WO2017065505A1 - 아모르피제니를 유효성분으로 함유하는 피부 미백용 조성물 - Google Patents

아모르피제니를 유효성분으로 함유하는 피부 미백용 조성물 Download PDF

Info

Publication number
WO2017065505A1
WO2017065505A1 PCT/KR2016/011464 KR2016011464W WO2017065505A1 WO 2017065505 A1 WO2017065505 A1 WO 2017065505A1 KR 2016011464 W KR2016011464 W KR 2016011464W WO 2017065505 A1 WO2017065505 A1 WO 2017065505A1
Authority
WO
WIPO (PCT)
Prior art keywords
composition
amorphigeni
melanin
present
acid
Prior art date
Application number
PCT/KR2016/011464
Other languages
English (en)
French (fr)
Inventor
김광동
유지윤
박수종
오상석
김대욱
박기훈
이기원
Original Assignee
경상대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 경상대학교산학협력단 filed Critical 경상대학교산학협력단
Priority to CN201680059088.1A priority Critical patent/CN108135818B/zh
Priority to EP16855722.1A priority patent/EP3363426B1/en
Priority to JP2018518632A priority patent/JP6629968B2/ja
Priority to US15/768,609 priority patent/US10500146B2/en
Publication of WO2017065505A1 publication Critical patent/WO2017065505A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/49—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds
    • A61K8/4973—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds with oxygen as the only hetero atom
    • A61K8/498—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds with oxygen as the only hetero atom having 6-membered rings or their condensed derivatives, e.g. coumarin
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/352—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline 
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • A61K8/9783—Angiosperms [Magnoliophyta]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • A61K8/9783—Angiosperms [Magnoliophyta]
    • A61K8/9789—Magnoliopsida [dicotyledons]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0014—Skin, i.e. galenical aspects of topical compositions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/02—Preparations for care of the skin for chemically bleaching or whitening the skin
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/318—Foods, ingredients or supplements having a functional effect on health having an effect on skin health and hair or coat

