WO2017030370A1 - 항-코티닌 항체가 연결된 키메라 항체 수용체 및 이의 용도 - Google Patents

항-코티닌 항체가 연결된 키메라 항체 수용체 및 이의 용도 Download PDF

Info

Publication number
WO2017030370A1
WO2017030370A1 PCT/KR2016/009047 KR2016009047W WO2017030370A1 WO 2017030370 A1 WO2017030370 A1 WO 2017030370A1 KR 2016009047 W KR2016009047 W KR 2016009047W WO 2017030370 A1 WO2017030370 A1 WO 2017030370A1
Authority
WO
WIPO (PCT)
Prior art keywords
chimeric antigen
antigen receptor
cotinine
cell
cancer
Prior art date
Application number
PCT/KR2016/009047
Other languages
English (en)
French (fr)
Inventor
최경호
박형배
이지은
오유미
김기현
김수현
김효리
정준호
Original Assignee
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교산학협력단 filed Critical 서울대학교산학협력단
Priority to KR1020187004954A priority Critical patent/KR102157701B1/ko
Priority to CN201680060859.9A priority patent/CN108463469B/zh
Priority to US15/753,212 priority patent/US11478555B2/en
Priority to EP16837312.4A priority patent/EP3339320A4/en
Priority to JP2018509573A priority patent/JP7010487B2/ja
Publication of WO2017030370A1 publication Critical patent/WO2017030370A1/ko
Priority to US17/900,527 priority patent/US20230017956A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/7051—T-cell receptor (TcR)-CD3 complex
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6801—Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
    • A61K47/6803—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
    • A61K47/6811—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug being a protein or peptide, e.g. transferrin or bleomycin
    • A61K47/6817—Toxins
    • A61K47/6819—Plant toxins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/55—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
    • A61K31/551—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole having two nitrogen atoms, e.g. dilazep
    • A61K31/5513—1,4-Benzodiazepines, e.g. diazepam or clozapine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/17—Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
    • A61K38/1774—Immunoglobulin superfamily (e.g. CD2, CD4, CD8, ICAM molecules, B7 molecules, Fc-receptors, MHC-molecules)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/39558—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A61K39/4611—T-cells, e.g. tumor infiltrating lymphocytes [TIL], lymphokine-activated killer cells [LAK] or regulatory T cells [Treg]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/463—Cellular immunotherapy characterised by recombinant expression
    • A61K39/4631—Chimeric Antigen Receptors [CAR]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A61K39/464402—Receptors, cell surface antigens or cell surface determinants
    • A61K39/464403—Receptors for growth factors
    • A61K39/464406—Her-2/neu/ErbB2, Her-3/ErbB3 or Her 4/ ErbB4
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A61K39/46448—Cancer antigens from embryonic or fetal origin
    • A61K39/464482—Carcinoembryonic antigen [CEA]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4646—Small organic molecules e.g. cocaine or nicotine
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/16—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from plants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2809—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against the T-cell receptor (TcR)-CD3 complex
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2818—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD28 or CD152
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2887—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against CD20
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0636—T lymphocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterised by the cancer treated
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/31—Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52—Constant or Fc region; Isotype
    • C07K2317/53—Hinge
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/10—Fusion polypeptide containing a localisation/targetting motif containing a tag for extracellular membrane crossing, e.g. TAT or VP22
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/13011—Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/13043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the present invention relates to chimeric antibody receptors to which anti-cotinine antibodies are linked and their use.
  • Chimeric antigen receptors are composed of fragments, hinge regions, transmembrane domains and intracellular signaling domains of antibodies.
  • Immune cells such as T cells and natural killer cells expressing the chimeric antigen receptor specifically recognize cells (cancer cells, etc.) in which fragments of the antibody express target molecules, thereby activating cytotoxicity of the immune cells. Induces apoptosis
  • the cells have been used for genetically engineered cell therapy, and in particular, chimeric antigen receptor T cells have been reported to exhibit a high therapeutic effect against CD19 expressing hematologic cancers.
  • chimeric antigen receptor cells have a limitation in recognizing one target molecule, and chimeric antigen receptor cells using hapten have been studied.
  • the hapten is preferably a substance which does not exist in vivo in order to prevent the cells presenting the chimeric antigen receptor from binding to cells other than the target. In addition, it must have a chemical functional group (group) for effective bonding with the conjugate.
  • Cotinine is a major metabolite of nicotine and is not de novo biosynthesis in the body and does not cause physiological activity.
  • the metabolic processes of cotinine in mammals are well known, and the serum half-life of 16 hours has also been reported (Benowits NL et al. , 3rd Handb . Exp . Pharmacol . , 29-60, 2009). Therefore, even if a smoker does not exist in the body after smoking for several days, it can be used as a hapten.
  • the cotinine is easy to manufacture in the form of a carboxyl group is bonded, it is possible to bond with the bonding material.
  • the present inventors prepared chimeric antigen receptor T cells and a cotinine-labeled conjugate to which an anti-cotinine antibody is linked, and thus the chimeric antigen receptor T cells secrete interferon gamma specifically target molecules of the conjugate labeled with cotinine.
  • apoptosis of target cells was induced, and apoptosis of the chimeric antigen receptor T cells was induced by cotinine-labeled cytotoxic substances (FIG. 1).
  • the cytotoxic substance can only bind to the anti-hapten chimeric antigen receptor T cells and induce apoptosis, it has an additional advantage that can also be used as a safety device to eliminate the side effects caused by these T cells (FIG. 2). ). Accordingly, the present inventors completed the present invention by confirming that apoptosis of the chimeric antigen receptor T cells is induced by a cytotoxic substance labeled with cotinine.
  • Another object of the present invention is to provide a nucleic acid molecule encoding the chimeric antigen receptor, an expression vector and virus comprising the same, and a cell transduced with the virus.
  • Still another object of the present invention is to provide a chimeric antigen receptor cell further comprising a conjugate labeled with cotinine on the cell.
  • Still another object of the present invention is to provide a pharmaceutical composition for preventing or treating a disease or a disease in which specific cells containing the chimeric antigen receptor cells are expanded.
  • Still another object of the present invention is to provide a method for inducing apoptosis of the chimeric antigen receptor cells.
  • the present invention provides a chimeric antigen receptor to which an anti-cotinine antibody is linked, including an anti-cotinine antibody or fragment thereof, a hinge domain, a transmembrane domain, and a signaling domain.
  • the present invention also provides a nucleic acid molecule encoding the chimeric antigen receptor.
  • the present invention also provides an expression vector containing the nucleic acid molecule.
  • the present invention also provides a virus comprising the nucleic acid molecule.
  • the present invention also provides a cell transduced with the virus.
  • the present invention also provides a chimeric antigen receptor cell comprising a conjugated substance labeled with cotinine.
  • the present invention also provides a pharmaceutical composition for preventing or treating a disease or disorder in which specific cells containing the chimeric antigen receptor cells are expanded.
  • the present invention also provides a method for preventing or treating a disease or disorder in which specific cells are expanded, including administering the chimeric antigen receptor cells to a subject.
  • the present invention comprises the steps of administering the cells to the subject; And administering a cotinine-labeled conjugate to the subject.
  • the present invention comprises the steps of administering to the subject the conjugated labeled cells and cotinine; And it provides a method for inducing apoptosis of chimeric antigen receptor cells, comprising the step of further administering a cytotoxic substance labeled with cotinine to the subject.
  • the present invention comprises a first component containing a pharmaceutically treatable amount of the chimeric antigen receptor cell as an active ingredient; And it provides a pharmaceutical kit for the prevention or treatment of diseases or disorders, wherein the specific cell is proliferated, comprising a second component containing a complex of a pharmaceutically treatable amount of cotinine and a cytotoxic substance as an active ingredient.
  • FIG. 1 is a diagram showing that the target of chimeric antigen receptor T cells can be altered by different cotinine-labeled conjugates according to target cells.
  • FIG. 2 is a diagram showing the induction of apoptosis of chimeric antigen receptor T cells using cotinine-labeled cytotoxic substances.
  • Figure 3 shows the structure (A) of the chimeric antigen receptor gene to which the anti-cotinine antibody fragment prepared in one embodiment of the present invention is linked, the viral vector expressing the same, and the T cells presenting the chimeric antigen receptor on the surface of the flow cytometer.
  • the result of analysis (B) is a graph.
  • Figure 4 is secreted from the T cell when the anti-Cotinine antibody fragment prepared in one embodiment of the present invention when the chimeric antigen receptor T cells connected with the cotinine-labeled anti-VEGF aptamer and the target molecule VEGF protein It is a graph confirming the amount of interferon gamma.
  • FIG. 5 is a graph confirming the amount of interferon gamma secreted from T cells by adding chimeric antigen receptor T cells prepared in one embodiment of the present invention to HER2 positive or negative cells with a cotinine-labeled anti-HER2 antibody. to be.
  • Figure 6 confirms that the chitin antigen receptor T cells prepared in one embodiment of the present invention secreted interferon gamma specifically labeled with anti-HER2 antibody added with cotinine (A) and expressed on the surface of T cells.
  • the chimeric antigen receptor was analyzed by flow cytometry (B).
  • FIG. 7 is a graph confirming the amount of interferon gamma secreted from T cells by adding chimeric antigen receptor T cells prepared in one embodiment of the present invention to CD20 positive or negative cells with a cotinine-labeled anti-CD20 antibody. to be.
  • FIG. 8 is a graph confirming the amount of interferon gamma secreted from T cells by adding chimeric antigen receptor T cells prepared in one embodiment of the present invention to HLA positive or negative cells with a cotinine-labeled anti-HLA antibody. to be.
  • Figure 9 is staining the target cells to show different intensity of fluorescence intensity (A), to which chimeric antigen receptor T cells prepared in one embodiment of the present invention and cotinine-labeled anti-HER2 antibody is added, Target cell specific apoptosis effects of chimeric antigen receptor T cells were analyzed by flow cytometry (B).
  • A fluorescence intensity
  • B Target cell specific apoptosis effects of chimeric antigen receptor T cells were analyzed by flow cytometry (B).
  • FIG. 10 shows cytotoxics as conjugates, cotinine-labeled cytotoxics (A: cotinine-duokamycin single conjugate, B: cotinine-DM1 complex conjugate (2 ⁇ cotinine-4 ⁇ DM1) and C: cotinine-duo) It is a graph confirming the apoptosis-inducing effect of chimeric antigen receptor T cells by the carmycin complex conjugate (2x cotinine-4x duocarmycin).
  • FIG. 11 is a single conjugate of cotinine-duocamycin (A), a complex conjugate of cotinine-DM1 (B), and a conjugate conjugate of cotinine-duokamycin, which are used in one embodiment of the present invention. It is a figure which shows a structure.
  • the present invention provides chimeric antigen receptors to which anti-cotinine antibodies are linked, including anti-cotinine antibodies or fragments thereof, hinge domains, transmembrane domains and signaling domains.
  • the chimeric antigen receptor to which the anti-cotinine antibody is linked may be in the form of an anti-cotinine antibody or a fragment thereof, a hinge domain, a transmembrane domain, and a signaling domain in the direction from its N-terminus to the C-terminus.
  • the anti-cotinine antibody is an antibody that binds to cotinine, wherein the antibody is monoclonal, polyclonal or recombinant It may be any one of antibodies.
  • the antibody may be a full-length antibody and a fragment of the antibody.
  • the fragment of the antibody may comprise a portion of an anti-cotinine antibody capable of binding to cotinine.
  • the fragment of the antibody may be Fab, Fab ', F (ab') 2, Fv or scFv.
  • the anti-cotinine antibody or fragment thereof is a heavy chain variable region comprising CDR1, CDR2 or CDR3, which is a complementarity determining region (CDR) represented by the amino acid sequence of SEQ ID NOs: 23-25, or SEQ ID NOs: 26-28 It may include a light chain variable region comprising CDR1, CDR2 or CDR3, respectively represented by the amino acid sequence of.
  • the anti-cotinine antibody or fragment thereof is a heavy chain variable region comprising CDR1, CDR2 and CDR3 represented by amino acid sequences of SEQ ID NOs: 23 to 25, respectively, and CDR1 represented by amino acid sequences of SEQ ID NOs: 26 to 28, respectively.
  • the anti-cotinine antibody may be a scFv fragment having the amino acid sequence of SEQ ID NO: 1.
  • the anti-cotinine antibody may be at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO: 1.
  • Anti-Cotinine antibodies or fragments thereof according to the invention can be prepared by modifying the methods described in US Pat. No. 8,008,448.
  • the hinge domain is a domain connecting the anti-cotinine antibody or fragment thereof and the transmembrane domain, and may include a cysteine residue.
  • the cysteine residue may be involved in the hinge domain binding to the antibody.
  • the hinge domain can be a CD8 hinge domain, an IgG1 hinge domain, an Ig4 hinge domain, a CD28 extracellular region, a killer immunoglobulin-like receptor extracellular region, and combinations thereof ( Mol . Ther . , 2015 ( 23): 757; J. Immunother . , 2006 (29): 284; Cancer immunol.Res . , 3 (7): 815-26; Blood , 2013 (122): 2965).
  • the CD8 hinge domain may have an amino acid sequence of SEQ ID NO.
  • the CD8 hinge domain may be at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO.
  • the transmembrane domain may connect the hinge domain and the signaling domain of the chimeric antigen receptor.
  • the transmembrane domain may penetrate the cell membrane of the cell such that the anti-cotinine antibody or fragment thereof of the chimeric antigen receptor is located on the cell surface and the signaling domain is located within the cell.
  • the transmembrane domain may be a transmembrane region of a CD3zeta, CD4, CD8, CD28 or KIR protein ( Immunol . Rev. , 2014 (257): 107; J. Immunol. , 2010 (184): 6938; Blood , 2013 (122): 2965, J. Immunother . , 2006 (29): 284; Cancer Immunol . Res. , 3 (7): 815-26).
  • the transmembrane domain may comprise a transmembrane region and a cytoplasmic region of CD28, the domain may have an amino acid sequence of SEQ ID NO: 5 or SEQ ID NO: 7.
  • the transmembrane domain may be at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO: 5 or SEQ ID NO: 7.
  • the signaling domain receives a signal transmitted by an anti-cotinine antibody or a fragment thereof, and serves to deliver it into the cell to which the chimeric antigen receptor is bound.
  • the signaling domain is CD3 zeta, inducible T-cell costimulator (ICOS), CD28, CD134 (OX40), CD137 (4-1BB), killer immunoglobulin-like receptor (KIR) or DNAX activation protein 12 (DAP12).
  • the signaling domain may be a cytoplasmic region of CD28 and CD3 zeta or a cytoplasmic region of CD137 (4-1BB) and CD3 zeta.
  • the signaling domain may be a cytoplasmic region of CD28 and CD3 zeta.
  • the cytoplasmic region of CD28 may have an amino acid sequence of SEQ ID NO: 9 or SEQ ID NO: 11
  • the cytoplasmic region of the CD3 zeta may have an amino acid sequence of SEQ ID NO: 13.
  • the signaling domain may be at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO: 9, SEQ ID NO: 11 or SEQ ID NO: 13.
  • chimeric antigen receptors of the invention may comprise modified forms of antibodies and domains as described above.
  • the modification may be performed by replacing, deleting or adding one or more amino acids in the amino acid sequence of the antibody and domain of the wild type without modifying the functions of the antibodies and domains.
  • the substitution is alanine or can be performed by conservative amino acid substitutions that do not affect the charge, polarity or hydrophobicity of the entire protein.
  • the chimeric antigen receptor may have an amino acid sequence of SEQ ID NO: 15 or SEQ ID NO: 17.
  • the chimeric antigen receptor may be at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO: 15 or SEQ ID NO: 17.
  • the present invention also provides a nucleic acid molecule encoding the chimeric antigen receptor.
  • Nucleic acid molecules according to the present invention include the anti-cotinine antibody or fragment thereof (SEQ ID NO: 2), hinge domain (SEQ ID NO: 4), transmembrane domain (SEQ ID NO: 6 or 8), and signaling domain (SEQ ID NO: 10, 12 or 14).
  • the nucleic acid molecule encoding the chimeric antigen receptor according to the present invention may be the nucleotide sequence of SEQ ID NO: 16 or SEQ ID NO: 18.
  • the nucleotide sequence includes those substituted with another nucleotide sequence capable of expressing the antibody or domain of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 can do.
  • the nucleic acid molecule may comprise a nucleic acid molecule encoding the antibody and domain of the modified form as described above.
  • the present invention also provides an expression vector containing the nucleic acid molecule.
  • the expression vector may be an adenovirus vector, a retrovirus vector, a lentiviral vector or an adeno-associated virus vector, and in one embodiment of the present invention, the expression vector may be a retrovirus vector.
  • the expression vector may be prepared by a person skilled in the art so that the chimeric antigen receptor according to the present invention can be expressed and secreted.
  • the expression vector may further include a signal sequence or a leader sequence.
  • the leader sequence may be an immunoglobulin kappa leader sequence.
  • the immunoglobulin kappa leader sequence may have an amino acid sequence of SEQ ID NO: 19, and may be at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to the amino acid sequence of SEQ ID NO: 19. have.
  • the present invention also provides a virus comprising the nucleic acid molecule.
  • the virus may comprise a nucleic acid molecule encoding a chimeric antibody receptor according to the invention in the genome.
  • the virus-transduced cell may express a chimeric antibody receptor according to the invention, wherein an anti-cotinine antibody or fragment thereof is located on its surface.
  • the virus may be adenovirus, retrovirus, lentivirus or adeno-associated virus. In one embodiment of the invention, the virus may be a retrovirus.
  • the virus can be obtained by transforming a cell with an expression vector as described above together with an expression vector comprising a nucleic acid molecule encoding the envelope protein of the virus.
  • transformation may be performed by a conventional method.
  • the envelope proteins available for transformation are VSV-G, Ecotropic envelope, Mokola, Rabies, MLV-Ampho, MLV-10A1, LCMV-WE, LCMV-Arm53b envelope, feline endogenous gamma retrovirus RD114 envelope and variants thereof, gibbon ape leukemia virus (GALV) envelope and variants thereof, MLV 4070A envelope, or gp120 / gp41 ( Mol. Ther . Methods Clin . Dev . , 2016 (3): 16017; J. Virol . Methods , 2004: 122-131; Molecular Therapy-Methods & Clinical Development 2016 (3): 16017).
  • the present invention also provides a cell transduced with the virus described above.
  • the cell may be transduced with a virus comprising a nucleic acid capable of expressing a chimeric antigen receptor according to the present invention.
  • the transduced cell may have an anti-cotinine antibody or fragment thereof located on the surface of the cell, and cotinine binding to the antibody or fragment through antigen-antibody binding may induce cell activity through signaling into the cell.
  • the cells may be T cells, natural killer cells or macrophages.
  • the cell may be a T cell.
  • the present invention also provides a chimeric antigen receptor cell further comprising a conjugate labeled with cotinine.
  • the complex when the conjugate is an antibody, the complex may be formed through a bond between the carboxyl group of the cotinine and the amine group of the antibody.
  • the cotinine is a hapten, which can bind to an antibody that specifically recognizes itself without changing the properties of the conjugated conjugated cotinine.
  • the conjugate may be a peptide, nucleic acid, protein or chemical.
  • the nucleic acid may be an aptamer and the protein may be an antibody or a hormone.
  • the aptamer may be an anti-VEGF aptamer.
  • the antibody may be an anti-HER2 antibody, anti-CD20 antibody or anti-HLA antibody.
  • the chimeric antigen receptor cell is in the form of an anti-cotinine antibody or fragment thereof linked, and when the cotinine of the complex binds to the anti-cotinine antibody or fragment thereof, the cell activity can be induced.
  • the binding of the conjugate labeled with the cell and the cotinine may be an antigen-antibody binding between the anti-cortinin antibody or fragment thereof of the chimeric antigen receptor and the cotinine.
  • the activity may be apoptosis-inducing activity by cytotoxic T cells.
  • the chimeric antigen receptor cell comprises the steps of adding a cotinine-labeled conjugate to a cell expressing a chimeric antigen receptor to which an anti-cotinine antibody or fragment thereof is linked, and selecting a chimeric antigen receptor cell to which the complex is linked to the cell. It can be prepared through.
  • the present invention also provides a pharmaceutical composition for preventing or treating a disease or disorder in which specific cells containing the chimeric antigen receptor cells are expanded.
  • Chimeric antigen receptor cells used as active ingredients of the pharmaceutical composition are as described above.
  • the disease or condition may be cancer, and the cancer may be solid or hematological cancer.
  • the hematologic cancer may be lymphoma, leukemia or multiple myeloma.
  • the pharmaceutical composition may comprise 10 to 95% by weight of chimeric antigen receptor cells according to the present invention as an active ingredient based on the total weight of the pharmaceutical composition.
  • the pharmaceutical composition of the present invention may further contain one or more active ingredients exhibiting the same or similar functions in addition to the active ingredient.
