WO2017186813A1 - Treatment of canine atopic dermatitis - Google Patents

Treatment of canine atopic dermatitis Download PDF

Info

Publication number
WO2017186813A1
WO2017186813A1 PCT/EP2017/059977 EP2017059977W WO2017186813A1 WO 2017186813 A1 WO2017186813 A1 WO 2017186813A1 EP 2017059977 W EP2017059977 W EP 2017059977W WO 2017186813 A1 WO2017186813 A1 WO 2017186813A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
seq
acid sequence
cmv
vlp
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2017/059977
Other languages
English (en)
French (fr)
Inventor
Kaspars Tars
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Benchmark Animal Health Ltd
Original Assignee
Benchmark Animal Health Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US16/097,156 priority Critical patent/US10946078B2/en
Priority to AU2017256727A priority patent/AU2017256727B2/en
Priority to CA3019653A priority patent/CA3019653A1/en
Priority to BR112018071965A priority patent/BR112018071965A2/pt
Priority to EP17723294.9A priority patent/EP3448422A1/en
Priority to CN201780025651.8A priority patent/CN109562156B/zh
Priority to NZ747512A priority patent/NZ747512A/en
Priority to UAA201809978A priority patent/UA126852C2/uk
Priority to CN202310179224.2A priority patent/CN116688110A/zh
Priority to KR1020187031190A priority patent/KR102469478B1/ko
Priority to EA201892003A priority patent/EA201892003A1/ru
Application filed by Benchmark Animal Health Ltd filed Critical Benchmark Animal Health Ltd
Priority to JP2019508291A priority patent/JP7039561B2/ja
Priority to KR1020227040222A priority patent/KR20220162800A/ko
Priority to MX2018012973A priority patent/MX394254B/es
Publication of WO2017186813A1 publication Critical patent/WO2017186813A1/en
Priority to ZA2018/06503A priority patent/ZA201806503B/en
Priority to CONC2018/0011087A priority patent/CO2018011087A2/es
Anticipated expiration legal-status Critical
Priority to JP2022036245A priority patent/JP7273214B2/ja
Priority to AU2022291431A priority patent/AU2022291431B2/en
Priority to AU2026202093A priority patent/AU2026202093A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/385Haptens or antigens, bound to carriers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0008Antigens related to auto-immune diseases; Preparations to induce self-tolerance
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/35Allergens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C07K14/08RNA viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/244Interleukins [IL]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515Animal cells
    • A61K2039/5158Antigen-pulsed cells, e.g. T-cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5256Virus expressing foreign proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5258Virus-like particles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/55Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552Veterinary vaccine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/58Medicinal preparations containing antigens or antibodies raising an immune response against a target which is not the antigen used for immunisation
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/60Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6031Proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/00022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/00023Virus like particles [VLP]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/00034Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/16011Orthomyxoviridae
    • C12N2760/16034Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/14011Bromoviridae
    • C12N2770/14022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/14011Bromoviridae
    • C12N2770/14023Virus like particles [VLP]

