WO2016122166A1 - Sirt1 발현 조절을 통한 배아줄기세포로부터 지방세포 또는 신장전구세포로의 분화 조절 방법 - Google Patents

Sirt1 발현 조절을 통한 배아줄기세포로부터 지방세포 또는 신장전구세포로의 분화 조절 방법 Download PDF

Info

Publication number
WO2016122166A1
WO2016122166A1 PCT/KR2016/000721 KR2016000721W WO2016122166A1 WO 2016122166 A1 WO2016122166 A1 WO 2016122166A1 KR 2016000721 W KR2016000721 W KR 2016000721W WO 2016122166 A1 WO2016122166 A1 WO 2016122166A1
Authority
WO
WIPO (PCT)
Prior art keywords
sirt1
differentiation
embryonic stem
stem cells
cells
Prior art date
Application number
PCT/KR2016/000721
Other languages
English (en)
French (fr)
Inventor
김원
강경표
Original Assignee
전북대학교산학협력단
전북대학교병원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020150012049A external-priority patent/KR101672785B1/ko
Priority claimed from KR1020160007611A external-priority patent/KR101853477B1/ko
Application filed by 전북대학교산학협력단, 전북대학교병원 filed Critical 전북대학교산학협력단
Priority to US15/546,634 priority Critical patent/US10662407B2/en
Publication of WO2016122166A1 publication Critical patent/WO2016122166A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/04—Plant cells or tissues