Definitions

  • the present invention relates to a composition for skin whitening containing amorphigene as an active ingredient, and more specifically, to inhibit the activity of tyrosinase and to reduce melanin production and parasitic melanin content.
  • the present invention relates to a composition having a skin whitening function containing amorphisgen derived from weasel, as an active ingredient.
  • the skin is directly exposed to the external environment among the body tissues, and acts as a barrier between the internal and external environment of the human body, protecting the living body from the surrounding environment by preventing the invasion of external environmental pollutants and microorganisms including chemicals and ultraviolet rays. .
  • the skin color is determined by melanin, hemoglobin (hemoglobin), carotene (carotene), among which melanin plays the most important role.
  • melanin performs skin protection such as ultraviolet absorption and free radical scavenger.
  • excessive production of melanin due to external environmental changes such as overexposure to UV rays, air pollution, and stress causes pigmentation in the skin, causing melanism, blemishes, and freckles.
  • Blackening of the skin is caused by the response of skin cells to internal and external factors, a representative factor being due to UV exposure. That is, when the skin is exposed to ultraviolet light, tyrosinase is activated, and the tyrosinase acts on tyrosine present in the skin tissue to produce dopa (DOPA) and dopaquinone.
  • melanocytes melanocytes (melanosome) is synthesized a polymer called melanin, which is transferred to the keratinocytes (keratinocyte), the keratinocytes of the skin and reaches the skin surface by the keratinization process It protects the skin from ultraviolet rays.
  • melanin is an indispensable UV protective agent in the human body, and also serves as an effective free radical scavenger that removes various radicals that modify biological components such as proteins, lipids, nucleic acids, and the like.
  • melanin is locally excessively synthesized or the skin's physiological function decreases due to skin lesions and aging, melanin is deposited on the skin surface, causing melasma, freckles and various pigmentation.
  • the cause and mechanism of skin blackening are revealed, and a substance which has an inhibitory effect of tyrosinase, an enzyme involved in the skin blackening process in the manufacture of a whitening cosmetic, is incorporated into the cosmetic, or part of the melanin production process.
  • Methods for reducing the production of melanin by inhibiting the reaction are generally used.
  • Representative materials used for this purpose include chemicals such as ascorbic acid, kojic acid, hydroquinone and plant extracts such as lettuce extract and licorice extract.
  • ascorbic acid lacks the inhibitory effect of tyrosinase activity and is not suitable as an inhibitor of melanin production due to the low stability of the molecule itself, while kojic acid is excellent in inhibiting activity of tyrosinase, but discolored when combined with cosmetics, Therefore, not only there is a problem in stability, such as lowering the titer, the skin irritation is large, there is a limit in use, hydroquinone is limited to use in cosmetics due to skin irritation and safety problems. Therefore, attention is focused on the development of new and effective whitening ingredients.
  • Japanese Patent Laid-Open No. 194-016531 discloses a cosmetic
  • Korean Patent No. 1525090 discloses a cosmetic composition for skin whitening.
  • the skin whitening composition containing the amorphisgene of the present invention as an active ingredient.
  • the present invention was derived by the above-mentioned demands, and the present inventors have isolated and extracted amorphigeni from the root of weasel, and amorphisgen inhibits the expression of tyrosinase, and mela
  • the present invention was completed by confirming that amorphisgen of the present invention not only inhibits melanin production but also removes parasitic melanin because it induces autophagy of mesosomes.
  • the present invention provides a cosmetic composition for skin whitening containing amorphigeni or a cosmetically acceptable salt thereof as an active ingredient.
  • the present invention also provides a pharmaceutical composition for the prevention or treatment of melanin hyperpigmentation disease containing amorphigeni or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the present invention also provides a dietary supplement composition for preventing or improving melanin overdose, which contains amorphigeni or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the present invention relates to a composition for skin whitening containing amorphigeni as an active ingredient.
  • Amorphigeni of the present invention inhibits the expression of tyrosinase and melaminesomes (melasosome). Induction of autophagy of the present invention, amorphigeni of the present invention not only inhibits melanogenesis, but also exhibits the effect of removing melanin parasitic by ⁇ -MSH (melanocyte-stimulating hormone) It was confirmed. Therefore, the amorphigeni of the present invention may be usefully used as a functional material for skin whitening and lightening.
  • Amorpha is a weasel ( Amorpha) according to an embodiment of the present invention separated and purified from the roots of the amorphous fruticosa) shows the chemical structure of the blood Jenny (amorphigeni).
  • Figure 2 shows the cell viability when treated with amorphigene according to an embodiment of the present invention B16F10 mouse melanocytes by concentration.
  • Figure 3 shows the results of cell cycle measurement through a flow cytometer after staining with PI (Propidium Iodide) when Amorphisgen B16F10 mouse melanocytes in accordance with an embodiment of the present invention.
  • PI Propidium Iodide
  • Figure 4 shows the effect on the melanin content (A) and L-DOPA oxidation (B) in B16F10 mouse melanocytes when treated with ⁇ -MSH and amorphisgen according to an embodiment of the present invention.
  • Figure 5 shows the inhibitory activity against the expression of tyrosinase (TYR, tyrosinase) and PMEL (premelanosome protein) in B16F10 mouse melanocytes when treated with ⁇ -MSH and amorphisgenin according to an embodiment of the present invention will be.
  • ⁇ -tubulin is a loading control.
  • Figure 6 shows the expression levels of tyrosinase (TYR, tyrosinase) and PMEL (premelanosome protein) in B16F10 mouse melanocytes when treated with ⁇ -MSH, amorphizini and MG132 according to an embodiment of the present invention.
  • ⁇ -tubulin is known as a loading control; MG132 is a proteasome inhibitor.
  • Figure 7 shows the expression levels of tyrosinase and PMEL (premelanosome protein) in B16F10 mouse melanocytes when treated with ⁇ -MSH, amorphisgenin and 3-MA (3-methyladenine) according to an embodiment of the present invention. It is a change.
  • ⁇ -tubulin is known as a loading control; 3-MA is an autophagy inhibitor.
  • FIG. 8 shows ATG5-ATG12 in B16F10 mouse melanocytes when treated with a-MSH and amorphisgen after treatment with siATG5 knocked down ATG5 (autophagy-related gene 5) according to one embodiment of the present invention.
  • Tyrosinase and PMEL premelanosome protein expression level is shown.
  • ⁇ -tubulin is a loading control.
  • Figure 9 shows the melanin content (A) and L-DOPA oxidation (B) in B16F10 mouse melanocytes when treated with ⁇ -MSH, amorphisgene and 3-MA (3-methyladenine) according to an embodiment of the present invention. The degree is shown.
  • ⁇ -tubulin is known as a loading control; 3-MA is an autophagy inhibitor.
  • Figure 10 shows a decrease in the parasitic melanin content when treated with amorphisgen after the synthesis of the melanosomes by treatment with ⁇ -MSH according to an embodiment of the present invention.
  • 11 is a parasitic melanin content in B16F10 mouse melanocytes when treated with amorphisgene and 3-MA (3-methyladenine) after synthesizing melanosomes by treating ⁇ -MSH according to an embodiment of the present invention. It is a change.
  • ⁇ -tubulin is known as a loading control
  • 3-MA is an autophagy inhibitor
  • the present invention provides a cosmetic composition for skin whitening containing amorphigeni represented by the following formula (1) or a cosmetically acceptable salt thereof as an active ingredient.
  • the active ingredient of the cosmetic composition for skin whitening of the present invention is amorphigeni (amorphigeni) having a structure represented by the formula (1).
  • Amorphygenie of the present invention has skin whitening activity by significantly reducing melanogenesis and melanin already accumulated in melanocytes.
  • an acid addition salt formed by a cosmetically acceptable free acid is useful as a cosmetically acceptable salt thereof.
  • Acid addition salts can be prepared by conventional methods, for example by dissolving a compound in an excess of aqueous acid solution and precipitating the salt using a water miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. Equal molar amounts of the compound and acid or alcohol (eg, glycol monomethyl ether) in water can be heated and the mixture can then be evaporated to dryness or the precipitated salts can be suction filtered.
  • a water miscible organic solvent such as methanol, ethanol, acetone or acetonitrile.
  • Equal molar amounts of the compound and acid or alcohol (eg, glycol monomethyl ether) in water can be heated and the mixture can then be evaporated to dryness or the precipitated salts can be suction filtered.
  • organic acids and inorganic acids may be used as the free acid
  • hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, etc. may be used as the inorganic acid
  • methanesulfonic acid, p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, and maleic acid may be used as the organic acid.
  • maleic acid succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid, citric acid, lactic acid, glycolic acid, gluconic acid (gluconic acid), galacturonic acid, glutamic acid, glutaric acid, glucuronic acid, glucuronic acid, aspartic acid, ascorbic acid, carbonic acid, vanic acid, hydroiodic acid, and the like can be used. It is not limited.
  • the whitening effect is to improve or prevent dark skin, blemishes, freckles, dark circles caused by various factors such as exposure to ultraviolet rays, changes in hormonal balance, genetic programs, and make skin beautiful and transparent. Or it intends to maintain the beautiful skin with transparency, reduce the dullness of skin and increase the luster and tension.
  • dark skin, blemishes, freckles, and dark circles are known to be caused by melanocytes (melanocytes) are stimulated by ultraviolet light stimulation or changes in hormonal balance, and thus biosynthetic melanin pigments are deposited on the skin. Therefore, if the production of melanin can be suppressed, it is possible to prevent and improve dark skin, blemishes, freckles and dark circles.
  • the melanin production-inhibiting function of the amorpigenini was confirmed by a test method using cultured pigment cells.
  • Pigment cells are melanin-producing cells that, when cultured normally, melanin accumulates and becomes black.
  • a substance having a melanin production inhibiting function is present in the culture system, the production of melanin is suppressed and the whitening becomes relatively white.
  • the melanin production inhibitory function can be expected from this relative degree of whitening.
  • the amorfigenie may be separated from the root of Amorpha fruticosa , but is not limited thereto.
  • the amorphisgen may inhibit the activity of tyrosinase, but is not limited thereto.
  • the amorpigenini may inhibit the production of melanin or remove parasitic melanin, but is not limited thereto.
  • the cosmetic composition for skin whitening is an external skin ointment, cream, supple cosmetics, nourishing cosmetics, pack, essence, hair tonic, shampoo, conditioner, hair conditioner, hair treatment, Gel, Skin Lotion, Skin Softener, Skin Toner, Astringent, Lotion, Milk Lotion, Moisture Lotion, Nutrition Lotion, Massage Cream, Nutrition Cream, Moisture Cream, Hand Cream, Foundation, Nutrition Essence, Sunscreen, Soap, Cleansing Foam, Cleansing It may have any one formulation selected from the group consisting of lotion, cleansing cream, body lotion and body cleanser, but is not limited thereto.
  • the cosmetic composition consisting of each of these formulations may contain various bases and additives necessary for the formulation of the formulation and are suitable, and the type and amount of these components can be easily selected by those skilled in the art.
  • the cosmetic composition of the present invention may further contain one or more skin whitening active ingredients exhibiting the same or similar functions in addition to the active ingredient.
  • Skin whitening active ingredients include kojic acid and derivatives thereof, arbutin, ascorbic acid and derivatives thereof, hydroquinone and derivatives thereof, resorcinol, cycloalkanone, methylenedioxyphenyl alkanol, 2,7-dinitroindazole or Plant extracts such as vine tangerine extract, rice extract, licorice extract, and the like, but is not limited thereto.
  • the carrier component is animal fiber, vegetable fiber, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide. And the like can be used.
  • the formulation of the cosmetic composition of the present invention is a powder or a spray
  • lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as the carrier component, and in particular, in the case of a spray, additionally chlorofluorohydro Propellants such as carbon, propane-butane or dimethyl ether.
  • a solvent, solvating agent or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene.
  • a carrier component such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene.
  • the formulation of the cosmetic composition of the present invention is a suspension
