WO2022065859A1 - 마이크로 rna를 이용하여 체세포로부터 췌장 베타세포를 직접 분화시키는 방법 및 분화 조성물 - Google Patents

마이크로 rna를 이용하여 체세포로부터 췌장 베타세포를 직접 분화시키는 방법 및 분화 조성물 Download PDF

Info

Publication number
WO2022065859A1
WO2022065859A1 PCT/KR2021/012922 KR2021012922W WO2022065859A1 WO 2022065859 A1 WO2022065859 A1 WO 2022065859A1 KR 2021012922 W KR2021012922 W KR 2021012922W WO 2022065859 A1 WO2022065859 A1 WO 2022065859A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
cells
composition
group
pancreatic
Prior art date
Application number
PCT/KR2021/012922
Other languages
English (en)
French (fr)
Inventor
김경규
Original Assignee
성균관대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020210102649A external-priority patent/KR20220040982A/ko
Application filed by 성균관대학교산학협력단 filed Critical 성균관대학교산학협력단
Priority to US18/246,663 priority Critical patent/US20230364153A1/en
Publication of WO2022065859A1 publication Critical patent/WO2022065859A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/37—Digestive system
    • A61K35/39—Pancreas; Islets of Langerhans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0676—Pancreatic cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C12N2500/38—Vitamins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/16—Activin; Inhibin; Mullerian inhibiting substance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/40—Regulators of development
    • C12N2501/41—Hedgehog proteins; Cyclopamine (inhibitor)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/65—MicroRNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/70—Enzymes
    • C12N2501/72—Transferases (EC 2.)
    • C12N2501/727—Kinases (EC 2.7.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/13—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells
    • C12N2506/1307—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from adult fibroblasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/22—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from pancreatic cells

Definitions

  • the present invention relates to a method and a differentiation composition for directly differentiating pancreatic beta cells from somatic cells, and more specifically, to a method and a differentiation composition comprising at least one selected from the group consisting of micro RNA (miRNA) miR-127 and miR-709 as an active ingredient,
  • miRNA micro RNA
  • the present invention relates to a composition for inducing direct differentiation of somatic cells into pancreatic beta cells, and a method for direct differentiation of pancreatic beta cells using the same.
  • glucose toxicity causes apoptosis of ⁇ -cells and affects various organ systems, including the pancreas.
  • the underlying mechanism is not fully known.
  • Disorder of ⁇ -cells and impaired insulin production are typical features of diabetes, but the exact molecular mechanism of glucose toxicity that causes ⁇ -cell apoptosis is still unknown despite the rapid spread of diabetes.
  • pancreatic beta cells In particular, in diseases such as type 1 diabetes mellitus and pancreatic cancer, malfunction is induced by damage or loss of beta cells, so the transplantation method of pancreatic beta cells is the only treatment.
  • pancreatic beta cells derived from induced pluripotent stem cells may have immune rejection reactions because they use other people's cells, and there may be stability problems due to the cancer-causing potential of stem cells.
  • a direct differentiation method that converts one's own somatic cells into pancreatic beta cells is in the spotlight.
  • Methods for converting somatic cells into pancreatic beta cells include a method of forcibly expressing the marker gene of beta cells and a method of using a low molecular weight substance.
  • pancreatic beta cells Conventionally, the period required to convert into pancreatic beta cells is 27 days or more, and there is a disadvantage that the production period of pancreatic beta cells is long, and it is necessary to shorten it (Cell Stem Cell. 2014 Feb 6; 14 (Cell Stem Cell. 2014 Feb 6; 14 (Cell Stem Cell. 2014 Feb 6; 14 (Cell Stem Cell. 2):228-36.doi:10.1016/j.stem.2014.01.006.)).
  • the present inventors have developed a technology for effectively converting somatic cells into pancreatic beta cells in a short time by treating somatic cells with microRNA alone or together with a low molecular weight substance.
  • the present invention has been devised to solve the problems in the prior art as described above, and the present inventors have made diligent efforts to find a method for directly changing a somatic cell into a pancreatic beta cell.
  • the microRNA of the present invention alone; or histone methyltransferase inhibitors, retinoic acid agonists, ALK-5 kinase inhibitors, hedgehog inhibitors, MAPK inhibitors, calcium channel agonist, GLP receptor agonist, supplement; And by confirming that the composition containing micro RNA can be treated to induce conversion of somatic cells into pancreatic beta cells, the present invention has been completed.
  • compositions for inducing direct differentiation of somatic cells into pancreatic beta cells comprising one or more miRNAs selected from the group consisting of miR-127 and miR-709.
  • Another object of the present invention is a MAPK inhibitor (MAPK inhibitor), calcium channel agonist, GLP receptor agonist, supplement; and culturing somatic cells in the presence of a composition comprising; and one or more miRNAs selected from the group consisting of miR-127 and miR-709.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating diabetes or pancreatic cancer comprising one or more miRNAs selected from the group consisting of miR-127 and miR-709 as an active ingredient.
  • Another object of the present invention is diabetes or pancreatic cancer, comprising mixing the pancreatic beta cells induced by direct differentiation by the method with at least one selected from the group consisting of pharmaceutically acceptable pharmaceutically acceptable carriers and excipients.
  • An object of the present invention is to provide a method for manufacturing a therapeutic cell therapy product.
  • Another object of the present invention is to deliver a composition comprising one or more miRNAs selected from the group consisting of miR-127 and miR-709 as an active ingredient in vivo to induce direct differentiation of somatic cells into beta cells in vivo. It is to provide a method for preventing or treating diabetes or pancreatic cancer, including.
  • the present invention provides a composition for inducing direct differentiation of somatic cells into pancreatic beta cells, comprising micro RNA or a low molecular weight substance as an active ingredient.
  • the present invention provides a composition for inducing direct differentiation of somatic cells into pancreatic beta cells comprising one or more miRNAs selected from the group consisting of miR-127 and miR-709.
  • the somatic cell may be one or more selected from the group consisting of fibroblasts, pancreatic duct cells, and exocrine cells, but is not limited thereto.
  • the composition may further include miR-19b, but is not limited thereto.
  • the composition comprises a histone methyltransferase inhibitor, a retinoic acid agonist, an ALK-5 kinase inhibitor, a hedgehog inhibitor ( hedgehog inhibitor), MAPK inhibitor (MAPK inhibitor), calcium channel agonist, GLP receptor agonist, and may further include one or more low molecular weight substances selected from the group consisting of supplements, but is not limited thereto.
  • the histone methyltransferase inhibitor is BIX01294 (2-(Hexahydro-4-methyl-1H-1,4-diazepin-1-yl)-6,7-dimethoxy-N-[1 -(phenylmethyl)-4-piperidinyl]-4-quinazolinamine), decitabine (5-aza-2'-deoxycytidine, DAC), zebularine, 3'-deazaneplanosine A hydrochloride ( 3'-Deazaneplanocin A hydrochloride), Lomeguatrib, and Chaetocin (Chaetocin, 2,2',3S,3'S,5aR,5'aR,6,6'-octahydro-3,3'- bis(hydroxymethyl)-2,2'-dimethyl-[10bR,10'bR(11aS,11'aS)-bi-3,11a-epidithio-11aH-pyr
  • the supplement may be one or more selected from the group consisting of 2-phospho-L-ascorbic acid, B27, laminin, nicotinamide, and N2, but is not limited thereto.
  • the retinoic acid agonist may be one or more selected from the group consisting of TTNPB, phytanic acid, and retinoic acid, but is not limited thereto.
  • the hedgehog inhibitor is cyclopamine, mifepristone, GDC-0449 (Vismodegib), XL139 (BMS-833923), IPI926, IPI609 (IPI269609), LDE225, gerbin.
  • GANT61, permorphamine, SAG, SANT-2, tomatidine, SANT74, SANT75 may be at least one selected from the group consisting of gerumbon and derivatives thereof, but is not limited thereto.
  • the MAPK inhibitor is 1-Pyridinyl-2-phenylazole, SB 203580, SKF 86002, SKF 86096, SKF 104351, 1-Aryl-2-pyridinyl/pyrimidinyl heterocycles, SB 242235, RO-32001195 , SX-011, and may be at least one selected from the group consisting of BIRB-796, but is not limited thereto.
  • the ALK-5 kinase inhibitor is RepSox (1,5-Naphthyridine, 2-[3-(6-methyl-2-pyridinyl)-1H-pyrazol-4-yl]); SB525334 (6-(2-tert-butyl-4-(6-methylpyridin-2-yl)-1H-imidazol-5-yl)quinoxaline); GW788388 (4-(4-(3)-(pyridin-2-yl)-1H-pyrazol-4-yl)pyridin-2-yl)-N-(tetrahydro-2H-pyran-4-yl)benzamide); SD-208 (2-(5-chloro-2-fluorophenyl)-N-(pyridin-4-yl)pteridin-4-amine); Galunisertib (LY2157299, 4-(2-(6-methylpyridin-2-yl)-5,6-dihydro-4H-pyrrolo[1,2-
  • the calcium channel agonist may be one or more selected from the group consisting of Bay K-8644, FPL 64179, and CGP28392, but is not limited thereto.
  • the GLP receptor agonist is exendin-4, dulaglutide, exenatide, semaglutide, liraglutide, lixise It may be one or more selected from the group consisting of natide (Lixisenatide), and albiglutide (Albiglutide), but is not limited thereto.
  • the present invention provides a MAPK inhibitor, a calcium channel agonist, a GLP receptor agonist, a supplement; and culturing somatic cells in the presence of a composition comprising; and at least one miRNA selected from the group consisting of miR-127 and miR-709.
  • the method comprises the steps of (1) inducing somatic cells into pancreatic endoderm cells; (2) inducing pancreatic endoderm cells into pancreatic progenitor cells; and (3) inducing pancreatic progenitor cells into pancreatic beta cells, or may consist of the above steps, but is not limited thereto.
  • the method may include or consist of (3) inducing pancreatic progenitor cells into pancreatic beta cells, but is not limited thereto.
  • somatic cells of the method are fibroblasts
  • differentiation through three steps is required, but when the somatic cells are pancreatic duct cells and exocrine cells having the properties of pancreatic progenitor cells, the presence of the composition can be directly differentiated from somatic cells into pancreatic beta cells.
  • the direct differentiation method may include, but is not limited to, the following steps:
  • histone methyltransferase inhibitors activin A, supplement; and at least one miRNA selected from the group consisting of miR-127 and miR-709; inducing somatic cells into pancreatic endoderm cells in the presence of a composition comprising;
  • retinoic acid agonists retinoic acid agonists, ALK-5 kinase inhibitors, hedgehog inhibitors, supplements; and at least one miRNA selected from the group consisting of miR-127 and miR-709; inducing pancreatic endoderm cells into pancreatic progenitor cells in the presence of a composition comprising; and
  • MAPK inhibitors calcium channel agonists, GLP receptor agonists, supplements; And at least one miRNA selected from the group consisting of miR-127 and miR-709; culturing somatic cells in the presence of a composition comprising a.
  • the present invention provides a pharmaceutical composition for preventing or treating diabetes or pancreatic cancer comprising at least one miRNA selected from the group consisting of miR-127 and miR-709 as an active ingredient.
  • the diabetes may be selected from the group consisting of type 1 diabetes, type 2 diabetes, and gestational diabetes, but is not limited thereto.
  • the present invention provides a cell therapy agent for the treatment of diabetes or pancreatic cancer, comprising mixing the pancreatic beta cells induced by direct differentiation by the direct differentiation method with at least one selected from the group consisting of pharmaceutically acceptable carriers and excipients.
  • a method of manufacturing is provided.
  • the present invention provides a cell therapeutic agent for the treatment of diabetes or pancreatic cancer, comprising as an active ingredient pancreatic beta cells induced by direct differentiation by the direct differentiation method.
  • the present invention includes the step of inducing direct differentiation of somatic cells into beta cells in vivo by delivering a composition comprising one or more miRNAs selected from the group consisting of miR-127 and miR-709 in vivo, diabetes or A method for preventing or treating pancreatic cancer is provided.
  • the present invention provides one or more miRNAs selected from the group consisting of miR-127 and miR-709; Or, it provides a method for preventing or treating diabetes or pancreatic cancer, comprising administering to an individual in need thereof a pharmaceutical composition comprising the pancreatic beta cells induced by direct differentiation by the above method as an active ingredient.
  • the present invention provides one or more miRNAs selected from the group consisting of miR-127 and miR-709; Or it provides a use for preventing or treating diabetes or pancreatic cancer of a pharmaceutical composition comprising as an active ingredient the pancreatic beta cells induced by direct differentiation by the method.
  • the present invention provides one or more miRNAs selected from the group consisting of miR-127 and miR-709; Or it provides a use for preparing a medicament for the treatment of diabetes or pancreatic cancer of pancreatic beta cells induced by direct differentiation by the method.
  • the present invention provides a use of a composition comprising one or more miRNAs selected from the group consisting of miR-127 and miR-709 to induce direct differentiation of somatic cells into pancreatic beta cells.
  • the present invention provides a kit for inducing direct differentiation of somatic cells into pancreatic beta cells, comprising a composition comprising one or more miRNAs selected from the group consisting of miR-127 and miR-709.
  • the present invention relates to a method for direct differentiation (reprogramming) of somatic cells into pancreatic beta cells using micro RNA and low molecular weight substances.
  • the expression level of PDX1 in pancreatic beta cells was significantly increased, and it was confirmed that when similar pancreatic beta cells were induced in this way, they were directly differentiated with a very high yield.
  • the present invention uses autologous cells when transplanting converted pancreatic beta cells into diabetic or pancreatic cancer patients, it has the advantage that the possibility of cancer occurrence is low without causing immune rejection, so it will be usefully used for the development of safer cell therapy products. It is expected.
  • the pancreatic beta cells produced by the present invention are expected to be usefully used as a cell composition for preventing, treating and improving diabetes or pancreatic cancer.
  • FIG. 1A is a diagram of a method for converting a somatic cell into a beta cell using a low-molecular substance
  • FIG. 1B shows a method in which microRNA is additionally added to the conversion condition using a low-molecular substance
  • FIG. 1C is a conversion using a low-molecular substance It is a diagram showing the overexpression of beta cell markers Pdx1 and Ins-2 in the beta cells.
  • 2A to 2E show the expression of major beta cell markers in the stage of differentiating fibroblasts into ⁇ -cell-like cells. *P ⁇ 0.05, **P ⁇ 0.01 and ***P ⁇ 0.001. Statistical significance was determined by a two-way, paired Student's t-test. Data shown represent mean ⁇ SEM from three independent experiments.
  • Figure 2a shows the results of comparison of Pdx1 gene expression in stage 1 cells after treatment with various types of miRNA.
  • Figure 2b shows the effect of Pdx1 expression induction according to the combination of different concentrations of miR-127 and miR-709 in stage 1 cells.
  • Figure 2c shows Ngn3 transcript levels in stage 1 cells after miR-127 and miR-709 transfection with Combination-3.
  • Figure 2d shows the results of confirming the pancreatic gene expression profile of the second stage cells transfected with miR-127 and miR-709 (combination-3) by qRT-PCR.
  • Figure 2e shows the results of confirming the pancreatic ⁇ -cell marker by qRT-PCR in stage 3 cells transfected with miR-127 and miR-709 (combination-3).
  • 3a to 3c confirm the proliferative ability of mouse embryonic fibroblasts (MEF) following transfection of a miRNA mimic and miRNA (miR-127, miR-709, and miR-19b) combinations of the present invention.
  • Figure 3a shows the results of transfection of 5' FAM-labeled control mimics to optimize transfection efficiency in fibroblasts.
  • Brightfield microscopy images (left) and fluorescence microscopy images (right) are shown after transfection in step 1 medium for 48 hours.
  • Scale bar 100 ⁇ m.
  • 3B shows the effect of inducing Pdx1 expression according to various concentration combinations of miR-127, miR-709 and miR-19b in the first-stage medium using qRT-PCR analysis.
  • Statistical significance was determined by a two-way, paired Student's t-test. Data shown represent mean ⁇ SEM from three independent experiments.
  • Fig. 3c shows the morphological changes of MEFs according to different combinations of treatments in stage 1 of differentiation (after 48 hours) in bright field microscopy images.
  • Scale bar 100 ⁇ m.
  • 4A and 4B show the expression of pancreatic beta-cell-related markers in acinar cells 266-6, a type of exocrine cells, following transfection of a miRNA mimic and miRNA (miR-127, and miR-709) combinations of the present invention. it has been confirmed
  • Figure 4a shows the results of optimization of transfection of 266-6 cells in the step 3 medium, and shows bright field microscopy images (left) and fluorescence microscopy images (right) after transfection in the step 3 medium for 48 hours.
  • Figure 4b shows the transcription levels of Pdx1, Ngn3, Insulin-1, Insulin-2, and Elastase after transfecting 266-6 cells with miR-127 + miR-709 (combination-3).
  • Combination-3 reduced the expression of Elastase, an acinar cell marker.
  • Statistical significance was determined by a two-way, paired Student's t-test. Data shown represent mean ⁇ SEM from three independent experiments.
  • FIG. 5 shows the expression of pancreatic beta-cell gene expression in human pancreatic duct cells Capan-1 cells according to the combination of miR-127 and three-stage small-molecular substances.
  • SB203580 MAP kinase inhibitor
  • nicotinamide asdjuvant
  • Exendin-4 GLP receptor agonist
  • Bay K-8644 calcium channel agonist
  • the present inventors confirmed that direct differentiation into pancreatic beta cells was significantly better when micro RNA and small molecule were used in combination, compared to when micro RNA or small molecule alone was used, compared to the control group that was not treated with micro RNA alone or small molecule alone
  • the present invention provides a composition for inducing direct differentiation of somatic cells into pancreatic beta cells, comprising a specific microRNA as an active ingredient, and more specifically, at least one selected from the group consisting of miR-127 and miR-709 It relates to a composition for inducing direct differentiation of somatic cells into pancreatic beta cells containing miRNA.
