WO2019231266A1 - Hla 유전자가 제거된 인간 유도만능줄기세포 유래 중간엽줄기세포 및 그의 제조 방법 - Google Patents

Hla 유전자가 제거된 인간 유도만능줄기세포 유래 중간엽줄기세포 및 그의 제조 방법 Download PDF

Info

Publication number
WO2019231266A1
WO2019231266A1 PCT/KR2019/006536 KR2019006536W WO2019231266A1 WO 2019231266 A1 WO2019231266 A1 WO 2019231266A1 KR 2019006536 W KR2019006536 W KR 2019006536W WO 2019231266 A1 WO2019231266 A1 WO 2019231266A1
Authority
WO
WIPO (PCT)
Prior art keywords
hla
stem cells
cells
ipsc
mesenchymal stem
Prior art date
Application number
PCT/KR2019/006536
Other languages
English (en)
French (fr)
Inventor
강경선
서광원
안희진
권대기
한미정
Original Assignee
주식회사 강스템바이오텍
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 강스템바이오텍 filed Critical 주식회사 강스템바이오텍
Priority to US17/059,634 priority Critical patent/US20210222127A1/en
Priority to EP19812038.8A priority patent/EP3805370A4/en
Publication of WO2019231266A1 publication Critical patent/WO2019231266A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/70539—MHC-molecules, e.g. HLA-molecules
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/02—Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0603—Embryonic cells ; Embryoid bodies
    • C12N5/0606—Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/02—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from embryonic cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/45—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from artificially induced pluripotent stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/10041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/10043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites

Definitions

  • the present invention provides a method for producing induced pluripotent stem cells (iPSCs) and embryonic stem cells (ESCs) in which the expression level of HLA, which is the cause of the immune rejection reaction in transplantation of cells, tissues and organs, and the new differentiation method of iPSCs It relates to a method for producing mesenchymal stem cells (MSC), and a cell therapeutic agent using the iPSC and MSC.
  • iPSCs induced pluripotent stem cells
  • ESCs embryonic stem cells
  • HLA mesenchymal stem cells
  • MHC Major Histocompatibility Antigen
  • HLA human human leukocyte antigen
  • HLA mainly has 6 locus antigens of A, B, C, DR, DQ, DP, each of which consists of complex combinations of dozens of different types (alleles), with tens of thousands of combinations.
  • HLA plays an important immune mechanism in the human body and its main role is to present antigen for self recognition. If cells and tissues are transplanted from others (allogeneic transplantation), this HLA acts as the most important antigen and is recognized by immune cells such as T cells, and transplantation does not engraft.
  • iPSCs induced pluripotent stem cells
  • HLA antigen is a major obstacle to the use of stem cells clinically. Since the combination of HLA alleles reaches tens of thousands, it is very difficult to obtain natural HLA isoform cell lines (Rim et al., J Tissue Eng Regen Med, 2017). Genetic manipulation of HLA molecules is considered a preferred alternative to avoid immune rejection.
  • the present inventors have tried to develop a method for obtaining a transplant-compatible cell and a cell population containing the same, which do not cause an immune rejection reaction in the recipient, and thus knock out the allele by targeting a gene encoding the HLA alpha or beta subunit.
  • HLA class I homozygous mesenchymal stem cells which differentiated the induced pluripotent stem cells through the induced pluripotent stem cells and a new method, were prepared, and the present invention was completed by confirming the differentiation capacity of the mesenchymal stem cells.
  • One object of the present invention is to (a) reduce the expression level of HLA class I of iPSCs using genetic scissors technology; (b) forming an culture body (EB) from the induced pluripotent stem cells of step (a); And (c) differentiating the culture of step (b) into mesenchymal stem cells (MSCs), to provide a method for producing mesenchymal stem cells.
  • EB culture body
  • MSCs mesenchymal stem cells
  • Another object of the present invention is to provide a transplant-compatible mesenchymal stem cell prepared according to the above method.
  • Another object of the present invention is a pharmaceutical for the prevention or treatment of any one disease selected from the group consisting of immune diseases, inflammatory diseases, neurological diseases, bone diseases and joint diseases, including the graft-compatible mesenchymal stem cells as an active ingredient To provide a composition.
  • Still another object of the present invention is to provide a cell therapy agent comprising the transplantable mesenchymal stem cells as an active ingredient.
  • Another object of the present invention is to provide a method for producing graft compatible induced pluripotent stem cells, comprising the step of reducing the expression level of HLA class I using genetic scissors technology.
  • Still another object of the present invention is to provide a graft compatible induced pluripotent stem cell prepared according to the above method.
  • Another object of the present invention is to provide a method for producing transplantable embryonic stem cell (ESC), comprising the step of reducing the expression level of HLA class I using genetic scissors technology.
  • ESC transplantable embryonic stem cell
  • MSC By differentiating iPSC from which the HLA gene prepared in the present invention is removed, MSC can be prepared, and various kinds of cells which do not cause an immune rejection reaction can be prepared using the same, and can be used for future therapeutic purposes.
  • FIG. 1 is a photograph observing the wild-type iPSC manufacturing process and protein expression of the prepared iPSC.
  • Figure 1A is a photograph of a microscopic observation of the morphology of cells prepared after introducing a retrovirus expressing Yamanaka factor (Oct4, Sox2, c-Myc, Klf-4) into human dermal fibroblasts (hDF). . It can be seen that the prepared cells exhibit a specific form of induced pluripotent stem cells.
  • Figure 1B is a photograph showing the results of microscopic observation of the surface protein (Oct4, Sox2, Nanog, TRA-1-60) expression of the prepared iPSC using immunostaining.
  • Figure 2 shows the teratoma formed by injecting wild-type iPSCs into nude mice.
  • 2A is a photograph confirming that teratoma was formed in a nude mouse.
  • Figure 2B is ectoderm, mesoderm, endoderm cells observed in the tissues of the formed teratoma.
  • Figure 3 is a photograph showing the results of performing electrophoresis on the product by PCR amplification of the HLA-A, HLA-B, HLA-C locus.
  • 4 shows the genotype of iPSC # 10 in the iPSC colonies formed.
  • 4A shows the genotype of iPSC # 10 using a primer after purification of the PCR product, confirming that one allele of the HLA-A gene was knocked out of HLA-A knockout iPSC.
  • 4B shows detailed genotypes of iPSC # 10 and shows them in a table.
  • HLA-A, HLA-B, and HLA-C belonging to HLA class I HLA-A homozygous knocked out an allele of HLA-A ( homozygous) confirmed that it is an iPSC.
  • 5 shows the genotype of iPSC # 22 in the formed iPSC colonies.
  • 5A shows the genotype of iPSC # 22 using a primer after purification of the PCR product, confirming that one allele of the HLA-A gene was knocked out of HLA-A knockout iPSC.
  • FIG. 5B shows a detailed genotype of iPSC # 22, which is a table confirming that HLA-A, HLA-B and HLA-C alleles are knocked out by one HLA class I isoform iPSC.
  • FIG. 5C confirms that iPSC # 22 is strongly stained with differentiation marker proteins Oct4, Sox2, Nanog, and TRA-1-60 by immunostaining.
  • Figure 6 shows the method and result of differentiating MSC from iPSC of Example 2-1.
  • 6A is a schematic diagram showing the differentiation method, showing that the cultures were cultured in KSB-3, EGM-2MV, and DMEM-F12 medium 6 days after the formation of the cultures from iPSC.
  • 6B is a photograph observing the morphology of the cells proliferated in each medium.
  • 6C shows the results of FACS analysis of cell surface markers grown in each medium.
  • 8 observes the characteristics of MSCs differentiated from iPSCs (iMSCs).
  • 8A is a photograph showing the process of differentiating MSC by culturing iPSC.
  • 8B confirms the proliferative capacity of iMSCs.
  • 9 observes the characteristics of the prepared iMSC.
  • 9A confirms the expression of surface antigens (CD11b, CD19, CD34, CD45, HLA-DR, CD73, CD105) of iMSC prepared by FACS analysis.
  • 9B is a bar graph of mRNA expression levels of iPSC and stem cell function genes (POU5F1, SOX2, REX1, ZNF281) of iMSCs differentiated therefrom.
  • 9C shows Western expression of Sox2 expression, a differentiation marker, in iPSCs and iMSCs differentiated therefrom.
  • Figure 10 confirms the differentiation capacity of the prepared iMSC.
  • Figure 10A is a graph showing the results of measuring the expression level of genes involved in adipocyte, osteocytes, chondrocyte differentiation using qRT-PCR in the prepared iMSC.
  • 10B is representatively confirmed the differentiation ability to bone cells
  • UCB is cord blood stem cells
  • AD is adipose derived stem cells
  • BM is bone marrow derived stem cells
  • iMSC shows the MSC differentiated from iPSC.
  • FIG. 11 shows the genetic stability and gene lineage of the prepared iMSC.
  • FIG. 11A shows the normal karyotype as a result of karyotype analysis of the prepared iMSC.
  • Figure 11B confirms the in vivo stability of the prepared iMSC, the site of injection of the iMSC and iPSC to the experimental mice are indicated by arrows, respectively. Tumors are formed at the site injected with iPSC (right mouse of FIG. 11B), whereas no tumors are formed at the site injected iMSC (left mouse of FIG. 11B).
  • 11C and 10D show the results of performing a microarray using hDF, iPSC, and iMSC to confirm the gene hierarchy of the prepared iMSC. In the case of iMSC, the hDF shows a gene hierarchy separated from iPSC. It can be seen that the expression system is more similar to iPSC.
  • FIG. 12 shows the results of observing the characteristics of HLA-class I homo iMSC derived from differentiated HLA-class I homo iPSC through the method of Example 2-1.
  • 12A is a photograph showing the differentiation of the culture medium, the attached culture medium and the cells in the process of differentiation in the same manner as in Example 2-1 using the HLA-class I homo iPSC.
  • Figure 12B is a photograph of the morphology of the HLA-class I homo iMSC, it can be seen that shows the same MSC-specific cell morphology as the existing iMSC.
  • 12C shows the results of confirming MSC-specific surface antigen expression of HLA-class I homo iMSCs by FACS analysis.
  • the present invention comprises the steps of (a) reducing the expression level of HLA class I of induced pluripotent stem cells (iPSC) using genetic scissors technology; (b) forming an culture body (EB) from the induced pluripotent stem cells of step (a); And (c) differentiating the culture of step (b) into mesenchymal stem cells (MSCs), providing a method for producing mesenchymal stem cells.
  • iPSC induced pluripotent stem cells
  • EB culture body
  • MSCs mesenchymal stem cells
  • step (a) is a step of reducing the expression level of HLA class I of iPSCs using genetic scissors technology.
  • iPSC induced pluripotent stem cell
  • iPSC induced pluripotent stem cell
  • Artificial dedifferentiation process is performed by the use of virus-mediated or non-viral vectors with retroviruses and lentiviruses, introduction of non-virus-mediated dedifferentiation factors using protein and cell extracts, or by stem cell extracts, compounds, etc. It may include a reverse differentiation process, specifically, may include a process of introducing a retrovirus expressing Oct4, Sox2, c-Myc, Klf-4 to the differentiated cells, but is not limited thereto.
  • Induced pluripotent stem cells have similar characteristics to embryonic stem cells, specifically, show similar cell morphology, and gene and protein expression patterns may be similar, for example, Oct4, Sox2, Nanog, TRA-1-60, etc. Proteins can be strongly expressed, but are not limited thereto. In addition, they have differentiation potential in vitro and in vivo, and when injected subcutaneously in mice, they can form teratomas including trioderm cells, and germline of genes. transmission) may have possible features.
  • HLA human leukocyte antigen
  • MHC Major Histocompatibility Antigen Complex
  • HLA classes are used for histocompatibility testing between donors and recipients when transplanting cells, tissues, and organs. Transplantation is possible if the donor's and recipient's HLA antigens all match, but there are more than 9719 alleles of HLA class I and II, because each person has numerous genetic polymorphisms on each HLA gene. It is not easy to find a donor whose HLA type is a perfect match. If the donor's HLA-A gene does not match the donor's HLA-A gene during cell, tissue, or organ transplantation, the recipient's body's immune cells recognize the difference and attack the donor cell. This leads to a transplant failure.
  • the present invention provides a method for producing a cell that is homozygous or null for an immunocompatible antigen, specifically, a genetically modified antigen, through genetic engineering.
  • graft suitability of the present invention means a property that does not cause an immune rejection reaction in cell transplantation. Reducing the expression of a gene that is responsible for an immune rejection reaction can render a cell, tissue, or organ transplantable, and by way of non-limiting example, a cell, tissue, or organ can be transplanted by reducing the expression level of the HLA gene. Can be adapted. Graft compatible cells include, but are not limited to, cells in which the immunocompatible antigen is homozygous or missing.
  • HLA can be classified into "HLA Class I” and "HLA Class II".
  • HLA-A, HLA-B, HLA-C belong to HLA class I
  • HLA-DR, HLA-DP, HLA-DQ belong to HLA class II.
  • Normal somatic cells express only three pairs of HLA-A, HLA-B, HLA-C belonging to HLA class I
  • immune cells express a total of six pairs in total, both HLA class I and HLA class II.
  • reducing the expression level using gene shearing techniques means that the gene encoding the polypeptide is not expressed by knock-in or knock-out, or gene expression. It means that it does not produce a corresponding polypeptide that exhibits a certain reduction in the natural state or the state before the modification, or is functional even if expressed.
  • gene encoding the polypeptide is not only completely inactivated, but also means that the expression level thereof is weakened or markedly lower than the intrinsic expression level and is not substantially expressed.
  • gene inactivation is a product of a mutant gene that is either full (knocked out) or partial (e.g., a hypomorphic gene whose genes are below an intrinsic expression level, or which exhibits a partial decrease in the activity to which it affects). May be).
  • the reduction in gene expression levels can be “homozygous” by being made for one of the two pairs of alleles, or “null” by being made for all of the two pairs of alleles. That is, the term “homozygosity” as used in the present invention with respect to a decrease in the level of gene expression may be interpreted to mean that one allele has been knocked out and “deleted” means that the two alleles have been knocked out. It can be interpreted as meaning.
  • "HLA-homo" cells prepared in one embodiment of the present invention means “HLA-homozygous", “HLA homozygous” cells.
  • a method of deleting part or all of a polynucleotide encoding the protein replaces a polynucleotide encoding an endogenous target protein in a chromosome with a polynucleotide or a marker gene in which some nucleic acid sequences are deleted through an intracellular chromosome insertion vector. This can be done by.
  • the term "some” differs depending on the kind of polynucleotide, but is specifically 1 to 300, more specifically 1 to 100, and more specifically 1 to 50.
  • a method of modifying an expression control sequence to reduce the expression of the polynucleotide is not particularly limited, but deletion, insertion, non-conservative or conservative of the nucleic acid sequence to further weaken the activity of the expression control sequence. It can be carried out by inducing a mutation on the expression control sequence by substitution or a combination thereof, or by replacing with a nucleic acid sequence having weaker activity.
  • the expression control sequence may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosomal binding site, and a sequence that controls termination of transcription and translation.
  • the method of modifying the polynucleotide sequence on the chromosome is carried out by inducing a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution or a combination thereof to further weaken the activity of the protein, It can be performed by replacing with a polynucleotide sequence that has been improved to have weaker activity, but is not limited thereto.
  • the "genetic scissors technique" of the present invention may include reducing the expression of the HLA antigen through genetic manipulation, specifically gene deletion or genetic modification, using "engineered nuclease", but is not limited thereto. It is not.
  • the genetic manipulation includes gene deletion or genetic modification, and may be performed using a method called gene editing, genome editing, or genome engineering technique. Genetic engineering can be accomplished by knocking out or knocking in a particular gene, but is not limited thereto.
  • the genetic engineering technique may include, but is not limited to, an enzyme that specifically acts on a desired sequence, including nucleases or nickases and guide vectors.
  • the genetic scissors may include, for example, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), and clustered regularly interspaced short palindromic repeat (CRISPR). Does not.
  • ZFN zinc finger nuclease
  • TALEN transcription activator-like effector nuclease
  • CRISPR clustered regularly interspaced short palindromic repeat
  • zinc finger nuclease refers to a fusion protein comprising a zinc finger domain and a nucleotide cleavage domain, and may include all known or commercially available zinc finger nucleases. In the present invention, the terms “zinc finger nuclease” and “ZFN” may be used interchangeably.
  • the "TALEN (Transcription activator-like effector nuclease)" means an artificial restriction enzyme prepared by fusing a TAL effector DNA binding domain and a DNA cleavage domain to each other.
  • the TALEN also includes a form in which the TAL effector DNA binding domain and the DNA cleavage domain are linked through a linker.
  • the TAL effector DNA binding domain is engineered to bind quickly to any desired DNA sequence, and when combined with the DNA cleavage domain, the TAL effector DNA binding domain is specifically bound to a desired DNA sequence, thereby bringing about an effect of cleaving a desired DNA site.
  • Donor DNA is used together with nucleases.
  • the donor DNA is a DNA containing a gene to be introduced to a position on a chromosome cleaved by a nuclease, and may include a left flanked arm and a right flanked arm for recombination, and further includes a selection marker. It may optionally include, but is not limited thereto.
  • RNA-guided nuclease refers to a nuclease capable of recognizing and cleaving a specific position on a desired genome, particularly a nuclease having target specificity by guide RNA.
  • the RNA-guided nuclease may be, but is not limited to, specifically a Cas protein derived from CRISPR, which is a microbial immune system, or a Cpf1 nuclease, and more specifically, a Cas9 (CRISPR-Associated Protein 9) nuclease ( nuclease) and variants thereof, Cas9 nickases.
  • the "Cas protein” is a major protein component of the CRISPR / Cas system, a protein that can act as an activated endonuclease or nickase.
  • the Cas protein may form a complex with crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) to show its activity.
  • the Cas9 nuclease recognizes specific sequences in the genomes of animal and plant cells, including human cells, resulting in double strand break (DSB).
  • the double helix cut includes both cutting the double helix of the DNA to create a blunt end or a cohesive end.
  • DSBs are efficiently repaired by homologous recombination or non-homologous end-joining (NHEJ) mechanisms within cells, which allows the researchers to introduce desired mutations into the target site.
  • NHEJ non-homologous end-joining
  • the RNA-guided nuclease may be artificial or engineered non-naturally occurring.
  • the Cas9 nickase may have a D10A mutation, but is not limited thereto. Unlike the Cas9 nuclease, the Cas9 kinase causes a single strand break. Thus, Cas9 kinase requires two guide RNAs to function and functions as a pair. The two guide RNAs direct sequence specific binding of the CRISPR complex to each target sequence and direct the cleavage of one strand of the DNA duplex near each target sequence, resulting in two nicks in different DNA strands. Can be derived.
  • Cas protein or genetic information can be obtained from known databases such as GenBank of the National Center for Biotechnology Information (NCBI).
  • the Cas protein may be a Cas9 protein.
  • the Cas protein is Staphylococcus, Streptococcus, Neisseria, Pasteurella, Francisella, Campylobacter Cas protein derived from the genus, but the present invention is not limited to the examples described above.
  • the "Cpf1 nuclease” is derived from Francisella novicida , and may form a complex with crRNA to express its activity.
  • the structure of the Cpf1 protein has a shorter length of RNA that binds, thus making it easier to manufacture and excellent in accuracy.
  • the Cpf1 protein or gene information can be obtained from a known database such as GenBank of the National Center for Biotechnology Information (NCBI). "Reducing the expression level of HLA class I using genetic scissors technology" of the present invention is to knock out at least one of HLA-A, HLA-B and HLA-C using the composition for HLA class I knockout.
  • the knockout composition may include, but is not limited to, a CRISPR / Cas9 system targeting HLA class I.
  • the HLA class I knockout composition comprises (a) an expression vector comprising an isolated polynucleotide encoding a guide RNA consisting of a nucleotide sequence of SEQ ID NO: 1 or a nucleotide sequence complementary thereto; (b) an expression vector comprising an isolated polynucleotide encoding a guide RNA consisting of the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence complementary thereto; And (c) an expression vector comprising an isolated polynucleotide encoding a guide RNA consisting of a nucleotide sequence of SEQ ID NO: 3 or a nucleotide sequence complementary thereto, but is not limited thereto.
  • the expression level of one or more of the genes belonging to HLA-class II may further be included.
  • HLA class I was knocked out by introducing all of the expression vectors.
  • the expression vector may include a polynucleotide encoding Cas9 nuclease or Cas9 nickase. That is, when the Cas9 protein and the guide RNA are present together, the target DNA can be cleaved, so that the polynucleotide encoding the Cas9 protein can be used in a form included in the guide RNA and one vector, or the Cas9 protein. It is also possible to use a separate expression vector encoding.
  • the vector may be a viral vector, a plasmid vector, or an agrobacterium vector, but is not limited thereto.