  • a carrier component water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Microcrystalline cellulose, aluminum metahydroxy, bentonite, agar or tracant and the like can be used.
  • the carrier component is an aliphatic alcohol sulfate, an aliphatic alcohol ether sulfate, a sulfosuccinic acid monoester, acethionate, an imidazolinium derivative, a methyltaurate, or a sarcosinate.
  • Fatty acid amide ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, linolin derivatives or ethoxylated glycerol fatty acid esters and the like can be used.
  • the cosmetic composition of the present invention may further contain an excipient including a fluorescent substance, a fungicide, a caustic agent, a moisturizer, a fragrance, a fragrance carrier, a protein, a solubilizer, a sugar derivative, a sunscreen agent, a vitamin, a plant extract, and the like.
  • an excipient including a fluorescent substance, a fungicide, a caustic agent, a moisturizer, a fragrance, a fragrance carrier, a protein, a solubilizer, a sugar derivative, a sunscreen agent, a vitamin, a plant extract, and the like.
  • the present invention also provides a pharmaceutical composition for the prevention or treatment of melanin hyperpigmentation disease containing amorphigeni or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the salt is not particularly limited as long as it is pharmaceutically acceptable.
  • hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, hydrofluoric acid, hydrobromic acid, formic acid acetic acid, tartaric acid, lactic acid, citric acid, fumaric acid, maleic acid, succinic acid, methanesulfonic acid , Benzene sulfonic acid, toluene sulfonic acid, naphthalene sulfonic acid and the like can be used.
  • base addition salts such as sodium hydroxide, potassium hydroxide, triethylamine, tert-butylamine can also be used.
  • the term "melanin hyperpigmentation” means blacking or darkening in comparison to other areas by excessive increase of melanin in the skin or in certain areas of the nails.
  • the melanin hyperpigmentation disease includes freckles, senile plaques, liver spots, blemishes, brown or sunspots, sunrays, cyanic melasma, hyperpigmentation after drug use, gravidic chloasma, or scratches and Hyperpigmentation after inflammation due to wounds or dermatitis, including burns, and the like.
  • the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier in addition to the active ingredient, which is commonly used in the preparation of lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, Calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and minerals Oils and the like, but are not limited thereto.
  • a pharmaceutically acceptable carrier in addition to the active ingredient, which is commonly used in the preparation of lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, Calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, prop
  • the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like.
  • a lubricant e.g., talc, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, a kaolin, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mann
  • Suitable dosages of the pharmaceutical compositions according to the present invention vary depending on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion and response to response of the patient. Can be. On the other hand, the dosage of the pharmaceutical composition of the present invention is preferably 0.0001 to 100 mg / kg (body weight) per day.
  • the pharmaceutical composition of the present invention can be administered orally or parenterally, and in the case of parenteral administration, it can be administered topically to the skin, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration and the like.
  • parenteral administration it can be administered topically to the skin.
  • the concentration of the active ingredient included in the composition of the present invention can be determined in consideration of the purpose of treatment, the condition of the patient, the period of time, etc., and is not limited to a specific range of concentration.
  • compositions of the present invention may be prepared in unit dosage form by formulating with a pharmaceutically acceptable carrier or excipient according to methods which can be easily carried out by those skilled in the art. It can be prepared by incorporation into a dose container.
  • the formulation may be prepared in any one formulation selected from injections, creams, patches, sprays, ointments, warnings, lotions, linings, pastas, and cataplasmas, and may further include dispersants or stabilizers. have.
  • the present invention also provides a dietary supplement composition for preventing or improving melanin overdose, which contains amorphigeni or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the health functional food composition of the present invention When used as a food additive, the health functional food composition may be added as it is or used with other foods or food ingredients, and may be appropriately used according to a conventional method. Mixed amounts of active ingredients may be suitably used depending on the purpose of use (prevention or improvement).
  • the nutraceutical composition of the present invention is added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less with respect to the raw material.
  • the amount may be below the above range, and the active ingredient may be used in an amount above the above range because there is no problem in terms of safety.
  • dietary supplement there is no particular limitation on the type of dietary supplement.
  • foods to which the health functional food composition may be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products, including ice cream, various soups, drinks, tea Drinks, alcoholic beverages, vitamin complexes, and the like, and include all health foods in the conventional sense.
  • nutraceutical composition of the present invention may be prepared as a food, in particular a functional food.
  • Functional foods of the present invention include ingredients that are commonly added in food production, and include, for example, proteins, carbohydrates, fats, nutrients and seasonings.
  • natural carbohydrates or flavors may be included as additional ingredients in addition to the active ingredient.
  • the natural carbohydrates may be monosaccharides (eg, glucose, fructose, etc.), disaccharides (eg, maltose, sucrose, etc.), oligosaccharides, polysaccharides (eg, dextrins, cyclodextrins, etc.), or sugar alcohols ( For example, xylitol, sorbitol, erythritol and the like) are preferable.
  • the flavourant may be a natural flavourant (eg, taumartin, stevia extract, etc.) and a synthetic flavourant (eg, saccharin, aspartame, etc.).
  • the carbonation agent etc. which are used for a drink can be contained further.
  • the ratio of the above-mentioned ingredients is not critical, it is generally selected from 0.01 to 0.1 parts by weight based on 100 parts by weight of the health functional food composition of the present invention.
  • a B16F10 mouse melanoma cell line was provided from the American Type of Culture Collection (ATCC), which cells were 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin (Sigma-Aldrich, USA). The added DME (Dulbecco's Modified Eagle's) medium was incubated in 37% condition in a 5% CO 2 humidified incubator.
  • ATCC American Type of Culture Collection
  • FBS fetal bovine serum
  • penicillin / streptomycin Sigma-Aldrich, USA
  • DME Dulbecco's Modified Eagle's
  • ⁇ -MSH melanocyte-stimulating hormone
  • 3-MA 3-methyladenine
  • tyrosine-EDTA is Lonza, USA
  • MTT [3- (4,5-dimethylthiazol -2-yl) -2,5-diphenyl tetrazolium bromide) was purchased from Amresco, USA and used in the examples below.
  • B16F10 cells were incubated for 24 hours in 96-well plates, and then the cells were incubated for 24 hours with various concentrations of amorphisgen. Then, the cells were incubated for 3 hours by adding MTT (5 ⁇ g / mL) solution, and then cultured for 20 minutes by removing the medium and treating the cells with DMSO, and a microplate reader (Bio-Rad). The absorbance at 595 nm was measured using
  • the melanin content was measured with a slight modification of Yang et al. (2006, Acta pharmacologica Sinica 27 , 1467-73).
  • B16F10 cells were aliquoted into 6-well plates, incubated for 24 hours, and then treated with amorphigeni and ⁇ -MSH at 1 ⁇ M each for 48 hours.
  • Cultured cells were harvested by trypsinization and dissolution in 1N NaOH containing DMSO at 65 ° C. for 24 hours, and melanin content was measured at 415 nm using a microplate reader (Bio-Rad).
  • Tyrosinase activity was measured by slightly modifying the method of Ohgushi et al., 2009, Biological & pharmaceutical bulletin 32 , 308-10.
  • B16F10 cells were aliquoted into 6-well plates, incubated for 24 hours, and then treated with amorphigeni and ⁇ -MSH at 1 ⁇ M each for 48 hours, followed by harvesting the cultured cells.
  • Proteins were incubated with 100 ⁇ l (2 mg / ml) of L-DOPA at 37 ° C. in a 5% CO 2 humidified incubator for 4 hours and then using a microplate reader (Bio-Rad). Absorbance was measured at 490 nm.
  • Total protein was extracted using RIPA lysis buffer (50 mM Tris-HCl, pH 8.0), 150 mM NaCl, 1% NP-40, 0.5% sodium dioxycholate and 0.1% SDS. The proteins were separated on 10-15% SDS-PAGE and then transferred to PVDF membranes (Millipore, Billerica, Mass., USA). The membrane was incubated with tri% -buffer saline (TBS) containing 0.1% Tween 20 for 1 hour with 5% skim milk and primary antibodiy. Antibodies against tyrosinase were purchased from Santa Cruz Biotechnology, USA, ATG5 for CST (Cell Signaling Technology, USA), and antibodies against PMEL from Abcam (UK).
  • Adapted siRNA to mouse ATG5 siRNA was synthesized from Genolution (Seoul, Korea), and B16F10 cells were infected with siATG5 using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions (Invitrogen). Next, the cells were treated with amorpigenini ( ⁇ -mangostin, 10 ⁇ M) and ⁇ -MSH (1 ⁇ M) for 48 hours, and then the results were confirmed.
  • Example 1.of the present invention Amorfijeni ( amorphigeni Cell viability analysis by treatment
  • Example 1 in order to find a functional plant metabolite that induces depigmentation in melanocytes, amorphigeni was isolated from the root of weasel (Fig. 1).
  • B16F10 cells were treated with various concentrations of amorfigeni and incubated for 24 hours, and MTT (3- (4,5-dimethylthiazol-2-yl) -2,5- Cell viability was confirmed by diphenyltetrazolium bromide analysis.
  • MTT 3- (4,5-dimethylthiazol-2-yl)-2,5- Cell viability was confirmed by diphenyltetrazolium bromide analysis.
  • Fig. 2 showed a low cytotoxicity at 100 to 1600nM of amorpigenini, it was confirmed that does not induce apoptosis (Fig. 3).
  • Example 2 of the present invention Amorfijeni ( amorphigeni Reduction of Melanin Content by Treatment
  • ⁇ -MSH melanocyte-stimulating hormone
  • B16F10 cells were treated with or simultaneously with ⁇ -MSH and amorphisgen. And incubated for 72 hours.
  • the melanin content and the degree of L-DOPA oxidation were significantly increased when the ⁇ -MSH was treated only, whereas the melanin content and the degree of L-DOPA oxidation when the amorphisgene and ⁇ -MSH were treated together. Showed a tendency to decrease.
  • the amorphisgen of the present invention suppresses pigmentation by reducing the melanin content.
  • Example 3 of the present invention Amorfijeni ( amorphigeni ) Processing Proteasome Independent Melanosome Protein Removal Effect
  • the protein expression levels of tyrosinase (TYR) and premelanosome protein (PMEL) were measured, respectively. Measured through blots.
  • the amorphigene of the present invention effectively reduced the amount of protein expression of tyrosinase and PMEL increased by ⁇ -MSH.
  • Example 4 Of the present invention Amorfijeni ( amorphigeni ) Processing Autophagy Dependent Melanosome Removal Effect
  • BMA3, melanocytes, and 3MA (3-inhibitors of amorphism and autophagy) are applied to B16F10 melanocytes. methyladenine) was treated together for 48 hours. The protein expression levels of tyrosinase and PMEL were then measured via Western blot. As a result, as shown in FIG. 7, in the cells treated with ⁇ -MSH, amorphizini, and 3MA together, the protein expression levels of tyrosinase and PMEL decreased when the ⁇ -MSH and amorphizini were treated together. I was.
  • ATG5 autophagy-related gene 5
  • B16F10 melanocytes were transfected with siATG5 (knockdown of ATG5) for 48 hours to inhibit autophagy.
  • siATG5 knockdown of ATG5
  • FIG. 8 when siATG5 was transfected to inhibit autophagy and treated together with ⁇ -MSH and amorphisgen, the expression levels of tyrosinase and PMEL increased again.
  • the expression level of ATG5-ATG12 bound during formation was decreased. In other words, it was found that amorphisgen removes melanin through induction of autophagy in B16F10 melanocytes.
  • the B16F10 melanocytes were treated with ⁇ -MSH, amorphigene, and 3MA together for 48 hours, and the melanin content and the degree of L-DOPA oxidation were measured (*** P ⁇ 0.001).
  • the cells treated with ⁇ -MSH, amorphisgenin, and 3MA together reduced the melanin content (A) and the degree of L-DOPA oxidation when ⁇ -MSH and amorphisgen were treated together. It was confirmed to increase again.
  • Example 5 of the present invention Amorfijeni ( amorphigeni Generated by treatment Melanosome Breaking effect
  • the cells treated with ⁇ -MSH, amorphisgenin, and 3MA co-increased the decreased melanin content when treated with ⁇ -MSH and amorphisgenin, and tyrosina
  • the amount of protein expression of azease and PMEL was also increased again.
  • the amorphygenin-induced autophagy of the present invention regulates decolorization in melanocytes, and the specific inducer of melanosomal autophagy, such as amorphisgen, is used as a very useful material for skin whitening and lightening agent development. It seems to be possible.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Birds (AREA)
  • Mycology (AREA)
  • Dermatology (AREA)
  • Botany (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Cosmetics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)