  • composition according to the present invention may further include one or more pharmaceutically acceptable carriers in addition to the above-described active ingredients for administration.
  • the present invention also provides a method for preventing or treating a disease or disorder in which specific cells are expanded, including administering the chimeric antigen receptor cells to a subject.
  • the chimeric antigen receptor cells are as described above.
  • the disease or disorder may be cancer, and specific cancers are as described above.
  • the dosage of chimeric antigen receptor cells according to the present invention may be determined by the type of disease, the severity of the disease, the type and amount of the active ingredient and other ingredients contained in the pharmaceutical composition, the type of formulation and the age, weight, general state of health and sex of the patient. And diet, time of administration, route of administration, duration of treatment, and drugs used concurrently.
  • the effective amount of chimeric antigen receptor cells included in the pharmaceutical composition according to the present invention may be 1 ⁇ 10 5 to 1 ⁇ 10 11 cells / kg. In this case, the administration may be administered once a day, may be divided into several times.
  • the chimeric antigen receptor cells of the invention can be administered to a subject in a variety of ways known in the art.
  • the subject may be a mammal, specifically a human.
  • the route of administration may be appropriately selected by those skilled in the art in consideration of the method of administration, the volume of body fluid, viscosity, and the like.
  • the present invention comprises the steps of administering the cells to the subject; And administering a cotinine-labeled conjugate to the subject.
  • the cells are transduced with a virus comprising a nucleic acid capable of expressing a chimeric antigen receptor according to the present invention, as described above.
  • Cotinine-labeled conjugates are as described above.
  • the subject may be a mammal, in particular a human, and administration may be carried out by a person skilled in the art as described above.
  • the present invention comprises the steps of administering to the subject the conjugated labeled cells and cotinine; And it provides a method for inducing apoptosis of chimeric antigen receptor cells, comprising the step of further administering a cytotoxic substance labeled with cotinine to the subject.
  • the chimeric antigen receptor cells are as described above.
  • immunotoxicity due to overactivity of the cells may occur as a side effect. Therefore, in order to solve such side effects, it is possible to induce apoptosis of chimeric antigen receptor cells by additionally administering a cotinine-labeled cytotoxic substance instead of a cotinine-labeled conjugate.
  • the cytotoxic substance may be used as long as it is a substance capable of inducing cell death.
  • the cytotoxic substance is duocarmycin, SN-38, calicheamicin, calicheamicin, MMAE (monomethyl auristatin E), MMAF (monomethyl auristatin F), doxorubicin, pyrrolobenzodiazepine, DM4 or DM1 Can be.
  • the cytotoxic material may be duocarmycin or DM1 (ASCO meeting abstracts 2014 (32): 2558; Clin . Cancer Res. , 2011 (17): 3157-69; Leuk . Lymphoma ., 2015 (56): 2863-69 ; J.
  • Administration of the cotinine-labeled cytotoxic substance can be controlled by various factors as described above.
  • An effective amount of chimeric antigen receptor cells included in the pharmaceutical composition according to the present invention may be appropriately selected by a person skilled in the art. In this case, the administration may be administered once a day, may be divided into several times.
  • the present invention comprises a first component containing a pharmaceutically treatable amount of the chimeric antigen receptor cell as an active ingredient; And it provides a pharmaceutical kit for the prevention or treatment of diseases or disorders in which a specific cell is proliferated, comprising a second component containing a cytotoxic substance labeled with a pharmaceutically treatable amount of cotinine as an active ingredient.
  • the first component and the second component may be sequentially administered in order to prevent or treat a disease or condition.
  • the second component may be administered when an immunotoxic side effect occurs after administration of the first component or when the chimeric antigen receptor cell is immortalized.
  • the disease or condition may be cancer, and specific cancers are as described above.
  • plasmids containing nucleic acids encoding scFv fragments, hinge domains, transmembrane domains, and signaling domains of anti-cotinine antibodies, respectively, were prepared by the following method.
  • the scFv fragment of the anti-cotinine antibody is a plasmid ( Clin . Chim ) ligated into a pCEP4 (Invitrogen, USA) vector after cleavage of the primer with the mouse Ig kappa leader sequence and the anti-cotinine scFv sequence with SfiI restriction enzyme . . Acta., 2010, 411-1238) for the PCR were in a conventional manner by using as a template.
  • c-myc markers, the human CD8 hinge region, the mouse CD28 transmembrane region and the cytoplasmic region of the chimeric antigen receptor, and the cytoplasmic region of human CD3 zeta are pLxSN-scFv-anti-CEA-CD28-zeta PCR was performed using a plasmid (Dr. Philip Darcy, PeterMac Cancer Center, Australia) as a template. Specific sequences of the primers used for PCR are shown in Table 1 below.
  • the two PCR products obtained were ligated to prepare cDNA of anti-cotinine chimeric antigen receptor.
  • the prepared cDNA and pMSCV-puro vectors (K1062-1, clontech, USA) were cleaved and ligated with HindIII / SalI and HindIII / ClaI, respectively.
  • the scFv fragment of the anti-cotinine antibody and the nucleic acid encoding the respective domains were cloned at the position of the puromycin resistance gene under the PGK promoter of the pMSCV-puro retroviral vector.
  • the prepared construct was confirmed by sequencing, which was named pMP-Cot-28Z (FIG. 3A).
  • the retroviral construct prepared in Example 1-1, pMD2.G (# 12259, Addgene, plasmid having a sequence complementary to a nucleic acid encoding vesicular stomatitis indiana virus G protein), a viral envelope protein And transduced with Phoenix GP (ATCC, USA) cell line. Transduction was performed according to the manufacturer's protocol using Lipofectamine 2000 (Cat. # 11668-019, invitrogen, USA). After 48 hours, cultures containing retroviruses of the VSV-G pseudotype were taken and infected again with the Phoenix Eco (ATCC, USA) cell line. Three to five days after infection, cell lines were established by selecting Phoenix Eco cells showing myc label positive using a flow cytometer (BD Bioscience, USA). The produced retroviruses were cultured and stored at 10-fold concentrations using a centrifugal filter device (Amicon Ultra-15, 100 kDa cut-off, Millipore, USA).
  • cytotoxic T cells with chimeric antigen receptors to which anti-Cotinine antibody fragments were linked were presented on the surface.
  • splenocytes were isolated from B6 mice and seeded at a cell culture vessel coated with 10 ⁇ g / ml of anti-CD3 antibody (145-2C11, BD Bioscience, USA) to 2.5 ⁇ 10 6 cells per well.
  • cells were prepared by adding RPMI-1640 medium containing 2 ⁇ g / ml of anti-CD28 antibody (37.51, BD Bioscience, USA) to a total of 1 ml and incubating at 5% CO 2 , 37 ° C. It was.
  • the medium of virus-transduced T cells was replaced with a medium containing 20 U / ml of Interleukin-2, which was incubated for 72 hours at 5% CO 2 , 37 ° C. Thereafter, the transduction rate of the chimeric antigen receptor to which the anti-cotinine antibody fragments which were determined by measuring the stained c-myc label by flow cytometry was about 50 to 70% (FIG. 3B).
  • T cells into which the green fluorescent protein was introduced as a control group exhibited a transduction rate of about 80%.
  • the T cells in which the chimeric antigen receptor to which the anti-cotinine antibody fragment thus prepared was connected were presented on the surface, and were used in subsequent experiments within 24 hours after preparation.
  • Rituximab (Genentech, Biogen, USA), an anti-CD20 antibody, Trastuzumab (Genentech, USA), an anti-HER2 antibody, CT302 (Celtrion, an anti-influenza virus hemagglutinin antibody) Korea) and W6 / 32 (eBioscience, USA), an anti-HLA antibody, to prepare a conjugate conjugated with cotinine.
  • the complex was conjugated by EDC (1-ethyl-3- [3 dimethylaminopropyl] carbodiimide) connection method.
  • the antibodies were prepared by dissolving to 25 ⁇ M concentration in PBS. Meanwhile, trans-4-cotininecarboxylic acid (Sigma-Aldrich) was added to 1 ml of MES buffer [0.1 M of 2- [morpholino] ethaneusulfonic acid (MES) and 0.5 M sodium chloride, pH 6.0]. It was prepared by dissolving to a concentration of 5 mM. To this was added 50 mM EDC and 125 mM N-hydroxysulfosuccinimide (N-hydroxysulfosuccinimide, Sulfo-NHS, Thermo Scientific, USA), followed by dissolving with cotinine at room temperature for 15 minutes.
  • MES buffer 0.1 M of 2- [morpholino] ethaneusulfonic acid (MES) and 0.5 M sodium chloride, pH 6.0]. It was prepared by dissolving to a concentration of 5 mM. To this was added 50 mM EDC and 125 mM N-hydroxysul
  • An active solution in which -NHS ester was produced was prepared.
  • sodium hydroxide solution was added, the pH of the active solution was adjusted to 7 or more and 1 mL was taken, and 25 ⁇ M of the antibody to be conjugated with cotinine was added thereto. Concentration was added in the same amount as the active solution. The mixture was reacted with stirring for 3 hours at room temperature to obtain a cotinine-antibody complex produced through EDC ligation.
  • the obtained cotinine-antibody complexes were dialyzed in PBS using a Slide-A-lyzer TM dialysis cassette (Thermo Fisher Scientific, USA) or exchanged buffer to PBS using an Amicon® Ultra Centrifugal Filter (EMD Millipore, USA). Used.
  • Cotinine-Pegaptanib complex was prepared by the solid phase oligopeptide synthesis method using pegaptanib, an aptamer that recognizes vascular endothelial growth factor (VEGF).
  • VEGF vascular endothelial growth factor
  • pegaptanib RNA aptamer (5'-pCfpGmpGmpArpArpUfpCfpAmpGmpUfpGmpAmpAmpUfpGmpCfpUfpUfpAmpUfpAmpCfpAmpUfpCfpCfpGm-p-dT-3-3 ', SEQ ID NO: 34) was synthesized at the 5'-terminal end using the oligopeptide synthesizer. Amino C6 linker was attached at the end. Cotinine was attached to the amino C6 linker by using active ester cross-linking.
  • the synthesized complex of cotinine and pegaptanib was suspended in distilled water to which diethylpyrocarbonate was added, reacted at 95 ° C. for 5 minutes, cooled at room temperature for 30 minutes, and stored at ⁇ 20 ° C.
  • the chimeric antigen receptor gene to which the anti-carcinoembryonic antigen (anti-CEA) scFv fragment is linked is based on the pLxSN-scFv-anti-CEA-zeta plasmid (Dr. Philip Darcy, PeterMac Cancer Center, Australia). Obtained by the PCR method using the primers described in Table 1 above. The gene and the pMSCV-puro vector (K1062-1, clontech, USA) obtained were digested and ligated with HindIII and ClaI, respectively. The constructed construct was named pMP-C28Z. The construct was used to produce retroviruses under the conditions and methods of Examples 1 and 2, to prepare T cells transduced with the retrovirus.
  • T cells expressing green fluorescence protein genes of green fluorescence protein included in pMIG-w plasmid (Dr. Yosef Refaeli, National Jewish Medical and Research Center, USA) were obtained using NcoI and SalI. .
  • the gene was removed from the pMP-C28Z plasmid prepared in Comparative Example 2 with the same enzyme as the anti-cancer embryo chimeric antigen receptor gene and then inserted into the site.
  • the constructed construct was named pMP-GFP. Thereafter, the construct was used to produce retroviruses under the conditions and methods of Examples 1 and 2, and T cells transduced with the retroviruses were prepared.
  • ELISA was performed to determine whether the complex induces activation of chimeric antigen receptor cells by recognizing vascular endothelial growth factor (VEGF). It was.
  • VEGF vascular endothelial growth factor
  • VEGF vascular endothelial growth factor
  • VEGF-coated plate was added nothing (VEGF only), VEGF-coated plate was added only T cells (T cell only), VEGF-coated plate was added only T cells
  • a group VEGF + T cell
  • a group in which a control aptamer (5'-dTTGGTGGTGGTGGTTGTGGTGGTGGTGG-3 ', SEQ ID NO: 36) and a T cell were added to a VEGF-coated plate (VEGF + Control Aptamer + T cell) were used. .
  • the secretion of interferon gamma was significantly increased in the group (VEGF + Cot-pegaptanib + T cells) in which the cotinine-pegatanib complex was added to the chimeric antigen receptor T cells to which the anti-cotinine antibody fragments were linked. It was confirmed.
  • the cotinine-anti-HER2 antibody complex prepared in Example 3-1 was used to determine whether the complex induces activation of chimeric antigen receptor cells by recognizing HER2 on the cell surface.
  • the AU565 cell line, HER2-positive cells, and the MDA-MB-231 cell line, HER2 negative cells were divided into 96-well plates with round bottoms so as to have 3x10 4 per well, overnight at 5% CO 2 and 37 ° C. Incubated for After removing the culture supernatant, 100 ⁇ l of the cotinine-anti-HER2 antibody complex added at a concentration of 10 ⁇ g / ml was added to DMEM (Gibco, USA) medium to which 10% fetal bovine serum and 1% penicillin-streptomycin were added. It was incubated for 1 hour under the same conditions.
  • DMEM Gibco, USA
  • the medium was removed, the cells were washed twice with serum-free medium, and the chimeric antigen receptor T cells prepared in Example 2 were added so as to have 3 ⁇ 10 5 cells per well, under conditions of 5% CO 2 and 37 ° C. Incubated for 24 hours.
  • the amount of interferon gamma secreted in the medium was measured according to the manufacturer's protocol using an ELISA kit, and the results are shown in FIG. 5.
  • CT302 influenza virus hemagglutinin-specific antibody
  • CT302 chimeric antigen receptor T cells
  • the group in which the cotinine to which the CT302 antibody was linked to the plate was added to the chimeric antigen receptor T cells (CT302-Cot), and the group to which the anti-HER2 antibody was added to the chimeric antigen receptor T cells to the plate in which the cells were cultured (anti-HER2) were used. It was.
  • the secretion of interferon gamma was significantly increased in the group (anti-HER2-Cot) in which the cotinine-anti-HER2 antibody complex was added to the chimeric antigen receptor T cells to which the anti-cotinine antibody fragment was linked. Confirmed.
  • Test Example 3 Anti- Cotinine Antibody fragments Connected chimera Confirm antigen specific activation of antigen receptor T cells
  • the experiment was conducted under the same conditions and methods as in Test Example 2 except that only AU565 cells, which were HER2 positive cells, were used.
  • CT302 A group in which CT302 antibody and T cells were added to a plate in which cells were cultured
  • CT302-Cot a group in which cotinine and
  • the secretion of interferon gamma increased significantly in the group (anti-HER2-Cot) in which the cotinine-anti-HER2 antibody complex was added to the chimeric antigen receptor T cells to which the anti-cotinine antibody fragment was linked. Confirmed. Therefore, it was found that the secretion of interferon gamma is induced by a binding substance linked to cotinine.
  • Test Example 4 Presented on the surface of T cells chimera Expression rate of antigen receptor
  • the expression rate of each of the chimeric antigen receptors was measured by measuring the expression of c-myc in T cells that expressed nothing on the surface, and chimeric antigen receptor T cells linked to CEA or anti-cotinine antibody fragments prepared in Examples 2 and Comparative Example 1. It was confirmed.
  • T cells expressing nothing on the surface, and chimeric antigen receptor T cells prepared in Example 2 or Comparative Example 1 were each dispensed to be 4 ⁇ 10 5 cells per well.
  • the dispensed cells were washed twice with PBS buffer with 1% bovine serum albumin (BSA) and 0.02% NaN 3 , and diluted with anti-myc antibody (BD Bioscience, USA) at a ratio of 1: 400 in the buffer. Added. It was reacted for 20 minutes in refrigeration and washed three times with the PBS buffer.
  • BSA bovine serum albumin
  • anti-myc antibody BD Bioscience, USA
  • streptavidin-PE (BD Bioscience, USA) at a ratio of 1: 1000
  • CD8-perCP-cy5.5 (BD Bioscience, USA) at a ratio of 1: 500
  • CD4-APC at a ratio of 1: 1000.
  • 50 ⁇ l of PBS buffer to which (BD Bioscience, USA) was added was added and reacted for 25 minutes in refrigeration.
  • the cells were resuspended in 300 ⁇ l of PBS and analyzed for c-myc label positive cells using a flow cytometer (FACS Caliber, BD Bioscience, USA). Shown in At this time, as a control group for each T cell, an untreated group (Unstained), a group treated with only the streptavidin-PE which is a secondary antibody (Control) were used.
  • Example 2 As shown in FIG. 6B, it was confirmed that the chimeric antigen receptor T cells prepared in Example 2 and Comparative Example 1 express anti-cotinine antibody fragment or CEA.
  • the cotinine-anti-CD20 antibody complex prepared in Example 3-1 was used to determine whether the complex induces activation of chimeric antigen receptor cells by recognizing CD20 on the cell surface. Specifically, experiments were performed using the RPMI- with 10% fetal bovine serum and 1% penicillin-streptomycin supplemented with Jurkat E6.1 cell line, CD20 negative cell, and Raji cell line, CD20 positive cell, instead of AU565 cell line and MDA-MB-231 cell line. The culture was carried out in 1640 medium, and the amount of the interferon gamma secreted was carried out under the same conditions and methods as in Test Example 2, except that the amount of the interferon gamma was confirmed in the culture obtained after 48 hours of culture.
  • the amount of interferon gamma secreted is shown in FIG. 7.
  • the secretion of interferon gamma was significantly increased in the group (anti-CD20-Cot) in which the cotinine-anti-CD20 antibody complex was added to the chimeric antigen receptor T cells to which the anti-cotinine antibody fragment was linked. Confirmed.
  • the cotinine-anti-HLA antibody complex prepared in Example 3-1 was used to determine whether the complex induces activation of chimeric antigen receptor cells by recognizing HLA on the cell surface. Specifically, experiments were conducted in the IMDM medium supplemented with 20% fetal bovine serum and 1% penicillin-streptomycin with HLA-negative NIH3T3 cell line and HLA-positive HLA7 or HLA20 cell line instead of AU565 cell line and MDA-MB-231 cell line. The culture was used in the same manner as in Test Example 2, except that the amount of secreted interferon gamma was confirmed in the culture obtained after 48 hours of culture.
  • HLA7 and HLA20 cell lines were prepared by the following method. Specifically, a mixture of 10 ml of peripheral blood and the same amount of PBS was dispensed into 15 ml of Ficoll-Paque PLUS (GE Healthcare Life Science, USA). It was centrifuged at 400 xg for 30 minutes, with the brake set to '0'. After centrifugation, the uppermost plasma was removed and 5 ml of peripheral blood monocyte layer was taken. 30 ml of RPMI-1640 medium was added thereto and centrifuged for 10 minutes under the same conditions. The supernatant was removed and washed once more by addition of the same amount of RPMI-1640 medium.
  • Precipitated cells were resuspended in 2 ml of RPMI-1640 medium containing 20% fetal bovine serum and the number of cells was counted. 1 ⁇ 10 7 cells were dispensed into a T25 flask, and a total of 6 ml of culture medium was added thereto and cultured at 5% CO 2 and 37 ° C. 2 ml of Epstein Barr virus (VR-1492, ATCC, USA) was added thereto and cultured under the same conditions. After 2 hours of incubation, 1 ⁇ g / ml of cyclosporin A (Gibco, USA) was added and incubated for 4 days under the same conditions.
  • RPMI-1640 medium containing 20% fetal bovine serum
  • the amount of interferon gamma secreted is shown in FIG. 8.
  • the secretion of interferon gamma was significantly increased in the anti-HLA-Cot group in which the cotinine-anti-HLA antibody complex was added to the chimeric antigen receptor T cells to which the anti-cotinine antibody fragment was linked. Confirmed.
  • Test Example 7 Cotinine -term- HER2 Antibody Complexes and Anti- Cotinine Antibody fragments Connected Height By Mera antigen receptor T cells Target cell Confirmation of specific apoptosis effect
  • Example 3-1 Using chimeric antigen receptor T cells to which the cotinine-anti-HER2 antibody complex and anti-cotinine antibody fragments prepared in Example 3-1 are linked, the complex recognizes HER2 on the cell surface, thereby It was confirmed whether apoptosis was induced.
  • the AU565 cell line, HER2 positive cells, and MDA-MB-231 cells, HER2 negative cells were divided into 2 ⁇ 10 6 cells in a 100 mm cell culture vessel.
  • the divided cells were cultured in the same medium and conditions as in Test Example 2.
  • MDA-MB-231 cell line is first to prepare a cell such that the dog 2x10 7 per 1 ml, here CFSE (carboxyfluorescein succinimidyl ester, Invitrogen, USA) to each at concentrations of ⁇ M and 100 nM. After reacting this for 8 minutes at room temperature, each cell line was stained with different fluorescence intensity, and this was confirmed using a flow cytometer (BD Bioscience, USA).
  • CFSE carboxyfluorescein succinimidyl ester, Invitrogen, USA
  • the AU565 cell line was weakly stained (CFSE low ) and the MDA-MB-231 cell line was strongly stained (CFSE high ).
  • Stained cells were washed twice with PBS, and the washed cell lines were mixed in a ratio of 1: 1 by 1.5 ⁇ 10 6, and then divided into 96-well plates. When the divided cells were attached, 1 ⁇ g / ml of cotinine-anti-HER2 antibody complex was added thereto, and the cells were reacted at room temperature for 1 hour. After the reaction, the cell lines were washed with culture medium, counted and placed in 5 ml tubes to give 5 ⁇ 10 4 cells. To this was added chimeric antigen receptor T cells to which the anti-cotinine antibody fragments were linked, which were incubated for 4 hours or 22 hours at 5% CO 2 , 37 ° C.
  • the ratio of the chimeric antigen receptor T cells (acting cell line, E), and the AU565 and MDA-MB-231 cell lines (target cell line, T) was set to 0: 1, 5: 1, 10: 1.
  • 7-AAD BD Bioscience, USA
  • 7-AAD negative cells and CFSE positive cells were fractionated and analyzed.
  • the cell death rate of the target cells was calculated according to Equation 1 below, and the results are shown in FIG. 9B.
  • the complex of cotinine-toxic material was prepared by Concortitis, and it was confirmed by the following method whether the complex induces apoptosis of chimeric antigen receptor T cells prepared in Example 2.
  • chimeric antigen receptor T cells were aliquoted into 5 ⁇ 10 5 cells in 96-well plates and cultured with the culture medium. A complex of 0, 0.1, 1, 10, 100 or 1,000 nM of cotinine-toxic material was added thereto, and incubated for 48 hours under conditions of 5% CO 2 and 37 ° C.
  • a cotinine-duocarmycin single conjugate, a cotinine-DM1 complex conjugate (2x cotinine-4xDM1) or a cotinine-duocarmycin complex conjugate (2x cotinine-4x duocarmycin) was used ( 11).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Mycology (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Oncology (AREA)
  • Botany (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Hematology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Reproductive Health (AREA)
  • Pregnancy & Childbirth (AREA)
  • Developmental Biology & Embryology (AREA)
  • Chemical Kinetics & Catalysis (AREA)