  • micro RNA is a small noncoding RNA (small noncoding RNA) of ⁇ 22 nucleotides in length that serves as a negative regulator of gene expression by inhibiting mRNA translation or promoting mRNA degradation. .
  • “miR-709” may include or consist of the nucleotide sequence shown in SEQ ID NO: 2, but is not limited thereto.
  • “miR-19b” may include or consist of the nucleotide sequence represented by SEQ ID NO: 5, but is not limited thereto.
  • miR-127 and miR-709 may be included in a molar concentration (M) ratio of 0.1 to 10: 1, 1-3: 1, 1:1 to 3, or 1:1, but is limited thereto. it is not going to be
  • miR-127, miR-709, and miR-19b have a molar concentration (M) ratio of 0.1 to 10: 0.1 to 10: 1, and a molar concentration (M) of 1-3: 1-3: ) ratio, or 1:1 molarity (M) ratio of 1: 1 may be included, but is not limited thereto.
  • the type of the starting somatic cells is not particularly limited, and any somatic cells may be used.
  • any somatic cells may be used.
  • in addition to the somatic cells of the embryonic period mature somatic cells may be used.
  • somatic cells isolated from a patient for example, somatic cells involved in disease or somatic cells involved in disease treatment may be used.
  • the somatic cell of the present invention may be a human pancreas-derived cell, but is not limited thereto.
  • the somatic cells may be fibroblasts, pancreatic duct cells, or exocrine cells, and in the present invention, somatic cells are all derived from animals such as humans, mice, horses, sheep, pigs, goats, camels, antelopes, and dogs. contains somatic cells.
  • pancreatic beta cells may be used interchangeably with “pancreatic beta-cell-like cells”, which are cells constituting the islets of Langerhans in the pancreas, and are cells that produce and secrete insulin. If there is a problem with the beta cells of the pancreas, there is a problem with the production of insulin, which can lead to diabetes. Therefore, such cells can be used for the treatment of diabetes caused by a problem in pancreatic insulin secretion.
  • pancreatic progenitor cell refers to an endoderm cell capable of differentiating into a pancreatic endocrine cell and a pancreatic exocrine cell, and in the present invention, differentiation can be induced into a pancreatic beta cell.
  • pancreatic beta cells it was confirmed that the directly differentiated pancreatic beta cells by treating somatic cells with microRNA and low molecular weight substances high-expressed pancreatic-specific gene markers PDX1, Ngn3, Ins-1, and Ins-2.
  • composition may further include miR-19b, but is not limited thereto.
  • the composition is a histone methyltransferase inhibitor (histone methyltransferase inhibitor), retinoic acid agonist (retinoic acid agonist), ALK-5 kinase inhibitor (ALK-5 kinase inhibitor), hedgehog inhibitor (hedgehog inhibitor), MAPK Inhibitors (MAPK inhibitors), calcium channel agonists, GLP receptor agonists, and may further include one or more low molecular weight substances selected from the group consisting of supplements, but is not limited thereto.
  • histone methyltransferase inhibitor histone methyltransferase inhibitor
  • retinoic acid agonist retinoic acid agonist
  • ALK-5 kinase inhibitor ALK-5 kinase inhibitor
  • hedgehog inhibitor hedgehog inhibitor
  • MAPK Inhibitors MAPK Inhibitors
  • calcium channel agonists GLP receptor agonists
  • GLP receptor agonists may further include one or more low molecular weight substances selected from the group consisting of supplements, but is not limited thereto.
  • composition when the composition includes a histone methyltransferase inhibitor, it may be for inducing differentiation of somatic cells into pancreatic endoderm cells, but is not limited thereto.
  • the pancreas of somatic cells or pancreatic endoderm cells may be for inducing differentiation into progenitor cells, but is not limited thereto.
  • the composition when the composition includes a MAPK inhibitor, a calcium channel agonist, and a GLP receptor agonist, it may be for inducing the maturation of pancreatic beta cells, but is not limited thereto.
  • the term “maturation” refers to conversion of cells induced into pancreatic beta cells into beta cells having more perfect activity.
  • histone methyltransferase inhibitor refers to an enzyme that catalyzes the transfer of a methyl group from a donor to a recipient.
  • the histone methyltransferase inhibitor that can be used herein is BIX01294 (2-(Hexahydro-4-methyl-1H-1,4-diazepin-1-yl)-6,7-dimethoxy-N-[1-(phenylmethyl)- 4-piperidinyl]-4-quinazolinamine), decitabine (5-aza-2'-deoxycytidine, DAC), zebularine, 3'-deazaneplanocin A hydrochloride (3'-Deazaneplanocin A) hydrochloride), lomeguatrib, and chaetocin (2,2',3S,3'S,5aR,5'aR,6,6'-octahydro-3,3'-bis(hydroxymethyl)- 2,2'-dimethyl
  • retinoic acid agonist may be preferably a retinoic acid receptor agonist (RAR agonist), TTNPB (4-[(E)-2-(5,6,7) group consisting of ,8-Tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl]benzoic acid, Arotinoid acid), phytanic acid, and retinoic acid (RA) It may be one or more selected from, but is not limited thereto.
  • RAR agonist retinoic acid receptor agonist
  • TTNPB 4-[(E)-2-(5,6,7) group consisting of ,8-Tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl]benzoic acid
  • Arotinoid acid phytanic acid
  • RA retinoic acid
  • the RAR receptor activates transcription by binding to a DNA sequence element known as the RAR response element (RARE) in the form of a heterodimer with the retinoid X receptor (known as RXR).
  • RARE RAR response element
  • RXR retinoid X receptor
  • the prior art includes a number of compounds that are RAR type receptor ligands. Among the prior art documents, examples that may be mentioned include the patent US 6150413, which describes triaromatic compounds, US 6214878, which describes stilbene compounds, or the patent US 6218128, which describes a group of bicyclic or tricyclic molecules do.
  • the medium of the present invention contains a retinoic acid agonist from 0.01 nM to 30 nM, 0.01 nM to 20 nM, 0.01 nM to 10 nM, 0.1 nM to 30 nM, 0.01 nM to 20 nM, 0.01 nM to 10 nM, 0.1 nM to 8 nM, 0.1 nM to 6 nM, 0.1 nM to 3 nM, 0.1 nM to 2 nM, 0.1 nM to 1 nM, 0.1 nM to 0.8 nM, 0.1 nM to 0.7 nM, 0.3 nM to 1 nM, 0.3 nM to 0.7 nM, Or it may contain about 0.5 nM, but is not limited thereto.
  • ALK-5 kinase inhibitor refers to a substance that binds to the TGF- ⁇ type I receptor and interferes with the normal signaling process of TGF- ⁇ I
  • TGF- ⁇ type Transforming growth factor- ⁇ type I Transforming growth factor- ⁇ type I is a multifunctional peptide that has various actions on cell proliferation, differentiation, and various types of cells. It plays a pivotal role in tissue growth and differentiation.
  • the ALK-5 kinase inhibitor (TGF- ⁇ type I receptor inhibitor) is RepSox(1,5-Naphthyridine, 2-[3-(6-methyl-2-pyridinyl)-1H-pyrazol-4-yl]); SB525334 (6-(2-tert-butyl-4-(6-methylpyridin-2-yl)-1H-imidazol-5-yl)quinoxaline); GW788388(4-(4-(3)-(pyridin-2-yl)-1H-pyrazol-4-yl)pyridin-2-yl)-N-(tetrahydro-2H-pyran-4-yl)benzamide); SD-208(2-(5-chloro-2-fluorophenyl)-N-(pyridin-4-yl)pteridin-4-amine); Galunisertib (LY2157299, 4-(2-(6-methylpyridin-2-yl)-5,6-dihydro-4H-pyrrol
  • the medium of the present invention may contain 0.01 ⁇ M to 20 ⁇ M of an ALK-5 kinase inhibitor, preferably 0.1 to 10 ⁇ M, more preferably 0.5 ⁇ M to 5 ⁇ M, most preferably 0.7 ⁇ M to 1.5 ⁇ M.
  • the term "hedgehog inhibitor” is preferably a sonic hedgehog inhibitor, more preferably cyclopamine, mifepristone, GDC-0449 ( Vismodegib), XL139 (BMS-833923), IPI926, IPI609 (IPI269609), LDE225, gerbin, GANT61, permorphamine, SAG, SANT-2, tomatidine, SANT74, SANT75, xerumbon or a derivative thereof, not limited
  • the medium of the present invention may contain 0.05 ⁇ M to 20 ⁇ M of hedgehog inhibitor, preferably 0.1 to 15 ⁇ M, more preferably 0.5 ⁇ M to 10 ⁇ M, even more preferably 0.5 ⁇ M to 5 ⁇ M, Most preferably, it may be 1 ⁇ M to 3 ⁇ M.
  • MAPK inhibitor refers to mitogen activated protein kinases [Mitogen activated protein kinases; MAPK], which is a member of the prolinergic serine/threonine kinase family that activates their substrates by double phosphorylation.
  • MAPK inhibitors are known P38 kinase inhibitors, 1-Pyridinyl-2-phenylazole, SB 203580, SKF 86002, SKF 86096, SKF 104351, 1-Aryl-2-pyridinyl/pyrimidinyl heterocycles, SB 242235, RO-3001195, SX-011, or BIRB-796, but is not limited thereto, and is described in G. J.
  • the MAPK inhibitor of the present invention may preferably be sb203580, but is not limited thereto.
  • the medium of the present invention contains a MAPK inhibitor from 50 ⁇ M to 5000 ⁇ M, 0.001 to 2500 ⁇ M, 0.01 to 1000 ⁇ M, 0.01 to 900 ⁇ M, 0.01 to 800 ⁇ M, 0.01 to 700 ⁇ M, 0.01 to 600 ⁇ M, 0.01 to 500 ⁇ M, 0.01 to 400 ⁇ M, 0.01 to 300 ⁇ M, 0.01 to 200 ⁇ M, 0.01 to 100 ⁇ M, 0.01 to 90 ⁇ M, 0.01 to 80 ⁇ M, 0.01 to 70 ⁇ M, 0.01 to 60 ⁇ M, 0.01 to 50 ⁇ M, 0.01 to 40 ⁇ M, 0.01 to 30 ⁇ M, 0.01-20 ⁇ M, 0.01-10 ⁇ M, 0.01-5 ⁇ M, 0.01-3 ⁇ M, 0.01-2 ⁇ M, 0.01-1 ⁇ M, 0.5-10 ⁇ M, 0.5-7 ⁇ M, 0.5-5 ⁇ M, 0.5-3 ⁇ M, 0.5-1.5 ⁇ M, 0.7-1.3 ⁇
  • the term “calcium channel agonist” is also referred to as “calcium channel opener”, and is not limited as long as it is a material that promotes ion transfer through the calcium channel.
  • the calcium channel agonist of the present invention may be at least one selected from the group consisting of Bay K-8644, FPL 64179, and CGP28392, but is not limited thereto.
  • the medium of the present invention may contain 0.05 ⁇ M to 20 ⁇ M of a calcium channel agonist, preferably 0.1 to 15 ⁇ M, more preferably 0.5 ⁇ M to 10 ⁇ M, even more preferably 0.5 ⁇ M to 5 ⁇ M , most preferably 1 ⁇ M to 3 ⁇ M.
  • GLP receptor agonist may specifically be a GLP-1 receptor agonist, and includes all peptides having GLP action activity, fragments, precursors, variants or derivatives thereof, Substances capable of activating GLP receptors may be included without limitation.
  • the GLP receptor agonist of the present invention is exendin-4, dulaglutide, exenatide, semaglutide, liraglutide, lixisenatide, and It may be one or more selected from the group consisting of albiglutide, but is not limited thereto.
  • the medium of the present invention contains the GLP receptor agonist at 1-500 ng/mL, 1-400 ng/mL, 1-300 ng/mL, 1-200 ng/mL, 1-100 ng/mL, 30-500 ng/mL. mL, 30-400 ng/mL, 30-300 ng/mL, 30-200 ng/mL, 30-100 ng/mL, 30-90 ng/mL, 30-80 ng/mL, 30-70 ng/mL , 40 to 60 ng/mL, or about 50 ng/mL may be included.
  • the term "supplement” may be one or more selected from the group consisting of 2-phospho-L-ascorbic acid, B27, laminin, nicotinamide, and N2.
  • the present invention provides a MAPK inhibitor, a calcium channel agonist, a GLP receptor agonist, a supplement; and at least one miRNA selected from the group consisting of miR-127 and miR-709; culturing somatic cells in the presence of a composition comprising; it relates to a direct differentiation method from somatic cells to pancreatic beta cells, comprising a.
  • the method comprises the steps of (1) inducing somatic cells into pancreatic endoderm cells; (2) inducing pancreatic endoderm cells into pancreatic progenitor cells; and (3) inducing pancreatic progenitor cells into pancreatic beta cells, or may consist of the above steps, but is not limited thereto.
  • the method may include or consist of (3) inducing pancreatic progenitor cells into pancreatic beta cells, but is not limited thereto.
  • somatic cells of the method are fibroblasts
  • differentiation is required through three steps, but when the somatic cells are pancreatic duct cells and exocrine cells having the properties of pancreatic progenitor cells, somatic cells in the presence of the composition of (3) can be directly differentiated into pancreatic beta cells.
  • the direct differentiation method may include the following steps, but is not limited thereto:
  • Step (1) of the present invention may be made without limitation as long as it is a period capable of inducing differentiation into pancreatic beta cells, but 3 to 10 days, 4 to 9 days, 4 to 8 days, 4 to 7 days, or 5 days It may be carried out for 7 days, and more preferably, it may be carried out for about 6 days.
  • the supplement in the above step may preferably be 2-phospho-L-ascorbic acid.
  • the culture of step (2) may be performed without limitation, but may be performed for 0.5 to 8 days, 0.5 to 7 days, 1 to 7 days, 2 to 6 days, 3 to 5 days, or about 4 days. However, the incubation period is not limited thereto.
  • the supplement of step (2) may preferably be 2-phospho-L-ascorbic acid.
  • Step (3) of the present invention may be made without limitation as long as the period during which the differentiation-induced cells can mature, but is performed for 7 to 13 days, 8 to 12 days, 9 to 11 days, or about 10 days. can be However, the incubation period is not limited thereto.
  • the supplement in the above step may preferably be at least one selected from the group consisting of 2-phospho-L-ascorbic acid, laminin, B27, and nicotinamide, more preferably 2-phospho-L-ascorbic acid, laminin , B27, and nicotinamide.
  • the term "medium" of the present invention may use a basic medium known in the art without limitation.
  • the basal medium may be artificially synthesized and manufactured, or a commercially prepared medium may be used.
  • commercially prepared media include DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI 1640, F-10, F-12, ⁇ -MEM ( ⁇ -Minimal essential Medium), Glasgow's Minimal Essential Medium (G-MEM), and Iscove's Modified Dulbecco's Medium, but is not limited thereto, and may be a DMEM medium.
  • the culture medium for culturing the somatic cells includes all of the medium culture medium commonly used for culturing fibroblasts in the art.
  • the culture medium used for culture generally contains a carbon source, a nitrogen source, and a trace element component.
  • the present invention provides a kit for inducing direct differentiation of somatic cells into pancreatic beta cells, comprising a composition comprising one or more miRNAs selected from the group consisting of miR-127 and miR-709.
  • the kit may further include a cell culture dish, but is not limited thereto.
  • the cell culture dish refers to a cell culture vessel, and includes a cell culture vessel regardless of the material, size, and shape of the culture dish.
  • the cell culture dish may be a culture dish for suspension culture or a culture dish for adherent culture.
  • the present invention is a method for securing genetic stability for inducing pancreatic beta cells from a patient's somatic cells by treating microRNA or a composition combining microRNA and a small molecule without introducing an external gene. It is designed to fundamentally solve the genetic defect, which is the problem of the conversion method, while lowering the possibility of cancer.
  • micro RNA alone; Alternatively, somatic cells were directly differentiated into pancreatic beta cells using a combination of a low molecular weight substance and microRNA. Accordingly, the microRNA of the present invention can be used as a therapeutic agent for diabetes or pancreatic cancer by itself, and has a very high application potential because it can manufacture a cell therapy agent for patients.
  • the present invention relates to a pharmaceutical composition for preventing or treating diabetes or pancreatic cancer comprising at least one miRNA selected from the group consisting of miR-127 and miR-709 as an active ingredient.
  • the present invention provides a cell therapeutic agent for the treatment of diabetes or pancreatic cancer, comprising as an active ingredient pancreatic beta cells induced by direct differentiation by the direct differentiation method.
  • the present invention includes the step of inducing direct differentiation of somatic cells into beta cells in vivo by delivering a composition comprising one or more miRNAs selected from the group consisting of miR-127 and miR-709 in vivo, diabetes or A method for preventing or treating pancreatic cancer is provided.
  • Diabetes which is the subject of treatment or prevention in the present invention, is a metabolic disorder syndrome characterized by a deficiency of insulin hormone produced in beta cells of the pancreas or abnormal insulin resistance, and hyperglycemia caused by both of these defects.
  • diabetes can be divided into insulin-dependent diabetes mellitus (IDDM, Type 1) and non-insulin-dependent diabetes mellitus (NIDDM, Type 2) caused by insulin resistance and impaired insulin secretion.
  • IDDM insulin-dependent diabetes mellitus
  • NIDDM non-insulin-dependent diabetes mellitus
  • various complications such as heart disease, intestinal disease, eye disease, neurological disease, and stroke occur.
  • Short-term hypoglycemia and hyperglycemia will cause acute complications. Diabetes mellitus causes chronic high blood sugar and lipid and protein metabolism as well as carbohydrate metabolism.
  • the conditions are various and are directly caused by hyperglycemia, including diabetic peripheral neuropathy, diabetic retinopathy, diabetic nephropathy, diabetic cataract, keratosis, diabetic arteriosclerosis, etc. in the retina, kidney, nerve, and cardiovascular system.