Definitions

  • the present invention relates to compositions, immunogenic or vaccine compositions and pharmaceutical compositions for the prevention or treatment of canine atopic dermatitis (CAD). Furthermore, the invention provides methods for preventing or treating CAD.
  • the compositions of the invention induce efficient immune responses, in particular antibody responses, in dogs and are, therefore, useful for the treatment and/or prevention of CAD.
  • Canine atopic dermatitis is defined as an inflammatory and pruritic allergic skin disease caused by an interaction between genetic and environmental factors and affects up to 10% of all canines (Hensel P et al, (2015) BMC Veterinary Research 11 : 196-209; Meury S et al, (201 1) Vet Dermatol 22: 327-334; Nodtvedt A, et al, (2007) Prev Vet Med 78: 210-222). It is the second most common allergic skin condition in canidae, in particular domestic dogs, surpassed only by flea allergies.
  • the allergic symptoms appear as eczematous skin and canidae such as domestic dogs with atopic dermatitis often suffer from pruritus, or severe itching, hair loss, excoriation of the skin from deep scratching, frequent licking of their paws and excessive tear production. Secondary skin problems are also common, including skin infections and excessive sebum discharge.
  • Clinical signs usually develop at a young age and the peak age of onset is typically between six months and three years. Face, ears, paws, extremities, ventrum and flex-zones are typically affected by pruritus and erythema (Griffin CE, DeBoer DJ (2001) Veterinary Immunology and Immunopathology 81 : 255-269). It is typically a chronic relapsing condition and most dogs will require ongoing, usually life-long, therapy (Nuttall T., et al, Veterinary Record (2014) 174 (suppl 2), 3-12).
  • the present invention provides for compositions for the prevention and treatment of atopic dermatitis in canidae, including and preferably of domestic dogs (Canis lupus familiaris or Canis familiaris), and other members of the family.
  • the present invention provides for compositions and its uses for prevention and treatment of canine atopic dermatitis (CAD), wherein preferred inventive compositions comprise canine Interleukin-31 antigen (cIL-31 antigen) displayed on virus-like particles of plant virus Cucumber Mosaic Virus (CMV) modified by incorporation of Th cell epitopes, in particular universal Th cell epitopes.
  • CMV Cucumber Mosaic Virus
  • these modified VLPs serve as vaccines for generating immune responses, in particular antibody responses, against cIL-31.
  • the presence of the Th cell epitopes, in particular universal Th cell epitopes leads to a further increase in the generated immune response and, thus, the beneficial effect for the prevention and treatment of CAD.
  • the administration of the compositions of the present invention to canidae, in particular domestic dogs leads to an efficient reduction of CAD disease parameters and symptoms.
  • the administration of the compositions of the present invention to canidae, in particular domestic dogs not only leads to the induction of auto-antibodies and reduction of interleukin 31 levels in blood and skin of the canidae, in particular domestic dogs, but furthermore said reduction of cIL-31 levels correlates with reduction of CAD disease symptoms.
  • the administration of the compositions of the present invention to canidae, in particular domestic dogs leads to reduced itching and an efficient reduction of the severity grade of skin lesions of the dogs affected with CAD.
  • Treatment in accordance with the invention results in a lowering of the Atopic
  • ADLI Dermatitis Lesion Index
  • Pruritus Visual Analog Score or PVAS in treated canidae, in particular domestic dogs.
  • the ADLI score is a validated composite index of six clinical symptoms associated with canine atopic dermatitis evaluated in five specified body regions. At each specified body region, each parameter is scored by the scorer from zero to five, with a score of zero defined as no lesion and a score of five defined as a severe/extensive lesions.
  • PVAS is scored by the scorer using a zero to ten analog scale, with a score of zero representing no pruritus/chewing and a score of ten equating to inceimpuls and intense pruritus/ chewing .
  • the present invention is believed to impact on CAD which is considered to be a multifaceted disease. It is believed that in CAD, the combination of Th2 polarization and microbial presence may lead to cIL-31 mediated effects driving inflammation and pruritus by immune cells, keratinocytes, and direct neuronal stimulation causing itching.
  • the induced auto-antibodies to cIL-31 by the compositions and methods of the present invention in canidae such as and in particular domestic dogs, thus, reduce the levels of cIL-31 and thus, have a positive impact on CAD by reducing itching and consequently scratching of the dog, inhibiting all the down-stream events of scratching, including inflammation and infection.
  • the present invention provides for a composition for use in a method of preventing or treating canine atopic dermatitis (CAD) of a canidae, preferably of a domestic dog, wherein an effective amount of said composition is administered to said canidae, preferably to said domestic dog, and wherein said composition comprises (a) a core particle with at least one first attachment site; and (b) at least one canine Interleukin-31 antigen (cIL-31 antigen) with at least one second attachment site, wherein said cIL-31 antigen comprises, or preferably consists of, a protein with the amino sequence selected from SEQ ID NO:22 or a protein with an amino acid sequence of at least 90%, preferably of at least 92 %, further preferably of at least 95%, and again further preferably of at least 98% amino acid sequence identity with SEQ ID NO:22; wherein (a) and (b) are linked through said at least one first and said at least one second attachment site via at least one non-
  • said core particle is a virus-like particle (VLP), preferably a recombinant VLP.
  • VLP is a modified VLP of cucumber mosaic virus (CMV), wherein said modified VLP of CMV comprises, essentially consists of, or alternatively consists of, at least one modified CMV polypeptide, wherein said modified CMV polypeptide comprises, or preferably consists of, (a) a CMV polypeptide, and (b) a T helper cell epitope; and wherein said CMV polypeptide comprises, or preferably consists of, (i) an amino acid sequence of a coat protein of CMV; or (ii) a mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of a coat protein of CMV, and wherein said mutated amino acid sequence and said coat protein of CMV show a sequence identity of at least 90 %, preferably of at least 95%, further preferably of at least 98% and again more
  • said CMV polypeptide comprises, or preferably consists of, (a) an amino acid sequence of a coat protein of CMV, wherein said amino acid sequence comprises, or preferably consists of, SEQ ID NO: l or (b) an amino acid sequence having a sequence identity of at least 90 % of SEQ ID NO : 1 ; and wherein said amino sequence as defined in (a) or (b) in this claim comprises SEQ ID NO:23; or wherein said amino sequence as defined in
  • VLP is a modified VLP of cucumber mosaic virus (CMV), wherein said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO:6 or SEQ ID NO:7.
  • CMV cucumber mosaic virus
  • said at least one cIL-31 antigen comprises, or preferably consists of, a protein with the amino sequence selected from: (a) SEQ ID NO: 18;
  • said at least one cIL-31 antigen comprises, or preferably consists of, a protein with the amino sequence selected from: (a) SEQ ID NO: 18; (b) SEQ ID NO:21; (c) SEQ ID NO:22; (d) SEQ ID NO:25 or (e) SEQ ID NO:26.
  • said second attachment site is a sulfhydryl group, and wherein preferably said sulfhydryl group is derived from reaction of said cIL-31 antigen with N-succinimidyl S-acetylthioacetate (SAT A).
  • said second attachment site is a sulfhydryl group, and wherein preferably said sulfhydryl group is derived from reaction of a lysine residue of said cIL-31 antigen.
  • the present invention provides for an immunogenic or vaccine composition
  • an immunogenic or vaccine composition comprising an effective amount of said composition of the invention, wherein preferably said immunogenic or vaccine composition further comprises an adjuvant.
  • the present invention provides for a pharmaceutical composition comprising: (a) the inventive composition or the inventive immunogenic or vaccine composition; and (b) a pharmaceutically acceptable carrier.
  • the present invention provides for a method of immunization, wherein said method comprises administering the inventive composition, the inventive immunogenic or vaccine composition or the inventive pharmaceutical composition to human.
  • the present invention provides for the inventive composition, the inventive immunogenic or vaccine composition, or the inventive pharmaceutical composition for use as a medicament.
  • the present invention provides for the inventive composition, the inventive immunogenic or vaccine composition, or the inventive pharmaceutical composition for use in a method of prevention or treatment of canine atopic dermatitis (CAD) of a domestic dog, wherein an effective amount of said inventive composition, said inventive immunogenic or vaccine composition, or said inventive pharmaceutical composition is administered to said domestic dog.
  • said administration of said inventive composition, said inventive immunogenic or vaccine composition, or said inventive pharmaceutical composition reduces at least one symptom of said canine atopic dermatitis (CAD) when compared to the at least one symptom before said administration.
  • the present invention provides for a method of prevention or treatment of canine atopic dermatitis (CAD) of a domestic dog, wherein said method comprises administering an effective amount of said inventive composition, said inventive immunogenic or vaccine composition, or said inventive pharmaceutical composition to said domestic dog.
  • CAD canine atopic dermatitis
  • the present invention provides for the use of said inventive composition, said inventive immunogenic or vaccine composition, or said inventive pharmaceutical composition for the manufacture of a medicament for the prevention or treatment of canine atopic dermatitis (CAD) of a domestic dog, wherein typically and preferably an effective amount of said inventive composition, said inventive immunogenic or vaccine composition, or said inventive pharmaceutical composition is administered to said domestic dog.
  • inventive composition said inventive immunogenic or vaccine composition, or said inventive pharmaceutical composition for the manufacture of a medicament for the prevention or treatment of canine atopic dermatitis (CAD) of a domestic dog, wherein typically and preferably an effective amount of said inventive composition, said inventive immunogenic or vaccine composition, or said inventive pharmaceutical composition is administered to said domestic dog.
  • CAD canine atopic dermatitis
  • the present invention provides for a composition for use in a method of preventing or treating canine atopic dermatitis (CAD) of a domestic dog, wherein an effective amount of said composition is administered to said domestic dog, and wherein said composition comprises (a) a core particle with at least one first attachment site, wherein said core particle is preferably a virus-like particle (VLP), further preferably a recombinant VLP; and (b) at least one canine Interleukin-31 antigen (cIL- 31 antigen) with at least one second attachment site, wherein said cIL-31 antigen comprises, or preferably consists of, a protein with the amino sequence selected from SEQ ID NO:22 or a protein with an amino acid sequence of at least 90%, preferably of at least 92 %, further preferably of at least 95%, and again further preferably of at least 98% amino acid sequence identity with SEQ ID NO:22; wherein (a) and (b) are linked through said at least one first and said at
  • the present invention provides for a composition
  • a composition comprising (a) a virus-like particle (VLP) with at least one first attachment site; (b) at least one canine Interleukin-31 antigen (cIL-31 antigen) with at least one second attachment site, wherein said cIL-31 antigen comprises, or preferably consists of, a protein with the amino sequence selected from SEQ ID NO:22 or a protein with an amino acid sequence of at least 90%, preferably of at least 92 %, further preferably of at least 95%, and again further preferably of at least 98% amino acid sequence identity with SEQ ID NO:22, and again further preferably said antigen comprises, or preferably consists of a protein with the amino sequence of SEQ ID NO:22; wherein (a) and (b) are linked through said at least one first and said at least one second attachment site via at least one non-peptide covalent bond.
  • VLP virus-like particle
  • cIL-31 antigen canine Interleukin-31 antigen
  • said VLP is a modified VLP of cucumber mosaic virus (CMV), wherein said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO:6 or SEQ ID NO:7.
  • CMV cucumber mosaic virus
  • said at least one cIL-31 antigen comprises, or preferably consists of, a protein with the amino sequence selected from: (a) SEQ ID NO: 18; (b) SEQ ID NO:21; (c) SEQ ID NO:22; or (d) SEQ ID NOs:25-30.
  • said at least one cIL-31 antigen comprises, or preferably consists of, a protein with the amino sequence selected from: (a) SEQ ID NO: 18; (b) SEQ ID NO:21; (c) SEQ ID NO:22; (d) SEQ ID NO:25 or (e) SEQ ID NO:26.
  • said second attachment site is a sulfhydryl group, and wherein preferably said sulfhydryl group is derived from reaction of said cIL-31 antigen with N-succinimidyl S-acetylthioacetate (SAT A).
  • said second attachment site is a sulfhydryl group, and wherein preferably said sulfhydryl group is derived from reaction of a lysine residue of said cIL-31 antigen.
  • FIG. 1 pET-CMVwt plasmid map. The relative positions of relevant genes and restriction enzyme sites are denoted.
  • FIG. 2A Dynamic light scattering of purified CMVwt VLPs. The size of particles was detected by using Zetasizer Nano ZS (Malvern Instruments Ltd., United
  • FIG. 2B Electron-microscopy analysis of purified CMVwt VLPs.
  • JEM-1230 electron microscope Jeol Ltd., Tokyo, Japan
  • FIG. 3 Mass spectrometric analysis of purified CMV-derived VLPs.
  • Matrix- assisted laser desorption/ionization (MALDI)-TOF MS analysis was carried out on an Autoflex MS (Bruker Daltonik, Germany).
  • the protein molecular mass (MM) calibration standard II 22.3-66.5 kDa; Bruker Daltonik was used for mass determination.
  • FIG. 4A Dynamic light scattering of purified CMV-Ntt830 VLPs. The size of particles was detected by using Zetasizer Nano ZS (Malvern Instruments).
  • FIG. 4B Electron-microscopy analysis of purified CMV-Ntt830 VLPs.
  • JEM-1230 electron microscope Jeol
  • FIG. 5A Dynamic light scattering of purified CMV-Npadr VLPs. The size of particles was detected by using Zetasizer Nano ZS (Malvern Instruments).
  • FIG. 5B Electron-microscopy analysis of purified CMV-Npadr VLPs.
  • JEM-1230 electron microscope Jeol
  • FIG. 6 Production of cIL-31 with 6xHis tag and C-terminal cysteine in E.coli. Lane
  • FIG. 7 Purification of cIL-31 with 6xHis tag and C-terminal cysteine.
  • FIG. 8A Refolding of cIL-31 with 6xHis tag and C-terminal cysteine. Lane 1- marker, lane 2 - insoluble fraction after refolding, lane 3 - soluble fraction after refolding.
  • FIG. 8B Gel filtration profile of refolded cIL-31 with 6xHis tag and C-terminal cysteine. The peak corresponds to the void volume of column, indicating that material is aggregated.
  • FIG. 9 Production of native recombinant canine cIL-31.
  • Lane 1 - total cell lysate before induction lane 2 - total cell lysate after induction, lane 3 - marker.
  • Position of cIL-31 protein is indicated with arrow.
  • FIG. 10A Purification of refolded native recombinant cIL-31 on gel- filtration column.
  • Protein is eluted much later than column void volume, indicating that material has not aggregated.
  • FIG. 10B Analysis of peak fractions on SDS-PAGE
  • FIG. 11 SDS-PAGE electrophoresis analysis of cIL-31 coupled to CMV VLPs. Lane
  • FIG. 12 Electron microscopy of CMV-Ntt830 VLPs and the same VLPs with coupled cIL-31.
  • FIG. 13A Vaccination against cIL-31 strongly reduces scratching in immunized allergic dogs. Scratching over 6 hours after challenge with house dust mite extract before and after vaccination.
  • FIG. 13B Correlation of lack of scratching with induction of cIL-31 specific antibodies.
  • virus-like particle refers to a non-replicative or non-infectious, preferably a non-replicative and non-infectious virus particle, or refers to a non-replicative or non-infectious, preferably a non-replicative and noninfectious structure resembling a virus particle, preferably a capsid of a virus.
  • non- replicative refers to being incapable of replicating the genome comprised by the VLP.
  • non- infectious refers to being incapable of entering the host cell.
  • a virus-like particle in accordance with the invention is non-replicative and noninfectious since it lacks all or part of the viral genome or genome function.
  • a virus-like particle in accordance with the invention may contain nucleic acid distinct from their genome.
  • Recombinantly produced virus-like particles typically contain host cell derived RNA.
  • a typical and preferred embodiment of a virus-like particle in accordance with the present invention is a viral capsid composed of polypeptides of the invention.
  • a virus-like particle is typically a macromolecular assembly composed of viral coat protein which typically comprises 60, 120, 180, 240, 300, 360, or more than 360 protein subunits per virus-like particle. Typically and preferably, the interactions of these subunits lead to the formation of viral capsid or viral-capsid like structure with an inherent repetitive organization.
  • One feature of a virus-like particle is its highly ordered and repetitive arrangement of its subunits.
  • virus-like particle of CMV refers to a virus-like particle comprising, or preferably consisting essentially of, or preferably consisting of at least one CMV polypeptide.
  • a virus-like particle of CMV comprises said CMV polypeptide as the major, and even more preferably as the sole protein component of the capsid structure.
  • virus-like particles of CMV resemble the structure of the capsid of CMV.
  • Virus-like particles of CMV are non-replicative and/or non-infectious, and lack at least the gene or genes encoding for the replication machinery of the CMV, and typically also lack the gene or genes encoding the protein or proteins responsible for viral attachment to or entry into the host.
  • This definition includes also virus-like particles in which the aforementioned gene or genes are still present but inactive.
  • Preferred methods to render a virus-like particle of CMV non replicative and/or non- infectious is by physical or chemical inactivation, such as UV irradiation, formaldehyde treatment.
  • VLPs of CMV lack the gene or genes encoding for the replication machinery of the CMV, and also lack the gene or genes encoding the protein or proteins responsible for viral attachment to or entry into the host.
  • non- replicative and/or non-infectious virus-like particles are obtained by recombinant gene technology.
  • Recombinantly produced virus-like particles of CMV according to the invention typically and preferably do not comprise the viral genome.
  • Virus-like particles comprising more than one species of polypeptides, often referred to as mosaic VLPs are also encompassed by the invention.
  • the virus-like particle according to the invention comprises at least two different species of polypeptides, wherein at least one of said species of polypeptides is a CMV polypeptide.
  • a VLP of CMV is a macro molecular assembly composed of CMV coat protein which typically comprises 180 coat protein subunits per VLP.
  • a VLP of CMV as used herein, comprises, essentially consists of, or alternatively consists of, at least one CMV polypeptide comprising or preferably consisting of (i) an amino acid sequence of a coat protein of CMV; or (ii) a mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of a coat protein of CMV, and wherein said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 90 %, preferably of at least 95%, further preferably of at least 98% and again more preferably of at least 99%.
  • Polypeptide refers to a polymer composed of amino acid monomers which are linearly linked by peptide bonds (also known as amide bonds).
  • polypeptide refers to a consecutive chain of amino acids and does not refer to a specific length of the product. Thus, peptides, and proteins are included within the definition of polypeptide.
  • CMV polypeptide refers to a polypeptide comprising or preferably consisting of: (i) an amino acid sequence of a coat protein of cucumber mosaic virus (CMV), or (ii) a mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of a coat protein of CMV, and wherein said mutated amino acid sequence and said amino acid sequence to be mutated, i.e. said coat protein of CMV, show a sequence identity of at least 90 %, preferably of at least 95%, further preferably of at least 98% and again more preferably of at least 99%.
  • the CMV polypeptide is capable of forming a virus-like particle of CMV upon expression by self-assembly.
  • Coat protein (CP) of cucumber mosaic virus (CMV) The term "coat protein (CP) of cucumber mosaic virus (CMV)", as used herein, refers to a coat protein of the cucumber mosaic virus which occurs in nature. Due to extremely wide host range of the cucumber mosaic virus, a lot of different strains and isolates of CMV are known and the sequences of the coat proteins of said strains and isolates have been determined and are, thus, known to the skilled person in the art as well. The sequences of said coat proteins (CPs) of CMV are described in and retrievable from the known databases such as Genbank, www.dpyweb.net, or www.ncbi.nlm.nih.gov/protein/. Examples are described in EP Application No. 14189897.3.
  • CMV coat proteins are provided in SEQ ID NOs 1-3. It is noteworthy that these strains and isolates have highly similar coat protein sequences at different protein domains, including the N-terminus of the coat protein. In particular, 98.1% of all completely sequenced CMV isolates share more than 85% sequence identity within the first 28 amino acids of their coat protein sequence, and still 79.5% of all completely sequenced CMV isolates share more than 90% sequence identity within the first 28 amino acids of their coat protein sequence.
  • the coat protein of CMV used for the present invention is capable of forming a virus-like particle of CMV upon expression by self-assembly.
  • the coat protein of CMV used for the present invention is capable of forming a virus-like particle of CMV upon expression by self-assembly in E.coli.
  • Modified virus-like particle (VLP) of cucumber mosaic virus (CMV) refers to a VLP of CMV which is a modified one in such as it comprises, or preferably consists essentially of, or preferably consists of at least one modified CMV polypeptide, wherein said modified CMV polypeptide comprises, or preferably consists of, a CMV polypeptide, and a T helper cell epitope.
  • said T helper cell epitope (i) is fused to the N- terminus of said CMV polypeptide, (ii) is fused to the C-terminus of said CMV polypeptide, (iii) replaces a region of consecutive amino acids of said CMV polypeptide, wherein the sequence identity between said replaced region of consecutive amino acids of said CMV polypeptide and the T helper cell epitope is at least 15%, preferably at least 20%, or (iv) replaces a N-terminal region of said CMV polypeptide, and wherein said replaced N-terminal region of said CMV polypeptide consists of 5 to 15 consecutive amino acids.
  • said T helper cell epitope replaces a N-terminal region of said CMV polypeptide, and wherein said replaced N-terminal region of said CMV polypeptide consists of 5 to 15 consecutive amino acids, preferably of 9 to 14 consecutive amino acids, more preferably of 11 to 13 consecutive amino acids, and most preferably of 11, 12 or 13 consecutive amino acids.
  • said modified VLP of CMV of the present invention is a recombinant modified VLP of CMV.
  • Modified CMV polypeptide refers to a CMV polypeptide modified in such as defined herein, that said modified CMV polypeptide comprises, or preferably consists of, a CMV polypeptide, and a T helper cell epitope.
  • the modified CMV polypeptide is capable of forming a virus-like particle of CMV upon expression by self-assembly.
  • the modified CMV polypeptide is a recombinant modified CMV polypeptide and is capable of forming a virus-like particle of CMV upon expression by self-assembly in E.coli.