  • An expression vector comprising the polynucleotide encoding the guide RNA and / or the polynucleotide encoding the Cas9 protein may be prepared by performing a cloning method known in the art, but is not particularly limited thereto. .
  • step (b) is a step of forming an embryonic body (EB) from the induced pluripotent stem cells of step (a).
  • cultured body (EB) of the present invention refers to agglomerates of pluripotent stem cells, and may be used to refer to a state in which stem cells are separated from supporting cells and reach an early stage of differentiation.
  • Forming the culture from the stem cells may include a method for changing the stem cell medium composition, specifically, may be to exclude a specific component, growth factors, etc. from the medium of the stem cells, but is not limited thereto.
  • the culture medium of stem cells may include DMEM / F12 + GlutaMAX-I (Gibco), Primocin (Invivogen), Knockout SR (Gibco), Basic fibroblast growth factor (R & D), but in the present invention, the medium Cultures were formed using media except for basic fibroblast growth factor.
  • step (c) is a step of differentiating the culture of step (b) into mesenchymal stem cells (MSC).
  • meenchymal stem cell of the present invention means having a heterogeneous population of stem cells with the ability to self-renewal and differentiate into other embryonic lineages such as endoderm and ectoderm. do.
  • Mesenchymal stem cells can specifically aid in making cartilage, bone, fat, myeloid epilepsy, muscle, nerves, skin, etc.In adults, they usually stay in the bone marrow but can be obtained from umbilical cord, cord blood, peripheral blood, or other tissues. Can be obtained through differentiation from induced pluripotent stem cells, but is not limited thereto.
  • the induced pluripotent stem cells were differentiated to obtain mesenchymal stem cells, and the obtained mesenchymal stem cells were confirmed to stably differentiate into adipocytes, chondrocytes, and bone cells.
  • the mesenchymal stem cells of the present invention can be differentiated into cells constituting various tissues, bar cells can be formed using the mesenchymal stem cells of the present invention.
  • KSB-3 Keratstem biotech
  • KSB-3 Kerangstem biotech medium containing 10% FBS was used to differentiate induced pluripotent stem cells into mesenchymal stem cells.
  • the cells differentiated into mesenchymal stem cells were selectively grown in mass by culturing the culture in KSB-3 medium containing 10% FBS for 6 days without separating into single cells.
  • differentiated cells obtainable using the mesenchymal stem cells of the present invention refers to any cell that is in the process of being differentiated into or finally differentiated into a somatic lineage.
  • the cells constituting the adult means cells with limited differentiation and self-producing ability.
  • the differentiated cells may be somatic cells constituting human cartilage, bone, fat, myeloid epilepsy, muscle, nerve, skin, and the like, but are not limited thereto.
  • Another aspect of the present invention provides a transplantable mesenchymal stem cell prepared according to the above method.
  • the "graft suitability”, “mesenchymal stem cells” are as described above.
  • Another aspect of the present invention the prevention of any one disease selected from the group consisting of immune diseases, inflammatory diseases, neurological diseases, bone diseases and joint diseases, including mesenchymal stem cells prepared according to the method as an active ingredient Or it provides a pharmaceutical composition for treatment.
  • immune disease means a disease that is a problem when a specific immune response occurs, but is not limited thereto, and may preferably be an autoimmune disease, transplant rejection, graft versus host disease, and autoimmune disease Crohn's disease, erythema, atopy, rheumatoid arthritis, Hashimoto's thyroiditis, pernicious anemia, Edison's disease, type 1 diabetes, lupus, chronic fatigue syndrome, fibromyalgia, hypothyroidism and hypertension, scleroderma, Behcet's disease, inflammatory bowel disease, Multiple sclerosis, myasthenia gravis, Meniere's syndrome, Guilian-Barre syndrome, Sjogren's syndrome, vitiligo, endometriosis, psoriasis, vitiligo, systemic scleroderma, asthma or ulcerative colitis Can be.
  • the term "inflammatory disease” refers to a disease that is mainly caused by inflammation, but is not limited thereto, preferably, edema, dermatitis, allergy, atopic dermatitis, asthma, conjunctivitis, periodontitis, rhinitis, otitis media, sore throat, Tonsillitis, pneumonia, gastric ulcer, gastritis, Crohn's disease, colitis, hemorrhoids, gout, spondylitis spondylitis, rheumatic fever, lupus, fibromyalgia, psoriatic arthritis, osteoarthritis, rheumatoid arthritis, periarthritis, tendinitis, hay salt, myositis, hepatitis, Cystitis, nephritis, Sjogren's syndrome or multiple sclerosis.
  • Neve system disease of the present invention includes diseases caused by the deformation, loss, etc. of nerve cells, specifically, Parkinson's disease, Alzheimer's disease, Pick's disease, Huntington's disease, muscular dystrophy Amyotriophiclateral sclerosis, ischemic stroke, demyelinating disease, multiple sclerosis, epilepsy, degenerative neuropathy, spinal cord injury, and the like, but are not limited thereto. .
  • the "bone disease” of the present invention includes all diseases that can occur due to a decrease in bone density, and specifically, osteoporosis, rheumatoid arthritis, periodontal disease, osteomalacia, osteoogenesis imperfecta, bone May include, but are not limited to, osteopetrosis, osteosclerosis, Paget's disease, adynamic bone disease, metabolic bone disease, rickets, etc. It doesn't happen. Since the mesenchymal stem cells of the present invention have osteogenic differentiation ability, it can be used as a composition for the purpose of forming bone tissue by administering to a subject having osteo metabolic disease.
  • “Arthropathy” of the present invention also referred to as “arthrosis” (“arthrosis” or “osteo-arthrosis”) refers to a disease involving the lack of pain and joint abnormalities, neurotrophic diseases of the joints Generally, polyarthrosis, Coxarthrosis, Gonarthrosis, spondyloarthropathy, etc., can be accompanied by cartilage damage or cartilage dysfunction. It is known that the disease can progress to arthritis because it involves inflammation In one embodiment of the present invention, it has been confirmed that mesenchymal stem cells can be differentiated into chondrocytes. It can be used as a composition for the prophylaxis or treatment of.
  • prevention includes all actions that inhibit or delay the onset of the disease by administration of the composition.
  • treatment includes any action that improves or benefits the condition of the disease by administration of the composition.
  • composition may comprise a pharmaceutically acceptable carrier.
  • the "pharmaceutically acceptable carrier” may refer to a carrier or diluent that does not interfere with the biological activity and properties of the compound to be injected without stimulating the organism.
  • the kind of the carrier usable in the present invention is not particularly limited, and any carrier can be used as long as it is a conventionally used and pharmaceutically acceptable carrier in the art.
  • Non-limiting examples of the carrier include saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol and the like. These may be used alone or in combination of two or more thereof.
  • composition comprising a pharmaceutically acceptable carrier may be in various oral or parenteral formulations.
  • diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used.
  • solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations include at least one excipient such as starch, calcium carbonate, sucrose, lactose in the compound. , Gelatin and the like can be mixed.
  • excipients such as starch, calcium carbonate, sucrose, lactose in the compound. , Gelatin and the like can be mixed.
  • lubricants such as magnesium stearate, talc can also be used.
  • Oral liquid preparations include suspensions, solvents, emulsions, and syrups.In addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. have.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations and suppositories.
  • non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate and the like can be used.
  • base of the suppository utopsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
  • Another aspect of the present invention provides a cell therapy comprising the graft compatible mesenchymal stem cells prepared according to the method as an active ingredient.
  • the transplantable mesenchymal stem cells are as described above.
  • the term "cell therapeutic agent” refers to a medicine (US FDA regulation) used for the purpose of treatment, diagnosis, and prevention of cells and tissues prepared through isolation, culture, and special manipulation from an individual. Means a medicine used for the purpose of treatment, diagnosis and prevention through a series of actions, such as proliferating and screening the living autologous, allogeneic, or heterologous cells in vitro or by altering the biological characteristics of the cells in order to restore.
  • the cell therapy agent of the present invention may include 1.0 ⁇ 10 to 1.0 ⁇ 10 9 cells per ml, but is not limited thereto.
  • the cell therapy of the invention can be used unfrozen or frozen for future use. If frozen, standard cryopreservatives (eg DMSO, glycerol, Epilife cell freezing medium (Cascade Biologics)) can be added to the cell population before freezing.
  • standard cryopreservatives eg DMSO, glycerol, Epilife cell freezing medium (Cascade Biologics)
  • the cell therapeutic agent may be administered in a unit dosage form suitable for administration in the body of a patient according to a conventional method in the pharmaceutical field, and the agent may be administered in an effective dosage by one or several administrations. Include.
  • Formulations suitable for this purpose include parenteral injectables such as injectable ampoules, injectables such as infusion bags, sprays such as aerosol preparations and the like.
  • the injection ampoule may be mixed with the injection solution immediately before use, and physiological saline, glucose, mannitol, and Ringer's solution may be used as the injection solution.
  • Infusion bags may also be made of polyvinyl chloride or polyethylene, and include Baxter, Becton ickinson, Medcep, National Hospital Products, or Terumo.
  • the injection bag of the yarn can be illustrated.
  • the cell therapy products include one or more pharmaceutically acceptable inert carriers such as preservatives, analgesics, solubilizers or stabilizers in the case of injections, and in the case of preparations for topical administration , Excipients, lubricants or preservatives.
  • pharmaceutically acceptable inert carriers such as preservatives, analgesics, solubilizers or stabilizers in the case of injections, and in the case of preparations for topical administration , Excipients, lubricants or preservatives.
  • the cell therapeutic agent of the present invention thus prepared may be administered with other stem cells used for transplantation and other uses or in the form of a mixture with such stem cells using administration methods commonly used in the art. It is possible, but not limited to, to engraft or implant directly at the disease site of the patient in need or to implant or inject directly into the abdominal cavity.
  • the administration can be both non-surgical administration using a catheter and surgical administration methods such as injection or transplantation after dissection of the disease site, but non-surgical administration using a catheter is more preferable.
  • parenteral administration for example, in addition to direct lesions, transplantation by intravascular injection, which is a general method of hematopoietic stem cell transplantation, is also possible according to a conventional method.
  • the cell therapy agent may be administered once or in divided doses.
  • the actual dosage of the active ingredient should be determined in light of several relevant factors such as the disease to be treated, the severity of the disease, the route of administration, the patient's weight, age and gender, and therefore, the dosage may be It does not limit the scope of the present invention in terms of aspects.
  • mesenchymal stem cells can be differentiated into adipocytes, osteocytes and chondrocytes.
  • the mesenchymal stem cells of the present invention can be used as a therapeutic agent for various diseases.
  • Another aspect of the invention provides a method for producing graft compatible induced pluripotent stem cells, comprising reducing the expression level of HLA class I using genetic scissors technology.
  • graft suitability and "induced pluripotent stem cells” are as described above.
  • the HLA class I may be one or more selected from the group consisting of HLA-A, HLA-B and HLA-C
  • the genetic scissors technology is any of CRISPR, TALEN or zinc finger nuclease It may be one, but is not limited thereto.
  • the step of reducing the expression level of the HLA class I using the scissors technology may be to use the composition for HLA class I knockout
  • the composition for HLA class I knockout is SEQ ID NO: 1, SEQ ID NO: 2 and sequence It may include one or more of the expression vector containing the isolated polynucleotide encoding the guide sequence consisting of the base sequence of SEQ ID NO: 3 or a base complementary to these.
  • the expression vector may include a polynucleotide encoding Cas9 nuclease, Cpf1 nuclease or Cas9 kinase.
  • Another aspect of the present invention provides a graft compatible induced pluripotent stem cell prepared according to the above method.
  • the "graft suitability” and “induced pluripotent stem cells” are as described above.
  • Another embodiment of the present invention comprises the steps of reducing the expression level of HLA class I using a genetic scissors technology, the method for producing graft-compatible embryonic stem cells (ESC) and graft-compatible embryonic stem cells prepared by the method to provide.
  • ESC embryonic stem cells
  • Embryonic stem cell (ES cell) of the present invention is a cell having the potential to differentiate into cells of all tissues constituting an individual, the term pluripotent stem cell (pluripotent stem cell) or pluripotent stem cells and Can be used interchangeably.
  • the embryonic stem cells may be undifferentiated cells capable of unlimited proliferation, may differentiate into all cells, and may form germ cells, unlike adult stem cells.
  • HLA class I genetic scissors technology, graft compatibility and the like are described above.
  • iPSC was prepared by introducing a retrovirus expressing Yamanaka factor (Oct4, Sox2, c-Myc, Klf-4) into human dermal fibroblasts (hDF) (FIG. 1A).
  • Yamanaka factor Oct4, Sox2, c-Myc, Klf-4
  • hDF human dermal fibroblasts
  • the prepared iPSC strongly confirmed the expression of Oct4, Sox2, Nanog, and TRA-1-60 proteins, which are proteins showing differentiation potential, by immunostaining (FIG. 1B), and further, the manufactured iPSC was nude mouse (nude mouse). It was confirmed that the teratoma containing cells of the three germ cells were formed by injecting subcutaneously (Figs. 2A and 2B), and through this, iPSC was not only in vitro but also in vivo. It can be seen that it has differentiation potential.
  • the prepared guide RNA sequence was cloned into a pCas-guide vector to prepare three CRISPR / Cas9 vectors targeting each of the HLA-A, HLA-B, and HLA-C genes.
  • genomic DNA was isolated from 24 iPSC colonies separated and cultured, followed by PCR amplification of HLA-A, HLA-B, and HLA-C locus using the isolated genomic DNA and primers. Primers used for amplification are listed in Table 2 below.
  • iPSC # 10 among 24 iPSC colonies was HLA-A knockout iPSC knocked out of one allele of HLA-A gene (FIG. 4A).
  • TA cloning, transformation, colony inoculation, and plasmid miniprep of the amplified PCR product confirmed the detailed genotype.
  • iPSC # 10 was HLA knocked out of two HLA-A alleles. It was finally confirmed that -A homozygous iPSC (FIG. 4B).
  • iPSC # 22 is HLA-A knockout iPSC knocked out of one allele of the HLA-A gene (FIG. 5A), and the amplified PCR product was TA cloned, transformed, and colonized. Inoculation, plasmid miniprep confirmed the detailed genotype, and finally iPSC # 22 was HLA class I homozygous iPSC knocked out of two alleles of each of HLA-A, HLA-B and HLA-C. It was confirmed (FIG. 5B).
  • HLA class I knockout iPSC prepared above was confirmed by immunostaining strongly expressing proteins Oct4, Sox2, Nanog, TRA-1-60, which are proteins showing differentiation potential (Fig. 5C), differentiation potential It can be seen that.
  • Example 2-1 Induction of MSC Differentiation and Confirmation of Efficiency from iPSC
  • iPSC was isolated from the culture dish using a dissociation solution or mechanical passage.
  • the isolated iPSC was washed three times with PBS and cultured in a Petri dish capable of floating culture to induce the formation of an embryoid body (EB) to induce primary differentiation.
  • EB embryoid body
  • the EB-forming medium was maintained undifferentiated in normal iPSC medium (DMEM / F12 + GlutaMAX-I (Gibco) 500 ml + Primocin (Invivogen) 1 ml + Knockout SR (Gibco) 125 ml + Basic fibroblast growth factor (R & D) 2.5 ug) Except for the bFGF component (Basic fibroblast growth factor) was used. Medium was changed every 2-3 days.
  • DMEM / F12 + GlutaMAX-I (Gibco) 500 ml + Primocin (Invivogen) 1 ml + Knockout SR (Gibco) 125 ml + Basic fibroblast growth factor (R & D) 2.5 ug) Except for the bFGF component (Basic fibroblast growth factor) was used. Medium was changed every 2-3 days.
  • EB was added to KSB-3 medium with 10% FBS and attached to a culture dish coated with 0.1% gelatin for 30 minutes. The point of attachment of EB was set to passage passage 0. In addition, EB was attached to EGM-2MV and DMEM-F12 medium in addition to KSB-3 medium to compare differentiation efficiency.
  • EB was isolated from the culture dish using TrypLE, separated into single cells by pipetting, and then attached to a new culture dish and incubated with KSB-3 medium, which was set as passage passage 1. . Subsequently, the medium was exchanged every 2-3 days, each time 4x10 5 cells were passaged in a 100 mm petri dish using TrypLE and Trypan blue staining whenever 80-90% confluency was indicated by cell proliferation. This procedure was repeated to induce differentiation into MSCs (FIG. 6A). Surface antigen expression of differentiated MSCs was analyzed using FACS and the time required for passage culture was measured.
  • KSB-3 can differentiate induced pluripotent stem cells into mesenchymal stem cells more efficiently than other media.
  • Example 2-1 shows that iPSC differentiated into MSC.
  • the number of iMSCs differentiated and expanded in one iPSC colony was determined.
  • iMSC prepared in the present invention has a unique characteristic of MSC, whether or not surface antigen expression was confirmed using a FACS analysis method.
  • iMSC prepared by the method of Example 2-1 was treated with 7 kinds of antigens known as MSC surface antigens, induced cell surface adhesion, and did not adhere to the cell surface through FACS analysis.
  • the expression of the antigens (CD11b, CD19, CD34, CD45, HLA-DR) and the antigens attached to the cell surface (CD73, CD105) showing positive results was confirmed (Fig. 9A).
  • the prepared iMSCs showed results consistent with MSC-specific surface antigen expression. Through this, it was confirmed that iMSC is normally induced differentiation.
  • MSC has a differentiation capacity that can be differentiated into fat (Adipogenesis), bone (Osteogenesis) and cartilage (Chondrogenesis) according to differentiation conditions, in order to confirm the differentiation capacity of the iMSC prepared in Example 2-1, StemPro Adipogenesis Differentiation Differentiation was induced into adipocytes, bone cells, and chondrocytes for 4 weeks using the kit (Gibco, A10070-01), the StemPro Osteogeneis Differentiation kit (Gibco, A10072-01), and the StemPro Chnodrogenesis Differentiation kit (Gibco, A10071-01). .
  • the kit Gibco, A10070-01
  • StemPro Osteogeneis Differentiation kit Gibco, A10072-01
  • StemPro Chnodrogenesis Differentiation kit Gibco, A10071-01
  • the MSC prepared in the present invention can differentiate into adipocytes, osteocytes, chondrocytes, it can be seen that it has a general MSC differentiation ability.
  • Example 2-7 Checking the Stability of the Prepared iMSCs
  • iMSC and the same amount of iPSC were injected subcutaneously in experimental mice to verify the in vivo stability of the prepared iMSC. After 8 weeks, it was confirmed that tumors were formed at the site where iPSC was injected into the experimental mouse, whereas tumors were not formed at the site where iMSC was injected (FIG. 11B). These results indicate that the iMSC of the present invention secured stability of forming no tumor even when injected into the body.
  • Microarray was performed to confirm the gene hierarchy of the iMSC prepared in the present invention.
  • Example 3 Preparation and Characterization of HLA-homo iMSCs from HLA-Class I Homozygous (HLA-homo) iPSCs
  • HLA-class I homo iMSCs differentiation was induced into MSCs after EB formation from the HLA-class I homo iPSCs prepared in Example 1 in the same manner as described in Example 2-1 (FIG. 12A). .
  • the prepared HLA-class I homo iMSC showed a result corresponding to the MSC-specific surface antigen expression pattern (negative: CD11b, CD19 , CD34, CD45, HLA-DR; positive: CD73, CD105) (FIG. 12C).
  • HLA-class I homo iMSC prepared using HLA-class I homo iPSC also has the characteristics of MSC.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Rheumatology (AREA)
  • Immunology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Hematology (AREA)
  • Virology (AREA)
  • Epidemiology (AREA)
  • Pain & Pain Management (AREA)
  • Gynecology & Obstetrics (AREA)
  • Reproductive Health (AREA)
  • Mycology (AREA)

