WO2018050824A1 - Methods for performing multiplexed pcr - Google Patents
Methods for performing multiplexed pcr Download PDFInfo
- Publication number
- WO2018050824A1 WO2018050824A1 PCT/EP2017/073288 EP2017073288W WO2018050824A1 WO 2018050824 A1 WO2018050824 A1 WO 2018050824A1 EP 2017073288 W EP2017073288 W EP 2017073288W WO 2018050824 A1 WO2018050824 A1 WO 2018050824A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- oligonucleotide
- quenching
- tag portion
- moiety
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6804—Nucleic acid analysis using immunogens
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6811—Selection methods for production or design of target specific oligonucleotides or binding molecules
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/6818—Hybridisation assays characterised by the detection means involving interaction of two or more labels, e.g. resonant energy transfer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/6823—Release of bound markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
- C12Q2525/10—Modifications characterised by
- C12Q2525/161—Modifications characterised by incorporating target specific and non-target specific sites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2527/00—Reactions demanding special reaction conditions
- C12Q2527/107—Temperature of melting, i.e. Tm
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2531/00—Reactions of nucleic acids characterised by
- C12Q2531/10—Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid
- C12Q2531/113—PCR
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
- C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
- C12Q2537/143—Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2561/00—Nucleic acid detection characterised by assay method
- C12Q2561/113—Real time assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2565/00—Nucleic acid analysis characterised by mode or means of detection
- C12Q2565/10—Detection mode being characterised by the assay principle
- C12Q2565/101—Interaction between at least two labels
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Definitions
- the present invention relates to methods for polymerase chain reaction (PGR) particularly to methods for performing multiplexed PGR.
- PGR polymerase chain reaction
- PGR polymerase chain reaction
- PGR assay is able to si multaneously amplify and detect and quantify the start ing amount of the target sequence.
- a typical real-t ime PGR protocol involves the use of a labeled probe, specific for each target sequence.
- the probe is preferably labeled with one or more fluorescent moieties, which absorb and emit light at specific wavelengths. Upon hybridizing to the target sequence or its am pi icon, the probe exhibits a detectable change in fluorescent emission as a result of probe hybridization or hydrolysis.
- the ma jor challenge of a PGR assay however remains the ability to analyze numerous targets in a single tube.
- the number of loci of interest increases rapidly.
- mult iple loci must be analyzed in forensic DN A profiling, pathogenic microorganism detection, multi-locus genetic disease screening and multi-gene expression studies, to name a few.
- the ability to mult iplex an assay is limited by the detection instruments. Specifically, the use of multiple probes in the same reaction requires the use of distinct fluorescent labels. To simultaneously detect mult iple probes, an instrument must be able to discriminate among the light signals emitted by each probe.
- the majority of current technologies on the market do not permit detection of more than four to seven separate wavelengths in the same reaction vessel. Therefore, using one uniquely-labeled probe per target, no more than four to seven separate targets can be detected in the same vessel.
- at least one target is usually a control nucleic acid. Accordingly, in practice, no more than three to six experimental targets can be detected in the same tube.
- fluorescent dyes are also limited due to the spectral width where only about six or seven dyes can be fit within the visible spectrum without significant overlap interference. Thus the ability to multiplex an assay will not keep pace with the clinical needs, unless radical changes in the amplification and detection strategy are made.
- An addit ional ability to multiplex an amplification reaction is provided by a post -PGR melting assay. See U.S. patent appl ication Serial No. 1 1 /474,071 , filed on june 23, 2006.
- a melting assay the ampl ified n ucleic acid is identified by its unique melting profile.
- a melting assay involves determining the melting temperature (melting point) of a double-stranded target, or a duplex between the labeled probe and the target.
- a duplex between the target nucleic acid and the probe is gradually heated (or cooled) in a cont rolled temperature program.
- the dissociation of the duplex changes the distance between interacting fluorophores or between a fluorophore and a quencher.
- the interacting fluorophores may be con jugated to separate probe molecules, as described in U.S. Patent No. 6, 174,670.
- one fluorophore may be conjugated to a probe, while the other fluorophore may be intercalated into a nucleic acid duplex, as described in U.S. Patent No. 5,871 ,908.
- the fluorophores may be conjugated to a single probe
- the fluorescence is quenched as the fluorophore to the quencher are brought together in the now single-stranded probe.
- the melting of the nucleic acid duplex is monitored by measuring the associated change in fluorescence.
- the change in fluorescence may be represented on a graph referred to as "melting profile.”
- melting profile a graph referred to as "melting profile.”
- different probe-target duplexes may be designed to melt (or rean neal) at different temperatures, each probe will generate a unique melt ing profile.
- Properly designed probes would have melting temperatures that are clearly distinguishable from those of the other probes in the same assay.
- Many existing software tools enable one to design probes for a same-tube multiplex assay with these goals in mind. For example, Visual OMP TM software (DNA Software, Inc., Ann A rbor, Mich.) enables one to determine melting temperatures of nucleic acid duplexes under various reaction conditions.
- the post-amplification melting assay is most commonly used for qualitative purposes, i.e. to identify target nucleic acids, see U.S. Patent Nos. 6, 174,670, 6,427, 1 56 and 5,871 ,908. It is known to obtain a melting peak by differentiating the melting curve function. Ririe et al. ("Product differentiation by analysis of DNA melting curves during the polymerase chain reaction, " ( 1997) Anal. Biochem. 245: 1 54- 160) observed that differentiat ion helps resolve melting curves generated by mixtures of products. After differentiation, the melting peaks generated by each component of the mixture become easily distinguishable. It was also previously known that the post-amplification melting signal, i.e.
- U.S. Patent No. 6,245,5 14 teaches a post-amplification melt assay using a d u p I e x - i n t e r c a 1 a t i n g dye, to generate a derivative melting peak, and then, using proprietary software, to integrate the peak.
- the integration provides information about the efficiency of amplification and relative amount of the amplified nucleic acid.
- Patent Appl ication Publication No. 2005/0053939; Van Den Boom, U.S. Patent No. 8, 1 33,701 More recently, improved methods to perform multiplexed nucleic acid target identification by using structure based ol igonucleotide probe cleavage have been described in U.S. Patent Appl ication Publication No. 2014/0272955, U.S. 2015/0176075, and U.S. 2015/0376681.
- the present invent ion provides for novel methods for nucleic acid sequence detection, particularly detect ion of multiple target nucleic acids wherein a PGR reaction is run until it reaches an end-point beyond the log phase of ampli fication, (e.g. in the plateau, phase).
- the methods are performed by the use of novel oligonucleotide probes having two unique features, a n o n - c o in p 1 e in e n t a r y tag portion and a quenching molecule.
- the invention provides for a method for amplification and detect ion of a target nucleic acid in a sample comprising the steps of: (a) contact ing t he sample contain ing the target n ucleic acid in a single reaction vessel with ( i) one pair of oligonucleot ide primers, each oligonucleotide primer capable of hybridizing to opposite strands of a subsequence of the target nucleic acid; (ii) an oligonucleotide probe that comprises an annealing portion and a tag portion, wherein the tag portion comprises a nucleot ide sequence non -complementary to the target nucleic acid sequence or a non- nucleot ide molecule, wherein the annealing portion comprises a nucleotide sequence at least partially complementary to the target nucleic acid sequence and hybridizes to a region of the subsequence of the target nucleic acid that is bounded by the pair of
- PGR amplification is allowed to reach an end-point beyond the log phase of amplification (e.g. in the plateau phase).
- the tag portion comprises a modification such that it is not capable of being extended by a nucleic acid polymerase.
- the reporter moiety is on the tag portion of the oligonucleotide probe. In another embodiment, the reporter moiety is located on the annealing portion of the oligonucleotide probe and is able to interact in a tern perat u re-depen dent manner to the quench ing molecule that comprises the second quencher moiety.
- the tag port ion comprises a nucleotide sequence non-complementary to the target nucleic acid sequence and the quenching molecule is an oligonucleotide comprising a nucleotide sequence at least partially complementary to the tag portion of the oligonucleotide probe and binds to the tag portion by hybridization.
- the tag portion of the oligonucleotide probe or the quenching molecule or both the tag portion and the quenching molecule contain one or more nucleotide modifications.
- the one or more nucleotide modifications is selected from the group consisting of Locked Nucleic Acid (LNA), Pept ide Nucleic Acid (PNA), Bridged Nucleic Acid (BNA), 2 -0 alkyl subst itution, L-enantiomeric nucleotide, or combinations thereof.
- the reporter moiety is a fluorescent dye and the quencher moiety quenches a detectable signal from the fluorescent dye.
- the invention provides for a method for detecting two or more target nucleic acid sequences in a sample comprising the steps of: (a) contacting the sample suspected of containing the two or more target nucleic acid sequences in a single reaction vessel with (i) a first pai r of oligonucleotide primers with nucleotide sequences that are complementary to each strand of a first target nucleic acid sequence, and a second pair of oligonucleotide primers wit h nucleotide sequences that are
- a first oligonucleotide probe comprising a nucleotide sequence at least partially
- the first oligonucleotide probe comprises a fluorescent moiety capable of generating a detectable signal and a first quencher moiety capable of quenching t he detectable signal generated by the fluorescent moiety, wherein the fluorescent moiety is separated the first quencher moiety by a nuclease susceptible cleavage site ; (iii) a second oligonucleot ide probe comprising two distinct portions, an annealing portion comprising a nucleotide sequence at least part ially complementary to the second target nucleic acid sequence and anneals within the second target nucleic acid sequence bounded by the second pai r of oligonucleotide primers, wherein the annealing portion comprises a second quencher moiety; and a tag portion attached to the 5 ' terminus or to the
- oligonucleotide probe (d) measuring one or more fluorescent signals at a second temperature, which is higher than the first temperature, at which the quenching oligonucleotide is not hybridized to the tag portion from the second ol igonucleotide probe; (e) obtaining a calculated signal value by subtracting a median or average of the one or more fluorescent signals detected at the first temperature from a median or average of the one or more fl uorescent signal detected at the second temperature;
- PGR ampli fication is allowed to reach an end- point beyond the log phase of
- amplification (e.g. in the plateau phase).
- the tag portion comprises a modification such that it is not capable of being extended by a nucleic acid polymerase.
- the tag port ion is attached to the 5 ' terminus of t he annealing port ion.
