 15 % 메탄올을 흘려준 후 5분에서 20분까지 15%에서 100%까지 메탄올 농도를 순차적으로 증가시켰으며, 20분에서 25분은 100% 메탄올로 유지시키고, 25분에서 35분까지 100%에서 15%까지 메탄올 농도를 감소시켰으며, 이 후 5분 동안은 15% 메탄올로 유지시키며 측정하였다(표 2).
HPLC 조건
HPLC 보유시간(분) A; MeOH(%) B; Water(%)
0-5 15 85
5-20 15-100 85-0
20-25 100 0
25-35 100-15 0-85
35-40 15 85
류코노스톡 속 LN180020에 의해서 전환된 성분을 분석하기 위해 HPLC를 수행한 결과, 작약 추출물 발효물의 보유시간 약 15분 근처에서 지표 물질이 감소하였고(도 1a 및 도 1b), 약 14.2분에서 새로운 유용성분에 해당하는 피크가 증가한 것을 확인하였다. 또한, 상기에서 감소된 지표물질과 새로운 유용성분을 확인하기 위해 각 해당 피크를 silica gel 60G F254 glass plate를 이용한 얇은 막 크로마토그래피(Thin Layer Chromatography) 방법으로 전개용매 메탄올:클로로포름 (1.5:5)에서 분리 및 정제하여 LC-MS 분석을 수행한 결과, 약 15분 근처의 지표물질이 분자량 480.3의 패오니플로린(paeoniflorin)임을 알 수 있었고, 약 14.2분에서의 전환 후 새로운 유용성분 물질은 분자량 642.3으로 확인 되었다(도 4).
<제제예 1>
약학적 제제의 제조
1. 산제의 제조
본 발명에 따른 작약 추출물의 발효물 2 g
유당 1 g
상기의 성분을 혼합하고 기밀포에 충진하여 산제를 제조하였다.
2. 정제의 제조
본 발명에 따른 작약 추출물의 발효물 100 ㎎
옥수수전분 100 ㎎
유 당 100 ㎎
스테아린산 마그네슘 2 ㎎
상기의 성분을 혼합한 후, 통상의 정제의 제조방법에 따라서 타정하여 정제를 제조하였다.
3. 캡슐제의 제조
본 발명에 따른 작약 추출물의 발효물 100 ㎎
옥수수전분 100 ㎎
유 당 100 ㎎
스테아린산 마그네슘 2 ㎎
상기의 성분을 혼합한 후, 통상의 캡슐제의 제조방법에 따라서 젤라틴 캡슐에 충전하여 캡슐제를 제조하였다.
4. 환의 제조
본 발명에 따른 작약 추출물의 발효물 1 g
유당 1.5 g
글리세린 1 g
자일리톨 0.5 g
상기의 성분을 혼합한 후, 통상의 방법에 따라 1환 당 4 g이 되도록 제조하였다.
5. 과립의 제조
본 발명에 따른 작약 추출물의 발효물 150 ㎎
대두추출물 50 ㎎
포도당 200 ㎎
전분 600 ㎎
상기의 성분을 혼합한 후, 30 % 에탄올 100 ㎎을 첨가하여 섭씨 60 ℃에서 건조하여 과립을 형성한 후 포에 충진하였다.
이상 살펴본 바와 같이 본 발명의 류코노스톡 속 LN180020(KCTC 13719BP) 유산균을 이용하여 작약 추출물을 발효시킬 경우 비발효 작약 추출물 및 다른 유산균으로 발효시킨 작약 추출물의 유산균 발효물에 비해 근육세포로의 포도당 흡수를 촉진시켜 항-당뇨 활성을 증가시킬 수 있음을 알 수 있었다. 본 발명의 작약 추출물의 유산균 발효물은 천연 소재인 작약과 김치 유래의 유산균을 사용하여 인체에 부작용이 없으므로, 당뇨병의 예방, 개선 또는 치료용 건강기능식품 및 의약품에 유용하게 활용될 수 있다.
[수탁번호]
기탁기관명 : 한국생명공학연구원
수탁번호 : KCTC13719BP
수탁일자 : 2018.11.20.
Figure PCTKR2019017107-appb-img-000001

