WO2020116941A2 - 디카르복시산 생산을 위한 미생물 및 이를 이용한 디카르복시산 생산방법 - Google Patents

디카르복시산 생산을 위한 미생물 및 이를 이용한 디카르복시산 생산방법 Download PDF

Info

Publication number
WO2020116941A2
WO2020116941A2 PCT/KR2019/017044 KR2019017044W WO2020116941A2 WO 2020116941 A2 WO2020116941 A2 WO 2020116941A2 KR 2019017044 W KR2019017044 W KR 2019017044W WO 2020116941 A2 WO2020116941 A2 WO 2020116941A2
Authority
WO
WIPO (PCT)
Prior art keywords
strain
gene
plasmid
candida tropicalis
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2019/017044
Other languages
English (en)
French (fr)
Other versions
WO2020116941A3 (ko
Inventor
김경헌
바브티루말라이자나
김도형
이종화
이정무
이호창
오성호
김수한
현창석
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea University Research and Business Foundation
Original Assignee
Korea University Research and Business Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Korea University Research and Business Foundation filed Critical Korea University Research and Business Foundation
Priority to US17/299,194 priority Critical patent/US11873517B2/en
Priority to CN201980091207.5A priority patent/CN113748210B/zh
Publication of WO2020116941A2 publication Critical patent/WO2020116941A2/ko
Publication of WO2020116941A3 publication Critical patent/WO2020116941A3/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/18—Carboxylic ester hydrolases (3.1.1)
    • C12N9/20—Triglyceride splitting, e.g. by means of lipase
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/39—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
    • C07K14/40—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts from Candida
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/44—Polycarboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/01—Carboxylic ester hydrolases (3.1.1)
    • C12Y301/01003—Triacylglycerol lipase (3.1.1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/72—Candida
    • C12R2001/74—Candida tropicalis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/01—Carboxylic ester hydrolases (3.1.1)