  • N-terminal region of the CMV polypeptide refers either to the N-terminus of said CMV polypeptide, and in particular to the N-terminus of a coat protein of CMV, or to the region of the N-terminus of said CMV polypeptide or said coat protein of CMV but starting with the second amino acid of the N-terminus of said CMV polypeptide or said coat protein of CMV if said CMV polypeptide or said coat protein comprises a N-terminal methionine residue.
  • the start-codon encoding methionine will usually be deleted and added to the N-terminus of the Th cell epitope.
  • one, two or three additional amino acids, preferably one amino acid may be optionally inserted between the stating methionine and the Th cell epitope for cloning purposes.
  • 'TNf-terminal region of the mutated amino acid sequence of a CMV polypeptide or a CMV coat protein refers either to the N-terminus of said mutated amino acid sequence of said CMV polypeptide or said coat protein of CMV, or to the region of the N-terminus of said mutated amino acid sequence of said CMV polypeptide or said coat protein of CMV but starting with the second amino acid of the N-terminus of said mutated amino acid sequence of said CMV polypeptide or said coat protein of CMV if said mutated amino acid sequence comprises a N- terminal methionine residue.
  • the start-codon encoding methionine will usually be deleted and added to the N-terminus of the Th cell epitope.
  • one, two or three additional amino acids, preferably one amino acid may be optionally inserted between the stating methionine and the Th cell epitope for cloning purposes.
  • Recombinant polypeptide refers to a polypeptide which is obtained by a process which comprises at least one step of recombinant DNA technology.
  • a recombinant polypeptide is produced in a prokaryotic expression system. It is apparent for the artisan that recombinantly produced polypeptides which are expressed in a prokaryotic expression system such as E. coli may comprise an N-terminal methionine residue. The N-terminal methionine residue is typically cleaved off the recombinant polypeptide in the expression host during the maturation of the recombinant polypeptide.
  • a preparation of a recombinant polypeptide may comprise a mixture of otherwise identical polypeptides with and without an N-terminal methionine residue.
  • a preparation of a recombinant polypeptide comprises less than 10 %, more preferably less than 5 %, and still more preferably less than 1 % recombinant polypeptide with an N-terminal methionine residue.
  • Recombinant CMV polypeptide refers to a
  • CMV polypeptide as defined above which is obtained by a process which comprises at least one step of recombinant DNA technology.
  • a preparation of a recombinant CMV polypeptide comprises less than 10 %, more preferably less than 5 %, and still more preferably less than 1 % recombinant CMV polypeptide with an N-terminal methionine residue. Consequently, a recombinant virus-like particle of the invention may comprise otherwise identical recombinant polypeptides with and without an N-terminal methionine residue.
  • Recombinant modified CMV polypeptide refers to a modified CMV polypeptide as defined above which is obtained by a process which comprises at least one step of recombinant DNA technology.
  • a preparation of a recombinant modified CMV polypeptide comprises less than 10 %, more preferably less than 5 %, and still more preferably less than 1 % recombinant modified CMV polypeptide with an N-terminal methionine residue. Consequently, a recombinant virus-like particle of the invention may comprise otherwise identical recombinant polypeptides with and without an N-terminal methionine residue.
  • Recombinant virus-like particle refers to a virus-like particle (VLP) which is obtained by a process which comprises at least one step of recombinant DNA technology.
  • a recombinant virus-like particle comprises at least one recombinant polypeptide, preferably a recombinant CMV polypeptide or recombinant modified CMV polypeptide.
  • a recombinant virus-like particle is composed of or consists of recombinant CMV polypeptides or recombinant modified CMV polypeptides.
  • inventive recombinant VLPs are effected with reference to specific amino acid sequences comprising a N-terminal methionine residue
  • the scope of these inventive recombinant VLPs encompass the VLPs formed by said specific amino acid sequences without said N-terminal methionine residue but as well, even though typically in a minor amount as indicated herein, the VLPs formed by said specific amino acid sequences with said N-terminal methionine.
  • inventive recombinant VLPs are effected with reference to specific amino acid sequences comprising a N-terminal methionine residue VLPs are encompassed comprising both amino acid sequences comprising still said N-terminal methionine residue and amino acid sequences lacking the N-terminal methionine residue.
  • Mutated amino acid sequence refers to an amino acid sequence which is obtained by introducing a defined set of mutations into an amino acid sequence to be mutated.
  • said amino acid sequence to be mutated typically and preferably is an amino acid sequence of a coat protein of CMV.
  • a mutated amino acid sequence differs from an amino acid sequence of a coat protein of CMV in at least one amino acid residue, wherein said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 90 %.
  • said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 91 %, 92 %, 93 % 94 %, 95 %, 96 %, 97 %, 98 %, or 99 %.
  • said mutated amino acid sequence and said sequence to be mutated differ in at most 11, 10, 9, 8, 7, 6, 4, 3, 2, or 1 amino acid residues, wherein further preferably said difference is selected from insertion, deletion and amino acid exchange.
  • the mutated amino acid sequence differs from an amino acid sequence of a coat protein of CMV in least one amino acid, wherein preferably said difference is an amino acid exchange.
  • Position corresponding to residues... The position on an amino acid sequence, which is corresponding to given residues of another amino acid sequence can be identified by sequence alignment, typically and preferably by using the BLASTP algorithm, most preferably using the standard settings. Typical and preferred standard settings are: expect threshold: 10; word size: 3; max matches in a query range: 0; matrix: BLOSUM62; gap costs: existence 11, extension 1; compositional adjustments: conditional compositional score matrix adjustment.
  • Sequence identity The sequence identity of two given amino acid sequences is determined based on an alignment of both sequences. Algorithms for the determination of sequence identity are available to the artisan. Preferably, the sequence identity of two amino acid sequences is determined using publicly available computer homology programs such as the "BLAST" program (http://blast.ncbi.nlm.nih.gov/Blast.cgi) or the "CLUSTALW” (http ://www. genome.jp/tools/clustalw/), and hereby preferably by the "BLAST" program provided on the NCBI homepage at http://blast.ncbi.nlm.nih.gov/Blast.cgi using the default settings provided therein. Typical and preferred standard settings are: expect threshold: 10; word size: 3; max matches in a query range: 0; matrix: BLOSUM62; gap costs: existence 11, extension 1; compositional adjustments: conditional compositional score matrix adjustment.
  • amino acid exchange refers to the exchange of a given amino acid residue in an amino acid sequence by any other amino acid residue having a different chemical structure, preferably by another proteinogenic amino acid residue. Thus, in contrast to insertion or deletion of an amino acid, the amino acid exchange does not change the total number of amino acids of said amino acid sequence. Very preferred in the context of the invention is the exchange of an amino acid residue of said amino acid sequence to be mutated by a lysine residue or by a cysteine residue.
  • Epitope refers to continuous or discontinuous portions of an antigen, preferably a polypeptide, wherein said portions can be specifically bound by an antibody or by a T-cell receptor within the context of an MHC molecule. With respect to antibodies, specific binding excludes non-specific binding but does not necessarily exclude cross- reactivity.
  • An epitope typically comprise 5-20 amino acids in a spatial conformation which is unique to the antigenic site.
  • T helper (Th) cell epitope refers to an epitope that is capable of recognition by a helper Th cell.
  • said T helper cell epitope is a universal T helper cell epitope.
  • Universal Th cell epitope refers to a Th cell epitope that is capable of binding to at least one, preferably more than one MHC class II molecules.
  • the simplest way to determine whether a peptide sequence is a universal Th cell epitope is to measure the ability of the peptide to bind to individual MHC class II molecules. This may be measured by the ability of the peptide to compete with the binding of a known Th cell epitope peptide to the MHC class II molecule.
  • a representative selection of HLA-DR molecules are described in e.g. Alexander J, et al, Immunity (1994) 1 :751-761.
  • Th cell epitopes for MHC class II molecules should be at least 10 ⁇ 5 M.
  • An alternative, more tedious but also more relevant way to determine the "universality" of a Th cell epitope is the demonstration that a larger fraction of people (>30%) generate a measurable T cell response upon immunization and boosting one months later with a protein containing the Th cell epitope formulated in IFA.
  • a representative collection of MHC class II molecules present in different individuals is given in Panina-Bordignon P, et al., Eur J Immunol (1989) 19:2237- 2242.
  • the term "universal Th cell epitope” as used herein preferably refers to a Th cell epitope that generates a measurable T cell response upon immunization and boosting (one months later with a protein containing the Th cell epitope formulated in IFA) in more than 30% of a selected group of individuals as described in Panina-Bordignon P, et al, Eur J Immunol (1989) 19:2237-2242.
  • the term "universal Th cell epitope” as used herein preferably refers to a Th cell epitope that is capable of binding to at least one, preferably to at least two, and even more preferably to at least three DR alleles selected from of DR1, DR2w2b, DR3, DR4w4, DR4wl4, DR5, DR7, DR52a, DRw53, DR2w2a; and preferably selected from DR1, DR2w2b, DR4w4, DR4wl4, DR5, DR7, DRw53, DR2w2a, with an affinity at least 500nM (as described in Alexander J, et al, Immunity (1994) 1 :751-761 and references cited herein); a preferred binding assay to evaluate said affinities is the one described by Sette A, et al, J Immunol (1989) 142:35-40.
  • the term "universal Th cell epitope” as used herein refers to a Th cell epitope that is capable of binding to at least one, preferably to at least two, and even more preferably to at least three DR alleles selected from DR1, DR2w2b, DR4w4, DR4wl4, DR5, DR7, DRw53, DR2w2a, with an affinity at least 500nM (as described in Alexander J, et al, Immunity (1994) 1 :751-761 and references cited herein); a preferred binding assay to evaluate said affinities is the one described by Sette A, et al, J Immunol (1989) 142:35-40.
  • Adjuvant refers to non-specific stimulators of the immune response or substances that allow generation of a depot in the host which when combined with the vaccine and pharmaceutical composition, respectively, of the present invention may provide for an even more enhanced immune response.
  • Preferred adjuvants are complete and incomplete Freund's adjuvant, aluminum containing adjuvant, preferably aluminum hydroxide, and modified muramyldipeptide.
  • Further preferred adjuvants are mineral gels such as aluminum hydroxide, surface active substances such as lyso lecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and human adjuvants such as BCG (bacille Calmette Guerin) and Corynebacterium parvum. Such adjuvants are also well known in the art.
  • compositions of the invention include, but are not limited to, Monophosphoryl lipid immunomodulator, AdjuVax 100a, QS-21, QS-18, CRL1005, Aluminum salts (Alum), MF-59, OM- 174, OM- 197, OM-294, and Virosomal adjuvant technology.
  • the adjuvants may also comprise mixtures of these substances.
  • Virus-like particles have been generally described as an adjuvant.
  • the term "adjuvant” refers to an adjuvant not being the inventive virus-like particle. Rather “adjuvant” relates to an additional, distinct component of the inventive compositions, vaccines or pharmaceutical compositions.
  • the term "effective amount” refers to an amount necessary or sufficient to realize a desired biologic effect.
  • An effective amount of the composition, or alternatively the pharmaceutical composition would be the amount that achieves this selected result, and such an amount could be determined as a matter of routine by a person skilled in the art.
  • the term "effective amount”, as used herein refers to an amount necessary or sufficient to be effective to reduce levels of cIL-31 to a level that causes reduced itching in dogs and improves CAD.
  • the term “effective amount”, as used herein refers to an amount necessary or sufficient to be effective to neutralize the activity of cIL-31 at sites of inflammation.
  • the effective amount can vary depending on the particular composition being administered and the size of the subject. One of ordinary skill in the art can empirically determine the effective amount of a particular composition of the present invention without necessitating undue experimentation.
  • treatment refers to prophylaxis and/or therapy. In one embodiment, the terms “treatment”, “treat”, “treated” or “treating” refer to a therapeutic treatment. In another embodiment, the terms “treatment”, “treat”, “treated” or “treating” refer to a prophylactic treatment.
  • first attachment site refers to an element which is naturally occurring with the virus-like particle or which is artificially added to the virus-like particle, and to which the second attachment site may be linked.
  • the first attachment site preferably is a protein, a polypeptide, an amino acid, a peptide, a sugar, a polynucleotide, a natural or synthetic polymer, a secondary metabolite or compound (biotin, fluorescein, retinol, digoxigenin, metal ions, phenylmethylsulfonylfluoride), or a chemically reactive group such as an amino group, a carboxyl group, a sulfhydryl group, a hydroxyl group, a guanidinyl group, histidinyl group, or a combination thereof.
  • a preferred embodiment of a chemically reactive group being the first attachment site is the amino group of an amino acid residue, preferably of a lysine residue.
  • the first attachment site is typically located on the surface, and preferably on the outer surface of the VLP. Multiple first attachment sites are present on the surface, preferably on the outer surface of the VLP, typically in a repetitive configuration.
  • the first attachment site is associated with the VLP, through at least one covalent bond, preferably through at least one peptide bond.
  • the first attachment site is naturally occurring with the VLP.
  • the first attachment site is artificially added to the VLP.
  • said first attachment site is the amino group of a lysine residue of the amino acid sequence of said VLP polypeptide.
  • the phrase "second attachment site” refers to an element which is naturally occurring with or which is artificially added to the cIL-31 antigen, and to which the first attachment site may be linked.
  • the second attachment site of the cIL-31 antigen preferably is a protein, a polypeptide, a peptide, an amino acid, a sugar, a polynucleotide, a natural or synthetic polymer, a secondary metabolite or compound (biotin, fluorescein, retinol, digoxigenin, metal ions, phenylmethylsulfonylfluoride), or a chemically reactive group such as an amino group, a carboxyl group, a sulfhydryl group, a hydroxyl group, a guanidinyl group, histidinyl group, or a combination thereof.
  • a preferred embodiment of a chemically reactive group being the second attachment site is a sulfhydryl group, preferably the sulfhydryl group of the amino acid cysteine most preferably the sulfhydryl group of a cysteine residue.
  • the term "antigen with at least one second attachment site” or "cIL-31 antigen with at least one second attachment site” refers, therefore, to a construct comprising the cIL-31 antigen and at least one second attachment site.
  • a construct typically and preferably further comprises a "linker”.
  • the second attachment site is associated with the cIL-31 antigen through at least one covalent bond, preferably through at least one peptide bond.
  • the second attachment site is naturally occurring within the cIL-31 antigen.
  • the second attachment site is artificially added to the cIL-31 antigen through a linker, wherein said linker comprises or alternatively consists of a cysteine.
  • the linker is fused to the cIL-31 antigen by a peptide bond or is added by chemical linkage.
  • Linked refer to all possible ways, preferably chemical interactions, by which the at least one first attachment site and the at least one second attachment site are joined together. Chemical interactions include covalent and non-covalent interactions. Typical examples for non-covalent interactions are ionic interactions, hydrophobic interactions or hydrogen bonds, whereas covalent interactions are based, by way of example, on covalent bonds such as ester, ether, phosphoester, carbon- phosphorus bonds, carbon- sulfur bonds such as thioether, or imide bonds.
  • the first attachment site and the second attachment site are linked through at least one covalent bond, preferably through at least one non-peptide bond, and even more preferably through exclusively non-peptide bond(s).
  • the first attachment site and the second attachment site are linked through at least one covalent bond, preferably through at least one peptide bond, and even more preferably through exclusively peptide bond(s).
  • Linker either associates the second attachment site with the cIL-31 antigen or already comprises, essentially consists of, or consists of the second attachment site.
  • a preferred linkers are an amino acid linkers, i.e. linkers containing at least one amino acid residue. The term amino acid linker does not imply that such a linker consists exclusively of amino acid residues. However, a linker consisting exclusively of amino acid residues is a preferred embodiment of the invention.
  • the amino acid residues of the linker are, preferably, composed of naturally occurring amino acids or unnatural amino acids known in the art, all-L or all-D or mixtures thereof.
  • Further preferred embodiments of a linker in accordance with this invention are molecules comprising a sulfhydryl group or a cysteine residue and such molecules are, therefore, also encompassed within this invention.
  • Association of the linker with the cIL-31 antigen is preferably by way of at least one covalent bond, more preferably by way of at least one peptide bond.
  • Ordered and repetitive antigen array refers to a repeating pattern of cIL-31 antigens which typically and preferably is characterized by a high order of uniformity in spacial arrangement of said antigens with respect to the core particle and VLP, respectively.
  • the repeating pattern may be a geometric pattern.
  • Preferred ordered and repetitive antigen arrays moreover, possess strictly repetitive para-crystalline orders of cIL-31 antigens, preferably with spacing of 1 to 30 nanometers, preferably 2 to 15 nanometers, even more preferably 2 to 10 nanometers, even again more preferably 2 to 8 nanometers, and further more preferably 1.6 to 7 nanometers.
  • Immunostimulatory substance refers to a substance capable of inducing and/or enhancing an immune response.
  • Immunostimulatory substances include, but are not limited to, toll- like receptor activating substances and substances inducing cytokine secretion.
  • Toll-like receptor activating substances include, but are not limited to, immunostimulatory nucleic acids, peptideoglycans, lipopolysaccharides, lipoteichonic acids, imidazoquinoline compounds, flagellins, lipoproteins, and immuno stimulatory organic substances such as taxol.
  • Immunostimulatory nucleic acid refers to a nucleic acid capable of inducing and/or enhancing an immune response.
  • Immunostimulatory nucleic acids comprise ribonucleic acids and in particular desoxyribonucleic acids, wherein both, ribonucleic acids and desoxyribonucleic acids may be either double stranded or single stranded.
  • Preferred ISS-NA are desoxyribonucleic acids, wherein further preferably said desoxyribonucleic acids are single stranded.
  • immunostimulatory nucleic acids contain at least one CpG motif comprising an unmethylated C.
  • Very preferred immunostimulatory nucleic acids comprise at least one CpG motif, wherein said at least one CpG motif comprises or preferably consist of at least one, preferably one, CG dinucleotide, wherein the C is unmethylated.
  • said CG dinucleotide is part of a palindromic sequence.
  • immunostimulatory nucleic acid also refers to nucleic acids that contain modified bases, preferably 4-bromo-cytosine.
  • ISS- NA which are capable of stimulating IFN- alpha production in dendritic cells.
  • Immunostimulatory nucleic acids useful for the purpose of the invention are described, for example, in WO2007/068747A1.
  • oligonucleotide refers to a nucleic acid sequence comprising 2 or more nucleotides, preferably about 6 to about 200 nucleotides, and more preferably 20 to about 100 nucleotides, and most preferably 20 to 40 nucleotides. Very preferably, oligonucleotides comprise about 30 nucleotides, more preferably oligonucleotides comprise exactly 30 nucleotides, and most preferably oligonucleotides consist of exactly 30 nucleotides.
  • Oligonucleotides are polyribonucleotides or polydeoxribonucleotides and are preferably selected from (a) unmodified R A or DNA, and (b) modified R A or DNA.
  • the modification may comprise the backbone or nucleotide analogues.
  • Oligonucleotides are preferably selected from the group consisting of (a) single- and double-stranded DNA, (b) DNA that is a mixture of single- and double-stranded regions, (c) single- and double-stranded RNA, (d) RNA that is mixture of single- and double-stranded regions, and (e) hybrid molecules comprising DNA and RNA that are single-stranded or, more preferably, double- stranded or a mixture of single- and double-stranded regions.
  • Preferred nucleotide modifications/analogs are selected from the group consisting of (a) peptide nucleic acid, (b) inosin, (c) tritylated bases, (d) phosphorothioates, (e) alkylphosphorothioates, (f) 5-nitroindole desoxyribofliranosyl, (g) 5-methyldesoxycytosine, and (h) 5,6-dihydro-5,6- dihydroxydesoxythymidine.
  • Phosphothioated nucleotides are protected against degradation in a cell or an organism and are therefore preferred nucleotide modifications.
  • Unmodified oligonucleotides consisting exclusively of phosphodiester bound nucleotides typically are more active than modified nucleotides and are therefore generally preferred in the context of the invention. Most preferred are oligonucleotides consisting exclusively of phosphodiester bound deoxinucleo tides, wherein further preferably said oligonucleotides are single stranded. Further preferred are oligonucleotides capable of stimulating IFN-alpha production in cells, preferably in dendritic cells. Very preferred oligonucleotides capable of stimulating IFN- alpha production in cells are selected from A-type CpGs and C-type CpGs. Further preferred are RNA-molecules without a Cap.
  • CpG motif refers to a pattern of nucleotides that includes an unmethylated central CpG, i.e. the unmethylated CpG dinucleotide, in which the C is unmethylated, surrounded by at least one base, preferably one or two nucleotides, flanking (on the 3' and the 5' side of) the central CpG.
  • the CpG motif as used herein comprises or alternatively consists of the unmethylated CpG dinucleotide and two nucleotides on its 5 ' and 3 ' ends.
  • the bases flanking the CpG confer a significant part of the activity to the CpG oligonucleotide.
  • Unmethylated CpG-containing oligonucleotide refers to an oligonucleotide, preferably to an oligodesoxynucleotide, containing at least one CpG motif.
  • a CpG contains at least one unmethylated cytosine, guanine dinucleotide.
  • Preferred CpGs stimulate/activate, e.g. have a mitogenic effect on, or induce or increase cytokine expression by, a vertebrate bone marrow derived cell.
  • CpGs can be useful in activating B cells, NK cells and antigen-presenting cells, such as dendritic cells, monocytes and macrophages.
  • CpG relates to an oligodesoxynucleotide, preferably to a single stranded oligodesoxynucleotide, containing an unmethylated cytosine followed 3' by a guanosine, wherein said unmethylated cytosine and said guanosine are linked by a phosphate bond, wherein preferably said phosphate bound is a phosphodiester bound or a phosphothioate bound, and wherein further preferably said phosphate bond is a phosphodiester bound.