Abstract

본 발명은 아모르피제니(amorphigeni) 또는 이의 염을 유효성분으로 함유하는 피부 미백용 조성물에 관한 것으로, 본 발명의 아모르피제니(amorphigeni)는 티로시나아제(tyrosinase)의 발현을 억제하며, 멜라소좀(melasosome)의 자가소화작용(autophagy)을 유도하므로, 본 발명의 아모르피제니(amorphigeni)가 멜라닌 생성을 억제할 뿐만 아니라, α-MSH(melanocyte-stimulating hormone)에 의해 기생성된 멜라닌을 제거하는 효과까지 나타내는 것을 확인하였다. 따라서 본 발명의 아모르피제니(amorphigeni)는 피부 화이트닝 및 라이트닝을 위한 기능성 소재로 유용하게 사용될 수 있을 것이다.

Description

아모르피제니를 유효성분으로 함유하는 피부 미백용 조성물
본 발명은 아모르피제니를 유효성분으로 함유하는 피부 미백용 조성물에 관한 것으로, 보다 구체적으로는 티로시나아제(tyrosinase)의 활성을 저해하여 멜라닌(melanin)의 생성 및 기생성된 멜라닌 함량을 감소시키는 것을 특징으로 하는 족제비싸리 유래의 아모르피제니를 유효성분으로 함유하는 피부 미백 기능을 갖는 조성물에 관한 것이다.
피부는 신체조직 중 직접적으로 외부환경에 노출되어 있으며, 인체의 내부와 외부환경 사이의 방어벽 역할을 하여 화학물질이나 자외선을 포함한 외부 환경오염 물질 및 미생물의 침입을 방어함으로써 주위환경으로부터 생체를 보호한다. 또한 피부는 멜라닌, 헤모글로빈(hemoglobin), 카로틴(carotene) 등에 의해 색이 결정되는데 이 중에서도 멜라닌이 가장 중요한 역할을 한다. 멜라닌은 사람의 피부색을 결정하는 것 이외에도 자외선 흡수 작용, 자유 라디칼 소거제(free radical scavenger) 등과 같은 피부 보호 작용을 수행한다. 그러나 자외선의 과다 노출, 대기 오염, 스트레스 등과 같은 외부의 환경 변화에 의하여 멜라닌이 과다하게 생성되면 피부 내에서 색소 침착 현상을 일으켜 피부의 흑화(melanism) 또는 기미, 주근깨 등의 원인이 된다. 피부의 흑화는 내적 및 외적 요인에 대한 피부 세포의 반응에 의하여 발생하는 것으로, 대표적인 요인은 자외선 노출로 인한 것이다. 즉, 피부가 자외선에 노출되면 티로시나아제(tyrosinase)가 활성화되는데, 상기 티로시나아제가 피부조직에 존재하는 티로신에 작용하여 도파(DOPA) 및 도파퀴논(dopaquinone)을 생성시키는 산화 과정에 의하여, 피부 색소 세포인 멜라노사이트(melanocyte) 내의 멜라노좀(melanosome)에서 멜라닌이라는 중합체가 합성되며, 이러한 멜라닌이 피부의 각질 형성 세포인 케라티노사이트(keratinocyte)로 전달되고 각질화 과정에 의해 피부 표면에 도달하여 자외선으로부터 피부를 보호하게 된다. 따라서, 멜라닌은 우리 인체에 없어서는 안되는 자외선 방어제이며, 또한 단백질, 지질, 핵산 등과 같은 생체성분을 변형시키는 다양한 라디칼을 제거하는 효과적인 자유 라디칼 소거제의 역할을 담당하고 있다. 그러나 멜라닌이 국소적으로 과도하게 합성되거나, 피부 병변 및 노화에 따른 피부의 생리 기능이 떨어지게 되면, 멜라닌이 피부 표면에 침착되어 기미, 주근깨 및 다양한 색소 침착을 유발하게 된다. 상기한 바와 같이 피부 흑화의 원인과 기작이 밝혀지면서, 미백 화장료의 제조에 있어 피부 흑화 과정에 관여하는 효소인 티로시나아제의 활성 저해 효과를 갖는 물질들을 화장료에 배합하거나, 또는 멜라닌 생성 과정 중에서 일부 반응을 저해함으로써 멜라닌의 생성을 감소시키는 방법이 일반적으로 사용되고 있다. 이러한 목적을 위해 사용되고 있는 대표적인 물질로는 아스코르브산(ascorbic acid), 코지산(kojic acid), 하이드로퀴논(hydroquinone) 등의 화학 물질과 상백피 추출물, 감초 추출물 등의 식물 추출물이 있다. 하지만, 아스코르브산은 티로시나아제 활성 저해 효과가 부족할 뿐만 아니라 분자 자체의 안정성이 낮아서 멜라닌 생성 억제제로 적합하지 않으며, 코지산은 티로시나아제의 저해활성이 우수하지만, 화장료에 배합할 때 변색되고 경시 변화에 따라서 역가가 저하되는 등의 안정성에 문제가 있을 뿐만 아니라, 피부 자극이 커서 사용상 한계가 있고, 하이드로퀴논은 피부 자극 및 안전성 문제로 인하여 화장료에서의 사용이 제한되고 있다. 따라서, 신규하고 효과적인 미백 성분의 개발에 대한 관심이 집중되고 있다.
한편, 일본공개특허 제1994-016531호에는 화장료에 대해 개시하고 있고, 한국등록특허 제1525090호에는 피부미백용 화장료 조성물에 대해 개시하고 있다. 하지만 본 발명의 아모르피제니를 유효성분으로 함유하는 피부 미백용 조성물에 대해 개시한 바가 없다.
본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명자들은 족제비싸리의 뿌리로부터 아모르피제니(amorphigeni)를 분리 및 추출하였으며, 아모르피제니가 티로시나아제(tyrosinase)의 발현을 억제하며, 멜라소좀(melasosome)의 자가소화작용(autophagy)을 유도하므로, 본 발명의 아모르피제니가 멜라닌 생성을 억제할 뿐만 아니라, 기생성된 멜라닌을 제거하는 효과까지 나타내는 것을 확인함으로써, 본 발명을 완성하였다.
상기 목적을 달성하기 위하여, 본 발명은 아모르피제니(amorphigeni) 또는 화장품학적으로 허용가능한 이의 염을 유효성분으로 함유하는 피부 미백용 화장료 조성물을 제공한다.
또한, 본 발명은 아모르피제니(amorphigeni) 또는 약학적으로 허용가능한 이의 염을 유효성분으로 함유하는 멜라닌 색소 과다 침착 질환의 예방 또는 치료용 약학 조성물을 제공한다.
또한, 본 발명은 아모르피제니(amorphigeni) 또는 약학적으로 허용가능한 이의 염을 유효성분으로 함유하는 멜라닌 색소 과다 침착 예방 또는 개선용 건강기능식품 조성물을 제공한다.
본 발명은 아모르피제니(amorphigeni)를 유효성분으로 함유하는 피부 미백용 조성물에 관한 것으로, 본 발명의 아모르피제니(amorphigeni)는 티로시나아제(tyrosinase)의 발현을 억제하며, 멜라소좀(melasosome)의 자가소화작용(autophagy)을 유도하므로, 본 발명의 아모르피제니(amorphigeni)가 멜라닌 생성을 억제할 뿐만 아니라, α-MSH(melanocyte-stimulating hormone)에 의해 기생성된 멜라닌을 제거하는 효과까지 나타내는 것을 확인하였다. 따라서 본 발명의 아모르피제니(amorphigeni)는 피부 화이트닝 및 라이트닝을 위한 기능성 소재로 유용하게 사용될 수 있을 것이다.
도 1은 본 발명의 일 실시예에 따른 족제비싸리(Amorpha fruticosa)의 뿌리로부터 분리 및 정제한 아모르피제니(amorphigeni)의 화학구조를 나타낸 것이다.
도 2는 본 발명의 일 실시예에 따른 아모르피제니를 농도별로 B16F10 마우스 멜라노 세포에 처리하였을 때, 세포 생존율(cell viability)을 나타낸 것이다.
도 3은 본 발명의 일 실시예에 따른 아모르피제니를 B16F10 마우스 멜라노 세포에 처리하였을 때, PI(Propidium Iodide) 염색을 한 뒤 유세포분석기(flow cytometer)를 통해 세포주기 측정결과를 나타낸 것이다.
도 4는 본 발명의 일 실시예에 따른 α-MSH 및 아모르피제니를 처리하였을 때, B16F10 마우스 멜라노 세포 내 멜라닌 함량(A) 및 L-DOPA 산화(B)에 대한 감소효과를 나타낸 것이다.
도 5는 본 발명의 일 실시예에 따른 α-MSH 및 아모르피제니를 처리하였을 때, B16F10 마우스 멜라노 세포 내 티로시나아제(TYR, tyrosinase) 및 PMEL(premelanosome protein)의 발현에 대한 저해활성을 나타낸 것이다. α-튜불린(tubulin)은 로딩 컨트롤(loading control)이다.
도 6은 본 발명의 일 실시예에 따른 α-MSH, 아모르피제니 및 MG132를 처리하였을 때, B16F10 마우스 멜라노 세포 내 티로시나아제(TYR, tyrosinase) 및 PMEL(premelanosome protein)의 발현량을 나타낸 것이다. α-튜불린(tubulin)은 로딩 컨트롤(loading control); MG132는 프로테아좀 억제제이다.
도 7은 본 발명의 일 실시예에 따른 α-MSH, 아모르피제니 및 3-MA(3-methyladenine)을 처리하였을 때, B16F10 마우스 멜라노 세포 내 티로시나아제 및 PMEL(premelanosome protein)의 발현량의 변화를 나타낸 것이다. α-튜불린(tubulin)은 로딩 컨트롤(loading control); 3-MA는 자가포식작용 억제제이다.
도 8은 본 발명의 일 실시예에 따른 ATG5(autophagy-related gene 5)를 넉다운(knockdown)시킨 siATG5를 처리한 뒤에 α-MSH 및 아모르피제니를 처리하였을 때, B16F10 마우스 멜라노 세포 내 ATG5-ATG12, 티로시나아제 및 PMEL(premelanosome protein)의 발현량 변화를 나타낸 것이다. α-튜불린(tubulin)은 로딩 컨트롤(loading control)이다.
도 9는 본 발명의 일 실시예에 따른 α-MSH, 아모르피제니 및 3-MA(3-methyladenine)을 처리하였을 때, B16F10 마우스 멜라노 세포 내 멜라닌 함량(A) 및 L-DOPA 산화(B) 정도를 나타낸 것이다. α-튜불린(tubulin)은 로딩 컨트롤(loading control); 3-MA는 자가포식작용 억제제이다.
도 10은 본 발명의 일 실시예에 따른 α-MSH를 처리하여 멜라노좀을 합성한 뒤에 아모르피제니를 처리하였을 때, 기생성된 멜라닌 함량의 감소를 나타낸 것이다.
도 11은 본 발명의 일 실시예에 따른 α-MSH를 처리하여 멜라노좀을 합성한 뒤에 아모르피제니 및 3-MA(3-methyladenine)을 처리하였을 때, B16F10 마우스 멜라노 세포 내 기생성된 멜라닌 함량 변화를 나타낸 것이다.
도 12는 본 발명의 일 실시예에 따른 α-MSH를 처리하여 멜라노좀을 합성한 뒤에 아모르피제니 및 3-MA(3-methyladenine)을 처리하였을 때, B16F10 마우스 멜라노 세포 내 티로시나아제 및 PMEL의 발현수준 변화를 나타낸 것이다. α-튜불린(tubulin)은 로딩 컨트롤(loading control); 3-MA는 자가포식작용 억제제이다.
본 발명의 목적을 달성하기 위하여, 본 발명은 하기 화학식 1로 표시되는 아모르피제니(amorphigeni) 또는 화장품학적으로 허용가능한 이의 염을 유효성분으로 함유하는 피부 미백용 화장료 조성물을 제공한다.
Figure PCTKR2016011464-appb-C000001
본 발명의 피부 미백용 화장료 조성물의 유효성분은 상기 화학식 1로 표시되는 구조를 갖는 아모르피제니(amorphigeni)이다. 본 발명의 아모르피제니는 멜라닌 세포에서 멜라닌 생성 및 이미 축적된 멜라닌을 유의적으로 감소시켜 피부 미백 활성을 갖는다.
본 발명의 조성물의 유효성분으로서 화장품학적으로 허용가능한 이의 염으로는 화장품학적으로 허용 가능한 유리산(free acid)에 의해 형성된 산 부가염이 유용하다. 산 부가염은 통상의 방법, 예를 들어 화합물을 과량의 산 수용액에 용해시키고, 이 염을 수혼화성 유기 용매, 예를 들어 메탄올, 에탄올, 아세톤 또는 아세토니트릴을 사용하여 침전시켜서 제조할 수 있다. 동 몰량의 화합물 및 물 중의 산 또는 알콜(예, 글리콜 모노메틸 에테르)을 가열하고, 이어서 상기 혼합물을 증발시켜 건조시키거나, 또는 석출된 염을 흡인 여과시킬 수 있다. 이때, 유리산으로는 유기산과 무기산을 사용할 수 있으며, 무기산으로는 염산, 인산, 황산, 질산, 주석산 등을 사용할 수 있고 유기산으로는 메탄술폰산, p-톨루엔술폰산, 아세트산, 트리플루오로아세트산, 말레인산(maleic acid), 숙신산, 옥살산, 벤조산, 타르타르산, 푸마르산(fumaric acid), 만데르산, 프로피온산(propionic acid), 구연산(citric acid), 젖산(lactic acid), 글리콜산(glycollic acid), 글루콘산(gluconic acid), 갈락투론산, 글루탐산, 글루타르산(glutaric acid), 글루쿠론산(glucuronic acid), 아스파르트산, 아스코르브산, 카본산, 바닐릭산, 히드로아이오딕산 등을 사용할 수 있으며, 이들에 제한되지 않는다.