Abstract

본 발명은 항-코티닌 항체가 연결된 키메라 항체 수용체 및 이의 용도에 관한 것이다. 상기 키메라 항체 수용체를 표면에 제시하는 T 세포는 함께 첨가하는 코티닌이 표지된 접합물질의 표적분자 특이적으로 인터페론 감마를 분비하고 표적분자를 발현하는 세포의 세포사멸을 유도한다. 또한, 코티닌이 표지된 세포독성물질을 투여함으로써 상기 키메라 항원 수용체 T 세포의 세포사멸이 유도되고, 그에 따라 필요시 코티닌이 표지된 세포독성물질을 투여하여 기투여된 키메라 항원 수용체 T 세포를 제거함으로써 T 세포의 과활성에 의한 면역 부작용을 억제할 수 있다. 따라서, 상기 항-코티닌 항체가 연결된 키메라 항원 수용체는 암의 치료에 유용하게 사용될 수 있다.

Description

항-코티닌 항체가 연결된 키메라 항체 수용체 및 이의 용도
본 발명은 항-코티닌 항체가 연결된 키메라 항체 수용체 및 이의 용도에 관한 것이다.
바이오 의약품으로 개발 가능한 펩타이드, 앱타머(aptamer) 또는 항체 등의 물질은 그 효과가 좋으나, 체내에서 분해되기 쉬우며 신장을 통해 빠르게 배출되기 때문에 체내 반감기가 짧다. 이와 같은 문제점을 해결하기 위해 폴리에틸렌글리콜(PEG)을 접합시켜, 이들의 체내 반감기를 증가시키기 위한 연구가 진행되고 있다(Veronese F.M. & Pasut G., Drug Discov . Today, 10, 1451-1458, 2005). 그러나, PEG를 접합시키는 과정에서 다양한 분자 결합체가 생성되고, PEG와 접합하는 접합물질에 따라 최적화 조건을 확립해야 하는 문제점이 있다. 또한, 이들 분자들은 대상표적이 세포(암세포 등)인 경우, 세포독성이 없거나 약한 단점이 있다. 따라서, 최근에 항체와 세포독성물질의 접합체(antibody-drug conjugates)가 개발되고 있다.
한편, 키메라 항원 수용체(chimeric antigen receptor, CAR)는 항체의 단편, 힌지 영역, 막통과 도메인 및 세포 내 신호전달 도메인으로 구성된다. 상기 키메라 항원 수용체가 발현된 T 세포 및 자연살해세포 등과 같은 면역세포는, 항체의 단편이 표적분자를 발현하는 세포(암세포 등)를 특이적으로 인지하여 면역세포의 세포독성을 활성화시킴으로써 표적세포의 세포사멸을 유도한다. 따라서, 상기 세포는 유전자이입 세포 치료요법(genetically engineered cell therapy)에 활용되고 있으며, 특히, 키메라 항원 수용체 T 세포는 CD19가 발현된 혈액암에 대해 높은 치료 효과를 나타냄이 보고되었다.
그러나, 통상의 키메라 항원 수용체 세포는 하나의 표적분자를 인지한다는 한계점이 있어, 합텐(hapten)을 사용한 키메라 항원 수용체 세포가 연구되고 있다. 이는 합텐을 인지하는 항체 부위를 갖는 키메라 항원 수용체 세포와 표적을 인지하는 접합물질(예를 들어, 펩티드, 앱타머, 항체, 저분자 화학물질 등)이 결합된 합텐을 포함한다. 이를 통해 한 종류의 키메라 항원 수용체 T 세포가 다양한 표적분자에 결합할 수 있는 다표적형(multi-targeting) 키메라 항원 수용체 T 세포를 제작할 수 있다.
상기 합텐은 키메라 항원 수용체를 표면에 제시하는 세포가 표적 이외의 세포와 결합하는 것을 방지하기 위하여 생체 내에 본래 존재하지 않는 물질일수록 좋다. 또한, 접합물질과의 효과적인 결합을 위하여 화학작용기(chemical functional group)를 가져야 한다.
코티닌은 니코틴의 주요 대사 산물로서 체내에서 생합성(de novo biosynthesis)되지 않고, 생리적 활성도 유발하지 않는다. 또한, 포유동물에서 코티닌의 대사과정이 잘 알려져 있을뿐만 아니라, 혈청 반감기가 16시간이라는 점도 보고되어 있다(Benowits N.L. et al., 3rd Handb . Exp . Pharmacol ., 29-60, 2009). 따라서, 코티닌은 흡연자의 경우에도 수일간 금연한 이후에는 체내에 존재하지 않아 합텐으로서 사용 가능하다. 또한, 상기 코티닌은 카르복실기가 결합된 형태로 제조가 용이하여 접합물질과의 결합이 가능하다.
이에, 본 발명자들은 항-코티닌 항체가 연결된 키메라 항원 수용체 T 세포 및 코티닌이 표지된 접합물질을 제조하여, 상기 키메라 항원 수용체 T 세포가 코티닌이 표지된 접합물질의 표적분자 특이적으로 인터페론 감마를 분비하고, 표적 세포의 세포 사멸을 유도하며, 코티닌이 표지된 세포독성물질에 의해 상기 키메라 항원 수용체 T 세포의 세포사멸이 유도됨을 확인하였다(도 1).
또한, 최근 키메라 항원 수용체 T 세포 요법의 항암 치료제로서의 효능이 강화됨에 따라 이들 유전자이입 T 세포의 과활성에 의한 면역독성이 부작용으로 부각되고 있다. 따라서, 이들 T 세포에 의한 심각한 부작용(serious adverse side effect)이 출현 시, 이들 세포의 세포사멸을 유도함으로써 부작용을 해소하려는 방안들이 강구되고 있다. 상기 항-합텐 키메라 항원 수용체의 경우, 이를 발현하는 T 세포가 주입된 환자 체내에서 면역독성 부작용이 생기는 경우, 합텐이 표지된 접합물질 대신 합텐이 표지된 세포독성물질을 주입하게 되면, 합텐이 표지된 세포독성물질이 항-합텐 키메라 항원 수용체 T 세포에만 결합하여 세포사멸을 유도할 수 있으므로, 이들 T 세포에 의한 부작용을 해소할 수 있는 안전장치로도 이용될 수 있는 추가적인 장점을 가진다(도 2). 이에, 본 발명자들은 코티닌이 표지된 세포독성물질에 의해 상기 키메라 항원 수용체 T 세포의 세포사멸이 유도됨을 확인함으로써, 본 발명을 완성하였다.
따라서, 본 발명의 목적은 항-코티닌 항체가 연결된 키메라 항원 수용체를 제공하는 것이다.
본 발명의 다른 목적은 상기 키메라 항원 수용체를 코딩하는 핵산분자, 이를 포함하는 발현벡터 및 바이러스, 및 상기 바이러스가 형질도입된 세포를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 세포에 코티닌이 표지된 접합물질을 더 포함하는 키메라 항원 수용체 세포를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 키메라 항원 수용체 세포를 유효성분으로 함유하는 특정 세포가 증식되는 질환 또는 질병의 예방 또는 치료용 약학 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 키메라 항원 수용체 세포를 개체에 투여하는 것을 포함하는 특정 세포가 증식되는 질환 또는 질병의 예방 또는 치료 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 키메라 항원 수용체 세포의 세포사멸 유도 방법을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 항-코티닌 항체 또는 이의 단편, 힌지 도메인, 막관통 도메인 및 신호전달 도메인을 포함하는 항-코티닌 항체가 연결된 키메라 항원 수용체를 제공한다.
또한, 본 발명은 상기 키메라 항원 수용체를 코딩하는 핵산 분자를 제공한다.
또한, 본 발명은 상기 핵산 분자를 포함하는 발현벡터를 제공한다.
또한, 본 발명은 상기 핵산 분자를 포함하는 바이러스를 제공한다.
또한, 본 발명은 상기 바이러스가 형질도입된 세포를 제공한다.
또한, 본 발명은 상기 세포에 코티닌이 표지된 접합물질을 포함하는 키메라 항원 수용체 세포를 제공한다.
또한, 본 발명은 상기 키메라 항원 수용체 세포를 유효성분으로 함유하는 특정 세포가 증식되는 질환 또는 질병의 예방 또는 치료용 약학 조성물을 제공한다.
또한, 본 발명은 상기 키메라 항원 수용체 세포를 개체에 투여하는 것을 포함하는 특정 세포가 증식되는 질환 또는 질병의 예방 또는 치료 방법을 제공한다.
또한, 본 발명은 상기 세포를 개체에 투여하는 단계; 및 코티닌이 표지된 접합물질을 개체에 투여하는 단계를 포함하는, 개체 내에서 키메라 항원 수용체 세포를 제조하는 방법을 제공한다.
또한, 본 발명은 상기 세포 및 코티닌이 표지된 접합물질을 개체에 투여하는 단계; 및 상기 개체에 코티닌이 표지된 세포독성물질을 더 투여하는 단계를 포함하는, 키메라 항원 수용체 세포의 세포사멸 유도 방법을 제공한다.
나아가, 본 발명은 약학적으로 치료가능한 양의 상기 키메라 항원 수용체 세포를 유효성분으로 함유하는 제1성분; 및 약학적으로 치료가능한 양의 코티닌과 세포독성물질의 복합체를 유효성분으로 함유하는 제2성분을 포함하는, 특정 세포가 증식되는 질환 또는 질병의 예방 또는 치료용 약학적 키트를 제공한다.
본 발명의 항-코티닌 항체가 연결된 키메라 항원 수용체를 표면에 제시하는 T 세포는 함께 첨가하는 코티닌이 표지된 접합물질의 표적분자 특이적으로 인터페론 감마를 분비하고 표적분자를 발현하는 세포의 세포사멸을 유도한다. 또한, 코티닌이 표지된 세포독성물질을 투여함으로써 상기 키메라 항원 수용체 T 세포의 세포사멸이 유도되고, 그에 따라 필요시 코티닌이 표지된 세포독성물질을 투여하여 기투여된 키메라 항원 수용체 T 세포를 제거함으로써 T 세포의 과활성에 의한 면역 부작용을 억제할 수 있다. 따라서, 상기 항-코티닌 항체가 연결된 키메라 항원 수용체는 특정 세포가 증식되는 질환 또는 질병의 치료에 유용하게 사용될 수 있다.
도 1은 표적 세포에 따라 코티닌이 표지된 접합물질을 달리하여 키메라 항원 수용체 T 세포의 표적을 변경할 수 있음을 보여주는 도면이다.
도 2는 코티닌이 표지된 세포독성물질을 사용하여 키메라 항원 수용체 T 세포의 세포사멸을 유도하는 것을 보여주는 도면이다.
도 3은 본 발명의 일실시예에서 제작된 항-코티닌 항체 단편이 연결된 키메라 항원 수용체 유전자와 이를 발현하는 바이러스 벡터의 구조(A) 및 상기 키메라 항원 수용체를 표면에 제시하는 T 세포를 유세포분석기로 분석한 결과(B) 그래프이다.
도 4는 본 발명의 일실시예에서 제작된 항-코티닌 항체 단편이 연결된 키메라 항원 수용체 T 세포를 코티닌이 표지된 항-VEGF 앱타머와 함께 표적분자인 VEGF 단백질과 반응시켰을 때, T 세포에서 분비된 인터페론 감마의 양을 확인한 그래프이다.
도 5는 본 발명의 일실시예에서 제작된 키메라 항원 수용체 T 세포를 코티닌이 표지된 항-HER2 항체와 함께 HER2 양성 또는 음성인 세포에 첨가하여 상기 T 세포에서 분비된 인터페론 감마의 양을 확인한 그래프이다.
도 6은 본 발명의 일실시예에서 제작된 키메라 항원 수용체 T 세포가 함께 첨가되는 코티닌이 표지된 항-HER2 항체 특이적으로 인터페론 감마를 분비함을 확인하고(A), T 세포 표면에 발현된 키메라 항원 수용체를 유세포분석기로 분석한 결과(B) 그래프이다.
도 7은 본 발명의 일실시예에서 제작된 키메라 항원 수용체 T 세포를 코티닌이 표지된 항-CD20 항체와 함께 CD20 양성 또는 음성인 세포에 첨가하여 상기 T 세포에서 분비된 인터페론 감마의 양을 확인한 그래프이다.
도 8은 본 발명의 일실시예에서 제작된 키메라 항원 수용체 T 세포를 코티닌이 표지된 항-HLA 항체와 함께 HLA 양성 또는 음성인 세포에 첨가하여 상기 T 세포에서 분비된 인터페론 감마의 양을 확인한 그래프이다.
도 9는 표적 세포를 다른 세기의 형광강도를 나타내도록 염색하고(A), 여기에 본 발명의 일실시예에서 제작된 키메라 항원 수용체 T 세포와 코티닌이 표지된 항-HER2 항체를 첨가하여, 상기 키메라 항원 수용체 T 세포의 표적 세포 특이적 세포사멸 효과를 유세포분석기로 분석한 결과(B) 그래프이다.
도 10은 접합물질로서 세포독성물질을 사용하여, 코티닌이 표지된 세포독성물질(A: 코티닌-듀오카마이신 단일 접합체, B: 코티닌-DM1 복합 접합체(2x코티닌-4xDM1) 및 C: 코티닌-듀오카마이신 복합 접합체(2x코티닌-4x듀오카마이신)에 의한 키메라 항원 수용체 T 세포의 세포사멸 유도 효과를 확인한 그래프이다.
도 11은 본 발명의 일실시예에서 사용된 세포독성물질인 코티닌-듀오카마이신의 단일 접합체(A), 코티닌-DM1의 복합 접합체(B) 및 코티닌-듀오카마이신의 복합 접합체(C)의 구조를 나타낸 도면이다.
이하, 본 발명을 상세히 설명한다.
본 발명은 항-코티닌 항체 또는 이의 단편, 힌지 도메인, 막관통 도메인 및 신호전달 도메인을 포함하는 항-코티닌 항체가 연결된 키메라 항원 수용체를 제공한다.
상기 항-코티닌 항체가 연결된 키메라 항원 수용체는 이의 N-말단에서부터 C-말단 방향으로 항-코티닌 항체 또는 이의 단편, 힌지 도메인, 막관통 도메인 및 신호전달 도메인의 순서로 결합된 형태일 수 있다.
상기 항-코티닌 항체는 코티닌에 결합하는 항체로서, 상기 항체는 단일클론항체, 다클론항체 또는 재조합 항체 중 어느 하나일 수 있다. 또한, 상기 항체는 전장 형태의 항체 및 항체의 단편일 수 있다. 이때, 항체의 단편은 코티닌과 결합 능력이 있는 항-코티닌 항체의 일부분을 포함할 수 있다. 상기 항체의 단편은 Fab, Fab', F(ab')2, Fv 또는 scFv일 수 있다.
상기 항-코티닌 항체 또는 이의 단편은 서열번호 23 내지 25의 아미노산 서열로 각각 표시되는 상보성 결정 영역(complementarity determining region, CDR)인 CDR1, CDR2 또는 CDR3을 포함하는 중쇄 가변 영역, 또는 서열번호 26 내지 28의 아미노산 서열로 각각 표시되는 CDR1, CDR2 또는 CDR3을 포함하는 경쇄 가변 영역을 포함할 수 있다. 구체적으로, 상기 항-코티닌 항체 또는 이의 단편은 서열번호 23 내지 25의 아미노산 서열로 각각 표시되는 CDR1, CDR2 및 CDR3을 포함하는 중쇄 가변 영역, 및 서열번호 26 내지 28의 아미노산 서열로 각각 표시되는 CDR1, CDR2 및 CDR3을 포함하는 경쇄 가변 영역을 포함할 수 있다. 본 발명의 일실시예에서, 상기 항-코티닌 항체는 서열번호 1의 아미노산 서열을 갖는 scFv 단편일 수 있다. 또한, 상기 항-코티닌 항체는 서열번호 1의 아미노산 서열과 80%, 85%, 90%, 95%, 97%, 98% 또는 99% 이상 동일할 수 있다.
본 발명에 따른 항-코티닌 항체 또는 이의 단편은 미국 특허 제8,008,448호에 기재된 방법을 변형하여 제조할 수 있다.
상기 힌지 도메인은 항-코티닌 항체 또는 이의 단편과 막관통 도메인을 연결하는 도메인으로서, 시스테인 잔기를 포함할 수 있다. 상기 시스테인 잔기는 힌지 도메인이 항체와 결합하는데 관여할 수 있다. 예를 들어, 상기 힌지 도메인은 CD8 힌지 도메인, IgG1 힌지 도메인, Ig4 힌지 도메인, CD28 세포외 영역, KIR(killer immunoglobulin-like receptor) 세포외 영역 및 이의 조합일 수 있다(Mol . Ther ., 2015(23):757; J. Immunother ., 2006(29):284; Cancer immunol . Res., 3(7):815-26; Blood, 2013(122):2965). 상기 CD8 힌지 도메인은 서열번호 3의 아미노산 서열을 가질 수 있다. 또한, 상기 CD8 힌지 도메인은 서열번호 3의 아미노산 서열과 80%, 85%, 90%, 95%, 97%, 98% 또는 99% 이상 동일할 수 있다.