  • CpGs can include nucleotide analogs such as analogs containing phosphorothio ester bonds and can be double-stranded or single-stranded. Generally, double- stranded molecules are more stable in vivo, while single-stranded molecules have increased immune activity.
  • a CpG is an oligonucleotide that is at least about ten nucleotides in length and comprises at least one CpG motif, wherein further preferably said CpG is 10 to 60, more preferably 15 to 50, still more preferably 20 to 40, still more preferably about 30, and most preferably exactly 30 nucleotides in length.
  • a CpG may consist of methylated and/or unmethylated nucleotides, wherein said at least one CpG motif comprises at least one CG dinucleotide wherein the C is unmethylated.
  • the CpG may also comprise methylated and unmethylated sequence stretches, wherein said at least one CpG motif comprises at least one CG dinucleotide wherein the C is unmethylated.
  • CpG relates to a single stranded oligodesoxynucleotide containing an unmethylated cytosine followed 3' by a guanosine, wherein said unmethylated cytosine and said guanosine are linked by a phosphodiester bound.
  • the CpGs can include nucleotide analogs such as analogs containing phosphorothioester bonds and can be double-stranded or single-stranded.
  • phosphodiester CpGs are A-type CpGs as indicated below, while phosphothioester stabilized CpGs are B-type CpGs.
  • Preferred CpG oligonucleotides in the context of the invention are A-type CpGs.
  • A-type CpG As used herein, the term "A-type CpG” or “D-type CpG” refers to an oligodesoxynucleotide (ODN) comprising at least one CpG motif.
  • ODN oligodesoxynucleotide
  • A-type CpGs preferentially stimulate activation of T cells and the maturation of dendritic cells and are capable of stimulating IFN-alpha production.
  • the nucleotides of the at least one CpG motif are linked by at least one phosphodiester bond.
  • A-type CpGs comprise at least one phosphodiester bond CpG motif which may be flanked at its 5' end and/or, preferably and, at its 3' end by phosphorothioate bound nucleotides.
  • the CpG motif and hereby preferably the CG dinucleotide and its immediate flanking regions comprising at least one, preferably two nucleotides, are composed of phosphodiester nucleotides.
  • Preferred A-type CpGs exclusively consist of phosphodiester (PO) bond nucleotides.
  • the poly G motif comprises or alternatively consists of at least one, preferably at least three, at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 Gs (guanosines), most preferably by at least 10 Gs.
  • the A-type CpG of the invention comprises or alternatively consists of a palindromic sequence.
  • the term "packaged” as used herein refers to the state of a polyanionic macromolecule or immunostimulatory substances in relation to the core particle and VLP, respectively.
  • the term “packaged” as used herein includes binding that may be covalent, e.g., by chemically coupling, or non-covalent, e.g., ionic interactions, hydrophobic interactions, hydrogen bonds, etc.
  • the term also includes the enclosement, or partial enclosement, of a polyanionic macromolecule.
  • the polyanionic macromolecule or immunostimulatory substances can be enclosed by the VLP without the existence of an actual binding, in particular of a covalent binding.
  • the at least one polyanionic macromolecule or immunostimulatory substances is packaged inside the VLP, most preferably in a non-covalent manner.
  • said immunostimulatory substances is nucleic acid, preferably a DNA
  • the term packaged implies that said nucleic acid is not accessible to nucleases hydrolysis, preferably not accessible to DNAse hydrolysis (e.g. DNasel or Benzonase), wherein preferably said accessibility is assayed as described in Examples 11-17 ofWO2003/024481A2.
  • the present invention provides for a composition for use in a method of preventing or treating canine atopic dermatitis (CAD) of a canidae, preferably of a domestic dog, wherein an effective amount of said composition is administered to said canidae, preferably to said domestic dog, and wherein said composition comprises (a) a core particle with at least one first attachment site; and (b) at least one canine Interleukin-31 antigen (cIL-31 antigen) with at least one second attachment site, wherein said cIL-31 antigen comprises, or preferably consists of, a protein with the amino sequence selected from SEQ ID NO:22 or a protein with an amino acid sequence of at least 90%, preferably of at least 92 %, further preferably of at least 95%, and again further preferably of at least 98% amino acid sequence identity with SEQ ID NO:22; wherein (a) and (b) are linked through said at least one first and said at least one second attachment site via at least one non-
  • said core particle is a virus-like particle (VLP), preferably a recombinant VLP.
  • VLP is a modified VLP of cucumber mosaic virus (CMV), wherein said modified VLP of CMV comprises, essentially consists of, or alternatively consists of, at least one modified CMV polypeptide, wherein said modified CMV polypeptide comprises, or preferably consists of, (a) a CMV polypeptide, and (b) a T helper cell epitope; and wherein said CMV polypeptide comprises, or preferably consists of, (i) an amino acid sequence of a coat protein of CMV; or (ii) a mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of a coat protein of CMV, and wherein said mutated amino acid sequence and said coat protein of CMV show a sequence identity of at least 90 %, preferably of at least 95%, further preferably of at least 98% and again more
  • said CMV polypeptide comprises, or preferably consists of, (a) an amino acid sequence of a coat protein of CMV, wherein said amino acid sequence comprises, or preferably consists of, SEQ ID NO: l or (b) an amino acid sequence having a sequence identity of at least 90 % of SEQ ID NO: 1 ; and wherein said amino sequence as defined in (a) or (b) in this claim comprises SEQ ID NO:23; or wherein said amino sequence as defined in
  • VLP is a modified VLP of cucumber mosaic virus (CMV), wherein said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO:6 or SEQ ID NO:7.
  • CMV cucumber mosaic virus
  • said at least one cIL-31 antigen comprises, or preferably consists of, a protein with the amino sequence selected from: (a) SEQ ID NO: 18;
  • said at least one cIL-31 antigen comprises, or preferably consists of, a protein with the amino sequence selected from: (a) SEQ ID NO: 18; (b) SEQ ID NO:21; (c) SEQ ID NO:22; (d) SEQ ID NO:25; or (e) SEQ ID NO:26.
  • said second attachment site is a sulfhydryl group, and wherein preferably said sulfhydryl group is derived from reaction of said cIL-31 antigen with N-succinimidyl S-acetylthioacetate (SAT A).
  • said second attachment site is a sulfhydryl group, and wherein preferably said sulfhydryl group is derived from reaction of a lysine residue of said cIL-31 antigen.
  • the present invention provides for a composition for use in a method of preventing or treating canine atopic dermatitis (CAD) of a domestic dog, wherein an effective amount of said composition is administered to said domestic dog, and wherein said composition comprises (a) a core particle with at least one first attachment site, wherein said core particle is preferably a virus-like particle (VLP), further preferably a recombinant VLP; and (b) at least one canine Interleukin-31 antigen (cIL- 31 antigen) with at least one second attachment site, wherein said cIL-31 antigen comprises, or preferably consists of, a protein with the amino sequence selected from SEQ ID NO:22 or a protein with an amino acid sequence of at least 90%, preferably of at least 92 %, further preferably of at least 95%, and again further preferably of at least 98% amino acid sequence identity with SEQ ID NO:22; wherein (a) and (b) are linked through said at least one first and said at
  • said virus-like particle is derived from a plant virus.
  • said VLP is a recombinant VLP, and wherein preferably said recombinant VLP is derived from a plant virus.
  • said VLP is a VLP of cucumber mosaic virus (CMV).
  • said VLP is a modified VLP comprising, essentially consisting of, or alternatively consisting of, at least one modified VLP polypeptide, wherein said modified VLP polypeptide comprises, or preferably consists of, (a) a VLP polypeptide, and (b) a T helper cell epitope, wherein said VLP polypeptide comprises, or preferably consists of, (i) an amino acid sequence of a coat protein of a virus, preferably an amino acid sequence of a coat protein of a plant virus; or (ii) a mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of said coat protein of a virus, and wherein said mutated amino acid sequence and said coat protein of a virus show a sequence identity of at least 90 %, preferably of at least 95%, further preferably of at least 98% and again more preferably of at least 99%.
  • said VLP is a modified VLP of cucumber mosaic virus (CMV), wherein said modified VLP of CMV comprises, essentially consists of, or alternatively consists of, at least one modified CMV polypeptide, wherein said modified CMV polypeptide comprises, or preferably consists of, (a) a CMV polypeptide, and (b) a T helper cell epitope; and wherein said CMV polypeptide comprises, or preferably consists of, (i) an amino acid sequence of a coat protein of CMV; or (ii) a mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of a coat protein of CMV, and wherein said mutated amino acid sequence and said coat protein of CMV show a sequence identity of at least 90 %, preferably of at least 95%, further preferably of at least 98% and again more preferably of at least 99%.
  • CMV cucumber mosaic virus
  • said CMV polypeptide comprises, preferably consists of, an amino acid sequence of a coat protein of CMV.
  • said CMV polypeptide comprises, preferably consists of a mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of a coat protein of CMV, and wherein said mutated amino acid sequence and said coat protein of CMV show a sequence identity of at least 90 %, preferably of at least 95%, further preferably of at least 98% and again more preferably of at least 99%.
  • said mutated amino acid sequence and said amino acid sequence to be mutated differ in least one and in at most 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 amino acid residues, and wherein preferably these differences are selected from (i) insertion, (ii) deletion, (iii) amino acid exchange, and (iv) any combination of (i) to (iii).
  • said CMV polypeptide comprises, or preferably consists of, (i) (a) an amino acid sequence of a coat protein of CMV, wherein said amino acid sequence comprises, or preferably consists of, SEQ ID NO: l or (b) an amino acid sequence having a sequence identity of at least 75%, preferably of at least 80%, more preferably of at least 85%, again further preferably of at least 90 %, again more preferably of at least 95%, still further preferably of at least 98% and still again further more preferably of at least 99% of SEQ ID NO: l ; or (ii) a mutated amino acid sequence, wherein said amino acid sequence to be mutated is said amino acid sequence as defined in (i) of this claim, and wherein said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 95%, preferably of at least 98%, and more preferably of at least 99%.
  • said CMV polypeptide comprises, or preferably consists of, (a) an amino acid sequence of a coat protein of CMV, wherein said amino acid sequence comprises, or preferably consists of, SEQ ID NO: l or (b) an amino acid sequence having a sequence identity of at least 75%, preferably of at least 80%, more preferably of at least 85%, again further preferably of at least 90 %, again more preferably of at least 95%, still further preferably of at least 98% and still again further more preferably of at least 99% of SEQ ID NO: l .
  • said CMV polypeptide comprises, or preferably consists of, (i) (a) an amino acid sequence of a coat protein of CMV, wherein said amino acid sequence comprises SEQ ID NO:23, or (b) an amino acid sequence of a coat protein of CMV comprising an amino acid sequence region, wherein said amino acid sequence region has a sequence identity of at least 75%, preferably of at least 80%>, more preferably of at least 85%, again further preferably of at least 90 %, again more preferably of at least 95%, still further preferably of at least 98% and still again further more preferably of at least 99% with SEQ ID NO:23; or (ii) a mutated amino acid sequence, wherein said amino acid sequence to be mutated is said amino acid sequence as defined in (i) of this claim, and wherein said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 95%, preferably of at least 98%, and more preferably of at least 99%.
  • said CMV polypeptide comprises, or preferably consists of, (a) an amino acid sequence of a coat protein of CMV, wherein said amino acid sequence comprises SEQ ID NO:23, or (b) an amino acid sequence of a coat protein of CMV comprising an amino acid sequence region, wherein said amino acid sequence region has a sequence identity of at least 75%, preferably of at least 80%, more preferably of at least 85%, again further preferably of at least 90 %, again more preferably of at least 95%, still further preferably of at least 98% and still again further more preferably of at least 99% with SEQ ID NO:23.
  • said CMV polypeptide comprises, or preferably consists of, (i) (a) an amino acid sequence of a coat protein of CMV, wherein said amino acid sequence comprises, or preferably consists of, SEQ ID NO: l or (b) an amino acid sequence having a sequence identity of at least 75%, preferably of at least 80%, more preferably of at least 85%, again further preferably of at least 90 %, again more preferably of at least 95%, still further preferably of at least 98% and still again further more preferably of at least 99% of SEQ ID NO: l; and wherein said amino sequence as defined in (a) or (b) in this claim comprises SEQ ID NO:23; or wherein said amino sequence as defined in (a) or (b) in this claim comprises an amino acid sequence region, wherein said amino acid sequence region has a sequence identity of at least 75%, preferably of at least 80%, more preferably of at least 85%, again further preferably of at least 90 %, again more preferably of at least 9
  • said CMV polypeptide comprises, or preferably consists of, (a) an amino acid sequence of a coat protein of CMV, wherein said amino acid sequence comprises, or preferably consists of, SEQ ID NO: l or (b) an amino acid sequence having a sequence identity of at least 90 % of SEQ ID NO:l; and wherein said amino sequence as defined in (a) or (b) in this claim comprises SEQ ID NO:23; or wherein said amino sequence as defined in (a) or (b) in this claim comprises an amino acid sequence region, wherein said amino acid sequence region has a sequence identity of at least 90%> with SEQ ID NO:23.
  • said T helper cell epitope replaces a N-terminal region of said CMV polypeptide.
  • the number of amino acids of said N-terminal region replaced is equal to or lower than the number of amino acids of which said T helper cell epitope consists.
  • said T helper cell epitope replaces a N-terminal region of said CMV polypeptide, and wherein the number of amino acids of said N-terminal region replaced is equal to or lower than the number of amino acids of which said T helper cell epitope consists.
  • said replaced N-terminal region of said CMV polypeptide consists of 5 to 15 consecutive amino acids, preferably of 9 to 14 consecutive amino acids, more preferably of 11 to 13 consecutive amino acids.
  • said N-terminal region of said CMV polypeptide corresponds to amino acids 2-12 of SEQ ID NO: l .
  • said T helper cell epitope is a universal T helper cell epitope. In another preferred embodiment, said T helper cell epitope consists of at most 20 amino acids.
  • said Th cell epitope is a PADRE sequence.
  • said Th cell epitope comprises, preferably consists of, the amino acid sequence of SEQ ID NO:5.
  • said Th cell epitope is a PADRE sequence, and wherein said Th cell epitope comprises, preferably consists of, the amino acid sequence of SEQ ID NO:5.
  • said T helper cell epitope is derived from a human vaccine.
  • said Th cell epitope is derived from tetanus toxin.
  • said Th cell epitope has, preferably consists of, the amino acid sequence of SEQ ID NO:4.
  • said Th cell epitope is derived from tetanus toxin, and wherein said Th cell epitope has, preferably consists of, the amino acid sequence of SEQ ID NO:4.
  • said Th cell epitope is a PADRE sequence, and wherein said Th cell epitope comprises, preferably consists of, the amino acid sequence of
  • Th cell epitope is derived from tetanus toxin, and wherein said
  • Th cell epitope has, preferably consists of, the amino acid sequence of SEQ ID NO:4.
  • said CMV polypeptide comprises, or preferably consists of, an amino acid sequence of a coat protein of CMV, wherein said amino acid sequence comprises, or preferably consists of, SEQ ID NO: l or an amino acid sequence having a sequence identity of at least 95 % of SEQ ID NO:l; and wherein said amino sequence comprises SEQ ID NO:23, and wherein said T helper cell epitope replaces the N- terminal region of said CMV polypeptide, and wherein said replaced N-terminal region of said CMV polypeptide consists of 11 to 13 consecutive amino acids, preferably of 11 consecutive amino acids, and wherein further preferably said N-terminal region of said CMV polypeptide corresponds to amino acids 2-12 of SEQ ID NO: l .
  • said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO:6. In another very preferred embodiment, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO:7.
  • said first attachment site and said second attachment site are linked via at least one covalent non-peptide-bond.
  • said first attachment site comprises, or preferably is, an amino group, preferably an amino group of a lysine.
  • said second attachment site comprises, or preferably is, a sulfhydryl group, preferably a sulfhydryl group of a cysteine.
  • the at least one first attachment site is an amino group, preferably an amino group of a lysine residue and the at least one second attachment site is a sulfhydryl group, preferably a sulfhydryl group of a cysteine residue or a sufhydryl group that has been chemically attached to the cIL-31 antigen.
  • only one of said second attachment sites associates with said first attachment site through at least one non-peptide covalent bond leading to a single and uniform type of binding of said cIL-31 antigen to said modified virus-like particle, wherein said only one second attachment site that associates with said first attachment site is a sulfhydryl group, and wherein said cIL-31 antigen and said modified virus-like particle interact through said association to form an ordered and repetitive antigen array, i.e. an ordered and repetitive array of cIL-31 antigens.
  • the cIL-31 antigen is linked to the modified VLP by way of chemical cross-linking, typically and preferably by using a heterobifunctional cross- linker.
  • the hetero-bifunctional cross- linker contains a functional group which can react with the preferred first attachment sites, preferably with the amino group, more preferably with the amino groups of lysine residue(s) of the modified VLP, and a further functional group which can react with the preferred second attachment site, i.e. a sulfhydryl group, preferably of cysteine(s) residue inherent of, or artificially added to the cIL-31 antigen, and optionally also made available for reaction by reduction.
  • hetero-bifunctional cross- linkers are known to the art. These include the preferred cross-linkers SMPH (Pierce), Sulfo- MBS, Sulfo-EMCS, Sulfo-GMBS, Sulfo- SIAB, Sulfo-SMPB, Sulfo-SMCC, Sulfo-KMUS SVSB, SIA, and other cross-linkers available for example from the Pierce Chemical Company, and having one functional group reactive towards amino groups and one functional group reactive towards sulfhydryl groups.
  • the above mentioned cross-linkers all lead to formation of an amide bond after reaction with the amino group and a thioether linkage with the sulfhydryl groups.
  • cross- linkers suitable in the practice of the invention is characterized by the introduction of a disulfide linkage between the cIL-31 antigen and the modified VLP upon coupling.
  • Preferred cross-linkers belonging to this class include, for example, SPDP and Sulfo-LC-SPDP (Pierce).
  • said hetero-bifunctional cross-linker is SMPH.
  • Other methods of linking the cIL-31 antigen to the modified VLP include methods wherein the cIL-31 antigen is cross-linked to the modified VLP, using the carbodiimide EDC, and NHS.
  • the cIL-31 antigen may also be first thiolated through reaction, for example with SAT A, SATP or iminothiolane.
  • the cIL-31 antigen, after deprotection if required, may then be coupled to the modified VLP as follows.
  • the cIL-31 antigen is reacted with the modified VLP, previously activated with a hetero-bifunctional cross-linker comprising a cysteine reactive moiety, and therefore displaying at least one or several functional groups reactive towards cysteine residues, to which the thiolated cIL-31 antigen can react, such as described above.
  • a reducing agent are included in the reaction mixture.
  • the cIL-31 antigen is attached to the modified VLP, using a homo-bifunctional cross-linker such as glutaraldehyde, DSG, BM[PEO]4, BS3, (Pierce) or other known homo-bifunctional cross- linkers with functional groups reactive towards amine groups or carboxyl groups of the modified VLP.
  • a homo-bifunctional cross-linker such as glutaraldehyde, DSG, BM[PEO]4, BS3, (Pierce) or other known homo-bifunctional cross- linkers with functional groups reactive towards amine groups or carboxyl groups of the modified VLP.
  • composition further comprises at least one immuno- stimulatory substance.
  • said immunostimulatory substance is packaged into the modified VLPs of the invention.
  • the immunostimulatory substance is mixed with the modified VLPs of the invention.
  • Immunostimulatory substances useful for the invention are generally known in the art and are disclosed, inter alia, in WO2003/024481A2.
  • said immunostimulatory substance consists of DNA or RNA of non-eukaryotic origin.
  • said immunostimulatory substance is selected from the group consisting of: (a) immunostimulatory nucleic acid; (b) peptidoglycan; (c) lipopolysaccharide; (d) lipoteichonic acid; (e) imidazoquinoline compound; (f) flagelline; (g) lipoprotein; and (h) any mixtures of at least one substance of (a) to (g).
  • said immunostimulatory substance is an immunostimulatory nucleic acid, wherein said immunostimulatory nucleic acid is selected from the group consisting of: (a) ribonucleic acids; (b) deoxyribonucleic acids; (c) chimeric nucleic acids; and (d) any mixture of (a), (b) and/or (c).
  • said immunostimulatory nucleic acid is a ribonucleic acid, and wherein said ribonucleic acid is bacteria derived RNA.
  • said immunostimulatory nucleic is poly-(LC) or a derivative thereof.
  • said immunostimulatory nucleic acid is a deoxyribonucleic acid, wherein said deoxyribonucleic acid is an unmethylated CpG- containing oligonucleotide.
  • said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide.
  • said unmethylated CpG- containing oligonucleotide is an A-type CpG.
  • said A-type CpG comprises the sequence GACGATCGTC (SEQ ID NO:24).
  • said palindromic sequence is flanked at its 5'- terminus and at its 3 '-terminus by guanosine entities.
  • said palindromic sequence is flanked at its 5 '-terminus by at least 3 and at most 15 guanosine entities, and wherein said palindromic sequence is flanked at its 3 '-terminus by at least 3 and at most 15 guanosine entities.
  • said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide, and wherein preferably said unmethylated CpG-containing oligonucleotide comprises a palindromic sequence, and wherein further preferably the CpG motif of said unmethylated CpG-containing oligonucleotide is part of a palindromic sequence, and wherein again further preferably said palindromic sequence is GACGATCGTC (SEQ ID NO:24).
  • said at least one cIL-31 antigen is linked via a sulfhydryl group to said core particle, preferably to said VLP, again further preferably to said modified CMV VLP, wherein preferably said sulfhydryl group is comprised by said second attachment site and wherein said sulfhydryl group is is not naturally occurring with said cIL- 31 antigen, and wherein preferably said sulfhydryl group is derived from reaction of said cIL- 31 antigen with N-succinimidyl S-acetylthioacetate (SAT A), N-succinimidyl S- acetylthiopropionate (SATP) or iminothiolane, further preferably wherein said sulfhydryl group is derived from reaction of said cIL-31 antigen with N-succinimidyl S-acetylthioacetate (SAT A).
  • said second attachment site is a sulfhydryl group to said core particle
  • the cIL-31 antigen is linked via a cysteine residue, having been added to either the N-terminus or the C-terminus of, or a natural cysteine residue within the cIL-31 antigen, to lysine residues of the modified virus-like particle.