- the tag portion is attached to the 3 ' terminus of the anneal ing portion.
- the tag portion is attached via a linker to a region of the annealing portion.
- the oligonucleotide probe or the quenching oligonucleotide or both the tag portion and the quenching oligonucleotide contain one or more nucleotide modifications.
- the one or more nucleotide modifications is selected from the group consist ing of Locked Nucleic Acid (LNA), Peptide Nucleic Acid (PNA), Bridged Nucleic Acid (BNA), 2 -0 alkyl substitution, L-enant iomeric nucleotide, or
- the invention provides for a method for detecting two or more target nucleic acid sequences in a sample comprising the steps of: (a) contacting the sample suspected of containing the two or more target nucleic acid sequences in a single reaction vessel with (i) a first pair of oligonucleotide primers with sequences that are complementary to each st rand of a first target nucleic acid sequence, and a second pair of oligonucleotide primers with sequences that are complementary to each st rand of a second target nucleic acid sequence; (ii) a first oligonucleotide probe comprising two distinct portions, a first annealing portion comprising a sequence at least partially complementary to the first target nucleic acid sequence and anneals within the first target nucleic acid sequence bounded by the first pair of oligonucleotide primers, wherein the first annealing portion comprises a first quencher moiety; and a first tag portion attached to the 5
- oligonucleot ide probe (e) obtaining a calculated signal val ue by subtracting a median or average of the one or more fluorescent signals detected at the first temperature from a median or average of the one or more fluorescent signals detected at the second temperature; whereby a value of the median or average of the one or more fluorescent signals detected at the first temperature that is higher than a threshold value allows determination of the presence of the first target nucleic acid sequence and the calculated signal value that is higher than the threshold signal value allows
- PGR amplification is allowed to reach an end-point beyond the log phase of ampl ification (e.g. in the plateau phase).
- the first tag portion and the second tag portion both comprise a modification such that both tag port ions are not capable of being extended by a nucleic acid polymerase.
- the first tag portion is attached to the 3 ' terminus of the first annealing portion of the first ol igonucleotide probe and the second tag portion is attached to the 3 '' terminus of the second annealing portion of the second
- the first tag port ion is attached to the 3 ' terminus of the first annealing portion of the first oligonucleotide probe and the second tag portion is attached to the 5 ' terminus of the second annealing portion of the second ol igonucleotide probe.
- the first tag portion is attached to the 3 ' terminus of the first annealing portion of the first oligonucleotide probe and the second tag portion is attached via a l inker to a region of the second annealing port ion of t he second oligonucleotide probe.
- the first tag portion is attached to the 5 ' terminus of the first annealing port ion of the first oligonucleotide probe and the second tag portion is attached to the 5 ' terminus of the second annealing portion of the second
- the first tag portion is attached to the 5 ' terminus of the first annealing portion of the first oligonucleotide probe and the second tag portion is attached to the 3 ' terminus of the second annealing portion of the second oligonucleotide probe.
- the first tag portion is attached to the 5 ' terminus of the first annealing portion of the first oligonucleotide probe and the second tag portion is attached via a l inker to a region of the second annealing port ion of the second oligonucleotide probe.
- the first tag portion is attached via a linker to a region of the first annealing portion of the first ol igonucleotide probe and the second tag portion is attached to the 5 ' terminus of the second annealing portion of the second
- the first tag portion is attached via a linker to a region of the first annealing portion of the first oligonucleotide probe and the second tag portion is attached to the 3 ' terminus of the second annealing portion of the second oligonucleotide probe.
- the first tag portion is attached via a linker to a region of the first annealing portion of the first oligonucleotide probe and the second tag portion is attached via a l inker to a region of the second anneal ing portion of the second oligonucleotide probe.
- any of the first tag portion of the first ol igonucleotide probe or the first quench ing oligonucleotide or the second tag portion of the second oligonucleotide probe or the second quenching ol igonucleotide or any combinat ions thereof contains one or more nucleotide modifications.
- the one or more nucleotide modifications is selected from the group consisting of Locked Nucleic Acid (LNA), Peptide Nucleic Acid (PNA), Bridged Nucleic Acid (BNA), 2 " -O alky] substitution, L- enantiomeric nucleotide, or combinations thereof.
- FIG. I is a graphical description of the oligonucleotide probe used to perform the methods of the invention.
- FIG. 2 is a graphical representation of the method of the invention that shows the separation of t he tag portion and subsequent dissociat ion of the quenching
- FIG. 3 is a description of one embodiment of the methods of the present invention.
- FIG. 4 shows the signal detection temperatures using another embodiment of the methods of the present invention.
- FIG. 5 shows different embodiments of the oligonucleotide probes used to practice the methods of the present invention.
- FIG. 6 shows the results of the hybridization and dissociation at two temperatures between a quench ing oligonucleotide and a fluorescently labeled complementary oligonucleotide as described in Example 1.
- FIG. 7 shows the detection of the IC target in increasing background of the H I V I - M. target as described in Example 2.
- FIG. 8 shows t he detect ion of the HIV1-M gag target in increasing background of t he IC target as described in Example 2.
- FIG. 9 shows the detection of the H I V 1 -M Itr target in increasing background of the IC target as described in Example 2.
- FIG. 10 shows the results of detection of the IC sample in the experiment as described in Example 3.
- Basel ine subtraction was used where IC signal temperature correction and subt raction was applied in thermal channel 2.
- Thermal channel 1 :
- sample includes a specimen or culture (e.g., microbiological cultures) that includes nucleic acids.
- sample is also meant to include both biological and environ mental samples.
- a sample may include a specimen of synthetic origin.
- Biological samples include whole blood, serum, plasma, umbil ical cord blood, chorionic villi, amniotic fluid, cerebrospinal fluid, spinal fluid, lavage fluid (e.g., bronchioalveolar, gastric, peritoneal, ductal, ear, arthroscopic), biopsy sample, urine, feces, sputum, sal iva, nasal mucous, prostate fluid, semen, lymphatic fluid, bile, tears, sweat, breast milk, breast fluid, embryonic cells and fetal cells.
- lavage fluid e.g., bronchioalveolar, gastric, peritoneal, ductal, ear, arthroscopic
- the biological sample is blood, and more preferably plasma.
- blood encompasses whole blood or any fract ions of blood, such as serum and plasma as conventionally defined.
- Blood plasma refers to the fraction of whole blood resulting from centrifugat ion of blood treated with anticoagulants.
- Blood serum refers to the watery portion of fluid remaining after a blood sample has coagulated.
- Environmental samples include environmental material such as surface matter, soil, water and industrial samples, as well as samples obtained from food and dairy processing instruments, apparatus, equipment, utensils, disposable and non- disposable items. These examples are not to be construed as lim iting the sample types applicable to the present invention.
- a target includes essentially any molecule for which a detectable probe (e.g., oligonucleotide probe) or assay exists, or can be produced by one skilled in the art.
- a target may be a biomolecule, such as a nucleic acid molecule, a polypeptide, a lipid, or a carbohydrate, which is capable of binding with or otherwise coming in contact with a detectable probe (e.g., an antibody), wherein the detectable probe also comprises nucleic acids capable of being detected by methods of the invention.
- detectable probe refers to any molecule or agent capable of hybridizing or annealing to a target biomolecule of interest and allows for the specific detect ion of the target biomolecule as described herein.
- the target is a nucleic acid
- the detectable probe is an oligonucleotide.
- nucleic acid and “nucleic acid molecule” may be used interchangeably th roughout the disclosure.
- oligonucleotides refer to oligonucleotides, ol igos, polynucleotides, deoxyribonucleotide (DNA), genomic DNA, mitochondrial DN A (intDNA), complementary DNA (cDNA), bacterial DNA, viral DNA, viral RNA, RNA, message RNA ( mRNA), transfer RNA (t RNA), ribosomal RNA ( rRNA), siRNA, catalytic RNA, clones, plasmids, M 13, P I , cosmid, bacteria arti ficial chromosome ( BAG), yeast artificial chromosome (YAC), amplified nucleic acid, amplicon, PGR product and other types of amplified nucleic acid, RNA /DNA hybrids and polyamide nucleic acids (PNAs), all of wh ich can be in either single- or double-stranded form, and unless otherwise li mited, would encompass known analogs of natural nucleotides that can function in a
- nucleotides refers to both naturally-occurring and modified/non naturally-occurring nucleotides, including nucleoside tri, di, and monophosphates as well as monophosphate monomers present within polynucleic acid or oligonucleotide.
- a nucleotide may also be a ribo; 2'-deoxy; 2',3'-deoxy as well as a vast array of other nucleotide mimics that are well-known in the art.
- Mimics incl ude chain-terminating nucleotides such as 3'-0-methyl, halogenated base or sugar substitut ions; alternative sugar structures including nonsugar, alkyl ring structures; alternative bases including inosine; deaza-modified; chi, and psi, linker-modified; mass label-modified; phosphodiester modifications or replacements including
- phosphorothioate met h yl phosph onate, boranophosphate, amide, ester, ether; and a basic or complete internucleotide replacements, including cleavage l inkages such a photocleavable nitrophenyl moieties.
- a target can be measured quantitatively or qualitat ively.
- Targets can come in a variety of di fferent forms including, for example, simple or complex mixtures, or in substantially purified forms.
- a target can be part of a sample that contains other components or can be the sole or major component of the sample. Therefore, a target can be a component of a whole cell or t issue, a cell or t issue extract, a fract ionated lysate thereof or a substantially purified molecule.
- a target can have either a known or unknown sequence or structure.
- amplification reaction'' refers to any in vitro means for multiplying the copies of a target sequence of nucleic acid.
- “Amplifying” refers to a step of submitting a solution to conditions sufficient to allow for ampl ification.
- Components of an amplification reaction may include, but are not limited to, e.g., primers, a polynucleotide template, polymerase, nucleotides, dNTPs and the like.
- the term “amplifying” typically refers to an " exponential” increase in target nucleic acid.
- amplifying as used herein can also refer to linear increases in t he numbers of a select target sequence of nucleic acid, but is different than a one-time, single primer extension step.
- PGR Polymerase chain reaction
- Oligonucleotide refers to linear ol igomers of natural or modified nucleosidic monomers linked by phosphodiester bonds or analogs thereof.