상기 막관통 도메인은 키메라 항원 수용체의 힌지 도메인과 신호전달 도메인을 연결할 수 있다. 막관통 도메인은, 키메라 항원 수용체의 항-코티닌 항체 또는 이의 단편이 세포 표면에 위치하고, 신호전달 도메인이 세포 내에 위치하도록 세포의 세포막을 관통할 수 있다. 상기 막관통 도메인은 CD3제타, CD4, CD8, CD28 또는 KIR 단백질의 막관통 영역일 수 있다(Immunol . Rev., 2014(257):107; J. Immunol., 2010(184):6938; Blood, 2013(122):2965, J. Immunother ., 2006(29):284; Cancer Immunol . Res., 3(7):815-26). 본 발명의 일실시예에서, 상기 막관통 도메인은 CD28의 막관통 영역 및 세포질 영역을 포함할 수 있고, 상기 도메인은 서열번호 5 또는 서열번호 7의 아미노산 서열을 가질 수 있다. 또한, 상기 막관통 도메인은 서열번호 5 또는 서열번호 7의 아미노산 서열과 80%, 85%, 90%, 95%, 97%, 98% 또는 99% 이상 동일할 수 있다.
상기 신호전달 도메인은 항-코티닌 항체 또는 이의 단편에 의해 전달된 신호를 받아, 키메라 항원 수용체가 결합된 세포 내로 이를 전달하는 역할을 한다. 상기 신호전달 도메인은 CD3제타, CD278(inducible T-cell costimulator, ICOS), CD28, CD134(OX40), CD137(4-1BB), KIR(killer immunoglobulin-like receptor) 또는 DAP12(DNAX activation protein 12)일 수 있다(J. Immunol ., 2004(172):104; Mol. Ther ., 2013(21):2268; Proc . Natl . Acad Sci . USA, 2009(106):3360; Cancer Immunol . Res., 3(7):815-26). 구체적으로, 상기 신호전달 도메인은 CD28 및 CD3제타의 세포질 영역이거나, CD137(4-1BB) 및 CD3제타의 세포질 영역일 수 있다.
본 발명의 일실시예에서, 상기 신호전달 도메인은 CD28 및 CD3제타의 세포질 영역일 수 있다. 상기 CD28의 세포질 영역은 서열번호 9 또는 서열번호 11의 아미노산 서열을 가질 수 있고, 상기 CD3제타의 세포질 영역은 서열번호 13의 아미노산 서열을 가질 수 있다. 또한, 상기 신호전달 도메인은 서열번호 9, 서열번호 11 또는 서열번호 13의 아미노산 서열과 80%, 85%, 90%, 95%, 97%, 98% 또는 99% 이상 동일할 수 있다.
나아가, 본 발명의 키메라 항원 수용체는 상기 서술한 바와 같은 항체 및 도메인들의 변형된 형태를 포함할 수 있다. 이때, 상기 변형은 상기 항체 및 도메인들의 기능을 변형시키지 않고, 야생형의 항체 및 도메인의 아미노산 서열에서 하나 이상의 아미노산을 치환, 결실 또는 추가하여 수행될 수 있다. 통상적으로, 상기 치환은 알라닌이거나, 전체 단백질의 전하, 극성 또는 소수성에 영향을 주지 않는 보존적 아미노산 치환(conservative amino acid substitution)에 의해 수행될 수 있다. 본 발명의 일실시예에서, 상기 키메라 항원 수용체는 서열번호 15 또는 서열번호 17의 아미노산 서열을 가질 수 있다. 또한, 상기 키메라 항원 수용체는 서열번호 15 또는 서열번호 17의 아미노산 서열과 80%, 85%, 90%, 95%, 97%, 98% 또는 99% 이상 동일할 수 있다.
또한, 본 발명은 상기 키메라 항원 수용체를 코딩하는 핵산 분자를 제공한다.
본 발명에 따른 핵산 분자는 상술한 항-코티닌 항체 또는 이의 단편(서열번호 2), 힌지 도메인(서열번호 4), 막관통 도메인(서열번호 6 또는 8), 및 신호전달 도메인(서열번호 10, 12 또는 14)을 코딩할 수 있다. 이때, 본 발명에 따른 키메라 항원 수용체를 코딩하는 핵산 분자는 서열번호 16 또는 서열번호 18의 염기서열일 수 있다. 이때, 상기 염기서열은 서열번호 1, 서열번호 3, 서열번호 5, 서열번호 7, 서열번호 9, 서열번호 11, 서열번호 13의 항체 또는 도메인을 발현시킬 수 있는 다른 염기서열로 치환된 것을 포함할 수 있다. 또한, 상기 핵산 분자는 상기 서술한 바와 같이 변형된 형태의 항체 및 도메인을 코딩하는 핵산 분자를 포함할 수 있다.
또한, 본 발명은 상기 핵산 분자를 포함하는 발현벡터를 제공한다.
상기 발현벡터는 아데노바이러스 벡터, 레트로바이러스 벡터, 렌티바이러스 벡터 또는 아데노-연관 바이러스 벡터일 수 있고, 본 발명의 일실시예에서 상기 발현벡터는 레트로바이러스 벡터일 수 있다. 상기 발현벡터는 본 발명에 따른 키메라 항원 수용체가 발현 및 분비될 수 있도록 통상의 기술자에 의해 제작될 수 있다.
상기 발현벡터는 신호서열 또는 리더서열을 더 포함할 수 있다. 본 발명의 일실시예에서, 상기 리더서열은 면역글로불린 카파 리더서열일 수 있다. 상기 면역글로불린 카파 리더서열은 서열번호 19의 아미노산 서열을 가질 수 있고, 상기 서열번호 19의 아미노산 서열과 80%, 85%, 90%, 95%, 97%, 98% 또는 99% 이상 동일할 수 있다.
또한, 본 발명은 상기 핵산 분자를 포함하는 바이러스를 제공한다.
상기 바이러스는 본 발명에 따른 키메라 항체 수용체를 코딩하는 핵산 분자를 게놈에 포함할 수 있다. 따라서, 상기 바이러스가 형질도입된 세포는 이의 표면에 항-코티닌 항체 또는 이의 단편이 위치하는, 본 발명에 따른 키메라 항체 수용체가 발현될 수 있다. 상기 바이러스는 아데노바이러스, 레트로바이러스, 렌티바이러스 또는 아데노-연관 바이러스일 수 있다. 본 발명의 일실시예에서, 상기 바이러스는 레트로바이러스일 수 있다.
상기 바이러스는 상기 서술한 바와 같은 발현벡터를 바이러스의 외피 단백질(envelope protein)을 코딩하는 핵산 분자를 포함하는 발현벡터와 함께 세포에 형질전환시켜 수득될 수 있다. 이때, 형질전환은 통상적인 방법으로 수행될 수 있다. 형질전환 시, 사용 가능한 외피 단백질은 VSV-G, Ecotropic envelope, Mokola, Rabies, MLV-Ampho, MLV-10A1, LCMV-WE, LCMV-Arm53b envelope, feline endogenous gamma retrovirus RD114 envelope 및 이의 변이체, gibbon ape leukemia virus(GALV) envelope 및 이의 변이체, MLV 4070A envelope, 또는 gp120/gp41일 수 있다(Mol. Ther . Methods Clin . Dev ., 2016(3):16017; J. Virol . Methods, 2004:122-131; Molecular Therapy-Methods & Clinical Development 2016(3):16017).
또한, 본 발명은 상술한 바이러스가 형질도입된 세포를 제공한다.
상기 세포는 본 발명에 따른 키메라 항원 수용체를 발현시킬 수 있는 핵산을 포함하는 바이러스에 형질도입된 것일 수 있다. 상기 형질도입된 세포는 세포의 표면에 항-코티닌 항체 또는 이의 단편이 위치할 수 있고, 상기 항체 또는 단편에 항원-항체 결합을 통해 코티닌이 결합하면 세포 내로 신호전달을 통해 세포의 활성을 유도할 수 있다. 이때, 상기 세포는 T 세포, 자연살해세포 또는 대식세포일 수 있다. 본 발명의 일실시예에서, 상기 세포는 T 세포일 수 있다.
또한, 본 발명은 상기 세포에 코티닌이 표지된 접합물질을 더 포함하는 키메라 항원 수용체 세포를 제공한다.
상기 코티닌이 표지된 접합물질에서, 접합물질이 항체일 때, 상기 복합체는 코티닌의 카르복실기와 항체의 아민기 사이의 결합을 통해 형성될 수 있다.
상기 코티닌은 합텐으로서, 코티닌이 표지된 접합물질의 특성을 변화시키지 않으면서, 자신을 특이적으로 인지하는 항체와 결합할 수 있다. 구체적으로, 상기 접합물질은 펩타이드, 핵산, 단백질 또는 화학물질일 수 있다. 상기 핵산은 앱타머일 수 있고, 상기 단백질은 항체 또는 호르몬일 수 있다. 본 발명의 일실시예에서, 상기 앱타머는 항-VEGF 앱타머일 수 있다. 또한, 본 발명의 일실시예에서, 상기 항체는 항-HER2 항체, 항-CD20 항체 또는 항-HLA 항체일 수 있다.
상기 키메라 항원 수용체 세포는 항-코티닌 항체 또는 이의 단편이 연결된 형태로, 복합체의 코티닌이 상기 항-코티닌 항체 또는 이의 단편과 결합하면 세포의 활성을 유도할 수 있다. 이때, 세포와 코티닌이 표지된 접합물질의 결합은 키메라 항원 수용체의 항-코티닌 항체 또는 이의 단편과 코티닌 사이의 항원-항체 결합일 수 있다. 또한, 상기 활성은 세포독성 T 세포에 의한 세포사멸 유도 활성일 수 있다.
상기 키메라 항원 수용체 세포는, 항-코티닌 항체 또는 이의 단편이 연결된 키메라 항원 수용체가 발현된 세포에 코티닌이 표지된 접합물질을 첨가하는 단계, 및 상기 세포와 복합체가 연결된 키메라 항원 수용체 세포를 선별하는 단계를 통해 제조될 수 있다.
또한, 본 발명은 상기 키메라 항원 수용체 세포를 유효성분으로 함유하는 특정 세포가 증식되는 질환 또는 질병의 예방 또는 치료용 약학 조성물을 제공한다.
상기 약학 조성물의 유효성분으로 사용되는 키메라 항원 수용체 세포는 상기 서술한 바와 같다.
상기 질환 또는 질병은 암일 수 있고, 상기 암은 고형암 또는 혈액암일 수 있다. 이때, 상기 고형암은 폐암, 대장암, 전립선암, 갑상선암, 유방암, 뇌암, 두경부암, 식도암, 피부암, 흑색종, 망막모세포종, 흉선암, 위암, 결장암, 간암, 난소암, 자궁암, 방광암, 직장암, 담낭암, 담도암 또는 췌장암일 수 있다. 또한, 상기 혈액암은 림프종, 백혈병 또는 다발성 골수종일 수 있다.
상기 약학 조성물은 약학 조성물 전체 중량에 대하여 유효성분인 본 발명에 따른 키메라 항원 수용체 세포를 10 내지 95 중량%로 포함할 수 있다. 또한, 본 발명의 약학 조성물은 상기 유효성분 외에 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1종 이상 추가로 함유할 수 있다.
본 발명에 다른 약학 조성물은 투여를 위해 상기 기재한 유효성분 이외에 추가적으로 약학적으로 허용가능한 담체를 1종 이상 포함할 수 있다.
또한, 본 발명은 상기 키메라 항원 수용체 세포를 개체에 투여하는 것을 포함하는 특정 세포가 증식되는 질환 또는 질병의 예방 또는 치료 방법을 제공한다.
상기 키메라 항원 수용체 세포는 상기 서술한 바와 같다. 또한, 상기 질환 또는 질병은 암일 수 있고, 구체적인 암은 상기 서술한 바와 같다.
본 발명에 따른 키메라 항원 수용체 세포의 투여량은 질환의 종류, 질환의 중증도, 약학 조성물에 함유된 유효성분 및 다른 성분의 종류 및 함량, 제형의 종류 및 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로, 치료기간 및 동시에 사용되는 약물을 비롯한 다양한 인자에 따라 조절될 수 있다. 그러나, 바람직한 효과를 위해서, 본 발명에 따른 약학 조성물에 포함되는 키메라 항원 수용체 세포의 유효량은 1x105 내지 1x1011 cells/㎏일 수 있다. 이때, 투여는 하루에 한번 투여할 수 있고, 수회에 나누어 투여할 수도 있다.
또한, 본 발명의 키메라 항원 수용체 세포는 당업계에 공지된 다양한 방법으로 개체에 투여될 수 있다. 상기 개체는 포유동물, 구체적으로 인간일 수 있다. 상기 투여 경로는 투여 방법, 체액의 부피, 점성도 등을 고려하여 통상의 기술자가 적절히 선택할 수 있다.
또한, 본 발명은 상기 세포를 개체에 투여하는 단계; 및 코티닌이 표지된 접합물질을 개체에 투여하는 단계를 포함하는, 개체 내에서 키메라 항원 수용체 세포를 제조하는 방법을 제공한다.
상기 세포는 본 발명에 따른 키메라 항원 수용체를 발현시킬 수 있는 핵산을 포함하는 바이러스에 형질도입된 것으로서, 상술한 바와 같다. 또한, 코티닌이 표지된 접합물질은 상술한 바와 같다.
상기 개체는 포유동물, 구체적으로 인간일 수 있고, 투여는 상술한 바와 같이 통상의 기술자에 의해 적절히 수행될 수 있다.
또한, 본 발명은 상기 세포 및 코티닌이 표지된 접합물질을 개체에 투여하는 단계; 및 상기 개체에 코티닌이 표지된 세포독성물질을 더 투여하는 단계를 포함하는, 키메라 항원 수용체 세포의 세포사멸 유도 방법을 제공한다.
상기 키메라 항원 수용체 세포는 상기 서술한 바와 같다. 키메라 항원 수용체 세포를 이용하여 항암치료를 하는 경우, 상기 세포의 과활성에 의한 면역독성이 부작용으로 발생될 수 있다. 따라서, 이와 같은 부작용을 해결하기 위해, 코티닌이 표지된 접합물질 대신 코티닌이 표지된 세포독성물질을 추가로 투여하여 키메라 항원 수용체 세포의 세포사멸을 유도할 수 있다.
상기 세포독성물질은 세포의 사멸을 유도할 수 있는 물질이면 모두 사용할 수 있다. 구체적으로, 상기 세포독성물질은 듀오카마이신, SN-38, 칼리캐미신(calicheamicin), MMAE(monomethyl auristatin E), MMAF(monomethyl auristatin F), 독소루비신, 피롤로벤조디아제핀(pyrrolobenzodiazepine), DM4 또는 DM1일 수 있다. 본 발명의 일실시예에서, 상기 세포독성물질은 듀오카마이신 또는 DM1일 수 있다(ASCO meeting abstracts 2014(32):2558; Clin . Cancer Res., 2011(17):3157-69; Leuk . Lymphoma, 2015(56):2863-69; J. Clin . Oncol ., 2014(32):3619-25; Proc . Am. Soc . Clin. Oncol ., 2015(33):2503; J. Drug Deliv ., 2013(2013):898146; Sci . Transl . Med., 2015(7):302ra136; Mol , Cancer Ther ., 2014(13):1537-48; J. Clin . Oncol ., 2008(26):2147-54).
상기 코티닌이 표지된 세포독성물질의 투여는 상기 서술한 바와 같이 다양한 인자에 의해서 조절될 수 있다. 본 발명에 따른 약학 조성물에 포함되는 키메라 항원 수용체 세포의 유효량은 통상에 기술자에 의해 적절히 선택될 수 있다. 이때, 투여는 하루에 한번 투여할 수 있고, 수회에 나누어 투여할 수도 있다.