  • the composition of the invention further comprises a linker, wherein said linker associates said cIL-31 antigen with said second attachment site, and wherein preferably said linker comprises or alternatively consists of said second attachment site.
  • said cIL-31 antigen comprises, or preferably consists of, a protein with an amino acid sequence of at least 90%, amino acid sequence identity with SEQ ID NO:22.
  • said cIL-31 antigen comprises, or preferably consists of, a protein with an amino acid sequence of at least 92%, amino acid sequence identity with SEQ ID NO:22. In a further preferred embodiment, said cIL-31 antigen comprises, or preferably consists of, a protein with an amino acid sequence of at least 95%, amino acid sequence identity with SEQ ID NO:22. In a very preferred embodiment, said cIL- 31 antigen comprises, or preferably consists of, a protein with an amino acid sequence of at least 98%, amino acid sequence identity with SEQ ID NO:22. In a further very preferred embodiment, said cIL-31 antigen comprises, or preferably consists of, a protein with an amino acid sequence of SEQ ID NO:22.
  • said at least one cIL-31 antigen comprises, or preferably consists of, a protein with the amino sequence of SEQ ID NO: 18. In a further very preferred embodiment, said at least one cIL-31 antigen comprises, or preferably consists of, a protein with the amino sequence of SEQ ID NO:21. In a further very preferred embodiment, said second attachment site is a sulfliydryl group, and wherein preferably said sulfliydryl group is derived from reaction of said cIL-31 antigen with N-succinimidyl S-acetylthioacetate (SATA).
  • SATA N-succinimidyl S-acetylthioacetate
  • said second attachment site is a sulfliydryl group, and wherein preferably said sulfliydryl group is derived from reaction of a lysine residue of said cIL-31 antigen.
  • the present invention provides for a composition
  • a composition comprising (a) a virus-like particle (VLP) with at least one first attachment site; (b) at least one canine Interleukin-31 antigen (cIL-31 antigen) with at least one second attachment site, wherein said cIL-31 antigen comprises, or preferably consists of, a protein with the amino sequence selected from SEQ ID NO:22 or a protein with an amino acid sequence of at least 90%, preferably of at least 92 %, further preferably of at least 95%, and again further preferably of at least 98% amino acid sequence identity with SEQ ID NO:22, and again further preferably said antigen comprises, or preferably consists of a protein with the amino sequence of SEQ ID NO:22; wherein (a) and (b) are linked through said at least one first and said at least one second attachment site via at least one non-peptide covalent bond.
  • VLP virus-like particle
  • cIL-31 antigen canine Interleukin-31 antigen
  • said VLP is a modified VLP of cucumber mosaic virus (CMV), wherein said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO:6 or SEQ ID NO:7.
  • CMV cucumber mosaic virus
  • said at least one cIL-31 antigen comprises, or preferably consists of, a protein with the amino sequence selected from: (a) SEQ ID NO: 18; (b) SEQ ID NO:21; (c) SEQ ID NO:22; (d) SEQ ID NOs:25-30.
  • said at least one cIL-31 antigen comprises, or preferably consists of, a protein with the amino sequence selected from: (a) SEQ ID NO: 18; (b) SEQ ID NO:21; (c) SEQ ID NO:22; (d) SEQ ID NO:25; or (e) SEQ ID NO:26.
  • said cIL-31 antigen comprises, or preferably consists of, a protein with an amino acid sequence of at least 95%, amino acid sequence identity with SEQ ID NO:22. In a very preferred embodiment, said cIL-31 antigen comprises, or preferably consists of, a protein with an amino acid sequence of at least 98%, amino acid sequence identity with SEQ ID NO:22. In a further very preferred embodiment, said cIL-31 antigen comprises, or preferably consists of, a protein with an amino acid sequence of SEQ ID NO:22. In a further very preferred embodiment, said at least one cIL-31 antigen comprises, or preferably consists of, a protein with the amino sequence of SEQ ID NO: 18.
  • said at least one cIL-31 antigen comprises, or preferably consists of, a protein with the amino sequence of SEQ ID NO:21.
  • said second attachment site is a sulfhydryl group, and wherein preferably said sulfhydryl group is derived from reaction of said cIL-31 antigen with N-succinimidyl S-acetylthioacetate (SATA).
  • SATA N-succinimidyl S-acetylthioacetate
  • said second attachment site is a sulfhydryl group, and wherein preferably said sulfhydryl group is derived from reaction of a lysine residue of said cIL-31 antigen.
  • the present invention provides for a method of preventing or treating canine atopic dermatitis (CAD) of a canidae, preferably of a domestic dog, comprising administering an effective amount of a composition to said canidae, preferably to said domestic dog, and wherein said composition comprises (a) a core particle with at least one first attachment site; and (b) at least one canine Interleukin-31 antigen (cIL-31 antigen) with at least one second attachment site, wherein said cIL-31 antigen comprises, or preferably consists of, a protein with the amino sequence selected from SEQ ID NO:22 or a protein with an amino acid sequence of at least 90%, preferably of at least 92 %, further preferably of at least 95%, and again further preferably of at least 98% amino acid sequence identity with SEQ ID NO:22; wherein (a) and (b) are linked through said at least one first and said at least one second attachment site via at least one non-peptide covalent bond, wherein
  • CAD
  • the present invention provides for a use of a composition
  • a composition comprising (a) a core particle with at least one first attachment site; and (b) at least one canine Interleukin-31 antigen (cIL-31 antigen) with at least one second attachment site, wherein said cIL-31 antigen comprises, or preferably consists of, a protein with the amino sequence selected from SEQ ID NO:22 or a protein with an amino acid sequence of at least 90%, preferably of at least 92 %, further preferably of at least 95%, and again further preferably of at least 98% amino acid sequence identity with SEQ ID NO:22; wherein (a) and (b) are linked through said at least one first and said at least one second attachment site via at least one non- peptide covalent bond; for the manufacture of a medicament for preventing or treating canine atopic dermatitis (CAD) of a canidae, preferably of a domestic dog, wherein an effective amount of said composition is administered to said canidae,
  • RNA sequences from GenBank CMcpF (CACCATGGACAAATCTGAATCAACCAGTGCTGGT) (SEQ ID NO: 8) and CMcpR (CAAAGCTTATCAAACTGGGAGCACCCCAGATGTGGGA (SEQ ID NO:9); Ncol and Hindlll sites are underlined.
  • PCR products were cloned into the pTZ57R/T vector (Fermentas, Vilnius, Lithuania). E. coli XLl-Blue cells were used as a host for cloning and plasmid amplification. To avoid selecting clones containing PCR errors, several CP gene-containing pTZ57 plasmid clones were sequenced using a BigDye cycle sequencing kit and an ABI Prism 3100 Genetic analyzer (Applied Biosystems, Carlsbad, USA).
  • E. coli C2566 cells (New England Biolabs, Ipswich, USA) were transformed with the CMV CP gene-containing plasmid pET-CMVwt. After selection of clones with the highest expression levels of target protein, E. coli cultures were grown in 2xTY medium containing kanamycin (25 mg/1) on a rotary shaker (200 rev/min; Infors, Bottmingen, Switzerland) at 30°C to an OD600 of 0.8-1.0. Then, the cells were induced with 0.2 mM IPTG, and the medium was supplemented with 5 mM MgC12. Incubation was continued on the rotary shaker at 20°C for 18 h.
  • the resulting bio mass was collected by low- speed centrifugation and was frozen at -20°C. After thawing on ice, the cells were suspended in the buffer containing 50 mM sodium citrate, 5 mM sodium borate, 5 mM EDTA, 5 mM mercaptoethanol (pH 9.0, buffer A) and were disrupted by ultrasonic treatment. Insoluble proteins and cell debris were removed by centrifugation (13,000 rpm, 30 min at 5°C). The soluble CMV CP protein in clarified lysate was pelleted using saturated ammonium sulfate (1 : 1, vol/vol) overnight at +4°C.
  • Precipitated proteins were solubilized in the same buffer A (without mercaptoethanol) for 4 h at +4°C. Insoluble proteins were removed by low speed centrifugation (13,000 rpm, 15 min at 4°C). Soluble CMV CP-containing protein solution was separated from the cellular proteins by ultracentrifugation (SW28 rotor, Beckman, Palo Alto, USA; at 25,000 rpm, 6 h, 5°C) in a sucrose gradient (20-60% sucrose in buffer A, without mercaptoethanol, supplemented with 0.5% Triton X-100). The gradient was divided into six fractions, starting at the bottom of the gradient, and the fractions were analyzed by SDS- PAGE (data not shown).
  • the concentration of purified CMVwt was estimated using the QuBit fluorometer in accordance with manufacturer's recommendations (Invitrogen, Eugene, USA). Concentrated VLP solutions (approx. 3 mg/ml) were stored at +4°C in 5 mM sodium borate, 2 mM EDTA, buffer (pH 9.0). All steps involved in the expression and purification of VLP were monitored by SDS-PAGE using 12.5% gels.
  • CMV coat protein can be successfully expressed in E.coli cells and significant part obtained can be in soluble fraction. Moreover, these proteins are found directly in E.coli cell extracts in the form of isometric VLPs, as demonstrated by sucrose gradient analysis (FIG. 2A), dynamic light scattering and electron-microscopy analysis (FIG. 2B).
  • the pET-CMVwt plasmid was used for PCR amplification and mutagenesis.
  • a Sail site located within the CMVwt gene (FIG. l) was used for cloning the corresponding PCR products.
  • pET-220 AGCACCGCCGCCGCAAGGAA (SEQ ID NO: 11) -upstream from polylinker, the amplified region includes Bglll site) and CMV-tt83-lR (ATTTGGAGTTGGCCTTAATATACTGGCCCATGGTATATCTCCTTCTTAAAGT) (SEQ ID NO: 12).
  • the PCR product from the first amplification was diluted 1 :50 and re-amplified with primers pET-220 (SEQ ID NO: 11) and CMV-tt83Sal-R2 (GACGTCGACGCTCGGTAATCCCGATAAATTTGGAGTTGGCCTTAATATACTG) (SEQ ID NO: 13).
  • the resulting PCR product (cDNA of SEQ ID NO: 14 coding for CMV- Ntt830 of SEQ ID NO:6) was subcloned in Bglll/SaLI sites of pET-CMVwt. The correct clone was identified by sequencing and designated pET-CMV-Ntt830.
  • E. coli C2566 cells (New England Biolabs, Ipswich, USA) were transformed with the CMV-Ntt830 gene-containing plasmid pET-CMV-Ntt830.
  • E. coli cultures were grown in 2xTY medium containing kanamycin (25 mg/1) in a rotary shaker (200 rev/min; Infors, Bottmingen, Switzerland) at 30°C to an OD600 of 0.8-1.0. The, cells were then induced with 0.2 mM IPTG, and the medium supplemented with 5 mM MgCl 2 .
  • Precipitated proteins were solubilized in the buffer A (without mercaptoethanol) for 4 h at +4°C. Insoluble proteins were removed by low speed centrifugation (13,000 rpm, 15 min at 4°C). Soluble CMV-Ntt830-containing protein solution was separated from cellular proteins by ultracentrifugation (SW28 rotor, Beckman, Palo Alto, USA; at 25,000 rpm, 6 h, 5°C) in a sucrose gradient (20-60% sucrose in buffer A, without mercaptoethanol, supplemented with 0.5% Triton X-100). The gradient was divided into six fractions, starting at the bottom of the gradient.
  • CMV-Ntt830 Fractions containing recombinant CMV- Ntt830 were combined and dialyzed against 200 volumes of 5 mM sodium borate, 2 mM EDTA (pH 9.0) to remove the sucrose and Triton X-100. After dialysis, CMV-Ntt830 solution was sterilized by filtration through a 0.2 ⁇ filter. Next, CMV-Ntt830 was concentrated using Type70 rotor (Beckman, Palo Alto, USA) ultracentrifugation through the 20%> sucrose "cushion" under sterile conditions (50 000 rpm, 4 h, +5°C).
  • the concentration of purified CMV-Ntt830 was estimated using the QuBit fluorometer in accordance with manufacturer's recommendations (Invitrogen, Eugene, USA). Concentrated VLP solutions (approx. 3 mg/ml) were stored at +4°C in 5 mM sodium borate, 2 mM EDTA, buffer (pH 9.0). All steps involved in the expression and purification of VLP were monitored by SDS-PAGE using 12.5% gels. To demonstrate the presence of the tetanus toxoid epitope in CMV VLPs, mass spectrometric analysis of the purified CMV-Ntt830 VLPs was used. As shown in FIG.
  • the major peak obtained corresponds to the theoretical molecular mass of the protein if the first methionine is removed which occurs during protein synthesis in E.coli cells.
  • Dynamic light scattering and electron microscopy confirmed isometric particle morphology similar to CMVwt VLPs (FIG. 4 A and 4B).
  • CMV-Npadr modified Coat Protein of CMV containing a PADRE epitope
  • PCR mutagenesis was carried out using as the template for amplification and subcloning the pET-CMVwt plasmid (see also Example 2 and 3).
  • primers were used: pET- 220 (SEQ ID NO: 11) and CMV-padrSal-R
  • GGCCACAAATTTCGCCATGGT (SEQ ID NO: 15).
  • the resulting PCR product (cDNA of SEQ ID NO: 16 coding for CMV-Npadr of SEQ ID NO:7) was again subcloned in BghT/Sall sites of pET-CMVwt. The correct clone was identified by sequencing and designated as pET- CMV-Npadr.
  • CMV-Npadr VLPs The procedures for expression and purification of CMV-Npadr were essentially the same as for CMV-Ntt830 and are described in Example 4.
  • the mass spectrometric analysis of the purified CMV-Npadr VLPs was used.
  • the major peak obtained corresponds to the theoretical molecular mass of the protein if the first methionine is removed which occurs during protein synthesis in E.coli cells.
  • Dynamic light scattering and electron microscopy analysis confirmed isometric particle morphology, (FIG. 5A and FIG. 5B).
  • Canine IL31 cDNA sequence with E.coli optimised codons, N-terminal 6xHis tag, TEV protease cleavage site, C-terminal cysteine and flanking Ncol and Pstl restriction sites (SEQ ID NO: 17) was manufactured in company IDT. Further, Ncol/Pstl fragment was ligated into the corresponding sites of vector pET42. Construct was transformed in chemically competent E. coli DH5 cells and colonies were seeded on LB agar plate containing ampicillin. The sequence of resulting clones was verified by Sanger sequencing. The resulting construct pET42_6HcIL31C was further transformed in chemically competent E. coli BL21- DE3 cells.
  • Seeding material stock was prepared by seeding IL31-pET42 transformed BL31-DE3 cells into LB medium containing 50 ⁇ g/ml ampicillin, and incubating overnight at +37°C. The stock was then added to 2TY medium in volume proportion 1 :20. Cells were grown at +37°C with shaking until optical density at 540 nm reached 0.7 units. Then protein (SEQ ID NO: 18) expression was induced with 1 mM IPTG, and cells were grown for additional 4 hours at +37°C with shaking. Protein production was confirmed by loading the total cell lysate on SDS-PAGE (FIG. 6).
  • Bio mass was collected with centrifugation and suspended in ice-cold lysis buffer containing 40 mM Tris-HCl (pH 8.0), 200 mM NaCl, 20 mM MgS0 4 , 0.1 mg/ml DNasel, lmM PMSF and 1% Triton X-100, maintaining proportion of 1 g wet cells per 5 ml of lysis buffer.
  • Cells were lysed with ultrasound sonification on ice, the obtained lysate was centrifuged for 40 min at 15000g and supernatant discarded.
  • Pellet was resuspended by vortexing and incubated on rotary shaker for 1 h at room temperature and centrifugated for 15 min at 15000g.
  • Target protein was located in the pellet fraction.
  • Canine IL-31 was amplified from plasmid, containing SEQ ID NO: 17 with PCR, using primers cIL31NATf (TACACCATGGCCTCCCACATGGCTCCAACG, SEQ ID NO: 19) and cIL3 INATr (CATACTGCAGTTACTGCGGTCCACTGTTTAAG, SEQ ID NO:20) containing Pstl and Ncol sites.
  • the obtained cIL-31 PCR fragment was digested with Pstl and Ncol restriction enzymes and ligated in the corresponding sites of pET42 vector.
  • Construct was transformed in chemically competent E. coli DH5 cells and colonies were seeded on LB agar plate containing ampicillin. Positive clones were identified by Sanger sequencing.
  • cIL31- pET42 construct was then transformed in chemically competent E. coli BL21-DE3 cells.
  • Seeding material stock was prepared by seeding cIL31-pET42 transformed BL31-DE3 cells into LB medium containing 50 ⁇ g/ml ampicillin, and incubating overnight at +37°C. The stock was then added to 2TY medium in volume proportion 1 :20. Cells were grown at +37°C with shaking until optical density at 540 nm reached 0.7 units. Then protein (SEQ ID NO:21) expression was induced with 1 mM IPTG, and cells were grown for additional 4 hours at +37°C with shaking. Protein production was confirmed by loading the total cell lysate on SDS-PAGE (FIG. 9).
  • Biomass was collected by centrifugation and suspended in ice-cold lysis buffer containing 40 mM Tris-HCl (pH 8.0), 200 mM NaCl, 20 mM MgS0 4 , 0.1 mg/ml DNasel, lmM PMSF and 1% Triton X-100, maintaining proportion of 1 g cells per 5 ml of lysis buffer.
  • Cells were lysed with ultrasound sonification on ice and the obtained lysate was centrifuged for 40 min at 15000g. Supernatant was discarded, and lysis buffer was added to the pellet, maintaining proportion of 1.5 ml of lysis buffer to lg of initial wet cell mass.
  • Pellet was suspended in solution by ultrasound sonification, and the solution was centrifuged for 20 min at 15000g. Supernatant was discarded, and pellet was washed 5 more times with lysis buffer as described above. After washing steps, pellet was re-suspended in 6.86 M urea and 20 mM dithiotreithol by ultrasound sonification. Solution was centrifuged for 20 min at 15000g, and supernatant was diluted in refolding buffer containing 50 mM Tris-HCl, 1 M glycine, 1 mM EDTA and 5 mM ⁇ -mercaptoethanol, maintaining proportion of 75 ml refolding buffer per 1 ml of urea-dithiotreithol solution.
  • Refolding was performed overnight at +4°C with stirring.
  • the solution was then filtrated using 22 ⁇ filter and concentrated with ultrafiltration using 10 kDa device (Amicon) from 200 ml to 4 ml.
  • the solution was then centrifuged at 15000 g for 10 minutes to remove remaining precipitate.
  • the solution was loaded on Superdex 200 gel filtration column (16x600 mm), previously equilibrated in refolding buffer, and fractionated (2ml per fraction, flow speed 2 ml/min). Fractions containing cIL-31 protein were identified with SDS-PAGE electrophoresis, pooled and concentrated with ultrafiltration using 10 kDa device (Amicon) to the volume of 3 ml.
  • Re- chromatography was performed on the same Superdex 200 gel filtration column as previously. Column in re-chromatography step was equilibrated in PBS buffer (0.1 M sodium phosphate, pH 7.2 and 0.15 M NaCl). Fractions were analysed with SDS-PAGE electrophoresis (FIG. 10), and four fractions containing the purest cIL-31 protein (SEQ ID NO:21) were pooled, concentrated to 4mg/ml by ultrafiltration on 10 kDa device (Amicon) and further used for coupling experiments to CMV VLPs.
  • PBS buffer 0.1 M sodium phosphate, pH 7.2 and 0.15 M NaCl
  • Sulfhydrylgroups were deprotected by addition of 10 ⁇ L of deacetylation solution (0.5 M hydroxylamine and 25 mM EDTA in PBS ) and incubation for 2h at RT.
  • Deacetylat ion solution was removed by 4x buffer exchange to PBS with Amicon Ultra-0.5 3K filtration units (Merck-Millipore) and final volume adjusted to 100 ⁇ .
  • the amount of SMPH refers to 7.5x molar excess regarding one VLP monomer, i.e. one CMV polypeptide.
  • Unreacted SMPH was removed by 4x buffer exchange to 5 mM aHPOi pH 7.5, 2 mM EDTA pH 8.0 with Amicon Ultra-0.5 3K filtration units (Merck-Millipore) and final volume adjusted to 250 ⁇ .
  • mice are bled on days 0 (pre-immune), day 14, and day 28, and sera are analyzed using cIL-31 specific ELISA.
  • ELISA The antibody response in mouse sera is analyzed at the indicated time.
  • Antibodies specific for cIL-31 is analyzed by coating ELISA plates with a concentration of 5 ⁇ g/ml of recombinant cIL-31 in a volume of 100 ⁇ in PBS (pH 7.2) at 4°C overnight.
  • ELISA plates are washed 5x with 200 ⁇ PBS containing 0.05% Tween20 (pH 7.2, PBST). In order to avoid unspecific binding the ELISA plates are blocked with 200 ⁇ of 2% BSA in PBST and incubated for 2 hours at RT.
  • the serum samples are diluted in 2% BSA/PBST.
  • Pre-diluted sera are transferred onto the coated plates and further serial diluted to obtain antibody titers based on OD50 calculation. After 2 hours of incubation at RT, the ELISA plates are washed 5x with 200 ⁇ of PBST. Binding of serum antibodies is detected by horse-radish peroxidase- conjugated goat anti-mouse IgG (Jackson ImmunoResearch). The detection antibody is diluted 1 : 1000 in 2% BSA/PBST and a volume of 100 ⁇ per sample was transferred. The plates are incubated for 1 hour at RT. ELISA plates are washed as described before. Prior washing the substrate solution is prepared.
  • Groups of five dogs are either immunized s.c. on day 0 and day 14, day 28 and day 42 with 50 ug of CMV-Npadr VLP and CMV-Ntt830 VLP coupled via SATA to cIL-31 of SEQ ID NO:21 formulated in PBS. Dogs are bled on days 0 (pre-immune), day 14, day 28, day 42 and day 56 and sera are analyzed using cIL-31 specific ELISA.
  • Antibodies specific for cIL-31 is analyzed by coating ELISA plates with a concentration of 5 ⁇ g/ml of recombinant cIL-31 in a volume of 100 ⁇ in PBS (pH 7.2) at 4°C overnight. ELISA plates are washed 5x with 200 ⁇ PBS containing 0.05%> Tween20 (pH 7.2, PBST). In order to avoid unspecific binding the ELISA plates are blocked with 200 ⁇ of 2% BSA in PBST and incubated for 2 hours at RT. The serum samples are diluted in 2% BSA/PBST. Pre-diluted sera are transferred onto the coated plates and further serial diluted to obtain antibody titers based on OD50 calculation.
  • the ELISA plates are washed 5x with 200 ⁇ of PBST. Binding of serum antibodies is detected by horse-radish peroxidase- conjugated goat anti-dog IgG (Jackson ImmunoResearch). The detection antibody is diluted 1 : 1000 in 2% BSA/PBST and a volume of 100 ⁇ per sample was transferred. The plates are incubated for 1 hour at RT. ELISA plates are washed as described before. Prior washing the substrate solution is prepared.
  • Groups of 15 dogs with atopic dermatitis are immunized s.c. on day 0 and day 14, day 28, day 56 and and day 80 with 50 ug CMV-Ntt830 VLP coupled via SATA to cIL-31 of SEQ ID NO:21 or CMV-Ntt830 alone formulated in Alum. Disease severity is measured by visual inspection before immunization and on day 28, day 56, day 80 and day 120.
  • ADLI Atopic Dermatitis Lesion Index
  • PVAS Pruritus Visual Analog Score
  • the ADLI score is a validated composite index of six clinical symptoms associated with canine atopic dermatitis evaluated in five specified body regions. At each specified body region, each parameter is scored by the scorer from zero to five, with a score of zero defined as no lesion and a score of five defined as a severe/extensive lesions.
  • PVAS is scored by the scorer using a zero to ten analog scale, with a score of zero representing no pruritus/chewing and a score of ten equating to inceimpuls and intense pruritus/chewing.
  • CAD scoring of treated dogs is compared to baseline as well as to scores of dogs treated with placebo.
  • FIG 13A shows the scratching behavior of the dogs before and after vaccination. There was a strong reduction in scratching, with 5/6 immunized dogs essentially stopped scratching while the behavior of placebo treated animals did not change.
  • cIL-31 specific IgG titers The antibody response in dog sera was analyzed on day 28. Antibodies specific for cIL-31 was analyzed by coating ELISA plates with a concentration of 3 ⁇ g/ml of recombinant cIL-31 in a volume of 100 ⁇ in PBS (pH 7.2) at 4°C overnight. ELISA plates were washed 5x with 200 ⁇ PBS containing 0.05% Tween20 (pH 7.2, PBST). In order to avoid unspecific binding, the ELISA plates were blocked with 200 ⁇ of 2% BSA in PBST and incubated for 2 hours at RT. The serum samples are diluted in 2% BSA/PBST.
  • Pre-diluted sera (10-fold) were transferred onto the coated plates and further serial diluted (3-fold steps) to obtain an tibody titers based on OD50 calculation. After 2 hours of incubation at RT, the ELISA plates are washe 5x with 200 ⁇ of PBST. Binding of serum antibodies was detected by horse-radish peroxidase- conjugated goat anti-dog IgG (Jackson ImmunoResearch). The detection antibody was diluted 1 : 1000 in 2% BSA/PBST and a volume of 100 ⁇ per sample was transferred. The plates were incubated for 1 hour at RT. ELISA plates are washed as described before. Prior washing the 5 substrate solution was prepared.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Genetics & Genomics (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Rheumatology (AREA)
  • Dermatology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Pain & Pain Management (AREA)
  • Endocrinology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicinal Preparation (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/EP2017/059977 2016-04-27 2017-04-26 Treatment of canine atopic dermatitis Ceased WO2017186813A1 (en)