Definitions

  • the present invention relates to a method for regulating the differentiation of adipocytes or renal progenitor cells from embryonic stem cells by regulating SIRT1 (silent mating type information regulation 2 homolog; sirtuin 1) expression, and more particularly, SIRT1 (silent mating of embryonic stem cells).
  • SIRT1 sirtuin 1
  • Type information regulation 2 homolog; sirtuin 1 It relates to a method for inhibiting differentiation from embryonic stem cells to adipocytes or renal progenitor cells comprising the step of inhibiting expression.
  • SIRT1 sirtuin 1
  • sirtuin 1 is a NAD + dependent deacetylase known as an enzyme that regulates protein function by deacetylating lysine residues of several proteins (Ageing Res, Vol. 326, 2002), which is most similar to Sir2 of yeast with NAD + dependent class III histone deacetyl activity.
  • it is known to cut acetyl groups attached to transcription factors such as Nuclear factor-kB and p53 to regulate their functions (Cancer Res, Vol. 64 pages 7513-7525, 2004; Cell, Vol. 107, pages 149-). 159, 2001; Trends Endocrinol Metab, Vol. 17 pages 186-191, 2006).
  • SIRT1 is involved in chromatin reconstitution, DNA damage response and dietary restriction associated with gene expression inhibition (Chen et al., Science, 310: 1641, 2005). That is, SIRT1, like Sir2 in yeast, reconstructs chromatin and inhibits gene expression through histone deacetylation, and induces deacetylation of various transcription factors related to cell growth, stress response, and endocrine control in addition to histone protein.
  • SIRT1 inhibits the expression of PPAR- ⁇ to differentiate into adipocytes Inhibition has been reported (Frederic Picard et al., Nature, 429: 771, 2004), but there has been no study on the regulation of differentiation into adipocytes by controlling the expression of SIRT1 in embryonic stem cells.
  • the present inventors have made diligent efforts to develop a method for regulating differentiation into adipocytes or renal progenitor cells according to the regulation of SIRT1 expression in embryonic stem cells. It was confirmed that the cell was involved in differentiation into adipocytes or renal progenitor cells, and differentiation into adipocytes or renal cells was inhibited or promoted according to the timing of suppressing SIRT1 expression.
  • the present invention has been made to solve the above problems, the present invention is to provide a method for inhibiting or promoting the differentiation of embryonic stem cells into adipocytes or renal progenitor cells through the control of SIRT1 expression.
  • the present invention the differentiation of fat cells or kidney progenitor cells of embryonic stem cells comprising the step of inhibiting SIRT1 (silent mating type information regulation 2 homolog; sirtuin 1) expression of embryonic stem cells Inhibition methods.
  • SIRT1 simple mating type information regulation 2 homolog; sirtuin 1
  • the method for inhibiting adipocyte differentiation of embryonic stem cells is to inhibit the differentiation into adipocytes or renal precursor cells by treating the embryoid body formed by culturing embryonic stem cells with SIRT1 expression inhibitor. It may be.
  • the SIRT1 expression inhibitor may be treated for 0-7 days of embryoid body culture.
  • the SIRT1 expression inhibitor is thitinol (Sirtinol; 2-[(2-Hydroxynaphthalen-1-ylmethylene) amino] -N- (1-phenethyl) benzamide), Nicotinamide (pyridine- 3-carboxamide) and EX527 (6-Chloro-2,3,4,9-tetrahydro-1H-Carbazole-1-carboxamide) may be any one selected from the group consisting of.
  • SIRT1 is PPAR- ⁇ (peroxisome proliferator-activated receptors- ⁇ ), C / EBP ⁇ (CCAAT / enhancer-binding protein- ⁇ ), FABP4 (fatty acid) in embryonic stem cells Binding protein 4), SIX2 (sine oculis homeobox homolog 2) and WT1 (Wilms tumor 1) by reducing the amount of mRNA may be to inhibit differentiation into adipocytes.
  • the present invention also comprises the steps of (a) culturing embryonic stem cells to form an embryoid body (embryoid body); And
  • the SIRT1 expression inhibitor in step (b) may be treated for 7 to 21 days of differentiation induction.
  • the SIRT1 expression inhibitor is thitinol (Sirtinol; 2-[(2-Hydroxynaphthalen-1-ylmethylene) amino] -N- (1-phenethyl) benzamide), Nicotinamide (pyridine- 3-carboxamide) and EX527 (6-Chloro-2,3,4,9-tetrahydro-1H-Carbazole-1-carboxamide) may be any one or more selected from the group consisting of 5 to 500 ⁇ M in the medium. Can be added at a concentration.
  • the medium of step (b) is a medium for inducing adipocyte differentiation and is selected from the group consisting of insulin, triiodinethyronine and rosiglitazone. It may be to include one or more materials.
  • the present invention also includes a method for promoting renal progenitor cell differentiation of embryonic stem cells, comprising culturing embryonic stem cells in a medium containing an SIRT1 active material to promote differentiation into renal progenitor cells.
  • the SIRT1 expression promoter may be treated for differentiation induction 0 to 21 days, preferably may be treated for 1 to 7 days.
  • the SIRT1 expression promoter is at least one selected from the group consisting of SRT1270 (ChemCruz Biochemicals), adenovirus, lentivirus, BML-278 (ChemCruz Biochemicals), and resveratrol It may be, preferably resveratrol. SIRT1 expression promoters may be added to the medium at a concentration of 10-50 ⁇ M.
  • SIRT1 expression promoters increase the mRNA expression levels of SIX2 (sine oculis homeobox homolog 2) and WT1 (wilms tumor 1) of embryonic stem cells, thereby to the renal precursor cells It can be seen that differentiation is promoted (see FIGS. 3 and 4).
  • the medium is a renal progenitor cell differentiation induction medium, retinoic acid ((2E, 4E, 6E, 8E) -3,7-dimethyl-9- (2,6,6 -trimethylcyclohexen-1-yl) nona-2,4,6,8-tetraenoic acid) and activin A may comprise one or more substances selected from the group.
  • retinoic acid ((2E, 4E, 6E, 8E) -3,7-dimethyl-9- (2,6,6 -trimethylcyclohexen-1-yl) nona-2,4,6,8-tetraenoic acid) and activin A may comprise one or more substances selected from the group.
  • the present invention provides a kidney cell to solve another problem of the present invention.
  • the present invention to solve another object of the present invention provides a renal function recovery agent and therapeutic agent comprising a renal progenitor cell.
  • the method for controlling the differentiation of adipocytes or renal progenitor cells from embryonic stem cells by controlling the expression of SIRT1 may control the differentiation inhibition or promotion of adipocytes or renal progenitor cells depending on the SIRT1 expression inhibitor treatment time, It is effective to screen and use as an inhibitor or treatment of obesity, obesity and diabetes, kidney disease and metabolic diseases.
  • FIG. 1 is a schematic diagram showing a culture protocol for differentiation from embryonic stem cells to adipocytes.
  • Figure 2 is a data confirming the degree of differentiation of embryonic stem cells into adipocytes according to the presence or absence of SIRT1 expression (A: Oil red O staining to see the lipid drop (lipid drop) formed in adipocytes, B: stained oil data of absorbance obtained from red O sample).
  • Figure 3 is a data confirming the mRNA expression level of PPAR, C / EBPa and FABP4 according to the presence or absence of SIRT1 expression upon induction of differentiation of embryonic stem cells into adipose stem cells.
  • Figure 4 is a data confirming the degree of adipocyte differentiation of embryonic stem cells according to the SIRT1 expression inhibitor treatment time (A: Oil red O staining to see the lipid drop formed in the adipocytes (lipid drop), B: stained Data obtained by absorbance of oil red O sample).
  • FIG. 5 is a schematic diagram showing a culture protocol for differentiation from embryonic stem cells to renal progenitor cells (RA: retinoic acid).
  • RA renal progenitor cells
  • FIG. 6 shows the renal progenitor cell markers Six2 (A) and WT1 (B) after differentiating cells expressing SIRT1 protein (SIRT1 + / +; WT) and cells not expressing SIRT1 protein (SIRT1-/-; KO). It is data that measured the amount of mRNA expression.
  • WT1 A and Six2 (B), which are renal precursor cell markers, when EX527 (5-10 uM), a SIRT1 inhibitor, and resveratrol (10-20 uM), a SIRT1 promoter, are administered to embryonic stem cells. Is the data measured
  • FIG. 8 shows that SIRT1 was specifically inhibited only in renal tubular cells (conditional knockout mouse: Sirt1 co / co; Hoxb7-Cre (+)) and wild-type mice (Sirt1 co / co; Hoxb7-Cre (-)).
  • the immunofluorescence staining data of the expression sites of Six2 (FIG. 4A) and WT1 (FIG. 4B) at 1 day of age were measured.
  • the present invention sought to solve the above-mentioned problem by providing a method for controlling the differentiation of adipocytes or renal progenitor cells of embryonic stem cells by controlling the expression of SIRT1.
  • SIRT1 sirtuin 1
  • sirtuin 1 sirtuin 1
  • adipocytes or kidneys depending on the timing of SIRT1 expression inhibition
  • differentiation into progenitor cells is inhibited or promoted, and it can be used as a pediatric obesity research model according to the regulation of SIRT1 expression in embryos, renal disease research model, etc. through the control of differentiation of adipocytes or renal progenitor cells of embryonic stem cells It has an effect.
  • the present invention includes a method for regulating the differentiation of adipocytes or renal progenitor cells of embryonic stem cells, comprising the step of inhibiting SIRT1 (silent mating type information regulation 2 homolog; sirtuin 1) expression in embryonic stem cells, specifically, It includes a method of inhibiting differentiation into adipocytes or renal progenitor cells by treating SIRT1 expression inhibitor in the embryoid body formed by culturing embryonic stem cells.
  • SIRT1 simple mating type information regulation 2 homolog
  • SIRT1 of the present invention is a silent mating type information regulation 2 homolog;
  • An abbreviation of sirtuin 1 the nucleotide sequence of the SIRT1 gene may be represented by SEQ ID NO: 1.
  • “Stem cells” of the present invention refers to cells having the ability to differentiate into various cells and have the ability to self-proliferate, embryonic stem cells (ES cells) isolated from early embryos, primitive reproduction of embryos Three types of embryonic germ cells (EG cells) isolated from cells and multipotent adult progenitor cells (MAPC cells) isolated from adult bone marrow are best known.
  • ES cells embryonic stem cells
  • EG cells embryonic germ cells
  • MPC cells multipotent adult progenitor cells
  • mouse-derived embryonic stem cells are used as embryonic stem cells, but are not limited thereto.
  • specific examples of mouse-derived embryonic stem cells include EB3 cells, E14 cells, D3 cells, CCE cells, R1 cells, 129SV cells, and J1. And the like.
  • standard protocols already established for the preparation, passage and preservation of embryonic stem cells, embryonic germ cells and pluripotent adult stem cells (Matsui et al., Cell, 70: 841, 1992; Shamblott et al., Proc ... Natl Acad Sci USA, 95:. 13726, 1998; U.S. Patent No. 6,090,622; Jiang et al, Nature, 418 :. 41, 2002; in reference to International Patent Publication 01/11011) make these stem cells facilitate It can be used, and can be cultured using a variety of known feeder cells and embryonic stem cell medium.
  • Cells usable in the present invention are not limited to embryonic stem cells, and include stem cells having similar characteristics as mammalian embryos or embryonic stem cells.
  • embryonic stem cell-like trait means that there are surface (antigen) markers specific for embryonic stem cells, express embryonic stem cell-specific genes, or have teratoma-forming functions, Or it can be defined as cell biological properties specific to embryonic stem cells, such as chimeric mouse formation ability.
  • the SIRT1 expression inhibitor may be treated for 0-7 days in embryoid body culture, and the SIRT1 expression inhibitor may be treated with certinol; 2-[(2-Hydroxynaphthalen-1-ylmethylene) amino] -N- (1-phenethyl) benzamide ), Nicotinamide (pyridine-3-carboxamide) and EX527 (6-Chloro-2,3,4,9-tetrahydro-1H-Carbazole-1-carboxamide).
  • EX527 is preferably used, a known SIRT1 expression inhibitor capable of inhibiting SIRT1 expression may be used without limitation, and a specific sequence for SIRT1 such as siRNA that inhibits protein synthesis of SIRT1 may be synthesized and used. .
  • the SIRT1 expression inhibitor When inhibiting differentiation into adipocytes, the SIRT1 expression inhibitor may be added to the medium at a concentration of 5 to 500 ⁇ M, preferably at a concentration of 10 to 100 ⁇ M, and when added at a concentration of 5 ⁇ M or less, inhibition of differentiation to adipocytes There may be no effect, and when added at a concentration of 500 ⁇ M or more, cytotoxicity may occur or efficiency may be reduced due to a small increase in efficacy due to the increase in concentration.
  • SIRT1 expression inhibitor When inhibiting differentiation into renal progenitor cells, SIRT1 expression inhibitor may be added to the medium at a concentration of 4 to 25 ⁇ M, preferably at a concentration of 5 to 10 ⁇ M, and when added at a concentration of 5 ⁇ M or less, There may be no inhibitory effect of differentiation, and when added at a concentration of 500 ⁇ M or more, there may be a problem in that cytotoxicity is exhibited or the efficiency is decreased due to the improvement of efficacy due to the increase in concentration.
  • R1 cells which are mouse embryonic stem cells, were used, and in order to determine whether differentiation into adipocytes of embryonic stem cells depends on whether SIRT1 protein is expressed, mouse embryonic stem cells expressing SIRT1 genes.
  • a mouse embryonic stem cell lacking the SIRT1 gene (SIRT1 + / +; WT) and a mouse embryonic stem cell (SIRT1-/-; KO) were prepared, and SIRT1 inhibition was performed by treating the SIRT1 gene-expressing mouse embryonic stem cells EX527. The degree of fat differentiation was confirmed.
  • a hanging-drop culture method is used, but not limited thereto, an embryoid body known in the art. Formation methods can be used without limitation.
  • FIG. 1 is a schematic diagram illustrating a culture protocol for differentiating embryonic stem cells to adipocytes.
  • the embryonic body formed by the cultivation method is treated with retinoic acid, followed by culture. insulin), triiodine tyronine (Triiodothyronine) and rosiglitazone (rosiglitazone) containing a culture for adipocyte differentiation for 14 days to induce differentiation of adipocytes.
  • Triiodothyronine triiodothyronine
  • rosiglitazone rosiglitazone
  • SIRT1 + / +; WT mouse embryonic stem cell
  • SIRT1-/-; KO mouse embryonic stem cell lacking SIRT1 gene
  • Figure 2 confirms the degree of differentiation of embryonic stem cells into adipocytes according to the presence or absence of SIRT1 expression, as shown in Figure 2A, SIRT1 + / + cells, the embryonic stem cells differentiate into adipocytes, lipid drop (lipid drop) ), While much of the SIRT1 ⁇ / ⁇ cells were confirmed to be hardly differentiated into adipocytes.
  • SIRT1 + / + cells were treated with the SIRT1 inhibitor EX527, lipid droplets were observed, but it was confirmed that the differentiation of adipocytes was made at a significantly lower level than SIRT1 + / + cells. That is, it was confirmed that differentiation into adipocytes was suppressed due to the inhibition of SIRT1 expression.
  • FIG. 2B is a data obtained by measuring the absorbance at 500 nm by extracting a sample of oil red O stained on lipid droplets of a cell.
  • SIRT1 ⁇ / ⁇ cells reduced adipocyte differentiation by 40% compared to SIRT1 + / + cells.
  • EX527 When the SIRT1 inhibitor EX527 was treated, it was confirmed that the differentiation of adipocytes was reduced by about 38%.
  • PPAR- ⁇ peroxisome proliferator-activated receptors- ⁇
  • C / EBP ⁇ CCAAT / enhancer-binding protein- ⁇
  • FABP4 fatty acid binding protein 4
  • mRNA expression levels of PPAR ⁇ , C / EBP ⁇ and FABP4 in adipocytes were measured by PCR method, and FIG.
  • the data confirmed the expression level of PPAR, C / EBP ⁇ and FABP4 according to the presence or absence of SIRT1 expression upon inducing differentiation into adipocytes.
  • SIRT1 + / + cells after induction of differentiation into adipocytes, PPAR ⁇ , C / EBP ⁇ and While it was confirmed that mRNA expression of FABP4 was increased, treatment with SIRT1 ⁇ / ⁇ cells and SIRT1 inhibitor EX527 significantly reduced mRNA expression of PPAR ⁇ , C / EBP ⁇ and FABP4.
  • SIRT1 inhibits the expression of PPAR- ⁇ and inhibits differentiation into adipocytes (Frederic Picard et al., Nature, 429: 771, 2004), whereas embryonic stem cells formed from embryonic stem cells Initially, it was confirmed that PPAR ⁇ mRNA expression was reduced by SIRT1 expression inhibition.
  • R1 cells which are mouse embryonic stem cells
  • R1 cells were used, and in order to determine whether differentiation of renal precursor cells from embryonic stem cells was influenced by the presence or absence of SIRT1 protein expression, mouse embryonic stem cells expressed with SIRT1 gene
  • a control group of cells SIRT1 + / +; WT
  • a mouse embryonic stem cell SIRT1-/-; KO
  • SIRT1 inhibitor EX527 was treated with a mouse embryonic stem cell expressing SIRT1 gene. Renal progenitor cell differentiation according to inhibition was confirmed.
  • FIG. 5 is a schematic diagram showing a culture protocol for differentiation from embryonic stem cells to renal progenitor cells, in one embodiment of the present invention retinoic acid (Leukemia Inhibitory Factor, LIF; Milipore, USA) Retinoic acid) was treated with 100 nmol / L and 10 ng / mL of Activin A for 7 days to induce differentiation into renal progenitor cells.
  • retinoic acid Leukemia Inhibitory Factor, LIF; Milipore, USA
  • Retinoic acid was treated with 100 nmol / L and 10 ng / mL of Activin A for 7 days to induce differentiation into renal progenitor cells.
  • SIRT1 + / +; WT mouse embryonic stem cell
  • SIRT1-/-; KO mouse embryonic stem cell lacking SIRT1 gene
  • SIRT1 expression in SIRT1 expression inhibits the expression of SIX2 (sine oculis homeobox homolog 2) and WT1 (wilms tumor 1) in embryonic stem cells, thereby differentiating into renal progenitor cells. May be suppressed.
  • mRNA expression levels of Six2 and WT1 in cells were measured by PCR, and the results are shown in FIG. 2.
  • 6 is a data confirming the degree of mRNA expression of Six2 and WT1 according to the presence or absence of SIRT1 expression in induction of differentiation of embryonic stem cells into renal progenitor cells.