나아가, 본 발명은 약학적으로 치료가능한 양의 상기 키메라 항원 수용체 세포를 유효성분으로 함유하는 제1성분; 및 약학적으로 치료가능한 양의 코티닌이 표지된 세포독성물질을 유효성분으로 함유하는 제2성분을 포함하는, 특정 세포가 증식되는 질환 또는 질병의 예방 또는 치료용 약학적 키트를 제공한다.
본 발명의 약학적 키트는 질환 또는 질병의 예방 또는 치료를 위하여 제1성분 및 제2성분이 순차적으로 투여될 수 있다. 상기 제1성분 및 제2성분이 순차적으로 투여되는 경우, 제1성분의 투여 후 면역독성 부작용이 나타나거나, 키메라 항원 수용체 세포가 불멸화되었을 때 제2성분을 투여할 수 있다.
상기 질환 또는 질병은 암일 수 있고, 구체적인 암은 상기 서술한 바와 같다.
이하, 본 발명을 하기 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐, 본 발명이 이들로 제한되는 것은 아니다.
실시예 1. 항- 코티닌 항체 단편이 연결된 키메라 항원 수용체를 코딩하는 핵산을 포함하는 레트로바이러스의 제작
1-1. 컨스트럭트의 제작
먼저, 항-코티닌 항체의 scFv 단편, 힌지 도메인, 막관통 도메인 및 신호전달 도메인을 각각 코딩하는 핵산을 탑재한 플라스미드를 다음과 같은 방법으로 제조하였다.
구체적으로, 항-코티닌 항체의 scFv 단편은 마우스 Ig 카파 리더 서열이 삽입된 프라이머와 항-코티닌 scFv 서열을 SfiI 제한효소로 절단한 뒤, pCEP4(Invitrogen, 미국) 벡터에 결찰시킨 플라스미드(Clin . Chim . Acta ., 2010, 411-1238)를 주형으로 사용하여 통상적인 방법으로 PCR을 하였다. 한편, 키메라 항원 수용체의 골격(skeleton) 부위인 c-myc 표지자, 인간 CD8 힌지 영역, 마우스 CD28 막관통 영역 및 세포질 영역, 및 인간 CD3제타의 세포질 영역은 pLxSN-scFv-anti-CEA-CD28-zeta 플라스미드(Dr. Philip Darcy, PeterMac Cancer Center, 호주)를 주형으로 사용하여 PCR을 하였다. PCR에 사용된 프라이머의 구체적인 서열은 하기 표 1에 나타내었다.
명칭 서열(5'→3') 서열번호
항-코티닌 scFv 정방향 gatatcaagcttgccaccatggattttcaggtgcagattttcagcttcctgctaatcagtgcctcagtcataatgtctagagagctcgatctgacccag 서열번호 29
항-코티닌 scFv 역방향 tgaagagatggtgaccag 서열번호 30
CAR 골격 정방향 gcggccgcagaacaaaaa 서열번호 31
CAR 골격역방향 actagtgtcgacttagcgagggggcagggc 서열번호 32
CEA CAR정방향 gatatcaagcttccatgggccaccatggattttcaggtgcag 서열번호 33
CEA CAR역방향 gaattcatcgatgtcgacgcggccgcttagcgagggggcagggc 서열번호 34
상기 수득된 두 PCR 산물을 결찰시켜 항-코티닌 키메릭 항원 수용체의 cDNA를 제조하였다. 제조된 cDNA 및 pMSCV-puro 벡터(K1062-1, clontech, 미국)를 각각 HindIII/SalI 및 HindIII/ClaI으로 절단 및 결찰시켰다. 그 결과, pMSCV-puro 레트로바이러스 벡터의 PGK 프로모터 하부에 퓨로마이신 저항성 유전자의 위치에 항-코티닌 항체의 scFv 단편 및 각 도메인들을 코딩하는 핵산이 클로닝되었다. 제조된 컨스트럭트는 그 염기서열 분석을 통해 확인하였고, 이를 pMP-Cot-28Z라고 명명하였다(도 3A).
1-2. 레트로바이러스의 생산
실시예 1-1에서 제조된 레트로바이러스 컨스트럭트를 바이러스 외피 단백질인 VSV-G(vesicular stomatitis indiana virus G protein)를 코딩하는 핵산과 상보적인 서열을 갖는 플라스미드인 pMD2.G(#12259, Addgene, 미국)와 함께 Phoenix GP(ATCC, 미국) 세포주에 형질도입시켰다. 형질도입은 리포펙타민 2000(Cat.#11668-019, invitrogen, 미국)을 사용하여 제조사의 프로토콜대로 수행하였다. 48시간 후, VSV-G 위형(pseudotype)의 레트로바이러스가 함유된 배양액을 취하여 이를 다시 Phoenix Eco(ATCC, 미국) 세포주에 감염시켰다. 감염 3 내지 5일 후, 유세포분석기(BD Bioscience, 미국)를 사용하여 myc 표지 양성을 나타내는 Phoenix Eco 세포를 선별하여 세포주를 확립하였다. 생산된 레트로바이러스는 배양액을 원심분리형 필터장치(Amicon Ultra-15, 100 kDa cut-off, Millipore, 미국)를 사용하여 10배 농축하여 보관하였다.
실시예 2. 항- 코티닌 항체 단편이 연결된 키메라 항원 수용체가 표면에 제시된 세포독성 T 세포의 제조
실시예 1-2에서 제조된 바이러스를 이용하여, 항-코티닌 항체 단편이 연결된 키메라 항원 수용체가 표면에 제시된 세포독성 T 세포를 제조하였다.
먼저, B6 마우스로부터 비장세포를 분리하여, 10 ㎍/㎖의 항-CD3 항체(145-2C11, BD Bioscience, 미국)가 코팅된 세포 배양용기에 웰 당 2.5x106개가 되도록 분주하였다. 이때, 세포는 2 ㎍/㎖의 항-CD28 항체(37.51, BD Bioscience, 미국)가 포함된 RPMI-1640 배지를 총 1 ㎖가 되도록 첨가하고, 5% CO2, 37℃의 조건에서 배양하여 준비하였다. 24시간 후, 6 ㎎/㎖의 폴리브렌(Sigma-Aldrich, 미국)이 2 ㎕ 포함된 농축된 레트로바이러스 1 ㎖을 상기 세포에 첨가하고, 이를 원심분리기(Centrifuge 5810R, Eppendorf, 미국)를 사용하여 2,500 rpm의 조건으로 90분 동안 원심분리 형질도입으로 형질도입시켰다. 이때, 폴리브렌은 레트로바이러스의 형질도입율을 증가시키기 위해 사용되었다. 이후, 배양 상등액 1 ㎖를 제거하고, 여기에 1 ㎖의 농축된 레트로바이러스와 1 ㎕의 폴리브렌을 다시 첨가하여 상기와 동일한 조건으로 원심분리함으로써 레트로바이러스를 형질도입시켰다. 이후, 배양액 1 ㎖을 제거하고, 20 U/㎖의 인터루킨-2(Gibco, 미국)가 포함된 RPMI-1640 배지를 1 ㎖ 첨가하였다.
48시간 후, 바이러스가 형질도입된 T 세포의 배지를 20 U/㎖의 인터루킨-2가 함유된 배지로 교체하고, 이를 5% CO2, 37℃의 조건에서 72시간 동안 배양하였다. 그 후, 염색된 c-myc 표지를 유세포분석기로 측정하여 확인한 항-코티닌 항체 단편이 연결된 키메라 항원 수용체의 형질 도입율은 약 50 내지 70%였다(도 3B). 한편, 대조군으로서 녹색 형광 단백질이 도입된 T 세포는 약 80%의 형질 도입율을 나타내었다. 이렇게 제조된 항-코티닌 항체 단편이 연결된 키메라 항원 수용체가 표면에 제시된 T 세포는, 제조 후 24시간 이내로 이후의 실험에 사용하였다.
실시예 3. 코티닌과 접합 물질의 복합체 제조
3-1. 코티닌과 항체의 복합체 제조
접합 물질로서, 항-CD20 항체인 리툭시맙(Genentech, Biogen, 미국), 항-HER2 항체인 트라스트주맙(Genentech, 미국), 항-인플루엔자 바이러스 헤마글루티닌(hemagglutinin) 항체인 CT302(셀트리온, 한국) 및 항-HLA 항체인 W6/32(eBioscience, 미국)를 사용하여, 코티닌과 접합된 복합체를 제조하였다. 이때, 상기 복합체는 EDC(1-ethyl-3-[3 dimethylaminopropyl]carbodiimide) 연결방법으로 접합시켰다.
먼저, 상기 항체들을 PBS에 25 μM 농도가 되도록 용해시켜 준비하였다. 한편, 1 ㎖의 MES 완충액[0.1M의 MES(2-[morpholino]ethaneusulfonic acid) 및 0.5 M의 염화나트륨, pH 6.0]에 트랜트-4-코티닌카복실산(trans-4-cotininecarboxylic acid, Sigma-Aldrich)이 5 mM의 농도가 되도록 용해시켜 준비하였다. 여기에 50 mM 농도의 EDC 및 125 mM 농도의 N-하이드록시설포숙시니마이드(N-hydroxysulfosuccinimide, Sulfo-NHS, Thermo Scientific, 미국)를 첨가한 뒤, 이를 상온에서 15분 동안 교반하며 용해시켜 코티닌-NHS 에스터가 생성된 활성용액을 제조하였다. 코티닌-NHS 에스터와 단백질의 아민기 사이의 반응을 유도하기 위해 수산화 나트륨 용액을 첨가하여, 상기 활성용액의 pH를 7 이상으로 조절하고 1 ㎖을 취하여, 여기에 코티닌과 접합시킬 항체를 25 μM의 농도로 활성용액과 동량으로 첨가하였다. 혼합물을 상온에서 3시간 동안 교반하면서 반응시켜 EDC 연결반응을 통해 생성된 코티닌-항체 복합체를 수득하였다. 수득된 코티닌-항체 복합체는 Slide-A-lyzer™ 투석카세트(Thermo Fisher Scientific, 미국)을 이용하여 PBS로 투석하거나, Amicon® Ultra Centrifugal Filter(EMD Millipore, 미국)을 이용하여 완충액을 PBS로 교환하여 사용하였다.
3-2. 코티닌과 앱타머의 복합체 제조
혈관내피성장인자(VEGF)를 인식하는 앱타머인 페갑타닙(pegaptanib)을 사용하여, 고체상 올리고펩타이드 합성 방법으로 코티닌-페갑타닙 복합체를 제조하였다.
구체적으로, 페갑타닙 RNA 앱타머(5'-pCfpGmpGmpArpArpUfpCfpAmpGmpUfpGmpAmpAmpUfpGmpCfpUfpUfpAmpUfpAmpCfpAmpUfpCfpCfpGm-p-dT-3-3', 서열번호 34)는 올리고 펩타이드 합성기를 이용하여 3'-말단에서 5'-말단으로 합성한 뒤, 5'-말단에 아미노 C6 링커를 붙였다. 상기 아미노 C6 링커에 활성 에스터 결합방법(active ester cross-linking)을 이용하여 코티닌이 부착된 구조를 제조하였다. 이후 Xbridge Prep C18 컬럼(5 μm, 10x150 ㎜, Waters Corp., 미국)을 이용하여 역상 고압 액체 크로마토그래피로 정제(>95% 순도)하고, 질량분석기를 이용하여 이의 크기를 확인하였다(ST Pharm, 한국)(Clin . Chim . Acta., 2010(411):1238; Exp. Mol. Med., 2012(44):554).
상기 합성된 코티닌 및 페갑타닙의 복합체는 디에틸피로카보네이트(diethylpyrocarbonate)를 첨가한 증류수에 현탁하고, 95℃에서 5분 동안 반응시킨 뒤, 상온에서 30분 동안 식혀 -20℃에 보관하였다.
비교예 1. 항- 암배아성 항원 scFv 단편이 연결된 키메라 항원 수용체 T 세포의 제조
항-암배아성 항원(anti-carcinoembryonic antigen, anti-CEA) scFv 단편이 연결된 키메라 항원 수용체 유전자는 pLxSN-scFv-anti-CEA-zeta 플라스미드(Dr. Philip Darcy, PeterMac Cancer Center, 호주)를 주형으로 상기 표 1에 기재된 프라이머를 사용하여 PCR 방법으로 수득하였다. 상기 수득된 유전자 및 pMSCV-puro 벡터(K1062-1, clontech, 미국)를 각각 HindIII 및 ClaI으로 절단 및 결찰시켰다. 상기 제조된 컨스트럭트를 pMP-C28Z로 명명하였다. 상기 컨스트럭트를 사용하여 실시예 1 및 2의 조건 및 방법으로 레트로바이러스를 생산하고, 상기 레트로바이러스가 형질도입된 T 세포를 제조하였다.
비교예 3. 녹생형광단백질을 발현하는 T 세포의 제조
녹생형광단백질을 발현하는 T 세포를 제조하기 위하여, pMIG-w 플라스미드(Dr. Yosef Refaeli, National Jewish Medical and Research Center, 미국)에 포함되어 있는 녹색형광단백질의 유전자를 NcoI 및 SalI을 사용하여 수득하였다. 상기 유전자를 비교예 2에서 제조된 pMP-C28Z 플라스미드에서 상기와 동일한 효소로 항-암배아항원 키메라 항원 수용체 유전자를 제거한 뒤, 상기 부위에 삽입하였다. 제조된 컨스트럭트를 pMP-GFP로 명명하였다. 이후, 상기 컨스트럭트를 사용하여 실시예 1 및 2의 조건 및 방법으로 레트로바이러스를 생산하고, 상기 레트로바이러스가 형질도입된 T 세포를 제조하였다.
시험예 1. 코티닌 - 페갑타닙 복합체를 이용한 항- 코티닌 항체 단편이 연결된 키메라 항원 수용체 T 세포의 활성화 확인
상기 실시예 3-2에서 제조한 코티닌과 페갑타닙의 복합체를 사용하여, 상기 복합체가 VEGF(vascular endothelial growth factor)를 인식함으로써, 키메라 항원 수용체 세포의 활성화를 유도하는지 여부를 확인하기 위하여 ELISA를 수행하였다.
먼저, 96-웰 플레이트에 5 ㎍/㎖의 VEGF를 첨가하고, 이를 4℃에서 하룻밤 두어 VEGF로 코팅하였다. 코팅된 플레이트를 20% 소태아혈청 및 1% 페니실린-스트렙토마이신(Gibco, 미국)이 첨가된 RPMI-1640 배지(Welgene, 한국)로 2회 세척하고, 100 nM의 코티닌-페갑타닙 복합체를 첨가하여 37℃에서 한시간 동안 반응시켰다. 반응 후, 이를 상기 RPMI-1640 배지로 3회 세척 후, 웰 당 1x105개가 되도록 실시예 2에서 제조한 키메라 항원 수용체 T 세포를 첨가하고, 5% CO2 및 37℃의 조건으로 24시간 동안 배양하였다. 그 결과, 배지에 분비된 인터페론 감마의 양을 ELISA 키트(Cat#. 555138, BD Bioscience, 미국)를 사용하여 제조사의 프로토콜대로 측정하였고, 그 결과를 도 4에 나타내었다. 이때, 대조군으로서 VEGF가 코팅된 플레이트에 아무것도 첨가하지 않은 군(VEGF only), VEGF가 코팅되지 않은 플레이트에 T 세포만 첨가한 군(T cell only), VEGF가 코팅된 플레이트에 T 세포만 첨가한 군(VEGF+T cell), 및 VEGF가 코팅된 플레이트에 대조군 앱타머(5'-dTTGGTGGTGGTGGTTGTGGTGGTGGTGG-3', 서열번호 36)와 T 세포를 첨가한 군(VEGF+Control Aptamer+T cell)을 사용하였다.
도 4에 나타난 바와 같이, 코티닌-페갑타닙 복합체를 항-코티닌 항체 단편이 연결된 키메라 항원 수용체 T 세포와 첨가한 군(VEGF+Cot-pegaptanib+T cell)에서 인터페론 감마의 분비가 유의적으로 증가함을 확인하였다.
시험예 2. 코티닌 -항- HER2 항체 복합체를 이용한 항- 코티닌 항체 단편이 연결된 키메라 항원 수용체 T 세포의 활성화 확인
실시예 3-1에서 제조한 코티닌-항-HER2 항체 복합체를 사용하여, 상기 복합체가 세포 표면의 HER2를 인식함으로써, 키메라 항원 수용체 세포의 활성화를 유도하는지 여부를 확인하였다.