  • diabetes in the present invention may be a target if it is diabetes induced by glucose toxicity or deep or advanced diabetes, and more specifically, it is selected from the group consisting of type 1 diabetes, type 2 diabetes, and gestational diabetes. it could be
  • Delivery of the present invention may be through administration, but is not limited thereto.
  • the miRNA of the present invention may be included in the form of a pharmaceutically acceptable salt.
  • pharmaceutically acceptable salt includes salts derived from pharmaceutically acceptable inorganic acids, organic acids, or bases.
  • acids examples include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, toluene-p-sulfonic acid, tartaric acid, acetic acid, citric acid, methanesulfonic acid, formic acid , benzoic acid, malonic acid, gluconic acid, naphthalene-2-sulfonic acid, benzenesulfonic acid, and the like.
  • Acid addition salts can be prepared by conventional methods, for example, by dissolving the compound in an aqueous solution of an excess of acid, and precipitating the salt using a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. It can also be prepared by heating an equimolar amount of the compound and an acid or alcohol in water and then evaporating the mixture to dryness, or by suction filtration of the precipitated salt.
  • a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile.
  • Salts derived from suitable bases may include, but are not limited to, alkali metals such as sodium and potassium, alkaline earth metals such as magnesium, and ammonium.
  • the alkali metal or alkaline earth metal salt can be obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and then evaporating and drying the filtrate.
  • the metal salt it is pharmaceutically suitable to prepare a sodium, potassium or calcium salt, and the corresponding silver salt can be obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (eg, silver nitrate).
  • the content of the miRNA in the composition of the present invention can be appropriately adjusted according to the symptoms of the disease, the degree of progression of the symptoms, the condition of the patient, etc., for example, 0.00001 to 99.9% by weight, or 0.001 to 50% by weight based on the total weight of the composition.
  • the content ratio is a value based on the dry amount from which the solvent is removed.
  • the pharmaceutical composition according to the present invention may further include suitable carriers, excipients and diluents commonly used in the preparation of pharmaceutical compositions.
  • the excipient may be, for example, at least one selected from the group consisting of a diluent, a binder, a disintegrant, a lubricant, an adsorbent, a humectant, a film-coating material, and a controlled-release additive.
  • the pharmaceutical composition according to the present invention can be prepared according to a conventional method, respectively, in powders, granules, sustained-release granules, enteric granules, liquids, eye drops, elsilic, emulsions, suspensions, alcohols, troches, fragrances, and limonaade.
  • tablets, sustained release tablets, enteric tablets, sublingual tablets, hard capsules, soft capsules, sustained release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, perfusates, Warnings, lotions, pasta, sprays, inhalants, patches, sterile injection solutions, or external preparations such as aerosols can be formulated and used, and the external preparations are creams, gels, patches, sprays, ointments, warning agents , lotion, liniment, pasta, or cataplasma.
  • Carriers, excipients and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • formulation it is prepared using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants.
  • water diluted hydrochloric acid, diluted sulfuric acid, sodium citrate, monostearate sucrose, polyoxyethylene sorbitol fatty acid esters (Twinester), polyoxyethylene monoalkyl ethers, lanolin ethers, Lanolin esters, acetic acid, hydrochloric acid, aqueous ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethyl cellulose, sodium carboxymethyl cellulose, etc.
  • water diluted hydrochloric acid, diluted sulfuric acid, sodium citrate, monostearate sucrose, polyoxyethylene sorbitol fatty acid esters (Twinester), polyoxyethylene monoalkyl ethers, lanolin ethers, Lanolin esters, acetic acid, hydrochloric acid, aqueous ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone,
  • sucrose solution other sugars or sweeteners may be used, and if necessary, a fragrance, colorant, preservative, stabilizer, suspending agent, emulsifying agent, thickening agent, etc. may be used.
  • Purified water may be used in the emulsion according to the present invention, and if necessary, an emulsifier, preservative, stabilizer, fragrance, etc. may be used.
  • Suspension agents according to the present invention include acacia, tragacantha, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose (HPMC), HPMC 1828, HPMC 2906, HPMC 2910, etc.
  • An agent may be used, and a surfactant, a preservative, a stabilizer, a colorant, and a fragrance may be used as needed.
  • the injection according to the present invention includes distilled water for injection, 0.9% sodium chloride injection solution, ring gel injection solution, dextrose injection solution, dextrose + sodium chloride injection solution, PEG (PEG), lactated ring gel injection solution, ethanol, propylene glycol, non-volatile oil-sesame oil , solvents such as cottonseed oil, peanut oil, soybean oil, corn oil, ethyl oleate, isopropyl myristate, and benzene benzoate; Solubilizing aids such as sodium benzoate, sodium salicylate, sodium acetate, urea, urethane, monoethyl acetamide, butazolidine, propylene glycol, tweens, nijeongtinamide, hexamine, and dimethyl acetamide; Weak acids and their salts (acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, buffers such
  • the suppository according to the present invention includes cacao fat, lanolin, witepsol, polyethylene glycol, glycerogelatin, methyl cellulose, carboxymethyl cellulose, a mixture of stearic acid and oleic acid, Subanal, cottonseed oil, peanut oil, palm oil, cacao butter + Cholesterol, Lecithin, Lanet Wax, Glycerol Monostearate, Tween or Span, Imhausen, Monolene (Propylene Glycol Monostearate), Glycerin, Adeps Solidus, Butyrum Tego -G), Cebes Pharma 16, Hexalide Base 95, Cotomar, Hydroxote SP, S-70-XXA, S-70-XX75 (S-70-XX95), Hydro Hydrokote 25, Hydrokote 711, Idropostal, Massa estrarium, A, AS, B, C, D, E, I, T, Massa-MF, Masupol, Masupol-15, Neos
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in the extract, for example, starch, calcium carbonate, sucrose ) or lactose, gelatin, etc.
  • excipients for example, starch, calcium carbonate, sucrose ) or lactose, gelatin, etc.
  • lubricants such as magnesium stearate and talc are also used.
  • Liquid formulations for oral administration include suspensions, internal solutions, emulsions, syrups, etc.
  • various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories.
  • Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • composition according to the present invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type, severity, drug activity, and type of the patient's disease; Sensitivity to the drug, administration time, administration route and excretion rate, treatment period, factors including concurrent drugs and other factors well known in the medical field may be determined.
  • the pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or may be administered in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. In consideration of all of the above factors, it is important to administer an amount capable of obtaining the maximum effect with a minimum amount without side effects, which can be easily determined by a person skilled in the art to which the present invention pertains.
  • the pharmaceutical composition of the present invention may be administered to an individual by various routes. All modes of administration can be contemplated, for example, oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, paraspinal space (intrathecal) injection, sublingual administration, buccal administration, rectal insertion, vaginal It can be administered according to internal insertion, ocular administration, ear administration, nasal administration, inhalation, spraying through the mouth or nose, skin administration, transdermal administration, and the like.
  • the pharmaceutical composition of the present invention is determined according to the type of drug as an active ingredient along with several related factors such as the disease to be treated, the route of administration, the patient's age, sex, weight, and the severity of the disease.
  • "individual” means a subject in need of treatment for a disease, and is not limited if it is a vertebrate, specifically, a human, a mouse, a rat, a guinea pig, a rabbit, a monkey, a pig, a horse, a cow, Applicable to sheep, antelopes, dogs, cats, fish and reptiles.
  • administration means providing a given composition of the present invention to a subject by any suitable method.
  • prevention means any action that inhibits or delays the onset of a desired disease
  • treatment means that the desired disease and metabolic abnormalities are improved or It means all actions that are advantageously changed
  • improvement means all actions that reduce the parameters related to the desired disease, for example, the degree of symptoms by administration of the composition according to the present invention.
  • the present invention is a method for preparing a cell therapy for diabetes or pancreatic cancer, comprising mixing the pancreatic beta cells induced by the above method with one or more selected from the group consisting of pharmaceutically acceptable carriers and excipients. is about
  • cellular therapeutic agent refers to cells and tissues isolated from humans, cultured, and manufactured through special manipulation, and is a drug (US FDA regulations) used for the purpose of treatment, diagnosis, and prevention. Or through a series of actions such as proliferating and selecting living autologous, allogeneic, or xenogeneic cells in vitro or changing the biological characteristics of cells in other ways to restore the function of the tissue, these cells can be used in the treatment, diagnosis and prevention of diseases. Drugs used for that purpose.
  • the administration route of the cell therapy composition of the present invention may be administered through any general route as long as it can reach the target tissue.
  • Parenteral administration for example, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, may be administered intradermally, but is not limited thereto.
  • composition may be formulated in a suitable form together with a pharmaceutical carrier commonly used for cell therapy.
  • “Pharmaceutically acceptable” refers to a composition that is physiologically acceptable and does not normally cause allergic reactions such as gastrointestinal disorders, dizziness, or similar reactions when administered to humans.
  • Pharmaceutically acceptable carriers include, for example, carriers for parenteral administration such as water, suitable oils, saline, aqueous glucose and glycol, and may further include stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives are benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol.
  • the cell therapeutic agent according to the present invention is prepared in a unit dosage form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by a person of ordinary skill in the art to which the present invention pertains. or it may be prepared by incorporation into a multi-dose container.
  • Pharmaceutically acceptable carriers included in the cell therapeutic agent of the present invention are commonly used in formulation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate.
  • the cell therapy agent of the present invention may further include a lubricant, a wetting agent, an emulsifier, a suspending agent, a preservative, and the like, in addition to the above components.
  • composition may be administered by any device capable of transporting a cell therapy agent to a target cell.
  • the cell therapy composition of the present invention may contain a therapeutically effective amount of the cell therapy agent for the treatment of a disease.
  • “Therapeutically effective amount” means the amount of an active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue system, animal or human as considered by a researcher, veterinarian, physician or other clinician. , which includes an amount that induces amelioration of the symptoms of the disease or disorder being treated.
  • the optimal content of the cell therapy agent can be easily determined by those skilled in the art, and the type of disease, the severity of the disease, the content of other components contained in the composition, the type of formulation, and the age, weight, general health status, sex and diet of the patient , administration time, administration route and secretion rate of the composition, treatment period, and drugs used at the same time may be adjusted according to various factors. In consideration of all of the above factors, it is important to include an amount that can obtain the maximum effect with a minimum amount without side effects.
  • the daily dose of the stem cells of the present invention is 1.0 ⁇ 10 4 to 1.0 ⁇ 10 11 cells/kg body weight, preferably 1.0 ⁇ 10 5 to 1.0 ⁇ 10 9 cells/kg body weight divided once or several times. can be administered.
  • the actual dosage of the active ingredient should be determined in light of several related factors such as the disease to be treated, the severity of the disease, the route of administration, the patient's weight, age, and sex, and, therefore, the dosage It is not intended to limit the scope of the present invention in any way.
  • the composition comprising the cell therapy agent of the present invention as an active ingredient is rectal, intravenous (intravenous therapy, iv), intraarterial, intraperitoneal, intramuscular, intrasternal, transdermal, topical, or intraocular Alternatively, it may be administered in a conventional manner via an intradermal route.
  • the present invention provides a treatment method comprising administering to a mammal a therapeutically effective amount of the cell therapy composition of the present invention.
  • mammal refers to a mammal that is the subject of treatment, observation or experimentation, and preferably refers to a human.
  • FBS fetal bovine serum
  • Welgene penicillin-streptomycin
  • DMEM dulbecco's minimal essential
  • Exocrine tissue was [GC Chau, DU Im, TM Kang, JM Bae, W. Kim, S. Pyo, E.-Y. Moon, SHJJCB Um, mTOR controls ChREBP transcriptional activity and pancreatic ⁇ cell survival under diabetic stress, 216(7) (2017) 2091-2105.]
  • HBSS Hort's Balanced Salt Solution, Welgene
  • a 400 ⁇ m mesh (Sigma) was used to filter the digested suspension, and all exocrine cells were isolated from the islets using density gradient centrifugation on biocoll separation solution (Merck-Millipore). Then, the cells were centrifuged at 2000 rpm for 20 minutes at 20 °C. The upper layer of the biocall gradient contained acinar cells, whereas the pellet contained all other cells, including islets and ductal cells, except for acinar cells. Acinar cells and pancreatic duct cells were carefully collected, mixed together and filtered through a 70 ⁇ m mesh (Falcon).
  • MEFs (5 ⁇ 10 4 cells/well per 12 well plate) were transfected using jetMESSENGER (Polyplus-Transfection, Illkirch, France) reagent according to the manufacturer's instructions.
  • the miRNA to be infected 200 nM (QIAGEN, Hilden, Germany) was diluted in mRNA buffer and 2 ⁇ L of jetMESSENGER reagent was added. The mixture was incubated at room temperature for 20 min and added to the MEFs, followed by the addition of the stage specific medium after 24 h.
  • 266-6 cells (8 ⁇ 10 4 cells/well) were transfected using RNAiMAX reagent (Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocol. Transfection was performed in stage specific medium and the transfected cells were incubated for the desired time.
  • RNAiMAX reagent Thermo Fisher Scientific, Inc., Waltham, MA, USA
  • differentiated ⁇ -like cells were harvested and immunostained as described in the prior literature (Int. J. Mol. Sci. 2020 , 21, 665). Samples were visualized using a fluorescence microscope (IX71S1F3, Olympus, Tokyo, Japan). The antibodies used are shown in Table 1 below.
  • knockout DMEM (KO-DMEM) (Gibco) was used as a basal medium.
  • Knockout DMEM contains 15% knockout serum substitute (Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA), 5% FBS (exosome depleted), 1% glutamax (Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA), 1% non-essential amino acids (NEAA, Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA), and 0.5 mM ⁇ -ME (Sigma Aldrich, Inc., Saint Louis, MO, USA).
  • the three-step differentiation protocol of the present invention is as follows: step 1, differentiation from MEFs into pancreatic endoderm cells; Stage 2, differentiation of pancreatic endoderm cells into pancreatic progenitor-like cells; Stage 3, differentiation from pancreatic progenitor-like cells to beta-cell-like cells.
  • Step 1 differentiation medium was 1 ⁇ M Bix-01294 (MedchemExpress, Monmouth Junction, NJ, USA), 280 ⁇ M 2-phospho-L-ascorbic acid (pVc, Sigma Aldrich, Inc., Saint Louis, MO, USA), and 50 ng/mL activin A (R&D Systems, Minneapolis, MI, USA).
  • Cells were maintained for 6 days after medium addition. The medium used was changed every 3 days. After 6 days, the second-stage differentiation medium was added for 4 days.
  • the two-stage differentiation medium was a small molecule, 0.5 nM TTNPB (MedchemExpress, Monmouth Junction, NJ, USA), 1 ⁇ M repsox (MedchemExpress, Monmouth Junction, NJ, USA), 2 ⁇ M cyclopamine (Tocris, Bristol, UK), and 280 Contains ⁇ M pVc.
  • Step 3 differentiation medium was 1 ⁇ M SB203580 (MedchemExpress, Monmouth Junction, NJ, USA), 1 ⁇ insulin-transferrin-selenium (ITS, Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA), 10 mM nicotinamide ( Sigma Aldrich, Inc., Saint Louis, MO, USA), 1 ⁇ g/mL laminin (Sigma Aldrich, Inc., Saint Louis, MO, USA), 50 ng/mL exendin-4 (MedchemExpress, Monmouth Junction, NJ, USA), 2 ⁇ M Bay K-8644 (Tocris, Bristol, UK), 1 ⁇ B27 plus supplement (Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA), and pVc.
  • step 3 medium cells were maintained for 10 days.
  • step Step Features medium ingredients Level 1 Differentiate into endoderm cells BIX01294 (BIX), phospho-L-ascorbic acid (pVC), activin A and microRNA Step 2 Differentiation into pancreatic progenitor cells TTNPB, repsox, cyclopamine, and pVC, microRNA Step 3 Differentiate into beta cells SB203580, Nicotinamide, Extendin-A, Bay K-8644, Micro RNA
  • micro RNA NAME SEQUENCE SEQ ID NO: miR-127-5p CUGAAGCUCAGAGGGCUCUGAU One miR-709 GGAGGCAGAGGCAGGAGGA 2 miR-127 MI0000154 precursor CCAGCCUGCUGAAGCUCAGAGGGCUCUGAUUCAGAAAGAUCAUCGGAUCCGUCUGAGCUUGGCUGGUCGG 3 miR-709 MI0004693 precursor UGUCCCGUUUCUCUCUGCUUCUACUCAGAAGUGCUCUGAGCAUAGAACUGUCCUGUUUGAGCAGCACUGGGGAGGCAGAGGCAGGAGGAU 4 miR-19b ugugcaaauccaugcaaaacuga 5
  • Total cell RNA was extracted using the manufacturer's Trizol (Invitrogen) method. 1ug of total RNA was used for cDNA synthesis using PrimeScript 1st strand cDNA Synthesis Kit (Takara Clontech). Pancreatic lineage-specific marker analysis was performed with an iQ SYBR Green Supermix (Biorad) using Real Time PCR (Biorad). The qRT-PCR conditions were 40 cycles of 30 sec at 95 °C, 15 sec at 60 °C, and 15 sec at 72 °C. The primers used in this study are shown in Table 4 below.
  • pancreatic (endocrine)-specific transcription changes in MEF in the first-stage medium depending on the presence or absence of small molecular substances such as epigenetic modifier BIX01294 and pVC was assumed to induce.
  • the small molecule compound differentiation protocol includes three steps: Step 1, from MEFs to pancreatic endoderm cells (PECs); Step 2, PEC to Pancreatic Progenitor-Like Cells (PPLC); and Step 3, converting PPLCs to ⁇ -like cells (BLCs).
  • Step 1 from MEFs to pancreatic endoderm cells (PECs); Step 2, PEC to Pancreatic Progenitor-Like Cells (PPLC); and Step 3, converting PPLCs to ⁇ -like cells (BLCs).
  • the present inventors established a final protocol of adding microRNAs to the three-step protocol of Fig. 1a (see Fig. 1b).
  • pancreas-specific program was initiated compared with microRNA-untreated cells.
  • the formation of the pancreas begins with the differentiation of definitive endoderm into pancreatic endoderm.