Definitions

  • the present invention relates to a microorganism having improved resistance to cytotoxicity of a substrate, including a mutant gene, and a method for producing decarboxylic acid (DCA) using the same.
  • Dicarboxylic acid is an organic compound containing two carboxy groups (-COOH).
  • the general molecular formula of dicarboxylic acid can be written as HO 2 CR-CO 2 H (where R can be aliphatic or aromatic).
  • dicarboxylic acids exhibit similar chemical reactions and reactivity to monocarboxylic acids.
  • Dicarboxylic acids are also used in the manufacture of copolymers such as polyamides and polyesters.
  • the most widely used dicarboxylic acid in the industry is adipic acid, a precursor to nylon production.
  • Other examples of dicarboxylic acids are the two amino acids in the human body: aspartic acid and glutamic acid.
  • Other carboxylic acids are also used in various industries.
  • dicarboxylic acids are manufactured by chemical processes or biological methods.
  • the synthesis of sebacic acid which is one of dicarboxylic acids, is also possible by phenol and cresol, but castor oil oxidation is known as the most environmentally friendly and cost competitive method.
  • the castor oil undergoes transesterification through steam cracking, thereby producing ricinoleic acid.
  • the produced ricinoleic acid is heated at 250°C and mixed with alkali such as molten caustic soda, it is separated into capryl alcohol (2-octanol) and sebacic acid by caustic digestion. Purification of the product thus produced results in high purity sebacic acid (US Pat. No.
  • Candida tropicalis strains that produce dicarboxylic acids and have improved resistance to cytotoxic substrates through an evolutionary method to select strains with enhanced production capacity of dicarboxylic acids, from which The present invention was completed by identifying genes that influence substrate resistance.
  • the object of the present invention is LIP1 (lipase) gene represented by the nucleotide sequence of SEQ ID NO: 1, FAT1 (fatty acid transport) gene represented by the nucleotide sequence of SEQ ID NO: 2 and MRP1 (multidrug resistance) represented by the nucleotide sequence of SEQ ID NO: 3 protein) to provide a Candida tropicalis strain having enhanced resistance to cytotoxicity of a substrate, in which one or more of the genes are mutated or one or more of the mutated genes are introduced.
  • LIP1 lipase gene represented by the nucleotide sequence of SEQ ID NO: 1
  • FAT1 fatty acid transport gene represented by the nucleotide sequence of SEQ ID NO: 2
  • MRP1 multidrug resistance
  • Another object of the present invention is to provide a method for producing a dicarboxylic acid by culturing the Candida tropicalis strain with a substrate.
  • the present invention is represented by the LIP1 (lipase) gene represented by the nucleotide sequence of SEQ ID NO: 1, the FAT1 (fatty acid transport) gene represented by the nucleotide sequence of SEQ ID NO: 2 and the nucleotide sequence of SEQ ID NO: 3
  • LIP1 lipase
  • FAT1 fatty acid transport gene represented by the nucleotide sequence of SEQ ID NO: 2
  • nucleotide sequence of SEQ ID NO: 3 Provided is a Candida tropicalis strain having enhanced resistance to a substrate exhibiting cytotoxicity, in which one or more of the MRP1 (multidrug resistance protein) genes are mutated or one or more of the mutated genes is introduced.
  • a normal Candida tropicalis strain was cultured in a medium containing a substrate that exhibits cytotoxicity, and thus strains having excellent viability against the substrate were selected for evolution, and genome analysis of the selected strain
  • LIP1 lipase
  • FAT1 fatty acid transport
  • MRP1 fatty acid transport
  • LIP1 lipase
  • SEQ ID NO: 1 The nucleotide sequence of the gene mt LIP1 (lipase) is SEQ ID NO: 4, the mutation of FAT1 (fatty acid transport) represented by the nucleotide sequence of SEQ ID NO: 2
  • the base sequence of the gene mt FAT1 (fatty acid transport) is SEQ ID NO: 5, or the base sequence of the mutant gene mt MRP1 (multidrug resistance protein) of the MRP1 (multidrug resistance protein) gene represented by the base sequence of SEQ ID NO: 3 It can be indicated by the number 6.
  • the vector may be a form in which the genes are operatively linked.
  • the term, "operably linked” may generally affect the expression of the nucleotide sequence encoding the nucleotide sequence encoding the desired protein and the nucleotide sequence control sequence to perform a function. Operable linkages with vectors can be made using known genetic recombination techniques in the art, and site-specific DNA cleavage and linkage can be made using cleavage and linkage enzymes in the art.
  • the term “vector” refers to any medium for cloning and/or transfer of a base to a host cell.
  • the vector may be a replication unit (replicon) capable of binding to other DNA fragments to obtain replication of the combined fragments.
  • “Replication unit” refers to any genetic unit (eg, plasmid, phage, cosmid, chromosome, virus) that functions as an autologous unit of DNA replication in vivo, ie is replicable by its own control.
  • the term “vector” can include viral and non-viral mediators for introducing a base into a host cell in vitro, ex vivo or in vivo.
  • the term “vector” can also include minispherical DNA.
  • the vector can be a plasmid that does not have a bacterial DNA sequence.
  • the term “vector” can also include transposons such as Sleeping Beauty (Izsvak et.al. J. MoI. Biol. 302:93-102 (2000)), or artificial chromosomes. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophage. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A, etc. can be used as a phage vector or a cosmid vector, and a plasmid vector can be used.
  • the vector usable in the present invention is not particularly limited, and known expression vectors can be used.
  • the Candida tropicalis strain may express the mutated gene or include a vector containing the mutated gene.
  • the Candida tropicalis strain may be a strain in which a beta-oxidation pathway is blocked, and specifically, a beta-oxidation pathway may be blocked to produce a dicarboxylic acid using a substrate.
  • the substrate may be a fatty acid methyl ester (FAME), and the substrate exhibits cytotoxicity against a Candida tropicalis strain producing dicarboxylic acid.
  • the fatty acid methyl ester may be one of fatty acid methyl esters containing a C 6 -C 20 alkylene group. More specifically, the fatty acid methyl ester may be DAME (Decanoic acid methyl ester).
  • LIP1 lipase gene represented by the nucleotide sequence of SEQ ID NO: 1
  • FAT1 fatty acid transport gene represented by the nucleotide sequence of SEQ ID NO: 2
  • the Candida tropicalis strain in which one or more of the MRP1 (multidrug resistance protein) genes are mutated or the Candida tropicalis strain in which one or more of the mutated genes are introduced has enhanced resistance to the cytotoxicity of the fatty acid methyl ester, thereby enhancing the substrate It was confirmed that the viability was excellent.
  • the present invention is represented by the LIP1 (lipase) gene represented by the nucleotide sequence of SEQ ID NO: 1, the FAT1 (fatty acid transport) gene represented by the nucleotide sequence of SEQ ID NO: 2 and the nucleotide sequence of SEQ ID NO: 3
  • LIP1 lipase
  • FAT1 fatty acid transport
  • SEQ ID NO: 2 the nucleotide sequence of SEQ ID NO: 3
  • Candida tropicalis strain with enhanced resistance to the cytotoxicity of the substrate in which one or more of the MRP1 (multidrug resistance protein) genes are mutated or one or more of the mutated genes are introduced, together with the substrate It provides a method for producing dicarboxylic acid (DCA), including culturing.
  • DCA dicarboxylic acid
  • the method for producing the dicarboxylic acid of the present invention uses the above-mentioned Candida tropicalis strain as it is, the contents common to the two are omitted to avoid excessive complexity of the present specification.
  • the Candida tropicalis strain may be a strain in which a beta-oxidation pathway is blocked.
  • the substrate required for dicarboxylic acid production of the Candida tropicalis strain may be fatty acid methyl ester (FAME), and the substrate exhibits cytotoxicity against the Candida tropicalis strain producing dicarboxylic acid.
  • the fatty acid methyl ester may be one of fatty acid methyl esters having an alkyl chain of C 6 -C 20 .
  • the beta-oxidation pathway is blocked LID1 (lipase) gene represented by the nucleotide sequence of SEQ ID NO: 1 mutated to Candida tropicalis strain, FAT1 represented by the nucleotide sequence of the mutated SEQ ID NO: 2 A fatty acid transport ( MCT ) gene and a mutant strain in which one or more of the MRP1 (multidrug resistance protein) genes represented by the nucleotide sequence of SEQ ID NO: 3 were introduced were prepared to perform dicarboxylic acid production experiments.
  • LID1 lipase
  • FAT1 represented by the nucleotide sequence of the mutated SEQ ID NO: 2
  • MCT fatty acid transport
  • MRP1 multidrug resistance protein
  • the mutant Candida tropicalis strain of the present invention has better production capacity of the dicarboxylic acid. This is judged as a result of improved resistance to the cytotoxicity of Candida tropicalis to the cytotoxicity of the substrate through mutation of the gene disclosed above.
  • the Candida tropicalis strain for production of dicarboxylic acid developed through the present invention not only has improved resistance to the existing toxic substrate, but also the production efficiency of dicarboxylic acid has increased significantly compared to the existing strain, so it can be applied to the biological production process of dicarboxylic acid. It is expected to have high industrial utilization.
  • DAME decanoic acid methyl ester
  • DA decanoic acid
  • SA sebacic acid
  • Figure 2 shows the growth curve of the mutant Candida tropicalis strains according to generation (generation time): E1 (170 generation time), E2 (470 generation time), E4 (700 generation time), E5 (720 generation time) and ES5.
  • Figure 3 shows the results of measuring the dry cell weight (DCW, Dry Cell Weight) of each mutant Candida tropicalis strains (WT, E5 and ES5).
  • Figure 4 shows the results of analyzing the consumption of DAME in the medium of each mutant Candida tropicalis strains (WT, E5 and ES5).
  • Figure 5 shows the results of analyzing the sebacic acid production of each mutant Candida tropicalis strains (WT, E5 and ES5).
  • Figures 6 to 8 shows the drying of the mutant Candida tropicalis strain (mtSAP1) in which the mt LIP1 gene was introduced, the strain in which the parental strain ⁇ -oxidation pathway was removed ( ⁇ -KO), and the strain in which the LIP1 gene was introduced (SAP1). It shows the results of comparative analysis of the total amount of cells (FIG. 6), consumption of DAME (FIG. 7) and sebaic acid production (FIG. 8).
  • FIGS. 9 to 11 are drying of a mutant Candida tropicalis strain (mtSAP2) in which the mt FAT1 gene is introduced, a strain in which the parental strain ⁇ -oxidation pathway is removed ( ⁇ -KO), and a strain in which the FAT1 gene is introduced (SAP2). It shows the results of comparative analysis of the total amount of cells (FIG. 9), consumption of DAME (FIG. 11) and sebaic acid production (FIG. 11).
  • FIG. 15 is a schematic diagram of a plasmid vector for Candida tropicalis transfection including mt LIP1 gene, mt FAT1 gene and mt MRP1 gene.
  • 16 to 18 are mt LIP1 gene, mt FAT1 gene and mt MRP1 gene, two or more genes are introduced mutant Candida tropicalis strain total amount of dried cells (Fig. 16), DAME consumption (Fig. 17) and sebacic acid production Fig. 18 shows the results of the analysis.
  • Figure 19 shows the cells of the mutant Candida tropicalis strain (mtSAP7) and the parent strain ( ⁇ -KO) in which the mt LIP1 gene, mt FAT1 gene, and mt MRP1 gene were introduced into the C10 fatty acid methyl ester (FAME) substrate. It shows the result of toxic resistance measured by measuring the total amount of dry cells and the amount of dicarboxylic acid.
  • FIG. 20 is a mutant Candida tropicalis strain (mtSAP7) and a parent strain ( ⁇ -KO) in which mt LIP1 gene, mt FAT1 gene and mt MRP1 gene are introduced into C8 to C12 fatty acid methyl ester (FAME) substrates. It shows the result of confirming the cytotoxic resistance of the total amount of dry cells and dicarboxylic acid production.
  • DAME Decanoic acid methyl ester
  • a toxicity test was conducted under the following conditions. More specifically, the Candida tropicalis MYA_3404 strain, which was previously used for the production of sebacic acid, was added with DAME, DA and sebacic acid at a concentration of 5 g/L, respectively, and YNB medium (yeast extract 10 g/L, peptone 20 g/L) Cultured in The incubation temperature was 30°C and incubated at 200 rpm for 36 hours.
  • YNB medium yeast extract 10 g/L, peptone 20 g/L
  • C. tripicalis MYA_3404 strain was cultured in YNB medium (yeast extract 10 g/L, peptone 20 g/L) to which DAME at a concentration of 10 g/L was added to develop a strain resistant to DAME, a cytotoxic substrate. Did. At this time, the concentration of DAME in the medium was confirmed to maintain about 0.45 g/L (maximal solubility) due to the low solubility of the DAME substrate (confirmed through internal experiment results). The growth curve of the inoculated strain was confirmed by measuring the absorbance value at 600 nm wavelength.
  • the absorbance of the medium inoculated with the strain was observed in real time, and when the growth of the strain reached the mid-exponential phase, it was passaged with a new medium.
  • the specific growth rate was determined from the measured absorbance values and the strains at which the specific growth rate was significantly changed were E1 (170 generation time), E2 (470 generation time), E4 (700 generation time), and E5 (720 generation time), respectively. Decided.
  • the E5 strain obtained by the above method was subcultured in YNB medium (yeast extract 10 g/L, peptone 20 g/L) to which 20 g/L glucose, a non-toxic carbon source, was added, and then cultured on a DAME substrate to re-cultivate the carbon source. After replacement, strains that remain resistant to DAME were selected and named ES5.
  • the actual DAME substrate consumption and sebacic acid production of the mutant strains E5 and ES5 obtained through Example 2 were compared with the parent strain (WT).
  • WT, E5, and ES5 strains were cultured for 120 hours at 30° C. in a YNB medium to which DAME at a concentration of 10 g/L was added.
  • Samples for GC/MS analysis for DAME analysis were prepared as follows. 4 mL of the collected culture was mixed with 1 mL of 10 M HCL and vortexed for 1 minute. The same amount of hexan is added to the above mixture, incubated at room temperature for 10 minutes, and after 10 minutes, the mixture is well mixed by vertex and centrifuged at 12,000 rpm for 1 minute. Haxane is collected from the mixture divided into two layers and used for GC/MS analysis. Samples for sebacic acid analysis are mixed after adding 10 M HCL to the collected samples as in the previous DAME analysis. After that, the same amount of ethyl acetate is added, mixed, and the ethyl acetate layer is collected and dried completely using a vacuum concentrator.
  • DAME and sebacic acid were purchased (Sigma-Aldrich, St Louis, MO, USA), diluted to a certain ratio, and then samples were prepared for analysis in the same manner as above, and analyzed by GC/MS. As a result of analyzing the amount of DAME in the medium using GC/MS for the collected sample, as shown in FIG.
  • transcript analysis of the ES5 strain grown in the medium to which DAME was added and the ES5 strain grown in the medium to which DAME was not added was performed.
  • RNA extraction was performed using the RNeasy Mini Kit (Qiagen, Hilden, Germany), and the concentration and purity of the extracted RNA were NanoDrop (Thermo Scientific, Wilmington, DE, USA) and Agilent Bioanalyzer 2100 (Santa Clara, Ca, USA), respectively. It was measured using.
  • LIP1 lipase, Uniprot.ID: C5M8S7
  • FAT1 Fatty Acid Transport Protein, Uniprot.ID: C5M964
  • MRP1 Multidrug resistance Protein CDR1, Uniprot.ID: C5M804
  • LIP1 SEQ ID NO: 1
  • FAT1 SEQ ID NO: 2
  • MRP1 Multidrug resistance Protein CDR1, Uniprot.ID: C5M804
  • Plasmid used in this study Plasmid Description pET21a Escherichia coli expression vector, AmpR pAUR123 Low copy number yeast expression vector, AurA R for yeast, and Amp R for E. coli pRS420 High copy number yeast expression vector, G418R for yeast, and Amp R for E.
  • Cloning was performed as follows to prepare the C. tropicalis strains each overexpressing the same mutant gene (mt LIP1 ) selected in Example 5 and the same (non-mutant) gene ( LIP1 ) in the parent strain.
  • ADH promotor (ADHpro, XhoI/SalI restriction enzyme site), ADH terminator (ADHter, XbaI/NotI restriction enzyme site)
  • ADHpro_F/R primer ADHter_F/R primer It was amplified using Table 6) and preferentially introduced to prepare plasmid 6.
  • genomic DNA extracted from C. tropicalis MYA_3404 strain and C.
  • tropicalis ES5 strain was amplified using LIP1 -F primer and LIP1 _R primer (Table 5), and the obtained DNA fragments were already produced.
  • the plasmid 6 was ligated to the SalI and XbaI restriction enzyme sites. This, the plasmid is introduced into a plasmid 8 finally LIP1 LIP1 mt 7 and is introduced through were obtained (Table 7). Subsequently, Plasmid 7 and 8 were trasformed with C. tropicalis 20962, where ⁇ -oxidation pathway was removed, and finally C. tropicalis_ LIP1 and C. tropicalis_ mtLIP1 strains were produced.
  • the phenotype changes of the strains incorporating the LIP1 gene and the mt LIP1 gene were compared with the control group ( C. tropicalis strain with ⁇ -oxidation pathway removed, ⁇ -KO). As a result, as shown in FIG. 6, it was confirmed that the growth of the strains incorporating LIP1 and mt LIP1 was enhanced compared to the ⁇ -KO strain, and in particular, the strain incorporating mt LIP1 showed the maximum DCW value (about 1.2 g/L). .
  • Example 6-1 Similarly to the FAT1 phenotype of the introduction of the strain and mt FAT1 transgenic strains genes change control ( ⁇ - oxidized path is removed C. tropicalis strain, ⁇ -KO) were compared with. From the genomic DNA of the C. tropicalis MYA_3404 strain and C. tropicalis ES5 strain used in Example 6-1, the DNA fragments amplified with FAT1 _F, FAT1 _R primers (Table 6) of SalI, XbaI of pRS420 vector in plasmid 6 are restricted. the plasmid is introduced into a plasmid 10 finally FAT1 9 and mt FAT1 enzyme is introduced by ligation to the position were produced (Table 7). The produced plasmids 9 and 10 were subsequently trasformed with C. tropicalis 20962, where ⁇ -oxidation pathway was removed, and finally C. tropicalis_ FAT1 and C. tropicalis_ mtFAT1 strains were produced.
  • the strains introduced ⁇ -KO strain and FAT1 did not show a significant difference, but the strain introduced mt FAT1 showed high DCW value (about 1.5 g/L), resulting in mutation in the FAT1 gene. Therefore, it was confirmed that the growth of the cells was greatly enhanced.
  • the ⁇ -KO strain hardly consumed DAME, and the FAT1- introduced strain also showed no significant difference when compared to the ⁇ -KO strain, but the mt FAT1- introduced strain was compared to the control group. It showed that the substrate consumption was relatively high, and it was confirmed that the substrate corresponding to about 70% of the total was consumed for 120 hours (FIG.
  • the phenotype changes of the strains in which the MRP1 gene and the mt MRP1 gene were introduced were compared with the control group ( C. tropicalis strain with ⁇ -oxidation pathway removed, ⁇ -KO).
  • the vector used for cloning was a pRS420 vector into which ADHpro and ADHter were used to construct plasmid 6 and was amplified with MRP1 _F and MRP1 _R primers and ligated to the SalI/XhoI restriction enzyme site.
  • palsmid 11 and 12 were produced, and the produced plasmid was finally trasformed to C. tropicalis 20962 with the ⁇ -oxidation pathway removed to finally produce C. tropicalis_ MRP1 and C. tropicalis_ mtMRP1 strains.
  • a strain for high production of sebacic acid ( C. tropicalis mtSAP7) in which all of the mt LIP1 , mt FAT1 , and mt MRP1 genes whose effects were confirmed through the previous examples was introduced was produced.
  • ADHpro1, ADHpro2, ADHpro3 and ADH terminator (ADHter1, ADHter2, ADHter3), which enhance expression of each gene, were introduced together.
  • the more specific strain production process is as follows.
  • DNA fragments (ADHpro1) amplified by PCR from pAUR123 vector using P1_F and P1_R primers at the BamI/SAlI restriction enzyme positions of pET21a vector selected for cloning were ligated using T4 DNA ligase to construct plasmid 13.
  • a Q5 High-Fidelity Master mix BioLabs, Ipswich, MA, USA was used, and the same reagent was used in all subsequent experiments.
  • plasmid 14 was produced by continuously adding the PmlI restriction enzyme sequence (CACGTG) after the restriction enzyme SalI sequence of the forward primer.
  • Plasmid 15 was prepared by ligating the DNA fragment (ADHter1) amplified with P3_F and P3_R primers from pAUR123 vector to the SalI/Btrl restriction enzyme site of plasmid 14.
  • Plasmid 16 For the production of Plasmid 16, the previously produced plasmid 15 was used as a backborn.
  • the plasmid 16 was produced by ligating the DNA fragment (ADHpro1) amplified using P1_F and P1_R primers as Plasmid 13 to the BamHI/SalI restriction enzyme position of plasmid 15.
  • mt FAT1 fragments were obtained through PCR using P5_F and P5_R primers as genomic DNA of the C. tropicalis ES5 strain as a template. This was ligated to the NotI restriction enzyme site of plasmid 17 to construct plasmid 18. Additionally, the amplified mt FAT1 fragment was subsequently introduced into the NotI restriction site of plasmid 15 for the construction of the final plasmid, which was named plasmid 19.
  • ADHter2 fragment and ADHpro3 fragment were obtained through PCR using P6_F and P6_R primers as temlate plasmlate. Got. At this time, by adding PmlI in front of the XhoI restriction enzyme site of the P6_R primer, it was subsequently used for the production of plasmid 21.
  • the plasmid 21 was completed by ligation of the DNA fragment (ADHter3) amplified with P7_F and P7_R primers from the pAUR123 vector at the positions of PmlI and XhoI restriction enzymes of the plasmid 20 already prepared.
  • Plasmid 25 was produced by ligation of the DNA fragment to the BamHI and XhoI restriction sites of pRS420 by PCR. The produced Plasmid 25 was finally transfected with C. tropicalis 20962 from which ⁇ -oxidation pathway was removed to finally produce a C. tropicalis_ mtSAP7 strain.
  • the composition of the final plasmid 25 and the restriction enzyme used are shown in FIG. 15.
  • the C. tropicalis_ mtSAP7 strain and C. tropicalis 20962 ( ⁇ -KO) strain from which the ⁇ -oxidation pathway was removed were fermented under the same conditions to confirm the effect of the three introduced genes.
  • the OD was first cultured so that 200 g/L DAME was added as a substrate and cultured at 30° C. for 250 hours when 80 hours had elapsed after the culture.
  • Example 6 the production of sebacic acid from DAME was further compared to the control strain, as shown in Example 6, as to the ability to produce dicarboxylic acids from various FAME substrates. .
  • the dicarboxylic acid is also significantly increased yields of C 8 to C FAME in the substrate of 12 C. tropicalis strains mtSAP7 a C 8 to C 12, as shown in Fig.
  • the mutant C. tropicalis mtSAP7 strain of the present invention shows strong resistance to the FAME substrate showing cytotoxicity, and thus it is judged that the FAME as a substrate will greatly contribute to the improvement of productivity of the dicarboxylic acid (FIG. 20).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)