  • SIRT1 + / + cells Six2 and WT1 after differentiation induction into renal precursor cells.
  • MRNA expression was increased, whereas in SIRT1 ⁇ / ⁇ cells, mRNA expression of Six2 and WT1 was significantly suppressed.
  • Fat cell differentiation control method of embryonic stem cells of the present invention (a) culturing the embryonic stem cells to form an embryoid body (embryoid body); And
  • step (b) culturing the embryoid body in a medium containing a SIRT1 expression regulating substance to induce differentiation into adipocytes; and a method of promoting differentiation from embryonic stem cells to adipocytes, comprising: SIRT1 expression control material in step b) is SIRT1 expression inhibition, it may be characterized in that the differentiation induction for 7 to 21 days.
  • the group treated with SIRT1 inhibitors only in the early stage of differentiation compared to the group treated with inhibitors While the differentiation of captives was reduced, the group treated with the SIRT1 inhibitor during the whole differentiation period was not significantly different from the group not treated with the inhibitor, and the group treated with the inhibitor during the 7-21 days later in the differentiation did not receive the inhibitor. It was confirmed that the differentiation into adipocytes was more advanced than the non-group.
  • the method of regulating differentiation of embryonic stem cells by fat tax according to the present invention was confirmed that the differentiation of SIRT1 expression can be induced or inhibited or promoted the differentiation of adipocytes. Inhibition of differentiation into adipocytes was inhibited by SIRT1 inhibition unlike the conventionally known inhibition. Inhibition of SIRT1 expression during induction of differentiation into adipocytes of embryoid bodies for 7 to 21 days resulted in differentiation into adipocytes, unlike the above results. It was confirmed that it was promoted.
  • the method of controlling the differentiation of adipocytes from embryonic stem cells through the SIRT1 expression regulation of the present invention can control the differentiation inhibition or promotion of adipocytes according to the SIRT1 expression inhibitor treatment time. It can be used as an obesity research model such as childhood obesity according to the time of inhibition.
  • SIRT1 expression promoter in order to promote differentiation from embryonic stem cells to adipocytes, in step (b), instead of the SIRT1 inhibitor, SIRT1 expression promoter can be treated for 0-5 days of differentiation induction, and the SIRT1 expression promoter Interferon beta-1a, interferon beta-1b, cGMP (cyclic guanosine monophosphate), adiponectin, pyruvate, 2-deoxyglucose , SRT1270 (ChemCruz Biochemicals), adenovirus, lentivirus, BML-278 (ChemCruz Biochemicals), and resveratrol may be at least one selected from the group, and can promote or induce SIRT1 expression in the art.
  • Known materials can be used without limitation.
  • the present invention also includes an adipocyte prepared by the method for promoting adipocyte differentiation and a tissue regeneration composition comprising the adipocyte as an active ingredient.
  • composition for tissue regeneration comprising adipocytes derived from embryonic stem cells of the present invention as an active ingredient may be formulated by a method known in the pharmaceutical art, and may be mixed with the construct itself or a pharmaceutically acceptable carrier, excipient, etc.
  • Conventional pharmaceutical preparations can be formulated into a variety of formulations, such as solutions, ointments, emulsions, gels, creams, pastes and the like.
  • the dosage of the therapeutic agent for tissue regeneration of the present invention but the preferred dosage depends on the condition and weight of the patient, the extent of the disease or condition, the form and duration of the drug, and may be appropriately selected by those skilled in the art.
  • the therapeutic agents of the present invention are usually administered at 25-100 ⁇ M, preferably 45-65 ⁇ M, per day wound. Administration can be administered once to several times daily.
  • the present invention provides a method for promoting differentiation of renal progenitor cells of embryonic stem cells, wherein the embryonic stem cells are treated with an SIRT1 expression promoter to promote differentiation into renal progenitor cells.
  • the SIRT1 expression promoters are interferon beta-1a (interferon beta-1a), interferon beta-1b (interferon beta-1b), cyclic guanosine monophosphate (cGMP), adiponectin, pyruvate, 2-deoxyglucose (2-deoxyglucose), SRT1270 (ChemCruz Biochemicals), adenovirus, lentivirus, BML-278 (ChemCruz Biochemicals), and resveratrol, and may be one that promotes or induces SIRT1 expression. Any material known in the art to be present can be used without limitation.
  • the expression of Six2 and WT1 was significantly promoted compared to the control group, thereby confirming that the differentiation into renal progenitor cells is promoted (see Figure 3).
  • resveratrol is preferably used, a known SIRT1 expression promoter capable of promoting SIRT1 expression may be used without limitation, and a specific sequence for SIRT1 such as RNA for promoting protein synthesis of SIRT1 may be synthesized and used. .
  • SIRT1 expression promoter may be added to the medium at a concentration of 5 to 50 ⁇ M, preferably at a concentration of 10 to 20 ⁇ M, and when added at a concentration of 5 ⁇ M or less, may not have an inhibitory effect on differentiation into renal progenitor cells.
  • concentration of ⁇ M or more there may be a problem in that cytotoxicity is exhibited or the efficiency is decreased due to the improvement of efficacy due to the increase in concentration.
  • FIG. 7 shows mRNA expression levels of WT1 (A) and Six2 (B), which are markers of renal progenitor cells, when EX527 (5-10 uM), a SIRT1 inhibitor, and resveratrol (10-20 uM), a SIRT1 promoter, are administered to embryonic stem cells. Is the measured data. As described above, when the SIRT1 inhibitor was administered, it was confirmed that the expression levels of Six2 and WT1 mRNA were significantly decreased, and when the resveratrol, the SIRT1 expression promoter, was administered, the expression of Six2 and WT1 mRNA was significantly increased.
  • the SIRT1 expression promoter is characterized in that it is treated for 1 to 21 days of differentiation induction. Most preferably, the treatment may be for 1 to 7 days. If treated for a period of less than 1 day, the effect of promoting or inhibiting the differentiation of renal progenitor cells may not be effective, and if treated for a period of more than 21 days may show cytotoxicity and cause cell death.
  • the present invention provides renal cells derived from renal precursor cells produced by the above method.
  • the present invention provides a renal function restorer or therapeutic agent containing renal progenitor cells produced by the above method.
  • the renal function repair or therapeutic agent of the present invention replenishes (regenerates) or rebuilds (restores) damaged kidney cells.
  • the therapeutic agent may preferably be a cellular therapeutic agent.
  • Regeneration is a phenomenon in which a part of a formed organ or individual is lost, and “reconstruction” is also referred to as “reconstitution”. Reconstructing tissues or organs from dissociated cells or tissues.
  • treatment is a therapeutic treatment and a means of prevention or prevention. Therefore, those in need of treatment include those already with renal failure.
  • the method of the invention is not limited to treating humans, primates and any mammals in need of treatment, including livestock, breeding, pet or sport animals, such as dogs, horses, cats, sheep, pigs, cattle, and the like. Can be used.
  • a “therapeutically effective amount” of cells is an amount sufficient to stop or alleviate the physiological effects of a patient caused by the loss, damage or degeneration of differentiated kidney cells.
  • the therapeutically effective amount of cells used will depend on the patient's need, the patient's age, physiological condition and health, the desired therapeutic effect, the size and area of tissue to be targeted for treatment, the extent of the lesion and the route of delivery chosen. For example, treatment of a disorder affecting a larger area of the brain may require more cells to achieve a therapeutic effect when compared to smaller target areas.
  • the cells may be administered at one or more sites within a given target tissue in multiple small grafts of low cell dose.
  • the cells of the invention can be completely isolated before transplantation, for example to form a suspension of single cells, or almost completely isolated before transplantation, for example to form small aggregates of cells.
  • the cells can be administered by transplanting or migrating them to a predetermined tissue site and reconstructing or regenerating functionally deficient regions.
  • the actual dosage should be determined in light of several relevant factors such as the disease to be treated, the route of administration, the age, sex and weight of the patient, and the severity of the disease, and therefore the dosage may be viewed in any way. It is not intended to limit the scope of the invention.
  • R1 cells which are mouse embryonic stem cells
  • ATCC American Type Culture Collection; ATCC SCRC-1011
  • SIRT1 + / +; WT mouse embryonic stem cells
  • SIRT1-/-; KO mouse embryonic stem cell lacking SIRT1 gene
  • DMEM Dulbeco's Modified Eagle's Medium
  • GlutaMAX TM GlutaMAX
  • non-essential amino acids 1X Non-essential amino acid, 1X NEAA; Gibco, USA
  • beta-mercaptoethanol ⁇ -mercaptoethanol
  • 10 3 unit / ml leukemia inhibitory factor Liukemia Inhibitory Factor, LIF; Milipore, USA
  • the degree of differentiation of mouse embryonic stem cells (SIRT1-/-; KO) lacking to adipocytes was confirmed.
  • SIRT1 + / + embryonic stem cells were treated with the SIRT1 inhibitor EX527 (10 ⁇ M, Tocris, UK), SITRT1 The degree of fat differentiation following inhibition was confirmed.
  • experiments were performed according to a culture protocol for differentiating embryonic stem cells to adipocytes.
  • an embryoid body was formed using a hanging-drop culture method, and then retinosine. Acid (Retinoic acid) was treated for 3 days, and cultured for 14 days in a medium to induce differentiation into adipocytes.
  • the cultivation culture was put into 20 embryos of 1000 embryonic stem cells to make one embryoid body, the process of inducing fat cells inoculated 15 cultures in each well using a 6-well plate (6-well plate) And incubated.
  • the medium for adipocyte differentiation was supplemented with 85 nM insulin (sigma, USA), 2 nM triiodine tyronine (Sigma, USA) and 2 ⁇ M rosiglitazone (sigma, USA) in DMEM medium. embryoid bodies) were incubated and exhaust exchange was performed daily.
  • SIRT1 inhibitor EX527 was added to SIRT1 + / + embryonic stem cells and cultured until the 5th day of early differentiation into adipocytes.
  • Example 2 Mouse embryonic stem cells differentiated for 21 days in Example 2 was subjected to Oil Red O staining to confirm that the differentiation into adipocytes was well done.
  • SIRT1 + / + cells were fixed by treating with 10% formaldehyde (SI) in SIRT1 + / + cells, SIRT1 ⁇ / ⁇ cells, and SIRT1 + / + cells treated with SIRT1 inhibitors. After washing three times with buffered saline, and treated with 60% isopropanol (isopropanol). Thereafter, 2 ml of Oil Red O staining solution was added thereto, and the resultant was dyed in a dark state at room temperature for 30 minutes and washed three times with phosphate buffered saline.
  • SI formaldehyde
  • the stained cells were observed under a microscope. Oil Red O was stained on lipid drops in the differentiated adipocytes, and stained with red microscope.
  • the Oil Red O dye is a solution in which 500 mg of Oil Red O dye (sigma, USA) is dissolved in 100 mL of isopropanol, mixed with distilled water at a ratio of 6: 4, and filtered with a 0.45 ⁇ m filter.
  • SIRT1 + / + cells confirmed that embryonic stem cells differentiated into adipocytes, thereby forming a lot of intracellular lipid drops, whereas SIRT1 + / + cells differentiated into adipocytes. It was confirmed that the hardly made.
  • SIRT1 + / + cells were treated with the SIRT1 inhibitor EX527, lipid drops were partially observed, but it was confirmed that the induction of adipocyte differentiation was made at a significantly lower level than SIRT1 + / + cells.
  • FIG. 2B is a data obtained by measuring the absorbance at 500 nm by extracting a sample of oil red O stained on lipid droplets of a cell.
  • SIRT1 ⁇ / ⁇ cells reduced adipocyte differentiation by 40% compared to SIRT1 + / + cells.
  • EX527 When the SIRT1 inhibitor EX527 was treated, it was confirmed that the differentiation of adipocytes was reduced by about 38%.
  • PPAR ⁇ peroxisome proliferator-activated receptors- ⁇
  • C / EBP ⁇ CCAAT / enhancer
  • mRNA expression levels of -binding protein- ⁇ ) and FABP4 were measured by PCR.
  • Each primer used in the PCR is shown in Table 1 below, was prepared by requesting Bioneer (Korea). GAPDH was used as a control for the reliability of PCR.
  • Primer Sequence primer Sequence (5 '-> 3') Tm (°C) PPAR ⁇ Forward TGTGAGACCAACAGCCTGAC SEQ ID NO: 2 60 Reverse AGCTGATTCCGAAGTTGGTG SEQ ID NO: 3 C / EBP ⁇ Forward TGGACAAGAACAGCAACGAG SEQ ID NO: 4 60 Reverse AAACCATCCTCTGGGTCTCC SEQ ID NO: 5 FABP4 Forward AATGTGTGATGCCTTTGTGG SEQ ID NO: 6 60 Reverse TCGACTTTCCATCCCACTTC SEQ ID NO: 7 GAPDH Forward AGGTCGGTGTGAACGGATTTG SEQ ID NO: 8 60 Reverse GGGGTCGTTGATGGCAACA SEQ ID NO: 9
  • inhibiting the expression of SIRT1 decreased the expression of intracellular PPAR ⁇ , C / EBP ⁇ and FABP4 in the differentiation of embryonic stem cells into adipocytes, thereby reducing the differentiation into adipocytes.
  • Increasing means promotes the differentiation of embryonic stem cells into adipocytes.
  • SIRT1 inhibitor EX527 (10 ⁇ M) was treated with time.
  • the group treated with SIRT1 inhibitors only in the early differentiation it was confirmed that the differentiation into adipocytes is reduced compared to the group not treated with the inhibitor.
  • the group treated with the SIRT1 inhibitor during the whole differentiation period was not significantly different from the group without the inhibitor, and the group treated with the inhibitor during the 7-21 days later in the differentiation had more differentiation into adipocytes than the group without the inhibitor. It was confirmed to proceed.
  • SIRT1 expression is suppressed early in the embryonic body culture formed from embryonic stem cells, SIRT1 inhibition to adipocytes is unlikely known. It was confirmed that the differentiation is inhibited, and when the SIRT1 expression is suppressed during the induction of differentiation into adipocytes of the embryoid body, the differentiation into adipocytes is promoted.
  • Renal progenitor cells Six2 were treated with 100 nmol / L of retinoic acid and 10 ng / mL of retinoic acid in cell cultures except Leukemia Inhibitory Factor (LIF; Milipore, USA). And mRNA expression levels of WT1 were measured.
  • Induction into renal progenitor cells was incubated by inoculating embryonic stem cells in each well using a 6-well plate.
  • the medium for renal progenitor cell differentiation was DMM (Dulbeco'Modified Eagle'Medium) medium in 2 mM Gluta MAXTM (Gibco, USA), non-essential amino acids (1X Non-essential aminoacid, 1X NEAA; Gibco, USA), 0.1 mM Beta-mercaptoethanol ( ⁇ -mercaptoethanol; Invitrogen, USA) and 1,000 unit / ml leukemia inhibitory factor (Leukemia Inhibitory Factor, LIF; Milipore, USA) were added thereto.
  • DMM Dulbeco'Modified Eagle'Medium
  • Gluta MAXTM Gibco, USA
  • non-essential amino acids (1X Non-essential aminoacid, 1X NEAA; Gibco, USA
  • Beta-mercaptoethanol ⁇ -mercaptoethanol
  • Invitrogen, USA 1,000 unit / ml leukemia inhibitory factor
  • LIF Leukemia Inhibitory Factor
  • SIRT1 + / +; WT Mouse embryonic stem cells expressing SIRT1 gene
  • SIRT1 gene prepared in Example 1 to confirm differentiation into renal progenitor cells of embryonic stem cells depending on whether SIRT1 protein is expressed or not. Differentiation of stem cells (SIRT1-/-; KO) into renal precursor cells was confirmed. Differentiation was confirmed by mRNA expression levels of six progenitor cells, Six2 and WT1.
  • mRNA expression levels of six progenitor cells Six2 and WT1 were measured by PCR.
  • Each primer used in the PCR is shown in Table 1 below, was prepared by requesting Bioneer (Korea). GAPDH was used as a control for the reliability of PCR.
  • Primer Sequence primer Sequence (5 '-> 3') Tm (°C) Six2 Forward CAAGGAAAGGGAGAACAGCGA SEQ ID NO: 10 60 Reverse GCGTCTTCTCATCCTCGGAA SEQ ID NO: 11 WT1 Forward ATCCCAGGCAGGAAAGTGTG SEQ ID NO: 12 60 Reverse GTGCTGTCTTGGAAGTCGGA SEQ ID NO: 13 GAPDH Forward AGGTCGGTGTGAACGGATTTG SEQ ID NO: 14 60 Reverse GGGGTCGTTGATGGCAACA SEQ ID NO: 15
  • inhibiting the expression of SIRT1 decreased the expression of Six2 and WT1 intracellular mRNAs during differentiation from embryonic stem cells to renal progenitor cells, thereby inhibiting the differentiation of renal progenitor cells. This means that differentiation of embryonic stem cells into renal progenitor cells is inhibited.
  • SIRT1 gene-expressed mouse embryonic stem cells (SIRT1 + / +; WT) prepared from Example 1 to kidney progenitor cells Differentiation was confirmed. Differentiation was confirmed by protein expression levels of six precursors of the renal progenitor cells, Six2 and WT1.
  • mRNA expression levels of six progenitor cells Six2 and WT1 were measured by quantitative PCR.
  • SIRT1 protein was suppressed only in renal tubular cells, and changes in protein expression of Six2 and WT1 were observed in conditional knockout mouse (Sirt1 co / co; Hoxb7-Cre (+)) 1 day after birth.
  • Protein expression changes of Six2 and WT1 were measured by immunofluorescence staining. To carry out immunochemical staining, the kidneys of pregnant rats or the rats of day 0 of birth were obtained, fixed with 4% paraformaldehyde for 6 hours, and cut into 10 mm thicknesses. Anti-Six2 (Abcam; ab68908, Cambridge, UK) and Anti-WT1 (Abcam; Cambridge, UK) were used as antibodies for the Zeiss Z1 microscope and a Zeiss LSM 510 confocal microscope (Carzais, Germany).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Botany (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 SIRT1(silent mating type information regulation 2 homolog; sirtuin 1) 발현 조절을 통한 배아줄기세포로부터 지방세포 또는 신장전구세포의 분화 조절 방법에 관한 것으로, 본 발명의 SIRT1 발현 조절을 통한 배아줄기세포로부터 지방세포의 분화 조절방법은 SIRT1 발현 억제제 처리 시기에 따라 지방세포의 분화 억제 또는 촉진을 조절할 수 있는 있다. 또한, SIRT1 발현 억제제 또는 촉진제를 처리하여 신장전구세포 분화를 조절할 수 있다. 이는 SIRT1 억제제를 선별하여 비만, 비만과 동반된 당뇨병, 신장질환 그리고 대사질환의 억제제 또는 치료제 등으로 활용할 수 있는 효과가 있다.