  • Pancreatic endoderm cells express the pancreatic-duodenal homeobox gene, PDX1.
  • PDX1 expression characterizes an important step in pancreatic organogenesis.
  • the mature pancreas contains exocrine and endocrine tissue, among other cell types. Exocrine and endocrine tissues result from the differentiation of pancreatic endoderm. Accordingly, the present inventors confirmed the expression of Pdx1 in order to confirm the differentiation into pancreatic beta-cell-like cells.
  • the small molecule compound differentiation protocol of the present invention is suitable for direct differentiation of pancreatic beta cells.
  • the present inventors confirmed that MIN6-derived exosomes were not only rich in various miRNAs, such as miR-486, miR-127, miR-19b, miR-494 and miR-709, but also related to the pancreatic lineage. Accordingly, the present inventors investigated whether the miRNA can enhance the expression of pancreatic beta cell markers individually or in combination.
  • transfection experiments were optimized using a 5' FAM (fluorescein amidite) labeled control miRNA mimic before transfecting MEFs with miRNA mimetics to simulate naturally occurring miRNAs.
  • a control miRNA mimic was used that had no homology with mouse, murine, or human miRNA.
  • transfection was performed individually.
  • miR-127 and miR-709 had the best effect of inducing expression of Pdx1 among various miRNAs. Specifically, it was shown that miR-127 induced 3.9-fold of the mimic, miR-709 induced 3.2-fold of the mimic, and miR-19b induced 1.6-fold.
  • Example 3 it was confirmed whether miR-127 and miR-709, which had a large effect on inducing Pdx1 expression, were combined for each concentration to increase the expression of the pancreatic gene marker.
  • Ngn3 was also significantly upregulated. Early activation of Ngn3 is known to exclusively induce glucagon-positive cells while depleting the pool of pancreatic progenitor cells.
  • miRNA provided about 80% transfection efficiency with low cytotoxicity when treated with a dose of 200 nM.
  • step 1 the highest transcription level of Pdx1 was observed in step 1 after transfection of miR-127+miR-709+miR-19b combination-1.
  • the present inventors confirmed that fibroblasts can be differentiated into pancreatic beta-cell-like cells using the microRNA combination of the present invention through Examples 3 and 4 above.
  • exocrine and endocrine cells of the pancreas share a common developmental pathway, we investigated whether exocrine cells can be used to differentiate into pancreatic beta-cell-like cells.
  • mouse acinar cell line 266-6 cells were tested using miR-127+miR-709 combination-3.
  • the isolated exocrine cells were aliquoted into a 6-well plate (coated with 1:10 dilution of Matrigel from BD Bioscience) in step 3 medium. After 1 day in step 3 medium, 50 ⁇ g/ml microRNA was added to one well and no microRNA was added to the other well. After the cells were incubated with microRNAs in step 3 medium for 2 days, fresh medium without microRNAs was added to each well. After 7 days, cells for RNA isolation were harvested using Qiagen RNeasy kit, and gene profiling was performed using qRT-PCR.
  • transfected 266-6 cells were cultured and grown in step 3 medium, expression of the pancreatic beta cell marker was confirmed.
  • the beta cell marker gene was increased even when exocrine cells were treated with the microRNA combination of the present invention.
  • the level of Pdx1 was increased more than 1.5-fold compared to untreated cells.
  • Ngn3 expression was also upregulated by 1.6-fold in microRNA-treated cells.
  • the levels of insulin-1 and insulin-2 also increased by 1.8-fold and 1.9-fold, respectively.
  • the expression of elastase was shown to be rather decreased upon microRNA treatment.
  • somatic cells such as fibroblasts and exocrine cells can be directly differentiated into pancreatic beta cells.
  • Example 6 Confirmation of beta cell-like cell differentiation effect of human pancreatic duct cells according to the combination of micro RNA and small molecule
  • pancreatic duct cells can be differentiated into pancreatic beta-cell-like cells through the combination of miR-127 and a small molecule. Expression of pancreatic beta cell markers was confirmed.
  • pancreatic beta cells are expected to be usefully used for the prevention, treatment and improvement of pancreatic-related diseases such as diabetes or pancreatic cancer.
  • this composition for direct differentiation induction is directly injected into the body, and it is expected that it will be usefully used for the prevention, treatment and improvement of pancreatic-related diseases such as diabetes or pancreatic cancer through beta-cell induction of somatic cells in the body.
  • pancreatic beta cells When the present inventors attempted direct differentiation by co-treating various low molecular weight substances such as various differentiation-inducing substances and microRNA, the expression level of PDX1 in pancreatic beta cells was significantly increased. It was confirmed that direct differentiation into In addition, since the present invention uses autologous cells when transplanting converted pancreatic beta cells into diabetic or pancreatic cancer patients, it has the advantage that there is no immune rejection and the possibility of cancer occurrence is low. As it is expected, it has industrial applicability.
  • various low molecular weight substances such as various differentiation-inducing substances and microRNA

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physiology (AREA)
  • Immunology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Virology (AREA)
  • Nutrition Science (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 체세포를 마이크로 RNA 및 저분자성 물질을 이용하여 췌장 베타세포로의 직접분화(Reprogramming)하는 방법에 관한 것으로, 본 발명자들은 다양한 분화 유도 물질 등 저분자성 물질과 마이크로 RNA를 병용처리하여 직접분화를 시도한 결과, 췌장 베타세포에서 PDX1의 발현량이 현저히 증가하였으며, 이러한 방법으로 유사 췌장 베타세포를 유도하였을 때 매우 높은 수율로 직접분화됨을 확인하였다. 또한, 본 발명은 자가 세포를 이용하므로 면역거부반응이 생기지 않으면서 암 발생 가능성도 낮다는 장점이 있어 더욱 안전한 세포치료제 개발에 유용하게 사용될 것으로 기대된다. 또한, 본 발명에 의해 생산된 췌장 베타세포는 당뇨병 또는 췌장암을 예방, 치료 및 개선하기 위한 세포 조성물로 유용하게 이용될 수 있을 것으로 기대된다.

Description

마이크로 RNA를 이용하여 체세포로부터 췌장 베타세포를 직접 분화시키는 방법 및 분화 조성물
본 발명은 체세포로부터 췌장 베타세포를 직접 분화시키는 방법 및 분화 조성물에 관한 것으로, 보다 구체적으로는 마이크로 RNA(miRNA) miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상을 유효성분으로 포함하는, 체세포의 췌장 베타세포로의 직접분화 유도용 조성물 및 그를 이용한 췌장 베타세포의 직접분화 방법 등에 관한 것이다.
본 출원은 2020년 9월 24일에 출원된 한국특허출원 제10-2020-0123558호 및 2021년 8월 4일에 출원된 한국특허출원 제10-2021-0102649호에 기초한 우선권을 주장하며, 해당 출원의 명세서 및 도면에 개시된 모든 내용은 본 출원에 원용된다.
당뇨에서 글루코스 독성은 β-세포의 세포사멸(apoptosis)을 야기하고, 췌장을 포함한 다양한 장기 시스템에 영향을 미친다. 그러나 기본적인 메커니즘은 완전하게 알려져 있지는 않다. β-세포의 장애 및 손상된 인슐린 생산은 당뇨의 전형적인 특징이나, 당뇨병의 급속한 확산에도 불구하고 β-세포의 세포사멸을 야기하는 글루코스 독성의 정확한 분자적 메커니즘은 여전히 알려지지 않았다.
특히, 제1형 당뇨병 및 췌장암과 같은 질환은 베타세포의 손상 또는 손실에 의하여 기능이상이 유발되므로, 췌장 베타세포의 이식 방법만이 유일한 치료법이다.
최근 줄기세포 연구가 발전함에 따라, 중간 분화를 거치지 않고 다양한 계통으로 체세포를 직접분화(재분화 또는 리프로그래밍)시키는 과정에서 시간 및 효과 문제를 줄였을 뿐만 아니라 자가 이식을 위한 새로운 길이 열렸다. 다만, 유도만능줄기세포(induced pluripotent stem cell, iPSC)에서 유래된 췌장 베타세포는 타인의 세포를 사용하므로 면역 거부 반응이 있을 수 있고 줄기세포의 암 유발가능성 때문에 안정성 문제가 있을 수 있다.
이에, 본인의 체세포를 췌장 베타세포로 전환시키는 직접 분화법이 각광을 받고 있다. 체세포를 췌장 베타세포로 전환하는 방법은 베타세포의 마커 유전자를 강제로 발현시키는 방법 및 저분자 물질을 이용하는 방법이 있으나, 외부 유전자를 도입하는 방법은 유전체에 영향을 주어 암발생 가능성이 있고, 저분자 물질을 이용하는 경우 췌장 베타세포로 전환 효율이 낮아지는 단점이 있었다.
또한, 기존에는 췌장 베타세포로 변환하는데 소요되는 기간이 27일 이상으로, 췌장 베타세포를 생산하는 기간이 길다는 단점이 있고, 이를 단축할 필요가 있었다(Cell Stem Cell. 2014 Feb 6; 14(2):228-36. doi:10.1016/j.stem.2014.01.006.)).
이러한 문제를 극복하기 위하여 본 발명자들은 마이크로 RNA를 단독 혹은 저분자 물질과 함께 체세포에 처리함으로써 체세포를 췌장 베타세포로 단시간에 효과적으로 전환하는 기술을 개발하였다.
본 발명은 상기와 같은 종래 기술상의 문제점을 해결하기 위해 안출된 것으로서, 본 발명자들은 체세포를 바로 췌장 베타세포로 변화시키는 방법을 찾고자 예의 노력한 결과, 본 발명의 마이크로 RNA 단독; 또는 히스톤 메틸전달효소 저해제 (histone methyltransferase inhibitor), 레티노산 아고니스트(retinoic acid agonist), ALK-5 키나아제 억제제(ALK-5 kinase inhibitor), 헷지호그 억제제(hedgehog inhibitor), MAPK 억제제(MAPK inhibitor), 칼슘 채널 아고니스트, GLP 수용체 아고니스트, 보충제; 및 마이크로 RNA를 포함한 조성물이 체세포의 췌장 베타세포로의 전환을 유도하기 위해 처리될 수 있음을 확인함으로써, 본 발명을 완성하였다.
이에, 본 발명의 목적은 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA를 포함하는 체세포의 췌장 베타세포로의 직접분화 유도용 조성물을 제공하는 것이다.
본 발명의 다른 목적은 MAPK 억제제(MAPK inhibitor), 칼슘 채널 아고니스트, GLP 수용체 아고니스트, 보충제; 및 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA;를 포함하는 조성물의 존재 하에 체세포를 배양하는 단계;를 포함하는 체세포로부터 췌장 베타세포로의 직접분화 방법을 제공하는 것이다.
본 발명의 또 다른 목적은, miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA를 유효성분으로 포함하는 당뇨병 또는 췌장암 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 방법에 의해 직접분화 유도된 췌장 베타세포를 약학적으로 허용되는 약제학적으로 허용되는 담체 및 부형제로 이루어진 군에서 선택된 하나 이상과 혼합하는 단계를 포함하는, 당뇨병 또는 췌장암 치료용 세포치료제를 제조하는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA를 유효성분으로 포함하는 조성물을 생체 내에 전달하여 생체 내에서 체세포의 베타세포로의 직접분화를 유도하는 단계를 포함하는, 당뇨병 또는 췌장암 예방 또는 치료 방법을 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
상기 목적을 달성하기 위하여, 본 발명은 마이크로 RNA 또는 저분자 물질을 유효성분으로 포함하는, 체세포의 췌장 베타세포로의 직접분화 유도용 조성물을 제공한다.
또한, 본 발명은 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA를 포함하는 체세포의 췌장 베타세포로의 직접분화 유도용 조성물을 제공한다.
본 발명의 일 구현예에서, 상기 체세포는 섬유아세포 (fibroblast), 췌관세포 및 외분비 세포로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 다른 구현예에서, 상기 조성물은 miR-19b를 추가로 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구현예에서, 상기 조성물은 히스톤 메틸전달효소 저해제 (histone methyltransferase inhibitor), 레티노산 아고니스트(retinoic acid agonist), ALK-5 키나아제 억제제(ALK-5 kinase inhibitor), 헷지호그 억제제(hedgehog inhibitor), MAPK 억제제(MAPK inhibitor), 칼슘 채널 아고니스트, GLP 수용체 아고니스트, 및 보충제로 이루어진 군으로부터 선택된 하나 이상의 저분자 물질을 추가로 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구현예에서, 상기 히스톤 메틸전달효소 저해제는 BIX01294 (2-(Hexahydro-4-methyl-1H-1,4-diazepin-1-yl)-6,7-dimethoxy-N-[1-(phenylmethyl)-4-piperidinyl]-4-quinazolinamine), 데시타빈(Decitabine, 5-aza-2'-deoxycytidine, DAC), 제불라린 (Zebularine), 3'-데아자네플라노신 A 하이드로클로리드 (3'-Deazaneplanocin A hydrochloride), 로메구아트리브 (Lomeguatrib), 및 카에토신 (Chaetocin, 2,2',3S,3'S,5aR,5'aR,6,6'-octahydro-3,3'-bis(hydroxymethyl)-2,2'-dimethyl-[10bR,10'bR(11aS,11'aS)-bi-3,11a-epidithio-11aH-pyrazino[1',2':1,5]pyrrolo[2,3-b]indole]-1,1',4,4'-tetrone)으로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구현예에서, 상기 보충제는 2-포스포-L-아스코르브산, B27, 라미닌, 니코틴아마이드, 및 N2로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구현예에서, 상기 레티노산 아고니스트는 TTNPB, 피탄산, 및 레티노산으로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구현예에서, 상기 헷지호그 억제제는 사이클로파민(cyclopamine), 미페프리스톤(mifepristone), GDC-0449(Vismodegib), XL139(BMS-833923), IPI926, IPI609(IPI269609), LDE225, 제르빈, GANT61, 퍼모파민, SAG, SANT-2, 토마티딘, SANT74, SANT75, 제룸본 및 그의 유도체로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구현예에서, 상기 MAPK 억제제는 1-Pyridinyl-2-phenylazole, SB 203580, SKF 86002, SKF 86096, SKF 104351, 1-Aryl-2-pyridinyl/pyrimidinyl heterocycles, SB 242235, RO-32001195, SX-011, 및 BIRB-796로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구현예에서, 상기 ALK-5 키나아제 억제제는 RepSox (1,5-Naphthyridine, 2-[3-(6-methyl-2-pyridinyl)-1H-pyrazol-4-yl]); SB525334 (6-(2-tert-butyl-4-(6-methylpyridin-2-yl)-1H-imidazol-5-yl)quinoxaline); GW788388 (4-(4-(3)-(pyridin-2-yl)-1H-pyrazol-4-yl)pyridin-2-yl)-N-(tetrahydro-2H-pyran-4-yl)benzamide); SD-208 (2-(5-chloro-2-fluorophenyl)-N-(pyridin-4-yl)pteridin-4-amine); Galunisertib (LY2157299, 4-(2-(6-methylpyridin-2-yl)-5,6-dihydro-4H-pyrrolo[1,2-b]pyrazol-3-yl)quinoline-6-carboxamide); EW-7197 (N-(2-fluorophenyl)-5-(6-methyl-2-pyridinyl)-4-[1,2,4]triazolo[1,5-a]pyridin-6-yl-1H-imidazole-2-methanamine); LY2109761 (7-(2-morpholinoethoxy)-4-(2-(pyridin-2-yl)-5,6-dihydro-4H-pyrrolo[1,2-b]pyrazol-3-yl)quinoline); SB505124 (2-(4-(benzo[d][1,3]dioxol-5-yl)-2-tert-butyl-1H-imidazol-5-yl)-6-methylpyridine); LY364947 (Quinoline, 4-[3-(2-pyridinyl)-1H-pyrazol-4-yl]); SB431542 (4-(4-(benzo[d][1,3]dioxol-5-yl)-5-(pyridin-2-yl)-1H-imidazol-2-yl)benzamide); K02288 (3)-[(6-Amino-5-(3),4,5-trimethoxyphenyl)-3-pyridinyl]phenol]; 및 LDN-212854 (Quinoline, 5-[6-[4-(1-piperazinyl)phenyl]pyrazolo[1,5-a]pyrimidin-3-yl])로 이루어지는 군으로부터 선택되는 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구현예에서, 상기 칼슘 채널 아고니스트는 Bay K-8644, FPL 64179, 및 CGP28392로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구현예에서, 상기 GLP 수용체 아고니스트는 엑센딘-4, 둘라글루티드(Dulaglutide), 엑세나티드(Exenatide), 세마글루티드(Semaglutide), 리라글루티드(Liraglutide), 릭시세나타이드(Lixisenatide), 및 알비글루티드(Albiglutide)로 이루어지는 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.
또한, 본 발명은 MAPK 억제제(MAPK inhibitor), 칼슘 채널 아고니스트, GLP 수용체 아고니스트, 보충제; 및 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA;를 포함하는 조성물의 존재 하에 체세포를 배양하는 단계;를 포함하는 체세포로부터 췌장 베타세포로의 직접분화 방법을 제공한다.
본 발명의 일 구현예에서, 상기 방법은 (1) 체세포를 췌장 내배엽 세포 (pancreatic endoderm cell)로 유도하는 단계; (2) 췌장 내배엽 세포를 췌장 전구 세포로 유도하는 단계; 및 (3) 췌장 전구 세포를 췌장 베타세포로 유도하는 단계를 포함하거나, 상기 단계로 이루어진 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 다른 구현예에서, 상기 방법은 (3) 췌장 전구 세포를 췌장 베타세포로 유도하는 단계를 포함하거나, 상기 단계로 이루어진 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구현예에서, 상기 방법의 체세포가 섬유아세포인 경우 세 가지 단계를 통해 분화가 필요하지만, 상기 체세포가 췌장 전구 세포의 성질을 갖는 췌관세포 및 외분비세포인 경우, 상기 조성물의 존재 하에서 체세포로부터 췌장 베타세포로 직접분화할 수 있다.