- Ol igonucleotides include deo xy r i bo n u c I eos i des, ribonucleosides, anomeric forms thereof, peptide nucleic acids (PNAs), and the like, capable of specifically binding to a target nucleic acid.
- PNAs peptide nucleic acids
- monomers are l inked by phosphodiester bonds or analogs thereof to form oligonucleotides ranging in size from a few monomeric units, e.g., 3-4, to several tens of monomeric units, e.g., 40-60.
- oligonucleotide is represented by a sequence of letters, such as " ATGCCTG,” it will be understood that the nucleotides are in 5'-3' order from left to right and that "A” denotes deoxyadenosine, “C” denotes deoxycytidine, “G” denotes deoxyguanosine, “T” denotes deoxythymidine, and “U” denotes the ribonucleoside, uridine, unless otherwise noted.
- ATGCCTG a sequence of letters
- oligonucleotides comprise the four natural deoxynucleotides; however, they may also comprise ribonucleosides or non- natural nucleotide analogs.
- an enzyme has specific oligonucleotide or polynucleotide substrate requirements for activity, e.g., single stranded DNA, RNA/DNA duplex, or the like, then selection of appropriate composition for the oligonucleotide or polynucleotide substrates is well within the knowledge of one of ordinary skill.
- oligonucleotide primer refers to a polynucleotide sequence that hybridizes to a sequence on a target nucleic acid template and facilitates the detection of an oligonucleotide probe.
- an oligonucleotide primer serves as a point of initiation of nucleic acid synthesis.
- an oligonucleotide primer may be used to create a st ructure that is capable of being cleaved by a cleavage agent.
- Primers can be of a variety of lengths and are often less than 50 nucleotides in length, for example 12- 25 nucleot ides, in length.
- the lengt h and sequences of primers for use in PGR can be designed based on principles known to those of skill in the art .
- oligonucleotide probe refers to a polynucleotide sequence capable of hybridizing or annealing to a target nucleic acid of interest and allows for the specific detect ion of t he target nucleic acid.
- a “reporter moiety " or “reporter molecule” is a molecule that confers a detectable signal. The detectable phenotype can be colorimetric, fluorescent or luminescent, for example.
- a “quencher moiety " or “quencher molecule” is a molecule that is able to quench the detectable signal from the reporter moiety.
- a “mismatched nucleotide” or a “mismatch” refers to a nucleotide that is not complementary to the target sequence at that position or posit ions.
- An oligonucleotide probe may have at least one mismatch, but can also have 2, 3, 4, 5, 6 or 7 or more mismatched nucleotides.
- polymorphism refers to an allel ic variant. Polymorphisms can include single nucleotide polymorphisms (SN P's) as well as simple sequence length polymorphisms. A polymorphism can be due to one or more nucleotide substitutions at one allele in comparison to another allele or can be due to an insertion or deletion, duplicat ion, inversion and other alterations known to the art.
- SN P's single nucleotide polymorphisms
- a polymorphism can be due to one or more nucleotide substitutions at one allele in comparison to another allele or can be due to an insertion or deletion, duplicat ion, inversion and other alterations known to the art.
- modification refers to alterations of the oligonucleotide probe at the molecular level (e.g., base moiety, sugar moiety or phosphate backbone).
- Nucleoside modifications include, but are not limited to, the introduction of cleavage blockers or cleavage inducers, the introduct ion of minor groove binders, isotopic enrichment, isotopic depletion, the introduction of deuterium, and halogen
- Nucleoside modifications may also include moieties that increase the st ringency of hybridization or increase the melting temperature of the ol igonucleotide probe.
- a nucleotide molecule may be modified with an extra bridge connecting the 2' and 4' carbons resulting in locked nucleic acid (LNA) nucleotide that is resistant to cleavage by a nuclease (as described in I manishi et al., U.S. Patent No. 6,268,490 and in Wengel et a I., U.S. Patent No. 6,794,499.
- LNA locked nucleic acid
- compositions of the tag portion of the oligonucleotide probe and of the quenching oligonucleot ide molecule are only rest ricted by thei r abil ity to form stable duplexes.
- These ol igonucleotides can therefore comprise of DNA, L- DNA, RNA, L-RNA, LNA, L-LNA, PN A (pept ide nucleic acid, as described in Nielsen et al., U.S. Patent No. 5,539,082), BNA (bridged nucleic acid, for example, 2',4'-BNA(NC)
- L-XXX refers to the L-enantiomer of the sugar un it of the nucleic acids
- nucleoside modifications include various 2 '' substitutions such as halo, alkoxy and allyloxy groups that are introduced in the sugar moiety of
- the mixed 2 '' -OMe-substituted oligonucleotide hybridized to its RNA complement as strongly as the RNA -RNA duplex wh ich is significantly stronger than the same sequence RNA-DNA heteroduplex. Therefore, examples of substitutions at the X position of the sugar include F, CN, CF-., OCF 3 , OMe, OCN, O-alkyl, S-alkyl, SMe, SO.Me, ONO 2 , N0 2 , NH 3 , NH 2 , N H-alkyl, OCH 3 CH 2 and OCCH .
- speci fic or “specificity” in reference to the binding of one molecule to another molecule, such as a probe for a target polynucleotide, refers to the recogn ition, contact, and formation of a stable complex between the two molecules, together with substantially less recognition, contact, or complex formation of that molecule with other molecules.
- anneal refers to the formation of a stable complex between two molecules.
- a probe is "capable of annealing" to a nucleic acid sequence if at least one region of the probe shares substantial sequence identity with at least one region of the complement of the nucleic acid sequence.
- “Substant ial sequence identity” is a sequence ident ity of at least about 80%, preferably at least about 85%, more preferably at least about 90%, 95% or 99%, and most preferably 100%.
- U and T often are considered the same nucleotide.
- a probe comprising the sequence ATCAGC is capable of hybridizing to a target RNA sequence comprising the sequence GCUGAU.
- cleavage agent refers to any means that is capable of cleaving an oligon ucleotide probe to yield fragments, including but not li mited to enzymes.
- the cleavage agent may serve solely to cleave, degrade or otherwise separatethe second portion of the oligonucleotide probe or fragments thereof.
- the cleavage agent may be an enzyme.
- the cleavage agent may be natural, synthetic, un modified or modified.
- the cleavage agent is preferably an enzyme that possesses synthetic (or polymerization) activity and nuclease activity.
- an enzyme is often a nucleic acid ampl ification enzyme.
- An example of a nucleic acid ampl ification enzyme is a nucleic acid polymerase enzyme such as Thermus aquaticus (Taq) DNA polymerase (TaqMan ® ) or E. coli DNA polymerase I .
- the enzyme may be naturally occurring, unmodified or modified.
- nucleic acid poly me rase refers to an enzyme that catalyzes the incorporation of nucleotides into a nucleic acid.
- exemplary n ucleic acid polymerases include DNA polymerases, RNA polymerases, terminal transferases, reverse transcriptases, telomerases and the like.
- thermostable DNA polymerase refers to a DNA polymerase that is stable (i.e., resists breakdown or denaturation) and retains sufficient catalytic activity when subjected to elevated temperatures for selected periods of time.
- a thermostable DNA polymerase retains sufficient activity to effect subsequent pri mer extension reactions, when subjected to elevated temperatures for the ti me necessary to denature double-stranded nucleic acids. Heating conditions necessary for nucleic acid denaturation are well known in the art and are exemplified in U.S. Pat. Nos. 4,683,202 and 4,683, 195.
- thermostable polymerase is typically suitable for use in a temperature cycling reaction such as the polymerase chain reaction ("PGR").
- PGR polymerase chain reaction
- the examples of t hermostable nucleic acid polymerases include Thermus aquaticus Taq DNA polymerase, Thermus sp. Z05 polymerase, Thermus flavus polymerase,
- Thermotoga maritima polymerases such as TM.A-25 and TM A-30 polymerases, Tth DNA polymerase, and the like.
- a "modified " polymerase refers to a polymerase in wh ich at least one monomer differs from the reference sequence, such as a native or wild-type form of the polymerase or another modified form of the polymerase. Exemplary modifications include monomer insert ions, deletions, and substitutions. Modified polymerases also include chimeric polymerases that have identifiable component sequences (e.g., structural or functional domains, etc.) derived from two or more parents. Also included within the definition of modified polymerases are those comprising chemical modifications of the reference sequence.
- modified polymerases include G46E E678G CSS DNA polymerase, G46E L329A E678G CSS DNA polymerase, G46E L329A D640G S671 F CSS DNA polymerase, G46E L329A D640G S671 F E678G CSS DNA polymerase, a G46E E678G CS6 DN A polymerase, Z05 DNA polymerase, ⁇ 05 polymerase, ⁇ 05- Gold polymerase, ⁇ 05 ⁇ polymerase, E615G Taq DNA polymerase, E678G TMA-25 polymerase, E678G TMA-30 polymerase, and the l ike.
- 5' to 3' nuclease activity or “5'-3' nuclease activity” refers to an activity of a nucleic acid polymerase, typically associated with the nucleic acid strand synthesis, whereby nucleotides are removed from the 5' end of nucleic acid strand, e.g., E. coli DNA polymerase 1 has this activity, whereas the Klenow fragment does not.
- Some enzymes that have 5 ' to 3 ' nuclease activity are 5 ' to 3 ' exonucleases. Examples of such 5 ' to 3 ' exonucleases include: Exonuclease from B.
- subtilis Phosphodiesterase from spleen, Lambda exonuclease, Exonuclease 11 from yeast, Exonuclease V from yeast, and Exonuclease from Neurospora crassa.
- propanediol or "propanediol spacer” refers to 1 ,3-Propanediol and is synonymous with Propane- 1 ,3-diol, 1 ,3-Dihydroxypropane, and Trimethylene glycol.
- I I EG or "HEG spacer” refers to hexaethylene glycol, which is synonymous with 3,6,9, 12, 1 S-Pentaoxaheptadecane- 1 , 17-diol.
- nucleic acid polymerases can possess several activities, among them, a 5 ' to 3 ' nuclease activity whereby the nucleic acid polymerase can cleave mononucleotides or small oligonucleotides from an oligon ucleotide annealed to its larger,
- an upstream oligonucleotide In order for cieavage to occur efficiently, an upstream oligonucleotide must also be annealed to the same larger polynucleotide.