Abstract

본 발명은 돌연변이 유전자를 포함하는, 기질의 세포독성에 대한 내성이 향상된 캔디다 트로피칼리스 균주 및 이를 이용한 디카르복시산의 생산 방법에 관한 것이다. 본 발명을 통해 개발한 디카르복시산 생산용 캔디다 트로피칼리스 균주는 기존의 독성기질에 대한 내성이 증진되었을 뿐만 아니라 디카르복시산의 생산 효율 또한 기존의 균주에 비해 월등히 증가하였으므로 디카르복시산의 생물학적 생산공정에 적용이 가능하여 산업적 활용도가 높을 것으로 예상된다.

Description

디카르복시산 생산을 위한 미생물 및 이를 이용한 디카르복시산 생산방법
본 발명은 돌연변이 유전자를 포함하는, 기질의 세포독성에 대한 내성이 향상된 미생물 및 이를 이용한 디카르복시산(decarboxylic acid, DCA)의 생산 방법에 관한 것이다.
디카르복시산(dicarboxylic acid, DCA)은 두 개의 카르복시기 (-COOH)를 함유한 유기화합물이다. 디카르복시산의 일반 분자식은 HO2C-R-CO2H (여기서 R은 지방족 또는 방향족이 될 수 있음)으로 쓸 수 있다. 일반적으로 디카르복시산은 모노카르복시산과 유사한 화학 반응 및 반응성을 나타낸다. 디카르복시산은 또한 폴리아미드 및 폴리에스테르와 같은 공중합체의 제조에 사용된다. 업계에서 가장 널리 사용되는 디카르복시산은 아디핀산(adipic acid)으로 나일론 생산의 전구체이다. 디카르복시산의 다른 예로는 인체의 두 가지 아미노산인 아스파르트산과 글루타민산이 있다. 이 외의 다른 카르복시산들도 다양한 산업분야에서 활용되고 있다.
이와 같은 디카르복시산들은 화학적 공정 또는 생물학적인 방법에 의해 제조되고 있다. 디카르복시산 제조와 관련한 일 예로, 디카르복시산 중 하나인 세바식산의 합성은 phenol과 cresol에 의해서도 가능하지만 castor oil oxidation이 가장 친환경적이고 가격 경쟁력이 있는 방법으로 알려져 있다. castor oil은 steam cracking을 통해 transesterification이 일어나며 이를 통해 ricinoleic acid를 생산하게 된다. 이렇게 생산된 ricinoleic acid를 250℃에서 가열 후 molten caustic soda 등과 같은 alkali와 혼합하면 caustic digestion에 의해 capryl alcohol (2-octanol)과 세바식산으로 분리된다. 이렇게 생산된 생산물을 정제하면 높은 순도의 세바식산을 얻게 된다 (미국특허 제 5,952,517호, 미국특허 제 6,392,074호). 하지만 이를 위해서는 300℃ 이상의 고온 공정이 필요하고 황산과 같은 강산이 사용되며 중금속, 독성 유기용매 등과 같은 물질들을 사용함에 따라 환경오염 물질들을 대량으로 발생 시킨다는 문제점이 있다. 세바식산의 제조를 위한 화학적인 방법으로는 이 외에도 아디프산 모노에틸칼륨염을 전해함으로써 생산이 가능하다.
이전 연구를 통해 ω-oxidation capacity가 우수하고 β-oxidation이 차단된 캔디다 트로피칼리스 (Candida tropicalis)균주를 사용하여 생물학적으로 디카르복시산을 생산하는 사례가 보고되었으나 세포독성을 나타내는 기질에 대한 내성이 강하지 않아 디카르복시산을 효율적으로 생산하지 못한다는 한계가 있어 왔다. (비특허문헌 1, David L. Craft, et al., Applied and Environmental Microbiology, 69(10): 5983-5991, 2003). 특히, 국내 특허(출원번호 10-2015-0149253)를 통해 돌연변이 캔디다 트로피칼리스 (Candida tropicalis)균주를 사용하여 세포독성을 가지는 기질로부터 세바식산을 생산한 연구가 있으나 내성증진 요인과 세바식산 생산 경로에 대한 연구는 보고되어진 바 없다. 따라서 생물학적인 방법으로 디카르복시산을 대량 생산할 수 있는 유용한 균주의 개발이 중요하다.
이에 본 발명자들은 디카르복시산을 생산하는 캔디다 트로피칼리스 (Candida tropicalis)균주를 가지고 진화적인 방법을 통하여 세포독성이 있는 기질에 대한 내성이 향상되어 디카르복시산의 생산능이 증진된 균주를 선별하고, 이로부터 상기 기질 내성에 영향을 주는 유전자를 확인함으로써, 본 발명을 완성하였다.
[선행기술문헌]
[특허문헌]
한국공개공보 제10-2017-0048763호
[비특허문헌]
David L. Craft, et al., Applied and Environmental Microbiology, 69(10): 5983-5991, 2003
본 발명의 목적은 서열번호 1의 염기서열로 표시되는 LIP1(lipase) 유전자, 서열번호 2의 염기서열로 표시되는 FAT1(fatty acid transport) 유전자 및 서열번호 3의 염기서열로 표시되는 MRP1(multidrug resistance protein) 유전자 중 어느 하나 이상의 유전자가 돌연변이 되거나, 상기 돌연변이된 유전자 중 하나 이상이 도입된, 기질의 세포독성에 대한 내성이 증진된 캔디다 트로피칼리스(Candida tropicalis) 균주를 제공하기 위한 것이다.
본 발명의 다른 목적은 상기 캔디다 트로피칼리스(Candida tropicalis) 균주를 기질과 함께 배양하여 디카르복시산을 생산하는 방법을 제공하기 위한 것이다.
상기 목적을 달성하기 위하여, 본 발명은 서열번호 1의 염기서열로 표시되는 LIP1(lipase) 유전자, 서열번호 2의 염기서열로 표시되는 FAT1(fatty acid transport) 유전자 및 서열번호 3의 염기서열로 표시되는 MRP1(multidrug resistance protein) 유전자 중 어느 하나 이상의 유전자가 돌연변이 되거나, 상기 돌연변이된 유전자 중 하나 이상이 도입된, 세포독성을 나타내는 기질에 대한 내성이 증진된 캔디다 트로피칼리스(Candida tropicalis) 균주를 제공한다.
일 실시예에서, 정상의 캔디다 트로피칼리스(Candida tropicalis) 균주를 세포독성을 나타내는 기질이 포함된 배지에서 배양함으로써 진화적으로 상기 기질에 대하여 생존능이 우수한 균주를 선별하였고, 상기 선별된 균주의 유전체 분석을 통하여 균주의 내재유전자인 서열번호 1의 염기서열로 표시되는 LIP1(lipase) 유전자, 서열번호 2의 염기서열로 표시되는 FAT1(fatty acid transport) 유전자 및 서열번호 3의 염기서열로 표시되는 MRP1(multidrug resistance protein) 유전자 중 하나 이상의 유전자가 돌연변이 되었음을 확인하였다. 또한, 상기 돌연변이된 유전자를 분리하여, 독립적으로 정상의 캔디다 트로피칼리스(Candida tropicalis) 균주에 형질도입한 경우, 상기 세포독성을 나타내는 기질에 대한 내성이 증가하였음을 확인하였다.
상기 서열번호 1의 염기서열로 표시되는 LIP1(lipase) 유전자의 돌연변이 유전자 mtLIP1(lipase)의 염기서열은 서열번호 4로, 상기 서열번호 2의 염기서열로 표시되는 FAT1(fatty acid transport)의 돌연변이 유전자 mtFAT1(fatty acid transport)의 염기서열은 서열번호 5로, 또는 상기 서열번호 3의 염기서열로 표시되는 MRP1(multidrug resistance protein) 유전자의 돌연변이 유전자 mtMRP1(multidrug resistance protein)의 염기서열은 서열번호 6으로 표시될 수 있다.
상기 돌연변이된 유전자 중 하나 이상은 벡터에 포함될 수 있다. 벡터는 상기 유전자들이 작동가능하게 연결된 형태일 수 있다. 본 발명에서 용어, "작동 가능하게 연결된"이란 일반적으로 기능을 수행하도록 염기 발현 조절 서열과 목적하는 단백질을 코딩하는 염기서열이 작동 가능하게 연결되어 코딩하는 염기서열의 발현에 영향을 미칠 수 있다. 벡터와의 작동가능한 연결은 당업계의 공지된 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당업계의 절단 및 연결 효소 등을 사용하여 제작할 수 있다.
본 발명에서 용어, "벡터"는 숙주 세포로 염기의 클로닝 및/또는 전이를 위한 임의의 매개물을 말한다. 벡터는 다른 DNA 단편이 결합하여 결합된 단편의 복제를 가져올 수 있는 복제단위(replicon)일 수 있다. "복제단위"란 생체 내에서 DNA 복제의 자가 유닛으로서 기능하는, 즉, 스스로의 조절에 의해 복제가능한, 임의의 유전적 단위 (예를 들면, 플라스미드, 파지, 코스미드, 염색체, 바이러스)를 말한다. 용어 "벡터"는 시험관 내, 생체 외 또는 생체 내에서 숙주 세포로 염기를 도입하기 위한 바이러스 및 비 바이러스 매개물을 포함할 수 있다. 용어 "벡터"는 또한 미니구형 DNA를 포함할 수 있다. 예를 들면, 상기 벡터는 박테리아 DNA 서열을 갖지 않는 플라스미드일 수 있다. 용어 "벡터"는 또한 슬리핑 뷰티(Sleeping Beauty)같은 트랜스포존(Izsvak et.al. J. MoI. Biol. 302:93-102 (2000)), 또는 인공 염색체를 포함할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터를 사용할 수 있다. 본 발명에서 사용 가능한 벡터는 특별히 제한되는 것이 아니며 공지된 발현 벡터를 사용할 수 있다.
상기 캔디다 트로피칼리스 균주는 상기 돌연변이된 유전자를 발현하거나, 상기 돌연변이된 유전자가 포함된 벡터를 포함할 수 있다.
상기 캔디다 트로피칼리스(Candida tropicalis) 균주는 베타-산화(β-oxidation) 경로가 차단된 균주로, 구체적으로, 베타-산화 경로가 차단되어 기질을 이용하여 디카르복시산을 생산하는 균주일 수 있다.
상기 기질은 지방산 메틸 에스테르(fatty acid methyl ester, FAME)일 수 있고, 상기 기질은 디카르복시산을 생산하는 캔디다 트로피칼리스 균주에 대하여 세포독성을 나타낸다. 구체적으로 상기 지방산 메틸 에스테르는 C6-C20의 알킬렌기를 포함하는 지방산 메틸 에스테르 중 하나일 수 있다. 더욱 구체적으로, 상기 지방산 메틸 에스테르는 DAME (Decanoic acid methyl ester)일 수 있다.
본 발명의 일 실시예를 통해서, 서열번호 1의 염기서열로 표시되는 LIP1(lipase) 유전자, 서열번호 2의 염기서열로 표시되는 FAT1(fatty acid transport) 유전자 및 서열번호 3의 염기서열로 표시되는 MRP1(multidrug resistance protein) 유전자 중 하나 이상의 유전자에 돌연변이가 발생한 캔디다 트로피칼리스 균주 또는 상기 돌연변이된 유전자 중 하나 이상이 도입된 캔디다 트로피칼리스 균주는 상기 지방산 메틸 에스테르의 세포 독성에 대한 내성이 증진되어 상기 기질에서 생존능이 우수함을 확인하였다.
또 다른 하나의 양태로서, 본 발명은 서열번호 1의 염기서열로 표시되는 LIP1(lipase) 유전자, 서열번호 2의 염기서열로 표시되는 FAT1(fatty acid transport) 유전자 및 서열번호 3의 염기서열로 표시되는 MRP1(multidrug resistance protein) 유전자 중 어느 하나 이상의 유전자가 돌연변이 되거나, 상기 돌연변이된 유전자 중 하나 이상이 도입된, 기질의 세포독성에 대한 내성이 증진된 캔디다 트로피칼리스(Candida tropicalis) 균주를 기질과 함께 배양하는 것을 포함하는 디카르복시산(decarboxylic acid, DCA)의 생산 방법을 제공한다.
본 발명의 디카르복시산 생산 방법은 상술한 캔디다 트로피칼리스 균주를 그대로 이용하기 때문에, 이 둘 사이에 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여, 그 기재를 생략한다.
상기 캔디다 트로피칼리스 균주는 베타-산화(β-oxidation) 경로가 차단된 균주일 수 있다.
상기 캔디다 트로피칼리스 균주의 디카르복시산 생산에 필요한 기질은 지방산 메틸 에스테르(fatty acid methyl ester, FAME)일 수 있고, 상기 기질은 디카르복시산을 생산하는 캔디다 트로피칼리스 균주에 대하여 세포독성을 나타낸다. 구체적으로 상기 지방산 메틸 에스테르는 C6-C20의 알킬 사슬을 가지는 지방산 메틸 에스테르 중 하나일 수 있다.
본 발명의 일실시예에서, 베타-산화 경로가 차단된 캔디다 트로피칼리스 균주에 돌연변이된 서열번호 1의 염기서열로 표시되는 LIP1(lipase) 유전자, 돌연변이된 서열번호 2의 염기서열로 표시되는 FAT1(fatty acid transport) 유전자 및 돌연변이된 서열번호 3의 염기서열로 표시되는 MRP1(multidrug resistance protein) 유전자 중 하나 이상의 유전자를 도입한 돌연변이 균주를 제조하여 디카르복시산 생산 실험을 하였다. 베타 산화 경로만 차단된 캔디다 트로피칼리스 균주와의 디카르복시산의 생산능력을 비교한 결과, 본 발명의 돌연변이 캔디다 트로피칼리스 균주가 디카르복시산의 생산능력이 더 우수함을 확인하였다. 이는 상기 개시된 유전자의 돌연변이를 통해서 캔디다 트로피칼리스의 상기 기질의 세포독성에 대한 내성이 증진되어 균주의 생존능력이 향상된 결과로 판단된다.
본 발명을 통해 개발한 디카르복시산 생산용 캔디다 트로피칼리스 균주는 기존의 독성기질에 대한 내성이 증진되었을 뿐만 아니라 디카르복시산의 생산 효율 또한 기존의 균주에 비해 월등히 증가하였으므로 디카르복시산의 생물학적 생산공정에 적용이 가능하여 산업적 활용도가 높을 것으로 예상된다.