한편, 미백 효과란, 자외선 노출, 호르몬 밸런스의 변화, 유전적 프로그램 등의 각종 요인에 의해 발생하는 거뭇한 피부나 기미, 주근깨, 다크서클을 개선 또는 방지하는 효과, 피부를 투명감 있는 아름다운 것으로 하는, 혹은 투명감 있는 아름다운 피부를 유지하는 효과, 피부의 칙칙함을 경감하여 윤기ㆍ팽팽함을 증가시키는 효과 등을 의도하고 있다. 일반적으로, 거뭇한 피부나 기미, 주근깨, 다크서클은 자외선에 의한 자극이나 호르몬 밸런스의 변화 등에 의해 멜라노사이트(melanocyte)가 자극되고, 그래서 생합성된 멜라닌 색소가 피부에 침착하여 발생한다고 알려져 있다. 따라서, 멜라닌의 생성을 억제할 수 있다면, 거뭇한 피부나 기미, 주근깨, 다크서클을 예방ㆍ개선하는 것이 가능하다.
상기 아모르피제니의 멜라닌 생성 억제 기능을 배양 색소 세포를 사용한 시험법으로 확인하였다. 색소세포(pigment cell)란 멜라닌 생성 기능을 가지는 세포로서, 이 세포는 통상적으로 배양한 경우, 멜라닌 색소가 축적하여 흑색화된다. 이에 대하여, 이 배양계 내에 멜라닌 생성 억제 기능을 가지는 물질이 존재하면, 멜라닌의 생성이 억제되어 상대적으로 백색화된다. 이 상대적인 백색화의 정도로부터 멜라닌 생성 억제기능을 예상할 수 있다.
본 발명의 피부 미백용 화장료 조성물에서, 상기 아모르피제니는 족제비싸리(Amorpha fruticosa)의 뿌리로부터 분리한 것일 수 있으나, 이제 제한되지 않는다.
본 발명의 피부 미백용 화장료 조성물에서, 상기 아모르피제니는 티로시나아제(tyrosinase)의 활성을 저해할 수 있으나, 이에 제한되지 않는다.
본 발명의 피부 미백용 화장료 조성물에서, 상기 아모르피제니는 멜라닌(melanin)의 생성을 억제하거나 기생성된 멜라닌을 제거할 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구현 예에 따른 화장료 조성물에 있어서, 상기 피부 미백용 화장료 조성물은 피부외용 연고, 크림, 유연화장수, 영양화장수, 팩, 에센스, 헤어토닉, 샴푸, 린스, 헤어 컨디셔너, 헤어 트리트먼트, 젤, 스킨로션, 스킨소프너, 스킨토너, 아스트린젠트, 로션, 밀크로션, 모이스처 로션, 영양로션, 마사지 크림, 영양크림, 모이스처 크림, 핸드 크림, 파운데이션, 영양에센스, 선스크린, 비누, 클렌징폼, 클렌징로션, 클렌징크림, 바디 로션 및 바디 클렌저로 이루어지는 군으로부터 선택된 어느 하나의 제형을 가질 수 있으나, 이에 제한되지 않는다. 이들 각 제형으로 이루어진 화장료 조성물은 그 제형의 제제화에 필요하고 적절한 각종의 기제와 첨가물을 함유할 수 있으며, 이들 성분의 종류와 양은 당업자에 의해 용이하게 선정될 수 있다.
본 발명의 화장료 조성물은 유효성분 이외에 추가로 동일 또는 유사한 기능을 나타내는 피부 미백 활성 성분을 1종 이상 함유할 수 있다. 피부 미백 활성 성분으로는 코지산 및 이의 유도체, 알부틴, 아스코르브산 및 이의 유도체, 하이드로퀴논 및 이의 유도체, 레조르시놀, 사이클로알카논, 메틸렌디옥시페닐 알칸올, 2,7-디니트로인다졸 또는 덩굴귤 추출물, 쌀 추출물, 감초 추출물과 같은 식물 추출물 등이 있으나, 이에 제한되는 것은 아니다.
본 발명의 화장료 조성물의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물섬유, 식물섬유, 왁스, 파라핀, 전분, 트라가칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.
본 발명의 화장료 조성물의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판-부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다.
본 발명의 화장료 조성물의 제형이 용액 또는 유탁액의 경우에는 담체 성분으로서 용매, 용매화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 있다.
본 발명의 화장료 조성물의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 이용될 수 있다.
본 발명의 화장료 조성물의 제형이 계면-활성제 함유 클렌징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르설페이트, 설포숙신산 모노에스테르, 아세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 리놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.
본 발명의 화장료 조성물은 형광물질, 살진균제, 굴수성 유발물질, 보습제, 방향제, 방향제 담체, 단백질, 용해화제, 당 유도체, 일광차단제, 비타민, 식물 추출물 등을 포함하는 부형제를 추가로 함유할 수 있다.
또한, 본 발명은 아모르피제니(amorphigeni) 또는 약학적으로 허용가능한 이의 염을 유효성분으로 함유하는 멜라닌 색소 과다 침착 질환의 예방 또는 치료용 약학 조성물을 제공한다.
상기 염으로는 약학적으로 허용되는 것이면 특별히 한정되지 않으며, 예를 들어 염산, 황산, 질산, 인산, 불화수소산, 브롬화수소산, 포름산 아세트산, 타르타르산, 젖산, 시트르산, 푸마르산, 말레산, 숙신산, 메탄술폰산, 벤젠술폰산, 톨루엔술폰산, 나프탈렌술폰산 등을 사용할 수 있다. 산 부가염 이외에도, 수산화나트륨, 수산화칼륨, 트리에틸아민, 3차-부틸아민과 같은 염기 부가염도 사용될 수 있다.
본 명세서에서 사용되는 용어 "멜라닌 색소 과다 침착(hyperpigmentation)"은 피부 또는 손·발톱의 특정 부위에서 멜라닌의 과도한 증가에 의해 다른 부위에 비해 검게 또는 어둡게 되는 것을 의미한다. 상기 멜라닌 색소 과다침착 질환은 주근깨, 노인성 반점, 간반, 기미, 갈색 또는 흑점, 일광 색소반, 푸른흑피증(cyanic melasma), 약물 사용 후의 과다색소침착, 임신성 갈색반(gravidic chloasma), 또는 찰상 및 화상을 비롯한 상처 또는 피부염으로 인한 염증 후 과다 색소 침착 등을 포함하나 이에 한정되지 않는다.
본 발명의 약학 조성물은 유효성분 이외에 약학적으로 허용되는 담체를 포함할 수 있으며, 이러한 담체는 제제 시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약학적으로 허용되는 담체 및 제제는 레밍턴의 약학적 과학(Remington's Pharmaceutical Sciences, 19th ed., 1995)에 상세히 기재되어 있다.
본 발명에 따른 약학 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다. 한편, 본 발명의 약학 조성물의 투여량은 바람직하게는 1일 당 0.0001 내지 100 mg/kg(체중)이다.
본 발명의 약학 조성물은 경구 또는 비경구로 투여할 수 있으며, 비경구 투여의 경우, 피부에 국소적으로 도포, 정맥 내 주입, 피하 주입, 근육 주입, 복강 주입, 경피 투여 등으로 투여할 수 있다. 본 발명의 약학 조성물이 멜라닌 색소 과다 침착 질환을 치료 또는 예방을 위해 적용되는 점을 감안하면, 피부에 국소적으로 도포되어 이루어지는 것이 바람직하다.
본 발명의 조성물에 포함되는 유효성분의 농도는 치료 목적, 환자의 상태, 필요기간 등을 고려하여 결정할 수 있으며 특정 범위의 농도로 한정되지 않는다.
본 발명의 약학 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약학적으로 허용되는 담체 또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 주사제, 크림, 패취, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 및 카타플라스마제 중에서 선택된 어느 하나의 제형으로 제조될 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
또한, 본 발명은 아모르피제니(amorphigeni) 또는 약학적으로 허용가능한 이의 염을 유효성분으로 함유하는 멜라닌 색소 과다 침착 예방 또는 개선용 건강기능식품 조성물을 제공한다.
본 발명의 건강기능식품 조성물을 식품첨가물로 사용하는 경우, 상기 건강기능식품 조성물을 그대로 첨가하거나 다른 식품 또는 식품성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효 성분의 혼합양은 그의 사용 목적(예방 또는 개선)에 따라 적절하게 사용될 수 있다. 일반적으로, 식품 또는 음료의 제조시 본 발명의 건강기능식품 조성물은 원료에 대하여 15 중량부 이하, 바람직하게는 10 중량부 이하의 양으로 첨가된다. 그러나 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 양은 상기 범위 이하일 수 있으며, 안전성 면에서 아무런 문제가 없기 때문에 유효성분은 상기 범위 이상의 양으로 사용될 수 있다.
상기 건강기능식품의 종류에 특별한 제한은 없다. 상기 건강기능식품 조성물을 첨가할 수 있는 식품의 예로는 육류, 소시지, 빵, 초콜릿, 캔디류, 스낵류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차 드링크제, 알콜 음료 및 비타민 복합제 등이 있으며, 통상적인 의미에서의 건강식품을 모두 포함한다.
또한, 본 발명의 건강기능식품 조성물은 식품, 특히 기능성 식품으로 제조될 수 있다. 본 발명의 기능성 식품은 식품 제조 시에 통상적으로 첨가되는 성분을 포함하며, 예를 들어, 단백질, 탄수화물, 지방, 영양소 및 조미제를 포함한다. 예컨대, 드링크제로 제조되는 경우에는 유효성분 이외에 천연 탄수화물 또는 향미제를 추가 성분으로서 포함시킬 수 있다. 상기 천연 탄수화물은 모노사카라이드(예컨대, 글루코오스, 프럭토오스 등), 디사카라이드(예컨대, 말토스, 수크로오스 등), 올리고당, 폴리사카라이드(예컨대, 덱스트린, 시클로덱스트린 등), 또는 당알코올(예컨대, 자일리톨, 소르비톨, 에리쓰리톨 등)인 것이 바람직하다. 상기 향미제는 천연 향미제(예컨대, 타우마틴, 스테비아 추출물 등)와 합성 향미제(예컨대, 사카린, 아스파르탐 등)를 이용할 수 있다.
상기 건강기능식품 조성물 이외에 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산음료에 사용되는 탄산화제 등을 더 함유할 수 있다. 이러한 상기 첨가되는 성분의 비율은 크게 중요하진 않지만 본 발명의 건강기능식품 조성물 100 중량부에 대하여, 0.01 내지 0.1 중량부의 범위에서 선택되는 것이 일반적이다.
이하, 실시예를 이용하여 본 발명을 더욱 상세하게 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로 본 발명의 범위가 이들에 의해 제한되지 않는다는 것은 당해 기술분야에서 통상의 지식을 가진 자에게 있어 자명한 것이다.
재료 및 방법
1. 아모르피제니(amorphigeni)의 분리 및 추출
아모르피제니를 분리 및 추출하기 위하여, 음건한 0.5kg의 족제비싸리(A. fruticosa)의 뿌리에 5ℓ의 아세톤을 첨가하여 7일간 추출하였다. 추출액을 감압농축하여 21g의 농축물을 얻었으며, 제조한 농축물을 실라카겔 칼럼(10×30cm)을 이용하여 1단계 분리를 실시하였다. 이때, 용리용매는 헥산-아세톤을 이용하였으며, 헥산-아세톤 혼합용액을 100:1에서 100%(v/v) 아세톤까지 극성을 증가시키며 용리시켜 7개의 분획물(A-G)을 얻었다. 목표 화합물인 아모르피제니(Amorphigeni)가 다량 함유된 분획C를 농축하여 농축물 1.3g을 얻었으며, 얻어진 농축물 1.3g에 대하여 실리카겔 칼럼 크로마토그래피를 헥산-아세톤(4:1) 혼합용매 조건에서 실시하여 70% 이상 순도의 160mg의 아모르피제니를 얻었다. 얻어진 분획물을 80%(v/v) 메탄올로 용리시키는 겔 크로마토그래피(Sephadex LH-20)를 실시하여 98% 순도의 29mg의 아모르피제니를 얻었다. 얻어진 화합물의 구조는 1H-NMR, 13C-NMR, 2D-NMR, DEPT 및 질량분석기를 이용하여 규명하였다.
2. 세포 배양 및 화합물