Priority Applications (19)

Application Number Priority Date Filing Date Title
EA201892003A EA201892003A1 (ru) 2016-04-27 2017-04-26 Лечение атопического дерматита собак
CA3019653A CA3019653A1 (en) 2016-04-27 2017-04-26 Treatment of canine atopic dermatitis
BR112018071965A BR112018071965A2 (pt) 2016-04-27 2017-04-26 tratamento da dermatite atópica canina
EP17723294.9A EP3448422A1 (en) 2016-04-27 2017-04-26 Treatment of canine atopic dermatitis
CN201780025651.8A CN109562156B (zh) 2016-04-27 2017-04-26 犬特应性皮炎的治疗
NZ747512A NZ747512A (en) 2016-04-27 2017-04-26 Treatment of canine atopic dermatitis
JP2019508291A JP7039561B2 (ja) 2016-04-27 2017-04-26 イヌアトピー性皮膚炎の治療
AU2017256727A AU2017256727B2 (en) 2016-04-27 2017-04-26 Treatment of canine atopic dermatitis
KR1020187031190A KR102469478B1 (ko) 2016-04-27 2017-04-26 개 아토피성 피부염의 치료
US16/097,156 US10946078B2 (en) 2016-04-27 2017-04-26 Treatment of canine atopic dermatitis
CN202310179224.2A CN116688110A (zh) 2016-04-27 2017-04-26 犬特应性皮炎的治疗
UAA201809978A UA126852C2 (uk) 2016-04-27 2017-04-26 Лікування атопічного дерматиту собак
KR1020227040222A KR20220162800A (ko) 2016-04-27 2017-04-26 개 아토피성 피부염의 치료
MX2018012973A MX394254B (es) 2016-04-27 2017-04-26 Composiciones para el tratamiento de dermatitis atópica canina y sus usos.
ZA2018/06503A ZA201806503B (en) 2016-04-27 2018-10-01 Treatment of canine atopic dermatitis
CONC2018/0011087A CO2018011087A2 (es) 2016-04-27 2018-10-16 Tratamiento de dermatitis atópica canina
JP2022036245A JP7273214B2 (ja) 2016-04-27 2022-03-09 イヌアトピー性皮膚炎の治療
AU2022291431A AU2022291431B2 (en) 2016-04-27 2022-12-19 Treatment of canine atopic dermatitis
AU2026202093A AU2026202093A1 (en) 2016-04-27 2026-03-18 Treatment of canine atopic dermatitis