도 1은 캔디다 트로피칼리스 균주에 대한 데카노익산 메틸 에스테르(Decanoic acid methyl ester, DAME), 데카노익산 (Decanoic acid, DA) 및 세바식산(Sebacic acid, SA)의 세포 독성을 비교한 것이다.
도 2는 세대(generation time)에 따른 돌연변이 캔디다 트로피칼리스 균주들의 성장곡선(growth graph)를 나타낸 것이다: E1 (170 generation time), E2 (470 generation time), E4 (700 generation time), E5 (720 generation time) 및 ES5.
도 3은 각 돌연변이 캔디다 트로피칼리스 균주(WT, E5 및 ES5)들의 건조균체총량(DCW, Dry Cell Weight)을 측정한 결과를 나타낸 것이다.
도 4는 각 돌연변이 캔디다 트로피칼리스 균주(WT, E5 및 ES5)들의 배지 내 DAME의 소비량을 분석한 결과를 나타낸 것이다.
도 5는 각 돌연변이 캔디다 트로피칼리스 균주(WT, E5 및 ES5)들의 세바식산 생산량을 분석한 결과를 나타낸 것이다.
도 6 내지 도 8은 mtLIP1 유전자를 도입한 돌연변이 캔디다 트로피칼리스 균주(mtSAP1)와 모균주인 β-산화 경로가 제거된 균주(β-KO), 그리고 LIP1 유전자를 도입한 균주(SAP1)의 건조균체총량(도 6), DAME의 소비량(도 7) 및 세바식산 생산량(도 8)을 비교 분석한 결과를 나타낸 것이다.
도 9 내지 도 11은 mtFAT1 유전자를 도입한 돌연변이 캔디다 트로피칼리스 균주(mtSAP2)와 모균주인 β-산화 경로가 제거된 균주(β-KO), 그리고 FAT1 유전자를 도입한 균주(SAP2)의 건조균체총량(도 9), DAME의 소비량(도 11) 및 세바식산 생산량(도 11)을 비교 분석한 결과를 나타낸 것이다.
도 12 내지 도 14는 mtMRP1 유전자를 도입한 돌연변이 캔디다 트로피칼리스 균주(mtSAP3)와 모균주인 β-산화 경로가 제거된 균주(β-KO), 그리고 MRP1 유전자를 도입한 균주(SAP3)의 건조균체총량(도 12), DAME의 소비량(도 13) 및 세바식산 생산량(도 14)을 비교 분석한 결과를 나타낸 것이다.
도 15는 mtLIP1 유전자, mtFAT1 유전자 및 mtMRP1 유전자를 포함하는 캔디다 트로피칼리스 형질도입을 위한 플라스미드 벡터의 모식도이다.
도 16 내지 도 18은 mtLIP1 유전자, mtFAT1 유전자 및 mtMRP1 유전자 중 두 개 이상의 유전자가 도입된 돌연변이 캔디다 트로피칼리스 균주의 건조균체총량(도 16), DAME의 소비량(도 17) 및 세바식산 생산량(도 18)을 분석한 결과를 나타낸 것이다.
도 19는 C10 지방산 메틸 에스테르(fatty acid methyl ester, FAME) 기질에 대한 mtLIP1 유전자, mtFAT1 유전자 및 mtMRP1 유전자가 도입된 돌연변이 캔디다 트로피칼리스 균주(mtSAP7)과 모균주 (β-KO)의 세포독성 내성을 건조균체총량, 디카르복시산 생산량을 측정하여 확인한 결과를 나타낸 것이다.
도 20는 C8 내지 C12 지방산 메틸 에스테르(fatty acid methyl ester, FAME) 기질에 대한 mtLIP1 유전자, mtFAT1 유전자 및 mtMRP1 유전자가 도입된 돌연변이 캔디다 트로피칼리스 균주(mtSAP7)과 모균주 (β-KO)의 세포독성 내성을 건조균체총량, 디카르복시산 생산량을 측정하여 확인한 결과를 나타낸 것이다.
이하, 실시예를 통하여 본 발명의 구성 및 효과를 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것일 뿐, 본 발명의 범위가 이들 실시예에 의해 한정되는 것은 아니다.
[실시예 1] 기질 및 생산물의 생물 세포독성 확인
세바식산의 생산을 위한 기질로 사용되는 DAME (Decanoic acid methyl ester)와 생산물인 세바식산 (Sebacic acid)의 세포 독성을 확인하기 위해 아래와 같은 조건에서 독성테스트를 실시하였다. 보다 구체적으로 종전에 세바식산의 생산을 위해 사용되던 Candida tropicalis MYA_3404 균주를 5 g/L 농도의 DAME, DA와 세바식산이 각각 첨가된 YNB 배지(효모추출물 10 g/L, 펩톤 20 g/L)에서 배양하였다. 배양 온도는 30℃ 이고 200 rpm에서 36시간동안 배양하였다.
그 결과, 도 1과 같이 DAME과, DA, 세바식산을 모두 첨가하지 않은 대조군에 비해 첨가해준 배지에서 균주의 성장속도가 느리거나 성장하지 않는 것을 확인하였다. 보다 구체적으로 세바식산을 첨가한 배지의 경우 농도가 균주의 성장속도와 전체 균체량이 대조군에 비해 감소하는 것을 확인 하였으며 DAME과 DA의 경우 5 g/L 농도로 첨가된 배지에서 균주가 성장하지 않는 것을 확인하였다. 이를 통해 기질인 DAME과 DA, 생산물인 세바식산이 모두 세포독성을 가지는 것이 확인되었고 그 중에서도 세바식산에 비해 DAME의 세포 독성이 더 강하다는 사실을 확인하였다. 상기 결과로부터 고농도의 세바식산 생산을 위해서는 기질인 DAME에 내성을 가지는 균주의 개발이 우선적으로 필요하다는 것을 확인하였다.
[실시예 2] 진화공학적 방법을 이용한 DAME 내성 균주의 개발
세포독성을 가지는 기질인 DAME에 내성을 가지는 균주를 개발하기 위해 C. tripicalis MYA_3404 균주를 10 g/L 농도의 DAME이 첨가된 YNB 배지(효모추출물 10 g/L, 펩톤 20 g/L)에 배양하였다. 이때 배지 내 DAME의 농도는 DAME 기질의 낮은 용해도로 인해 약 0.45 g/L (maximal solubility)를 유지하는 것으로 확인되었다(내부 실험 결과를 통해 확인 함). 접종한 균주의 성장곡선은 600nm 파장에서의 흡광도 값을 측정함으로서 확인하였다.
균주를 접종한 배지의 흡광도를 실시간으로 관찰하여 균주의 성장이 mid-exponential phase에 도달할 때 새로운 배지로 계대배양 하였다. 측정한 흡광도 값으로부터 specific growth rate를 구하고 specific growth rate이 크게 변화하는 단계의 균주를 각각 E1 (170 generation time), E2 (470 generation time), E4 (700 generation time), E5 (720 generation time)로 결정하였다. 또한 위와 같은 방법으로 얻은 E5 균주를 비독성 탄소원인 20 g/L glucose가 첨가된 YNB 배지(효모추출물 10 g/L, 펩톤 20 g/L)에 계대배양 한 후 DAME 기질에 재배양하여 탄소원의 교체 후에도 DAME에 대한 내성을 유지하는 균주를 선별하여 ES5로 명명하였다.
돌연변이 균주들의 growth profile을 확인해본 결과 도 2와 같이 계대배양을 진행함에 따라 specific growth rate이 증가함을 확인하였고 ES5 균주의 경우에도 내성을 잃지 않고 높은 specific growth rate을 보이며 DAME 기질에 대한 내성을 유지하는 것을 확인하였다. 더 구체적으로 확인하기 위해 대조군인 WT 균주와 돌연변이 균주인 E5, ES5 균주를 10 g/L 농도의 DAME을 첨가한 YNB 배지에서 배양하였다. 배양 온도는 30℃ 이고 배양 기간은 120 시간이며 12시간 혹은 24시간마다 시료를 채취하여 건조균체총량(DCW, Dry Cell Weight)을 측정하였다.
각 균주들의 건조균체총량(DCW, Dry Cell Weight)을 측정해본 결과, 도 3과 같이, WT 균주의 경우 DCW 값이 매우 낮은데(성장하지 않음) 비해 E5, ES5 균주의 경우 배양을 시작한 후 120시간이 경과하여 최대 균체량을 보이며 ES5는 균체량이 2.5 g/L, E5는 2.2 g/L까지 증가하는 것을 확인하였다. 이를 통해 진화공학적 방법을 통해 얻은 돌연변이 균주 E5와 ES5가 DAME 기질에 내성을 가지고 그로인해 더 잘 자라는 것을 확인하였다.
[실시예 3] 모균주(WT)와 돌연변이 균주(E5, ES5)의 phenotype 변화 확인
실시예 2를 통해 얻은 돌연변이 균주 E5, ES5의 실제 DAME 기질 소비량과 세바식산 생산량을 모균주(WT)와 비교하였다. DAME 기질 소비정도와 세바식산 생산성을 확인하기 위해 WT, E5, ES5 균주를 각각 10 g/L 농도의 DAME가 첨가된 YNB 배지에 30℃ 온도에서 120 시간동안 배양하였다.
분석을 위한 시료는 12시간 혹은 24시간마다 채취하여 배지 내 DAME의 농도와 세바식산의 농도를 GC/MS (Gas Chromatography/MAss spectrometry)를 통해 분석하였다. GC/MS 조건은 다음의 표 1과 같다.
Figure PCTKR2019017044-appb-T000001
DAME 분석을 위한 GC/MS 분석용 시료는 다음과 같이 준비하였다. 채취한 배양액 4 mL는 1 mL의 10 M HCL과 혼합하여 1분간 vortex 하였다. 위 혼합물에 동일한 양의 hexan을 첨가하여 10분간 상온에서 incubation하고 10분 후, 혼합물을 vertex하여 잘 섞어준 후 1분간 12,000 rpm에서 원심분리 한다. 두 층으로 갈라진 혼합액 중 상층액(haxane)을 채취하여 GC/MS 분석에 사용하게 된다. 세바식산 분석을 위한 시료는 채취한 시료에 이전 DAME분석과 마찬가지로 10 M HCL을 첨가한 후 혼합한다. 그 후 동일한 양의 ethyl acetate를 첨가하여 혼합 후 ethyl acetate 층을 채취하여 진공 농축기를 이용하여 완전히 건조시킨다. 그 후 2% (w/v) 농도의 메틸 하이드록시 아민 하이드로 클로라이드(O-methylhydroxylamine hydrochloride, Sigma-Aldrich, St Louis, MO, USA)에 pyridine (Sigma-Aldrich, St Louis, MO, USA) 50 μl를 넣은 후 75℃에서 30분간 메톡심화(methoximation) 하였다. 이어서 80 μl의 N-메틸-N-(트리메틸실릴) 트리플루오로아세트아마이드(N-methyl-N-(trimethylsilyl) trifluoroacetamide,Sigma-Aldrich, St Louis, MO, USA)를 넣은 후 40℃에서 30분간 유도체화 반응을 하였다. 위 분석결과의 정량을 위해 DAME와 세바식산을 구입(Sigma-Aldrich, St Louis, MO, USA)하여 일정 비율로 희석한 후 위와 동일한 방법으로 분석을 위한 시료를 준비하여 GC/MS로 분석하였다. 채취한 샘플을 GC/MS를 사용하여 배지 내 DAME의 양을 분석한 결과 도 4와 같이 모균주를 접종한 배지의 경우 DAME의 양이 크게 줄어들지 않는 반면, E5균주와 ES5균주를 접종한 배지의 경우 빠른 속도로 기질이 줄어 최대 균체량에 이르는 120 시간이 경과 하였을 시 E5를 접종한 배지에는 약 3.1 g/L의 DAME이, ES5를 접종한 배지에는 약 2.8 g/L의 DAME이 남아있는 것으로 확인되었다. 세바식산의 생산량(도 5) 또한 모균주와 비교하여 큰 차이를 보였는데, 모균주의 세바식산 생산량이 발효 48시간 후 약 44.3 mg/L 인 것에 반해 E5균주의 경우 약 177.4 g/L, ES5 균주의 경우 약 218.4 mg/L의 생산량을 보이는 것이 확인되었다. 이와 같이 E5 균주와 ES5 균주에서 높은 DAME 기질 소모성과 세바식산 생산성을 보이는 것은 생물 독성을 가지는 기질인 DAME에 계대배양을 하며 진화시킨 결과 균주 내 돌연변이 발생에 의한 것으로 판단된다. 이에 따라 가장 높은 DAME 소비성과 세바식산 생산성을 보이는 ES5 균주를 대상으로 염기서열 및 전사체 분석을 실시하였다.
[실시예 4] DAME 내성 돌연변이 균주(ES5)의 전사체 분석
배지 내 DAME 유무에 따른 전사체 변화를 확인하기 위해 DAME이 첨가된 배지에서 키운 ES5 균주와 DAME이 첨가되지 않은 배지에서 키운 ES5 균주의 전사체 분석을 실시하였다.
ES5 균주를 DAME이 첨가되지 않은 YNB 배지와 10g/L의 DAME이 첨가된 YNB 배지에서 30℃, 24시간동안 배양하였다. 배양한 균체는 회수하여 물로 세척한 후 이후 전체 RNA 추출을 위한 시료로 사용하였다. RNA 추출은 RNeasy Mini Kit (Qiagen, Hilden, Germany)을 사용하여 실시하였으며 추출된 RNA의 농도와 순도는 각각 NanoDrop (Thermo Scientific, Wilmington, DE, USA)과 Agilent Bioanalyzer 2100 (Santa Clara, Ca, USA)를 사용하여 측정하였다.
돌연변이 ES5 균주의 전사체를 분석하여 모균주와 비교한 결과 총 453개의 유전자가 ES5 균주에서 모균주에 비해 upregulation 되었으며, 147개의 유전자가 ES5 균주에서 모균쥬에 비해 downregulation 되었음이 확인되었다. 상세한 유전자의 수와 cluster는 표 2에 명시되어 있다.
모균주와 DAME 내성 돌연변이 균주(ES5)의 전사체 비교/분석 결과
No Pathway No ofUpregulated Gene No ofDownregulated Gene
1 Alanine, aspartate and glutamate metabolism 12
2 alpha-Linolenic acid metabolism 9
3 Arginine and proline metabolism 12
4 Arginine biosynthesis 9
5 Ascorbate and aldarate metabolism 6
6 Beta-Alanine metabolism 15 6
7 Biosynthesis of antibiotics 51