B16F10 마우스 멜라노 세포(mouse melanoma cell) 라인은 ATCC(American Type of Culture Collection, USA)로부터 제공받았으며, 상기 세포는 10% FBS(fetal bovine serum) 및 1% 페니실린/스트렙토마이신(Sigma-Aldrich, USA)이 첨가된 DME(Dulbecco's Modified Eagle's) 배지에 5% CO2 가습 배양기에서 37℃ 조건하에 배양되었다. α-MSH(melanocyte-stimulating hormone) 및 3-MA(3-methyladenine)은 시그마-알드리치(Sigma-Aldrich), 티로신-EDTA는 론자(Lonza, USA) 및 MTT([3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide)는 암레스코(Amresco, USA)로부터 구매하여 하기 실시예에 사용하였다.
3. 세포 생존율(cell viability) 측정
B16F10 세포는 96-웰 플레이트에 24시간 배양한 후, 상기 세포에 다양한 농도의 아모르피제니를 처리하여 24시간 동안 배양하였다. 그런 다음, 상기 세포에 MTT(5μg/mL) 용액을 첨가하여 3시간 동안 배양한 후, 배지를 제거하고 세포에 DMSO를 처리하여 20분 동안 배양시켰으며, 마이크로플레이트 리더(microplate reader, Bio-Rad)를 이용하여 595nm에서 흡광도를 측정하였다.
4. 멜라닌(melanin) 함량 측정
멜라닌 함량 측정은 양 등(Yang et al., 2006, Acta pharmacologica Sinica 27, 1467-73)의 방법을 약간 변형하여 실시하였다. B16F10 세포를 6-웰 플레이트에 분주하고, 24시간 동안 배양시킨 다음, 상기 세포에 아모르피제니(amorphigeni) 및 α-MSH를 각각 1μM씩 처리하여 48시간 동안 배양하였다. 배양된 세포는 트립신처리법(trypsinization) 및 65℃에서 DMSO가 포함된 1N NaOH에서 24시간 동안 녹여 수확하였으며, 마이크로플레이트 리더(microplate reader, Bio-Rad)를 이용하여 415nm에서 멜라닌 함량을 측정하였다.
5. 티로시나아제(tyrosinase) 활성 측정
티로시나아제(tyrosinase) 활성은 오구시 등(Ohgushi et al., 2009, Biological & pharmaceutical bulletin 32, 308-10)의 방법을 약간 변형하여 측정하였다. B16F10 세포를 6-웰 플레이트에 분주하고, 24시간 동안 배양시킨 다음, 상기 세포에 아모르피제니(amorphigeni) 및 α-MSH를 각각 1μM씩 처리하여 48시간 동안 배양한 후, 배양된 상기 세포를 수확하여 얼음에서 1시간 동안 1% 트리톤 X-100(Triton X-100) 용액으로 용해시켰다. 단백질은 4시간 동안 5% CO2 가습 배양기에서 37℃ 조건하에 100㎕(2㎎/㎖)의 L-DOPA와 함께 배양하였으며, 그런 다음, 마이크로플레이트 리더(microplate reader, Bio-Rad)를 이용하여 490nm에서 흡광도를 측정하였다.
6. RNA 추출 및 RT-PCR
총 RNA는 RiboEX 시약(GeneAll Biotechnology Co. Ltd, Seoul, Korea)를 이용하여 세포로부터 추출하였으며, cDNA는 역전사(Thermo Scientific, Waltham, MA, USA)을 통해 2μg의 RNA를 이용하여 합성하였다. PCR은 Solg™ e-Taq DNA 폴리머라아제 키트(SolGent Co. Ltd, Daejeon, Korea)를 이용하여 수행하였으며, 하기 표 1에 개시된 바와 같이 각 프라이머를 이용하였다.
본 발명에 사용된 프라이머
목표 유전자 서열번호 정방향/역방향 염기서열
Tyrosinase 1 정방향 GGCCAGCTTTCAGGCAGAGGT
2 역방향 TGGTGCTTCATGGGCAAAATC
7. 웨스턴 블롯(Western blot) 분석
총 단백질은 RIPA 용해버퍼(50 mM Tris-HCl(pH 8.0), 150 mM NaCl, 1% NP-40, 0.5% 소듐 디옥시콜레이트 및 0.1% SDS)를 이용하여 추출하였다. 상기 단백질은 10~15% SDS-PAGE 상에서 분리한 다음, PVDF 멤브레인(Millipore, Billerica, MA, USA)으로 트렌스퍼(transfer)하였다. 상기 멤브레인은 0.1% 트윈 20을 함유하는 TBS(tris-buffer saline)에 1시간 동안 5% 스킴 밀크(skim milk) 및 일차 항체(primary antibodiy)와 함께 배양시켰다. 티로시나아제에 대한 항체는 산타쿠르즈(Santa Cruz Biotechnology, USA), ATG5는 CST(Cell Signaling Technology, USA), PMEL에 대한 항체는 Abcam(UK)로부터 구매하였다.
8. 유전자 침묵(gene silencing)
마우스 ATG5 siRNA에 대한 적합화된 siRNA는 Genolution(Seoul, Korea)으로부터 합성하였으며, B16F10 세포는 제조사(Invitrogen사)의 지시에 따라 Lipofectamine 3000(Invitrogen, Carlsbad, CA, USA)을 이용하여 siATG5로 감염시킨 다음, 상기 세포에 아모르피제니(β-mangostin, 10μM) 및 α-MSH(1μM)를 48시간 동안 처리한 다음, 그 결과를 확인하였다.
9. 통계 분석(statistical analysis)
모든 데이터는 unpaired Student's t-test를 이용하여 분석하였으며, 결과는 P < 0.05의 경우 통계적으로 유의한 것으로 간주하였다.
실시예 1. 본 발명의 아모르피제니 ( amorphigeni ) 처리에 따른 세포 생존율(cell viability) 분석
본 실시예 1에서는 멜라닌 세포에서 탈색(depigmentation)을 유도하는 기능적 식물대사산물을 찾기 위해, 아모르피제니(amorphigeni)를 족제비싸리의 뿌리로부터 분리하였다(도 1). 상기 아모르피제니의 세포독성을 확인하기 위해, B16F10 세포에 다양한 농도의 아모르피제니를 처리하여 24시간 동안 배양하였으며, MTT(3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) 분석을 통하여 세포 생존율을 확인하였다. 그 결과, 도 2에 개시된 바와 같이 아모르피제니의 100 내지 1600nM에서 낮은 세포독성을 보였으나, 세포사멸을 유도하지 않는 것을 확인할 수 있었다(도 3).
실시예 2. 본 발명의 아모르피제니 ( amorphigeni ) 처리에 따른 멜라닌(melanin) 함량 감소효과
아모르피제니(amorphigeni)가 α-MSH(melanocyte-stimulating hormone)에 의해 유도된 색소침착(pigmentation)을 억제할 수 있는지를 알아보기 위해, B16F10 세포에 α-MSH 및 아모르피제니를 각각 또는 동시에 처리하여 72시간 동안 배양하였다. 그 결과, 도 4에 개시된 바와 같이 α-MSH만 처리한 경우, 멜라닌 함량 및 L-DOPA 산화 정도가 상당히 증가한 반면, 아모르피제니 및 α-MSH를 함께 처리한 경우 멜라닌 함량 및 L-DOPA 산화 정도를 감소시키는 경향을 보였다. 즉, 본 발명의 아모르피제니가 멜라닌 함량을 감소시켜 색소침착을 억제시키는 것을 확인할 수 있었다.
실시예 3. 본 발명의 아모르피제니 ( amorphigeni ) 처리에 따른 프로테아좀 비의존적 멜라노좀 단백질 제거효과
B16F10 멜라닌 세포에 α-MSH를 처리하거나 또는 α-MSH 및 아모르피제니(amorphigeni)를 함께 48시간 처리한 뒤, 티로시나아제(tyrosinase, TYR) 및 PMEL(premelanosome protein)의 단백질 발현 수준을 각각 웨스턴 블롯을 통해 측정하였다. 그 결과, 도 5에 개시된 바와 같이 본 발명의 아모르피제니는 α-MSH에 의해 증가된 티로시나아제 및 PMEL의 단백질 발현량을 효과적으로 감소시켰다.
아모르피제니가 프로테아좀 의존적 단백질 분해과정을 유도하여 티로시나아제 및 PMEL 단백질을 파괴하는지 확인하기 위해, B16F10 멜라닌 세포에 α-MSH, 아모르피제니 및 프로테아좀 억제제인 MG132를 함께 48시간 처리하였다. 그 후 티로시나아제 및 PMEL의 단백질 발현 수준을 웨스턴 블롯을 통해 측정한 결과, 도 6에 개시된 바와 같이 α-MSH, 아모르피제니 및 MG132를 함께 처리한 세포에서는 티로시나아제 및 PMEL의 단백질 발현량이 다시 증가하지 않았다. 이러한 결과를 통하여, 아모르피제니의 탈색(depigmentation) 효과가 프로테아좀 의존적 단백질 분해과정에 의해 매개되는 것이 아니라, 다른 메커니즘을 통해 일어나는 것으로 사료된다.
실시예 4. 본 발명의 아모르피제니 ( amorphigeni ) 처리에 따른 자가포식작용 의존적 멜라노좀 제거효과
아모르피제니(amorphigeni)가 자가포식작용을 유도하여 티로시나아제(tyrosinase) 및 PMEL 단백질을 파괴하는지 확인하기 위하여, B16F10 멜라닌 세포에 α-MSH, 아모르피제니 및 자가포식작용 억제제인 3MA(3-methyladenine)를 함께 48시간 처리하였다. 그 후 티로시나아제 및 PMEL의 단백질 발현 수준을 웨스턴 블롯을 통해 측정하였다. 그 결과, 도 7에 개시된 바와 같이 α-MSH, 아모르피제니 및 3MA를 함께 처리한 세포에서는 α-MSH 및 아모르피제니를 함께 처리하였을때 감소된 티로시나아제 및 PMEL의 단백질 발현량을 다시 증가시켰다.
자가소화작용 과정 중에 중요한 역할을 하는 자가소화포(autophagosomes) 신장(elongation)과 관련된 ATG5(autophagy-related gene 5)의 저해가 아모르피제니-매개된 탈색(depigmentation) 효과에 영향을 줄 수 있는지를 확인하기 위해, B16F10 멜라닌 세포에 siATG5(ATG5의 knockdown)를 48시간 동안 형질주입시켜 자가포식작용을 억제하였다. 그 결과, 도 8에 개시된 바와 같이 siATG5를 형질주입시켜 자가포식작용을 억제시킨 뒤 α-MSH 및 아모르피제니를 함께 처리하였을 때, 티로시나아제 및 PMEL의 단백질 발현량이 다시 증가하였으며, 자가소화포 형성과정 중에 결합되는 ATG5-ATG12의 발현량은 감소하였다. 즉, 아모르피제니가 B16F10 멜라닌 세포에서 자가소화작용 유도를 통하여 멜라닌을 제거한다는 것을 알 수 있었다.
또한, B16F10 멜라닌 세포에 α-MSH, 아모르피제니 및 3MA를 함께 48시간 처리한 후 멜라닌 함량 및 L-DOPA 산화 정도를 측정하였다(***P≤0.001). 그 결과, 도 9에 개시된 바와 같이 α-MSH, 아모르피제니 및 3MA를 함께 처리한 세포에서는 α-MSH 및 아모르피제니를 함께 처리하였을때 감소된 멜라닌 함량(A) 및 L-DOPA 산화정도를 다시 증가시키는 것을 확인할 수 있었다.
실시예 5. 본 발명의 아모르피제니 ( amorphigeni ) 처리에 따른 기생성된 멜라노좀 파괴 효과
아모르피제니가 α-MSH에 의해 기생성된 멜라노좀을 파괴하는지 알아보기 위해, B16F10 멜라닌 세포에 α-MSH를 48시간 처리하여 멜라노좀을 합성한 뒤 아모르피제니를 48시간 처리한 다음, 멜라닌 함량을 측정하였다. 그 결과, 도 10에 개시된 바와 같이 기생성된 멜라닌 함량을 효과적으로 감소시키는 것을 확인할 수 있었다.
또한, 아모르피제니가 기생성된 멜라노좀을 자가포식작용을 통해 파괴하는지를 알아보기 위해, B16F10 멜라닌 세포에 α-MSH를 48시간 처리하여 멜라노좀을 합성한 뒤 아모르피제니를 자가포식 억제제인 3MA와 함께 48시간 처리하였다. 그 후 멜라닌 함량과 티로시나아제 및 PMEL의 단백질 발현 수준을 통해 측정하였다(ns = no significance, *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001). 그 결과, 도 11 및 12에 개시된 바와 같이 α-MSH, 아모르피제니 및 3MA를 함께 처리한 세포에서는 α-MSH 및 아모르피제니를 함께 처리하였을때 감소된 멜라닌 함량을 다시 증가시켰으며, 티로시나아제 및 PMEL의 단백질 발현량도 다시 증가시켰다.
따라서 본 발명의 아모르피제니로 유도된 자가소화작용은 멜라노사이트에서 탈색을 조절하며, 아모르피제니와 같은 멜라노좀 자가소화작용의 특이적 유도제는 피부 화이트닝 및 라이트닝 제제 개발에 대해 매우 유용한 소재로 활용될 수 있을 것으로 판단된다.