본 발명의 또 다른 구현예에서, 상기 직접분화 방법은 하기 단계를 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다 :
(1) 히스톤 메틸전달효소 저해제(Histone methyltransferase inhibitor); activin A, 보충제; 및 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA;를 포함하는 조성물의 존재 하에 체세포를 췌장 내배엽 세포(pancreatic endoderm cell)로 유도하는 단계;
(2) 레티노산 아고니스트, ALK-5 키나아제 억제제 (ALK-5 kinase inhibitor), 헷지호그 억제제, 보충제; 및 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA;를 포함하는 조성물의 존재 하에 췌장 내배엽 세포를 췌장 전구 세포(pancreatic progenitor cell)로 유도하는 단계; 및
(3) MAPK 억제제(MAPK inhibitor), 칼슘 채널 아고니스트, GLP 수용체 아고니스트, 보충제; 및 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA;를 포함하는 조성물의 존재 하에 체세포를 배양하는 단계.
또한, 본 발명은 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA를 유효성분으로 포함하는 당뇨병 또는 췌장암 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 일 구현예에서, 상기 당뇨병은 제1형 당뇨병, 제2형 당뇨병 및 임신성 당뇨병으로 이루어진 군에서 선택될 수 있으나, 이에 제한되는 것은 아니다.
또한, 본 발명은 상기 직접분화 방법에 의해 직접분화 유도된 췌장 베타세포를 약학적으로 허용되는 담체 및 부형제로 이루어진 군에서 선택된 하나 이상과 혼합하는 단계를 포함하는, 당뇨병 또는 췌장암 치료용 세포치료제를 제조하는 방법을 제공한다.
또한, 본 발명은 상기 직접분화 방법에 의해 직접분화 유도된 췌장 베타세포를 유효성분으로 포함하는 당뇨병 또는 췌장암 치료용 세포 치료제를 제공한다.
또한, 본 발명은 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA를 포함하는 조성물을 생체 내에 전달하여 생체 내에서 체세포의 베타세포로의 직접분화를 유도하는 단계를 포함하는, 당뇨병 또는 췌장암 예방 또는 치료 방법을 제공한다.
또한, 본 발명은 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA; 또는 상기 방법에 의해 직접분화 유도된 췌장 베타세포를 유효성분으로 포함하는 약학적 조성물을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 당뇨병 또는 췌장암 예방 또는 치료 방법을 제공한다.
또한, 본 발명은 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA; 또는 상기 방법에 의해 직접분화 유도된 췌장 베타세포를 유효성분으로 포함하는 약학적 조성물의 당뇨병 또는 췌장암 예방 또는 치료 용도를 제공한다.
또한, 본 발명은 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA; 또는 상기 방법에 의해 직접분화 유도된 췌장 베타세포의 당뇨병 또는 췌장암 치료 약제를 제조하기 위한 용도를 제공한다.
또한, 본 발명은 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA를 포함하는 조성물의 체세포의 췌장 베타세포로의 직접분화 유도 용도를 제공한다.
또한, 본 발명은 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA를 포함하는 조성물을 포함하는 체세포의 췌장 베타세포로의 직접분화 유도용 키트를 제공한다.
본 발명은 체세포를 마이크로 RNA 및 저분자성 물질을 이용하여 췌장 베타세포로의 직접분화(Reprogramming)하는 방법에 관한 것으로, 본 발명자들은 다양한 분화 유도 물질 등 저분자성 물질과 마이크로 RNA를 병용처리하여 직접분화를 시도한 결과, 췌장 베타세포에서 PDX1의 발현량이 현저히 증가하였으며, 이러한 방법으로 유사 췌장 베타세포를 유도하였을 때 매우 높은 수율로 직접분화 됨을 확인하였다. 또한, 본 발명은 전환된 췌장베타세포를 당뇨병이나 췌장암 환자에게 이식하는 경우 자가 세포를 이용하므로 면역거부반응이 생기지 않으면서 암 발생 가능성도 낮다는 장점이 있어 더욱 안전한 세포치료제 개발에 유용하게 사용될 것으로 기대된다. 또한, 본 발명에 의해 생산된 췌장 베타세포는 당뇨병 또는 췌장암을 예방, 치료 및 개선하기 위한 세포 조성물로 유용하게 이용될 수 있을 것으로 기대된다.
도 1a는 저분자 물질을 이용하여 체세포를 베타세포로 전환하는 방법에 관한 그림이며, 도 1b는 저분자 물질을 이용한 전환조건에 마이크로 RNA를 추가로 넣은 방법을 나타내며, 도 1c는 저분자 물질을 이용하여 전환된 베타세포에서 베타세포 마커인 Pdx1 및 Ins-2가 과발현되는 것을 나타낸 도이다.
도 2a 내지 도 2e는 섬유아세포를 β 세포 유사 세포로 분화하는 단계에서 주요 베타세포 마커의 발현을 나타낸 것이다. * P <0.05, ** P <0.01 및 *** P <0.001. 통계적 유의성은 양방향, 대응 스튜던트 t-검정에 의해 결정되었다. 표시된 데이터는 세 번의 독립적인 실험에서 얻은 평균 ± SEM을 나타낸다.
도 2a는 다양한 종류의 miRNA를 처리한 후 1단계 세포에서 Pdx1 유전자 발현을 비교한 결과를 나타낸 것이다.
도 2b는 1 단계 세포에서 상이한 miR-127 및 miR-709 농도의 조합에 따른 Pdx1 발현 유도 효과를 나타낸 것이다.
도 2c는 조합-3을 사용하여 miR-127 및 miR-709 형질감염한 후, 1 단계 세포에서 Ngn3 전사체 수준을 나타낸 것이다.
도 2d는 miR-127 및 miR-709 (조합-3)로 형질감염된 2단계 세포의 췌장 유전자 발현 프로파일을 qRT-PCR로 확인한 결과를 나타낸 것이다.
도 2e는 miR-127 및 miR-709 (조합-3)로 형질감염된 3단계 세포에서 췌장 β세포 마커를 qRT-PCR로 확인한 결과를 나타낸 것이다.
도 3a 내지 도 3c은 miRNA 모방체 및 본 발명 miRNA(miR-127, miR-709, 및 miR-19b) 조합의 형질감염에 따른 마우스 배아 섬유아세포(MEF)의 증식 능력을 확인한 것이다.
도 3a는 섬유아세포에서 형질감염 효율을 최적화하기 위해 5 'FAM 표지된 대조군 모방체를 형질감염한 결과를 나타낸 것이다. 1단계 배지에서 48시간 동안 형질감염 후 명시야 현미경 이미지(좌측) 및 형광 현미경 이미지(우측)을 나타낸 것이다. 스케일 바 = 100 μm.
도 3b는 qRT-PCR 분석을 사용하여 1단계 배지에서 miR-127, miR-709 및 miR-19b의 다양한 농도 조합에 따른 Pdx1 발현 유도 효과를 나타낸 것이다. * P <0.05, ** P <0.01, *** P <0.001. 통계적 유의성은 양방향, 대응 스튜던트 t-검정에 의해 결정되었다. 표시된 데이터는 세 번의 독립적인 실험에서 얻은 평균 ± SEM을 나타낸다.
도 3c는 분화 1 단계 (48 시간 후)에서 각기 다른 조합의 처리에 따른 MEF의 형태학적 변화를 명시야 현미경 이미지로 나타낸 것이다. 스케일 바 = 100 μm.
도 4a 및 도 4b는 miRNA 모방체 및 본 발명 miRNA(miR-127, 및 miR-709) 조합의 형질감염에 따른 외분비 세포의 일종인 선방 (acinar) 세포 266-6의 췌장 베타세포 관련 마커 발현을 확인한 것이다.
도 4a는 3 단계 배지에서 266-6 세포의 형질 감염 최적화 결과로서, 3단계 배지에서 48시간 동안 형질감염 후 명시야 현미경 이미지(좌측) 및 형광 현미경 이미지(우측)을 나타낸 것이다.
도 4b는 266-6 세포를 miR-127 + miR-709(조합-3)로 형질감염시키고 Pdx1, Ngn3, Insulin-1, Insulin-2, 및 Elastase의 전사 수준을 나타낸 것이다. 조합-3은 선방세포 마커인, Elastase의 발현을 감소시켰다. * P <0.05 및 ** P <0.01. 통계적 유의성은 양방향, 대응 스튜던트 t-검정에 의해 결정되었다. 표시된 데이터는 세 번의 독립적인 실험에서 얻은 평균 ± SEM을 나타낸다.
도 5는 miR-127과 3 단계 저분자물질 조합에 따른 사람의 췌관 세포 Capan-1 세포에서 췌장 베타세포 유전자 발현을 나타낸 것이다. 3단계에서 사용된 저분자 물질인 SB203580 (MAP kinase inhibitor), Nicotinamide (보조제), Exendin-4 (GLP receptor agonist), Bay K-8644 (calcium channel agonist)을 서로 다른 조합으로 miR-127과 처리하여 베타세포 마커 Pax-6 및 MafA의 발현량을 측정한 결과이다.
본 발명자들은 마이크로 RNA 또는 저분자만을 사용하였을 때와 비교하여, 마이크로 RNA와 저분자를 병용 사용한 경우, 마이크로 RNA 단독 혹은 저분자 단독처리 혹은 처리하지 않은 대조군에 비해 췌장 베타세포로의 직접분화가 현저히 잘 됨을 확인하였는 바, 본 발명은 특정 마이크로 RNA를 유효성분으로 포함하는, 체세포의 췌장 베타세포로의 직접분화 유도용 조성물을 제공하며, 보다 구체적으로는miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA를 포함하는 체세포의 췌장 베타세포로의 직접분화 유도용 조성물에 관한 것이다.
이하, 본 발명을 상세히 설명한다.
본 발명에서, "마이크로 RNA(miRNA, microRNA)는 mRNA 번역의 억제 또는 mRNA 분해를 촉진함으로써, 유전자 발현의 음성 조절인자로서의 역할을 하는 ~22 뉴클레오티드 길이의 작은 비-암호화 RNA(small noncoding RNA)이다.
본 발명에서, "miR-127"는 서열번호 1로 표시되는 염기서열을 포함하거나 이루어진 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서, "miR-709"는 서열번호 2로 표시되는 염기서열을 포함하거나 이루어진 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서, "miR-19b"는 서열번호 5로 표시되는 염기서열을 포함하거나 이루어진 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서, miR-127 및 miR-709는 0.1 내지 10 : 1, 1 내지 3 : 1, 1 : 1 내지 3, 또는 1 : 1의 몰농도(M) 비율로 포함된 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서, miR-127, miR-709, 및 miR-19b는 0.1 내지 10 : 0.1 내지 10 : 1의 몰농도(M) 비율, 1 내지 3 : 1 내지 3 : 1 내지 3의 몰농도(M) 비율, 또는 1 : 1 : 1의 몰농도(M) 비율로 포함된 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 췌장 베타세포를 유도함에 있어서, 출발 체세포(모세포)의 종류는 특별히 한정되지 않으며, 임의의 체세포를 이용할 수 있다. 예를 들어, 태아기(embryonic period)의 체세포 이외에 성숙한(matured) 체세포를 이용해도 된다. 유도 췌장 베타세포를 질병의 치료에 이용하는 경우에는 환자로부터 분리된 체세포를 이용하는 것이 바람직하며, 예를 들어, 질병에 관여하는 체세포나 질병치료에 관여하는 체세포 등을 이용할 수 있다. 한편, 본 발명의 체세포는 인간 췌장 유래 세포일 수 있으나, 이에 제한되는 것은 아니다. 상기 체세포는 섬유아세포 (fibroblast), 췌관세포 또는 외분비 세포(exocrine cell) 일 수 있으며, 본 발명에서 체세포는 인간과 마우스, 말, 양, 돼지, 염소, 낙타, 영양, 개 등의 동물 유래의 모든 체세포를 포함한다.
본 발명에서 용어 "췌장 베타세포(pancreatic β cells)"는 "췌장 베타세포 유사 세포" 와 상호 교환되어 사용될 수 있으며, 이는 췌장의 랑게르한스섬을 구성하는 세포의 하나로, 인슐린을 생성 분비하는 세포이다. 췌장 베타세포에 문제가 있을 경우, 인슐린의 생성에 문제가 있어 당뇨병을 유발할 수 있다. 따라서 이와 같은 세포는 췌장의 인슐린 분비가 문제되어 발생하는 당뇨병의 치료에 이용될 수 있다.
본 발명에서 용어 "췌장 전구 세포"는 통상적으로 췌장 내분비 세포 및 췌장 외분비 세포로 분화가능한 내중배엽계 세포이며, 본 발명에서는 췌장 베타 세포로 분화 유도될 수 있다.
본 발명의 일 실시예에서는 체세포에 마이크로 RNA 및 저분자 물질을 처리하여 직접분화된 췌장 베타세포가 췌장 특이성 유전자 마커인 PDX1, Ngn3, Ins-1, 및 Ins-2를 고발현하는 것을 확인하였다.
본 발명에서, 상기 조성물은 miR-19b를 추가로 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서, 상기 조성물은 히스톤 메틸전달효소 저해제 (histone methyltransferase inhibitor), 레티노산 아고니스트(retinoic acid agonist), ALK-5 키나아제 억제제(ALK-5 kinase inhibitor), 헷지호그 억제제(hedgehog inhibitor), MAPK 억제제(MAPK inhibitor), 칼슘 채널 아고니스트, GLP 수용체 아고니스트, 및 보충제로 이루어진 군으로부터 선택된 하나 이상의 저분자 물질을 추가로 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서, 상기 조성물이 히스톤 메틸전달효소 저해제 (histone methyltransferase inhibitor)를 포함하는 경우, 체세포의 췌장 내배엽 세포로의 분화 유도용일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서, 상기 조성물이 레티노산 아고니스트(retinoic acid agonist), ALK-5 키나아제 억제제(ALK-5 kinase inhibitor), 및 헷지호그 억제제(hedgehog inhibitor)를 포함하는 경우, 체세포 또는 췌장 내배엽 세포의 췌장 전구 세포로의 분화 유도용일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서, 상기 조성물이 MAPK 억제제(MAPK inhibitor), 칼슘 채널 아고니스트, 및 GLP 수용체 아고니스트를 포함하는 경우, 췌장 베타세포의 성숙화 유도용일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 용어 "성숙(maturation)"이라 함은 췌장 베타세포로 유도된 세포가 보다 완벽한 활성을 갖는 베타세포로 전환되는 것을 의미한다.
본 발명에서 용어 "히스톤 메틸전달효소 저해제(Histone methyltransferase inhibitor)"는 공여자의 메틸기를 수용자로 옮기는 것을 촉매하는 효소를 일컫는 것이다. 본원에 사용될 수 있는 히스톤 메틸전달효소 저해제는 BIX01294 (2-(Hexahydro-4-methyl-1H-1,4-diazepin-1-yl)-6,7-dimethoxy-N-[1-(phenylmethyl)-4-piperidinyl]-4-quinazolinamine), 데시타빈(Decitabine, 5-aza-2'-deoxycytidine, DAC), 제불라린 (Zebularine), 3'-데아자네플라노신 A 하이드로클로리드 (3'-Deazaneplanocin A hydrochloride), 로메구아트리브 (Lomeguatrib), 및 카에토신 (Chaetocin, 2,2',3S,3'S,5aR,5'aR,6,6'-octahydro-3,3'-bis(hydroxymethyl)-2,2'-dimethyl-[10bR,10'bR(11aS,11'aS)-bi-3,11a-epidithio-11aH-pyrazino[1',2':1,5]pyrrolo[2,3-b]indole]-1,1',4,4'-tetrone)으로 이루어진 군에서 선택된 것일 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어 "레티노산 아고니스트(retinoic acid agonist)"는, 바람직하게는 레티노산 수용체 아고니스트(RAR agonist)일 수 있으며, TTNPB (4-[(E)-2-(5,6,7,8-Tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl]benzoic acid, Arotinoid acid), 피탄산(phytanic acid), 및 레티노산(retinoic acid, RA)으로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 제한되지 않는다. RAR 수용체는 RAR 반응 요소(RARE) 라고 알려진 DNA 서열 요소에 레티노이드 X 수용체(RXR 이라고 알려짐) 와의 이종이량체의 형태로 결합함으로써 전사를 활성화시킨다. 종래 공지 기술은 RAR 유형 수용체 리간드인 다수의 화합물을 포함하고 있다. 종래 기술 문서 중에, 언급할 수 있는 예로는, 삼방향족 화합물을 기재하고 있는 특허 US 6150413, 스틸벤 화합물을 기재하고 있는 특허 US 6214878, 또는 이환식 또는 삼환식 분자 군을 기재하고 있는 특허 US 6218128 이 포함된다. 본 발명의 배지는 레티노산 아고니스트를 0.01 nM 내지 30 nM, 0.01 nM 내지 20 nM, 0.01 nM 내지 10 nM, 0.1 nM 내지 30 nM, 0.01 nM 내지 20 nM, 0.01 nM 내지 10 nM, 0.1 nM 내지 8 nM, 0.1 nM 내지 6 nM, 0.1 nM 내지 3 nM, 0.1 nM 내지 2 nM, 0.1 nM 내지 1 nM, 0.1 nM 내지 0.8 nM, 0.1 nM 내지 0.7 nM, 0.3 nM 내지 1 nM, 0.3 nM 내지 0.7 nM, 또는 약 0.5 nM 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 있어서, "ALK-5 키나아제 억제제(ALK-5 kinase inhibitor)"는 TGF-β 타입 I 리셉터에 결합하여 TGF-β I의 정상적인 신호전달 과정을 방해하는 물질을 의미하며, TGF-β 타입 I(Transforming growth factor-β type I)은 세포증식, 분화 및 다양한 종류의 세포에 다양한 작용을 하는 다기능성 펩타이드로서, 이러한 다기능성은 지방세포형성, 근세포형성, 골세포형성, 상피세포 분화 등 여러 조직의 성장 및 분화에서 중추적인 역할을 한다. 상기 ALK-5 키나아제 억제제 (TGF-β 타입 I 리셉터 억제제)는 RepSox(1,5-Naphthyridine, 2-[3-(6-methyl-2-pyridinyl)-1H-pyrazol-4-yl]); SB525334(6-(2-tert-butyl-4-(6-methylpyridin-2-yl)-1H-imidazol-5-yl)quinoxaline); GW788388(4-(4-(3)-(pyridin-2-yl)-1H-pyrazol-4-yl)pyridin-2-yl)-N-(tetrahydro-2H-pyran-4-yl)benzamide); SD-208(2-(5-chloro-2-fluorophenyl)-N-(pyridin-4-yl)pteridin-4-amine); Galunisertib(LY2157299, 4-(2-(6-methylpyridin-2-yl)-5,6-dihydro-4H-pyrrolo[1,2-b]pyrazol-3-yl)quinoline-6-carboxamide); EW-7197(N-(2-fluorophenyl)-5-(6-methyl-2-pyridinyl)-4-[1,2,4]triazolo[1,5-a]pyridin-6-yl-1H-imidazole-2-methanamine); LY2109761(7-(2-morpholinoethoxy)-4-(2-(pyridin-2-yl)-5,6-dihydro-4H-pyrrolo[1,2-b]pyrazol-3-yl)quinoline); SB505124(2-(4-(benzo[d][1,3]dioxol-5-yl)-2-tert-butyl-1H-imidazol-5-yl)-6-methylpyridine); LY364947(Quinoline, 4-[3-(2-pyridinyl)-1H-pyrazol-4-yl]); SB431542(4-(4-(benzo[d][1,3]dioxol-5-yl)-5-(pyridin-2-yl)-1H-imidazol-2-yl)benzamide); K02288(3)-[(6-Amino-5-(3),4,5-trimethoxyphenyl)-3-pyridinyl]phenol]; 또는 LDN-212854(Quinoline, 5-[6-[4-(1-piperazinyl)phenyl]pyrazolo[1,5-a]pyrimidin-3-yl])를 포함할 수 있으며, 바람직하게는 Repsox일 수 있으나, 이것으로 제한되는 것은 아니다. 본 발명의 배지는 ALK-5 키나아제 억제제를 0.01μM 내지 20μM 포함하는 것일 수 있으며, 바람직하게는 0.1 내지 10μM 포함하는 것일 수 있고, 보다 바람직하게는 0.5μM 내지 5μM, 가장 바람직하게는 0.7μM 내지 1.5μM일 수 있다.