8 Biosynthesis of unsaturated fatty acids 12
9 Biotin metabolism 6
10 Butanoate metabolism 9 6
11 Cell cycle - yeast 12
12 Cysteine and methionine metabolism 12
13 DNA replication 15
14 Fatty acid degradation 6
15 Fatty acid metabolism 18 6
16 Galactose metabolism 6
17 Glycerolipid metabolism 12
18 Histidine metabolism 12
19 Homologous recombination 9
20 Lysine biosynthesis 9
21 Lysine degradation 12
22 Meiosis - yeast 15
23 Metabolic pathways 120 27
24 Mismatch repair 6
25 Monobactam biosynthesis 6
26 Nucleotide excision repair 6
27 Pantothenate and CoA biosynthesis 12
28 Pentose and glucuronate interconversions 6
29 Peroxisome 27 6
30 Pyruvate metabolism 18
31 Starch and sucrose metabolism 9
32 Steroid biosynthesis 9
33 Tryptophan metabolism 9
34 Ubiquinone and other terpenoid-quinonebiosynthesis 9
35 Valine, leucine and isoleucine biosynthesis 12
36 Valine, leucine and isoleucine degradation 15 6
Total 453 147
[실시예 5] DAME 내성 돌연변이 균주(ES5)의 전체 염기서열 분석 및 내성 증진 관련 후보 유전자의 탐색
진화공학적 방법을 통해 확보한 ES5 균주의 DAME 내성 증진에 관련 된 유전자를 확인하기 위해 ES5 균주의 전체 염기서열 분석을 실시하였다. 전체 염기서열 분석을 위한 genomic DNA 추출은 DNA isolation kit(Epicentre, Madison, WI, USA)를 사용하여 실시하였다. 전체 염기서열 분석은 DNA Link USA, INC.(San Diego, CA, USA)사의 Illumina Hiseq 2500 NGS platform을 사용해 분석하였다.
전체 염기서열 분석을 통해 전체 염기서열의 약 87.98%를 coverage하는 총 13,256,614의 절편(reads)를 획득하였으며 이를 Picard tool 1.128 software를 사용하여 정렬(alignment)하였다. 정렬된 서열은 SNPEff 4.1(GRCh 37.75)를 사용하여 명명(annotation)하였고 BWA 7.12 software를 사용해 지도화(mapping) 하였다. 이때 SNPs DB는 dbSNP138 software를 통해 제거되었다. 최종적으로 NCBI, Uniprot, KEGG database를 통해 확보한 유전자들과 비교하여 돌연변이가 발생한 유전자를 확인하였다.
그 결과 총 770개의 유전자에서 돌연변이가 일어난 것으로 확인하였으며 기능이 확인되지 않은 유전자를 제외한 총 106개의 돌연변이 유전자를 획득하였다. 그 중 세포독성 기질의 내성증진에 관여하며 세바식산 생산량 증진에 관련이 있을 것이라 예상되는 유전자 LIP1 (lipase, Uniprot.ID: C5M8S7), FAT1(Fatty Acid Transport Protein, Uniprot.ID: C5M964), MRP1 (Multidrug resistance Protein CDR1, Uniprot.ID: C5M804)을 선정, 각각 LIP1(서열번호 1), FAT1(서열번호 2), MRP1(서열번호 3) 으로 명명하였고 이들의 돌연변이 유전자를 각각 mtLIP1(서열번호 4), mtFAT1(서열번호 5), mtMRP1(서열번호 6) 라 명명하였다. 각각의 유전자의 mutation site는 표 3, 4 및 5와 같다.
Figure PCTKR2019017044-appb-T000002
Figure PCTKR2019017044-appb-I000001
Figure PCTKR2019017044-appb-T000003
Figure PCTKR2019017044-appb-I000002
Figure PCTKR2019017044-appb-T000004
Figure PCTKR2019017044-appb-I000003
Figure PCTKR2019017044-appb-I000004
Figure PCTKR2019017044-appb-I000005
Figure PCTKR2019017044-appb-I000006
[실시예 6] mt LIP1, mt FAT1 및 m t MRP1 유전자의 과발현 균주의 제작 및 표현형 변화
내성 유전자의 클로닝을 위해 사용한 primer list
서열번호 Primers 5'-3' sequence
pADH2 promotor cloning in PRS420
7 ADHpro_F AAACTCGAGTCTAGCTCCCTAACATGTAGGT (XhoI)
8 ADHpro_R AAAGTCGACAGTTGATTGTATGCTTGGTATAGCTT
pADH2 terminator cloning in PRS420
9 ADHter_F AAAGTCGACTCTAGATAAGCGAATTTCTTATGATTTATGATTTTTA (SalI-XbaI)
10 ADHter_R AAAGCGGCCGCGTGTGGAAGAACGATTACAACAG (NotI)
Individual cloning
11 LIP1_F AAAGTCGACATGAGATTTCTTGTATTCATTACAATTATTACATGGTTGAAAAC (SalI)
12 LIP1_R AAATCTAGAGTGGTGGTGGTGGTGGTGGACAAGATAGGTACTATTCTTCACAGTGAAGCTT (XbaI)
13 FAT1_F AAAGTCGACATGTCAGGATTAGAAATTGCTGCAGCTGCC (SalI)
14 FAT1_R AAATCTAGACAATTTGGCTTTACCAGTACAGATCAAAGACCA (XbaI)
15 MRP1_F AAAGTCGACATGGGAGAAATAACCCCAACTGACAAAAGCG (SalI)
16 MRP1_R AAATCTAGACTTTTTAGTCTTGACCCTTTTGGTACC (XbaI)
Combination cloning
17 P1_F AAAGGATCCTCTAGCTCCCTAACATGTAGGT (BamHI)
18 P1_R AAAGTCGACAGTTGATTGTATGCTTGGTATAGCTT (SalI)
19 P2_F AAAGTCGACCACGTGTCTAGCTCCCTAACATGTAGGT (SalI-PmlI)
20 P2_R AAAGCGGCCGCAGTTGATTGTATGCTTGGTATAGCTT (NotI)
21 P3_F AAAGTCGACTAAGCGAATTTCTTATGATTTATGATTTTTA (SalI)
22 P3_R AAACACGTGGTGTGGAAGAACGATTACAACAG (PmlI)
23 P4_F CAGTTGATTGTATGCTTGGTATAGTCGACATGAGATTTCTTGTATTCATTACAATTATT (SalI)
24 P4_R GTTAACTAAGCGAATTTCTTATGATTTATGTCGACAGTGGTGGTGGTGGTGGTG (SalI)
25 P5_F CAGTTGATTGTATGCTTGGTATAGCGGGCCGCATGTCAGGATTAGAAATTGCTGCA (NotI)
26 P5_R GTTAACTAAGCGAATTTCTTATGATTTATGCGGCCGCACAATTTGGCTTTACCAGTACAGA (NotI)
27 P6_F AAAGCGGCCGCATAAGCGAATTTCTTATGATTTATGATTTTTA (NotI)
28 P6_R AAACTCGAGCACGTGAGTTGATTGTATGCTTGGTATAGCTT (XhoI-PmlI)
29 P7_F AAACACGTGTAAGCGAATTTCTTATGATTTATGATTTTTA (PmlI)
30 P7_R AAACTCGAGGTGTGGAAGAACGATTACAACAG (XhoI)
31 P8_F CAGTTGATTGTATGCTTGGTATAGCACGTGATGGGAGAAATAACCCCAACTG (PmlI)
32 P8_R GTTAACTAAGCGAATTTCTTATGATTTACACGTGCTTTTTAGTCTTGACCCTTTTGGTA (PmlI)
33 P9_F GCTTGATATCGAATTCCTGCAGCCCGGGGGATCCTCTAGCTCCCTAACATGTAGGT (BamHI)
34 P9_R GGGGGGCCCGGTACCCAATTCGCCCTCTCGAGGTGTGGAAGAACGATTACAACAG (XhoI)
Restriction enzyme sites underlined.
Plasmid used in this study
Plasmid Description
pET21a Escherichia coli expression vector, AmpR
pAUR123 Low copy number yeast expression vector, AurAR for yeast, and AmpR for E. coli
pRS420 High copy number yeast expression vector, G418R for yeast, and AmpR for E. coli
plasmid 5 pRS420::ADHpro1
plasmid 6 pRS420::ADHpro1-ADHter1
plasmid 7 plasmid 6+ LIP1, pRS420::ADHpro1-LIP1-ADHter1
plasmid 8 plasmid 6+ mtLIP1, pRS420::ADHpro1-mtLIP1-ADHter1
plasmid 9 plasmid 6+ wtFAT1, pRS420::ADHpro1-FAT1-ADHter1
plasmid 10 plasmid 6+ mtFAT1, pRS420::ADHpro1-mtFAT1-ADHter1
plasmid 11 plasmid 6+ wtMRP1, pRS420::ADHpro1-MRP1-ADHter1
plasmid 12 plasmid 6+ mtMRP1, pRS420::ADHpro1-mtMRP1-ADHter1
plasmid 13 pET21a::ADHpro1
plasmid 14 pET21a::ADHpro2
plasmid 15 pET21a::ADHter1-ADHpro2
plasmid 17 pET21a::ADHpro1-ADHter1-ADHpro2
plasmid 18 pET21a::ADHpro1-mtLIP1-ADHter1-ADHpro2
plasmid 19 pET21a::ADHpro1-mtLIP1-ADHter1-ADHpro2-mtFAT1
plasmid 20 pET21a::ADHter1-ADHpro2-mtFAT1
plasmid 21 pET21a::ADHter2-ADHpro3
plasmid 22 pET21a::ADHter2-ADHpro3-ADHter3
plasmid 23 pET21a::ADHter2-ADHpro3-mtMRP1-ADHter3
plasmid 24 pET21a::ADHpro1-mtLIP1-ADHter1-ADHpro2-mtFAT1-ADHter2-ADHpro3-mtMRP1-ADHter3
plasmid 25 pRS420::ADHpro1-mtLIP1-ADHter1-ADHpro2-mtFAT1-ADHter2-ADHpro3-mtMRP1-ADHter3
[6-1] LIP1 유전자와 mt LIP1 유전자를 과발현 균주의 제작 및 phenotype 변화
실시예 5를 통해 선정한 돌연변이 유전자(mtLIP1)와 모균주에 있는 동일한 (돌연변이가 일어나지 않은) 유전자(LIP1)를 각각 과발현한 C. tropicalis 균주를 제작하기 위해 다음과 같이 클로닝을 실시하였다. 도입한 유전자의 효과적인 발현을 pRS420 벡터에 ADH promotor(ADHpro, XhoI/SalI 제한효소 위치에 도입), ADH terminator(ADHter, XbaI/NotI 제한효소 위치에 도입)를 ADHpro_F/R primer, ADHter_F/R primer(표 6)를 이용해 증폭하여 우선적으로 도입, plasmid 6를 제작하였다. LIP1 유전자와 mtLIP1의 획득을 위해 C. tropicalis MYA_3404 균주와 C. tropicalis ES5 균주로부터 추출한 genomic DNA를 LIP1-F primer와 LIP1_R primer(표 5)를 사용하여 증폭하였으며 획득한 DNA fragments는 이미 제작한 plasmid 6번의 SalI, XbaI 제한효소위치에 ligation 하였다. 이를 통해 최종적으로 LIP1 가 도입된 plasmid 7과 mtLIP1 가 도입된 plasmid 8을 획득하였다 (표 7). 이후 Plasmid 7과 8은 β-산화 경로가 제거된 C. tropicalis 20962로 trasformation하였고 최종적으로 C. tropicalis_LIP1 와 C. tropicalis_mtLIP1 균주를 제작하였다.
LIP1 유전자와 mtLIP1 유전자를 도입한 균주의 phenotype 변화를 대조군(β-산화 경로가 제거된 C. tropicalis 균주, β-KO)과 비교해 보았다. 그 결과 도 6과 같이 β-KO 균주에 비해 LIP1, mtLIP1를 도입한 균주의 성장이 증진됨을 확인하였으며 특히 mtLIP1을 도입한 균주는 최대 DCW값(약 1.2 g/L)을 보임을 확인하였다. 세 균주의 DAME 소비량을 비교해본 결과 β-KO 균주의 경우 DAME을 거의 소비하지 않는 것으로 확인되었으며 LIP1 유전자 도입 균주와 mtLIP1 유전자 도입 균주의 경우 대조군에 비해 높은 기질 소비량을 보였고 특히 mtLIP1 유전자를 도입한 균주의 경우 120시간동안 전체의 약 70%에 해당하는 기질을 소비한 것으로 확인되었다(도 7). 마지막으로 SA 생산량을 비교한 결과 β-KO 균주와 LIP1 도입균주의 경우 약 300 mg/L 의 세바식산을 생산하였으나 mtLIP1도입 균주의 경우 약 900 mg/L의 세바식산을 생산하는 것을 확인하였다(도 8).