Abstract

본 발명은 세포, 조직, 장기이식 시 면역거부반응의 원인인 HLA의 발현 수준이 감소된 유도만능줄기세포(iPSC) 및 배아줄기세포(ESC)의 제조 방법과, 상기 iPSC의 새로운 분화 방법을 이용한 중간엽 줄기세포(MSC)의 제조 방법, 및 상기 iPSC, ESC 및/또는 MSC를 이용한 세포 치료제에 관한 것으로, 본 발명에서 제조한 HLA 유전자가 제거된 MSC를 이용하여 면역 거부 반응을 일으키지 않는 다양한 종류의 세포를 제조할 수 있으며, 이를 향후 치료목적으로 활용할 수 있다.

Description

HLA 유전자가 제거된 인간 유도만능줄기세포 유래 중간엽줄기세포 및 그의 제조 방법
본 발명은 세포, 조직, 장기이식 시 면역거부반응의 원인인 HLA의 발현 수준이 감소된 유도만능줄기세포(iPSC) 및 배아줄기세포(ESC)의 제조 방법과, 상기 iPSC의 새로운 분화 방법을 이용한 중간엽 줄기세포(MSC)의 제조 방법, 및 상기 iPSC와 MSC를 이용한 세포 치료제에 관한 것이다.
주요 조직 적합 항원(Major Histocompatibility Antigen: MHC)은 인간의 HLA(Human leukocyte antigen: 인간 백혈구 항원)로 알려져 있고, 대부분의 세포와 조직에서 발현된다. HLA는 주로 A, B, C, DR, DQ, DP의 6유전자좌 항원이 있고, 이들 각각은 수십 종류의 상이한 유형(대립유전자)의 복잡한 조합으로 구성되어 있으며, 그 조합은 수만 가지 존재한다. HLA는 인간의 체내에서 중요한 면역 메커니즘을 담당하고 있고, 그 주요 역할은 자타 인식을 위한 항원 제시이다. 만약 타인으로부터 세포·조직을 이식받은 경우(동종이계 이식: allogeneic transplantation), 이 HLA가 가장 중요한 항원으로 작용하여 T 세포 등의 면역 담당 세포에 인식되어, 이식이 생착되지 않게 된다.
한편, 근래에 진행한 다양한 질병 치료에서 증명되었듯이, 다양한 세포로 분화될 수 있는 성체줄기세포는 치료제 분야에서 엄청난 잠재력을 보유한 것으로 여겨진다. 예를 들어 인체에서 분리된 다양한 종류의 세포를 배아줄기세포와 유사한 다능성 세포로 리프로그래밍을 가능하게 하는 유도만능줄기세포(induced pluripotent stem cell, iPSC) 제조 기술(Cell, 126: 663-676, 2006; Cell, 131:1-12, 2007)은 혈관전구세포와 같은 임상적으로 이용 가능한 계통 특이적 세포(lineage specific cells)의 환자 맞춤형 분화에 대한 새로운 전략을 제공한다.
그러나 줄기세포의 이와 같은 잠재력에도 불구하고, HLA 유형이 수여자와 일치하지 않는 줄기세포는 이식 시 면역거부반응을 일으킬 수 있는바 HLA 항원은 임상적으로 줄기세포를 사용하는 데 주요한 장애가 된다. HLA 대립유전자의 조합은 수만 개에 육박하는바, 자연적인 HLA 동형 세포주를 확보하는 방법은 매우 어려운 문제이다(Rim et al., J Tissue Eng Regen Med, 2017). HLA 분자를 유전적으로 조작하는 것이 면역 거부반응을 피할 수 있는 바람직한 대안으로 여겨진다.
본 발명자들은 수여자 내에서 면역거부반응을 일으키지 않는 이식 적합성 세포 및 이를 포함하는 세포 집단을 확보하는 방법을 개발하고자 노력한 결과, HLA alpha 또는 beta subunit을 코딩하는 유전자를 타겟으로 하여 대립유전자를 넉아웃 시킨 유도만능줄기세포 및 새로운 방법을 통해 상기 유도만능줄기세포를 분화시킨 HLA 클래스 I 동형접합성 중간엽 줄기세포를 제조하고, 중간엽 줄기세포의 분화능을 확인하여 본 발명을 완성하였다.
본 발명의 하나의 목적은 (a) 유도만능줄기세포(iPSC)의 HLA 클래스 I의 발현수준을 유전자 가위 기술을 이용하여 감소시키는 단계; (b) 상기 (a) 단계의 유도만능줄기세포로부터 배양체(embryoid body: EB)를 형성하는 단계; 및 (c) 상기 (b) 단계의 배양체를 중간엽 줄기세포(Mesenchymal stem cell: MSC)로 분화시키는 단계를 포함하는, 중간엽 줄기세포 제조방법을 제공하는 것이다.
본 발명의 다른 목적은 상기 방법에 따라 제조된 이식적합성 중간엽 줄기세포를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 이식적합성 중간엽 줄기세포를 유효 성분으로 포함하는, 면역질환, 염증질환, 신경계 질환, 골질환 및 관절질환으로 이루어진 군에서 선택된 어느 하나의 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 이식적합성 중간엽 줄기세포를 유효 성분으로 포함하는, 세포치료제를 제공하는 것이다.
본 발명의 다른 목적은 HLA 클래스 I의 발현수준을 유전자 가위 기술을 이용하여 감소시키는 단계를 포함하는, 이식적합성 유도만능줄기세포 제조방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 방법에 따라 제조된 이식적합성 유도만능줄기세포를 제공하는 것이다.
본 발명의 다른 목적은 HLA 클래스 I의 발현수준을 유전자 가위 기술을 이용하여 감소시키는 단계를 포함하는, 이식적합성 배아줄기세포(ESC) 제조방법을 제공한다.
본 발명에서 제조한 HLA 유전자가 제거된 iPSC를 분화시킴으로써, MSC를 제조할 수 있고, 이를 이용하여 면역 거부 반응을 일으키지 않는 다양한 종류의 세포를 제조할 수 있으며, 이를 향후 치료목적으로 활용할 수 있다.
도 1은 야생형 iPSC 제조 과정 및 제조된 iPSC의 단백질 발현을 관찰한 사진이다. 도 1A는 인간 섬유아세포(human dermal fibroblast: hDF)에 야마나카 인자(Oct4, Sox2, c-Myc, Klf-4)를 발현하는 레트로바이러스를 도입한 후 제조된 세포의 형태를 현미경으로 관찰한 사진이다. 제조된 세포가 유도만능줄기세포(induced pluripotent stem cell) 특이적인 형태를 나타내는 것을 확인할 수 있다. 도 1B는 제조된 iPSC의 표면 단백질(Oct4, Sox2, Nanog, TRA-1-60) 발현을 면역염색법을 이용하여 현미경으로 관찰한 결과를 나타낸 사진이다.
도 2는 야생형 iPSC를 누드 마우스에 주입하여 형성된 테라토마를 관찰한 것이다. 도 2A는 누드 마우스에 테라토마가 형성된 것을 확인한 사진이다. 도 2B는 형성된 테라토마의 조직에서 관찰된 외배엽(ectoderm), 중배엽(mesoderm), 내배엽(endoderm) 세포이다.
도 3은 HLA-A, HLA-B, HLA-C 로커스를 PCR 증폭하여 그 산물에 전기영동을 수행한 결과를 나타낸 사진이다.
도 4는 형성된 iPSC 콜로니 중 iPSC#10의 유전자형을 확인한 것이다. 도 4A는 PCR 산물을 정제한 후 프라이머를 이용하여 iPSC#10의 유전자형을 확인한 것으로 HLA-A 유전자의 대립 유전자 1개가 넉아웃된 HLA-A 넉아웃 iPSC임을 확인한 것이다. 도 4B는 iPSC#10의 상세한 유전자형을 확인하여 표로 나타낸 것으로, HLA 클래스 I에 속하는 HLA-A, HLA-B, HLA-C 중에서 HLA-A의 대립 유전자 하나가 넉아웃된 HLA-A 동형접합성(homozygous) iPSC임을 확인한 것이다.
도 5는 형성된 iPSC 콜로니 중 iPSC#22의 유전자형을 확인한 것이다. 도 5A는 PCR 산물을 정제한 후 프라이머를 이용하여 iPSC#22의 유전자형을 확인한 것으로 HLA-A 유전자의 대립 유전자 1개가 넉아웃된 HLA-A 넉아웃 iPSC임을 확인한 것이다. 도 5B는 iPSC#22의 상세한 유전자형을 확인하여 표로 나타낸 것으로, HLA-A, HLA-B 및 HLA-C의 대립 유전자가 각각 1개씩 넉아웃된 HLA 클래스 I 동형 iPSC임을 확인하여 표로 나타낸 것이다. 도 5C는 iPSC#22에 면역 염색하여 분화전능성 마커 단백질인 Oct4, Sox2, Nanog, TRA-1-60 단백질을 강하게 발현하고 있음을 확인한 것이다.
도 6은 실시예 2-1의 iPSC로부터 MSC를 분화시키는 방법과 그 결과를 나타낸것이다. 도 6A는 분화 방법을 간단히 나타낸 모식도로, iPSC로부터 배양체를 형성시킨 지 6일 뒤에, 배양체를 KSB-3, EGM-2MV, DMEM-F12 배지에서 배양하였음을 나타낸다. 도 6B는 각 배지에서 증식된 세포의 형태를 관찰한 사진이다. 도 6C는 각 배지에서 증식된 세포 표면 마커를 FACS 분석한 결과이다.
도 7은 각 배양 배지에서 계대 증가에 따른 세포 증식에 필요한 시간 변화를 나타낸 그래프이다.
도 8은 iPSC로부터 분화된 MSC(iMSC)의 특징을 관찰한 것이다. 도 8A는 iPSC를 배양하여 MSC로 분화되는 과정을 나타낸 사진이다. 도 8B는 iMSC의 증식능을 확인한 것이다.
도 9는 제조된 iMSC의 특징을 관찰한 것이다. 도 9A는 FACS 분석을 통해 제조된 iMSC의 표면항원(CD11b, CD19, CD34, CD45, HLA-DR, CD73, CD105) 발현 여부를 확인한 것이다. 도 9B는 iPSC와 이로부터 분화된 iMSC의 줄기세포능 유전자(POU5F1, SOX2, REX1, ZNF281)의 mRNA 발현 수준을 막대그래프로 도식화한 것이다. 도 9C는 iPSC와 이로부터 분화된 iMSC에서, 분화전능성 마커인 Sox2 발현을 웨스턴 블롯을 통해 관찰한 것이다.
도 10은 제조된 iMSC의 분화능을 확인한 것이다. 도 10A는 제조된 iMSC에서 지방세포, 골세포, 연골세포 분화에 관련된 유전자의 발현 수준을 qRT-PCR을 이용하여 측정한 결과를 나타낸 그래프이다. 도 10B는 대표적으로 골세포로의 분화능을 확인한 것으로, UCB는 제대혈 줄기세포, AD는 지방 유래 줄기세포, BM은 골수 유래 줄기세포, iMSC는 iPSC로부터 분화된 MSC를 나타낸다.
도 11은 제조된 iMSC의 유전적 안정성 및 유전자 계통도를 나타낸 것이다. 도 11A는 제조된 iMSC의 핵형 분석 결과로, 정상 핵형을 나타내는 것을 확인할 수 있다. 도 11B는 제조된 iMSC의 생체내 안정성을 확인한 것으로, 실험용 마우스에 iMSC 및 iPSC를 주사한 부위를 각각 화살표로 표시하였다. iPSC를 주사한 부위(도 11B의 마우스 우측)에서는 종양이 형성되는 반면, iMSC를 주사한 부위(도 11B의 마우스 좌측) 에는 종양이 형성되지 않은 것을 확인할 수 있다. 도 11C 및 10D는 제조된 iMSC의 유전자 계통도를 확인하기 위해 hDF, iPSC, iMSC를 이용하여 마이크로어레이(Microarray)를 수행한 결과를 나타낸 것으로, iMSC의 경우 iPSC와 분리된 유전자 계통도를 보이면서도, hDF보다는 iPSC와 더 유사한 발현 체계를 나타냄을 확인할 수 있다.
도 12는 실시예 2-1의 방법을 통해 분화된 HLA-클래스 I homo iPSC로부터 유도된 HLA-클래스 I homo iMSC의 특성을 관찰한 결과를 나타낸 것이다. 도 12A는 HLA-클래스 I homo iPSC를 이용하여 실시예 2-1과 동일한 방법으로 분화시키는 과정에서 배양체 및 부착된 배양체와 세포가 분화되는 모습을 촬영한 사진이다. 도 12B는 HLA-클래스 I homo iMSC의 형태를 관찰한 사진으로, 기존 iMSC와 동일하게 MSC 특이적인 세포 형태를 보이는 것을 확인할 수 있다. 도 12C는 FACS 분석을 통해 HLA-클래스 I homo iMSC의 MSC특이적 표면 항원 발현을 확인한 결과를 나타낸 것이다.
본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
본 발명의 목적을 달성하기 위한 하나의 양태로서, 본 발명은 (a) 유도만능줄기세포(iPSC)의 HLA 클래스 I의 발현수준을 유전자 가위 기술을 이용하여 감소시키는 단계; (b) 상기 (a) 단계의 유도만능줄기세포로부터 배양체(embryoid body: EB)를 형성하는 단계; 및 (c) 상기 (b) 단계의 배양체를 중간엽 줄기세포(Mesenchymal stem cell: MSC)로 분화시키는 단계를 포함하는, 중간엽 줄기세포 제조방법을 제공한다.
본 발명에서 (a) 단계는 유도만능줄기세포(iPSC)의 HLA 클래스 I의 발현수준을 유전자 가위 기술을 이용하여 감소시키는 단계이다.
본 발명의 용어, "유도만능줄기세포(induced pluripotent stem cell, iPSC)"는 분화된 세포들로부터 인위적인 역분화 과정을 통해 전능성 분화능을 가지도록 유도된 세포들을 의미한다. 인위적인 역분화 과정은 레트로바이러스 및 렌티바이러스를 이용한 바이러스-매개 또는 비바이러스성 벡터 이용, 단백질 및 세포 추출물 등을 이용하는 비바이러스-매개 역분화 인자의 도입에 의해 수행되거나, 줄기세포 추출물, 화합물 등에 의한 역분화 과정을 포함할 수 있으며, 구체적으로는 분화된 세포에 Oct4, Sox2, c-Myc, Klf-4를 발현하는 레트로바이러스를 도입하는 과정을 포함할 수 있으나, 이에 제한되지 않는다. 유도만능줄기세포는 배아줄기세포와 유사한 특성을 가지며, 구체적으로는 유사한 세포 형태를 나타내고, 유전자, 단백질 발현 패턴이 유사할 수 있으며, 예를 들어 Oct4, Sox2, Nanog, TRA-1-60 등의 단백질이 강하게 발현될 수 있으나, 이에 제한되지는 않는다. 또한, 인 비트로(in vitro) 및 인 비보(in vivo)에서 분화전능성을 가지고, 생쥐의 피하에 주입할 경우 삼배엽 세포를 포함하는 테라토마(teratoma)를 형성할 수 있고, 유전자의 생식선 전이(germline transmission)가 가능한 특징을 가질 수 있다.
본 발명의 용어, "HLA(human leukocyte antigen)"는 조직적합항원(histocompatibility antigen)과 동의어이며, 주요면역적합항원(Major Histocompatibility Antigen Complex, MHC)라고도 불리는 세포 표면 단백질이다. 사람에서는 부계 유전자에서 유래한 6 종과 모계 유전자에서 유래한 6 종, 즉 총 6 쌍이 발현 되고 있는 것으로 알려져 있다. HLA 의 역할은 세포 내에 존재하는 단백질들의 조각들을 세포의 표면에 전시(display)하여, 생체 내에서 발생했을지 모를 감염이나 돌연변이가 면역세포에 의해 감지되도록 하는 것이며, 이런 이유로 항원제공 단백질(antigen presenting protein:APP) 이라고도 한다. 이들 항원제공단백질들은 자가세포(autologous cell)가 아닌 경우 이식 수여자 몸 안에 존재하는 면역세포들의 주요 공격대상이 된다. 일반적으로 세포, 조직, 기관 이식 시 공여자와 수여자 간의 조직적합성 검사에 HLA 클래스를 이용하게 된다. 공여자와 수여자의 HLA 항원이 전부 일치하면 이식이 가능하나, HLA 클래스 I 및 II의 대립유전자는 총 9719가지 이상으로, 사람들마다 각 HLA 유전자들 상에 수많은 유전적 다형성 (polymorphism)을 가지고 있기 때문에 HLA 타입이 완전히 일치하는 공여자를 찾는 것이 쉽지 않다. 세포, 조직, 기관 이식 시 공여자의 HLA-A 유전자와 수여자의 HLA-A 유전자가 일치하지 않는 경우 수여자의 체내 면역세포들이 그 차이를 인식하여 공여자 세포를 공격하게 되고, 결국 면역거부 반응에 의한 이식의 실패로 이어지게 된다. 이와 관련하여 본 발명은 이식적합성 세포, 구체적으로는 유전자 조작을 통하여 면역적합항원이 동형접합성(homozygous)이거나 또는 결손(null)된 세포를 제조할 수 있는 방법을 제공한다.
본 발명의 용어 "이식적합성"은 세포 이식 시 면역거부 반응을 일으키지 않는 성질을 의미한다. 면역거부반응의 원인인 유전자의 발현을 감소시킴으로써 세포, 조직, 또는 기관이 이식적합성을 갖도록 할 수 있으며, 이에 대한 비제한적 예시로, 상기 HLA 유전자의 발현 수준을 감소시킴으로써 세포, 조직 또는 기관이 이식적합성을 갖도록 할 수 있다. 이식적합성 세포는 면역적합항원이 동형접합성(homozygous)이거나, 결손(null)된 세포를 포함하나, 이에 제한되지는 않는다.
상기 HLA는 "HLA 클래스 I" 및 "HLA 클래스 II"로 분류할 수 있다. HLA-A, HLA-B, HLA-C가 HLA 클래스 I에 속하며, HLA-DR, HLA-DP, HLA-DQ는 HLA 클래스 II에 속한다. 일반 체세포는 HLA 클래스 I에 속하는 HLA-A, HLA-B, HLA-C, 총 3 쌍 만을 발현하며, 면역세포들은 HLA 클래스 I과 HLA 클래스 II, 모두 합하여 총 6 쌍을 발현한다.
본 발명의 용어, "발현 수준을 유전자 가위 기술을 이용하여 감소시키는 단계"란, 넉인(knock-in) 또는 넉아웃(knock-out)에 의해 해당 폴리펩티드를 코딩하는 유전자가 발현되지 않거나, 유전자 발현에 있어 자연적 상태 또는 변형 전의 상태보다 특정의 감소를 나타내거나, 발현되더라도 기능성이 있는 해당 폴리펩티드를 생산하지 않는 것을 의미한다.
또한, 해당 폴리펩티드를 코딩하는 유전자가 완전하게 불활성화되어 있는 것뿐만 아니라 그 발현 수준이 내재적 발현 수준에 비하여 약화되거나 현저하게 낮아 실질적으로 발현되지 않는 것도 포함되는 의미이다. 따라서, 유전자 불활성화는 완전(넉아웃)하거나 부분적(예를 들면, 유전자가 내재적 발현 수준 미만을 나타내는 저차형유전자(hypomorph)이거나 이것이 영향을 미치는 활성에 있어서 부분적인 감소를 나타내는 돌연변이체 유전자의 생성물)일 수 있다.
또한, 유전자 발현 수준의 감소는 2쌍의 대립유전자 중 하나에 대해 이루어짐으로써 "동형접합성(homozygous)"이 되거나, 또는 2쌍의 대립유전자 전부에 대해 이루어짐으로써 "결손(null)"될 수 있다. 즉, 유전자 발현 수준의 감소와 관련하여 본 발명에서 사용되는 용어"동형접합성"은 1개의 대립형질이 넉아웃된 것을 의미하는 것으로 해석될 수 있으며, "결손"은 2개의 대립형질이 넉아웃된 것을 의미하는 것으로 해석될 수 있다. 구체적으로 본 발명의 한 구현예에서 제조된 "HLA-homo" 세포는 "HLA-homozygous", "HLA 동형접합성"인 세포를 의미한다.
구체적으로, 본 발명에서 HLA 의 불활성화는,
1) 상기 단백질을 코딩하는 폴리뉴클레오티드의 일부 또는 전체의 결실,
2) 상기 폴리뉴클레오티드의 발현이 감소하도록 발현조절 서열의 변형,
3) 상기 단백질의 활성이 약화되도록 염색체 상의 상기 폴리뉴클레오티드 서열의 변형, 또는
4) 이의 조합 등을 사용하여 수행될 수 있으나, 특별히 이에 제한되지는 않는다.
1) 상기 단백질을 코딩하는 폴리뉴클레오티드의 일부 또는 전체를 결실하는 방법은 세포 내 염색체 삽입용 벡터를 통해 염색체 내 내재적 목적 단백질을 암호화하는 폴리뉴클레오티드를 일부 핵산 서열이 결실된 폴리뉴클레오티드 또는 마커유전자로 교체함으로써 수행될 수 있다. 상기 "일부"란 폴리뉴클레오티드의 종류에 따라서 상이하지만, 구체적으로는 1 내지 300개, 더 구체적으로는 1 내지 100개, 보다 구체적으로는 1 내지 50개이다.
다음으로, 2) 상기 폴리뉴클레오티드의 발현이 감소하도록 발현조절 서열을 변형하는 방법은, 특별히 이에 한정되지 않으나, 상기 발현조절 서열의 활성을 더욱 약화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현조절 서열상의 변이를 유도하여 수행하거나, 더욱 약한 활성을 갖는 핵산 서열로 교체함으로써 수행할 수 있다. 상기 발현조절 서열에는 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함할 수 있으며, 이에 한정되지 않는다.
아울러, 3) 염색체 상의 폴리뉴클레오티드 서열을 변형하는 방법은 상기 단백질의 활성을 더욱 약화하도록 폴리뉴클레오티드 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 약한 활성을 갖도록 개량된 폴리뉴클레오티드 서열로 교체함으로써 수행할 수 있으며, 이에 한정되지 않는다.