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP16167264 2016-04-27
EP16167264.7 2016-04-27

Publications (1)

Publication Number Publication Date
WO2017186813A1 true WO2017186813A1 (en) 2017-11-02

Family

ID=56024099

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2017/059977 Ceased WO2017186813A1 (en) 2016-04-27 2017-04-26 Treatment of canine atopic dermatitis

Country Status (17)

Country Link
US (1) US10946078B2 (https=)
EP (1) EP3448422A1 (https=)
JP (2) JP7039561B2 (https=)
KR (2) KR102469478B1 (https=)
CN (2) CN116688110A (https=)
AR (1) AR108333A1 (https=)
AU (3) AU2017256727B2 (https=)
BR (1) BR112018071965A2 (https=)
CA (1) CA3019653A1 (https=)
CL (1) CL2018002960A1 (https=)
CO (1) CO2018011087A2 (https=)
EA (1) EA201892003A1 (https=)
MX (2) MX394254B (https=)
NZ (1) NZ747512A (https=)
UA (1) UA126852C2 (https=)
WO (1) WO2017186813A1 (https=)
ZA (1) ZA201806503B (https=)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019178601A1 (en) * 2018-03-16 2019-09-19 Zoetis Services Llc Peptide vaccines against interleukin-31
WO2019118512A3 (en) * 2017-12-11 2020-04-09 Ubi Ip Holdings Peptide immunogens of il-31 and formulations thereof for the treatment and/or prevention of atopic dermatitis
WO2020128037A1 (en) * 2018-12-20 2020-06-25 Saiba Gmbh Virus-like particles of cmv modified by fusion
US11530262B2 (en) 2018-03-16 2022-12-20 Zoetis Services Llc Interleukin-31 monoclonal antibodies for veterinary use
RU2786441C2 (ru) * 2018-03-16 2022-12-21 ЗОЕТИС СЕРВИСИЗ ЭлЭлСи Пептидные вакцины против интерлейкина-31
US12605454B2 (en) 2014-10-22 2026-04-21 Saiba AG Modified virus-like particles of CMV