본 발명에서 용어 "헷지호그 억제제(hedgehog inhibitor)"는, 바람직하게는 소닉 헷지호그 억제제(sonic hedgehog inhibitor)일 수 있으며, 보다 바람직하게는 사이클로파민(cyclopamine), 미페프리스톤(mifepristone), GDC-0449(Vismodegib), XL139(BMS-833923), IPI926, IPI609(IPI269609), LDE225, 제르빈, GANT61, 퍼모파민, SAG, SANT-2, 토마티딘, SANT74, SANT75, 제룸본 또는 그의 유도체일수 있으나, 이에 제한되지 않는다. 본 발명의 배지는 헷지호그 억제제를 0.05μM 내지 20μM 포함하는 것일 수 있으며, 바람직하게는 0.1 내지 15μM 포함하는 것일 수 있고, 보다 바람직하게는 0.5μM 내지 10μM, 보다 더 바람직하게는 0.5μM 내지 5μM, 가장 바람직하게는 1μM 내지 3μM일 수 있다.
본 발명에서 용어 "MAPK 억제제"는 미토겐 활성화 단백질 키나아제 [Mitogen activated protein kinases; MAPK]로, 이중 인산화에 의하여 그들의 기질을 활성화시키는 프롤린 작동성 세린/트레오닌 키나아제 패밀리 중 하나의 구성원이다. 공지된 MAPK 억제제는 알려져 있는 P38 키나아제 억제제로, 1-Pyridinyl-2-phenylazole, SB 203580, SKF 86002, SKF 86096, SKF 104351, 1-Aryl-2-pyridinyl/ pyrimidinyl heterocycles, SB 242235, RO-32001195, SX-011, 또는 BIRB-796 일 수 있으나, 이에 제한되지 않으며, 다음 문헌 [G. J. Hanson (Expert Opinions on Therapeutic Patents, 1997, 7, 729-733) J Hynes et al . (Current Topics in Medicinal Chemistry, 2005, 5, 967-985), C. Dominguez et al(Expert Opinions on Therapeutics Patents, 2005, 15, 801-816) and L. H. Pettus & R. P. Wurtz(Current Topics in Medicinal Chemistry, 2008, 8, 1452-1467)]에서 기재되어 있다. 본 발명의 MAPK 억제제는 바람직하게는 sb203580일 수 있으나, 이에 제한되지 않는다. 본 발명의 배지는 MAPK 억제제를 50μM 내지 5000μM, 0.001 내지 2500 μM, 0.01 내지 1000 μM, 0.01 내지 900 μM, 0.01 내지 800 μM, 0.01 내지 700 μM, 0.01 내지 600 μM, 0.01 내지 500 μM, 0.01 내지 400 μM, 0.01 내지 300 μM, 0.01 내지 200 μM, 0.01 내지 100 μM, 0.01 내지 90 μM, 0.01 내지 80 μM, 0.01 내지 70 μM, 0.01 내지 60 μM, 0.01 내지 50 μM, 0.01 내지 40 μM, 0.01 내지 30 μM, 0.01 내지 20 μM, 0.01 내지 10 μM, 0.01 내지 5 μM, 0.01 내지 3 μM, 0.01 내지 2 μM, 0.01 내지 1 μM, 0.5 내지 10 μM, 0.5 내지 7 μM, 0.5 내지 5 μM, 0.5 내지 3 μM, 0.5 내지 1.5 μM, 0.7 내지 1.3 μM, 또는 약 1 μM일 수 있다.
본 발명에서 용어 "칼슘 채널 아고니스트(calcium channel agonist)"는 "칼슘 채널 오프너"로도 명명되며, 칼슘 채널을 통한 이온 전달을 촉진하는 물질이라면 제한되지 않는다. 본 발명의 칼슘 채널 아고니스트는 Bay K-8644, FPL 64179, 및 CGP28392로 이루어진 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되는 것은 아니다. 본 발명의 배지는 칼슘 채널 아고니스트를 0.05μM 내지 20μM 포함하는 것일 수 있으며, 바람직하게는 0.1 내지 15μM 포함하는 것일 수 있고, 보다 바람직하게는 0.5μM 내지 10μM, 보다 더 바람직하게는 0.5μM 내지 5μM, 가장 바람직하게는 1μM 내지 3μM일 수 있다.
본 발명에서 용어 "GLP 수용체 아고니스트(GLP receptor agonist)"는 구체적으로 GLP-1 수용체 아고니스트일 수 있으며, GLP 작용 활성이 있는 모든 펩타이드, 이들의 단편, 전구물질, 변이체나 유도체를 망라하며, GLP 수용체를 활성화시킬 수 있는 물질을 제한없이 포함할 수 있다. 본 발명의 GLP 수용체 아고니스트는 엑센딘-4, 둘라글루티드(Dulaglutide), 엑세나티드(Exenatide), 세마글루티드(Semaglutide), 리라글루티드(Liraglutide), 릭시세나타이드(Lixisenatide), 및 알비글루티드(Albiglutide)로 이루어지는 군으로부터 선택된 하나 이상일 수 있으나, 이에 제한되는 것은 아니다. 본 발명의 배지는 GLP 수용체 아고니스트를 1 내지 500 ng/mL, 1 내지 400 ng/mL, 1 내지 300 ng/mL, 1 내지 200 ng/mL, 1 내지 100 ng/mL, 30 내지 500 ng/mL, 30 내지 400 ng/mL, 30 내지 300 ng/mL, 30 내지 200 ng/mL, 30 내지 100 ng/mL, 30 내지 90 ng/mL, 30 내지 80 ng/mL, 30 내지 70 ng/mL, 40 내지 60 ng/mL, 또는 약 50 ng/mL로 포함하는 것일 수 있다.
본 발명에서 용어 "보충제"는, 2-포스포-L-아스코르브산, B27, 라미닌(laminin), 니코틴아마이드(nicotinamide), 및 N2로 이루어진 군에서 하나 이상 선택된 것일 수 있다.
또한, 본 발명은 MAPK 억제제(MAPK inhibitor), 칼슘 채널 아고니스트, GLP 수용체 아고니스트, 보충제; 및 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA;를 포함하는 조성물의 존재 하에 체세포를 배양하는 단계;를 포함하는 체세포로부터 췌장 베타세포로의 직접분화 방법에 관한 것이다.
본 발명에서, 상기 방법은 (1) 체세포를 췌장 내배엽 세포 (pancreatic endoderm cell)로 유도하는 단계; (2) 췌장 내배엽 세포를 췌장 전구 세포로 유도하는 단계; 및 (3) 췌장 전구 세포를 췌장 베타세포로 유도하는 단계를 포함하거나, 상기 단계로 이루어진 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서, 상기 방법은 (3) 췌장 전구 세포를 췌장 베타세포로 유도하는 단계를 포함하거나, 상기 단계로 이루어진 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서, 상기 방법의 체세포가 섬유아세포인 경우 세 가지 단계를 통해 분화가 필요하지만, 상기 체세포가 췌장 전구 세포의 성질을 갖는 췌관세포 및 외분비세포인 경우, (3)의 조성물의 존재 하에서 체세포로부터 췌장 베타세포로 직접분화할 수 있다.
본 발명에서, 상기 직접분화 방법은 하기 단계를 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다 :
(1) 단계: 히스톤 메틸전달효소 저해제(Histone methyltransferase inhibitor); activin A, 보충제; 및 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA;를 포함하는 조성물의 존재 하에 체세포를 췌장 내배엽 세포(pancreatic endoderm cell)로 유도하는 단계;
(2) 단계: 레티노산 아고니스트, ALK-5 키나아제 억제제 (ALK-5 kinase inhibitor), 헷지호그 억제제, 보충제; 및 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA;를 포함하는 조성물의 존재 하에 췌장 내배엽 세포를 췌장 전구 세포(pancreatic progenitor cell)로 유도하는 단계; 및
(3) 단계: MAPK 억제제(MAPK inhibitor), 칼슘 채널 아고니스트, GLP 수용체 아고니스트, 보충제; 및 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA;를 포함하는 조성물의 존재 하에 체세포를 배양하는 단계.
본 발명의 (1) 단계는, 췌장 베타세포로 분화를 유도할 수 있는 기간이라면 제한이 없이 이루어질 수 있으나, 3 내지 10일, 4 내지 9일, 4 내지 8일, 4 내지 7일, 또는 5 내지 7일 동안 수행될 수 있고, 더욱 바람직하게는 약 6일 동안 수행될 수 있다. 상기 단계의 보충제는 바람직하게는 2-포스포-L-아스코르브산일 수 있다.
상기 (2) 단계의 배양은 제한없이 이루어질 수 있으나, 0.5 내지 8일, 0.5 내지 7일, 1 내지 7일, 2 내지 6일, 3 내지 5일, 또는 약 4일 동안 수행될 수 있다. 다만, 상기 배양 기간은 이에 제한되는 것은 아니다. 상기 (2) 단계의 보충제는 바람직하게는 2-포스포-L-아스코르브산일 수 있다.
본 발명의 (3) 단계는, 상기 분화가 유도된 세포가 성숙할 수 있는 기간이라면 제한이 없이 이루어질 수 있으나, 7 내지 13일, 8 내지 12일, 9 내지 11일, 또는 약 10일 동안 수행될 수 있다. 다만, 상기 배양 기간은 이에 제한되는 것은 아니다. 상기 단계의 보충제는 바람직하게는 2-포스포-L-아스코르브산, 라미닌, B27, 및 니코틴아마이드로 이루어진 군에서 선택된 하나 이상일 수 있으며, 보다 바람직하게는 2-포스포-L-아스코르브산, 라미닌, B27, 및 니코틴아마이드일 수 있다.
본 발명의 직접분화 방법을 사용하는 경우, 종래의 알려진 줄기세포 분화 방법 및 화학적 세포 분화 방법과 비교하여, 보다 면역 거부 반응이 생기지 않으면서도, 암 발생 가능성이 없다는 장점이 있다.
본 발명의 용어 "배지"는 당업계에 알려진 기본 배지를 제한 없이 사용할 수 있다. 기본 배지는 인위적으로 합성하여 제조할 수 있으며, 상업적으로 제조된 배지를 사용할 수도 있다. 상업적으로 제조되는 배지의 예를 들면, DMEM(Dulbecco's Modified Eagle's Medium), MEM(Minimal Essential Medium), BME(Basal Medium Eagle), RPMI 1640, F-10, F-12, α-MEM(α-Minimal essential Medium), G-MEM(Glasgow's Minimal Essential Medium) 및 Iscove's Modified Dulbecco's Medium 등이 있으나, 이에 한정되는 것은 아니며, DMEM 배지일 수 있다.
상기 체세포를 배양하는 배양액은 당해 분야에서 섬유아세포 배양에 통상적으로 사용되는 배지 배양액를 모두 포함한다. 배양에 사용되는 배양액은 일반적으로 탄소원, 질소원 및 미량원소 성분을 포함한다.
또한, 본 발명은 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA를 포함하는 조성물을 포함하는 체세포의 췌장 베타세포로의 직접분화 유도용 키트를 제공한다.
본 발명에서, 상기 키트는 세포 배양 접시를 추가로 포함할 수 있으나, 이에 제한되는 것은 아니다.
상기 세포 배양 접시는 세포 배양 용기를 말하고, 배양 접시의 재질, 크기, 및 모양과 관계없이 세포 배양 용기를 포함한다. 상기 세포 배양 접시는 부유 배양(suspension culture)용 배양 접시 또는 부착 배양(adherent culture)용 배양 접시일 수 있다.
체세포를 직접분화(Direct conversion) 방법을 이용하여 췌장 베타세포로 유도하는 대부분의 방법은 외부 유전자를 도입하는 방식으로 이루어지고 있다. 다만, 바이러스를 이용하여 유전자를 도입하는 것은 외부 유전자의 무작위적인 인테그레이션(integration)으로 인한 유전적 불안정성(genomic instability)을 야기하여, 향후 환자에 임상적용 시 암이 발생할 가능성이 있다. 이러한 이유로 인해 점차적으로 외부 유전자를 주입하지 않고 저분자성 물질(small molecule)을 이용하는 방법들이 제시되고 있는 실정이나 최근 다양한 저분자성 화합물들을 이용하여 직접분화를 유도하는 연구가 활발하게 진행되고 있음에도 불구하고 최소한 하나의 유전자는 이용되고 있으며, 유전자 도입 없이는 여전히 인간 체세포로부터 원하는 세포로 전환할 수 없는 상태이다.
그러나, 본 발명은 외부 유전자의 도입 없이 마이크로 RNA 혹은 마이크로 RNA와 저분자물질을 조합한 조성물을 처리하여 환자의 체세포로부터 췌장 베타세포를 유도하는 유전적 안정성이 확보된 방법으로써, 기존의 유전자를 이용한 세포전환 방법의 문제인 유전적 결손을 근본적으로 해결하면서, 암 발생 가능성을 낮추기 위하여 고안된 것이다.
본 발명에서는 마이크로 RNA 단독; 혹은 저분자성 물질과 마이크로 RNA의 조합을 이용하여 체세포를 췌장 베타세포로 직접분화하였다. 이에, 본 발명의 마이크로 RNA는 그 자체로서 당뇨병 또는 췌장암 치료제로 사용될 수 있을 것이며, 환자를 위한 세포치료제를 제조할 수 있어 활용 가능성이 매우 높다.
따라서, 본 발명은 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA를 유효성분으로 포함하는 당뇨병 또는 췌장암 예방 또는 치료용 약학적 조성물에 관한 것이다.
또한, 본 발명은 상기 직접분화 방법에 의해 직접분화 유도된 췌장 베타세포를 유효성분으로 포함하는 당뇨병 또는 췌장암 치료용 세포 치료제를 제공한다.
또한, 본 발명은 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA를 포함하는 조성물을 생체 내에 전달하여 생체 내에서 체세포의 베타세포로의 직접분화를 유도하는 단계를 포함하는, 당뇨병 또는 췌장암 예방 또는 치료 방법을 제공한다.
본 발명에서 치료 또는 예방의 대상인 "당뇨병"은 췌장의 베타세포에서 생성되는 인슐린 호르몬 부족 또는 인슐린 저항성의 이상과 나아가 이러한 두 가지 모두의 결함으로 발생하는 고혈당을 특징으로 하는 대사장애증후군이다. 이러한 당뇨병은 인슐린 의존형 당뇨병(IDDM, Type 1)과 인슐린 저항 및 인슐린 분비 손상에 의해 발생하는 인슐린 비의존형 당뇨병(NIDDM, Type 2)으로 나눌 수 있다. 제1형과 제2형 당뇨병 모두에서 심장 질환, 장 질환, 안과 질환, 신경 질환, 뇌졸중 등과 같은 다양한 합병증이 발생하게 되는데, 이는 장시간 동안 혈당과 인슐린 수준이 상승하여 만성신경질환과 심혈관질환이 발생하게 되고 단시간의 저혈당과 고혈당 반응으로 급성 합병증을 야기시키게 되는 것이다. 당뇨병은 고혈당이 만성으로 지속되면서 당질 대사뿐만 아니라 지질 및 단백질 대사 장애도 함께 일으킨다. 그 병태는 다양하며 직접 고혈당에 기인하는 것으로 망막, 신장, 신경, 심혈관계 등에서 당뇨병성 말초신경장해, 당뇨병성 망막증, 당뇨병성 신증, 당뇨병성 백내장, 각막증, 당뇨병성 동맥경화증 등이 있다.