본 발명의 "유전자 가위 기술"은 "유전자 가위(engineered nuclease)"를 이용하여 유전자 조작, 구체적으로는 유전자 결손 또는 유전자 변형을 통해 HLA 항원의 발현을 감소시키는 단계를 포함할 수 있으나, 이에 제한되는 것은 아니다. 상기 유전자 조작은 유전자 결손 또는 유전자 변형을 포함하며, 유전자편집 (gene editing), 유전체편집 (genome editing) 혹은 유전체조작 (genome engineering) 기술이라고 불리는 방법을 이용하여 이루어질 수 있다. 유전자 조작은 특정 유전자를 넉아웃(knock-out)하거나 넉인(knock-in)함으로써 이루어질 수 있으나, 이에 제한되지는 않는다. 상기 유전자 조작 기술은 뉴클레아제(nuclease) 또는 니케이즈(nickase)와 가이드 벡터를 포함하여 목적하는 서열에 특이적으로 작용하는 효소를 이용한 것일 수 있으나, 이에 제한되지는 않는다. 구체적으로, 유전자 가위는 예를 들어 징크 핑거 뉴클레아제(Zinc finger nuclease:ZFN), TALEN(transcription activator-like effector nuclease), CRISPR(Clustered regularly interspaced short palindromic repeat)를 포함할 수 있으나, 이에 제한되지는 않는다. 또한, 상기 유전자 가위와 표적 서열과 유사한 주형(template) DNA를 동시에 세포에 도입하여 표적 서열 부위에 도입된 주형 DNA가 상동성 재조합(homologous recombination)으로 넉인되는 방식을 이용하여, 표적 서열을 넉아웃 시킬 수 있다.
상기 "징크 핑거 뉴클레아제 (zinc finger nuclease)"란 징크 핑거 도메인 및 뉴클레오티드 절단 도메인을 포함하는 융합단백질을 의미하며, 공지의 또는 상용의 징크 핑거 뉴클레아제 모두를 포함할 수 있다. 본 발명에서 용어, "징크 핑거 뉴클레아제" 와 "ZFN"은 혼용될 수 있다.
상기 "TALEN(Transcription activator-like effector nuclease)"은 TAL 이펙터 DNA 결합 도메인과 DNA 절단 도메인을 서로 융합하여 제조한 인공의 제한효소를 의미한다. 또한, 본 발명에서 상기 TALEN은 TAL 이펙터 DNA 결합 도메인과 DNA 절단 도메인이 링커를 통하여 연결된 형태도 포함한다. 여기서, TAL 이펙터 DNA 결합 도메인은 어떠한 원하는 DNA 서열에도 빠르게 결합하도록 엔지니어링된 것으로, 이를 DNA 절단 도메인과 결합시키는 경우, 원하는 DNA 서열에 특이적으로 결합하여 원하는 DNA 부위를 절단하는 효과를 가져온다.
상기 유전자 가위를 이용하여 넉아웃 또는 넉인을 수행할 때, 뉴클레아제 외에 Donor DNA가 필수적으로 사용되지 않는 넉아웃과 달리, 넉인의 경우, 뉴클레아제와 함께 Donor DNA를 사용한다. 상기 Donor DNA는 뉴클레아제에 의해 절단된 염색체 상의 위치에 도입하고자 하는 유전자를 포함하는 DNA로서, 재조합을 위하여 왼쪽 Flanking Arm 및 오른쪽 Flanking Arm을 포함할 수 있으며, 또한 선별마커 (selection marker) 등을 선택적으로 포함할 수 있으나, 이에 제한되지 않는다.
상기"RNA-가이드 뉴클레아제"는 목적하는 유전체 상의 특정위치를 인식하여 절단할 수 있는 뉴클레아제로서, 특히 가이드 RNA에 의해 표적 특이성을 갖는 뉴클레아제를 말한다. 상기 RNA-가이드 뉴클레아제는 이에 제한되는 것은 아니나, 구체적으로 미생물 면역체계인 CRISPR에서 유래한 Cas 단백질, 또는 Cpf1 뉴클레아제일 수 있고, 더 구체적으로 Cas9 (CRISPR-Associated Protein 9) 뉴클레아제 (nuclease) 및 이의 변이체인 Cas9 니케이즈 (nickase)를 포함할 수 있다.
상기 "Cas 단백질"은 CRISPR/Cas 시스템의 주요 단백질 구성요소로, 활성화된 엔도뉴클레아제 또는 니케이즈(nickase)로 작용할 수 있는 단백질이다. 상기 Cas 단백질은 crRNA (CRISPR RNA) 및 tracrRNA (trans-activating crRNA)와 복합체를 형성하여 이의 활성을 나타낼 수 있다.
상기 Cas9 뉴클레아제는 인간 세포를 비롯한 동식물 세포의 유전체에서 특정 염기서열을 인식해 이중나선절단 (double strand break, DSB)을 일으킨다. 상기 이중나선절단은 DNA의 이중 나선을 잘라 둔단 (blunt end) 또는 점착종단 (cohesive end)을 만드는 것을 모두 포함한다. DSB는 세포 내에서 상동재조합 (homologous recombination) 또는 비상동재접합 (non-homologous end-joining, NHEJ) 기작에 의해 효율적으로 수선되는데 이 과정에 연구자가 원하는 변이를 표적 장소에 도입할 수 있다. 상기 RNA-가이드 뉴클레아제는 인공적인, 혹은 조작된 비자연적으로 발생된 (non-naturally occurring)것일 수 있다.
상기 Cas9 니케이즈는 D10A 돌연변이를 가지는 것일 수 있으나, 이에 제한되는 것은 아니다. 상기 Cas9 니케이즈는 Cas9 뉴클레아제와는 달리 단일가닥 절단 (single strand break)을 일으킨다. 따라서, Cas9 니케이즈가 작동하기 위해서는 두 개의 가이드 RNA를 필요로 하며, 쌍 (pair)으로서 기능한다. 상기 두 개의 가이드 RNA는 각각의 표적 서열에 대해 CRISPR 복합체의 서열 특이적 결합을 지시하고, 각 표적 서열 근처의 DNA 듀플렉스의 한 가닥의 절단을 지시하여, 서로 다른 DNA 가닥에 두 개의 틈 (nick)을 유도할 수 있다.
Cas 단백질 또는 유전자 정보는 NCBI (National Center for Biotechnology Information)의 GenBank와 같은 공지의 데이터 베이스에서 얻을 수 있다. 구체적으로, 상기 Cas 단백질은 Cas9 단백질일 수 있다. 또한, 상기 Cas 단백질은 스타필로코커스 (Staphylococcus) 속, 스트렙토코커스(Streptococcus) 속, 네이세리아 (Neisseria) 속, 파스테우렐라 (Pasteurella) 속, 프란시셀라 (Francisella) 속, 캄필로박터 (Campylobacter) 속 유래의 Cas 단백질일 수 있으나, 상기 기술된 예에 본 발명이 제한되는 것은 아니다.
상기 "Cpf1 뉴클레아제"는 Francisella novicida에서 유래된 것으로, crRNA과 복합체를 형성하여 이의 활성을 나타낼 수 있다. 또한, Cpf1 단백질의 구조는 Cas9 단백질과 달라 결합하는 RNA의 길이가 짧아 제작이 수월하며 정확성이 우수하다. 상기 Cpf1 단백질 또는 유전자 정보는 NCBI (National Center for Biotechnology Information)의 GenBank와 같은 공지의 데이터 베이스에서 얻을 수 있다. 본 발명의 " HLA 클래스 I의 발현수준을 유전자 가위 기술을 이용하여 감소시키는 단계"는 HLA class I 넉아웃용 조성물을 이용하여 HLA-A, HLA-B 및 HLA-C 중 1 이상을 넉아웃시키는 단계일 수 있고, 구체적으로 HLA-A, HLA-B 및 HLA-C를 모두 넉아웃시키는 단계일 수 있으나, 이에 제한되는 것은 아니다. 또한, 상기 넉아웃 조성물은 HLA 클래스 I을 타겟으로 하는 CRISPR/Cas9 시스템을 포함하는 것일 수 있으나, 이에 제한되지는 않는다. 구체적으로, 상기 HLA class I 넉아웃용 조성물은 (a) 서열번호 1의 염기서열 또는 이와 상보적인 염기서열로 이루어진 가이드 RNA를 암호화하는 분리된 폴리뉴클레오티드를 포함하는 발현 벡터; (b) 서열번호 2의 염기서열 또는 이와 상보적인 염기서열로 이루어진 가이드 RNA를 암호화하는 분리된 폴리뉴클레오티드를 포함하는 발현벡터; 및 (c) 서열번호 3의 염기서열 또는 이와 상보적인 염기서열로 이루어진 가이드 RNA를 암호화하는 분리된 폴리뉴클레오티드를 포함하는 발현벡터 중 1 이상을 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다. 또한, HLA 클래스 I의 발현수준을 유전자 가위 기술을 이용하여 감소시키는 단계에 더하여, HLA-클래스 II에 속하는 유전자, 즉 HLA-DR, HLA-DP, HLA-DQ 중 선택된 하나 이상의 유전자의 발현 수준을 감소시키는 단계가 추가로 더 포함될 수 있다.
본 발명의 한 구현 예에서는, HLA 클래스 I에 속하는 HLA-A, HLA-B 및 HLA-C를 각각 타겟으로 하는 서열번호 1 내지 서열번호 3을 가이드 RNA로 하는 CRIPSR/Cas9 발현 벡터를 제작하여, 상기 발현벡터를 모두 도입하는 과정을 통해 HLA 클래스 I을 넉아웃시켰다.
또한, 상기 발현벡터는 Cas9 뉴클레아제(nuclease) 또는 Cas9 니케이즈(nickase)를 암호화하는 폴리뉴클레오티드를 포함하는 것일 수 있다. 즉, Cas9 단백질과 가이드 RNA가 함께 존재하는 경우에 표적 대상의 DNA를 절단할 수 있으므로, Cas9 단백질을 암호화하는 폴리뉴클레오티드가 가이드 RNA와 하나의 벡터에 포함되는 형태로 이용될 수 있고, 또는 Cas9 단백질을 암호화하는 별개의 발현 벡터를 이용할 수도 있다. 상기 벡터는 바이러스 벡터, 플라스미드 벡터, 또는 아그로박테리움 (agrobacterium) 벡터일 수 있으나, 이에 제한되는 것은 아니다. 상기 가이드 RNA를 암호화하는 폴리뉴클레오티드 및/또는 Cas9 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 발현 벡터는 당업계에 공지된 클로닝 (clonning) 방법을 수행하여 제조될 수 있으며, 그 방법에 특별히 제한되는 것은 아니다.
본 발명에서 (b) 단계는 상기 (a) 단계의 유도만능줄기세포로부터 배양체(embryoid body: EB)를 형성하는 단계이다.
본 발명의 용어 "배양체(EB)"는 전능성 줄기세포의 응집세포덩어리를 의미하며, 줄기세포가 지지세포에서 분리되어 분화 초기 단계에 도달한 상태를 지칭하는 의미로 사용될 수 있다. 줄기세포로부터 배양체를 형성하는 단계는 줄기세포 배지 조성을 변경하는 방법을 포함할 수 있으며, 구체적으로는 줄기세포의 배지에서 특정 성분, 성장 인자 등을 제외하는 것일 수 있으나, 이에 제한되지는 않는다. 구체적으로, 줄기세포의 배양 배지는 DMEM/F12+GlutaMAX-I (Gibco), Primocin (Invivogen), Knockout SR (Gibco), Basic fibroblast growth factor (R&D) 등을 포함할 수 있으나, 본 발명에서는 상기 배지에서 Basic fibroblast growth factor를 제외한 배지를 이용하여 배양체를 형성하였다.
본 발명에서 (c) 단계는 상기 (b) 단계의 배양체를 중간엽 줄기세포(Mesenchymal stem cell: MSC)로 분화시키는 단계이다.
본 발명의 용어 "중간엽 줄기세포"란 자기-재생 및 중배엽 계통 (lineage) 및 내배엽 및 외배엽과 같은 다른 배아 계통으로 분화할 수 있는 능력을 갖는 줄기세포의 비균질 파퓰레이션 (Heterogeneous population)을 갖는 것을 의미한다. 중간엽 줄기세포는 구체적으로 연골, 뼈, 지방, 골수간질, 근육, 신경, 피부 등을 만드는데 원조가 될 수 있으며, 성인에서는 일반적으로 골수에 머물러 있지만 제대, 제대혈, 말초혈액, 기타 조직 등으로부터 수득할 수 있으며, 유도만능줄기세포로부터 분화를 통해 수득할 수 있으나, 이에 제한되지는 않는다.
본 발명의 한 구현예에서는 유도만능줄기세포를 분화시켜 중간엽 줄기세포를 수득하였으며, 수득된 중간엽 줄기세포가 지방세포, 연골세포 및 골세포로 안정적으로 분화되는 것을 확인하였다. 이를 통해, 본 발명의 중간엽 줄기세포를 이용하여 다양한 조직을 구성하는 세포로 분화시킬 수 있음을 확인하였는바, 본 발명의 중간엽 줄기세포를 이용하여 분화된 세포를 형성할 수 있다.
중간엽 줄기세포를 분화시키기 위해서, KSB-3(Kangstem biotech) 배지를 사용할 수 있다. 구체적으로, 본 발명의 한 구현예에서는 유도만능줄기세포를 중간엽 줄기세포로 분화시키기 위해 10% FBS가 포함된 KSB-3(Kangstem biotech) 배지를 사용하였다. 배양체 형성 후, 바로 단일세포로 분리시키지 않고 배양체를 6일간 10% FBS가 포함된 KSB-3 배지에 배양함으로써 중간엽줄기세포로 분화된 세포를 선택적으로 대량 증식시켰다.
또한, 본 발명의 중간엽 줄기세포를 이용하여 수득될 수 있는 "분화된 세포"는, 체세포 계통으로 분화되는 과정에 있거나 최종 분화된 임의의 세포를 지칭한다. 즉, 성체를 구성하는 세포로서 분화능 및 자가생산능이 제한된 세포를 의미한다. 구체적으로, 분화된 세포는 인간의 연골, 뼈, 지방, 골수간질, 근육, 신경, 피부 등을 구성하는 체세포일 수 있으나, 이에 제한되지는 않는다.
본 발명의 다른 양태는 상기 방법에 따라 제조된 이식적합성 중간엽 줄기세포를 제공한다. 상기 "이식적합성", "중간엽 줄기세포"는 전술한 바와 같다.
본 발명의 또 다른 양태는, 상기 방법에 따라 제조된 중간엽 줄기세포를 유효성분으로 포함하는, 면역질환, 염증질환, 신경계 질환, 골질환 및 관절질환으로 이루어진 군에서 선택된 어느 하나의 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 용어 "면역질환"이란 특정 면역 반응이 일어날 경우 문제가 되는 질환의 의미로서, 이에 제한되지는 않으나, 바람직하게는 자가면역질환, 이식거부, 이식편대숙주병 일 수 있으며, 자가면역질환은 크론씨병, 홍반병, 아토피, 류마티스 관절염, 하시모토 갑상선염, 악성빈혈, 에디슨씨 병, 제1형 당뇨, 루프스, 만성피로증후군, 섬유근육통, 갑상선기능저하증과 항진증, 경피증, 베체트병, 염증성 장질환, 다발성 경화증, 중증 근무력증, 메니에르 증후군(Meniere's syndrome), 길리안-바레 증후근(Guilian-Barre syndrome), 쇼그렌 증후군(Sjogren's syndrome), 백반증, 자궁내막증, 건선, 백반증, 전신성 경피증, 천식 또는 궤양성 대장염 등일 수 있다.
본 발명의 용어 "염증질환"은 염증을 주병변으로 하는 질병을 총칭하는 의미로서, 이에 제한되지는 않으나 바람직하게는 부종, 피부염, 알레르기, 아토피, 천식, 결막염, 치주염, 비염, 중이염, 인후염, 편도염, 폐렴, 위궤양, 위염, 크론병, 대장염, 치질, 통풍, 간직성 척추염, 류마티스 열, 루푸스, 섬유근통(fibromyalgia), 건선관절염, 골관절염, 류마티스 관절염, 견관절주위염, 건염, 건초염, 근육염, 간염, 방광염, 신장염, 쇼그렌 증후군(sjogren's syndrome) 또는 다발성 경화증일 수 있다.
본 발명의 "신경계 질환"은 신경세포의 변형, 손실 등이 원인이 되어 발생하는 질환을 포함하며, 구체적으로는 파킨슨씨병, 알츠하이머, 피크병(Pick's disease), 헌팅톤병(Huntington's disease), 근위축성 측면 경화증(amyotriophiclateral sclerosis), 허혈성 뇌질환(stroke), 탈수초질환(demyelinating disease), 다발성 경화증, 간질, 퇴행성 신경질환, 척추 손상(spinal cord injury) 등을 포함할 수 있으나, 이에 제한되지는 않는다.
본 발명의 "골질환"은 골밀도가 감소되어 일어날 수 있는 모든 질환을 포함하는 것으로, 구체적으로는 골다공증(osteoporosis), 류마티스 관절염, 치주질환, 골연화증(osteomalacia), 골형성 부전증(osteogenesis imperfecta), 골화석증(osteopetrosis), 골경화증(osteosclerosis), 파제트병(Paget's disease), 무형성 골질환(adynamic bone disease), 대사성 골질환(metabolic bone disease), 구루병(rickets) 등을 포함할 수 있으나 이에 제한되는 것은 아니다. 본 발명의 상기 중간엽 줄기세포는 골분화능을 가지므로 골대사성 질환을 가지는 개체에 투여하여 골조직 형성을 목적으로 하는 조성물로 사용될 수 있다.
본 발명의 "관절질환(arthropathy)은, "관절증(Arthrosis)" 또는 "골관절증(Osteo-arthrosis)"으로도 호칭되고, 통각의 결여 및 관절이상을 수반하는 질환을 의미하는데, 관절의 신경영양성 질환의 하나로 분류된다. 대체로, 다발성 관절증(Polyarthrosis), 엉덩이관절증(Coxarthrosis), 무릎관절증(Gonarthrosis), 척추관절증(spondyloarthropathy) 등을 포괄하며, 연골손상 또는 연골기능 이상을 수반할 수 있다. 대부분의 관절질환은 염증을 수반하기 때문에 관절염으로 진행될 수 있다고 알려져 있다. 본 발명의 한 구현예에서, 중간엽 줄기세포는 연골세포로 분화될 수 있음이 확인되었는바, 본 발명의 중간엽 줄기세포는 관절질환의 예방 또는 치료용 조성물로 사용될 수 있다.
본 발명에서 "예방"은 상기 조성물의 투여로 질환의 발병을 억제 또는 지연시키는 모든 행위를 포함한다.
본 발명에서 "치료"는 상기 조성물의 투여로 질환의 증세가 호전되거나 이롭게 되는 모든 행위를 포함한다.
상기 조성물은 약학적으로 허용 가능한 담체를 포함할 수 있다.
상기 "약학적으로 허용 가능한 담체"란 생물체를 자극하지 않으면서, 주입되는 화합물의 생물학적 활성 및 특성을 저해하지 않는 담체 또는 희석제를 의미할 수 있다. 본 발명에 사용 가능한 상기 담체의 종류는 특별히 제한되지 아니하며 당해 기술 분야에서 통상적으로 사용되고 약학적으로 허용되는 담체라면 어느 것이든 사용할 수 있다. 상기 담체의 비제한적인 예로는, 식염수, 멸균수, 링거액, 완충 식염수, 알부민 주사 용액, 덱스트로즈 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 등을 들 수 있다. 이들은 단독으로 사용되거나 2 종 이상을 혼합하여 사용될 수 있다.
약학적으로 허용 가능한 담체를 포함하는 상기 조성물은 경구 또는 비경구의 여러 가지 제형일 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다.
상세하게는, 경구 투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 화합물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 칼슘카보네이트, 수크로오스, 락토오스, 젤라틴 등을 섞어 조제될 수 있다. 또한, 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용될 수 있다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데, 흔히 사용되는 단순 희석제인 물, 액체 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제 및 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜, 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 오일, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔, 마크로골, 트윈 61, 카카오지, 라우린지, 글리세로젤라틴 등이 사용될 수 있다.
본 발명의 또 다른 양태는 상기 방법에 따라 제조된 이식적합성 중간엽 줄기세포를 유효 성분으로 포함하는 세포치료제를 제공한다. 상기 이식적합성 중간엽 줄기세포는 전술한 바와 같다.
본 발명의 용어, "세포 치료제"는 개체로부터 분리, 배양 및 특수한 조작을 통해 제조된 세포 및 조직으로 치료, 진단 및 예방의 목적으로 사용되는 의약품(미국 FDA 규정)으로서, 세포 혹은 조직의 기능을 복원시키기 위하여 살아있는 자가, 동종, 또는 이종 세포를 체외에서 증식 선별하거나 다른 방법으로 세포의 생물학적 특성을 변화시키는 등의 일련의 행위를 통하여 치료, 진단 및 예방의 목적으로 사용되는 의약품을 의미한다.