먼저, HER2 양성 세포인 AU565 세포주 및 HER2 음성 세포인 MDA-MB-231 세포주를 바닥이 둥근 형태의 96-웰 플레이트에 웰 당 3x104개가 되도록 분주하여, 5% CO2 및 37℃의 조건으로 하룻밤 동안 배양하였다. 배양 상등액을 제거한 뒤, 10% 소태아혈청 및 1% 페니실린-스트렙토마이신이 첨가된 DMEM(Gibco, 미국) 배지에 10 ㎍/㎖의 농도로 첨가된 코티닌-항-HER2 항체 복합체를 100 ㎕ 첨가하고, 이를 동일한 조건에서 1시간 동안 배양하였다. 이후, 배지를 제거하고, 무혈청배지로 세포를 2회 세척한 뒤, 웰 당 3x105개가 되도록 실시예 2에서 제조한 키메라 항원 수용체 T 세포를 첨가하고, 5% CO2 및 37℃의 조건으로 24시간 동안 배양하였다. 그 결과, 배지에 분비된 인터페론 감마의 양을 ELISA 키트를 사용하여 제조사의 프로토콜대로 측정하였고, 그 결과를 도 5에 나타내었다. 이때, 대조군으로서 세포를 배양하지 않은 플레이트에 키메라 항원 수용체 T 세포를 첨가한 군(T cell only), 세포를 배양한 플레이트에 아무것도 첨가하지 않은 군(tumor only), 세포를 배양한 플레이트에 키메라 항원 수용체 T 세포를 첨가한 군(tumor+T cell), 세포를 배양한 플레이트에 인플루엔자 바이러스 헤마글루티닌 특이적 항체(CT302)를 키메라 항원 수용체 T 세포와 첨가한 군(CT302), 세포를 배양한 플레이트에 CT302 항체가 연결된 코티닌을 키메라 항원 수용체 T 세포와 첨가한 군(CT302-Cot), 세포를 배양한 플레이트에 항-HER2 항체를 키메라 항원 수용체 T 세포와 첨가한 군(anti-HER2)을 사용하였다.
도 5에 나타난 바와 같이, 코티닌-항-HER2 항체 복합체를 항-코티닌 항체 단편이 연결된 키메라 항원 수용체 T 세포와 첨가한 군(anti-HER2-Cot)에서 인터페론 감마의 분비가 유의적으로 증가함을 확인하였다.
시험예 3. 항- 코티닌 항체 단편이 연결된 키메라 항원 수용체 T 세포의 항원 특이적 활성화 확인
코티닌-항-HER2 항체 복합체 및 항-코티닌 항체 단편이 연결된 키메라 항원 수용체 T 세포에 의해 유도되는 인터페론 감마의 분비가, 코티닌과 연결된 항체 특이적인지 확인하기 위하여 다음과 같은 실험을 수행하였다.
실험은, HER2 양성 세포인 AU565 세포만을 사용한 것을 제외하고는 상기 시험예 2와 동일한 조건 및 방법으로 수행되었다. 이때, 아무것도 표면에 발현하지 않는 T 세포, 비교예 1에서 제조된 T 세포 또는 실시예 2에서 제조된 T 세포를 각각, 세포를 배양하지 않은 플레이트에 T 세포만 첨가한 군(T cell only), 세포를 배양한 플레이트에 CT302 항체와 T 세포를 첨가한 군(CT302), 세포를 배양한 플레이트에 CT302 항체가 연결된 코티닌과 T 세포를 첨가한 군(CT302-Cot), 세포를 배양한 플레이트에 항-HER2 항체와 T 세포를 첨가한 군(anti-HER2) 및 세포를 배양한 플레이트에 항-HER2 항체가 연결된 코티닌과 T 세포를 첨가한 군(anti-HER2-Cot)과의 조합으로 첨가하였다. 그 결과, 분비되는 인터페론 감마의 양을 ELISA의 방법으로 측정하여 도 6A에 나타내었다.
도 6A에 나타난 바와 같이, 코티닌-항-HER2 항체 복합체를 항-코티닌 항체 단편이 연결된 키메라 항원 수용체 T 세포와 첨가한 군(anti-HER2-Cot)에서 인터페론 감마의 분비가 유의적으로 증가함을 확인하였다. 따라서, 인터페론 감마의 분비는 코티닌에 연결된 결합 물질에 의해서 유도되는 것을 알 수 있었다.
시험예 4. T 세포의 표면에 제시된 키메라 항원 수용체의 발현율 확인
아무것도 표면에 발현하지 않는 T 세포와 실시예 2 및 비교예 1에서 제조된 항-코티닌 항체 단편 또는 CEA가 연결된 키메라 항원 수용체 T 세포에서 c-myc의 발현을 측정하여, 상기 키메라 항원 수용체 각각의 발현율을 확인하였다.
먼저, 아무것도 표면에 발현하지 않는 T 세포, 및 실시예 2 또는 비교예 1에서 제조한 키메라 항원 수용체 T 세포를 웰 당 4x105개의 세포가 되도록 각각 분주하였다. 분주된 세포를 1% 소혈청알부민(BSA) 및 0.02% NaN3가 첨가된 PBS 완충액으로 2회 세척하고, 상기 완충액에 1:400의 비율로 항-myc 항체(BD Bioscience, 미국)를 희석하여 첨가하였다. 이를 냉장에서 20분 동안 반응시키고, 상기 PBS 완충액으로 3회 세척하였다. 여기에, 1:1000의 비율로 스트렙타비딘-PE(BD Bioscience, 미국), 1:500의 비율로 CD8-perCP-cy5.5(BD Bioscience, 미국) 및 1:1000의 비율로 CD4-APC(BD Bioscience, 미국)가 첨가된 PBS 완충액을 50 ㎕ 넣고, 냉장에서 25분 동안 반응시켰다. 이를 PBS 완충액으로 3회 세척한 뒤, 세포를 총 300 ㎕의 PBS에 재현탁하여 유세포분석기(FACS Caliber, BD Bioscience, 미국)를 사용하여 c-myc 표지 양성 세포를 분석하여, 그 결과를 도 6B에 나타내었다. 이때, 각각의 T 세포에 대한 대조군으로서, 항체를 처리하지 않은 군(Unstained), 2차 항체인 스트렙타비딘-PE만을 처리한 군(Control)을 사용하였다.
도 6B에 나타낸 바와 같이, 실시예 2 및 비교예 1에서 제조된 키메라 항원 수용체 T 세포는 항-코티닌 항체 단편 또는 CEA를 발현하고 있음을 확인하였다.
시험예 5. 코티닌 -항-CD20 항체 복합체를 이용한 항- 코티닌 항체 단편이 연결된 키메라 항원 수용체 T 세포의 활성화 확인
실시예 3-1에서 제조한 코티닌-항-CD20 항체 복합체를 사용하여, 상기 복합체가 세포 표면의 CD20을 인식함으로써, 키메라 항원 수용체 세포의 활성화를 유도하는지 여부를 확인하였다. 구체적으로, 실험은 AU565 세포주 및 MDA-MB-231 세포주 대신, CD20 음성 세포인 Jurkat E6.1 세포주 및 CD20 양성 세포인 Raji 세포주를 10% 소태아혈청 및 1% 페니실린-스트렙토마이신이 첨가된 RPMI-1640 배지에 배양하여 사용하고, 분비된 인터페론 감마의 양을 배양 48시간 후 수득한 배양액에서 확인한 것을 제외하고는, 상기 시험예 2와 동일한 조건 및 방법으로 수행하였다. 그 결과 분비된 인터페론 감마의 양은 도 7에 나타내었다. 이때, 대조군으로서 세포를 배양하지 않은 플레이트에 키메라 항원 수용체 T 세포를 첨가한 군(T cell only), 세포를 배양한 플레이트에 아무것도 첨가하지 않은 군(tumor only), 세포를 배양한 플레이트에 항-CD20 항체를 키메라 항원 수용체 T 세포와 첨가한 군(anti-CD20)을 사용하였다.
도 7에 나타난 바와 같이, 코티닌-항-CD20 항체 복합체를 항-코티닌 항체 단편이 연결된 키메라 항원 수용체 T 세포와 첨가한 군(anti-CD20-Cot)에서 인터페론 감마의 분비가 유의적으로 증가함을 확인하였다.
시험예 6. 코티닌 -항- HLA 항체 복합체를 이용한 항- 코티닌 항체 단편이 연결된 키메라 항원 수용체 T 세포의 활성화 확인
실시예 3-1에서 제조한 코티닌-항-HLA 항체 복합체를 사용하여, 상기 복합체가 세포 표면의 HLA을 인식함으로써, 키메라 항원 수용체 세포의 활성화를 유도하는지 여부를 확인하였다. 구체적으로, 실험은 AU565 세포주 및 MDA-MB-231 세포주 대신, HLA 음성 세포인 NIH3T3 세포주 및 HLA 양성 세포인 HLA7 또는 HLA20 세포주를 20% 소태아혈청 및 1% 페니실린-스트렙토마이신이 첨가된 IMDM 배지에 배양하여 사용하고, 분비된 인터페론 감마의 양을 배양 48시간 후 수득한 배양액에서 확인한 것을 제외하고는, 상기 시험예 2와 동일한 조건 및 방법으로 수행하였다.
한편, HLA7 및 HLA20 세포주는 다음과 같은 방법으로 제조되었다. 구체적으로, 10 ㎖의 말초혈액과 동량 PBS를 혼합한 혼합액을 15 ㎖의 Ficoll-Paque PLUS(GE Healthcare Life Science, 미국)에 분주하였다. 이를 400 xg에서 30분 동안 원심분리하고, 이때 브레이크는 '0'으로 설정하였다. 원심분리 후, 가장 상층의 혈장을 제거하고, 5 ㎖의 말초혈액 단핵구 층을 취하였다. 여기에 RPMI-1640 배지를 30 ㎖ 첨가하고, 동일한 조건으로 10분 동안 원심분리하였다. 상층액을 제거하고, 동량의 RPMI-1640 배지를 첨가하여 한번 더 세척하였다. 침전된 세포를 20% 소태아혈청이 포함된 RPMI-1640 배지 2 ㎖로 재현탁하고 세포 수를 계수하였다. T25 플라스크에 1x107개의 세포를 분주하고, 총 6 ㎖의 배양 배지를 넣어 5% CO2, 37℃의 조건에서 배양하였다. 여기에 2 ㎖의 엡스타인바 바이러스(VR-1492, ATCC, 미국)를 첨가하고, 동일한 조건에서 배양하였다. 배양 2시간 후, 1 ㎍/㎖의 사이클로스포린 A(Gibco, 미국)을 첨가하고, 동일한 조건에서 4일 동안 배양하였다. 배양 4일째에 2 ㎖의 배양 배지를 첨가하고, 7일째에 이를 계대배양하였다. 계대배양을 지속하여 10 내지 20일 동안 엡스타인바 바이러스가 형질도입된 B 세포가 콜로니를 형성하면, 상기 콜로니를 2개 취하여 계대배양을 지속하였다. 이렇게 제조된 불멸성 B 세포주 2개를 각각 HLA7 및 HLA20으로 명명하였다.
그 결과 분비된 인터페론 감마의 양은 도 8에 나타내었다. 이때, 대조군으로서 세포를 배양하지 않은 플레이트에 키메라 항원 수용체 T 세포를 첨가한 군(T cell only), 세포를 배양한 플레이트에 아무것도 첨가하지 않은 군(tumor only), 세포를 배양한 플레이트에 항-HLA 항체를 키메라 항원 수용체 T 세포와 첨가한 군(anti-HLA)을 사용하였다.
도 8에 나타난 바와 같이, 코티닌-항-HLA 항체 복합체를 항-코티닌 항체 단편이 연결된 키메라 항원 수용체 T 세포와 첨가한 군(anti-HLA-Cot)에서 인터페론 감마의 분비가 유의적으로 증가함을 확인하였다.
시험예 7. 코티닌 -항- HER2 항체 복합체 및 항- 코티닌 항체 단편이 연결된 키 메라 항원 수용체 T 세포에 의한 표적세포 특이적 세포사멸 효과 확인
실시예 3-1에서 제조한 코티닌-항-HER2 항체 복합체 및 항-코티닌 항체 단편이 연결된 키메라 항원 수용체 T 세포를 사용하여, 상기 복합체가 세포 표면의 HER2를 인식함으로써, 키메라 항원 수용체 T 세포에 의한 세포사멸을 유도하는지 여부를 확인하였다.
먼저, HER2 양성 세포인 AU565 세포주 및 HER2 음성 세포인 MDA-MB-231 세포를 100 ㎜의 세포 배양용기에 2x106개가 되도록 분주하였다. 분주된 세포를 시험예 2와 동일한 배지 및 조건으로 배양하였다. 배양된 세포를 계수하여 AU565 세포주는 1 ㎖당 2x107개, MDA-MB-231 세포주는 1 ㎖당 2x107개가 되도록 세포를 준비하고, 여기에 CFSE(carboxyfluorescein succinimidyl ester, Invitrogen, 미국)를 각각 1 μM 및 100 nM의 농도로 첨가하였다. 이를 상온에서 8분 동안 반응시켜 각각의 세포주가 다른 형광세기로 염색되게 한 뒤, 이를 유세포분석기(BD Bioscience, 미국)를 사용하여 확인한 결과를 도 9A에 나타내었다.
도 9A에 나타난 바와 같이, AU565 세포주는 형광 세기가 약하게 염색되었고(CFSElow), MDA-MB-231 세포주는 형광 세기가 강하게 염색되었다(CFSEhigh).
염색된 세포를 PBS로 2회 세척하고, 세척된 세포주를 각각 1.5x106개 씩 1:1의 비율이 되도록 혼합하여 96-웰 플레이트에 분주하였다. 분주된 세포가 부착되면, 여기에 1 ㎍/㎖의 코티닌-항-HER2 항체 복합체를 첨가하여, 상온에서 1시간 동안 반응시켰다. 반응 후, 세포주를 배양 배지로 세척하고, 계수하여 5x104개의 세포가 되도록 5 ㎖ 튜브에 넣었다. 여기에 항-코티닌 항체 단편이 연결된 키메라 항원 수용체 T 세포를 첨가하고, 이를 5% CO2, 37℃의 조건에서 4시간 또는 22시간 동안 배양하였다. 이때, 키메라 항원 수용체 T 세포(작용세포주, E), 및 AU565 및 MDA-MB-231 세포주(표적세포주, T)의 비율이 0:1, 5:1, 10:1이 되도록 하였다. 배양 후, 사멸된 세포를 구분하기 위해 7-AAD(BD Bioscience, 미국)를 1x106개의 세포 당, 0.25 ㎍ 첨가하여 상온에서 10분 동안 반응시킨 뒤, 이를 유세포분석기로 분석하였다. 이때, 7-AAD 음성인 세포와 CFSE 양성인 세포를 분획하여 분석하였다. 분석 결과, 표적 세포의 세포 사멸율을 하기 수학식 1에 따라 계산하여, 그 결과를 도 9B에 나타내었다.
Figure PCTKR2016009047-appb-M000001
도 9B에 나타난 바와 같이, 첨가된 키메라 항원 수용체 T 세포의 양에 비례하여 HER2 양성 세포주인 AU565의 세포 사멸이 증가함을 확인하였다. 이로부터, 항-코티닌 항체 단편이 연결된 키메라 항원 수용체 T 세포가 이와 복합체를 이루는 코티닌에 연결된 결합물질 특이적으로 세포사멸을 유도함을 알 수 있었다.
시험예 8. 코티닌 -독성물질 복합체에 의한 키메라 항원 수용체 T 세포의 세포사멸 유도 효과 확인
코티닌-독성물질의 복합체를 Concortitis사에 의뢰하여 제조하고, 상기 복합체가 실시예 2에서 제조된 키메라 항원 수용체 T 세포의 세포사멸을 유도하는지 여부를 다음과 같은 방법으로 확인하였다.
구체적으로, 키메라 항원 수용체 T 세포를 96-웰 플레이트에 5x105개가 되도록 분주하여 상기 배양배지로 배양하였다. 여기에 0, 0.1, 1, 10, 100 또는 1,000 nM의 코티닌-독성물질의 복합체를 첨가하고, 5% CO2, 37℃의 조건으로 48시간 동안 배양하였다. 첨가된 코티닌-독성물질의 복합체는, 코티닌-듀오카마이신 단일 접합체, 코티닌-DM1 복합 접합체(2x코티닌-4xDM1) 또는 코티닌-듀오카마이신 복합 접합체(2x코티닌-4x듀오카마이신)를 사용하였다(도 11). 배양 후, 7-AAD로 살아있는 세포를 염색하고, 7-AAD로 염색되거나, myc 표지에 의해 염색된 세포를 유세포분석기로 분석하였다. 분석 결과, 코티닌-독성물질 접합체에 의한 키메라 항원 수용체 T 세포의 세포독성은 하기 수학식 2를 이용하여 계산하였고, 그 결과는 도 10A 및 10B에 나타내었다. 이때, 대조군으로서 비교예 2에서 제조한 T 세포를 사용하였다.
Figure PCTKR2016009047-appb-M000002
도 10A 및 10B에 나타난 바와 같이, 항-코티닌 항체 단편이 연결된 키메라 항원 수용체 T 세포가 비교예 2의 T 세포에 비해 세포 사멸율이 높음을 확인하였고, 세포 사멸율은 첨가된 코티닌-독성물질의 복합체 농도에 비례하였다.
상기 결과로부터 코티닌-독성물질의 복합체를 사용하면 항-코티닌 항체 단편이 연결된 키메라 항원 수용체 T 세포의 세포사멸을 유도할 수 있음을 알 수 있었다.