당뇨병을 일으키고 심화시키는 중요한 병리 현상의 하나는 고혈당에 의한 췌장 β세포의 사멸이다. 본 발명자들은 체세포를 췌장 베타세포로 전환 시킴으로써 당뇨병 치료에 이용가능한 베타세포를 생산하는 방법을 제공하고 있다. 이에 따라, 본 발명에서의 당뇨병은 글루코스 독성에 의하여 유발되는 당뇨병 또는 심화 또는 진행된 당뇨병이라면 그 대상이 될 수 있으며, 보다 구체적으로는 제1형 당뇨병, 제2형 당뇨병 및 임신성 당뇨병으로 이루어진 군에서 선택된 것일 수 있다.
본 발명의 "전달"은 투여를 통한 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 miRNA는 약학적으로 허용가능한 염 형태로 포함될 수 있다. 본 발명에서 용어, "약학적으로 허용 가능한 염"이란 약학적으로 허용되는 무기산, 유기산, 또는 염기로부터 유도된 염을 포함한다.
적합한 산의 예로는 염산, 브롬산, 황산, 질산, 과염소산, 푸마르산, 말레산, 인산, 글리콜산, 락트산, 살리실산, 숙신산, 톨루엔-p-설폰산, 타르타르산, 아세트산, 시트르산, 메탄설폰산, 포름산, 벤조산, 말론산, 글루콘산, 나프탈렌-2-설폰산, 벤젠설폰산 등을 들 수 있다. 산부가염은 통상의 방법, 예를 들면 화합물을 과량의 산 수용액에 용해시키고, 이 염을 메탄올, 에탄올, 아세톤 또는 아세토니트릴과 같은 수혼화성 유기 용매를 사용하여 침전시켜서 제조할 수 있다. 또한, 동몰량의 화합물 및 물 중의 산 또는 알코올을 가열하고 이어서 상기 혼합물을 증발시켜서 건조시키거나, 또는 석출된 염을 흡인 여과시켜 제조할 수 있다.
적합한 염기로부터 유도된 염은 나트륨, 칼륨 등의 알칼리 금속, 마그네슘 등의 알칼리 토금속, 및 암모늄 등을 포함할 수 있으나, 이에 제한되는 것은 아니다. 알칼리 금속 또는 알칼리 토금속염은, 예를 들면 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리토 금속 수산화물 용액 중에 용해하고, 비용해 화합물염을 여과한 후 여액을 증발, 건조시켜 얻을 수 있다. 이 때, 금속염으로서는 특히 나트륨, 칼륨 또는 칼슘염을 제조하는 것이 제약상 적합하며, 또한 이에 대응하는 은염은 알칼리 금속 또는 알칼리토 금속염을 적당한 은염(예, 질산은)과 반응시켜 얻을 수 있다.
본 발명의 조성물 내의 상기 miRNA의 함량은 질환의 증상, 증상의 진행 정도, 환자의 상태 등에 따라서 적절히 조절 가능하며, 예컨대, 전체 조성물 중량을 기준으로 0.00001 내지 99.9중량%, 또는 0.001 내지 50중량%일 수 있으나, 이에 한정되는 것은 아니다. 상기 함량비는 용매를 제거한 건조량을 기준으로 한 값이다.
본 발명에 따른 약학적 조성물은 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다. 상기 부형제는 예를 들어, 희석제, 결합제, 붕해제, 활택제, 흡착제, 보습제, 필름-코팅 물질, 및 제어방출첨가제로 이루어진 군으로부터 선택된 하나 이상일 수 있다.
본 발명에 따른 약학적 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 서방형 과립제, 장용과립제, 액제, 점안제, 엘실릭제, 유제, 현탁액제, 주정제, 트로키제, 방향수제, 리모나아데제, 정제, 서방형정제, 장용정제, 설하정, 경질캅셀제, 연질캅셀제, 서방캅셀제, 장용캅셀제, 환제, 틴크제, 연조엑스제, 건조엑스제, 유동엑스제, 주사제, 캡슐제, 관류액, 경고제, 로션제, 파스타제, 분무제, 흡입제, 패취제, 멸균주사용액, 또는에어로졸 등의 외용제 등의 형태로 제형화하여 사용될 수 있으며, 상기 외용제는 크림, 젤, 패치, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 또는 카타플라스마제 등의 제형을 가질 수 있다.
본 발명에 따른 약학적 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 올리고당, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.
제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다.
본 발명에 따른 정제, 산제, 과립제, 캡슐제, 환제, 트로키제의 첨가제로 옥수수전분, 감자전분, 밀전분, 유당, 백당, 포도당, 과당, 디-만니톨, 침강탄산칼슘, 합성규산알루미늄, 인산일수소칼슘, 황산칼슘, 염화나트륨, 탄산수소나트륨, 정제 라놀린, 미결정셀룰로오스, 덱스트린, 알긴산나트륨, 메칠셀룰로오스, 카르복시메칠셀룰로오스나트륨, 카올린, 요소, 콜로이드성실리카겔, 히드록시프로필스타치, 히드록시프로필메칠셀룰로오스(HPMC), HPMC 1928, HPMC 2208, HPMC 2906, HPMC 2910, 프로필렌글리콜, 카제인, 젖산칼슘, 프리모젤 등 부형제; 젤라틴, 아라비아고무, 에탄올, 한천가루, 초산프탈산셀룰로오스, 카르복시메칠셀룰로오스, 카르복시메칠셀룰로오스칼슘, 포도당, 정제수, 카제인나트륨, 글리세린, 스테아린산, 카르복시메칠셀룰로오스나트륨, 메칠셀룰로오스나트륨, 메칠셀룰로오스, 미결정셀룰로오스, 덱스트린, 히드록시셀룰로오스, 히드록시프로필스타치, 히드록시메칠셀룰로오스, 정제쉘락, 전분호, 히드록시프로필셀룰로오스, 히드록시프로필메칠셀룰로오스, 폴리비닐알코올, 폴리비닐피롤리돈 등의 결합제가 사용될 수 있으며, 히드록시프로필메칠셀룰로오스, 옥수수전분, 한천가루, 메칠셀룰로오스, 벤토나이트, 히드록시프로필스타치, 카르복시메칠셀룰로오스나트륨, 알긴산나트륨, 카르복시메칠셀룰로오스칼슘, 구연산칼슘, 라우릴황산나트륨, 무수규산, 1-히드록시프로필셀룰로오스, 덱스트란, 이온교환수지, 초산폴리비닐, 포름알데히드처리 카제인 및 젤라틴, 알긴산, 아밀로오스, 구아르고무(Guar gum), 중조, 폴리비닐피롤리돈, 인산칼슘, 겔화전분, 아라비아고무, 아밀로펙틴, 펙틴, 폴리인산나트륨, 에칠셀룰로오스, 백당, 규산마그네슘알루미늄, 디-소르비톨액, 경질무수규산 등 붕해제; 스테아린산칼슘, 스테아린산마그네슘, 스테아린산, 수소화식물유(Hydrogenated vegetable oil), 탈크, 석송자, 카올린, 바셀린, 스테아린산나트륨, 카카오지, 살리실산나트륨, 살리실산마그네슘, 폴리에칠렌글리콜(PEG) 4000, PEG 6000, 유동파라핀, 수소첨가대두유(Lubri wax), 스테아린산알루미늄, 스테아린산아연, 라우릴황산나트륨, 산화마그네슘, 마크로골(Macrogol), 합성규산알루미늄, 무수규산, 고급지방산, 고급알코올, 실리콘유, 파라핀유, 폴리에칠렌글리콜지방산에테르, 전분, 염화나트륨, 초산나트륨, 올레인산나트륨, dl-로이신, 경질무수규산 등의 활택제;가 사용될 수 있다.
본 발명에 따른 액제의 첨가제로는 물, 묽은 염산, 묽은 황산, 구연산나트륨, 모노스테아린산슈크로스류, 폴리옥시에칠렌소르비톨지방산에스텔류(트윈에스텔), 폴리옥시에칠렌모노알킬에텔류, 라놀린에텔류, 라놀린에스텔류, 초산, 염산, 암모니아수, 탄산암모늄, 수산화칼륨, 수산화나트륨, 프롤아민, 폴리비닐피롤리돈, 에칠셀룰로오스, 카르복시메칠셀룰로오스나트륨 등이 사용될 수 있다.
본 발명에 따른 시럽제에는 백당의 용액, 다른 당류 혹은 감미제 등이 사용될 수 있으며, 필요에 따라 방향제, 착색제, 보존제, 안정제, 현탁화제, 유화제, 점조제 등이 사용될 수 있다.
본 발명에 따른 유제에는 정제수가 사용될 수 있으며, 필요에 따라 유화제, 보존제, 안정제, 방향제 등이 사용될 수 있다.
본 발명에 따른 현탁제에는 아카시아, 트라가칸타, 메칠셀룰로오스, 카르복시메칠셀룰로오스, 카르복시메칠셀룰로오스나트륨, 미결정셀룰로오스, 알긴산나트륨, 히드록시프로필메칠셀룰로오스(HPMC), HPMC 1828, HPMC 2906, HPMC 2910 등 현탁화제가 사용될 수 있으며, 필요에 따라 계면활성제, 보존제, 안정제, 착색제, 방향제가 사용될 수 있다.
본 발명에 따른 주사제에는 주사용 증류수, 0.9%염화나트륨주사액, 링겔주사액, 덱스트로스주사액, 덱스트로스+염화나트륨주사액, 피이지(PEG), 락테이티드 링겔주사액, 에탄올, 프로필렌글리콜, 비휘발성유-참기름, 면실유, 낙화생유, 콩기름, 옥수수기름, 올레인산에칠, 미리스트산 이소프로필, 안식향산벤젠과 같은 용제; 안식향산나트륨, 살리실산나트륨, 초산나트륨, 요소, 우레탄, 모노에칠아세트아마이드, 부타졸리딘, 프로필렌글리콜, 트윈류, 니정틴산아미드, 헥사민, 디메칠아세트아마이드와 같은 용해보조제; 약산 및 그 염(초산과 초산나트륨), 약염기 및 그 염(암모니아 및 초산암모니움), 유기화합물, 단백질, 알부민, 펩톤, 검류와 같은 완충제; 염화나트륨과 같은 등장화제; 중아황산나트륨(NaHSO3) 이산화탄소가스, 메타중아황산나트륨(Na2S2O5), 아황산나트륨(Na2SO3), 질소가스(N2), 에칠렌디아민테트라초산과 같은 안정제; 소디움비설파이드 0.1%, 소디움포름알데히드 설폭실레이트, 치오우레아, 에칠렌디아민테트라초산디나트륨, 아세톤소디움비설파이트와 같은 황산화제; 벤질알코올, 클로로부탄올, 염산프로카인, 포도당, 글루콘산칼슘과 같은 무통화제; 시엠시나트륨, 알긴산나트륨, 트윈 80, 모노스테아린산알루미늄과 같은 현탁화제를 포함할 수 있다.
본 발명에 따른 좌제에는 카카오지, 라놀린, 위텝솔, 폴리에틸렌글리콜, 글리세로젤라틴, 메칠셀룰로오스, 카르복시메칠셀룰로오스, 스테아린산과 올레인산의 혼합물, 수바날(Subanal), 면실유, 낙화생유, 야자유, 카카오버터+콜레스테롤, 레시틴, 라네트왁스, 모노스테아린산글리세롤, 트윈 또는 스판, 임하우젠(Imhausen), 모놀렌(모노스테아린산프로필렌글리콜), 글리세린, 아뎁스솔리두스(Adeps solidus), 부티룸 태고-G(Buytyrum Tego-G), 세베스파마 16 (Cebes Pharma 16), 헥사라이드베이스 95, 코토마(Cotomar), 히드록코테 SP, S-70-XXA, S-70-XX75(S-70-XX95), 히드록코테(Hydrokote) 25, 히드록코테 711, 이드로포스탈 (Idropostal), 마사에스트라리움(Massa estrarium, A, AS, B, C, D, E, I, T), 마사-MF, 마수폴, 마수폴-15, 네오수포스탈-엔, 파라마운드-B, 수포시로(OSI, OSIX, A, B, C, D, H, L), 좌제기제 IV 타입 (AB, B, A, BC, BBG, E, BGF, C, D, 299), 수포스탈 (N, Es), 웨코비 (W, R, S, M ,Fs), 테제스터 트리글리세라이드 기제(TG-95, MA, 57)와 같은 기제가 사용될 수 있다.
경구 투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 추출물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다.
경구 투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜 (propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다.
본 발명에 따른 약학적 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에 있어서, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.
본 발명에 따른 약학적 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 본 발명이 속하는 기술분야에 통상의 기술자에 의해 용이하게 결정될 수 있다.
본 발명의 약학적 조성물은 개체에게 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구 복용, 피하 주사, 복강 투여, 정맥 주사, 근육 주사, 척수 주위 공간(경막내) 주사, 설하 투여, 볼점막 투여, 직장 내 삽입, 질 내 삽입, 안구 투여, 귀 투여, 비강 투여, 흡입, 입 또는 코를 통한 분무, 피부 투여, 경피 투여 등에 따라 투여될 수 있다.
본 발명의 약학적 조성물은 치료할 질환, 투여 경로, 환자의 연령, 성별, 체중 및 질환의 중등도 등의 여러 관련 인자와 함께 활성성분인 약물의 종류에 따라 결정된다.
본 발명에서 "개체"란 질병의 치료를 필요로 하는 대상을 의미하고, 척추동물이라면 제한되지 아니하나, 구체적으로는 인간, 마우스, 래트, 기니어 피그, 토끼, 원숭이, 돼지, 말, 소, 양, 영양, 개, 고양이, 어류 및 파충류에 적용될 수 있다.
본 발명에서 "투여"란 임의의 적절한 방법으로 개체에게 소정의 본 발명의 조성물을 제공하는 것을 의미한다.
본 발명에서 "예방"이란 목적하는 질환의 발병을 억제하거나 지연시키는 모든 행위를 의미하고, "치료"란 본 발명에 따른 약학적 조성물의 투여에 의해 목적하는 질환과 그에 따른 대사 이상 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미하며, "개선"이란 본 발명에 따른 조성물의 투여에 의해 목적하는 질환과 관련된 파라미터, 예를 들면 증상의 정도를 감소시키는 모든 행위를 의미한다.
또한, 본 발명은 상기 방법에 의해 분화 유도된 췌장 베타세포를 약학적으로 허용되는 담체 및 부형제로 이루어진 군에서 선택된 하나 이상과 혼합하는 단계를 포함하는, 당뇨병 또는 췌장암 치료용 세포치료제를 제조하는 방법에 관한 것이다.
본 발명의 용어 "세포치료제 (cellular therapeutic agent)"란, 인간으로부터 분리, 배양 및 특수한 조작을 통해 제조된 세포 및 조직으로 치료, 진단 및 예방의 목적으로 사용되는 의약품 (미국 FDA 규정)으로서, 세포 혹은 조직의 기능을 복원시키기 위하여 살아있는 자가, 동종, 또는 이종세포를 체외에서 증식 선별하거나 다른 방법으로 세포의 생물학적 특성을 변화시키는 등의 일련의 행위를 통하여 이러한 세포가 질병의 치료, 진단 및 예방의 목적으로 사용되는 의약품을 의미한다.
본 발명의 세포치료제 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여 투여될 수 있다. 비경구 투여, 예를 들어, 복강 내 투여, 정맥 내 투여, 근육 내 투여, 피하 투여, 피내 투여될 수 있으나, 이에 제한되지는 않는다.
상기 조성물은 세포 치료에 일반적으로 사용되는 약제학적 담체와 함께 적합한 형태로 제형화될 수 있다. '약학적으로 허용되는'이란 생리학적으로 허용되고 인간에게 투여될 때, 통상적으로 위장 장애, 현기증 등과 같은 알레르기 반응 또는 이와 유사한 반응을 일으키지 않는 조성물을 말한다. 약학적으로 허용되는 담체로는 예를 들면, 물, 적합한 오일, 식염수, 수성 글루코스 및 글리콜 등과 같은 비경구 투여용 담체 등이 있으며 안정화제 및 보존제를 추가로 포함할 수 있다. 적합한 안정화제로는 아황산수소나트륨, 아황산나트륨 또는 아스코르브산과 같은 항산화제가 있다. 적합한 보존제로는 벤즈알코늄 클로라이드, 메틸- 또는 프로필-파라벤 및 클로로부탄올이 있다. 그 밖의 약학적으로 허용되는 담체로는 다음의 문헌에 기재되어 있는 것을 참고로 할 수 있다 (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).
본 발명에 따른 세포 치료제는 당해 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 본 발명의 세포 치료제에 포함되는 약학적으로 허용되는 담체는 제제 시에 통상적으로 이용되는 것으로서, 락토오스, 덱스트로오스, 수크로오스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알지네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로오스, 폴리비닐피롤리돈, 셀룰로오스, 물, 시럽, 메틸 셀룰로오스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 또는 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 세포치료제는 상기 성분들 이외에 윤활제, 습윤제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다.
또한, 상기 조성물은 세포치료제가 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수도 있다.
본 발명의 세포치료제 조성물은 질환의 치료를 위하여 치료학적으로 유효한 양의 세포치료제를 포함할 수 있다. "치료학적으로 유효한 양 (therapeutically effective amount)"은 연구자, 수의사, 의사 또는 기타 임상에 의해 생각되는 조직계, 동물 또는 인간에서 생물학적 또는 의학적 반응을 유도하는 유효 성분 또는 약학적 조성물의 양을 의미하는 것으로, 이는 치료되는 질환 또는 장애의 증상의 완화를 유도하는 양을 포함한다.