Claims (9)

  1. 하기 화학식 1로 표시되는 아모르피제니(amorphigeni) 또는 화장품학적으로 허용가능한 이의 염을 유효성분으로 함유하는 피부 미백용 화장료 조성물.
    [화학식 1]
    Figure PCTKR2016011464-appb-I000001
  2. 제1항에 있어서, 상기 아모르피제니(amorphigeni)는 족제비싸리(Amorpha fruticosa)의 뿌리로부터 분리한 것을 특징으로 하는 피부 미백용 화장료 조성물.
  3. 제1항에 있어서, 상기 조성물은 티로시나아제(tyrosinase)의 활성을 저해하는 것을 특징으로 하는 피부 미백용 화장료 조성물.
  4. 제1항에 있어서, 상기 조성물은 멜라닌(melanin)의 생성을 억제하거나 기생성된 멜라닌을 제거하는 것을 특징으로 하는 피부 미백용 화장료 조성물.
  5. 제1항에 있어서, 상기 조성물은 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클린싱, 오일, 분말 파운데이션, 유탁액, 파운데이션, 왁스 파운데이션 및 스프레이 중에서 선택된 어느 하나의 제형인 것을 특징으로 하는 피부 미백용 화장료 조성물.
  6. 하기 화학식 1로 표시되는 아모르피제니(amorphigeni) 또는 약학적으로 허용가능한 이의 염을 유효성분으로 함유하는 멜라닌 색소 과다 침착 질환의 예방 또는 치료용 약학 조성물.
    [화학식 1]
    Figure PCTKR2016011464-appb-I000002
  7. 제6항에 있어서, 상기 멜라닌 색소 침착 질환은 주근깨, 노인성 반점, 간반, 기미, 갈색 또는 흑점, 일광 색소반, 푸른흑피증(cyanic melasma), 약물 사용 후의 과다색소침착, 임신성 갈색반(gravidic chloasma), 또는 찰상 및 화상을 비롯한 상처 또는 피부염으로 인한 염증 후 과다 색소 침착인 것을 특징으로 하는 피부 색소 침착 질환의 예방 또는 치료용 약학 조성물.
  8. 제6항에 있어서, 상기 조성물은 주사제, 크림, 패취, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 및 카타플라스마제 중에서 선택된 어느 하나의 제형으로 제조되는 것을 특징으로 하는 피부 색소 침착 질환의 예방 또는 치료용 약학 조성물.
  9. 하기 화학식 1로 표시되는 아모르피제니(amorphigeni) 또는 약학적으로 허용가능한 이의 염을 유효성분으로 함유하는 멜라닌 색소 과다 침착 예방 또는 개선용 건강기능식품 조성물.
    [화학식 1]
    Figure PCTKR2016011464-appb-I000003
PCT/KR2016/011464 2015-10-16 2016-10-13 아모르피제니를 유효성분으로 함유하는 피부 미백용 조성물 WO2017065505A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CN201680059088.1A CN108135818B (zh) 2015-10-16 2016-10-13 作为有效成分含有紫穗槐苷元的皮肤美白用组合物
EP16855722.1A EP3363426B1 (en) 2015-10-16 2016-10-13 Composition for skin whitening containing amorphigeni as active ingredient
JP2018518632A JP6629968B2 (ja) 2015-10-16 2016-10-13 アモルフィゲニを有効成分として含有する肌美白用組成物
US15/768,609 US10500146B2 (en) 2015-10-16 2016-10-13 Composition for skin whitening comprising amorphigeni as effective ingredient