본 발명의 세포치료제는 1ml 당 1.0×10개 내지 1.0×109개의 세포를 포함할 수 있으나, 이에 제한되는 것은 아니다. 본 발명의 세포치료제는 동결되지 않은 채 사용되거나 차후 사용을 위해 동결될 수 있다. 동결되어야 할 경우, 표준 냉동보존제 (예를 들어 DMSO, 글리세롤, 에피라이프 (Epilife) 세포 동결 배지 (Cascade Biologics))가 동결 전 세포 집단에 첨가될 수 있다. 또한, 상기 세포치료제는 약학적 분야에서 통상의 방법에 따라 환자의 신체 내 투여에 적합한 단위투여형의 제제로 제형화시켜 투여할 수 있으며, 상기 제제는 1회 또는 수회 투여에 의해 효과적인 투여량을 포함한다. 이러한 목적에 적합한 제형으로는 비경구투여 제제로서 주사용 앰플과 같은 주사제, 주입 백과 같은 주입제, 및 에어로졸 제제와 같은 분무제 등이 바람직하다. 상기 주사용 앰플은 사용 직전에 주사액과 혼합 조제할 수 있으며, 주사액으로는 생리 식염수, 포도당, 만니톨, 링거액 등을 사용할 수 있다. 또한, 주입 백은 염화폴리비닐 또는 폴리에틸렌 재질의 것을 사용할 수 있으며, 박스터 (Baxter), 벡톤 디킨슨 (Becton ickinson), 메드셉(Medcep), 내셔날 호스피탈 프로덕츠 (National Hospital Products) 또는 테루모 (Terumo) 사의 주입 백을 예시할 수 있다.
상기 세포치료제에는 하나 또는 그 이상의 약학적으로 허용가능한 통상의 불활성 담체, 예를 들어, 주사제의 경우에는 보존제, 무통화제, 가용화제 또는 안정화제 등을, 국소 투여용 제제의 경우에는 기제 (base), 부형제, 윤활제 또는 보존제 등을 추가로 포함할 수 있다.
이렇게 제조된 본 발명의 세포치료제는 당업계에서 통상적으로 사용하는 투여방법을 이용하여 이식 및 기타 용도에 사용되는 다른 줄기세포와 함께 또는 그러한 줄기세포와의 혼합물의 형태로 투여될 수 있으며, 치료가 필요한 환자의 질환 부위에 직접 생착 또는 이식하거나 복강에 직접 이식 또는 주입하는 것이 가능하나 이에 한정되지는 않는다. 또한, 상기 투여는 카테터를 이용한 비외과적 투여 및 질환부위 절개 후 주입 또는 이식 등 외과적 투여방법 모두 가능하나 카테터를 이용한 비외과적 투여방법이 보다 바람직하다. 또한 통상의 방법에 따라 비경구적으로, 예를 들면 직접 병변에 투여하는 것 외에 조혈계 줄기세포 이식의 일반적 방법인 혈관 내 주입에 의한 이식도 가능하다.
상기 세포치료제는 1회 또는 수회로 나누어 투여할 수 있다. 그러나, 유효성분의 실제 투여량은 치료하고자 하는 질환, 질환의 중증도, 투여경로, 환자의 체중, 연령 및 성별 등의 여러 관련 인자에 비추어 결정되어야 하는 것으로 이해되어야 하며, 따라서, 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
본 발명의 구체적 실시예에서는 중간엽 줄기세포가 지방세포, 골세포 및 연골세포로 분화될 수 있다는 점을 확인하였는 바, 본 발명의 중간엽 줄기세포는 다양한 질환의 치료제로서 이용될 수 있다.
본 발명의 다른 양태는 HLA 클래스 I의 발현수준을 유전자 가위 기술을 이용하여 감소시키는 단계를 포함하는, 이식적합성 유도만능줄기세포 제조방법을 제공한다.
상기 "이식적합성" 및 "유도만능줄기세포"는 전술한 바와 같다.
구체적으로, 상기 HLA 클래스 I은 HLA-A, HLA-B 및 HLA-C로 구성된 군에서 선택된 1 이상인 것일 수 있으며, 상기 유전자 가위 기술은 CRISPR, TALEN 또는 징크 핑거(Zinc finger) 뉴클레아제 중 어느 하나인 것일 수 있으나 이에 제한되지는 않는다. 또한 상기 HLA 클래스 I의 발현수준을 유전자 가위 기술을 이용하여 감소시키는 단계는 HLA 클래스 I 넉아웃용 조성물을 이용하는 것일 수 있으며, 상기 HLA 클래스 I 넉아웃용 조성물은 서열번호 1, 서열번호 2 및 서열번호 3의 염기서열 또는 이들과 상보적인 염기서열로 이루어진 가이드 RNA를 암호화하는 분리된 폴리뉴클레오티드를 포함하는 발현벡터 중 1 이상을 포함하는 것일 수 있다. 또한, 상기 발현 벡터는 Cas9 뉴클레아제, Cpf1 뉴클레아제 또는 Cas9 니케이즈를 암호화하는 폴리뉴클레오티드를 포함하는 것일 수 있다.
본 발명의 다른 양태는 상기 방법에 따라 제조된 이식적합성 유도만능줄기세포를 제공한다. 상기 "이식적합성" 및 "유도만능줄기세포"는 전술한 바와 같다.
본 발명의 다른 양태는 HLA 클래스 I의 발현수준을 유전자 가위 기술을 이용하여 감소시키는 단계를 포함하는, 이식적합성 배아줄기세포(ESC) 제조방법 및 상기 제조방법을 통해 제조된 이식적합성 배아줄기세포를 제공한다.
본 발명의 배아줄기세포(embryonic stem cell, ES cell)는 한 개체를 구성하는 모든 조직의 세포로 분화될 수 있는 잠재력을 지닌 세포로, 용어 전분화능 줄기세포(pluripotent stem cell) 또는 전능성 줄기세포와 상호 교환적으로 사용될 수 있다. 상기 배아줄기세포는 무제한적으로 증식이 가능한 미분화 세포일 수 있고, 모든 세포로 분화할 수 있으며 성체줄기세포와 달리 배(germ) 세포도 형성할 수 있는 것일 수 있다.
HLA 클래스 I, 유전자 가위 기술, 이식적합성 등에 대해서는 전술한 바와 같다.
이하 본 발명을 실시예 및 실험예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예 및 실험예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예 및 실험예에 한정되는 것은 아니다.
실시예 1: CRISPR/Cas9 시스템을 이용한 HLA 대립 유전자 넉아웃 iPSC 제조
실시예 1-1: 야생형 iPSC 제조 및 분화전능성 확인
야생형 iPSC를 제조하기 위해, 인간 섬유아세포(human dermal fibroblast: hDF)에 야마나카 인자(Oct4, Sox2, c-Myc, Klf-4)를 발현하는 레트로바이러스를 도입하여 iPSC를 제작하였다(도 1A).
상기 제작된 iPSC은 분화전능성을 나타내는 단백질인 Oct4, Sox2, Nanog, TRA-1-60 단백질을 강하게 발현하는 것을 면역염색을 통해 확인하였고(도 1B), 또한, 제작된 iPSC를 누드 마우스(nude mouse)의 피하에 주입하여 삼배엽의 세포를 포함하는 테라토마가 형성되는 것을 확인하였는 바(도 2A 및 도 2B), 이를 통해, iPSC가 시험관 내(in vitro)뿐만 아니라, 생체 내(in vivo)에서도 분화전능성을 가짐을 알 수 있다.
실시예 1-2: 표적 서열(HLA 클래스 Ⅰ) 특이적 CRISPR/Cas9 제작
HLA 클래스 Ⅰ에 속하는 HLA-A, HLA-B, HLA-C 유전자를 제거할 수 있는 가이드 RNA 서열(서열번호 1 내지 3)을 디자인하였다. 디자인된 서열은 하기 표 1에 기재하였다.
Gene Guide RNA sequence 서열번호
HLA-A GAGCCCCGCTTCATCGCCGT 1
HLA-B CCTTGCCGTCGTAGGCGTAC 2
HLA-C GTCACTCACCGTCCTCGCTC 3
상기, 제조한 가이드 RNA 서열을 pCas-가이드 벡터에 클로닝하여, HLA-A, HLA-B, HLA-C 유전자 각각을 타겟팅하는 CRISPR/Cas9 벡터 3종을 제작하였다.
실시예 1-3: HLA유전자 넉아웃 iPSC 제조
HLA 유전자가 넉아웃된 iPSC를 제조하기 위해 하기와 같은 실험을 수행하였다.
구체적으로, 실시예 1-2에서 제조한 HLA-A, HLA-B, HLA-C 유전자를 제거할 수 있는 CRISPR/Cas9 벡터 3종을 단일세포화한 iPSC에 전기 천공법으로 동시에 도입한 후, CloneR™(STEMCELL Technologies)이 첨가된 iPSC 배지에서 10일 내지 14일 간 배양하였다. 이후 형성된 단일 iPSC 유래의 콜로니를 각각 분리하여 배양하였다.
그 후, 분리하여 배양한 24개의 iPSC 콜로니에서 게놈 DNA를 분리한 후, 분리된 게놈 DNA와 프라이머를 이용하여 HLA-A, HLA-B, HLA-C 로커스(locus)를 PCR 증폭하였다. 증폭에 사용된 프라이머는 하기 표 2에 기재하였다.
Gene Sequence (5` to 3`) Size (bp) Annealing temp (oC) 서열번호
HLA-A F-TTTCTCCCTCTCCCAACCTATG 1,000 60 4
R-CGTTCAGGGCGATGTAATCC 5
HLA-B F-CCCACTTCCCACTCCCATTG 1,091 60 6
R-CTTCCCGTTCTCCAGGTATCTG 7
HLA-C F-CAATCAGCGTCTCCGCAGTC 1,011 60 8
R-CTCCAGGTAGGCTCTCAGCT 9
상기 증폭된 PCR 산물에 전기영동을 수행하여 정제한 후(도 3), PCR 프라이머를 이용하여 유전자형 확인을 하였다. 그 결과, 24개의 iPSC 콜로니 중 iPSC#10이 HLA-A 유전자의 대립 유전자 1개가 넉아웃된 HLA-A 넉아웃 iPSC임을 확인하였다(도 4A). 또한, 증폭된 PCR 산물을 TA 클로닝, 형질전환, 콜로니 접종(inoculation), 플라스미드 미니프렙(miniprep)하여 상세한 유전자형을 확인한 결과, iPSC#10은 HLA-A 대립유전자 2개 중 1개가 넉아웃된 HLA-A 동형접합성(HLA-A homozygous) iPSC임을 최종적으로 확인하였다(도 4B).
또한, 24개의 iPSC 콜로니 중 iPSC#22가 HLA-A 유전자의 대립 유전자 1개가 넉아웃된 HLA-A 넉아웃 iPSC임을 확인하였고(도 5A), 상기 증폭된 PCR 산물을 TA 클로닝, 형질전환, 콜로니 접종(inoculation), 플라스미드 미니프렙하여 상세한 유전자형을 확인한 결과, iPSC#22는 HLA-A, HLA-B, HLA-C 각각의 대립유전자 2개 중 1개가 넉아웃된 HLA 클래스 I 동형접합성 iPSC임을 최종적으로 확인하였다(도 5B).
또한, 상기에서 제조된 HLA 클래스 I 넉아웃 iPSC는 분화전능성을 나타내는 단백질인 Oct4, Sox2, Nanog, TRA-1-60 단백질을 강하게 발현하는 것을 면역염색을 통해 확인하였는 바(도 5C), 분화전능성이 있음을 알 수 있다.
실시예 2: iPSC로부터 중간엽 줄기세포(MesenchymaL stem cell: MSC) 분화 유도 방법 및 이로부터 제조된 MSC의 특성 확인
실시예 2-1: iPSC로부터 MSC 분화 유도 및 효율 확인
iPSC를 중간엽 줄기세포(MesenchymaL stem cell: MSC)로 분화시키기 위해, 하기와 같은 실험을 수행하였다.
구체적으로, 실시예 1-1에서 제조된 야생형 iPSC를 7일 동안 배양한 후, 해리 용액(dissociation solution) 또는 메커니컬 계대를 이용해 배양접시로부터 iPSC를 분리하였다. 분리한 iPSC를 PBS로 3회 수세하고, 부유 배양이 가능한 페트리 디쉬에 배양하여 배양체(embryoid body: EB)형성을 유도하여 1차적인 분화를 유도하였다. 상기 EB 형성 배지는 일반 iPSC 배지(DMEM/F12+GlutaMAX-I (Gibco) 500 ml + Primocin (Invivogen) 1 ml + Knockout SR (Gibco) 125 ml + Basic fibroblast growth factor (R&D) 2.5 ug)에서 미분화 유지에 필요한 bFGF 성분(Basic fibroblast growth factor)을 제외한 것을 사용하였다. 배지는 2-3일에 한 번씩 교환하였다.
EB가 형성된 지 6일째에 EB를 KSB-3 배지에 10% FBS를 첨가하고, 0.1% gelatin 으로 30분간 코팅한 배양접시에 부착시켰다. EB를 부착시킨 시점을 계대배양 passage 0으로 설정하였다. 또한 분화 효율을 비교하기 위하여 KSB-3 배지 이외에도 EGM-2MV 및 DMEM-F12 배지에도 EB를 부착시켰다.
EB 부착 후 5일째에 TrypLE을 이용하여 배양 접시로부터 EB를 분리하고 피펫팅을 통해 단일 세포로 분리한 후, 새로운 배양접시에 부착하여 KSB-3 배지로 배양하여, 이를 계대배양 passage 1로 설정하였다. 이후 2-3일에 한 번씩 배지를 교환해 주면서, 세포 증식에 의해 80-90% 융합(confluency)을 나타낼 때마다 TrypLE 및 Trypan blue 염색을 활용하여 4x105개의 세포를 100mm 배양접시에 계대 배양하면서 본 과정을 반복적으로 수행하여, MSC로의 분화를 유도하였다(도 6A). 분화된 MSC의 표면 항원 발현을 FACS를 이용하여 분석하였으며, 계대 배양에 소요되는 시간을 측정하였다.
그 결과, EB 배양 배지로 EGM-2MV, DMEM-F12보다 KSB-3을 이용한 실험군에서 보다 균일한 형태의 세포가 안정적으로 증식하는 것을 확인할 수 있었다(도 6B). 또한 표면 항원 발현을 확인하기 위한 FACS 분석 결과, 배양 배지로 KSB-3을 이용한 경우에 비하여, EGM-2MV를 사용한 경우 CD44와 CD105의 발현이, DMEM/F12를 사용한 경우 CD105의 발현이 낮음을 확인하였다(도 6C). 또한, 계대배양에 소요되는 시간의 측정 결과, DMEM/F12의 경우 Passage 5에서, EGM-2MV에서는 Passage 6 이후로 80시간 이상이 소요되어 세포증식 지연 현상이 일어난 것을 확인한 반면, KSB-3의 경우 Passage 11까지도 처음과 유사한 속도로 세포가 증식되는 것을 확인하였다(도 7).
이를 통해, KSB-3이 다른 배지에 비해 유도만능줄기세포를 보다 효율적으로 중간엽 줄기세포로 분화시킬 수 있음을 알 수 있다.
실시예 2-2: 제조된 iMSC의 세포 형태 확인
EB에서 MSC로 분화되었는지 여부를 확인하기 위해, 실시예 2-1의 MSC 분화 유도 과정 중 현미경을 통해 세포의 형태를 관찰하였다.
그 결과, MSC의 고유한 형태인, 짧은 섬유아세포(fibroblast)형태를 확인하였는 바(도 8A), 실시예 2-1의 과정을 통해 iPSC가 MSC로 분화한 것을 알 수 있다.
실시예 2-3: 제조된 iMSC의 세포증식능 확인
세포 치료제로써의 상용화 가능성을 판단하기 위해, 하나의 iPSC 콜로니에서 분화 증식되는 iMSC의 수를 확인하였다.
구체적으로, 실시예 2-1의 과정에서 iPSC를 부유 배양하여 EB를 형성한 후, EB 개수에 따른 iMSC 분화 증식 세포 수를 계대배양 과정 동안 확인하였다.
그 결과, EB에서 분리되어 나온 하나의 세포가 평균 70회 증식이 가능하다는 것을 확인하였으며(도 8B), 이는 세포치료제로 활용하기에 충분한 양의 세포 확보가 가능하다는 것을 알 수 있다.
실시예 2-4: 제조된 iMSC의 MSC 특이적 세포표면 항원 발현 확인
본 발명에서 제조한 iMSC가 MSC 고유의 성격을 가지고 있는지 확인하기 위해, 표면항원 발현 여부를 FACS 분석 방법을 활용하여 확인하였다.
구체적으로, 실시예 2-1의 방법으로 제조된 iMSC에 MSC의 표면 항원으로 알려져 있는 7종의 항원을 처리하여, 세포 표면 부착을 유도한 후, FACS 분석을 통해 세포 표면에 부착되지 않아 negative 결과를 나타내는 항원(CD11b, CD19, CD34, CD45, HLA-DR)과, 세포 표면에 부착되어 positive 결과를 나타내는 항원(CD73, CD105)의 발현 여부를 확인하였다(도 9A). 분석 결과, 제조된 iMSC는 MSC 특이적인 표면 항원 발현 양상에 부합하는 결과를 나타내었다. 이를 통해, iMSC가 정상적으로 분화 유도되었음을 확인할 수 있었다.
실시예 2-5: 제조된 iMSC의 줄기세포능(stemness) 소실 확인
본 발명에서 제조된 iMSC가 iPSC로부터 분화하는 과정에서, iPSC에 특이적으로 발현하는 줄기세포능 표식인자의 발현이 소실되는지 여부를 확인하였다.
구체적으로, 유전자 수준에서 줄기세포능 소실 여부를 확인하기 위해, 실시예 2-1의 과정을 통해 제조된 iMSC로부터 RNA를 분리한 후, cDNA를 합성하여 Real-time PCR을 수행하였다. 그 결과, iPSC 특이적 발현 유전자인 POU5F1, SOX2, REX1, ZNF281의 발현이 iMSC에서 유의하게 감소하는 것을 확인하였다(도 9B).
또한, 단백질 수준에서 줄기세포능 소실 여부를 확인하기 위해, 실시예 2-1의 과정을 통해 제조된 iMSC로부터 단백질을 분리한 후, 줄기세포능을 나타내는 대표적 단백질인 SOX2의 세포내 발현량을 웨스턴 블롯을 이용해 측정하였다. 분석 결과, iPSC에서는 SOX2 단백질 발현을 확인하였으나, iMSC에서는 SOX2 발현이 감소되어 밴드가 관찰되지 않았다(도 9C). 이를 통해, iPSC가 iMSC로 분화되면서 줄기세포능이 소실되는 것을 확인할 수 있었다.
실시예 2-6: 제조된 iMSC의 분화능 확인
MSC는 분화 조건에 따라 지방(Adipogenesis), 골(Osteogenesis) 및 연골(Chondrogenesis)로 분화될 수 있는 분화능을 갖는 바, 상기 실시예 2-1에서 제조된 iMSC의 분화능을 확인하기 위해, StemPro Adipogenesis Differentiation 키트 (Gibco, A10070-01), StemPro Osteogeneis Differentiation 키트(Gibco, A10072-01), StemPro Chnodrogenesis Differentiation 키트(Gibco, A10071-01)를 사용하여 4주간 지방세포, 골세포, 연골세포로 분화를 유도하였다. 실험 결과, 골세포/연골세포/지방세포로의 분화를 확인할 수 있었으며(도 10A), 대표적으로 골세포로의 분화를 형태학적으로 확인하였다(도 10B).
이를 통해, 본 발명에서 제조된 MSC가 지방세포, 골세포, 연골세포로 분화할 수 있다는 것을 확인하였으며, 일반적인 MSC 분화능을 갖는 것을 알 수 있다.
실시예 2-7: 제조된 iMSC의 안정성 확인
제조된 iMSC의 유전학적 안정성을 검증하기 위하여 핵형 분석을 수행하였다. 분석결과 46+XX의 정상 핵형을 나타내는 것을 확인하였는 바(도 11A), 이를 토대로 실시예 2-1의 MSC 분화 방법이 유전적 안정성을 유지할 수 있는 것임을 알 수 있다.
또한, 제조된 iMSC의 생체내 안정성을 검증하고자 실험용 마우스의 피하에 제조된 iMSC 및 동량의 iPSC를 주사하였다. 8주 후, 실험용 마우스에 iPSC를 주입한 부위에서는 종양이 형성된 반면, iMSC를 주사한 부위에서는 종양이 형성되지 않는 것을 확인하였다(도 11B). 이러한 결과는 본 발명의 iMSC가 체내 주입 시에도 종양을 형성하지 않는 안정성을 확보하였음을 나타낸다.
실시예 2-8: 제조된 iMSC의 유전자 계통도 분석
본 발명에서 제조된 iMSC의 유전자 계통도를 확인하기 위해 마이크로어레이(Microarray)를 수행하였다.
구체적으로, hDF, hDF에 야마나카 인자를 도입하여 형성한 iPSC 및 실시예 2-1과 같이 iPSC의 분화 유도로 제조된 iMSC 간의 유전자 계통도를 비교 분석하였다. 분석 결과, hDF, iPSC, iMSC는 각각 독립적인 유전자 발현 체계를 가지고 있으며, iMSC의 경우 iPSC와 분리된 유전자 계통도를 보이면서도, hDF보다는 iPSC와 더 유사한 유전자 발현 체계를 가지고 있음을 확인하였다(도 11C 및 도 11D).
실시예 3: HLA-클래스 I 동형접합성(HLA-homo) iPSC로부터 HLA-homo iMSC 제조 및 특성 확인
HLA-클래스 I homo iMSC를 제조하기 위해, 실시예 2-1에 설명된 것과 같은 방법으로, 실시예 1에서 제조된 HLA-클래스 I homo iPSC로부터 EB 형성 후 MSC로 분화를 유도하였다(도 12A).
또한, 상기에서 제조된 HLA-클래스 I homo iMSC가 일반적인 MSC의 특성을 나타내는 지 확인하기 위해 하기와 같은 실험을 수행하였다.
구체적으로, 상기에서 제조된 HLA-클래스 I homo iMSC의 세포 형태를 실시예 2-2와 같이 관찰한 결과, 섬유아세포와 같은 MSC 특이적 세포 형태를 나타내는 것을 확인하였다(도 12B).
또한, 실시예 2-4와 같은 방법으로 MSC 고유 표면 항원 발현 여부를 확인한 결과, 제조된 HLA-클래스 I homo iMSC는 MSC 특이적인 표면 항원 발현 양상에 부합하는 결과를 나타내었다(negative: CD11b, CD19, CD34, CD45, HLA-DR; positive: CD73, CD105)(도 12C).
이를 통해, HLA-클래스 I homo iPSC를 이용하여 제조된 HLA-클래스 I homo iMSC 역시 MSC의 특성을 갖는다는 것을 알 수 있었다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (14)