- the detection of a target nucleic acid ut ilizing the 5 ' to 3 ' nuclease activity can be performed by a "Taq Man'" or "5'-nuclease assay", as described in U.S. Pat. Nos.
- amplification is performed using a DNA polymerase having 5' to 3' exonuclease activity.
- any probe wh ich hybridizes to the target nucleic acid downstream from the primer being extended is degraded by the 5' to 3' exonuclease activity of the DNA polymerase.
- the synthesis of a new target strand also results in the degradation of a probe, and the accumulation of degradation product provides a measure of the synthesis of target sequences.
- Any method suitable for detecting degradation product can be used in a 5' n uclease assay. Often, the detection probe is labeled with two fluorescent dyes, one of which is capable of quenching the fluorescence of the ot her dye.
- the dyes are attached to the probe, typically with the reporter or detector dye attached to the 5' term inus and the quenching dye attached to an internal site, such that quenching occurs when the probe is in an unhybridized state and such that cleavage of the probe by the 5' to 3' exonuclease activity of the DNA polymerase occurs in between the two dyes.
- Amplification results in cleavage of the probe between the dyes with a concomitant el imination of quenching and an increase in the fluorescence observable from the initially quenched dye.
- the accumulat ion of degradat ion product is monitored by measuring the increase in reaction fluorescence.
- U.S. Pat. Nos. 5,491 ,063 and 5,571 ,673 describe alternative methods for detecting the degradation of probe which occurs concomitant with amplification.
- a 5' nuclease assay for the detect ion of a target nucleic acid can employ any polymerase that has a 5' to 3' exonuclease activity.
- the polymerases with 5 '-nuclease activity are thermostable and thermoactive nucleic acid polymerases.
- thermostable polymerases include, but are not limited to, native and recombinant forms of polymerases from a variety of species of the eubacterial genera Thermus, Thermatoga, and Thermosipho, as well as chimeric forms thereof
- Thermus species polymerases that can be used in the methods of the invention include Thermus aquaticus (Taq) DNA polymerase, Thermus thermophilic (Tth) DNA polymerase, Thermus species Z05 (Z05) DNA polymerase, Thermus species sps 17 (sps l 7), and Thermus species Z05 (e.g., described in U.S. Pat. Nos.
- Thermatoga polymerases that can be used in the methods of the invention include, for example, Thermatoga maritima DNA polymerase and Thermatoga neapolitana DNA polymerase, while an example of a Thermosipho polymerase that can be used is Thermosipho africanus DNA polymerase.
- the sequences of Thermatoga maritima and Thermosipho africanus DNA polymerases are published in International Patent Application No. PCT7US91 /07035 with
- the amplification detect ion is typically concurrent with ampl ification (i.e., "real-time " ).
- the amplification detection is quantitative, and the amplification detection is real-time.
- the amplification detection is qualitative (e.g., end-point detection of the presence or absence of a target nucleic acid).
- the ampl ificat ion detection is subsequent to amplification.
- the amplification detection is qual itative, and the amplification detection is subsequent to ampli fication, i.e. when amplification reaches an end-point beyond the log phase of amplification.
- PGR ampli fication and end-point detection of two or more target nucleic acid in a single react ion vessel may be performed using a standard Taq Man' oligonucleotide probe for detect ing the presence of the first target and one or more novel TaqMan * oligonucleotide probes for detecting the presence of the second, third or more targets, with all the probes containing the same fluorescent label.
- the novel TaqMan * oligonucleotide probes may be used for detecting the presence of all the target nucleic acids.
- the novel probes have two distinguish ing features.
- the first feature of the novel probe is that it comprises two distinct portions.
- the first portion is referred as an annealing portion and comprises a sequence that is at least partially complementary to a target nucleic acid sequence such that it is capable of being hybridized with the target sequence.
- the annealing portion also contains a quencher moiety.
- the anneal ing portion contains a reporter moiety such as a fluorescent dye that is capable of being quenched the quencher moiety and is separated from the quencher moiety by a nuclease susceptible cleavage site.
- the second portion of the oligonucleotide probe is referred as a tag portion.
- the tag portion is attached to the 5 ' terminus of the annealing port ion.
- the tag portion is attached to the 3 '' terminus of the annealing portion. In another embodiment, the tag portion is attached anywhere between the 5 ' terminus and the 3 ' terminus of the annealing portion via a linker.
- the tag portion may comprise a nucleotide sequence that is not complementary to the target nucleic acid sequence and forms a "flap" region that is not capable of binding to the target nucleic acid (see FIG. 1 for a graphical representation of a 5 ' flap probe).
- the tag portion may also be comprised of non-nucleotides such as any organic moieties, or repeat units (e.g.
- the tag portion contains a reporter moiety such as a fluorescent dye that is capable of being quenched by the quencher moiety on the annealing portion.
- the annealing and tag portions of the oligonucleotide probe may optionally be separated by a non- nucleot ide linker.
- This linker can be comprised of carbon, carbon and oxygen, carbon and nitrogen, or any combination of these and can be of any length.
- the linker can be comprised of a linear moiety or a cycl ic moiety.
- the linker may be derived from a single unit or from mult iple identical or different units separated by phosphate linkages.
- the purpose of the l inker is to create a region at the junction of the annealing and tag portions of the oligonucleotide probe. When the tag portion is separated from the annealing portion, the l inker also prevents it from being extended by a nucleic acid polymerase. Alternatively, another modification on the separated tag port ion renders it non-extendible by the nucleic acid polymerase.
- the second feature of the novel probe is that the tag portion binds to a quenching molecule.
- the quench ing molecule may be an oligonucleotide that is fully or partially complementary to the nucleotide sequence of the tag portion and hybridizes to the tag portion.
- the quenching molecule also contains or is associated with a quencher moiety, i.e. a second quencher moiety, which is also capable of quenching t he signal from the reporter moiety (e.g. fluorescent dye) on the tag portion.
- the quencher moiety on or associated with the quenching molecule (the second quencher moiety) can be the same as or different from the quencher moiety on the annealing portion (the first quencher moiety).
- the reporter moiety on the tag portion is quenched by both the quencher moiety on the annealing portion of the probe and by the quencher moiety on or associated with the quenching molecule (e.g. by a quenching oligonucleotide as shown in FIG. 1 ).
- the general principle of using the novel probe to perform PGR amplificat ion and end- point detection of target nucleic acid in a 5' nuclease assay is described below.
- Fi rst a sample suspected of containing the target nucleic acid is provided.
- the sample is then contacted inside a single reaction vessel (e.g. a single test tube or a single well in a multi- well microplate) with PGR reagents that contain both the oligonucleot ide primers capable of generat ing amplicons of the target nucleic acid and the novel ol igonucleotide probe.
- PGR amplification begins by using a nucleic acid polymerase having 5 ' to 3 ' nuclease activity such that during the extension step of each PGR cycle, the nuclease activity of the polymerase allows cleavage and separationof the tag portion from the quenching moiety on the annealing portion of the probe.
- the separatedtag portion may optionally contain a modification (such as the non-nucleotide linker) such that it is not capable of being extended by a nucleic acid polymerase.
- the signal from the reporter moiety on the separatedtag portion is measured at a first temperature, usually, the annealing and/or extension temperature, at which the quench ing molecule is still bound to the tag portion. Due to the presence of the quencher moiety on or associated with the quenching molecule, the signal from the reporter moiety (e.g. a fluorescent dye) on the tag portion is still quenched. I n some instances, it may be advantageous to measure the signal from the reporter moiety more than once at the first temperature and obtain an average or median signal value at the first temperature. Then, a second signal reading is performed at a temperature point at which the quenching molecule is no longer bound to the tag portion. I f the quenching molecule is an oligonucleotide that has sequences
- this dissociation occurs at the melting temperature (Tm) of the duplex formation between the quenching oligonucleotide molecule and the tag port ion.
- Tm melting temperature
- Signal from the reporter moiety which is no longer quenched by the quencher moiety on or associated with the quench ing oligonucleotide is then measured at a second temperature that is at or above the Tm temperature of the duplex. In fact, it may be better that the second temperature is above the Tm temperature to ensure that close to 100% of the tag portion are in single- stranded form. However, it is also possible to measure the signal at a temperature below the Tm temperature.
- a calculated signal value is determined by subt racting the signal (or the average or median signal value) detected at the first temperature when the quenching molecule is still bound to the tag port ion from the signal (or the average or median signal value) detected at the second temperature when the quenching molecule is not bound to the tag portion (see FIG. 2 and FIG. 3).
- the calculated signal value may optionally be normalized for correction of signals that may be affected by temperature. For example, fluorescent signals are known to decrease at higher temperatures, and therefore, standards can be used to normalize the signal values obtained at di fferent temperatures.
- dPCR digital PGR
- a sample is partitioned so that individual nucleic acid molecules within the sample are localized and concentrated within many separate regions.
- the quenching or isolation of individual nucleic acid molecules has been performed in micro well plates, capillaries, the dispersed phase of an emulsion, and arrays of min iaturized chambers, as well as on nucleic acid binding surfaces.
- the partition ing of the sample allows one to estimate the number of different molecules by assuming t hat the molecule population follows the Poisson dist ribution. As a result, each part will contain "0" or "1" molecules, or a negative or positive reaction, respectively.
- nucleic acids may be quantified by counting the regions that contain PGR end-product, positive reactions.
- the number of PGR amplification cycles is proportional to the starting copy number. dPCR, however, is not dependent on the number of
- amplification cycies to determine the initial sample amount, eliminating the reliance on uncertain exponential data to quantify target nucleic acids and therefore provides absolute quantification.
- Current digital PGR approaches are achieved by either a microfluidic based approach where a react ion is partitioned into nano-wells on an array or by a droplet based approach where the reaction is separated into m icro-droplets.
- Commercially available systems employing the microfluidic approach include the Biomark H D system from Fluidigm Corporat ion (South San Francisco, CA) and the QuantStudio 3 D dPCR system from Thermo Fisher Scientific (Walt ham, MA).
- Other competitors in the commercial digital PGR landscape include RainDance Technologies (Billerica, MA) with their Raindrop system and Bio-Rad (Hercules, CA) with their QX200 droplet based systems.