위 결과들로부터 C. tropicalis 균주 내 LIP1 유전자가 C. tropicalis 균주의 성장과 DAME 기질 소비, 세바식산의 생산에 영향을 주는 유전자임을 확인하였으며 본 발명을 통해 획득한 mtLIP1 돌연변이 유전자가 세바식산의 생산량 증진에 크게 기여함을 확인하였다.
[6-2] mt FAT1 유전자 도입 균주의 제작 및 phenotype 변화 확인
실시예 6-1과 마찬가지로 FAT1 유전자를 도입한 균주와 mtFAT1 유전자를 도입한 균주의 phenotype 변화를 대조군(β-산화 경로가 제거된 C. tropicalis 균주, β-KO)과 비교해 보았다. 실시예 6-1에서 사용한 C. tropicalis MYA_3404 균주와 C. tropicalis ES5 균주의 genomic DNA로부터, FAT1_F, FAT1_R primer(표 6)로 증폭한 DNA fragment를 plasmid 6에 있는 pRS420 벡터의 SalI, XbaI 제한효소 위치에 ligation 하여 최종적으로 FAT1 이 도입된 plasmid 9와 mtFAT1이 도입된 plasmid 10을 제작하였다(표 7). 제작한 plasmid 9, 10은 이후 β-산화 경로가 제거된 C. tropicalis 20962로 trasformation하였고 최종적으로 C. tropicalis_FAT1 와 C. tropicalis_mtFAT1 균주를 제작하였다.
그 결과 도 9와 같이 β-KO 균주와 FAT1를 도입한 균주의 경우 큰 차이를 보이지 않았으나 mtFAT1을 도입한 균주는 높은 DCW값(약 1.5 g/L)을 보임으로써 FAT1 유전자에 돌연변이가 일어남으로 인해 균체의 성장이 크게 증진됨을 확인하였다. 세 균주의 DAME 소비량을 비교해본 결과 β-KO 균주의 경우 DAME을 거의 소비하지 않는 것으로 확인되었으며 FAT1 도입 균주 또한 β-KO 균주와 비교하였을 때 큰 차이를 보이지 않았다 하지만 mtFAT1 도입 균주의 경우 대조군에 비해 상대적으로 높은 기질 소비량을 보였 120시간동안 전체의 약 70%에 해당하는 기질을 소비한 것으로 확인되었다(도 10). 마지막으로 세바식산 생산량을 비교한 결과 β-KO 균주와 FAT1 도입 균주의 경우 발효 120 시간 경과 후 약 280 mg/L, 약 384 mg/L 의 세바식산을 생산하였으나 mtFATP1 도입 균주의 경우 약 1275 mg/L의 세바식산을 생산하는 것을 확인하였다(도 11).
위 결과로부터 LIP1 유전자와 마찬가지로 C. tropicalis 균주 내 FAT1 유전자가 C. tropicalis 균주의 성장과 DAME 기질 소비, 세바식산의 생산과 관련이 있는 유전자임을 확인하였으며 본 발명을 통해 획득한 mtFAT1 유전자가 세바식산의 생산량 증진에 크게 기여함을 확인하였다.
[6-3] mt MRP1 유전자 도입 균주의 제작 및 phenotype 변화 확인
마지막으로 MRP1 유전자와 mtMRP1 유전자를 도입한 균주의 phenotype 변화를 대조군(β-산화 경로가 제거된 C. tropicalis 균주, β-KO)과 비교해 보았다. 앞선 실시예와 마찬가지로 클로닝에 사용한 벡터는 plasmid 6의 제작에 사용된 ADHpro와 ADHter가 도입된 pRS420 벡터이며 MRP1_F, MRP1_R primer로 증폭 후 SalI/XhoI 제한효소 사이트에 ligation 하였다. 이를 통해 palsmid 11, 12를 제작하였으며 제작된 plasmid는 β-산화 경로가 제거된 C. tropicalis 20962로 trasformation 함으로써 최종적으로 C. tropicalis_MRP1 과 C. tropicalis_mtMRP1 균주를 제작하였다.
위의 방법으로 제작된 MRP1 도입 균주, mtMRP1 도입 균주들과 대조군으로 사용된 β-KO 균주를 비교한 결과 MRP1 도입 균주와 mtMRP1 도입 균주에서 성장이 증진됨을 확인하고 특히 mtMRP1을 도입한 균주의 경우 약 1.5 g/L의 높은 균체량을 보임을 확인하였다(도 12). 세 균주의 DAME 소비량을 비교해본 결과 120시간이 경과 한 후 β-KO 균주의 경우 약 10%의 기질이 소비된 반면 MRP1 도입 균주는 약 40%, mtMRP1 도입 균주는 초기 DAME양 10 g/L중 약 1 g/L 미만의 DAME 가 남은 것으로 확인되었다(도 13). 세바식산 생산량을 비교한 결과 β-KO 균주와 MRP1 균주의 경우 약 280 mg/L, 약 488 mg/L 의 세바식산을 생산하였으나 mtMRP1 도입 균주의 경우 약 1677 mg/L의 세바식산을 생산함으로써 세바식산 생산량이 모균주 대비 약 6배 가량 증진되었음을 확인하였다(도 14).
위 결과를 통해 도입한 MRP1, mtMRP1 유전자에 의해 phenotype의 변화가 생겼음을 확인하였고 이러한 유전자들이 세바식산의 생산성 향상에 긍정적인 영향을 주는 것을 확인하였다.
[6-4] 세바식산 고생산용 균주( C. tropicalis mtSAP7)의 제작 및 고농도 배양을 통한 세바식산의 생산
앞선 실시예를 통해 그 효과가 확인된 mtLIP1, mtFAT1, mtMRP1 유전자를 모두 도입한 세바식산 고생산용 균주(C. tropicalis mtSAP7)를 제작하였다. 도입한 3개 유전자의 효과적인 발현을 위해 각 유전자 발현을 증진시키는 3쌍의 ADH promoter(ADHpro1, ADHpro2, ADHpro3)와 ADH terminator(ADHter1, ADHter2, ADHter3)를 함께 도입하였다. 보다 구체적인 균주 제작 과정은 다음과 같다.
(1) 클로닝을 위해 선정한 pET21a 벡터의 BamI/SAlI 제한효소 위치에 P1_F, P1_R primer를 이용해 pAUR123 벡터로부터 PCR로 증폭한 DNA fragment (ADHpro1)를 T4 DNA ligase를 이용해 ligation하여 plasmid 13을 제작하였다. PCR을 위해서는 Q5 High-Fidelity Master mix(BioLabs, Ipswich, MA, USA)를 사용하였으며 이후 모든 실험에서 동일한 시약을 사용하였다.
(2) 동시에 pAUR123 벡터로부터 P2_F, P2_R primer를 이용해 PCR로 증폭한 DNA fragment (ADHpro2)를 pET21a 벡터의 SalI/ NotI 제한효소 위치에 ligation 하였다. 이때 추후 균주의 도입을 용이하게 하기 위하여 Forward primer의 제한효소 SalI 서열 뒤에 PmlI 제한효소 서열(CACGTG)를 연속적으로 추가하여 plasmid 14를 제작하였다.
(3) 그 다음으로는 pAUR123 벡터로부터 P3_F, P3_R primer를 사용해 증폭한 DNA fragment (ADHter1)을 plasmid 14의 SalI/Btrl 제한효소 사이트에 ligation 한 plasmid 15를 제작하였다.
(4) Plasmid 16의 제작을 위해 앞서 제작한 plasmid 15를 backborn으로 사용되었다. Plasmid 13을 template로 하여 P1_F, P1_R primer를 사용해 증폭한 DNA fragment (ADHpro1)를 plasmid 15의 BamHI/SalI 제한효소 위치에 ligation 시킴으로써 plasmid 16을 제작하였다.
(5) C. tropicalis ES5 균주의 genomic DNA로부터 P4_F, P4_R primer를 사용해 증폭한 DNA fragment (mtLIP1)는 plasmid 16의 ADHpro1과 ADHter1 사이의 SalI 제한효소 위치에 ligation 하였고 이를 통해 plasmid 17을 제작하였다.
(6) mtFAT1 유전자의 도입을 위해 C. tropicalis ES5 균주의 genomic DNA를 template로 P5_F, P5_R primer를 사용해 PCR을 통해 mtFAT1 fragment를 획득하였다. 이를 plasmid 17의 NotI 제한효소 사이트에 ligation 하여 plasmid 18을 제작하였다. 추가적으로, 증폭한 mtFAT1 fragment는 이후 최종 plasmid의 제작을 위해 plasmid 15의 NotI 제한효소 사이트에 도입하였고 이를 plasmid 19라 명명하였다.
(7) 추가적인 promoter 와 terminator의 도입을 위해 plasmid 15를 temlate로 P6_F, P6_R primer를 사용해 PCR을 통해 ADHter2 fragment와 ADHpro3 fragment를 획득하였고 이를 새로운 pET21a 벡터의 NotI, XhoI 제한효소 사이트에 ligation 시킴으로써 plasmid 20을 얻었다. 이때 P6_R primer의 XhoI 제한효소 사이트 앞쪽에 PmlI를 추가함으로써 이후 plasmid 21의 제작에 활용하였다.
(8) plasmid 21은 이미 제작된 plasmid 20의 PmlI, XhoI 제한효소 위치에 pAUR123 벡터로부터 P7_F, P7_R primer를 이용해 증폭한 DNA fragment(ADHter3)을 ligation 함으로써 완성하였다.
(9) 마지막으로 세 번째 유전자인 mtMRP1 유전자의 도입을 위해 plasmid 21의 PmlI 제한효소 사이트에 C. tropicalis ES5 균주의 genomic DNA를 template로 P8_F, P8_R primer를 사용해 증폭한 PCR fragment(mtMRP1)를 ligation 함으로써 plasmid 22를 완성하였다.
(10) 최종적으로 앞서 제작한 plasmid 18과 plasmid 22의 제한효소 절편을 fusion 시킴으로써 mtLIP1, mtFAT1, mtMRP1이 모두 도입된 plasmid 24를 제작하였고, plasmid 24를 template로 P9_F와 P9_R primer를 사용하여 PCR을 수행 해 그 DNA fragment를 pRS420의 BamHI 과 XhoI 제한효소 사이트에 ligation 시킴으로써 Plasmid 25를 제작하였다. 제작한 Plasmid 25는 β-산화 경로가 제거된 C. tropicalis 20962로 trasformation 함으로써 최종적으로 C. tropicalis_mtSAP7 균주를 제작하였다. 최종 plasmid 25의 구성과 사용된 제한효소는 도 15와 같다.
상기 방법을 기초로 mtLIP1, mtFAT1, mtMRP1 유전자 중 두 개의 유전자가 도입된 C. tropicalis 균주 (mtSAP4(mtLIP1 + mtMRP1), mtSAP5(mtLIP1 + mtFAT1), mtSAP6(mtMRP1 + mtFAT1))도 함께 제작하였다.
상기 4개의 돌연변이 C. tropicalis 균주의 OD 변화, 기질 소비량 및 세바식산 생산량을 비교한 결과, 상기 3개의 돌연변이 유전자가 모두 도입된 C. tropicalis mtSAP7 균주가 균체 형성, 기질 소비능 및 세바식산 생산능력이 가장 우수함을 확인하였다(도 16, 17, 18)
도입한 3개 유전자의 효과를 확인하기 위해 제작한 C. tropicalis_mtSAP7 균주와 β-산화 경로가 제거된 C. tropicalis 20962 (β-KO) 균주를 같은 조건에서 발효하였다. 100 g/L glycerol이 첨가된 YP배지에서 OD값이 100이 되도록 우선 배양하였고, 배양 후 80시간이 경과하였을 시 200 g/L DAME을 기질로 첨가하여 30℃에서 250시간동안 배양하였다.
그 결과 대조군으로 사용한 C. tropicalis 20962 균주(β-산화 경로가 제거된 균주)와 C. tropicalis_mtSAP7 균주 모두에서 큰 OD 변화는 관찰되지 않았다(도 19). 두 균주의 SA 생산량을 비교한 결과 대조군으로 사용한 균주는 약 250시간에서 최대 세바식산 생산량(약 27 g/L)을 보였으며 mtSAP7 균주의 경우 약 250시간 경과시 약 110 g/L의 세바식산을 생산하는 것이 확인되었다(도 19).
위 연구를 통해, 전체 염기서열 분석을 통해 획득한 3개의 유전자가 균체형성과 기질 소비능, 세바식산의 생산성 증진에 크게 기여하는 것을 확인하였고 C. tropicalis_mtSAP7 균주를 이용한 high cell density bioconversion 공정을 통해 기존에 알려진 공정들보다 매우 우수한 세바식산 생산성을 보이는 공정을 개발하였음을 확인하였다.
[실시예 7] C. tropicalis mtSAP7 균주의 FAME 기질 내성 및 디카르복시산 생산의 확인
추가적으로, 실시예 6-4에서 제조된 C. tropicalis mtSAP7 균주를 이용하여, DAME으로부터 세바식산 생산에서 나아가, 다양한 FAME 기질로부터 디카르복시산 생산능은 어떠한지 실시예 6에서 실시한 바와 같이, 대조군 균주와 비교하였다.
그 결과, 도 20 에 나타나는 바와 같이, C8 내지 C12의 FAME 기질에서 C. tropicalis mtSAP7 균주가 C8 내지 C12의 디카르복실산 생산량도 현저히 증가함을 확인하였다. 이러한 결과를 통해서, 본 발명의 돌연변이 C. tropicalis mtSAP7균주는 세포독성을 나타내는 FAME 기질에 대한 강한 내성을 나타냄으로써, FAME을 기질로 하여 디카르복시산의 생산성 증진에 크게 기여할 것으로 판단된다(도 20).