Description

SIRT1 발현 조절을 통한 배아줄기세포로부터 지방세포 또는 신장전구세포로의 분화 조절 방법
본 출원은 2015년 01월 26일에 출원된 대한민국 특허출원 제10-2015-0012049호, 2015년 06월24일에 출원된 대한민국 특허출원 제10-2015-0089783호, 2016년 1월 21일에 출원된 대한민국 특허출원 제10-2016-0007611호를 우선권으로 주장하고, 상기 명세서 전체는 본 출원의 참고문헌이다.
본 발명은 SIRT1(silent mating type information regulation 2 homolog; sirtuin 1) 발현 조절을 통한 배아줄기세포로부터 지방세포 또는 신장전구세포의 분화 조절 방법에 관한 것으로, 보다 상세하게는 배아줄기세포의 SIRT1(silent mating type information regulation 2 homolog; sirtuin 1) 발현을 억제시키는 단계를 포함하는 배아줄기세포로부터 지방세포 또는 신장전구세포로의 분화 억제 방법에 관한 것이다.
SIRT1(silent mating type information regulation 2 homolog; sirtuin 1)은 NAD+ 의존적 탈아세틸효소로써 여러 단백질의 리신 잔기를 탈아세틸화하여 단백질의 기능을 조절하는 효소로 알려져 있으며(Ageing Res, Vol.1 페이지 313-326, 2002), NAD+ 의존적 class Ⅲ 히스톤 탈아세틸 활성을 가진 효모의 Sir2와 가장 유사하다. 특히, Nuclear factor-kB, p53 등의 전사인자에 붙어 있는 아세틸기를 잘라내어 이들의 기능을 조절하는 것으로 알려져 있다 (Cancer Res, Vol.64 페이지 7513-7525, 2004; Cell, Vol.107, 페이지 149-159, 2001; Trends Endocrinol Metab, Vol.17 페이지 186-191, 2006).
SIRT1은 유전자 발현억제와 관련 있는 크로마틴 재구성, DNA 손상 반응, 식이 제한에 동반된 수명연장 등에 관여한다(Chen et al., Science, 310:1641, 2005). 즉, SIRT1은 효모의 Sir2 처럼 히스톤 탈아세틸화를 통해 크로마틴을 재구성하고 유전자의 발현을 억제하며, 히스톤 단백질 외에도 세포성장, 스트레스 반응, 내분비조절 등에 관련된 다양한 전사인자의 탈아세틸화를 유도한다. 또한, 최근 연구에 따르면 상기 SIRT1의 탈아세틸화 활성을 증가시켜 당뇨, 비만, 신경퇴행성질병 또는 노화관련질병 등에 적용하는 기술이 보고되었고, SIRT1가 PPAR-γ의 발현을 억제하여 지방세포로 분화를 억제시킨다는 연구결과가 보고되었으나(Frederic Picard et al., Nature, 429:771, 2004) , 배아줄기세포에서 SIRT1의 발현 조절에 따른 지방세포로의 분화조절에 대한 연구는 이루어진바 없다.
이에, 본 발명자들은 배아줄기세포에서 SIRT1의 발현 조절에 따른 지방세포 또는 신장전구세포로의 분화조절 방법을 개발하기 위하여 예의 노력한 결과, SIRT1(silent mating type information regulation 2 homolog; sirtuin 1)가 배아줄기세포의 지방세포 또는 신장전구세포로의 분화에 관여하며, SIRT1 발현 억제 시기에 따라 지방세포 또는 신장세포로의 분화가 억제 또는 촉진되는 것을 확인하고, 본 발명을 완성하였다.
본 발명은 상기와 같은 문제점을 해결하기 위하여 안출된 것으로, 본 발명은 SIRT1 발현 조절을 통한 배아줄기세포로부터 지방세포 또는 신장전구세포로의 분화 억제 또는 촉진 방법을 제공하는데 있다.
상술한 본 발명의 과제를 해결하기 위하여 본 발명은, 배아줄기세포의 SIRT1(silent mating type information regulation 2 homolog; sirtuin 1) 발현을 억제시키는 단계를 포함하는 배아줄기세포의 지방세포 또는 신장전구세포 분화 억제 방법을 포함한다.
본 발명의 바람직한 일실시예에 따르면, 상기 배아줄기세포의 지방세포 분화억제 방법은 배아줄기세포를 배양하여 형성시킨 배상체에 SIRT1 발현 억제제를 처리하여 지방세포 또는 신장전구세포로의 분화를 억제하는 것일 수 있다.
본 발명의 바람직한 다른 일실시예에 따르면, SIRT1 발현 억제제는 배상체 배양 0 내지 7일 동안 처리하는 것일 수 있다.
본 발명의 바람직한 다른 일실시예에 따르면, 상기 SIRT1 발현억제제는 서티놀(Sirtinol; 2-[(2-Hydroxynaphthalen-1-ylmethylene)amino]-N-(1-phenethyl)benzamide), Nicotinamide (pyridine-3-carboxamide) 및 EX527 (6-Chloro-2,3,4,9-tetrahydro-1H-Carbazole-1-carboxamide)로 이루어지는 군에서 선택되는 어느 하나인 것일 수 있다.
본 발명의 바람직한 또 다른 일실시예에 따르면, SIRT1은 배아줄기세포 내 PPAR-γ(peroxisome proliferator-activated receptors-γ), C/EBP α(CCAAT/enhancer-binding protein-α), FABP4(fatty acid binding protein 4), SIX2 (sine oculis homeobox homolog 2) 및 WT1 (Wilms tumor 1)의 mRNA 발현량을 감소시켜 지방세포로의 분화를 억제하는 것일 수 있다.
본 발명은 또한, (a) 배아줄기세포를 배양하여 배상체(embryoid body)를 형성시키는 단계; 및
(b) SIRT1 발현 억제제가 포함된 배지에서 상기 배상체를 배양하여 지방세포로 분화를 유도하는 단계;를 포함하는 것을 특징으로 하는 배아줄기세포의 지방세포 분화 촉진 방법을 포함한다.
본 발명의 바람직한 일실시예에 따르면, 상기 (b) 단계에서 SIRT1 발현 억제제는 분화유도 7 내지 21일 동안 처리하는 것일 수 있다.
본 발명의 바람직한 다른 일실시예에 따르면, 상기 SIRT1 발현억제제는 서티놀 (Sirtinol; 2-[(2-Hydroxynaphthalen-1-ylmethylene)amino]-N-(1-phenethyl)benzamide), Nicotinamide (pyridine-3-carboxamide) 및 EX527 (6-Chloro-2,3,4,9-tetrahydro-1H-Carbazole-1-carboxamide)로 이루어진 군에서 선택된 어느 하나 이상일 수 있으며, SIRT1 발현 억제제는 배지에 5 ~ 500 μM 농도로 첨가할 수 있다.
본 발명의 바람직한 또 다른 실시예에 따르면, 상기 (b) 단계의 배지는 지방세포 분화 유도용 배지이며, 인슐린(insulin), 트리아이오딘티로닌(Triiodothyronine) 및 로시글리타존(rosiglitazone)로 구성된 군에서 선택되는 1종 이상의 물질을 포함하는 것일 수 있다.
본 발명은 또한, SIRT1 활성 물질이 포함된 배지에서 배아줄기세포를 배양하여 신장전구세포로 분화를 촉진하는 단계를 포함하는 것을 특징으로 하는 배아줄기세포의 신장전구세포 분화 촉진 방법을 포함한다.
본 발명의 바람직한 일실시예에 따르면, 상기 SIRT1 발현 촉진제는 분화유도 0 내지 21일 동안 처리하는 것일 수 있으며, 바람직하게는 1 내지 7일 동안 처리하는 것일 수 있다.
본 발명의 바람직한 다른 일실시예에 따르면, 상기 SIRT1 발현 촉진제는 SRT1270(ChemCruz Biochemicals), 아데노바이러스, 렌티바이러스, BML-278(ChemCruz Biochemicals), 및 레스베라트롤(resveratrol)로 이루어지는 군에서 선택되는 어느 하나 이상일 수 있으며, 바람직하게는 레스베라트롤(resveratrol)일 수 있다. SIRT1 발현 촉진제는 배지에 10 내지 50 μM 농도로 첨가할 수 있다.
본 발명의 바람직한 또 다른 일실시예에 따르면, SIRT1 발현 촉진제로 인해 배아줄기세포의 SIX2(sine oculis homeobox homolog 2) 및 WT1(wilms tumor 1)의 mRNA 발현량이 증가하며, 이를 통해 신장전구세포로의 분화가 촉진된다는 것을 알 수 있다(도 3 및 도 4 참조).
본 발명의 바람직한 또 다른 실시예에 따르면, 상기 배지는 신장전구세포 분화 유도용 배지이며, 레티노산((2E,4E,6E,8E)-3,7-dimethyl-9-(2,6,6-trimethylcyclohexen-1-yl)nona-2,4,6,8-tetraenoic acid ) 및 액티빈 A 로 구성된 군에서 선택되는 1종 이상의 물질을 포함할 수 있다.
본 발명의 또 다른 과제를 해결하기 위해 본 발명은 신장세포를 제공한다.
본 발명의 또 다른 과제를 해결하기 위해 본 발명은 신장전구세포를 포함하는 신장기능 회복제 및 치료제를 제공한다.
본 발명의 SIRT1 발현 조절을 통한 배아줄기세포로부터 지방세포 또는 신장전구세포의 분화 조절방법은 SIRT1 발현 억제제 처리시기에 따라 지방세포 또는 신장전구세포의 분화 억제 또는 촉진을 조절할 수 있는 있으므로, SIRT1 억제제를 선별하여 비만, 비만과 동반된 당뇨병, 신장질환 그리고 대사질환의 억제제 또는 치료제 등으로 활용할 수 있는 효과가 있다.
도 1은 배아줄기세포에서 지방세포로 분화하기 위한 배양 프로토콜을 나타낸 모식도이다.
도 2는 SIRT1 발현 유무에 따른 배아줄기세포의 지방세포로의 분화 정도를 확인한 데이터이다 (A: Oil red O 염색을 통해 지방세포 내 형성된 지질방울 (lipid drop)을 관찰한 사진, B: 염색된 Oil red O 시료를 추출하여 흡광도를 측정한 데이터).
도 3은 배아줄기세포의 지방줄기세포로의 분화 유도시 SIRT1 발현 유무에 따른 PPAR, C/EBPα 및 FABP4의 mRNA 발현정도를 확인한 데이터이다.
도 4는 SIRT1 발현 억제제 처리 시기에 따른 배아줄기세포의 지방세포 분화 정도를 확인한 데이터이다 (A: Oil red O 염색을 통해 지방세포 내 형성된 지질방울 (lipid drop)을 관찰한 사진, B: 염색된 Oil red O 시료를 추출하여 흡광도를 측정한 데이터).
도 5는 배아줄기세포에서 신장전구세포로 분화하기 위한 배양 프로토콜을 나타낸 모식도이다(RA: 레티노산).
도 6은 SIRT1 단백질을 발현하는 세포(SIRT1+/+; WT)와 SIRT1 단백질을 발현하지 않는 세포(SIRT1-/-; KO)를 분화시킨 후 신장전구세포 표시자인 Six2(A)와 WT1(B)의 mRNA 발현량을 측정한 데이터이다.
도 7은 배아줄기세포에서 SIRT1 억제제인 EX527 (5-10 uM)과 SIRT1 촉진제인 레스베라트롤(10-20 uM)을 투여하였을 때 신장전구세포 표시자인 WT1(A)와 Six2(B)의 mRNA 발현량을 측정한 데이터이다
도 8은 신장 집합관 세포에서만 특이하게 SIRT1을 억제시킨 마우스 (conditional knockout mouse: Sirt1 co/co; Hoxb7-Cre (+))와 wild-type 마우스 (Sirt1 co/co; Hoxb7-Cre (-))에서 생후 1일때에 Six2 (도4A)와 WT1 (도4 B)의 발현 위치를 측정한 면역형광염색 데이터이다.
도 9는 신장 집합관 세포에서만 특이하게 Sirt1을 억제시킨 마우스 (conditional knockout mouse: Sirt1 co/co; Hoxb7-Cre (+))와 wild-type 마우스 (Sirt1 co/co; Hoxb7-Cre (-))에서 생후 1일때에 Six2 (도4A)와 WT1 (도4B)의 mRNA 발현 정도를 측정한 quantitative RT-PCR 데이터이다.
이하, 본 발명을 보다 상세히 설명한다.
상술한 바와 같이, SIRT1 유전자의 기능에 대해 다양한 연구가 이루어지고 있으며, SIRT1 발현이 증가하면 PPAR-γ의 발현이 억제되어 지방세포로 분화를 억제시킨다는 연구결과가 보고되었으나, 배아줄기세포에서 SIRT1의 발현 조절에 따른 지방세포 또는 신장전구세포로의 분화조절에 대한 연구는 이루어진바 없다.
본 발명은 SIRT1의 발현을 조절하여 배아줄기세포의 지방세포 또는 신장전구세포 분화 조절 방법을 제공함으로써 상술한 문제의 해결방안을 모색하였다. 이를 통해, SIRT1(silent mating type information regulation 2 homolog; sirtuin 1)가 배아줄기세포의 지방세포 또는 신장전구세포로의 분화에 관여하며, 기존에 알려진 것과 달리, SIRT1 발현 억제시기에 따라 지방세포 또는 신장전구세포로의 분화가 억제 또는 촉진되는 것을 확인하였으며, 상기 배아줄기세포의 지방세포 또는 신장전구세포 분화조절 방법을 통해 배아에서 SIRT1 발현 조절에 따른 소아비만 연구모델, 신장질환 연구모델 등으로 사용할 수 있는 효과가 있다.