- oligonucleotide probes that have tag portions hybridized to their respective quenching ol igonucleot ide molecules at various Tm temperatures. For example, amplification and detection of three target nucleic acid in one reaction can be achieved by using th ree oligonucleotide probes all labeled with the same fl uorophore.
- a standard TaqMan ® oligonucleotide probe may be used to detect the first target by measuring the fluorescent signal at a first temperature (usually the annealing temperature of a PGR cycle).
- a first "tagged" probe with a low Tm tag-quench ing ol igonucleotide duplex may be used to detect the second target by measuring the calculated fluorescent value at a second temperature at or above its Tm temperature and that is higher than the first temperature.
- a second "tagged " probe with a high Tm tag- quenching oligonucleotide duplex may be used to detect the third target by measuring the calculated fluorescent value at a third temperature at or above its Tm temperature and that is higher than the second temperature, (see FIG. 4)
- novel probes of the present invention can be designed such that the tag portion is a nucleotide sequence and is connected to a quenching ol igonucleotide to form a hairpin (i.e. a stem-loop st ructure).
- the "stem” portion will consist of the complementary regions between the tag portion and quenching oligonucleot ide while the "loop" port ion may be comprised of non-complementary nucleotides or non -nucleotides such as linkers as previously described.
- novel probes of the present invention have been described as having the reporter moiety located on the tag portion of the probes, it is also possible to position the reporter moiety on the annealing portion and place the first quencher moiety on the tag portion, as long as the reporter moiety can reversibly interact with the second quencher moiety on the quenching oligonucleotide.
- the reporter moiety is designed and positioned in the probe oligonucleot ide in such a way that it is separated from the first quenching moiety on the annealing portion during the 5' nuclease (TaqMarT) assay and further designed to reversibly interact with the second quenching moiety on the quenching molecule.
- both the tag portion and the quenching molecule are comprised of nucleot ide sequences.
- both the tag portion and the quenching oligonucleotide should not hybridize specifically to the target nucleic acid sequence but they should be fully or partially complementary to each other to allow hybridization at the desired temperatures. Both may include a modification at their 3 ' termini in order to not be extended by the nucleic acid polymerase during PGR amplification.
- Both the reporter moiety e.g.
- the fluorescent dye) on the tag portion and the quencher moiety on the quenching oligonucleotide can be located at the 5 ' terminus, the 3 '' terminus or at any posit ion between the 5 ' and 3 ' termini but they must be located in proximity to each other when the tag portion is hybridized to the quenching oligonucleot ide to allow the quench ing moiety to quench the detectable signal from the reporter moiety.
- modified nucleotides can be introduced at all or some positions on either the tag portions, on the quench ing oligonucleot ides or on both the tag portions and the quenching oligonucleotides such that oligonucleotide length can be shortened.
- nucleotide modificat ions that serve to increase the melting temperature include LNA, PNA, G-clamp
- the tag portion of the oligonucleotide probe and the quenching molecular are comprised of non-nucleotide molecules that reversibly interact with each other in a tern pe ra t u re-d epen den t manner.
- non- nucleotide interactions incl ude but are not l imited to protein-protein interactions, protein-peptide interactions (e.g. peptide aptamers), protein-small molecule interactions, peptide-small molecule interactions, small molecule-small molecule interactions.
- biotin and avidin can be exploited by modifying either the biotin moiety (e.g. desthiobiotin) or the avidin moiety (see, Nordlund et a I., J. Biol. Chem., 2003, 278 (4) 2479-2483) or both in order to make the interaction reversible and temperature dependent.
- biotin moiety e.g. desthiobiotin
- avidin moiety see, Nordlund et a I., J. Biol. Chem., 2003, 278 (4) 2479-2483
- the interaction between the tag portion and the quenching molecule may involve interaction between a nucleotide sequence (or n ucleotide sequences) and a non-nucleotide molecule in a sequence specific manner.
- these types of interact ions include but are not limited to nucleic acid aptamers, DNA binding proteins or peptides and DNA minor groove binders.
- sequence-specific DNA-binding molecules have been described in several papers (see e.g. Dervan, Science, 1986, 232, 464-471 ; White et al., Nature, 1998, 391 , 468-471 ) and these methods may be used to generate interactions between the tag portion and the quenching molecule that are temperature-dependent.
- ol igonucleotide QO does not contain the quencher whereas quench ing oligonucleotide Q l contains a BHQ-2 quencher at its 5 ' terminus.
- the 9 FAM 9 TAG ol igonucleotide was incubated without a quenching ol igonucleotide (QX) or with the Q0 or Q l quenching oligonucleotide at 1 :5 molar ratio.
- the mixtures were then cycled in 50 ⁇ , reactions that consisted of 60 mM Tricine, 120mM potassium acetate, 5.4% DM SO, 0.027% Sodium Azide, 3% glycerol, 0.02% Tween 20, 43.9uM EDTA, 0.2U/uL UNG, 0.1 uM 19TAGC9FAMC9, 0.5 uM Q0 or Q l , 400 ⁇ dATP, 400 ⁇ 4CTP, 400 ⁇ . dGTP, 800 ⁇ . dUTP, and 3.3 mM Manganese Acetate. Cycle conditions resembl ing a typical PGR amplification reaction are shown on Table 2.
- Example 2 PCR with Tagged Probe and Quenching Oligonucleotide with End-Point Detection
- IC internal control
- Detection of three unique targets in a single fluorescence channel using fluorescein (FAM) was achieved through a combination of TaqMan ® chemist ry and thermal assisted generation of signal (TAGS) using tagged probes and their respect ive quenching oligonucleotides.
- Endpoint fluorescence signal (average fluorescence signal for last four cycles) was measured in the FAM fluorescence channel for all three targets post TaqMan * PCR.
- Table 3 shows the sequences of the probes and quench ing oligonucleotides used in this experiment.
- Each 50 ill, reaction contained 3% glycerol, 60 mM Tricine, 120mM potassium acetate, 400 ⁇ each dATP, dCTP and dGTP, 800 ⁇ dUTP, 0.3 ⁇ of each forward primer, 0.3 ⁇ of each reverse primer, 0.3 ⁇ of detection probe (sequence I -3), 0.6uM of each Q-tag (Sequence 4-5) 5.4% DM SO, 0.02% Tween 20, 43.9uM EDTA, 0.03% sodium azide, 0.211/ ⁇ uracil-N-glycosylase (UNG), 0.67 ⁇ NTQ2 I -46A aptamer, 0.91 ⁇ / ⁇ Z05D polymerase, and 3.3 mM manganese acetate (pH 6.3).
- thermal channel 2 when the H IV l -M gag target was present due to the tagged probe ( 1 1 I V- 1 M gag, SEQ 1 D NO: 5) cleavage and increased fluorescence from melting of the probe cleavage fragment from the complementary quench ing oligonucleot ide (Q-Tag gag, SEQ I D NO: 7). Furthermore, fluorescence signal was observed at 95"C (FIG.
- thermal channel 3 when the H IV l -M ltr target was present due to cleavage of the second tagged probe ( H IV- I M ltr, SEQ I D NO: 6) and increased fluorescence from melting of the probe cleavage fragment from the second complementary quenching oligonucleotide (Q-Tag ltr, SEQ I D NO: 8). Any samples with fluorescence signals below the defined fluorescence th reshold signal per thermal channel (dotted lines) were considered as negative. Temperature corrected thermal channel 1 (58"C) fluorescence was subtracted from thermal channel 2 (80"C) fluorescence to achieve specific signal for H IV 1 -M gag.
- thermal channel 2 fluorescence was subtracted from thermal channel 3 (95"C) fluorescence to achieve specific signal for H lV l -M Itr.
- Each 16 ill, reaction contained 3% glycerol, 60 mM Tricine, 120mM potassium acetate, 400 ⁇ each dATP, dCTP and dGTP, 800 ⁇ dUTP, 0.3 ⁇ of each forward primer, 0.3 ⁇ of each reverse primer, 0.3 ⁇ of detection probe (SEQ I D NO: 9 & 10), 0.6 ⁇ of Q-tag (SEQ I D NO: 11) 5.4% DMSO, 0.02% Tween 20, 43.9uM EDTA, 0.03% sodium azide, 0.21 ⁇ / ⁇ uracil-N-glycosylase (UNG), 0.67 ⁇ NTQ21 -46A aptamer, 0.9 ⁇ / ⁇ Z05D polymerase, and 3.3 mM manganese acetate (pi 1 6.3).
- PGR amplification was performed on a Roche LightCycler ® 480 instrument. Reactions were subjected to the temperature profile as described in TABLE 2 in Example 1 .
- IC crossover signal was removed from thermal channel 2 via temperature correction and fluorescence subtraction, enabling detection of only H IV l -M in thermal channel 2 ( FIG 12B).
- the ratio of negative reactions for each set of 96 wells was applied to a Poisson calculation to determine total copies of each target across those wells.
- the total copies across 96 wells are calculated by multiplying ⁇ by 96. Results are shown on TA BLE 5 and demonstrate the un ique detection of the IC template versus the H1V1-M Itr template in a single fluorescence channel and two thermal channels at endpoint detection.