  1. (a) 유도만능줄기세포(iPSC)의 HLA 클래스 I의 발현수준을 유전자 가위 기술을 이용하여 감소시키는 단계;
    (b) 상기 (a) 단계의 유도만능줄기세포로부터 배양체(embryoid body: EB)를 형성하는 단계; 및
    (c) 상기 (b) 단계의 배양체를 중간엽 줄기세포(Mesenchymal stem cell: MSC)로 분화시키는 단계를 포함하는, 중간엽 줄기세포 제조방법.
  2. 제1항에 있어서, 상기 HLA 클래스 I은 HLA-A, HLA-B 및 HLA-C로 구성된 군에서 선택된 1 이상인 것인, 중간엽 줄기세포 제조방법.
  3. 제1항에 있어서, 상기 (a) 단계의 유전자 가위 기술은 CRISPR, TALEN 또는 징크 핑거(Zinc finger) 뉴클레아제 중 어느 하나인 것인, 중간엽 줄기세포 제조 방법.
  4. 제1항에 있어서, 상기 (a) 단계에서 유도만능줄기세포(iPSC)의 HLA 클래스 I의 발현수준을 유전자 가위 기술을 이용하여 감소시키는 단계는 HLA 클래스 I 넉아웃용 조성물을 이용하는 것을 특징으로 하는 것인, 중간엽 줄기세포 제조방법.
  5. 제4항에 있어서, 상기 HLA 클래스 I 넉아웃용 조성물은
    (a) 서열번호 1의 염기서열 또는 이와 상보적인 염기서열로 이루어진 가이드 RNA를 암호화하는 분리된 폴리뉴클레오티드를 포함하는 발현 벡터;
    (b) 서열번호 2의 염기서열 또는 이와 상보적인 염기서열로 이루어진 가이드 RNA를 암호화하는 분리된 폴리뉴클레오티드를 포함하는 발현벡터; 및
    (c) 서열번호 3의 염기서열 또는 이와 상보적인 염기서열로 이루어진 가이드 RNA를 암호화하는 분리된 폴리뉴클레오티드를 포함하는 발현벡터 중 1 이상을 포함하는 것인, 중간엽 줄기세포 제조방법.
  6. 제5항에 있어서, 상기 발현 벡터는 Cas9 뉴클레아제(nuclease), Cpf1 뉴클레아제 또는 Cas9 니케이즈(nickase)를 암호화하는 폴리뉴클레오티드를 포함하는 것인, 중간엽 줄기세포 제조방법.
  7. 제1항 내지 제6항 중 어느 한 항의 방법에 따라 제조된, 이식적합성 중간엽 줄기세포.
  8. 제7항의 이식적합성 중간엽 줄기세포를 유효 성분으로 포함하는, 면역질환, 염증질환, 신경계 질환, 골질환 및 관절질환으로 이루어진 군에서 선택된 어느 하나의 질환의 예방 또는 치료용 약학적 조성물.
  9. 제8항에 있어서, 상기 질환은 골다공증, 류마티스 관절염, 치주질환인 것인, 질환의 예방 또는 치료용 약학적 조성물.
  10. 제8항의 이식적합성 중간엽 줄기세포를 유효 성분으로 포함하는, 세포치료제.
  11. HLA 클래스 I의 발현수준을 유전자 가위 기술을 이용하여 감소시키는 단계를 포함하는, 이식적합성 유도만능줄기세포 제조방법.
  12. 제11항의 방법에 따라 제조된, 이식적합성 유도만능줄기세포.
  13. HLA 클래스 I의 발현수준을 유전자 가위 기술을 이용하여 감소시키는 단계를 포함하는, 배아줄기세포(ESC) 제조방법.
  14. 제13항의 방법에 따라 제조된, 이식적합성 배아줄기세포.
PCT/KR2019/006536 2018-05-30 2019-05-30 Hla 유전자가 제거된 인간 유도만능줄기세포 유래 중간엽줄기세포 및 그의 제조 방법 WO2019231266A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US17/059,634 US20210222127A1 (en) 2018-05-30 2019-05-30 Hla gene-deleted human induced pluripotent stem cell-derived mesenchymal stem cells and preparation method thereof
EP19812038.8A EP3805370A4 (en) 2018-05-30 2019-05-30 MESENCHYMATE STEM CELL DERIVED FROM HLA GENE DELETED HUMAN INDUCED PLURIPOTENT STEM CELL AND METHOD FOR PREPARING IT