따라서, 본 발명은 배아줄기세포에서 SIRT1(silent mating type information regulation 2 homolog; sirtuin 1) 발현을 억제시키는 단계를 포함하는 배아줄기세포의 지방세포 또는 신장전구세포 분화 조절방법을 포함하며, 구체적으로, 배아줄기세포를 배양하여 형성시킨 배상체(embryoid body)에 SIRT1 발현 억제제를 처리하여 지방세포 또는 신장전구세포로의 분화를 억제하는 방법을 포함한다.
본 발명의 SIRT1은 silent mating type information regulation 2 homolog; sirtuin 1의 약자로, SIRT1 유전자의 염기서열은 서열번호 1로 표시될 수 있다.
본 발명의 "줄기세포"는 각종 세포로 분화할 수 있는 능력을 갖추고 있으며 자가증식 능력을 갖추고 있는 세포를 말하며, 초기 배아에서 분리한 배아 줄기세포(embryonic stem cell, ES 세포), 배아기의 원시생식세포에서 분리한 배아 생식세포(embryonic germ cell. EG 세포), 및 성체의 골수에서 분리한 다능성 성체줄기세포(multipotent adult progenitor cell, MAPC 세포)의 3종이 가장 잘 알려져 있다.
본 발명에서는 배아줄기세포로 마우스 유래 배아줄기세포를 사용하였으나, 이에 한정되지 않으며, 마우스 유래 배아 줄기세포의 구체적인 예로는, EB3 세포, E14 세포, D3 세포, CCE 세포, R1 세포, 129SV 세포 및 J1 세포 등을 들 수 있다. 또한, 배아 줄기세포, 배아 생식세포 및 다능성 성체줄기세포의 제조, 계대 및 보존에 대해서는 이미 확립되어 있는 표준적인 프로토콜(Matsui et al., Cell, 70: 841, 1992; Shamblott et al., Proc . Natl . Acad . Sci . USA, 95: 13726, 1998; 미국특허 제 6,090,622호; Jiang et al., Nature, 418: 41, 2002; 국제공개특허 01/11011)을 참조하여 이들 줄기세포를 용이하게 사용할 수 있으며, 이미 공지되어 있는 다양한 피더세포 및 배아줄기세포 배지를 사용하여 배양할 수 있다.
본 발명에서 이용 가능한 세포는 배아줄기세포로 한정되지 않으며, 포유동물의 배아나 배아 줄기세포와 유사한 형질을 가지는 줄기세포를 포함한다. 이 경우 용어, "배아 줄기세포와 유사한 형질"이란, 배아줄기세포에 특이적인 표면(항원) 마커가 존재하거나, 배아 줄기세포 특이적인 유전자를 발현하거나, 또는 테라토마(teratoma) 형성 기능을 가지거나, 또는 키메라 마우스 형성능이 있는 등의 배아 줄기세포에 특이적인 세포생물학적 성질로 정의할 수 있다.
상기 SIRT1 발현 억제제는 배상체 배양 0 내지 7일 동안 처리할 수 있으며, SIRT1 발현 억제제는 서티놀 (Sirtinol; 2-[(2-Hydroxynaphthalen-1-ylmethylene)amino]-N-(1-phenethyl)benzamide), Nicotinamide (pyridine-3-carboxamide) 및 EX527 (6-Chloro-2,3,4,9-tetrahydro-1H-Carbazole-1-carboxamide)로 이루어지는 군에서 선택되는 어느 하나인 것 일 수 있다.
본 발명에서는 바람직하게 EX527을 사용하였으나, SIRT1 발현을 억제할 수 있는 공지된 SIRT1 발현 억제제를 제한 없이 사용할 수 있으며, SIRT1의 단백질 합성을 저해시키는 siRNA 등 SIRT1에 대한 특이적인 서열을 합성하여 사용할 수도 있다.
지방세포로 분화를 억제할 경우, SIRT1 발현 억제제는 배지에 5 ~ 500 μM 농도로, 바람직하게는 10 ~ 100 μM 농도로 첨가될 수 있으며, 5 μM 이하의 농도로 첨가될 경우 지방세포로의 분화 억제 효과가 없을 수 있으며, 500 μM 이상의 농도로 첨가될 경우 세포 독성이 나타나거나 농도 증가로 인한 효능의 향상이 적어 효율이 떨어지는 문제점이 있을 수 있다.
신장전구세포로 분화를 억제할 경우, SIRT1 발현 억제제는 배지에 4 ~ 25 μM 농도로, 바람직하게는 5 ~ 10 μM 농도로 첨가될 수 있으며, 5 μM 이하의 농도로 첨가될 경우 신장전구세포로의 분화 억제 효과가 없을 수 있으며, 500 μM 이상의 농도로 첨가될 경우 세포 독성이 나타나거나 농도 증가로 인한 효능의 향상이 적어 효율이 떨어지는 문제점이 있을 수 있다.
본 발명의 일실시예에서는, 마우스 배아줄기세포인 R1 세포를 사용하였으며, SIRT1 단백질의 발현 유무에 따라 배아줄기세포의 지방세포로 분화가 영향을 미치는지 확인하기 위해, SIRT1 유전자 발현되는 마우스 배아줄기세포(SIRT1 +/+; WT)인 대조군과 SIRT1 유전자가 결여된 마우스 배아줄기세포(SIRT1 -/-; KO)를 준비하였으며, SIRT1 유전자 발현되는 마우스 배아줄기세포에 SIRT1 억제제인 EX527을 처리하여 SIRT1 억제에 따른 지방분화 정도를 확인하였다.
본 발명에서는 배아줄기세포를 배양하여 배상체(embryoid body)를 형성하기 위해 바람직하게는 현적배양(hanging-drop culture) 방법을 사용하였으며, 이에 한정되지 않고 당업계에 공지된 배상체(embryoid body) 형성 방법을 제한 없이 사용할 수 있다.
1) 지방세포로의 분화 억제
도 1은 배아줄기세포에서 지방세포로 분화하기 위한 배양 프로토콜을 나타낸 모식도로, 본 발명의 일실시예에서는 현적배양 방법으로 형성된 배상체에 레티노산(Retinoic acid)을 처리하여 배양한 다음, 인슐린(insulin), 트리아이오딘티로닌(Triiodothyronine) 및 로시글리타존(rosiglitazone)이 포함된 지방세포 분화용 배지에서 14일 동안 배양하여 지방세포의 분화를 유도하였다.
배아줄기세포의 지방세포로의 분화 유도는 상기에서 설명한 것처럼, SIRT1 유전자 발현되는 마우스 배아줄기세포(SIRT1 +/+; WT) 그룹, SIRT1 유전자가 결여된 마우스 배아줄기세포(SIRT1 -/-; KO) 그룹 및 SIRT1 유전자 발현되는 마우스 배아줄기세포에 SIRT1 억제제인 EX527를 처리한 그룹(EX 0-5)으로 나누어 지방세포로의 분화에 SIRT1가 미치는 영향을 확인하고자 하였다.
도 2는 SIRT1 발현 유무에 따른 배아줄기세포의 지방세포로의 분화 정도를 확인한 것으로, 도 2A에 나타난 바와 같이, SIRT1 +/+ 세포는 배아줄기세포가 지방세포로 분화하여 세포 내 지질방울(lipid drop)가 많이 형성된 것을 확인한 반면, SIRT1 -/- 세포는 지방세포로의 분화가 거의 이루어지지 않은 것을 확인하였다. 또한, SIRT1 +/+ 세포에 SIRT1 억제제인 EX527를 처리한 경우, 부분적으로 지질방울이 관찰되었으나, SIRT1 +/+ 세포에 비해 현저하게 낮은 수준으로 지방세포의 분화가 이루어진 것을 확인하였다. 즉, SIRT1 발현 억제로 인해 지방세포로의 분화가 억제되는 것을 확인하였다.
도 2B는 세포의 지질방울에 염색된 Oil red O 시료를 추출하여 500 nm에서 흡광도를 측정한 데이터로, SIRT1 -/- 세포는 SIRT1 +/+ 세포에 비해 지방세포로의 분화가 약 40% 정도 감소된 것을 확인하였으며, SIRT1 억제제인 EX527를 처리한 경우 약 38% 정도 지방세포의 분화가 감소된 것을 확인하였다.
본 발명에 있어서, SIRT1 발현 억제에 의해 배아줄기세포 내 PPAR-γ(peroxisome proliferator-activated receptors-γ), C/EBP α(CCAAT/enhancer-binding protein-α) 및 FABP4(fatty acid binding protein 4)의 mRNA 발현이 억제될 수 있다.
본 발명의 일실시예에서는, SIRT1의 지방분화 촉진 기전을 조사하기 위하여, 지방세포 내 PPAR γ, C/EBP α 및 FABP4의 mRNA 발현량을 PCR 방법으로 측정하였였으며, 도 3은 배아줄기세포의 지방줄기세포로의 분화 유도시 SIRT1 발현 유무에 따른 PPAR, C/EBPα 및 FABP4의 mRNA 발현정도를 확인한 데이터로, SIRT1 +/+ 세포에서는 지방세포로의 분화 유도 후, PPAR γ, C/EBP α 및 FABP4의 mRNA 발현이 증가한 것을 확인한 반면, SIRT1 -/- 세포 및 SIRT1 억제제인 EX527를 처리한 경우 PPAR γ, C/EBP α 및 FABP4의 mRNA 발현 현저히 감소하는 것을 확인하였다.
즉, SIRT1가 PPAR-γ의 발현을 억제하여 지방세포로 분화를 억제시킨다는 기존의 연구결과(Frederic Picard et al., Nature, 429:771, 2004)와는 달리, 배아줄기세포로부터 형성시킨 배상체 배양 초기에는 SIRT1 발현 억제에 의해 PPAR γ mRNA 발현이 감소하는 것을 확인하였다.
2) 신장전구세포로의 분화 억제
본 발명의 일실시예에서는, 마우스 배아줄기세포인 R1 세포를 사용하였으며, SIRT1 단백질의 발현 유무에 따라 배아줄기세포의 신장전구세포로 분화가 영향을 미치는지 확인하기 위해, SIRT1 유전자 발현되는 마우스 배아줄기세포(SIRT1 +/+; WT)인 대조군과 SIRT1 유전자가 결여된 마우스 배아줄기세포(SIRT1 -/-; KO)를 준비하였으며, SIRT1 유전자 발현되는 마우스 배아줄기세포에 SIRT1 억제제인 EX527을 처리하여 SIRT1 억제에 따른 신장전구세포 분화 정도를 확인하였다.
도 5는 배아줄기세포에서 신장전구세포로 분화하기 위한 배양 프로토콜을 나타낸 모식도로, 본 발명의 일실시예에서는 백혈병 억제인자(Leukemia Inhibitory Factor, LIF; Milipore, 미국)를 제외한 세포 배양액에 레티노산(Retinoic acid) 100 nmol/L와 액티빈 A(Activin A) 10 ng/mL를 7일 처리하여 신장전구세포로의 분화를 유도하였다.
배아줄기세포의 신장전구세포로의 분화 유도는 상기에서 설명한 것처럼, SIRT1 유전자 발현되는 마우스 배아줄기세포(SIRT1 +/+; WT) 그룹, SIRT1 유전자가 결여된 마우스 배아줄기세포(SIRT1 -/-; KO) 그룹으로 나누어 신장전구세포로의 분화에 SIRT1가 미치는 영향을 확인하고자 하였다.
본 발명에 있어서, SIRT1 발현 억제에 의해 배아줄기세포 내 SIRT1 발현억제로 인해 배아줄기세포의 SIX2(sine oculis homeobox homolog 2) 및 WT1(wilms tumor 1)의 mRNA 발현량이 억제되어 신장전구세포로의 분화가 억제 되는 것일 수 있다.
본 발명의 일실시예에서는, SIRT1의 신장전구세포 분화 억제를 조사하기 위하여, 세포 내 Six2 및 WT1의 mRNA 발현량을 PCR 방법으로 측정하였으며, 그 결과는 도2에 도시되어 있다. 도 6는 배아줄기세포의 신장전구세포로의 분화 유도시 SIRT1 발현 유무에 따른 Six2 및 WT1의 mRNA 발현 정도를 확인한 데이터로, SIRT1 +/+ 세포에서는 신장전구세포로의 분화 유도 후, Six2 및 WT1의 mRNA 발현이 증가발현된 반면, SIRT1 -/- 세포에서는 Six2 및 WT1의 mRNA 발현 현저히 억제되는 것을 확인하였다.
본 발명의 배아줄기세포의 지방세포 분화 조절방법은 또한, (a) 배아줄기세포를 배양하여 배상체(embryoid body)를 형성시키는 단계; 및
(b) SIRT1 발현조절 물질이 포함된 배지에서 상기 배상체를 배양하여 지방세포로 분화를 유도하는 단계;를 포함하는 것을 특징으로 하는 배아줄기세포로부터 지방세포로의 분화 촉진 방법을 포함하며, 상기 (b) 단계에서 SIRT1 발현조절 물질은 SIRT1 발현억제이며, 분화유도 7 내지 21일 동안 처리하는 것을 특징으로 할 수 있다.
본 발명의 일실시예에서, SIRT1 발현 억제 시기에 따른 지방세포의 분화에 미치는 영향을 확인한 결과, 도 4에 나타난 바와 같이, 분화 초반에만 SIRT1 억제제를 처리한 그룹은 억제제를 처리한 그룹에 비해 지방세포로의 분화가 감소하는 것을 확인한 반면, 분화 전체 시기 동안 SIRT1 억제제를 처리한 그룹은 억제제를 처리하지 않은 그룹과 별반 차이가 없었고 분화 후반인 7-21일 동안 억제제를 처리한 그룹은 억제제를 처리하지 않은 그룹보다 지방세포로의 분화가 더 진행되는 것을 확인할 수 있었다.