- SEQ 1 D NO 1 9FAM9TAG oligonucleotide sequence CGTCGCCAGTCAGCTCCGGT
- SEQ ID NO 2 QO quenching oligonucleotide sequence (no quencher)
- SEQ ID NO 4 IC TaqMan probe oligonucleotide sequence ( FAM/B HQ/phosphate) TGCGCGTCCCGTTTTGATACTTCGTAACGGTGC
- SEQ ID NO 5 I IIVl-M gag tagged probe oligonucleotide sequence
- SEQ I D NO 8 HIVl-M Itr quenching oligonucleotide sequence (Bt lQ- 1 quencher on 3' terminus)
- SEQ I D NO 9 IC probe oligonucleotide sequence (from Example 3) TGCGCGTCCCGTTTTGATACTTCGTAACGGTGC
- SEQ I D NO 10 HIVl-M Itr probe oligonucleotide sequence (from Example 3) TCTCTAGCAGTGGCGCCCGAACAGGGACCACACATTGGCACCGCCGTCT
- SEQ I D NO 1 1 Q-Tag oligonucleotide sequence (from Example 3) AGACGGCGGTGCCAATGTGTGTG
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA3036119A CA3036119C (en) | 2016-09-15 | 2017-09-15 | Methods for performing multiplexed pcr |
| KR1020197007698A KR102468174B1 (ko) | 2016-09-15 | 2017-09-15 | 멀티플렉스 pcr 수행 방법 |
| JP2019514294A JP7221199B2 (ja) | 2016-09-15 | 2017-09-15 | マルチプレックスpcrの実施方法 |
| CN201780056599.2A CN109689889A (zh) | 2016-09-15 | 2017-09-15 | 用于进行多重pcr的方法 |
| ES17768765T ES2893411T3 (es) | 2016-09-15 | 2017-09-15 | Procedimientos para realizar PCR multiplexada |
| DK17768765.4T DK3512959T3 (da) | 2016-09-15 | 2017-09-15 | Fremgangsmåder til udførelse af multipleks PCR |
| AU2017328613A AU2017328613B2 (en) | 2016-09-15 | 2017-09-15 | Methods for performing multiplexed PCR |
| EP17768765.4A EP3512959B1 (en) | 2016-09-15 | 2017-09-15 | Methods for performing multiplexed pcr |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662395325P | 2016-09-15 | 2016-09-15 | |
| US62/395,325 | 2016-09-15 | ||
| US201662435595P | 2016-12-16 | 2016-12-16 | |
| US62/435,595 | 2016-12-16 | ||
| US201762536871P | 2017-07-25 | 2017-07-25 | |
| US62/536,871 | 2017-07-25 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018050824A1 true WO2018050824A1 (en) | 2018-03-22 |
Family
ID=59901522
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2017/073288 Ceased WO2018050824A1 (en) | 2016-09-15 | 2017-09-15 | Methods for performing multiplexed pcr |
| PCT/EP2017/073293 Ceased WO2018050828A1 (en) | 2016-09-15 | 2017-09-15 | Methods for performing multiplexed real-time pcr |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2017/073293 Ceased WO2018050828A1 (en) | 2016-09-15 | 2017-09-15 | Methods for performing multiplexed real-time pcr |
Country Status (10)
| Country | Link |
|---|---|
| US (3) | US11034997B2 (enExample) |
| EP (2) | EP3512959B1 (enExample) |
| JP (2) | JP7063886B2 (enExample) |
| KR (2) | KR102468174B1 (enExample) |
| CN (2) | CN109689884A (enExample) |
| AU (2) | AU2017328613B2 (enExample) |
| CA (2) | CA3033250C (enExample) |
| DK (1) | DK3512959T3 (enExample) |
| ES (2) | ES2933176T3 (enExample) |
| WO (2) | WO2018050824A1 (enExample) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020031156A1 (en) | 2018-08-09 | 2020-02-13 | Speedx Pty Ltd | Multiplex detection of nucleic acids |
| EP4172355A4 (en) * | 2020-06-30 | 2024-09-25 | SpeeDx Pty Ltd | MULTIPLEX DETECTION OF NUCLEIC ACIDS USING MIXED REPORTERS |
Families Citing this family (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022269023A1 (en) | 2021-06-25 | 2022-12-29 | F. Hoffmann-La Roche Ag | Methods for performing temperature multiplexed pcr with increased sensitivity |
| JP7063886B2 (ja) | 2016-09-15 | 2022-05-09 | エフ.ホフマン-ラ ロシュ アーゲー | マルチプレックスリアルタイムpcrを実施する方法 |
| RU2665631C2 (ru) * | 2017-01-25 | 2018-09-03 | Общество с ограниченной ответственностью "Секвойя Дженетикс" | Способ специфической идентификации последовательностей днк |
| US20190093155A1 (en) * | 2017-05-25 | 2019-03-28 | Roche Molecular Systems, Inc. | Multiplex Nucleic Acid Amplification Assay |
| CN111629831A (zh) | 2018-01-22 | 2020-09-04 | 卢米耐克斯公司 | 用于离散解链分析的方法和组合物 |
| US20190292596A1 (en) | 2018-03-21 | 2019-09-26 | Roche Molecular Systems, Inc. | Modified nucleoside phosphates with high thermal stability |
| AU2019255933B2 (en) | 2018-04-20 | 2022-08-25 | Seegene, Inc. . | Method and apparatus for detecting a plurality of target nucleic acid sequences in sample |
| US11384376B2 (en) | 2018-05-31 | 2022-07-12 | Roche Molecular Systems, Inc. | Reagents and methods for post-synthetic modification of nucleic acids |
| US11371080B2 (en) | 2018-11-30 | 2022-06-28 | Luminex Corporation | Methods and probes for performing PCR with melt analysis for increased multiplexing |
| EP3899035B1 (en) * | 2018-12-20 | 2025-04-16 | F. Hoffmann-La Roche AG | Detection of target nucleic acid by solid-phase molography |
| US11441167B2 (en) | 2019-11-20 | 2022-09-13 | Roche Molecular Systems, Inc. | Compositions and methods for rapid identification and phenotypic antimicrobial susceptibility testing of bacteria and fungi |
| CN114787286A (zh) | 2019-12-09 | 2022-07-22 | 豪夫迈·罗氏有限公司 | 双阳离子荧光染料 |
| CN111534518B (zh) * | 2020-05-18 | 2021-07-23 | 纳昂达(南京)生物科技有限公司 | 通用封闭序列及其应用 |
| CN112195221B (zh) * | 2020-09-13 | 2021-08-06 | 武汉纳诺德医疗科技有限公司 | 一种多温度单荧光通道多重实时荧光定量pcr仪及其检测方法 |
| AU2021343471A1 (en) * | 2020-09-16 | 2023-05-04 | Bruker Spatial Biology, Inc. | Chemical compositions and methods of using the same |
| JP2024500169A (ja) | 2020-12-22 | 2024-01-04 | エフ. ホフマン-ラ ロシュ アーゲー | 大ストークスシフト蛍光色素を使用して多重化リアルタイムpcrを行うための方法 |
| JP7641445B2 (ja) | 2021-09-30 | 2025-03-06 | ジェン-プローブ・インコーポレーテッド | 温度で選択可能なfretカセットシグナル伝達 |
| WO2024002924A2 (en) | 2022-06-28 | 2024-01-04 | F. Hoffmann-La Roche Ag | Fluorescent dyes with large stokes shift |
| WO2024106890A1 (ko) * | 2022-11-16 | 2024-05-23 | 주식회사 씨젠 | 퀀칭-pto 절단 및 연장(quenching-pto cleavage and extension; q-ptoce) 어세이에 의한 타겟 핵산의 검출 |
| AR132405A1 (es) * | 2023-04-19 | 2025-06-25 | Consejo Nacional De Investigaciones Cientificas Y Tecn Conicet | Métodos y sistemas para seleccionar biomarcadores basados en metilación del adn para la detección de cáncer colorrectal |
| AU2024220029A1 (en) * | 2023-05-15 | 2024-11-28 | Speedx Pty Ltd | Target detection using temperature controlled probes |
| WO2025053620A1 (ko) * | 2023-09-08 | 2025-03-13 | 주식회사 씨젠 | 3개의 프로브를 이용하여 타겟 핵산을 검출하는 방법 |
| WO2025141105A1 (en) | 2023-12-27 | 2025-07-03 | bioMérieux | Specific probes for the detection of nucleic acids, methods and uses |
| EP4606908A1 (en) | 2024-02-21 | 2025-08-27 | Roche Diagnostics GmbH | Method of increasing the number of usable channels in multiplex pcr |
Citations (35)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4889818A (en) | 1986-08-22 | 1989-12-26 | Cetus Corporation | Purified thermostable enzyme |
| US4965188A (en) | 1986-08-22 | 1990-10-23 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme |
| US5079352A (en) | 1986-08-22 | 1992-01-07 | Cetus Corporation | Purified thermostable enzyme |
| WO1992006200A1 (en) | 1990-09-28 | 1992-04-16 | F. Hoffmann-La-Roche Ag | 5' to 3' exonuclease mutations of thermostable dna polymerases |
| US5210015A (en) | 1990-08-06 | 1993-05-11 | Hoffman-La Roche Inc. | Homogeneous assay system using the nuclease activity of a nucleic acid polymerase |
| US5352600A (en) | 1986-08-22 | 1994-10-04 | Hoffmann-La Roche Inc. | Purified thermostable enzyme |
| US5405774A (en) | 1986-08-22 | 1995-04-11 | Hoffmann-La Roche Inc. | DNA encoding a mutated thermostable nucleic acid polymerase enzyme from thermus species sps17 |
| US5466591A (en) | 1986-08-22 | 1995-11-14 | Hoffmann-La Roche Inc. | 5' to 3' exonuclease mutations of thermostable DNA polymerases |
| US5491063A (en) | 1994-09-01 | 1996-02-13 | Hoffmann-La Roche Inc. | Methods for in-solution quenching of fluorescently labeled oligonucleotide probes |
| US5539082A (en) | 1993-04-26 | 1996-07-23 | Nielsen; Peter E. | Peptide nucleic acids |
| US5571673A (en) | 1994-11-23 | 1996-11-05 | Hoffmann-La Roche Inc. | Methods for in-solution quenching of fluorescently labeled oligonucleotide probes |
| WO1997009451A1 (en) | 1995-09-08 | 1997-03-13 | Life Technologies, Inc. | Cloned dna polymerases from thermotoga and mutants thereof |
| US5618711A (en) | 1986-08-22 | 1997-04-08 | Hoffmann-La Roche Inc. | Recombinant expression vectors and purification methods for Thermus thermophilus DNA polymerase |
| US5674738A (en) | 1986-08-22 | 1997-10-07 | Roche Molecular Systems, Inc. | DNA encoding thermostable nucleic acid polymerase enzyme from thermus species Z05 |
| US5795762A (en) | 1986-08-22 | 1998-08-18 | Roche Molecular Systems, Inc. | 5' to 3' exonuclease mutations of thermostable DNA polymerases |