Claims (10)

  1. 서열번호 1의 염기서열로 표시되는 LIP1(lipase) 유전자, 서열번호 2의 염기서열로 표시되는 FAT1(fatty acid transport) 유전자 및 서열번호 3의 염기서열로 표시되는 MRP1(multidrug resistance protein) 유전자 중 어느 하나 이상의 유전자가 돌연변이 되거나, 상기 돌연변이된 유전자 중 하나 이상이 도입된, 기질의 세포독성에 대한 내성이 증진된 캔디다 트로피칼리스(Candida tropicalis) 균주.
  2. 제 1항에 있어서, 상기 돌연변이된 서열번호 1의 LIP1(lipase) 유전자는 서열번호 4로 표시되는 것인, 캔디다 트로피칼리스 균주.
  3. 제 1항에 있어서, 상기 돌연변이된 서열번호 2의 FAT1(fatty acid transport) 유전자는 서열번호 5로 표시되는 것인, 캔디다 트로피칼리스 균주.
  4. 제 1항에 있어서, 상기 돌연변이된 서열번호 3의 MRP1(multidrug resistance protein) 유전자는 서열번호 6으로 표시되는 것인, 캔디다 트로피칼리스 균주.
  5. 제 1항에 있어서, 상기 캔디다 트로피칼리스 균주는 베타-산화(β-oxidation) 경로가 차단된 것인, 캔디다 트로피칼리스 균주.
  6. 제 1항 내지 제 5항에 있어서, 상기 기질은 지방산 메틸 에스테르(fatty acid methyl ester, FAME)인, 캔디다 트로피칼리스 균주.
  7. 제 6항에 있어서, 상기 지방산 메틸 에스테르 기질은 C6-C20의 지방산 메틸 에스테르 중 어느 하나 이상인 것인, 캔디다 트로피칼리스 균주.
  8. 청구항 제 1항 내지 제 5항 중 어느 한 항의 캔디다 트로피칼리스(Candida tropicalis) 균주를 기질과 함께 배지에서 배양하는 단계를 포함하는, 디카복실산(decarboxylic acid, DCA)을 생산하는 방법.
  9. 제 8항에 있어서, 상기 기질은 지방산 메틸 에스테르(fatty acid methyl ester, FAME)인, 디카르복시산(decarboxylic acid, DCA)을 생산하는 방법.
  10. 제 9항에 있어서, 상기 지방산 메틸 에스테르는 C6-C20의 지방산 메틸 에스테르 중 어느 하나 이상인 것인, 디카르복시산(decarboxylic acid, DCA)을 생산하는 방법.
PCT/KR2019/017044 2018-12-04 2019-12-04 디카르복시산 생산을 위한 미생물 및 이를 이용한 디카르복시산 생산방법 Ceased WO2020116941A2 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US17/299,194 US11873517B2 (en) 2018-12-04 2019-12-04 Candida tropicalis strain having improved tolerance to the cytotoxicity of substrates, and method for producing dicarboxylic acid using same
CN201980091207.5A CN113748210B (zh) 2018-12-04 2019-12-04 用于生产二羧酸的微生物及使用其生产二羧酸的方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020180154372A KR102157781B1 (ko) 2018-12-04 2018-12-04 디카르복시산 생산을 위한 미생물 및 이를 이용한 디카르복시산 생산방법
KR10-2018-0154372 2018-12-04