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2018-0062166 2018-05-30
KR20180062166 2018-05-30

Publications (1)

Publication Number Publication Date
WO2019231266A1 true WO2019231266A1 (ko) 2019-12-05

Family

ID=68697049

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/006536 WO2019231266A1 (ko) 2018-05-30 2019-05-30 Hla 유전자가 제거된 인간 유도만능줄기세포 유래 중간엽줄기세포 및 그의 제조 방법

Country Status (4)

Country Link
US (1) US20210222127A1 (ko)
EP (1) EP3805370A4 (ko)
KR (1) KR102304549B1 (ko)
WO (1) WO2019231266A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021169017A1 (zh) * 2020-02-25 2021-09-02 上海大学 间充质干细胞在治疗重症covid19肺炎中的用途
WO2021222389A1 (en) * 2020-04-28 2021-11-04 Factor Bioscience Inc. Mesenchymal stem cell therapies

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102560588B1 (ko) * 2020-03-18 2023-07-28 가톨릭대학교 산학협력단 멀티플렉스 ＣＲＩＳＰＲ―ｃａｓ９ 시스템을 이용한 ＨＬＡ 클래스 Ｉ 및 ＭＩＣＡ／ＭＩＣＢ 유전자 결핍 세포주 및 이의 용도
US20230285635A1 (en) * 2020-08-06 2023-09-14 Kangstem Biotech Co., Ltd. Method for producing highly functional artificial organs using aptamers
WO2023008918A1 (ko) * 2021-07-28 2023-02-02 의료법인 성광의료재단 B2m 유전자의 발현이 저해된 유전적으로 조작된 줄기세포 및 이의 이용방법
WO2023090589A1 (ko) * 2021-11-22 2023-05-25 주식회사 미래셀바이오 전분화능 줄기세포 기반 과민성 면역반응에 의한 피부질환의 예방 또는 치료용 조성물
WO2023191709A2 (en) * 2022-03-31 2023-10-05 Agency For Science, Technology And Research Method

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110091862A1 (en) * 2007-11-14 2011-04-21 Osteosphere, Llc Generation of an hla-negative osteogenic precursor cell line
US20140134195A1 (en) * 2011-04-20 2014-05-15 University Of Washington Through Its Center For Commercialization Beta-2 microglobulin-deficient cells
WO2016183041A2 (en) * 2015-05-08 2016-11-17 President And Fellows Of Harvard College Universal donor stem cells and related methods
KR101826904B1 (ko) * 2014-08-06 2018-02-08 기초과학연구원 조직적합성항원 유전자들의 교정을 통하여 구축한, 면역적합형 세포

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104046593A (zh) * 2013-03-14 2014-09-17 浙江大学 一种低免疫原性的人细胞及其制备方法
KR20200138445A (ko) * 2014-04-24 2020-12-09 보드 오브 리전츠, 더 유니버시티 오브 텍사스 시스템 입양 세포 요법 생성물을 생성하기 위한 유도 만능 줄기 세포의 응용
US10648002B2 (en) * 2016-11-22 2020-05-12 Regents Of The University Of Minnesota Method for correcting a genetic sequence

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110091862A1 (en) * 2007-11-14 2011-04-21 Osteosphere, Llc Generation of an hla-negative osteogenic precursor cell line
US20140134195A1 (en) * 2011-04-20 2014-05-15 University Of Washington Through Its Center For Commercialization Beta-2 microglobulin-deficient cells
KR101826904B1 (ko) * 2014-08-06 2018-02-08 기초과학연구원 조직적합성항원 유전자들의 교정을 통하여 구축한, 면역적합형 세포
WO2016183041A2 (en) * 2015-05-08 2016-11-17 President And Fellows Of Harvard College Universal donor stem cells and related methods

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
CELL, vol. 126, 2006, pages 663 - 676
CELL, vol. 131, 2007, pages 1 - 12
KARABEKIAN, Z.: "HLA Class I depleted hESC as a source of hypoimmunogenic cells for tissue engineering applications", TISSUE ENGINEERING: PART A, vol. 21, no. 19-20, 2015, pages 2559 - 2571, XP055520166, DOI: 10.1089/ten.tea.2015.0105 *
KELTON, W: "Reprogramming MHC specificity by CRISPR-Cas9-assisted cassette exchange", SCIENTIFIC REPORTS, vol. 45775, 4 April 2017 (2017-04-04), pages 1 - 12, XP055659827 *
RIM ET AL., J TISSUE ENG REGEN MED, 2017
See also references of EP3805370A4
TORIKAI, H.: "Toward eliminating HLA class I expression to generate universal cells from allogeneic donors", BLOOD, vol. 122, no. 83, 22 August 2013 (2013-08-22), pages 1341 - 1349, XP002719612, DOI: 10.1182/BLOOD-2013-03-478255 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021169017A1 (zh) * 2020-02-25 2021-09-02 上海大学 间充质干细胞在治疗重症covid19肺炎中的用途
WO2021222389A1 (en) * 2020-04-28 2021-11-04 Factor Bioscience Inc. Mesenchymal stem cell therapies

Also Published As

Publication number Publication date
KR102304549B1 (ko) 2021-09-27
EP3805370A4 (en) 2022-04-27
KR20190137010A (ko) 2019-12-10
EP3805370A1 (en) 2021-04-14
US20210222127A1 (en) 2021-07-22

Similar Documents

Publication Publication Date Title
WO2019231266A1 (ko) Hla 유전자가 제거된 인간 유도만능줄기세포 유래 중간엽줄기세포 및 그의 제조 방법
KR101826904B1 (ko) 조직적합성항원 유전자들의 교정을 통하여 구축한, 면역적합형 세포
EP3498843B1 (en) Endonuclease targeting blood coagulation factor viii gene and composition for treating hemophilia comprising same
Clément et al. Stem cell manipulation, gene therapy and the risk of cancer stem cell emergence
US11981932B2 (en) Materials and methods for the manufacture of pluripotent stem cells
JP2021534813A (ja) 非免疫原性の操作された組織ならびにそれを製造および使用する方法
US20240060047A1 (en) Cells with sustained transgene expression
JP2024506751A (ja) 遺伝子サイレンシング
CN107208055B (zh) 引起免疫原性反应降低的被修饰细胞
Kumar et al. Potential of transposon-mediated cellular reprogramming towards cell-based therapies
WO2016093668A2 (ko) 일체형 유전자 치료 유도만능줄기세포 제작방법
WO2021107234A1 (ko) Hiv 감염 치료 또는 예방을 위한 ccr5/cxcr4 유전자 동시 넉아웃 환자맞춤형 조혈모세포 및 이의 제조방법
WO2016171625A1 (en) Targeting telomerase for cell therapy
WO2023167575A1 (ko) 저면역원성 줄기세포, 줄기세포로부터 분화되거나 유래된 저면역원성 세포 및 이의 제조방법
WO2012165740A1 (en) Composition for improving dedifferentiation of cells and method for producing inducted pluripotent stem cells using the same
KR20190135946A (ko) Hiv 감염 치료 또는 예방을 위한 ccr5/cxcr4 유전자 동시 넉아웃 환자맞춤형 조혈모세포 및 이의 제조방법
WO2023008918A1 (ko) B2m 유전자의 발현이 저해된 유전적으로 조작된 줄기세포 및 이의 이용방법
WO2022010220A1 (ko) 면역원성이 감소된 신규한 이식용 세포
Musacchio et al. Bone regeneration in the stem cell era: safe play for the patient?
KR20200011817A (ko) 혈액 응고인자 ⅷ의 교정용 조성물 및 이를 이용한 방법
KR102134428B1 (ko) 면역관용을 가지는 유도만능줄기세포 및 이의 제조방법
WO2022211604A1 (ko) Fe-fviii 변이 유전자로 교정된 줄기세포, 이로부터 분화된 내피 세포 및 이를 포함하는 혈우병 예방 또는 치료용 약제학적 조성물
EP2733202B1 (en) The INS cells and the method for reprogramming somatic cells to INS cells using Sox2 and c-Myc
WO2021172583A1 (ja) 遺伝子改変巨核球、改変血小板及びそれらの製造方法
US20220177922A1 (en) High-throughput gene-editing technique

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19812038

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019812038

Country of ref document: EP

Effective date: 20210111