Claims (14)

  1. 작약( Paeonia lactiflora) 추출물의 유산균 발효물을 유효성분으로 포함하는 당뇨병의 예방 또는 치료용 약학 조성물.
  2. 제1항에 있어서, 상기 유산균은 류코노스톡 시트레움( Leuconostoc citreum)인 것을 특징으로 하는 당뇨병의 예방 또는 치료용 약학 조성물.
  3. 제1항에 있어서, 상기 유산균은 기탁번호 KCTC 13719BP인 류코노스톡 속( Leuconostoc sp.) LN180020인 것을 특징으로 하는 당뇨병의 예방 또는 치료용 약학 조성물.
  4. 제1항에 있어서, 상기 당뇨병은 제1형 당뇨병, 제2형 당뇨병 및 임신성 당뇨병으로 이루어진 군에서 선택된 것임을 특징으로 하는 당뇨병의 예방 또는 치료용 약학 조성물.
  5. 제1항에 있어서, 상기 유산균 발효물은 근육 세포로의 포도당 흡수를 증가시키는 것을 특징으로 하는 당뇨병의 예방 또는 치료용 약학 조성물.
  6. 제1항에 있어서, 상기 작약 추출물은 물, C 1 내지 C 6의 저급 알콜, 유기용매 또는 이들의 혼합용매를 사용하여 추출한 것을 특징으로 하는 당뇨병의 예방 또는 치료용 약학 조성물.
  7. 작약 추출물의 유산균 발효물을 유효성분으로 포함하는 당뇨병의 예방 또는 개선용 식품 조성물.
  8. 제7항에 있어서, 상기 유산균은 류코노스톡 시트레움( Leuconostoc citreum)인 것을 특징으로 하는 당뇨병의 예방 또는 개선용 식품 조성물.
  9. (a) 패오니플로린을 포함하는 조성물에 류코노스톡 속( Leuconostoc sp.) 유산균을 접종하는 단계;
    (b) 상기 (a) 단계의 수득물을 배양하여 발효시키는 단계를 포함하는 패오니플로린의 전환 방법.
  10. 제9항에 있어서, 상기 패오니플로린의 전환은 패오니플로린의 감소인 것을 특징으로 하는 패오니플로린의 전환 방법.
  11. 당뇨병의 치료용 제제를 제조하기 위한 작약( Paeonia lactiflora) 추출물의 유산균 발효물을 유효성분으로 포함하는 조성물의 용도.
  12. 제11항에 있어서, 상기 유산균은 류코노스톡 시트레움( Leuconostoc citreum)인 것을 특징으로 하는 용도.
  13. 작약( Paeonia lactiflora) 추출물의 유산균 발효물을 유효성분으로 포함하는 조성물의 유효량을 이를 필요로 하는 개체에 투여하는 단계를 포함하는 당뇨병의 치료 방법.
  14. 제13항에 있어서, 상기 유산균은 류코노스톡 시트레움( Leuconostoc citreum)인 것을 특징으로 하는 당뇨병의 치료 방법.
PCT/KR2019/017107 2018-12-06 2019-12-05 작약 추출물의 유산균 발효물을 유효성분으로 포함하는 당뇨병의 예방, 개선 또는 치료용 조성물 WO2020116962A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2018-0155698 2018-12-06
KR20180155698 2018-12-06

Publications (1)

Publication Number Publication Date
WO2020116962A1 true WO2020116962A1 (ko) 2020-06-11

Family

ID=70973671

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/017107 WO2020116962A1 (ko) 2018-12-06 2019-12-05 작약 추출물의 유산균 발효물을 유효성분으로 포함하는 당뇨병의 예방, 개선 또는 치료용 조성물

Country Status (2)