Publications (2)

Publication Number Publication Date
WO2020116941A2 true WO2020116941A2 (ko) 2020-06-11
WO2020116941A3 WO2020116941A3 (ko) 2020-07-23

Family

ID=70974744

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/017044 Ceased WO2020116941A2 (ko) 2018-12-04 2019-12-04 디카르복시산 생산을 위한 미생물 및 이를 이용한 디카르복시산 생산방법

Country Status (4)

Country Link
US (1) US11873517B2 (ko)
KR (1) KR102157781B1 (ko)
CN (1) CN113748210B (ko)
WO (1) WO2020116941A2 (ko)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BR112023009059A2 (pt) * 2021-03-08 2023-10-03 Lanzatech Inc Micro-organismo geneticamente manipulado capaz de produzir um produto a partir de um substrato gasoso
KR102888733B1 (ko) * 2022-05-31 2025-11-21 한국생명공학연구원 폐플라스틱으로부터 이산을 생산하는 방법
KR102908415B1 (ko) * 2023-09-26 2026-01-05 국민대학교산학협력단 변이 균주 캔디다 트로피칼리스 cpj1 및 이를 생촉매로 이용한 디카르복시산생산방법

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1614004A (zh) * 2004-12-07 2005-05-11 清华大学 热带假丝酵母基因工程重组菌的构建方法
KR20170048763A (ko) 2015-10-27 2017-05-10 한국생명공학연구원 세바식산 생산용 미생물 및 이를 이용한 세바식산의 생산 방법

Also Published As

Publication number Publication date
US20220033790A1 (en) 2022-02-03
KR102157781B1 (ko) 2020-09-21
US11873517B2 (en) 2024-01-16
KR20200068143A (ko) 2020-06-15
WO2020116941A3 (ko) 2020-07-23
CN113748210B (zh) 2024-09-10
CN113748210A (zh) 2021-12-03

Similar Documents

Publication Publication Date Title
Huang et al. Phage serine integrase-mediated genome engineering for efficient expression of chemical biosynthetic pathway in gas-fermenting Clostridium ljungdahlii
WO2013162274A1 (ko) 신규한 ｄ형 젖산 생산균주 및 그의 용도
WO2018124440A2 (ko) 신규한 이소프로필말레이트 신타제 변이체 및 이를 이용한 l-류신의 생산 방법
WO2019203436A1 (ko) 에탄올 생산 경로가 억제된 내산성 효모 및 이를 이용한 젖산의 제조방법
WO2019117398A1 (ko) 5'-이노신산을 생산하는 미생물 및 이를 이용한 5'-이노신산의 생산 방법
CN109988722B (zh) 一种重组酿酒酵母菌株及其应用和生产酪醇和/或红景天苷的方法
WO2022240071A1 (ko) 카르노신, 히스티딘, 베타알라닌 생산용 재조합 미생물 및 이를 이용한 카르노신, 히스티딘, 베타알라닌의 생산방법
CN106635945B (zh) 重组菌株及其制备方法和生产l-苏氨酸的方法
US11873517B2 (en) Candida tropicalis strain having improved tolerance to the cytotoxicity of substrates, and method for producing dicarboxylic acid using same
WO2020075986A2 (ko) 알코올 생성이 억제된 재조합 내산성 효모 및 이를 이용한 젖산의 제조방법
CN102168098B (zh) 胆固醇氧化酶基因和工程菌及应用
US12378587B2 (en) Recombinant methanotrophic bacteria for indigo biosynthesis and methods thereof
CN116083387A (zh) 酶、生产红景天苷的菌株及生产方法
WO2023136421A1 (ko) L-히스티딘 생산능이 향상된 에스케리치아 속 변이주 및 이를 이용한 l-히스티딘의 생산 방법
WO2018199546A1 (ko) 신규한 피루브산 전달효소
WO2020116932A2 (ko) 디카르복시산 생합성 관련 효소 및 이를 이용한 디카르복시산 생산방법
WO2018056794A1 (ko) 아세트산을 유일 탄소원으로 이용할 수 있는 미생물
WO2015182941A1 (ko) 신규 카탈라아제 신호서열 및 이를 이용한 카탈라아제 발현방법
WO2023106543A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2015046978A1 (ko) 2,3-부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 2,3-부탄디올의 생산 방법
WO2010093150A2 (ko) 글리세롤 대사능력 및 숙신산 생산능력이 향상된 재조합 미생물 및 이를 이용한 숙신산의 제조방법
WO2022191358A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2020180132A1 (ko) D-글루타메이트 영양요구성 대장균 및 이를 이용한 목적 물질 생산 방법
WO2016159536A1 (ko) 신규 프로모터 및 이의 용도
WO2021125494A1 (ko) 다중약물 유출펌프 변이체, 상기 변이체를 코딩하는 폴리뉴클레오티드, 상기 변이체를 포함하는 미생물, 및 이를 이용하여 비올라세인 또는 디옥시비올라세인을 제조하는 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19893498

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19893498

Country of ref document: EP

Kind code of ref document: A2