즉, 본 발명의 배아줄기세포의 지방세로 분화 조절방법은 SIRT1 발현 억제 시기에 따라 지방세포의 분화 억제 또는 촉진을 유도할 수 있는 것을 확인하였으며, 배아줄기세포로부터 형성된 배상체 배양 초기에 SIRT1 발현을 억제시키면 기존에 알려진 것과 달리 SIRT1 억제에 의해 지방세포로의 분화가 억제되는 것을 확인하였으며, 배상체의 지방세포로 분화유도 7 내지 21일 동안에 SIRT1 발현을 억제하면 상기 결과와는 달리 지방세포로의 분화가 촉진되는 것을 확인하였다.
따라서, 기존 연구결과와 상이한 본 발명의 SIRT1 발현 조절을 통한 배아줄기세포로부터 지방세포의 분화 조절방법은 SIRT1 발현 억제제 처리 시기에 따라 지방세포의 분화 억제 또는 촉진을 조절할 수 있는 있으므로, 배아에서 SIRT1 발현 억제 시기에 따른 소아비만 등의 비만 연구모델로 사용할 수 있다.
본 발명에 있어서, 배아줄기세포로부터 지방세포로로의 분화를 촉진하기 위해, 상기 (b) 단계에서 SIRT1 억제제 대신에 SIRT1 발현 촉진제를 분화유도 0 내지 5일 동안 처리할 수 있으며, 상기 SIRT1 발현 촉진제는 인터페론 베타-1a(interferon beta-1a), 인터페론 베타-1b(interferon beta-1b), cGMP(cyclic guanosine monophosphate), 아디포넥틴(adiponectin), 피루베이트(pyruvate), 2-데옥시글루코오스(2-deoxyglucose), SRT1270(ChemCruz Biochemicals), 아데노바이러스, 렌티바이러스, BML-278(ChemCruz Biochemicals), 및 레스베라트롤(resveratrol)로 이루어진 군에서 선택된 1종 이상일 수 있으며, SIRT1 발현을 촉진 또는 유도할 수 있는 것으로 당업계에 알려진 물질을 제한 없이 사용할 수 있다.
본 발명은 또한, 상기 지방세포 분화 촉진 방법으로 제조된 지방세포 및 상기 지방세포를 유효성분으로 포함하는 조직 재생용 조성물을 포함한다.
본 발명의 배아줄기세포에서 유도된 지방세포를 유효성분으로 포함하는 조직 재생용 조성물은 약제학적 분야에서 공지의 방법에 의해 제제화할 수 있고, 구조체 자체 또는 약제학적으로 허용되는 담체, 부형제 등과 혼합하여 통상의 약학적 제제, 예를 들면 액제, 연고, 에멀젼, 겔, 크림제, 페이스트제 등의 다양한 제형으로 제제화할 수 있다. 본 발명 조직 재생용 치료제의 투여량에 특별한 제한은 없으나, 바람직한 투여량은 환자의 상태 및 체중, 질병이나 상태의 정도, 약물형태 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 바람직한 효과를 위해서 본 발명의 치료제는 통상 1일 상처당 25 내지 100μM, 바람직하게는 45 내지 65μM으로 투여하는 것이 좋다. 투여는 하루에 한 번 내지 수회 나누어 투여할 수 있다.
본 발명은 배아줄기세포에 SIRT1 발현 촉진제를 처리하여 신장전구세포로의 분화를 촉진시키는 것을 특징으로 하는 배아줄기세포의 신장전구세포 분화 촉진 방법을 제공한다.
상기 SIRT1 발현 촉진제는 인터페론 베타-1a(interferon beta-1a), 인터페론 베타-1b(interferon beta-1b), cGMP(cyclic guanosine monophosphate), 아디포넥틴(adiponectin), 피루베이트(pyruvate), 2-데옥시글루코오스(2-deoxyglucose), SRT1270(ChemCruz Biochemicals), 아데노바이러스, 렌티바이러스, BML-278(ChemCruz Biochemicals), 및 레스베라트롤(resveratrol)로 이루어진 군에서 선택된 1종 이상일 수 있으며, SIRT1 발현을 촉진 또는 유도할 수 있는 것으로 당업계에 알려진 물질을 제한 없이 사용할 수 있다.
본 발명의 일실시예에 따르면, 레스베라트롤을 20μM 처리하였을 때, Six2 및 WT1의 발현이 대조군에 비해 월등히 촉진되었으며, 그에 따라 신장전구세포로의 분화가 촉진됨을 확인하였다(도 3 참조). 본 발명에서는 바람직하게 레스베라트롤을 사용하였으나, SIRT1 발현을 촉진할 수 있는 공지된 SIRT1 발현 촉진제를 제한 없이 사용할 수 있으며, SIRT1의 단백질 합성을 촉진시키는 RNA 등 SIRT1에 대한 특이적인 서열을 합성하여 사용할 수도 있다.
SIRT1 발현 촉진제는 배지에 5 ~ 50 μM 농도로, 바람직하게는 10 ~ 20 μM 농도로 첨가될 수 있으며, 5 μM 이하의 농도로 첨가될 경우 신장전구세포로의 분화 억제 효과가 없을 수 있으며, 400 μM 이상의 농도로 첨가될 경우 세포 독성이 나타나거나 농도 증가로 인한 효능의 향상이 적어 효율이 떨어지는 문제점이 있을 수 있다.
도 7은 배아줄기세포에서 SIRT1 억제제인 EX527 (5-10 uM)과 SIRT1 촉진제인 레스베라트롤(10 내지 20 uM)을 투여하였을 때 신장전구세포 표시자인 WT1(A)와 Six2(B)의 mRNA 발현량을 측정한 데이터이다. 상기한 바와 마찬가지로 SIRT1 억제제를 투여한 경우에 Six2 및 WT1 mRNA 발현량이 현저히 감소함을 확인할 수 있었고, SIRT1 발현 촉진제인 레스베라트롤을 투여한 경우에 Six2 및 WT1 mRNA 발현량이 현저히 증가함을 확인할 수 있었다.
도8A와 도8B에서 wild-type 마우스 (Sirt1 co/co; Hoxb7-Cre (-))에서 생후 1일때에 Six2 및 WT1의 발현이 증가하였지만, 신장 집합관 세포에서만 특이하게 Sirt1을 억제시킨 마우스 (conditional knockout mouse: Sirt1 co/co; Hoxb7-Cre (+))에서 Six2 및 WT1의 발현이 감소하였다. 이는 SIRT1 억제시에 신장전구세포의 분화를 억제할 수 있다는 것을 의미한다.
상기 SIRT1 발현 촉진제는 분화유도 1 내지 21일 동안 처리하는 것을 특징으로 한다. 가장 바람직하게는 1 내지 7일 동안 처리하는 것일 수 있다. 만약 1일보다 짧은 기간동안 처리할 경우, 신장전구세포의 분화 촉진 또는 억제 효과가 유효하게 나타나지 않을 수 있으며, 21일보다 긴 기간동안 처리할 경우, 세포독성을 나타내어 세포사멸을 일으킬 수 있다.
본 발명은 상기 방법에 의해 제조된 신장전구세포로부터 유래된 신장세포를 제공한다.
본 발명은 상기 방법에 의해 제조된 신장전구세포를 함유하는 신장기능 회복제 또는 치료제를 제공한다.
본 발명의 신장기능 회복제 또는 치료제는 손상된 신장세포를 보충(재생)하거나 다시 구축(복원)한다. 상기 치료제는 바람직하게는 세포 치료제일 수 있다.
"재생(regeneration)"이란 형성된 기관 또는 개체의 일부가 상실되었을 때 그부분이 보충되는 현상이고, "복원"이란 "재구성(reconstitution)"이라고도 할 수 있는데, 이는 조직의 재구축을 의미하는 것으로 일단 해리된 세포나 조직으로부터 조직이나 기관을 다시 구축하는 것을 말한다.
이는 신장세포나 이를 함유하는 상기 조성물(세포치료제)의 형태로 병변 부위에 직접 이식함으로써 유리하게 수행될 수 있다. 신경 이식 및 세포 배양의 방법은 당업자에게 널리 알려진 공지의 방법 또는 본 발명의 실시예에 기재된 방법을 사용할 수 있다.
본 명세서에 사용되는 용어 "치료" 또는 "치료하다"는 치료학적 처치 및 예방 또는 방지 수단이다. 그러므로, 치료가 필요한 자들은 이미 신장기능 장애를 가진 자를 포함한다. 본 발명의 방법은, 한정하는 것은 아니지만, 사람, 영장류 및 가축, 사육, 애완용 또는 스포츠 동물, 예컨대 개, 말, 고양이, 양, 돼지, 소 등을 비롯한 치료가 필요한 임의의 포유동물을 치료하는 데 사용할 수 있다. 본 명세서에서 사용되는, 세포의 "치료학적 유효량"은 분화된 신장세포의 손실, 손상 또는 변성에 의해 유발되는 환자의 생리학적 효과를 중지 또는 경감시키기에 충분한 양이다.
사용된 세포의 치료학적 유효량은 환자의 필요성, 환자의 연령, 생리학적 상태 및 건강, 소정의 치료 효과, 치료에 표적하고자 하는 조직의 크기 및 면적, 병변의 정도 및 선택된 전달 경로에 의존할 것이다. 예를 들면, 뇌의 더 큰 영역에 영향을 주는 장애의 치료는 보다 작은 표적 영역과 비교하였을 때 치료 효과를 달성하기 위하여 보다 다수의 세포를 요할 수 있다. 또한, 세포는 저 세포 투여량의 다중 소형 이식편으로 소정의 표적 조직내 1 이상의 부위에 투여할 수 있다. 본 발명의 세포는 이식 전에 완전히 분리되어, 예컨대 단일 세포의 현탁액을 형성하거나, 또는 이식 전에 거의 완전히 분리되어, 예컨대 세포의 소형 응집물을 형성할 수 있다. 세포는 이들을 소정의 조직 부위로 이식 또는 이동시키고, 기능적으로 결핍된 영역을 재구성 또는 재생하는 방식으로 투여할 수 있다.
치료학적으로 유효하게 달성하도록 투여할 수 있는 세포의 적당한 범위는 당업자의 통상의 지식 내에서 환자에 맞추어 적절히 사용할 수 있다.
그러나, 실제 투여량은 치료할 질환, 투여 경로, 환자의 연령, 성별 및 체중, 및 질환의 중증도 등의 여러 관련 인자에 비추어 결정되어야 하는 것으로 이해되어야 하며, 따라서, 상기 투여량은 어떠한 방법으로도 본 발명의 범위를 한정하는 것이 아니다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
[실시예 1]
마우스 배아줄기세포 분비 및 배양
본 발명에서는 마우스 배아줄기세포인 R1 세포를 ATCC (American Type Culture Collection; ATCC SCRC-1011)로부터 구입하여 사용하였으며, SIRT1 단백질의 발현 유무에 따라 배아줄기세포의 지방세포로 분화가 영향을 미치는지 확인하기 위해, SIRT1 유전자 발현되는 마우스 배아줄기세포(SIRT1 +/+; WT)인 대조군과 SIRT1 유전자가 결여된 마우스 배아줄기세포(SIRT1 -/-; KO)를 준비하였다 (Han　MK et al., Cell　Stem　Cell.,　Mar 6;2(3):241, 2008).
마우스배아줄기세포는 DMEM(Dulbeco's Modified Eagle's Medium) 배지에 2 mM GlutaMAX™(Gibco, 미국), 비필수 아미노산(1X Non-essential amino acid, 1X NEAA; Gibco, 미국), 0.1 mM 베타-메르캅토에탄올(β-mercaptoethanol; Invitrogen, 미국) 및 103 unit/㎖ 백혈병억제인자(Leukemia Inhibitory Factor, LIF; Milipore, 미국)를 넣어 배양하였다.
[실시예 2]
마우스 배아줄기세포의 지방세포로의 분화 유도
본 발명에서는 SIRT1 단백질의 발현 유무에 따라 배아줄기세포의 지방세포로 분화가 영향을 미치는지 확인하기 위해, 실시예 1에서 준비한 SIRT1 유전자 발현되는 마우스 배아줄기세포(SIRT1 +/+; WT) 및 SIRT1 유전자가 결여된 마우스 배아줄기세포(SIRT1 -/-; KO)의 지방세포로의 분화정도를 확인하였으며, SIRT1 +/+ 배아줄기세포에 SIRT1 억제제인 EX527(10μM, Tocris, 영국)을 처리하였을 때, SITRT1 억제에 따른 지방분화 정도를 확인하였다.
도 1에 나타낸 바와 같이 배아줄기세포에서 지방세포로 분화하기 위한 배양 프로토콜에 따라 실험을 수행하였으며, 먼저 현적배양(hanging-drop culture) 방법을 사용하여 배상체(embryoid body)를 형성한 후, 레티노산(Retinoic acid)을 처리하여 3일 동안 처리하였으며, 지방세포로의 분화를 유도하기 위한 배지에서 14일 동안 배양하였다. 상기 현적배양은 1000개의 배아줄기세포를 20 ㎕에 넣어 하나의 배상체를 만들었으며, 지방세포로 유도하는 과정은 6-웰 플레이트(6-well plate)를 사용하여 각 웰에 15개의 배양체를 접종하여 배양하였다.
상기 지방세포분화를 위한 배지는 DMEM 배지에 85nM 인슐린(insulin; sigma, 미국), 2nM 트리아이오딘티로닌(Triiodothyronine; sigma, 미국) 및 2μM로시글리타존(rosiglitazone; sigma, 미국)을 첨가하여 배상체(embryoid body)를 배양하였으며, 배기교환은 매일 수행하였다.
또한, SIRT1 억제제 EX527는 지방세포로의 분화 초반인 5일까지 SIRT1 +/+ 배아줄기세포에 첨가하여 배양하였다.
[실시예 3]
Oil Red O 염색법을 통한 배아줄기세포의 지방세로포의 분화 확인
실시예 2에서 21일 동안 분화시킨 마우스 배아줄기 세포는 지방세포로의 분화가 잘 이루어졌는지 확인하기 위하여 Oil Red O 염색을 수행하였다.