Country Link
KR (1) KR102357880B1 (ko)
WO (1) WO2020116962A1 (ko)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20210147774A (ko) * 2020-05-29 2021-12-07 한국생명공학연구원 신규한 류코노스톡 속 균주 및 이를 이용한 패오니플로린의 생물전환방법
WO2021242043A1 (ko) * 2020-05-29 2021-12-02 한국생명공학연구원 작약 추출물의 유산균 발효물 또는 β-젠티오비오실 패오니플로린을 유효성분으로 포함하는 대사증후군 예방, 치료 또는 개선용 조성물
KR102501177B1 (ko) * 2020-09-16 2023-02-16 한국생명공학연구원 신규한 락토바실러스 플란타럼 균주 및 이를 이용한 패오니플로린의 생물전환방법
KR20230100949A (ko) 2021-12-29 2023-07-06 주식회사 한국인삼공사 작약의 품종을 판별하기 위한 단일염기다형성을 갖는 유전자 마커

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130068317A (ko) * 2011-12-15 2013-06-26 한국 한의학 연구원 소청룡탕 또는 소청룡탕 유산균 발효물을 포함하는 간독성 질환의 예방 및 치료용 약학적 조성물
KR20140052576A (ko) * 2012-10-25 2014-05-07 코웨이 주식회사 식물 발효 추출물을 포함하는 프리바이오틱 화장료 조성물
KR20160006812A (ko) * 2014-07-09 2016-01-20 가천대학교 산학협력단 작약 추출물을 포함하는 당뇨 예방 및 치료용 조성물
KR20180061062A (ko) * 2016-11-28 2018-06-07 콜마비앤에이치 주식회사 여주 추출물, 구절초 추출물 및 작약 추출물을 유효 성분으로 포함하는, 당뇨 예방 또는 개선용 조성물
KR20180093488A (ko) * 2017-02-13 2018-08-22 동인당 주식회사 발효 적송원컴파운드피(Compound-P)의 제조방법

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101424547B1 (ko) * 2011-06-29 2014-08-01 한국 한의학 연구원 뇌 신경 세포 보호 활성을 갖는 십전대보탕의 유산균 발효물 및 이의 용도
KR102488751B1 (ko) * 2012-09-28 2023-01-18 셀가드 엘엘씨 다공성 막, 재료, 복합재, 적층물, 텍스타일 및 관련 방법
KR102043644B1 (ko) * 2017-07-28 2019-11-12 대구한의대학교산학협력단 최종당화산물 생성 저해 효과를 나타내는 주초 작약 추출물 및 이를 유효성분으로 포함하는 항산화 및 주름 개선용 조성물

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130068317A (ko) * 2011-12-15 2013-06-26 한국 한의학 연구원 소청룡탕 또는 소청룡탕 유산균 발효물을 포함하는 간독성 질환의 예방 및 치료용 약학적 조성물
KR20140052576A (ko) * 2012-10-25 2014-05-07 코웨이 주식회사 식물 발효 추출물을 포함하는 프리바이오틱 화장료 조성물
KR20160006812A (ko) * 2014-07-09 2016-01-20 가천대학교 산학협력단 작약 추출물을 포함하는 당뇨 예방 및 치료용 조성물
KR20180061062A (ko) * 2016-11-28 2018-06-07 콜마비앤에이치 주식회사 여주 추출물, 구절초 추출물 및 작약 추출물을 유효 성분으로 포함하는, 당뇨 예방 또는 개선용 조성물
KR20180093488A (ko) * 2017-02-13 2018-08-22 동인당 주식회사 발효 적송원컴파운드피(Compound-P)의 제조방법

Also Published As

Publication number Publication date
KR102357880B1 (ko) 2022-02-03
KR20200069249A (ko) 2020-06-16