Claims (40)

  1. 항-코티닌 항체 또는 이의 단편, 힌지 도메인, 막관통 도메인 및 신호전달 도메인을 포함하는 항-코티닌 항체가 연결된 키메라 항원 수용체.
  2. 제1항에 있어서, 상기 단편이 항-코티닌 항체의 Fab, Fab', F(ab')2, Fv 또는 scFv인, 키메라 항원 수용체.
  3. 제1항에 있어서, 상기 항-코티닌 항체 또는 이의 단편이 서열번호 23 내지 25의 아미노산 서열로 각각 표시되는 CDR1, CDR2 또는 CDR3을 포함하는 중쇄 가변 영역, 또는 서열번호 26 내지 28의 아미노산 서열로 각각 표시되는 CDR1, CDR2 또는 CDR3을 포함하는 경쇄 가변 영역을 포함하는, 키메라 항원 수용체.
  4. 제3항에 있어서, 상기 항-코티닌 항체의 단편이 서열번호 1의 아미노산 서열을 갖는, 키메라 항원 수용체.
  5. 제1항에 있어서, 상기 힌지 도메인이 CD8 힌지 도메인, IgG1 힌지 도메인, Ig4 힌지 도메인, CD28 세포외 영역, KIR(killer immunoglobulin-like receptor) 세포외 영역 및 이의 조합으로 이루어진 군으로부터 선택된, 키메라 항원 수용체.
  6. 제5항에 있어서, 상기 CD8 힌지 도메인이 서열번호 3의 아미노산 서열을 갖는, 키메라 항원 수용체.
  7. 제1항에 있어서, 상기 막관통 도메인이 CD3제타, CD4, CD8, CD28 또는 KIR(killer immunoglobulin-like receptor) 단백질의 막관통 영역인, 키메라 항원 수용체.
  8. 제7항에 있어서, 상기 막관통 도메인이 CD28의 막관통 영역을 포함하는, 키메라 항원 수용체.
  9. 제8항에 있어서, 상기 CD28의 막관통 영역이 서열번호 5 또는 서열번호 7의 아미노산 서열을 갖는, 키메라 항원 수용체.
  10. 제1항에 있어서, 상기 신호전달 도메인이 CD3제타, CD278(inducible T-cell costimulator, ICOS), CD28, CD134(OX40), CD137(4-1BB), KIR(killer immunoglobulin-like receptor) 또는 DAP12(DNAX activation protein 12)인, 키메라 항원 수용체.
  11. 제10항에 있어서, 상기 신호전달 도메인이 CD28 및 CD3제타의 세포질 영역인, 키메라 항원 수용체.
  12. 제10항에 있어서, 상기 신호전달 도메인이 CD137(4-1BB) 및 CD3제타의 세포질 영역인, 키메라 항원 수용체.
  13. 제11항에 있어서, 상기 CD28의 세포질 영역이 서열번호 9 또는 서열번호 11의 아미노산 서열을 갖는, 키메라 항원 수용체.
  14. 제11항 또는 제12항에 있어서, 상기 CD3제타의 세포질 영역이 서열번호 13의 아미노산 서열을 갖는, 키메라 항원 수용체.
  15. 제1항에 있어서, 상기 키메라 항원 수용체가 서열번호 15 또는 서열번호 17의 아미노산 서열을 갖는, 키메라 항원 수용체.
  16. 제1항의 키메라 항원 수용체를 코딩하는 핵산 분자.
  17. 제16항의 핵산 분자를 포함하는 발현벡터.
  18. 제17항에 있어서, 상기 발현벡터가 바이러스 벡터인, 발현벡터.
  19. 제18항에 있어서, 상기 바이러스 벡터가 아데노바이러스 벡터, 레트로바이러스 벡터, 렌티바이러스 벡터 또는 아데노-연관 바이러스 벡터인, 발현벡터.
  20. 제16항의 핵산 분자를 포함하는 바이러스.
  21. 제20항의 바이러스가 형질도입된 세포.
  22. 제21항에 있어서, 상기 세포가 T 세포, 자연살해세포 또는 대식세포인, 세포.
  23. 제21항의 세포 및 코티닌이 표지된 접합물질을 포함하는 키메라 항원 수용체 세포.
  24. 제23항에 있어서, 상기 접합물질이 펩타이드, 핵산, 단백질 또는 화학물질인, 키메라 항원 수용체 세포.
  25. 제24항에 있어서, 상기 핵산이 앱타머인, 키메라 항원 수용체 세포.
  26. 제24항에 있어서, 상기 단백질이 항체 또는 호르몬인, 키메라 항원 수용체 세포.
  27. 제23항에 있어서, 상기 키메라 항원 수용체 세포가 키메라 항원 수용체의 항-코티닌 항체 부위와 코티닌 사이의 항원-항체 결합에 의해 형성되는, 키메라 항원 수용체 세포.
  28. 제23항에 있어서, 상기 키메라 항원 수용체 세포의 제조는,
    1) 제21항의 세포에 코티닌과 접합물질의 복합체를 첨가하는 단계; 및
    2) 상기 세포와 복합체가 결합된 키메라 항원 수용체 세포를 선별하는 단계를 포함하는, 키메라 항원 수용체 세포.
  29. 제23항의 키메라 항원 수용체 세포를 유효성분으로 함유하는 특정 세포가 증식되는 질환 또는 질병의 예방 또는 치료용 약학 조성물.
  30. 제29항에 있어서, 상기 질환 또는 질병은 암인, 약학 조성물.
  31. 제30항에 있어서, 상기 암이 고형암 또는 혈액암인, 약학 조성물.
  32. 제31항에 있어서, 상기 고형암이 폐암, 대장암, 전립선암, 갑상선암, 유방암, 뇌암, 두경부암, 식도암, 피부암, 흑색종, 망막모세포종, 흉선암, 위암, 결장암, 간암, 난소암, 자궁암, 방광암, 직장암, 담낭암, 담도암 또는 췌장암인, 약학 조성물.
  33. 제31항에 있어서, 상기 혈액암이 림프종, 백혈병 또는 다발성 골수종인, 약학 조성물.
  34. 제23항의 키메라 항원 수용체 세포를 개체에 투여하는 것을 포함하는 특정 세포가 증식되는 질환 또는 질병의 예방 또는 치료 방법.
  35. 제34항에 있어서, 상기 질환 또는 질병은 암인, 방법.
  36. 1) 제21항의 세포를 개체에 투여하는 단계; 및
    2) 코티닌이 표지된 접합물질을 개체에 투여하는 단계를 포함하는, 개체 내에서 키메라 항원 수용체 세포를 제조하는 방법.
  37. 1) 제21항의 세포 및 코티닌이 표지된 접합물질을 개체에 투여하는 단계; 및
    2) 상기 개체에 코티닌이 표지된 세포독성물질을 더 투여하는 단계를 포함하는, 키메라 항원 수용체 세포의 세포사멸 유도 방법.
  38. 제37항에 있어서, 상기 세포독성물질이 듀오카마이신, SN-38, 칼리캐미신(calicheamicin), MMAE(monomethyl auristatin E), MMAF(monomethyl auristatin F), 독소루비신, 피롤로벤조디아제핀(pyrrolobenzodiazepine), DM4 또는 DM1인, 세포사멸 유도 방법.
  39. 약학적으로 치료가능한 양의 제23항의 키메라 항원 수용체 세포를 유효성분으로 함유하는 제1성분; 및
    약학적으로 치료가능한 양의 코티닌이 표지된 세포독성물질을 유효성분으로 함유하는 제2성분을 포함하는, 특정 세포가 증식되는 질환 또는 질병의 예방 또는 치료용 약학적 키트.
  40. 제39항에 있어서, 상기 질환 또는 질병은 암인, 약학적 키트.
PCT/KR2016/009047 2015-08-17 2016-08-17 항-코티닌 항체가 연결된 키메라 항체 수용체 및 이의 용도 WO2017030370A1 (ko)