먼저, SIRT1 +/+ 세포와 SIRT1 -/- 세포, 그리고 SIRT1 +/+ 세포에 SIRT1 억제제를 처리하여 분화시킨 세포에 10% 포름알데하이드(formaldehyde)를 처리하여 세포를 고정시킨 다음, 포름알데하이드를 인산완충식염수로 3번 씻어낸 후, 60% 이소프로판올(isopropanol)을 처리하였다. 그 후, Oil Red O 염색액을 2 ㎖씩 넣고 상온에서 어두운 상태로 30분간 염색한 후 인산완충식염수로 3번 세척하였다.
염색이 된 세포는 현미경으로 관찰하였으며, 분화된 지방세포 내에 존재하는 지질방울(lipid drop)에 Oil Red O가 염색되어 염색 후 현미경을 이용하여 관찰하면 붉은색으로 염색된 지방세포를 확인할 수 있다.
관찰이 완료되면, 웰당 1 ㎖의 이소프로판올로 지방세포 내 염색된 염색약을 추출하여 ELISA reader로 500 ㎚에서 광학밀도값(OD값; optical density)을 측정하였다. 상기 Oil Red O 염색액은 Oil Red O 염색약(sigma, 미국) 500 ㎎을 이소프로판올 100 ㎖에 녹인 용액을 증류수와 6:4의 비율로 섞은 후 0.45 ㎛ 필터(filter)로 여과한 용액이다.
그 결과, 도 2A에 나타난 바와 같이, SIRT1 +/+ 세포는 배아줄기세포가 지방세포로 분화하여 세포 내 지질방울(lipid drop)가 많이 형성된 것을 확인한 반면, SIRT1 -/- 세포는 지방세포로의 분화가 거의 이루어지지 않은 것을 확인하였다. 또한, SIRT1 +/+ 세포에 SIRT1 억제제인 EX527를 처리한 경우, 부분적으로 지질방울이 관찰되었으나, SIRT1 +/+ 세포에 비해 현저하게 낮은 수준으로 지방세포의 분화유도가 이루어진 것을 확인하였다.
도 2B는 세포의 지질방울에 염색된 Oil red O 시료를 추출하여 500 nm에서 흡광도를 측정한 데이터로, SIRT1 -/- 세포는 SIRT1 +/+ 세포에 비해 지방세포로의 분화가 약 40% 정도 감소된 것을 확인하였으며, SIRT1 억제제인 EX527를 처리한 경우 약 38% 정도 지방세포의 분화가 감소된 것을 확인하였다.
[실시예 4]
SIRT1에 의한 지방세포로의 분화 조절 기전 확인
본 발명에서는 SIRT1에 의한 배아줄기세포의 지방세포로의 분화 조절 기전 확인하기 위해, 지방세포로 분화시키는 단계에서 지방세포 내 PPAR γ (peroxisome proliferator-activated receptors-γ), C/ EBP α (CCAAT/enhancer-binding protein-α), FABP4 (fatty acid binding protein 4)의 mRNA 발현량을 PCR 방법으로 측정하였다. PCR 수행에 사용한 각 프라이머는 하기 표 1과 같으며, 바이오니아(한국)에 의뢰하여 제조하였다. GAPDH는 PCR의 신뢰성을 위한 대조군으로 사용하였다.
프라이머 염기서열
프라이머 염기서열(5' -> 3') Tm(℃)
PPAR γ Forward TGTGAGACCAACAGCCTGAC 서열번호 2 60
Reverse AGCTGATTCCGAAGTTGGTG 서열번호 3
C/EBP α Forward TGGACAAGAACAGCAACGAG 서열번호 4 60
Reverse AAACCATCCTCTGGGTCTCC 서열번호 5
FABP4 Forward AATGTGTGATGCCTTTGTGG 서열번호 6 60
Reverse TCGACTTTCCATCCCACTTC 서열번호 7
GAPDH Forward AGGTCGGTGTGAACGGATTTG 서열번호 8 60
Reverse GGGGTCGTTGATGGCAACA 서열번호 9
실시예 2와 동일한 방법으로 배아줄기세포에서 지방세포로의 분화를 유도하였으며, 지방분화 유도 7일 및 10일에 각 세포를 수득(harvest)한 다음, TRIzol reagent(제조사)를 이용하여 total RNA를 추출하였다. 추출한 RNA는 cDNA 합성키트(roche, 독일)를 이용하여 cDNA를 합성한 후 표 1의 프라이머를 이용하여 PCR을 수행하였다.
그 결과, SIRT1 +/+ 세포에서는 지방세포로의 분화 유도 후, PPAR γ, C/EBP α 및 FABP4의 mRNA 발현이 증가한 것을 확인한 반면, SIRT1 -/- 세포 및 SIRT1 억제제인 EX527를 처리한 경우 PPAR γ, C/EBP α 및 FABP4의 mRNA 발현 현저히 감소하는 것을 확인하였다.
즉, SIRT1의 발현을 억제하면 배아줄기세포에서 지방세포로의 분화 시, 세포내 PPAR γ, C/EBP α 및 FABP4의 mRNA 발현이 감소되어 지방세포로의 분화가 감소되는 것을 확인하였으며, 이는 SIRT1의 발현을 증가시키면, 배아줄기세포의 지방세포로의 분화가 촉진된다는 것을 의미한다.
[실시예 5]
SIRT1 발현 억제 시기에 따른 지방세포로의 분화 정도 확인
본 발명에서는 SIRT1 발현 억제 시기에 따른 배아줄기세포에서 지방세포로의 분화에 미치는 영향을 확인하기 위해, SIRT1 억제제인 EX527 (10 μM)을 시기에 따라 처리하였다.
상기 실시예 2의 방법과 동일한 방법으로 배아줄기세포에서 지방세포로 분화를 유도하였으며, SIRT1 억제제는 분화 초반인 0 ~ 5일 동안 처리한 그룹, 분화 후반인 7 ~ 21일 동안 처리한 그룹 및 분화 전체 시기인 0 ~ 21일 동안 처리한 그룹으로 나누어 처리하였다. 그 후에 실시예 3과 동일한 방법으로 Oil Red O 염색을 수행하여 지방세포로의 분화 정도를 확인하였다.
그 결과, 도 4에 나타난 바와 같이, 분화 초반에만 SIRT1 억제제를 처리한 그룹은 억제제를 처리하지 않은 그룹에 비해 지방세포로의 분화가 감소하는 것을 확인할 수 있었다. 그러나 분화 전체 시기 동안 SIRT1 억제제를 처리한 그룹은 억제제를 처리하지 않은 그룹과 별반 차이가 없었고 분화 후반인 7-21일 동안 억제제를 처리한 그룹은 억제제를 처리하지 않은 그룹보다 지방세포로의 분화가 더 진행되는것을 확인하였다.
이는 SIRT1 발현 억제 시기에 따라 지방세포의 분화 억제 또는 촉진을 유도할 수 있는 것을 확인하였으며, 배아줄기세포로부터 형성된 배상체 배양 초기에 SIRT1 발현을 억제시키면 기존에 알려진 것과 달리 SIRT1 억제에 의해 지방세포로의 분화가 억제되는 것을 확인하였으며, 배상체의 지방세포로 분화유도 7 내지 21일 동안에 SIRT1 발현을 억제하면 지방세포로의 분화가 촉진되는 것을 확인하였다.
[실시예 6]
마우스 배아줄기세포의 신장전구세포로의 분화 유도
본 발명에서는 SIRT1 단백질의 발현 유무에 따라 배아줄기세포의 신장전구세포로 분화가 영향을 미치는지 확인하기 위해, 실시예 1에서 준비한 SIRT1 유전자 발현되는 마우스 배아줄기세포(SIRT1 +/+; WT) 및 SIRT1 유전자가 결여된 마우스 배아줄기세포(SIRT1 -/-; KO)의 신장전구세포로의 분화를 유도하였다.
도 5에 나타낸 바와 같이 배아줄기세포에서 신장전구세포로 분화하기 위한 배양 프로토콜에 따라 실험을 수행하였다. 백혈병 억제인자(Leukemia Inhibitory Factor, LIF; Milipore, 미국)를 제외한 세포 배양액에 레티노산(Retinoic acid) 100 nmol/L와 액티빈 A (Activin A) 10 ng/mL를 처리한 후에 신장전구세포인 Six2와 WT1의 mRNA 발현량 발현량을 측정하였다. 신장전구세포로 유도화는 과정은 6웰 플레이트 (6-well plate)를 사용하여 각 웰에 배아줄기세포를 접종하여 배양하였다.
상기 신장전구세포분화를 위한 배지는 DMEM(Dulbeco’Modified Eagle’Medium) 배지에 2 mM Gluta MAXTM(Gibco, 미국), 비필수 아미노산(1X Non-essential aminoacid, 1X NEAA; Gibco, 미국), 0.1 mM 베타-메르캅토에탄올(β-mercaptoethanol; Invitrogen, 미국) 및 1,000 unit/ml 백혈병 억제인자(Leukemia Inhibitory Factor, LIF; Milipore, 미국)를 넣어 배양하였다.
[실시예 7]
mRNA 발현량을 통한 배아줄기세포의 신장전구세포로의 분화 확인
SIRT1 단백질의 발현 유무에 따라 배아줄기세포의 신장전구세포로 분화를 확인하기 위해, 실시예 1에서 준비한 SIRT1 유전자 발현되는 마우스 배아줄기세포(SIRT1 +/+; WT) 및 SIRT1 유전자가 결여된 마우스 배아줄기세포(SIRT1 -/-; KO)의 신장전구세포로의 분화를 확인하였다. 분화는 신장전구세포 표시자인 Six2와 WT1의 mRNA 발현량을 통해 확인하였다.
신장전구세포로의 분화 단계에서 신장전구세포 표시자인 Six2와 WT1의 mRNA 발현량을 PCR 방법으로 측정하였다. PCR 수행에 사용한 각 프라이머는 하기 표 1과 같으며, 바이오니아(한국)에 의뢰하여 제조하였다. GAPDH는 PCR의 신뢰성을 위한 대조군으로 사용하였다.
프라이머 염기서열
프라이머 염기서열(5' ->3') Tm(℃)
Six2 Forward CAAGGAAAGGGAGAACAGCGA 서열번호 10 60
Reverse GCGTCTTCTCATCCTCGGAA 서열번호 11
WT1 Forward ATCCCAGGCAGGAAAGTGTG 서열번호 12 60
Reverse GTGCTGTCTTGGAAGTCGGA 서열번호 13
GAPDH Forward AGGTCGGTGTGAACGGATTTG 서열번호 14 60
Reverse GGGGTCGTTGATGGCAACA 서열번호 15
실시예 6과 동일한 방법으로 배아줄기세포에서 신장전구세포로의 분화를 유도하였으며, 분화 유도 11일에 각 세포를 수득(harvest)한 다음, TRIzol reagent (Life Technology, 미국)를 이용하여 total RNA를 추출하였다. 추출한 RNA는 cDNA 합성키트(Roche, 독일)를 이용하여 cDNA를 합성한 후 표 2의 프라이머를 이용하여 PCR을 수행하였다.
그 결과, 도 6에 나타난 바와 같이, SIRT1 -/- 세포에서는 신장전구세포로의 분화 유도 후, Six2 및 WT1의 mRNA 발현이 억제된 것을 확인한 반면, SIRT1 +/+ 세포에서는 Six2 및 WT1의 mRNA 발현 현저히 증가한 것을 확인하였다.
즉, SIRT1의 발현을 억제하면 배아줄기세포에서 신장전구세포로의 분화 시, 세포내 Six2 및 WT1의 mRNA 발현이 감소되어 신장전구세포로의 분화가 억제되는 것을 확인하였으며, 이는 SIRT1의 발현을 억제시키면, 배아줄기세포의 신장전구세포로의 분화가 억제된다는 것을 의미한다.
[실시예 8]
SIRT1억제와 활성화를 통한 배아줄기세포의 신장전구세포로의 분화 조절 확인
SIRT1 단백질의 발현 억제 또는 자극에 따라 배아줄기세포의 신장전구세포로 분화를 확인하기 위해, 실시예 1에서 준비한 SIRT1 유전자 발현되는 마우스 배아줄기세포(SIRT1 +/+; WT) 에서 신장전구세포로의 분화를 확인하였다. 분화는 신장전구세포 표시자인 Six2와 WT1의 단백질 발현량을 통해 확인하였다.
신장전구세포로의 분화 단계에서 신장전구세포 표시자인 Six2와 WT1의 mRNA발현량을 quantitative PCR으로 측정하였다.
그 결과, 도 7에 나타난 바와 같이, WT1 mRNA 발현량(A)과 Six2의 mRNA 발현량(B)이 SIRT1 억제제 투여시에 감소 발현됨을 알 수 있으며, SIRT1발현을 자극시키는 레스베라트롤 투여시에 Six2 와 WT1 mRNA 발현이 증가되고 있음을 알 수 있다. 이는 SIRT1 단백질의 발현이 증가된 상태에서 신장전구세포로의 분화가 촉진된다는 것을 의미한다.
[실시예 9]
SIRT1 발현 억제 시, 신장전구세포로의 분화 확인
SIRT1 단백질을 신장의 집합관 세포에서만 특이하게 억제하여 출생한지 1일째된 마우스 태아신장 (conditional knockout mouse: Sirt1 co/co; Hoxb7-Cre (+))에서 Six2와 WT1의 단백질 발현 변화를 관찰하였다.
Six2와 WT1의 단백질 발현 변화는 면역형광염색법을 통해 측정하였다. 면역화학염색을 실시하기 위해서 임신한 쥐의 신장이나 태생 0일의 쥐의 신장을 획득하여 4% paraformaldehyde으로 6시간 고정한 후에 10 mm의 두께로 잘라서 염색에 이용하였다. 항체는 Anti-Six2 (Abcam; ab68908, 켐브리지, 영국), Anti- WT1 (Abcam; 켐브리지, 영국) 상은 Zeiss Z1 microscope와 a Zeiss LSM 510 confocal microscope (칼자이스, 독일)을 사용하였다.
그 결과, 도 8 및 도 9에 나타난 바와 같이, SIRT1 단백질을 신장의 집합관 세포에서만 특이하게 억제한 그룹은 억제하지 않은 그룹에 비해 신장전구세포로의 분화가 감소된 것을 확인할 수 있었다. 이는 SIRT1이 결손되어 mRNA 또는 단백질이 발현되지 않을 때에도 신장전구세포로의 분화가 억제될 수 있음을 의미한다.