Similar Documents

Publication Publication Date Title
WO2020116962A1 (ko) 작약 추출물의 유산균 발효물을 유효성분으로 포함하는 당뇨병의 예방, 개선 또는 치료용 조성물
WO2015122717A1 (ko) 비만 억제 효능을 갖는 신규 유산균 및 이의 용도
WO2011052846A1 (ko) 자생 식물 추출물을 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물
WO2017204374A1 (ko) 혈당 조절 효능을 갖는 신규 유산균 및 이의 용도
WO2020076136A2 (ko) 아커만시아 뮤시니필라 균주 및 이의 용도
WO2018093238A2 (ko) 포름산 생성능이 우수한 균주를 유효성분으로 포함하는 비만 또는 비만으로 야기된 대사증후군의 예방 또는 치료용 조성물
WO2020130471A1 (ko) 체중 또는 체지방 감소 효능을 갖는 신규 유산균 및 이의 용도
WO2021261632A1 (ko) 신규한 피칼리박테리움 프로스니치 균주 eb-fpdk11 및 그의 용도
WO2023055188A1 (ko) 신규 프로바이오틱스 및 이의 용도
WO2018062914A1 (ko) 신규한 락토바실러스 사케이 및 이를 포함하는 조성물
WO2018164468A1 (en) Bacillus amyloliquefaciens gf423 strain, and composition for providing antioxidant and anti-inflammatory activities or preventing or treating hyperlipidemia, including polypeptide produced by the same
EP2575842A2 (en) A composition comprising the extract of physalis alkekengi var. francheti hort as an active ingredient for preventing and treating inflammatory diseases
WO2016072655A1 (ko) 결명자 유산균 발효물을 유효성분으로 하는 변비 개선, 치료 또는 예방용 조성물 및 그 제조방법
WO2021080297A1 (ko) 달맞이꽃 추출물을 유효성분으로 포함하는 비만 또는 비만으로부터 유도된 대사증후군의 예방 또는 치료용 조성물
WO2024048934A1 (ko) 체지방 감소용 신규 유산균 락티플랜티바실러스 플란타룸 sko-001 및 이의 용도
WO2012134172A2 (ko) 오미자 에틸아세테이트 분획물 또는 이로부터 분리한 우웨이지수 ｃ를 유효성분으로 포함하는 비만 예방 또는 치료용 조성물
WO2011074765A2 (ko) 한약재 발효물을 유효성분으로 포함한 비만 또는 고지혈증의 예방 및 치료용 조성물
WO2020242113A1 (ko) 인디안구스베리 추출물과 새싹보리 추출물의 복합물(ib복합물)을 유효성분으로 포함하는 비만 및/또는 당뇨를 동반하는 대사증후군의 예방, 개선 치료용 조성물
WO2022039514A1 (ko) 락토바실러스 사케이 또는 이로부터 유래된 세포밖 소포체를 유효성분으로 포함하는 뇌질환의 치료용 조성물
WO2021080298A1 (ko) 엔테로코커스 패칼리스를 유효성분으로 함유하는 비만 또는 비만으로부터 유도된 대사증후군의 예방 또는 치료용 조성물
WO2021261631A1 (ko) 신규한 피칼리박테리움 프로스니치 eb-fpdk9 균주 및 그의 용도
WO2009151236A2 (en) The composition comprising extracts or fractions of magnolia obovata thunb for treating and preventing inflammation disease
WO2019078381A1 (ko) 엔테로코커스 패칼리스, 이의 배양액 또는 이의 사균체를 유효성분으로 함유하는 근육감퇴, 약화 및 근위축 예방, 개선 또는 치료용 약학 조성물, 식품 조성물 및 식품첨가제
WO2022015033A1 (ko) 페디오코쿠스 이노피나투스 또는 이로부터 유래된 세포밖 소포체를 유효성분으로 포함하는 뇌질환의 치료용 조성물
WO2021242043A1 (ko) 작약 추출물의 유산균 발효물 또는 β-젠티오비오실 패오니플로린을 유효성분으로 포함하는 대사증후군 예방, 치료 또는 개선용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19892001

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19892001

Country of ref document: EP

Kind code of ref document: A1