Priority Applications (6)

Application Number Priority Date Filing Date Title
KR1020187004954A KR102157701B1 (ko) 2015-08-17 2016-08-17 항-코티닌 항체가 연결된 키메라 항체 수용체 및 이의 용도
CN201680060859.9A CN108463469B (zh) 2015-08-17 2016-08-17 一种与抗可替宁抗体连接的嵌合抗原受体及其用途
US15/753,212 US11478555B2 (en) 2015-08-17 2016-08-17 Chimeric antigen receptor to which anti-cotinine antibody is linked, and use thereof
EP16837312.4A EP3339320A4 (en) 2015-08-17 2016-08-17 CHIMERIC ANTIBODY RECEPTOR WITH AN ANTI-COTININ ANTIBODY BELARED AND USE THEREOF
JP2018509573A JP7010487B2 (ja) 2015-08-17 2016-08-17 抗コチニン抗体が連結したキメラ抗原受容体およびその使用
US17/900,527 US20230017956A1 (en) 2015-08-17 2022-08-31 Chimeric antigen receptor to which anti-cotinine antibody is linked, and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562205844P 2015-08-17 2015-08-17
US62/205,844 2015-08-17

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/753,212 A-371-Of-International US11478555B2 (en) 2015-08-17 2016-08-17 Chimeric antigen receptor to which anti-cotinine antibody is linked, and use thereof
US17/900,527 Division US20230017956A1 (en) 2015-08-17 2022-08-31 Chimeric antigen receptor to which anti-cotinine antibody is linked, and use thereof

Publications (1)

Publication Number Publication Date
WO2017030370A1 true WO2017030370A1 (ko) 2017-02-23

Family

ID=58051354

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/009047 WO2017030370A1 (ko) 2015-08-17 2016-08-17 항-코티닌 항체가 연결된 키메라 항체 수용체 및 이의 용도

Country Status (6)

Country Link
US (2) US11478555B2 (ko)
EP (1) EP3339320A4 (ko)
JP (1) JP7010487B2 (ko)
KR (1) KR102157701B1 (ko)
CN (1) CN108463469B (ko)
WO (1) WO2017030370A1 (ko)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107119021A (zh) * 2017-07-04 2017-09-01 王小平 Pd‑1敲除cd19car‑t细胞的制备
WO2018128485A1 (ko) * 2017-01-05 2018-07-12 한국생명공학연구원 항-코티닌 키메릭 항원 수용체를 발현하는 자연살해 세포
CN114369168A (zh) * 2020-10-19 2022-04-19 南京卡提医学科技有限公司 包含dap12和共刺激信号分子信号域的嵌合受体及其使用方法
US11478555B2 (en) 2015-08-17 2022-10-25 Seoul National University R&Db Foundation Chimeric antigen receptor to which anti-cotinine antibody is linked, and use thereof

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3847242A4 (en) * 2018-09-07 2022-06-08 NantBio, Inc. TARGETED IL-12 TREATMENTS AND METHODS TO STIMULATE HANK AND NK92MI CELLS
KR102502287B1 (ko) * 2020-04-17 2023-02-22 앱클론(주) 항-her2 어피바디 및 이를 스위치 분자로 이용하는 스위처블 키메라 항원 수용체
KR102530111B1 (ko) * 2022-03-11 2023-05-10 앱클론(주) 코티닌을 표적하는 항체 또는 그의 항원 결합 단편, 이를 포함하는 키메라 항원 수용체 및 이들의 용도

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130287752A1 (en) * 2010-12-14 2013-10-31 University Of Maryland, Baltimore Universal anti-tag chimeric antigen receptor-expressing t cells and methods of treating cancer
KR20140027219A (ko) * 2011-04-15 2014-03-06 서울대학교산학협력단 접합 물질과 코티닌과의 접합체에 항-코티닌 항체가 결합된 복합체 및 이의 용도
WO2014100615A1 (en) * 2012-12-20 2014-06-26 Purdue Research Foundation Chimeric antigen receptor-expressing t cells as anti-cancer therapeutics
WO2015080981A1 (en) * 2013-11-27 2015-06-04 Baylor College Of Medicine Csgp4-specific chimeric antigen receptor for cancer

Family Cites Families (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7446190B2 (en) * 2002-05-28 2008-11-04 Sloan-Kettering Institute For Cancer Research Nucleic acids encoding chimeric T cell receptors
US8008448B2 (en) * 2007-03-14 2011-08-30 National Cancer Center Cotinine neutralizing antibody
US20110189206A1 (en) 2008-01-03 2011-08-04 Barbas Iii Carlos F Antibody Targeting Through a Modular Recognition Domain
US9845362B2 (en) * 2010-10-08 2017-12-19 The University Of North Carolina At Charlotte Compositions comprising chimeric antigen receptors, T cells comprising the same, and methods of using the same
US9708384B2 (en) 2011-09-22 2017-07-18 The Trustees Of The University Of Pennsylvania Universal immune receptor expressed by T cells for the targeting of diverse and multiple antigens
SG11201406414WA (en) 2012-04-11 2014-11-27 Us Health Chimeric antigen receptors targeting b-cell maturation antigen
CA2878856A1 (en) * 2012-07-13 2014-01-16 The Trustees Of The University Of Pennsylvania Compositions and methods for regulating car t cells
KR102098985B1 (ko) 2013-05-03 2020-04-09 오하이오 스테이트 이노베이션 파운데이션 Cs1-특이적 키메라 항원 수용체 가공된 면역 작동체 세포
ES2741308T3 (es) 2013-10-15 2020-02-10 Scripps Research Inst Interruptores de células T con receptores de antígenos quiméricos y usos de los mismos
ES2688035T3 (es) 2014-08-29 2018-10-30 Gemoab Monoclonals Gmbh Receptor de antígeno universal que expresa células inmunes para direccionamiento de antígenos múltiples diversos, procedimiento para fabricación del mismo y utilización del mismo para tratamiento de cáncer, infecciones y enfermedades autoinmunes
EP3250587B1 (en) 2015-01-29 2020-03-25 Regents of the University of Minnesota Chimeric antigen receptors, compositions, and methods
US11161907B2 (en) 2015-02-02 2021-11-02 Novartis Ag Car-expressing cells against multiple tumor antigens and uses thereof
US10273280B2 (en) * 2015-02-27 2019-04-30 Icell Gene Therapeutics Llc Chimeric antigen receptors (CARs), targeting hematologic malignancies, compositions and methods of use thereof
US11091546B2 (en) 2015-04-15 2021-08-17 The Scripps Research Institute Optimized PNE-based chimeric receptor T cell switches and uses thereof
CN104788573B (zh) * 2015-05-08 2018-10-16 中国医学科学院血液病医院（血液学研究所） 嵌合抗原受体hCD19scFv-CD8α-CD28-CD3ζ及其用途
EP3339320A4 (en) 2015-08-17 2019-01-23 Seoul National University R&DB Foundation CHIMERIC ANTIBODY RECEPTOR WITH AN ANTI-COTININ ANTIBODY BELARED AND USE THEREOF
JP7033601B2 (ja) 2017-01-05 2022-03-10 コリア リサーチ インスティチュート オブ バイオサイエンス アンド バイオテクノロジー 抗コチニンキメラ抗原受容体を発現するナチュラルキラー細胞

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130287752A1 (en) * 2010-12-14 2013-10-31 University Of Maryland, Baltimore Universal anti-tag chimeric antigen receptor-expressing t cells and methods of treating cancer
KR20140027219A (ko) * 2011-04-15 2014-03-06 서울대학교산학협력단 접합 물질과 코티닌과의 접합체에 항-코티닌 항체가 결합된 복합체 및 이의 용도
WO2014100615A1 (en) * 2012-12-20 2014-06-26 Purdue Research Foundation Chimeric antigen receptor-expressing t cells as anti-cancer therapeutics
WO2015080981A1 (en) * 2013-11-27 2015-06-04 Baylor College Of Medicine Csgp4-specific chimeric antigen receptor for cancer

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
KIM ET AL.: "In Vitro and in Vivo Application of Anti-Cotinine Antibody and Cotinine-Conjugated Compounds", BMB REPORTS, vol. 47, no. 3, 2014, pages 130 - 134, XP055364733 *
See also references of EP3339320A4 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11478555B2 (en) 2015-08-17 2022-10-25 Seoul National University R&Db Foundation Chimeric antigen receptor to which anti-cotinine antibody is linked, and use thereof
WO2018128485A1 (ko) * 2017-01-05 2018-07-12 한국생명공학연구원 항-코티닌 키메릭 항원 수용체를 발현하는 자연살해 세포
US20190365815A1 (en) * 2017-01-05 2019-12-05 Korea Research Institute Of Bioscience And Biotechnology Natural killer cell expressing anti-cotinine chimeric antigen receptor
JP2020505014A (ja) * 2017-01-05 2020-02-20 コリア リサーチ インスティチュート オブ バイオサイエンス アンド バイオテクノロジー 抗コチニンキメラ抗原受容体を発現するナチュラルキラー細胞
JP7033601B2 (ja) 2017-01-05 2022-03-10 コリア リサーチ インスティチュート オブ バイオサイエンス アンド バイオテクノロジー 抗コチニンキメラ抗原受容体を発現するナチュラルキラー細胞
US11707486B2 (en) 2017-01-05 2023-07-25 Korea Research Institute Of Bioscience And Biotechnology Natural killer cell expressing anti-cotinine chimeric antigen receptor
CN107119021A (zh) * 2017-07-04 2017-09-01 王小平 Pd‑1敲除cd19car‑t细胞的制备
CN114369168A (zh) * 2020-10-19 2022-04-19 南京卡提医学科技有限公司 包含dap12和共刺激信号分子信号域的嵌合受体及其使用方法

Also Published As

Publication number Publication date
US20180256744A1 (en) 2018-09-13
KR20180031727A (ko) 2018-03-28
CN108463469A (zh) 2018-08-28
JP2018523487A (ja) 2018-08-23
JP7010487B2 (ja) 2022-03-03
EP3339320A1 (en) 2018-06-27
KR102157701B1 (ko) 2020-09-21
US20230017956A1 (en) 2023-01-19
US11478555B2 (en) 2022-10-25
EP3339320A4 (en) 2019-01-23
CN108463469B (zh) 2022-12-13

Similar Documents

Publication Publication Date Title
WO2017030370A1 (ko) 항-코티닌 항체가 연결된 키메라 항체 수용체 및 이의 용도
WO2018124766A2 (ko) 키메라 항원 수용체 및 이를 발현하는 자연 살해 세포
WO2015005632A1 (ko) Dll4와 vegf에 특이적으로 결합하는 신규 이중표적 단백질 및 이의 용도
WO2019112347A2 (ko) 악성 b 세포를 특이적으로 인지하는 항체 또는 그의 항원 결합 단편, 이를 포함하는 키메라 항원 수용체 및 이의 용도
WO2018217058A1 (en) Anti-human interleukin-2 antibodies and uses thereof
WO2019050362A2 (ko) 인간 dlk1에 대한 항체 및 이의 용도
WO2021235696A1 (ko) Cd22에 특이적인 항체 및 이의 용도
WO2020153605A1 (ko) 메소텔린 특이적인 키메라 항원 수용체 및 이를 발현하는 t 세포
WO2020005003A1 (ko) Lag-3에 특이적으로 결합하는 단클론항체 및 이의 용도
WO2021107566A1 (ko) C-kit에 대한 항체 및 이의 용도
WO2023277361A1 (ko) 메소텔린 특이적 항체 및 이의 용도
WO2019125070A1 (ko) 악성 b 세포를 특이적으로 인지하는 항체 또는 그의 항원 결합 단편, 이를 포함하는 키메라 항원 수용체 및 이의 용도
WO2018128485A1 (ko) 항-코티닌 키메릭 항원 수용체를 발현하는 자연살해 세포
US20220354960A1 (en) Immune checkpoint blocking bispecific molecules
WO2020004937A1 (ko) 항-bcma 항체-약물 접합체 및 그 용도
WO2021235697A1 (ko) Cd22에 특이적인 항체 및 이의 용도
WO2016084993A1 (ko) 신규 EGFRvIII 항체 및 이를 포함하는 조성물
WO2021182929A1 (ko) Bcma에 특이적인 항체 및 키메라 항원 수용체
WO2020071881A1 (ko) Pdgf 수용체에 대한 항체 및 이의 용도
AU2021324738A1 (en) Fusion protein comprising IL-12 and anti-fap antibody, and use thereof
WO2023195805A2 (ko) Itgb2 매개 약물전달체
WO2022124764A1 (ko) Cd47에 특이적인 항체 및 이의 용도
WO2021246637A1 (ko) Cd22에 특이적인 항체 및 이의 용도
WO2021172690A1 (ko) 메소텔린 특이적인 키메라 항원 수용체 및 이의 용도
WO2022124765A1 (ko) Gpc3에 특이적인 항체 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16837312

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2018509573

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 15753212

Country of ref document: US

ENP Entry into the national phase

Ref document number: 20187004954

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2016837312

Country of ref document: EP