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2015-0144455 2015-10-16
KR1020150144455A KR101692851B1 (ko) 2015-10-16 2015-10-16 아모르피제니를 유효성분으로 함유하는 피부 미백용 조성물

Publications (1)

Publication Number Publication Date
WO2017065505A1 true WO2017065505A1 (ko) 2017-04-20

Family

ID=57835657

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/011464 WO2017065505A1 (ko) 2015-10-16 2016-10-13 아모르피제니를 유효성분으로 함유하는 피부 미백용 조성물

Country Status (6)

Country Link
US (1) US10500146B2 (ko)
EP (1) EP3363426B1 (ko)
JP (1) JP6629968B2 (ko)
KR (1) KR101692851B1 (ko)
CN (1) CN108135818B (ko)
WO (1) WO2017065505A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150029305A (ko) * 2013-09-10 2015-03-18 제주대학교 산학협력단 로즈마리 유래의 베르베논을 유효성분으로 함유하는 피부 미백용 화장료 조성물
KR20150050995A (ko) * 2013-11-01 2015-05-11 가천대학교 산학협력단 아마란스 추출물 또는 이의 분획물을 함유하는 피부 미백용 조성물
KR101525090B1 (ko) * 2013-04-09 2015-06-02 (주)바이오시엠 피부미백용 화장료 조성물
KR101551106B1 (ko) * 2014-07-14 2015-09-07 순천향대학교 산학협력단 참새피 추출물을 포함하는 조성물

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS60202806A (ja) * 1984-03-26 1985-10-14 Sansho Seiyaku Kk 色白化粧料
JP3241440B2 (ja) 1992-07-02 2001-12-25 有限会社野々川商事 化粧料
JP2004256437A (ja) * 2003-02-26 2004-09-16 Sakamoto Bio:Kk 抗菌剤及び抗菌性組成物
JP4517249B2 (ja) * 2003-05-14 2010-08-04 株式会社坂本バイオ メラニン産生促進剤及びメラニン産生促進用組成物
JP5198732B2 (ja) * 2006-01-12 2013-05-15 ポーラ化成工業株式会社 メラニン生成抑制剤
JP5209848B2 (ja) * 2006-01-12 2013-06-12 ポーラ化成工業株式会社 皮膚外用剤
JP5219337B2 (ja) * 2006-01-12 2013-06-26 ポーラ化成工業株式会社 皮膚外用剤
CN102675336A (zh) * 2012-06-07 2012-09-19 南京泽朗医药科技有限公司 一种提取纯化紫穗槐苷元的方法
KR20140030721A (ko) * 2012-09-03 2014-03-12 한국과학기술연구원 족제비싸리 추출물을 포함하는 조성물
KR101551243B1 (ko) * 2013-04-09 2015-09-09 (주)바이오시엠 말굽버섯 추출물을 포함하는 피부미백용 화장료 조성물
KR101551240B1 (ko) * 2013-04-09 2015-09-09 (주)바이오시엠 검은 생강 추출물을 포함하는 피부미백용 화장료 조성물
CN104523819B (zh) * 2014-12-01 2018-11-13 广东医学院 一种紫穗槐提取物及其制备方法

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101525090B1 (ko) * 2013-04-09 2015-06-02 (주)바이오시엠 피부미백용 화장료 조성물
KR20150029305A (ko) * 2013-09-10 2015-03-18 제주대학교 산학협력단 로즈마리 유래의 베르베논을 유효성분으로 함유하는 피부 미백용 화장료 조성물
KR20150050995A (ko) * 2013-11-01 2015-05-11 가천대학교 산학협력단 아마란스 추출물 또는 이의 분획물을 함유하는 피부 미백용 조성물
KR101551106B1 (ko) * 2014-07-14 2015-09-07 순천향대학교 산학협력단 참새피 추출물을 포함하는 조성물

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
KIM, YOUNG SOO ET AL.: "Flavanones and Rotenoids from the Roots of Amorpha Fruticosa L. that Inhibit Bacterial Neuraminidase", FOOD AND CHEMICAL TOXICOLOGY, vol. 49, no. 8, 2011, pages 1849 - 1856, XP028388670 *

Also Published As

Publication number Publication date
JP6629968B2 (ja) 2020-01-15
EP3363426A1 (en) 2018-08-22
EP3363426A4 (en) 2019-04-10
US10500146B2 (en) 2019-12-10
CN108135818B (zh) 2021-06-25
CN108135818A (zh) 2018-06-08
EP3363426B1 (en) 2021-06-16
KR101692851B1 (ko) 2017-01-05
JP2018536633A (ja) 2018-12-13
US20180303734A1 (en) 2018-10-25

Similar Documents

Publication Publication Date Title
WO2017052155A1 (ko) 베타-망고스틴을 유효성분으로 함유하는 피부 미백용 조성물
JP5095221B2 (ja) 美白剤
WO2020060060A1 (ko) 병풀 부정근 추출물을 유효성분으로 함유하는 피부 미백 및 주름개선용 화장료 조성물
US20160271028A1 (en) Novel use of panduratin derivatives or extract of kaempferia pandurata comprising the same
KR20230021049A (ko) 에틸 페룰레이트를 포함하는 피부상태 개선용 조성물
WO2017217695A1 (ko) 알파-망고스틴, 베타-망고스틴, 감마-망고스틴 또는 가르탄닌 화합물을 유효성분으로 함유하는 피부 주름 개선 또는 피부 보습용 조성물
KR101811053B1 (ko) 루테올린-7-설페이트를 유효성분으로 포함하는 피부 미백용 조성물
WO2017065505A1 (ko) 아모르피제니를 유효성분으로 함유하는 피부 미백용 조성물
KR102094949B1 (ko) 흑무 추출물, 이의 분획물, 또는 이로부터 분리된 화합물을 포함하는 미백용 조성물
KR101721666B1 (ko) 선복화를 이용한 피부 미백용 화합물 및 이를 포함하는 피부 미백용 조성물
KR101526435B1 (ko) 머루근 추출물을 포함하는 미백용 조성물
KR102503107B1 (ko) 폴리갈라사포닌 ｆ를 포함하는 피부상태 개선용 조성물
US9730872B2 (en) Method for improving skin conditions with veratric acid or acceptable salt thereof as an active ingredient
KR102014685B1 (ko) 골담초 유래 화합물 및 이를 함유하는 피부 미백용 조성물
KR102014646B1 (ko) 골담초 유래 화합물 및 이를 함유하는 피부 미백용 조성물
WO2023277626A1 (ko) 2-phloroeckol을 유효성분으로 포함하는 피부 개선용 조성물
KR101868692B1 (ko) BDD(biphenyl dimethyl dicarboxylate)를 유효성분으로 함유하는 피부 미백, 피부 주름 개선 및 피부노화 예방 및 치료용 약학적 조성물
KR102512776B1 (ko) 아브신틴을 포함하는 피부상태 개선용 조성물
KR102523361B1 (ko) 디하이드로탄시논 아이를 포함하는 피부상태 개선용 조성물
KR102523896B1 (ko) 오바쿠논을 포함하는 피부상태 개선용 조성물
KR20160019765A (ko) 다이하이드로아르테미시닌을 포함하는 흑화, 탄력, 주름개선, 또는 보습용 화장료 또는 약학 조성물
KR20180098204A (ko) 율무 추출물을 포함하는 미백용 조성물
KR20130095136A (ko) 위드롤을 포함하는 미백용 조성물
KR20170078095A (ko) 바바치닌 에이를 포함하는 피부상태 개선용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16855722

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2018518632

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 15768609

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2016855722

Country of ref document: EP