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003024481A2 (en) 2001-09-14 2003-03-27 Cytos Biotechnology Ag Packaging of immunostimulatory substances into virus-like particles: method of preparation and use
WO2006032674A1 (en) * 2004-09-21 2006-03-30 Cytos Biotechnology Ag Virus-like particles comprising a fusion protein of the coat protein of ap205 and an antigenic polypeptide
WO2007068747A1 (en) 2005-12-14 2007-06-21 Cytos Biotechnology Ag Immunostimulatory nucleic acid packaged particles for the treatment of hypersensitivity
WO2015042596A1 (en) 2013-09-23 2015-03-26 Kindred Biosciences, Inc Treatment of atopic dermatitis in non-human animals
WO2016062720A1 (en) * 2014-10-22 2016-04-28 Saiba Gmbh Modified virus-like particles of cmv

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040024004A1 (en) 2001-05-04 2004-02-05 Sherman Barry M. Novel compositions and methods for enhancing potency or reducing adverse side effects of opioid agonists
CN101023103A (zh) * 2004-09-21 2007-08-22 赛托斯生物技术公司 包含ap205外壳蛋白和抗原性多肽的融合蛋白的病毒样颗粒
EP1858924A1 (en) * 2005-02-14 2007-11-28 ZymoGenetics, Inc. Methods of treating skin disorders using an il-31ra antagonist
WO2008112674A1 (en) 2007-03-12 2008-09-18 Irm Llc Compounds and compositions as inhibitors of cannabinoid receptor 1 activity
US8465756B2 (en) * 2009-08-12 2013-06-18 National Health Research Institutes Immunogenic peptides of tumor associated antigen L6 and uses thereof in cancer therapy
US8790651B2 (en) * 2011-07-21 2014-07-29 Zoetis Llc Interleukin-31 monoclonal antibody
EP2941646A1 (en) 2013-01-04 2015-11-11 Bristol-Myers Squibb Company Positive allosteric modulators and silent allosteric modulators of the opioid receptor

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003024481A2 (en) 2001-09-14 2003-03-27 Cytos Biotechnology Ag Packaging of immunostimulatory substances into virus-like particles: method of preparation and use
WO2006032674A1 (en) * 2004-09-21 2006-03-30 Cytos Biotechnology Ag Virus-like particles comprising a fusion protein of the coat protein of ap205 and an antigenic polypeptide
WO2007068747A1 (en) 2005-12-14 2007-06-21 Cytos Biotechnology Ag Immunostimulatory nucleic acid packaged particles for the treatment of hypersensitivity
WO2015042596A1 (en) 2013-09-23 2015-03-26 Kindred Biosciences, Inc Treatment of atopic dermatitis in non-human animals
WO2016062720A1 (en) * 2014-10-22 2016-04-28 Saiba Gmbh Modified virus-like particles of cmv

Non-Patent Citations (20)

* Cited by examiner, † Cited by third party
Title
ÁKOS GELLÉRT ET AL: "A Cucumber Mosaic Virus Based Expression System for the Production of Porcine Circovirus Specific Vaccines", PLOS ONE, vol. 7, no. 12, 20 December 2012 (2012-12-20), pages e52688, XP055221371, DOI: 10.1371/journal.pone.0052688 *
ALAIN C. TISSOT ET AL: "Versatile Virus-Like Particle Carrier for Epitope Based Vaccines", PLOS ONE, vol. 5, no. 3, 23 March 2010 (2010-03-23), pages e9809, XP055155235, DOI: 10.1371/journal.pone.0009809 *
ALEXANDER J ET AL., IMMUNITY, vol. 1, 1994, pages 751 - 761
ANDREA J. GONZALES ET AL: "Interleukin-31: its role in canine pruritus and naturally occurring canine atopic dermatitis", VETERINARY DERMATOLOGY., vol. 24, no. 1, 19 February 2013 (2013-02-19), GB, pages 48 - e12, XP055284818, ISSN: 0959-4493, DOI: 10.1111/j.1365-3164.2012.01098.x *
CALVO-CALLE JM ET AL., J IMMUNOL, vol. 159, 1997, pages 1362 - 1373
DATABASE UniProt [online] 1 March 2001 (2001-03-01), "SubName: Full=Capsid protein {ECO:0000313|EMBL:ABY27309.1}; SubName: Full=Coat protein {ECO:0000313|EMBL:CAC18657.1};", XP002759444, retrieved from EBI accession no. UNIPROT:Q9DJX6 Database accession no. Q9DJX6 *
GRIFFIN CE; DEBOER DJ, VETERINARY IMMUNOLOGY AND IMMUNOPATHOLOGY, vol. 81, 2001, pages 255 - 269
HANNA BERNIAK ET AL: "Cucumber mosaic virus groups IA and II are represented among isolates from naturally infected lilies", EUROPEAN JOURNAL OF PLANT PATHOLOGY, KLUWER ACADEMIC PUBLISHERS, DO, vol. 127, no. 3, 14 March 2010 (2010-03-14), pages 305 - 309, XP019817308, ISSN: 1573-8469 *
HENSEL P ET AL., BMC VETERINARY RESEARCH, vol. 11, 2015, pages 196 - 209
K KASUTANI ET AL: "Anti-IL-31 receptor antibody is shown to be a potential therapeutic option for treating itch and dermatitis in mice", BRITISH JOURNAL OF PHARMACOLOGY, 5 September 2014 (2014-09-05), pages n/a - n/a, XP055141286, ISSN: 0007-1188, DOI: 10.1111/bph.12823 *
K.E. LEWIS ET AL: "Interleukin (IL) 31 induces in cynomolgus monkeys a rapid and intense itch response that can be inhibited by an IL-31 neutralizing antibody", JEADV. JOURNAL OF THE EUROPEAN ACADEMY OF DERMATOLOGY AND VENEREOLOGY., vol. 31, no. 1, 8 January 2017 (2017-01-08), NL, pages 142 - 150, XP055389924, ISSN: 0926-9959, DOI: 10.1111/jdv.13794 *
KAUMAYA P T P ET AL: "PEPTIDE VACCINES INCORPORATING A 'PROMISCUOUS' T-CELL EPITOPE BYPASS CERTAIN HAPLOTYPE RESTRICTED IMMUNE RESPONSES AND PROVIDE BROAD SPECTRUM IMMUNOGENICITY", JOURNAL OF MOLECULAR RECOGNITION, HEYDEN & SON LTD., LONDON, GB, vol. 6, 1 January 1993 (1993-01-01), pages 81 - 94, XP000939315, ISSN: 0952-3499, DOI: 10.1002/JMR.300060206 *
KHAIRUNADWA JEMON ET AL: "An Enhanced Heterologous Virus-Like Particle for Human Papillomavirus Type 16 Tumour Immunotherapy", PLOS ONE, vol. 8, no. 6, 14 June 2013 (2013-06-14), pages e66866, XP055221454, DOI: 10.1371/journal.pone.0066866 *
MEURY S ET AL., VET DERMATOL, vol. 22, 2011, pages 327 - 334
NODTVEDT A ET AL., PREV VET MED, vol. 78, 2007, pages 210 - 222
NUTTALL T. ET AL., VETERINARY RECORD, vol. 174, no. 2, 2014, pages 3 - 12
ØYSTEIN GRIMSTAD ET AL: "Anti-interleukin-31-antibodies ameliorate scratching behaviour in NC/Nga mice: a model of atopic dermatitis", EXPERIMENTAL DERMATOLOGY, vol. 18, no. 1, 1 January 2009 (2009-01-01), pages 35 - 43, XP055001458, ISSN: 0906-6705, DOI: 10.1111/j.1600-0625.2008.00766.x *
PANINA-BORDIGNON P ET AL., EUR J IMMUNOL, vol. 19, 1989, pages 2237 - 2242
SETTE A ET AL., J IMMUNOL, vol. 142, 1989, pages 35 - 40
VALMORI D ET AL., J IMMUNOL, vol. 149, 1992, pages 717 - 721

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12605454B2 (en) 2014-10-22 2026-04-21 Saiba AG Modified virus-like particles of CMV
JP7250032B2 (ja) 2017-12-11 2023-03-31 ユービーアイ アイピー ホールディングス アトピー性皮膚炎の治療及び/または予防のためのil-31のペプチド免疫原ならびにその製剤
RU2799440C2 (ru) * 2017-12-11 2023-07-05 ЮБИ АйПи ХОЛДИНГЗ Пептидные иммуногены il-31 и их составы для лечения и/или профилактики атопического дерматита
WO2019118512A3 (en) * 2017-12-11 2020-04-09 Ubi Ip Holdings Peptide immunogens of il-31 and formulations thereof for the treatment and/or prevention of atopic dermatitis
KR102745247B1 (ko) * 2017-12-11 2024-12-23 유비아이 아이피 홀딩스 아토피성 피부염의 치료 및/또는 예방을 위한 il-31의 펩타이드 면역원 및 이의 제형물
KR20210009296A (ko) * 2017-12-11 2021-01-26 유비아이 아이피 홀딩스 아토피성 피부염의 치료 및/또는 예방을 위한 il-31의 펩타이드 면역원 및 이의 제형물
JP2021510169A (ja) * 2017-12-11 2021-04-15 ユービーアイ アイピー ホールディングスUbi Ip Holdings アトピー性皮膚炎の治療及び/または予防のためのil−31のペプチド免疫原ならびにその製剤
TWI741241B (zh) * 2017-12-11 2021-10-01 美商聯合生物醫學公司 用於治療及/或預防異位性皮膚炎之il-31胜肽免疫原及其劑型
US11433139B2 (en) 2018-03-16 2022-09-06 Zoetis Services Llc Peptide vaccines against interleukin-31
US12084494B2 (en) 2018-03-16 2024-09-10 Zoetis Services Llc Interleukin-31 monoclonal antibodies for veterinary use
US11530262B2 (en) 2018-03-16 2022-12-20 Zoetis Services Llc Interleukin-31 monoclonal antibodies for veterinary use
KR20200142010A (ko) * 2018-03-16 2020-12-21 조에티스 서비시즈 엘엘씨 인터루킨-31에 대한 펩티드 백신
RU2786441C2 (ru) * 2018-03-16 2022-12-21 ЗОЕТИС СЕРВИСИЗ ЭлЭлСи Пептидные вакцины против интерлейкина-31
AU2019236328B2 (en) * 2018-03-16 2025-10-09 Zoetis Services Llc Peptide vaccines against Interleukin-31
KR102672548B1 (ko) * 2018-03-16 2024-06-04 조에티스 서비시즈 엘엘씨 인터루킨-31에 대한 펩티드 백신
WO2019178601A1 (en) * 2018-03-16 2019-09-19 Zoetis Services Llc Peptide vaccines against interleukin-31
CN112135628B (zh) * 2018-03-16 2024-11-22 硕腾服务有限责任公司 抗白介素31的肽疫苗
CN112135628A (zh) * 2018-03-16 2020-12-25 硕腾服务有限责任公司 抗白介素31的肽疫苗
US12343402B2 (en) 2018-03-16 2025-07-01 Zoetis Services Llc Method of determining the identity and/or amount of an anti-IL-31 antibody in a sample
IL284135B2 (en) * 2018-12-20 2025-07-01 Saiba AG Virus-like particles of cmv modified by fusion
IL284135B1 (en) * 2018-12-20 2025-03-01 Saiba AG Virus-like particles of cmv modified by fusion
RU2845190C2 (ru) * 2018-12-20 2025-08-14 Сайба Аг Вирусоподобные частицы cmv, модифицированные путем слияния
CN113301918A (zh) * 2018-12-20 2021-08-24 塞坝股份公司 Cmv的通过融合修饰的病毒样颗粒
WO2020128037A1 (en) * 2018-12-20 2020-06-25 Saiba Gmbh Virus-like particles of cmv modified by fusion

Also Published As

Publication number Publication date
US20190209668A1 (en) 2019-07-11
EP3448422A1 (en) 2019-03-06
MX394254B (es) 2025-03-24
AU2017256727B2 (en) 2022-09-29
AU2017256727A1 (en) 2018-11-15
NZ747512A (en) 2023-05-26
JP2022078254A (ja) 2022-05-24
EA201892003A1 (ru) 2019-05-31
KR20220162800A (ko) 2022-12-08
AU2022291431A1 (en) 2023-03-30
CN116688110A (zh) 2023-09-05
JP7039561B2 (ja) 2022-03-22
KR20190003948A (ko) 2019-01-10
CA3019653A1 (en) 2017-11-02
CN109562156A (zh) 2019-04-02
BR112018071965A2 (pt) 2019-03-06
AU2026202093A1 (en) 2026-04-09
NZ787511A (en) 2025-10-31
MX2022009171A (es) 2022-08-17
CL2018002960A1 (es) 2019-01-25
US10946078B2 (en) 2021-03-16
CN109562156B (zh) 2023-03-10
AU2022291431B2 (en) 2025-12-18
JP7273214B2 (ja) 2023-05-12
AR108333A1 (es) 2018-08-08
CO2018011087A2 (es) 2019-02-08
ZA201806503B (en) 2019-07-31
JP2019515957A (ja) 2019-06-13
UA126852C2 (uk) 2023-02-15
KR102469478B1 (ko) 2022-11-23

Similar Documents

Publication Publication Date Title
US12605454B2 (en) Modified virus-like particles of CMV
AU2022291431B2 (en) Treatment of canine atopic dermatitis
AU2016319075B2 (en) Compositions against cat allergy
US10898569B2 (en) Treatment of peanut allergy
EP4580668A2 (en) Veterinary compositions of modified virus-like particles of cmv and ngf antigens
US20250281587A1 (en) Veterinary compositions of modified virus-like particles of cmv and feline il-1 beta mutein antigens
EA045381B1 (ru) Лечение атопического дерматита собак

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref document number: 3019653

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 201892003

Country of ref document: EA

ENP Entry into the national phase

Ref document number: 2019508291

Country of ref document: JP

Kind code of ref document: A

Ref document number: 20187031190

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112018071965

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2017256727

Country of ref document: AU

Date of ref document: 20170426

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2017723294

Country of ref document: EP

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17723294

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2017723294

Country of ref document: EP

Effective date: 20181127

ENP Entry into the national phase

Ref document number: 112018071965

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20181025