| US5871908A (en) | 1992-02-05 | 1999-02-16 | Evotec Biosystems Gmbh | Process for the determination of in vitro amplified nucleic acids |
| US6174670B1 (en) | 1996-06-04 | 2001-01-16 | University Of Utah Research Foundation | Monitoring amplification of DNA during PCR |
| US6268490B1 (en) | 1997-03-07 | 2001-07-31 | Takeshi Imanishi | Bicyclonucleoside and oligonucleotide analogues |
| US6427156B1 (en) | 1997-01-21 | 2002-07-30 | Xilinx, Inc. | Configurable logic block with AND gate for efficient multiplication in FPGAS |
| US6472156B1 (en) | 1999-08-30 | 2002-10-29 | The University Of Utah | Homogeneous multiplex hybridization analysis by color and Tm |
| US6794499B2 (en) | 1997-09-12 | 2004-09-21 | Exiqon A/S | Oligonucleotide analogues |
| US20050053939A1 (en) | 2001-11-09 | 2005-03-10 | Ahmed Chenna | Methods and compositions for enhancing detection in determinations employing cleavable electrophoretic tag reagents |
| WO2008021446A2 (en) * | 2006-08-15 | 2008-02-21 | Genetag Technology, Inc. | Probe-antiprobe compositions and methods for dna or rna detection |
| WO2008104791A1 (en) * | 2007-03-01 | 2008-09-04 | Oxitec Limited | Methods for detecting nucleic acid sequences |
| WO2010013017A1 (en) * | 2008-07-31 | 2010-02-04 | Oxitec Limited | Multiplex amplification and detection |
| WO2010139937A1 (en) * | 2009-06-01 | 2010-12-09 | Oxitec Limited | Multiplex amplification and detection |
| US8133701B2 (en) | 2006-12-05 | 2012-03-13 | Sequenom, Inc. | Detection and quantification of biomolecules using mass spectrometry |
| WO2012067831A1 (en) * | 2010-11-15 | 2012-05-24 | Exact Sciences Corporation | Real time cleavage assay |
| US8809239B2 (en) | 2011-01-11 | 2014-08-19 | Seegene, Inc. | Detection of target nucleic acid sequences by PTO cleavage and extension assay |
| US20140272955A1 (en) | 2013-03-15 | 2014-09-18 | Roche Molecular Systems, Inc. | Nucleic acid target identification by strucutre based probe cleavage |
| US20150176075A1 (en) | 2013-12-20 | 2015-06-25 | Roche Molecular Systems, Inc. | Multiplexed nucleic acid target identification by strucutre based probe cleavage |
| US9107035B2 (en) | 2008-12-18 | 2015-08-11 | Verizon Patent And Licensing Inc. | Updating an operating parameter |
| US20150376681A1 (en) | 2013-03-15 | 2015-12-31 | Roche Molecular Systems, Inc. | Nucleic acid target identification by strucutre based probe cleavage |
Family Cites Families (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4250257A (en) * | 1978-08-24 | 1981-02-10 | Technicon Instruments Corporation | Whole blood analyses in porous media |
| US5541311A (en) | 1992-12-07 | 1996-07-30 | Third Wave Technologies, Inc. | Nucleic acid encoding synthesis-deficient thermostable DNA polymerase |
| US5843691A (en) * | 1993-05-15 | 1998-12-01 | Lifescan, Inc. | Visually-readable reagent test strip |
| US5538848A (en) | 1994-11-16 | 1996-07-23 | Applied Biosystems Division, Perkin-Elmer Corp. | Method for detecting nucleic acid amplification using self-quenching fluorescence probe |
| US7381532B2 (en) | 1999-10-29 | 2008-06-03 | Stratagene California | Compositions and methods for the detection of a nucleic acid using a cleavage reaction |
| US7585632B2 (en) * | 1999-10-29 | 2009-09-08 | Hologic, Inc. | Compositions and methods for the detection of a nucleic acid using a cleavage reaction |
| US6893819B1 (en) | 2000-11-21 | 2005-05-17 | Stratagene California | Methods for detection of a nucleic acid by sequential amplification |
| BRPI0613592A2 (pt) | 2005-07-20 | 2011-01-18 | Bayer Healthcare Llc | amperometria conectada por porta |
| US7833716B2 (en) * | 2006-06-06 | 2010-11-16 | Gen-Probe Incorporated | Tagged oligonucleotides and their use in nucleic acid amplification methods |
| WO2008046930A1 (en) * | 2006-10-20 | 2008-04-24 | Clondiag Gmbh | Assay devices and methods for the detection of analytes |
| US7902345B2 (en) | 2006-12-05 | 2011-03-08 | Sequenom, Inc. | Detection and quantification of biomolecules using mass spectrometry |
| WO2008083261A1 (en) | 2006-12-29 | 2008-07-10 | Applera Corporation | Systems and methods for detecting nucleic acids |
| US10150990B2 (en) | 2008-04-21 | 2018-12-11 | Roche Molecular Systems, Inc. | Ribonucleotide tag nucleic acid detection |
| US20120252015A1 (en) * | 2011-02-18 | 2012-10-04 | Bio-Rad Laboratories | Methods and compositions for detecting genetic material |
| KR101073875B1 (ko) * | 2008-11-28 | 2011-10-14 | 한국생명공학연구원 | 대장암 진단 마커 및 이를 이용한 대장암 진단방법 |
| US8039215B2 (en) * | 2009-03-10 | 2011-10-18 | Roche Molecular Systems, Inc. | Multiplex quantitative nucleic acid amplification and melting assay |
| KR101177320B1 (ko) * | 2010-02-26 | 2012-09-10 | 문우철 | Y형 프로브 및 이것의 변형형, 및 이를 이용한 dna 마이크로어레이, 키트 및 유전자 분석방법 |
| KR20130101952A (ko) * | 2012-02-02 | 2013-09-16 | 주식회사 씨젠 | Pto 절단과 연장-의존적 혼성화를 이용한 타겟 핵산서열의 검출 |
| US20140378327A1 (en) | 2013-06-19 | 2014-12-25 | Luminex Corporation | Real-time multiplexed hydrolysis probe assay using spectrally identifiable microspheres |
| WO2015147370A1 (en) | 2014-03-28 | 2015-10-01 | Seegene, Inc. | Detection of target nucleic acid sequences using different detection temperatures |
| KR102465287B1 (ko) | 2014-08-11 | 2022-11-09 | 루미넥스 코포레이션 | 핵산 검정에서 개선된 용융 판별 및 멀티플렉싱을 위한 프로브 |
| KR102016747B1 (ko) | 2014-12-09 | 2019-09-02 | 주식회사 씨젠 | 상이한 검출 온도 및 기준값을 사용한 타겟 핵산 서열의 검출 |
| KR102084405B1 (ko) | 2014-12-09 | 2020-03-04 | 주식회사 씨젠 | 타겟 핵산 서열에 대한 시그널의 구별 |
| JP2018500932A (ja) | 2014-12-22 | 2018-01-18 | アナーパ バイオテック エー/エス | 標的核酸のマルチプレックス検出のためのデュアルクエンチングアッセイ |
| US10590469B2 (en) * | 2016-09-15 | 2020-03-17 | Roche Molecular Svstems, Inc. | Methods for performing multiplexed real-time PCR in a self-contained nucleic acid analysis pouch |
| JP7063886B2 (ja) | 2016-09-15 | 2022-05-09 | エフ.ホフマン-ラ ロシュ アーゲー | マルチプレックスリアルタイムpcrを実施する方法 |
-
2017
- 2017-09-15 JP JP2019514212A patent/JP7063886B2/ja active Active
- 2017-09-15 CN CN201780056666.0A patent/CN109689884A/zh active Pending
- 2017-09-15 CA CA3033250A patent/CA3033250C/en active Active
- 2017-09-15 DK DK17768765.4T patent/DK3512959T3/da active
- 2017-09-15 WO PCT/EP2017/073288 patent/WO2018050824A1/en not_active Ceased
- 2017-09-15 CA CA3036119A patent/CA3036119C/en active Active
- 2017-09-15 ES ES17768768T patent/ES2933176T3/es active Active
- 2017-09-15 AU AU2017328613A patent/AU2017328613B2/en active Active
- 2017-09-15 JP JP2019514294A patent/JP7221199B2/ja active Active
- 2017-09-15 AU AU2017328617A patent/AU2017328617B2/en active Active
- 2017-09-15 CN CN201780056599.2A patent/CN109689889A/zh active Pending
- 2017-09-15 US US15/705,821 patent/US11034997B2/en active Active
- 2017-09-15 KR KR1020197007698A patent/KR102468174B1/ko active Active
- 2017-09-15 EP EP17768765.4A patent/EP3512959B1/en active Active
- 2017-09-15 ES ES17768765T patent/ES2893411T3/es active Active
- 2017-09-15 US US15/705,772 patent/US11028433B2/en active Active
- 2017-09-15 WO PCT/EP2017/073293 patent/WO2018050828A1/en not_active Ceased
- 2017-09-15 KR KR1020197007697A patent/KR102468633B1/ko active Active
- 2017-09-15 EP EP17768768.8A patent/EP3512960B1/en active Active
-
2021
- 2021-05-07 US US17/314,470 patent/US11345958B2/en active Active
Patent Citations (40)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4683202B1 (enExample) | 1985-03-28 | 1990-11-27 | Cetus Corp | |
| US4683195B1 (enExample) | 1986-01-30 | 1990-11-27 | Cetus Corp | |
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US5079352A (en) | 1986-08-22 | 1992-01-07 | Cetus Corporation | Purified thermostable enzyme |
| US4965188A (en) | 1986-08-22 | 1990-10-23 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme |
| US5618711A (en) | 1986-08-22 | 1997-04-08 | Hoffmann-La Roche Inc. | Recombinant expression vectors and purification methods for Thermus thermophilus DNA polymerase |
| US4889818A (en) | 1986-08-22 | 1989-12-26 | Cetus Corporation | Purified thermostable enzyme |
| US5795762A (en) | 1986-08-22 | 1998-08-18 | Roche Molecular Systems, Inc. | 5' to 3' exonuclease mutations of thermostable DNA polymerases |
| US5352600A (en) | 1986-08-22 | 1994-10-04 | Hoffmann-La Roche Inc. | Purified thermostable enzyme |
| US5405774A (en) | 1986-08-22 | 1995-04-11 | Hoffmann-La Roche Inc. | DNA encoding a mutated thermostable nucleic acid polymerase enzyme from thermus species sps17 |
| US5466591A (en) | 1986-08-22 | 1995-11-14 | Hoffmann-La Roche Inc. | 5' to 3' exonuclease mutations of thermostable DNA polymerases |