Claims (14)

  1. 배아줄기세포의 SIRT1(silent mating type information regulation 2 homolog; sirtuin 1) 발현을 억제하는 단계를 포함하는 배아줄기세포의 지방세포 또는 신장전구세포 분화 억제 방법.
  2. 제1항에 있어서, 배아줄기세포를 배양하여 형성시킨 배상체에 SIRT1 발현 억제제를 처리하여 지방세포 또는 신장전구세포로의 분화를 억제시키는 것을 특징으로 하는 배아줄기세포의 지방세포 또는 신장전구세포 분화 억제 방법.
  3. 제2항에 있어서, SIRT1 발현 억제제는 배상체 배양 초기인 0 내지 7일 동안 처리하는 것을 특징으로 하는 배아줄기세포의 지방세포 또는 신장전구세포 분화 억제 방법.
  4. 제2항에 있어서, 상기 SIRT1 발현 억제제는 서티놀(Sirtinol; 2-[(2-Hydroxynaphthalen-1-ylmethylene)amino]-N-(1-phenethyl)benzamide), Nicotinamide (pyridine-3-carboxamide) 및 EX527 (6-Chloro-2,3,4,9-tetrahydro-1H-Carbazole-1-carboxamide)로 이루어지는 군에서 선택되는 어느 하나인 것을 특징으로 하는 배아줄기세포의 지방세포 또는 신장전구세포 분화 억제 방법.
  5. 제1항에 있어서, 상기 SIRT1 발현 억제제로 인해 배아줄기세포의 PPAR-γ(peroxisome proliferator-activated receptors-γ), C/EBP α(CCAAT/enhancer-binding protein-α), FABP4(fatty acid binding protein 4), SIX2 (sine oculis homeobox homolog 2) 및 WT1 (Wilms tumor 1)의 mRNA 발현량이 감소하는 것을 특징으로 하는 배아줄기세포의 지방세포 또는 신장전구세포 분화 억제 방법.
  6. (a) 배아줄기세포를 배양하여 배상체(embryoid body)를 형성시키는 단계; 및
    (b) SIRT1 발현 억제제가 포함된 배지에서 상기 배상체를 배양하여 지방세포로 분화를 유도하는 단계;
    를 포함하는 것을 특징으로 하는 배아줄기세포의 지방세포 분화 촉진 방법.
  7. 제6항에 있어서, 상기 (b) 단계에서 SIRT1 발현 억제제는 분화유도 7 내지 21일 동안 처리하는 것을 특징으로 하는 배아줄기세포의 지방세포 분화 촉진 방법.
  8. 제6항에 있어서, 상기 SIRT1 발현 억제제는 서티놀 (Sirtinol; 2-[(2-Hydroxynaphthalen-1-ylmethylene)amino]-N-(1-phenethyl)benzamide), Nicotinamide (pyridine-3-carboxamide) 및 EX527 (6-Chloro-2,3,4,9-tetrahydro-1H-Carbazole-1-carboxamide)로 이루어지는 군에서 선택되는 어느 하나인 것을 특징으로 하는 배아줄기세포의 지방세포 분화 촉진 방법.
  9. 제1항에 있어서, 상기 (b) 단계의 배지는 지방세포 분화 유도용 배지이며, 인슐린(insulin), 트리아이오딘티로닌(Triiodothyronine) 및 로시글리타존(rosiglitazone)로 구성된 군에서 선택되는 1종 이상의 물질을 포함하는 것을 특징으로 하는 배아줄기세포의 지방세포 분화 촉진 방법.
  10. 배아줄기세포에 SIRT1 발현 촉진제를 처리하여 신장전구세포로의 분화를 촉진시키는 것을 특징으로 하는 배아줄기세포의 신장전구세포 분화 촉진 방법.
  11. 제10항에 있어서, 상기 SIRT1 발현 촉진제는 인터페론 베타-1a(interferon beta-1a), 인터페론 베타-1b(interferon beta-1b), cGMP(cyclic guanosine monophosphate), 아디포넥틴(adiponectin), 피루베이트(pyruvate), 2-데옥시글루코오스(2-deoxyglucose), SRT1270, 아데노바이러스, 렌티바이러스, BML-278, 및 레스베라트롤(resveratrol)로 이루어지는 군에서 선택되는 어느 하나 이상인 것을 특징으로 하는 배아줄기세포의 신장전구세포 분화 촉진 방법.
  12. 제10항에 있어서, 상기 SIRT1 발현 촉진제는 분화유도 1 내지 21일 동안 처리하는 것을 특징으로 하는 배아줄기세포의 신장전구세포 분화 촉진 방법.
  13. 제10항 내지 제12항 중 어느 한 항의 방법에 의해 제조된 신장전구세포를 함유하는 신장기능 회복제 또는 치료제.
  14. 제10항 내지 제12항 중 어느 한 항의 방법에 의해 제조된 신장전구세포로부터 유래된 신장세포.
PCT/KR2016/000721 2015-01-26 2016-01-22 Sirt1 발현 조절을 통한 배아줄기세포로부터 지방세포 또는 신장전구세포로의 분화 조절 방법 WO2016122166A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/546,634 US10662407B2 (en) 2015-01-26 2016-01-22 Method for controlling differentiation of embryonic stem cells into adipocytes or kidney precursor cells by regulating SIRT1 expression

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
KR10-2015-0012049 2015-01-26
KR1020150012049A KR101672785B1 (ko) 2015-01-26 2015-01-26 Sirt1 발현 조절을 통한 배아줄기세포로부터 지방세포로의 분화 조절 방법
KR20150089783 2015-06-24
KR10-2015-0089783 2015-06-24
KR10-2016-0007611 2016-01-21
KR1020160007611A KR101853477B1 (ko) 2015-06-24 2016-01-21 Sirt1 발현 조절을 통한 배아줄기세포로부터 신장전구세포로의 분화 조절 방법

Publications (1)

Publication Number Publication Date
WO2016122166A1 true WO2016122166A1 (ko) 2016-08-04

Family

ID=56543716

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/000721 WO2016122166A1 (ko) 2015-01-26 2016-01-22 Sirt1 발현 조절을 통한 배아줄기세포로부터 지방세포 또는 신장전구세포로의 분화 조절 방법

Country Status (1)

Country Link
WO (1) WO2016122166A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110218229A1 (en) * 2003-07-03 2011-09-08 Guarente Leonard P SIRT1 Modulation of Adipogenesis and Adipose Function
KR20120128451A (ko) * 2011-05-17 2012-11-27 전북대학교산학협력단 줄기세포의 염색체 이상 억제 방법 및 이를 이용한 줄기세포 분화 후 암화 억제 방법
US20130302290A1 (en) * 2009-10-02 2013-11-14 Baxter Healthcare Sa Methods for treating a kidney injury

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110218229A1 (en) * 2003-07-03 2011-09-08 Guarente Leonard P SIRT1 Modulation of Adipogenesis and Adipose Function
US20130302290A1 (en) * 2009-10-02 2013-11-14 Baxter Healthcare Sa Methods for treating a kidney injury
KR20120128451A (ko) * 2011-05-17 2012-11-27 전북대학교산학협력단 줄기세포의 염색체 이상 억제 방법 및 이를 이용한 줄기세포 분화 후 암화 억제 방법

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
FAN, HONG ET AL.: "The Histone Deacetylase, SIRT1, contributes to the Resistance of Young Mice to Ischamia/regerfusion-induced Acute Kidney Injury", KIDNEY INTERNATIONAL, vol. 83, no. 3, 2013, pages 404 - 413 *
KONG, LILI ET AL.: "Sirtuin 1: A Target for Kidney Diseases", MOLECULAR MEDICINE, vol. 21, no. 1, 12 January 2015 (2015-01-12), pages 87 - 97 *
SAUNDERS, LAURA R. ET AL.: "miRNAs regulate SIRT1 Expression during Mouse Em- bryonic Stem Cell Differentiation and in Adult Mouse Tissues", AGING, vol. 2, no. 7, 2010, pages 415 - 431 *
SRIVASTAVA, SWATI ET AL.: "Synergistic Actions of Insulin-sensitive and Sirtl mediated Pathways in the Differentiation of Mouse Embryonic Stem Cells to Osteoblast", MOLECULAR AND CELLULAR ENDOCRINOLOGY, vol. 361, no. 1-2, 2012, pages 153 - 164 *

Similar Documents

Publication Publication Date Title
US20020151460A1 (en) Regulation of epithelial tissue by hedgehog-like polypeptides, and formulations and uses related thereto
WO2016048107A1 (ko) 인터페론-감마 또는 인터류킨-1베타를 처리한 줄기세포 또는 그 배양물을 포함하는 면역질환 또는 염증질환의 예방 또는 치료용 약학조성물
WO2011056017A2 (ko) 모낭 줄기세포의 대량 증식 방법
WO2019050071A1 (ko) 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물
US20160068805A1 (en) Method to expand and transduce cultured human small and large intestinal stem cells
WO2019198995A1 (ko) 엑소좀 기반의 면역세포의 교차분화 방법
Batista et al. Impairment of the immune system in GH-overexpressing transgenic zebrafish (Danio rerio)
JP2023116525A (ja) 網膜細胞への線維芽細胞の再プログラミング方法
WO2018155913A1 (ko) 저분자 화합물을 이용한 골격근육세포 분화 방법
WO2016122166A1 (ko) Sirt1 발현 조절을 통한 배아줄기세포로부터 지방세포 또는 신장전구세포로의 분화 조절 방법
WO2021141452A1 (ko) 인슐린 생산세포로의 분화 유도용 조성물 및 이의 이용
CN113015537A (zh) 用于增殖产生胰岛素的胰岛细胞的组合物和方法及其治疗用途
WO2022245138A1 (ko) 기능강화 줄기세포를 포함하는 아토피 피부염 예방 또는 치료용 조성물
WO2022065859A1 (ko) 마이크로 rna를 이용하여 체세포로부터 췌장 베타세포를 직접 분화시키는 방법 및 분화 조성물
WO2019190175A9 (ko) 편도 유래 중간엽 줄기세포로부터 운동신경세포의 분화방법
WO2021125844A1 (ko) 인간 만능 줄기세포로부터 제작된 3d 오가노이드를 해체하여 희소돌기아교세포를 다량 확보하는 분화방법
US20070274971A1 (en) Method of Proliferating Precursor Cells
WO2020130431A1 (ko) 클로날 줄기세포를 포함하는 이식편대숙주질환 치료용 약학적 조성물
WO2020122498A1 (ko) 클로날 줄기세포를 포함하는 췌장염 치료용 약학적 조성물
WO2020149538A1 (ko) 클로날 줄기세포를 포함하는 아토피 피부염 예방 또는 치료용 약학적 조성물
US10662407B2 (en) Method for controlling differentiation of embryonic stem cells into adipocytes or kidney precursor cells by regulating SIRT1 expression
WO2013125899A1 (ko) 줄기세포를 유효 성분으로 함유하는 면역 질환 또는 염증 질환의 예방 또는 치료용 조성물
WO2023106615A1 (ko) 전분화능 줄기세포 기반 혈관성 인지장애 및 치매 예방 또는 치료용 조성물
WO2024039236A1 (ko) 엑소좀을 이용한 생식세포 내 물질 전달 및 유전자 편집 시스템
WO2024014721A1 (ko) 줄기세포 유래 엑소좀을 포함하는 항암 조성물 및 이의 제조방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16743644

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 15546634

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 16743644

Country of ref document: EP

Kind code of ref document: A1