| US5674738A (en) | 1986-08-22 | 1997-10-07 | Roche Molecular Systems, Inc. | DNA encoding thermostable nucleic acid polymerase enzyme from thermus species Z05 |
| US5804375A (en) | 1990-08-06 | 1998-09-08 | Roche Molecular Systems, Inc. | Reaction mixtures for detection of target nucleic acids |
| US5210015A (en) | 1990-08-06 | 1993-05-11 | Hoffman-La Roche Inc. | Homogeneous assay system using the nuclease activity of a nucleic acid polymerase |
| US5487972A (en) | 1990-08-06 | 1996-01-30 | Hoffmann-La Roche Inc. | Nucleic acid detection by the 5'-3'exonuclease activity of polymerases acting on adjacently hybridized oligonucleotides |
| WO1992006200A1 (en) | 1990-09-28 | 1992-04-16 | F. Hoffmann-La-Roche Ag | 5' to 3' exonuclease mutations of thermostable dna polymerases |
| US5871908A (en) | 1992-02-05 | 1999-02-16 | Evotec Biosystems Gmbh | Process for the determination of in vitro amplified nucleic acids |
| US5539082A (en) | 1993-04-26 | 1996-07-23 | Nielsen; Peter E. | Peptide nucleic acids |
| US5491063A (en) | 1994-09-01 | 1996-02-13 | Hoffmann-La Roche Inc. | Methods for in-solution quenching of fluorescently labeled oligonucleotide probes |
| US5571673A (en) | 1994-11-23 | 1996-11-05 | Hoffmann-La Roche Inc. | Methods for in-solution quenching of fluorescently labeled oligonucleotide probes |
| WO1997009451A1 (en) | 1995-09-08 | 1997-03-13 | Life Technologies, Inc. | Cloned dna polymerases from thermotoga and mutants thereof |
| US6174670B1 (en) | 1996-06-04 | 2001-01-16 | University Of Utah Research Foundation | Monitoring amplification of DNA during PCR |
| US6245514B1 (en) | 1996-06-04 | 2001-06-12 | University Of Utah Research Foundation | Fluorescent donor-acceptor pair with low spectral overlap |
| US6427156B1 (en) | 1997-01-21 | 2002-07-30 | Xilinx, Inc. | Configurable logic block with AND gate for efficient multiplication in FPGAS |
| US6268490B1 (en) | 1997-03-07 | 2001-07-31 | Takeshi Imanishi | Bicyclonucleoside and oligonucleotide analogues |
| US6794499B2 (en) | 1997-09-12 | 2004-09-21 | Exiqon A/S | Oligonucleotide analogues |
| US6472156B1 (en) | 1999-08-30 | 2002-10-29 | The University Of Utah | Homogeneous multiplex hybridization analysis by color and Tm |
| US20050053939A1 (en) | 2001-11-09 | 2005-03-10 | Ahmed Chenna | Methods and compositions for enhancing detection in determinations employing cleavable electrophoretic tag reagents |
| WO2008021446A2 (en) * | 2006-08-15 | 2008-02-21 | Genetag Technology, Inc. | Probe-antiprobe compositions and methods for dna or rna detection |
| US8133701B2 (en) | 2006-12-05 | 2012-03-13 | Sequenom, Inc. | Detection and quantification of biomolecules using mass spectrometry |
| WO2008104791A1 (en) * | 2007-03-01 | 2008-09-04 | Oxitec Limited | Methods for detecting nucleic acid sequences |
| WO2010013017A1 (en) * | 2008-07-31 | 2010-02-04 | Oxitec Limited | Multiplex amplification and detection |
| US9107035B2 (en) | 2008-12-18 | 2015-08-11 | Verizon Patent And Licensing Inc. | Updating an operating parameter |
| WO2010139937A1 (en) * | 2009-06-01 | 2010-12-09 | Oxitec Limited | Multiplex amplification and detection |
| WO2012067831A1 (en) * | 2010-11-15 | 2012-05-24 | Exact Sciences Corporation | Real time cleavage assay |
| US8809239B2 (en) | 2011-01-11 | 2014-08-19 | Seegene, Inc. | Detection of target nucleic acid sequences by PTO cleavage and extension assay |
| US20140272955A1 (en) | 2013-03-15 | 2014-09-18 | Roche Molecular Systems, Inc. | Nucleic acid target identification by strucutre based probe cleavage |
| US20150376681A1 (en) | 2013-03-15 | 2015-12-31 | Roche Molecular Systems, Inc. | Nucleic acid target identification by strucutre based probe cleavage |
| US20150176075A1 (en) | 2013-12-20 | 2015-06-25 | Roche Molecular Systems, Inc. | Multiplexed nucleic acid target identification by strucutre based probe cleavage |
Non-Patent Citations (15)
| Title |
|---|
| "PCR Applications", 1999, ACADEMIC PRESS |
| "PCR Protocols", 1990, ACADEMIC PRESS |
| "PCR Strategies", 1995, ACADEMIC PRESS |
| "PCR Technology", 1989, STOCKTON PRESS |
| DERVAN, SCIENCE, vol. 232, 1986, pages 464 - 471 |
| HOLLAND ET AL., PROC. NATL. ACAD. SCI. USA, vol. 88, 1988, pages 7276 - 7280 |
| HUANG SHIHAI ET AL: "Thermodynamically modulated partially double-stranded linear DNA probe design for homogeneous real-time PCR", NUCLEIC ACIDS RESEARCH, INFORMATION RETRIEVAL LTD, vol. 35, no. 16, 1 January 2007 (2007-01-01), pages E101 - 1, XP002545144, ISSN: 0305-1048, [retrieved on 20070809], DOI: 10.1093/NAR/GKM551 * |
| IKEHARA ET AL., NUCLEIC ACIDS RES., vol. 5, 1978, pages 3315 |
| INNIS ET AL.: "PCR Protocols: A Guide to Methods and Applications", 1990 |
| INOUE ET AL., NUCLEIC ACIDS RES., vol. 15, 1987, pages 6131 |
| NORDLUND ET AL., J. BIOL. CHEM., vol. 278, no. 4, 2003, pages 2479 - 2483 |
| RAHMAN ET AL., J. AM. CHEM. SOC., vol. 130, no. 14, 2008, pages 4886 - 4896 |
| RIRIE ET AL.: "Product differentiation by analysis of DNA melting curves during the polymerase chain reaction", ANAL. BIOCHEM., vol. 245, 1997, pages 154 - 160, XP002996474, DOI: doi:10.1006/abio.1996.9916 |
| SPARANO ET AL.: "Development of the 21-gene assay and its application in clinical practice and clinical trials", J. CLIN. ONCOL., vol. 26, no. 5, 2008, pages 721 - 728, XP009132686 |
| WHITE ET AL., NATURE, vol. 391, 1998, pages 468 - 471 |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020031156A1 (en) | 2018-08-09 | 2020-02-13 | Speedx Pty Ltd | Multiplex detection of nucleic acids |
| EP3833778A4 (en) * | 2018-08-09 | 2022-12-07 | SpeeDx Pty Ltd | MULTIPLEX DETECTION OF NUCLEIC ACIDS |
| EP4172355A4 (en) * | 2020-06-30 | 2024-09-25 | SpeeDx Pty Ltd | MULTIPLEX DETECTION OF NUCLEIC ACIDS USING MIXED REPORTERS |
Also Published As
| Publication number | Publication date |
|---|---|
| CA3036119C (en) | 2022-09-20 |
| KR102468174B1 (ko) | 2022-11-17 |
| AU2017328613A1 (en) | 2019-03-07 |
| ES2893411T3 (es) | 2022-02-09 |
| CA3033250A1 (en) | 2018-03-22 |
| AU2017328613B2 (en) | 2023-05-18 |
| US11345958B2 (en) | 2022-05-31 |
| CA3033250C (en) | 2023-08-15 |
| CN109689884A (zh) | 2019-04-26 |
| JP7221199B2 (ja) | 2023-02-20 |
| EP3512959B1 (en) | 2021-08-11 |
| AU2017328617A1 (en) | 2019-02-28 |
| JP2019528726A (ja) | 2019-10-17 |
| CA3036119A1 (en) | 2018-03-22 |
| US20210269857A1 (en) | 2021-09-02 |
| JP2019532628A (ja) | 2019-11-14 |
| EP3512959A1 (en) | 2019-07-24 |
| US11034997B2 (en) | 2021-06-15 |
| EP3512960B1 (en) | 2022-10-19 |
| KR102468633B1 (ko) | 2022-11-18 |
| KR20190046881A (ko) | 2019-05-07 |
| DK3512959T3 (da) | 2021-10-18 |
| WO2018050828A1 (en) | 2018-03-22 |
| US20180073064A1 (en) | 2018-03-15 |
| US11028433B2 (en) | 2021-06-08 |
| EP3512960A1 (en) | 2019-07-24 |
| JP7063886B2 (ja) | 2022-05-09 |
| ES2933176T3 (es) | 2023-02-02 |
| US20180073056A1 (en) | 2018-03-15 |
| KR20190046880A (ko) | 2019-05-07 |
| CN109689889A (zh) | 2019-04-26 |
| AU2017328617B2 (en) | 2023-06-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11345958B2 (en) | Methods for performing multiplexed real-time PCR | |
| EP3268491B1 (en) | Methods, compositions and kits for small rna capture, detection and quantification | |
| US11198903B2 (en) | Methods for performing multiplexed real-time PCR | |
| EP3682030B1 (en) | Improved polynucleotide sequence detection method | |
| US20110117559A1 (en) | Small rna detection assays | |
| EP4359561A1 (en) | Methods for performing temperature multiplexed pcr with increased sensitivity | |
| CN102639719B (zh) | 用化学修饰的引物相比于DNA优先扩增mRNA | |
| US20250382664A1 (en) | Improved detection of lamp amplification products | |
| EP4453249A1 (en) | Improved detection of lamp amplification products | |
| US20220127665A1 (en) | Elimination probe-based method for detecting numerical chromosomal abnormalities, and nucleic acid composition for detecting numerical chromosomal abnormalities | |
| Whitcombe | 6 Using Scorpion Primers for Genotyping |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17768765 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2017328613 Country of ref document: AU Date of ref document: 20170915 Kind code of ref document: A Ref document number: 3036119 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2019514294 Country of ref document: JP Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 20197007698 Country of ref document: KR Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2017768765 Country of ref document: EP Effective date: 20190415 |