본 발명의 조성물에 포함되는 세포치료제는 원하는 효과에 따라 변화될 것임은 당업자에게 자명하다. 그러므로 최적의 세포치료제 함량은 당업자에 의해 쉽게 결정될 수 있으며, 질환의 종류, 질환의 중증도, 조성물에 함유된 다른 성분의 함량, 제형의 종류, 및 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료기간, 동시 사용되는 약물을 비롯한 다양한 인자에 따라 조절될 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 포함하는 것이 중요하다. 예컨대, 본 발명의 줄기세포의 1일 투여량은 1.0×104 내지 1.0×1011 세포/kg 체중, 바람직하게는 1.0×105 내지 1.0×109 세포/kg 체중을 1회 또는 수회로 나누어 투여할 수 있다. 그러나, 유효성분의 실제 투여량은 치료하고자 하는 질환, 질환의 중증도, 투여경로, 환자의 체중, 연령 및 성별 등의 여러 관련 인자에 비추어 결정되어야하는 것으로 이해되어야 하며, 따라서, 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
또한, 본 발명의 치료방법에서 본 발명의 세포치료제를 유효성분으로 포함하는 조성물은 직장, 정맥내(intravenous therapy, i.v), 동맥내, 복강내, 근육내, 흉골내, 경피, 국소, 안구내 또는 피내 경로를 통해 통상적인 방식으로 투여할 수 있다.
본 발명은 포유동물에게 치료학적으로 유효한 양의 본 발명의 상기 세포치료제 조성물을 투여하는 것을 포함하는 치료방법을 제공한다. 여기에서 사용된 용어 포유동물은 치료, 관찰 또는 실험의 대상인 포유동물을 말하며, 바람직하게는 인간을 말한다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실시예 1. 실험 준비 및 실험 방법
1-1. 세포배양
세포는 엑소좀이 고갈된 15 % 태아 소 혈청(FBS)(Gibco), 1 % 페니실린-스트렙토 마이신(Welgene) 및 55μM β 메르캅토 에탄올(β-ME)(Sigma)이 첨가된 DMEM(dulbecco's minimal essential medium, Welgene)에 넣고 5 % CO2 조건에서 37℃에서 배양되었다.
1-2. 마우스로부터의 외분비 세포 분리
외분비 조직은 [G.C. Chau, D.U. Im, T.M. Kang, J.M. Bae, W. Kim, S. Pyo, E.-Y. Moon, S.H.J.J.C.B. Um, mTOR controls ChREBP transcriptional activity and pancreatic β cell survival under diabetic stress, 216(7) (2017) 2091-2105.] 문헌을 참고하여, 8 주령 수컷 마우스 2 마리로부터 분리되었다. 먼저, 마우스 췌장에 HBSS (Hank's Balanced Salt Solution, 웰진)에 용해된 여과된 0.8 mg/ml 콜라게네이즈 P (Roche)를 주사하였다. 췌장조직은 간헐적으로 흔들면서 37 ℃에서 15 분 동안 배양되었다. 소화된 현탁액을 여과하기 위해 400㎛ 메쉬 (Sigma)를 사용하였고, 바이오콜 (biocoll) 분리 용액 (Merck-Millipore) 상에서 밀도 구배 원심 분리를 사용하여 모든 외분비 세포를 섬으로부터 분리하였다. 그리고나서, 세포를 20 ℃에서 20 분 동안 2000rpm에서 원심 분리하였다. 바이오콜 구배의 상부층은 선방 (acinar) 세포를 함유 한 반면, 펠렛은 섬 및 선방 세포를 제외한 췌관 (ductal) 세포를 포함한 다른 모든 세포를 함유한다. 선방 세포와 췌관 세포를 조심스럽게 수집하고 함께 혼합한 후 70μm 메쉬 (Falcon)를 통해 여과하였다. 이후, 세포를 1X HBSS로 3 회 세척하고 4 ℃에서 3 분 동안 1200rpm에서 원심분리하고 10 % FBS 및 1 % P/S (penicillin/streptomycin)가 보충된 RPMI (Roswell Park Memorial Institute) 배지를 함유하는 10cm 조직 배양 접시 (TPP)에 접종하고 95%의 공기 및 5%의 CO2 하에서 배양하였다.
1-3. 형질감염
MEF(12 웰 플레이트 당 5×104 세포/웰)는 제조업체의 지침에 따라 jetMESSENGER(Polyplus-Transfection, Illkirch, France) 시약을 사용하여 형질감염하였다. 감염시키고자 하는 miRNA(200 nM)(QIAGEN, Hilden, Germany)를 mRNA 완충액에 희석하고 2 μL의 jetMESSENGER 시약을 첨가하였다. 혼합물은 실온에서 20분 동안 인큐베이션하고 MEF에 첨가한 다음, 24시간 후에 단계 특이적 배지를 첨가하였다.
266-6 세포(8×104 세포/웰)는 제조사의 프로토콜에 따라 RNAiMAX 시약(Thermo Fisher Scientific, Inc., Waltham, MA, USA)을 사용하여 형질감염하였다. 단계 특이적 배지에서 형질감염을 수행하였고, 형질감염된 세포를 원하는 시간 동안 인큐베이션하였다.
1-4. 면역염색
3 단계의 분화를 완료한 후, 분화된 β-유사 세포를 종래 문헌(Int. J. Mol. Sci. 2020, 21, 665)에 기재된 바와 같이 수확하고 면역염색하였다. 샘플은 형광 현미경(IX71S1F3, Olympus, Tokyo, Japan)을 사용하여 시각화하였다. 사용한 항체는 하기 표 1에 나타내었다.
Figure PCTKR2021012922-appb-img-000001
1-5. 마이크로 RNA를 이용한 췌장 계통으로의 MEF 직접분화
도 1에 나타난 바와 같이, 마우스 배아 섬유아세포(mouse embryonic fibroblasts, MEF) 직접분화는 기존 프로토콜을 수정하여 수행하였다. 세포 직접분화를 위하여, 녹아웃 DMEM(KO-DMEM)(Gibco)을 기초배지로 사용하였다. 녹아웃 DMEM은 15% 녹아웃 혈청 대체물 (Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA), 5% FBS (exosome depleted), 1% 글루타맥스 (Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA), 1% 비필수 아미노산 (NEAA, Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA), 및 0.5 mM β-ME (Sigma Aldrich, Inc., Saint Louis, MO, USA)을 포함한다.
본 발명의 3단계 분화 프로토콜은 다음과 같다: 1단계, MEF에서 췌장 내배엽 세포로 분화; 2단계, 췌장 내배엽 세포에서 췌장 전구체 유사 세포로 분화; 3단계, 췌장 전구체 유사 세포에서 베타세포 유사 세포로 분화.
먼저, 5×104 MEF 세포/웰을 10% FBS 및 1×P/S를 포함하는 DMEM의 12웰 조직 배양 플레이트에 1일 동안 분주하였다. 다음날, 1단계 분화 배지를 첨가하였다. 1단계 분화 배지는 1 μM Bix-01294 (MedchemExpress, Monmouth Junction, NJ, USA), 280 μM 2-포스포-L-아스코르브산 (pVc, Sigma Aldrich, Inc., Saint Louis, MO, USA), 및 50 ng/mL 액티빈 A (R&D Systems, Minneapolis, MI, USA)를 포함한다. 배지 첨가 후 6일 동안 세포를 유지시켰다. 사용된 배지는 3일마다 교체되었다. 6일 뒤 2단계 분화 배지를 4일간 첨가하였다. 2단계 분화 배지는 저분자 물질로서 0.5 nM TTNPB (MedchemExpress, Monmouth Junction, NJ, USA), 1 μM repsox (MedchemExpress, Monmouth Junction, NJ, USA), 2 μM 사이클로파민 (Tocris, Bristol, UK), 및 280 μM pVc를 포함한다.
3단계 분화배지는 1 μM SB203580 (MedchemExpress, Monmouth Junction, NJ, USA), 1× 인슐린-트랜스페린-셀레늄 (ITS, Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA), 10 mM 니코틴아마이드 (Sigma Aldrich, Inc., Saint Louis, MO, USA), 1 μg/mL 라미닌 (Sigma Aldrich, Inc., Saint Louis, MO, USA), 50 ng/mL 엑센딘-4 (MedchemExpress, Monmouth Junction, NJ, USA), 2 μM Bay K-8644 (Tocris, Bristol, UK), 1× B27 플러스 보충제(Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA), 및 pVc를 포함한다. 3단계 배지에서는 세포를 10일간 유지시켰다.
단계 단계 특징 배지 성분
1 단계 내배엽 세포로 분화 BIX01294(BIX), 포스포-L-아스코르브산(pVC), activin A 및 마이크로 RNA
2 단계 췌장 전구체 세포로 분화 TTNPB, repsox, 사이클로파민, 및 pVC, 마이크로 RNA
3 단계 베타세포 세포로 분화 SB203580, 니코틴 아미드, Extendin-A, Bay K-8644, 마이크로 RNA
마이크로 RNA
NAME SEQUENCE 서열번호
miR-127-5p CUGAAGCUCAGAGGGCUCUGAU 1
miR-709 GGAGGCAGAGGCAGGAGGA 2
miR-127 MI0000154 precursor CCAGCCUGCUGAAGCUCAGAGGGCUCUGAUUCAGAAAGAUCAUCGGAUCCGUCUGAGCUUGGCUGGUCGG 3
miR-709 MI0004693 precursor UGUCCCGUUUCUCUGCUUCUACUCAGAAGUGCUCUGAGCAUAGAACUGUCCUGUUUGAGCAGCACUGGGGAGGCAGAGGCAGGAGGAU 4
miR-19b ugugcaaauccaugcaaaacuga 5
1-6. qRT-PCR을 이용한 유전자 발현 연구
제조사의 Trizol(Invitrogen) 방법을 이용하여 전체 세포 RNA를 추출하였다. 전체 RNA 1ug을 PrimeScript 1st strand cDNA Synthesis Kit(Takara Clontech)를 사용하여 cDNA 합성에 사용하였다. 췌장 계통 특이적 마커 분석은 Real Time PCR (Biorad)을 사용하여 iQ SYBR Green Supermix(Biorad)로 수행되었다. qRT-PCR 조건은 95 ℃에서 30 초, 60 ℃에서 15 초, 72 ℃에서 15 초의 40 주기였다. 이 연구에서 사용된 프라이머는 하기 표 4과 같다.
Figure PCTKR2021012922-appb-img-000002
1-7. 통계적 분석
통계적 유의성은 양방향, 대응 스튜던트 t-검정에 의해 결정되었다. 표시된 데이터는 세 번의 독립적인 실험을 통해 수득하였으며, 평균 ± SEM로 나타내었다. p < 0.05는 통계적으로 유의한 것으로 간주하였다. 통계 분석은 Prism v8.0(GraphPad Software, Inc., San Diego, CA, USA)을 사용하여 수행하였다.
실시예 2. 마이크로 RNA를 사용한 MEF의 β 유사 세포로의 전환
dox 유도성 MEF를 저분자화합물을 사용하는 세포와 같은 내배엽으로의 전환하고, 기능성 췌장 베타세포와 같은 세포 생성을 위한 연구는 직접분화 접근법을 위한 기초를 제공하였다. 이에, 본 발명자들은 마이크로 RNA가 전사변화 물질로 작용한다면, 후성유전 수정 인자(epigenetic modifier) BIX01294 및 pVC 등과 같은 저분자 물질의 존재 유무에 따라 1단계 배지에서 MEF 내 췌장(내분비) 특이적인 전사 변화를 유도할 것이라고 가정하였다.
도 1a에 나타난 바와 같이, 저분자 화합물 분화 프로토콜은 3 가지 단계를 포함한다 : 1단계, MEF에서 췌장 내배엽 세포(PEC)로; 2단계, PEC에서 췌장 선조 유사 세포(PPLC)로; 및 3단계, PPLC를 β-유사 세포(BLC)로 전환.
본 발명자들은 도 1a의 3단계 프로토콜에 마이크로 RNA를 첨가하는 최종 프로토콜을 확립하였다 (도 1b 참조).
한편, PDX1의 발현이 증가한 것은 마이크로 RNA 비처리 세포와 비교하여 췌장 특이적 프로그램이 시작되었음을 나타낸다. 췌장의 형성은 완성 내배엽의 췌장 내배엽으로의 분화로부터 시작된다. 췌장 내배엽 세포는 췌장-십이지장 호메오박스(homeobox) 유전자, PDX1을 발현한다. PDX1의 부재 하에서, 췌장은 복측 원기(ventral bud) 및 배측 원기(dorsal bud)의 형성 이상으로 발달하지 못한다. 따라서, PDX1 발현이 췌장 기관형성에서 중요한 단계를 특징짓는다. 성숙한 췌장은 다른 세포형 중에서도 외분비 조직 및 내분비 조직을 포함한다. 외분비 및 내분비 조직은 췌장 내배엽의 분화로부터 생성된다. 이에 본 발명자들은 췌장 베타세포 유사 세포로의 분화를 확인하기 위하여, Pdx1의 발현을 확인하였다.
도 1c에 나타난 바와 같이, 대조군 배지(기저 배지 사용)를 사용한 것과 비교하여 도 1a의 저분자 화합물 분화 프로토콜을 사용한 경우, MEF는 Pdx1 및 인슐린-2가 2.9배 및 2.6배로 발현 유도됨을 확인하였다.
따라서, 본 발명의 저분자 화합물 분화 프로토콜을 췌장 베타세포 직접분화에 사용하기에 적합함을 확인하였다.
실시예 3. 마이크로 RNA 단독의 pdx1 분화 효능 확인
기존 연구에서, 본 발명자들은 MIN6 유래 엑소좀에 miR-486, miR-127, miR-19b, miR-494 및 miR-709 등 다양한 miRNA가 풍부할 뿐만 아니라, 췌장 계통과 관련이 있음을 확인하였다. 그에 따라, 본 발명자들은 상기 miRNA가 췌장 베타세포 마커의 발현을 개별적으로, 또는 조합하여 사용한 경우에 향상시킬 수 있는지 여부를 조사하였다.
먼저, MEF를 miRNA 모방체로 형질감염시켜 자연적으로 발생하는 miRNA를 시뮬레이션하기 전에, 5' FAM(플루오레세인 아미다이트) 표지 대조군 miRNA 모방체를 사용하여 형질감염 실험을 최적화하였다. 대조군 miRNA 모방체(mimic)는 마우스, 쥐 또는 인간 miRNA와 상동성이 없는 것으로 사용하였다. 또한, 1단계 분화시 더 높은 수준의 Pdx1을 유도하는 miRNA를 선별하기 위하여, 개별적으로 형질감염을 수행하였다.
도 2a에 나타난 바와 같이, 다양한 miRNA 중에서도 miR-127 및 miR-709가 Pdx1의 발현 유도 효과가 가장 우수함을 확인하였다. 구체적으로, miR-127은 모방체의 3.9배, miR-709는 모방체의 3.2배, miR-19b는 1.6배를 유도하는 것으로 나타났다.
이하 실시예에서는 Pdx1 발현 유도 효과가 큰 상기 3가지 miRNA를 사용하여 실험을 진행하였다.
실시예 4. 마이크로 RNA 조합의 Pdx1 분화 효능 확인
실시예 3에서 Pdx1 발현 유도 효과가 큰 miR-127 및 miR-709를 농도별로 조합하여, 췌장 유전자 마커의 발현을 증가시키는지 확인하였다.
miR-127 miR-709
조합-1 100nM 100nM
조합-2 133nM 66nM
조합-3 66nM 133nM
도 2b에 나타난 바와 같이, miR-127+miR-709 조합-3의 형질감염 후 1단계에서 가장 높은 Pdx1의 전사 수준이 관찰되었다.
또한, 도 2c에 나타난 바와 같이, Ngn3의 발현 수준 또한 유의하게 상승조절되는 것을 확인할 수 있었다. Ngn3의 조기 활성화는 췌장 전구 세포의 풀(pool)을 고갈시키면서 글루카곤 양성 세포를 배타적으로 유도하는 것으로 알려져 있다.
또한, 도 2d에 나타난 바와 같이, miR-127+miR-709 조합-3의 형질감염 후 2단계에서도 높은 수준의 Pdx1, Ngn3, Nkx6.1, 및 NeuroD1이 관찰되었다. 특히, Pdx1 및 Ngn3는 모방체 처리군과 비교하여 각각 4.8배 및 4.1배 증가하였다.
또한, 도 2e에 나타난 바와 같이, miR-127+miR-709 조합-3의 형질감염 후 3단계 세포에서 모방체 처리군과 비교하여 Pdx1(5.4배), Ngn3(2.8배), Nkx6.1(6.2배), 인슐린-1(2.7배), 및 인슐린-2(4.3배)를 포함하는 췌장 특이성 유전자 마커의 발현이 모두 유의하게 상향조절된 것을 확인하였다.
즉, miR-127 및 miR-709의 단계적 처리가 저분자 화합물의 존재 하에서 MEF의 분화를 유도하고, 분화 효율을 향상시킴에 따라, MEF를 베타 유사 세포로 분화시킬 수 있음을 나타내는 결과이다.
또한, miR-127 및 miR-709에 더하여, miR-19b를 병용 처리하는 경우, 췌장 유전자 마커의 발현을 증가시키는지 확인하였다.
miR-127 miR-709 miR-19b
조합-1 66nM 66nM 66nM
조합-2 160nM 20nM 20nM
조합-3 20nM 160nM 20nM
조합-4 20nM 20nM 160nM
먼저, 도 3a에 나타난 바와 같이, 용량 의존적 형질감염을 수행한 결과, miRNA는 200nM의 용량을 처리한 경우, 낮은 세포독성으로 약 80%의 형질감염 효율을 제공함을 확인하였다.
또한, 도 3b에 나타난 바와 같이, miR-127+miR-709+miR-19b 조합-1의 형질감염 후 1단계에서 가장 높은 Pdx1의 전사 수준이 관찰되었다.
또한, 도 3c에 나타난 바와 같이, miR-127+miR-709+miR-19b의 각기 다른 조합이 세포 증식을 증가시키며, 특히 miR-19b 단독으로 형질감염한 경우와 조합-3에서 세포 증식이 가장 증가됨을 확인하였다.
실시예 5. 마이크로 RNA 조합의 외분비 세포의 췌장 베타세포 유사 세포 분화 효과 확인
본 발명자들은 상기 실시예 3 및 4를 통해 본 발명의 마이크로 RNA 조합을 사용하여 섬유아세포를 췌장 베타세포 유사 세포로 분화시킬 수 있음을 확인하였다.
이에 더하여, 췌장의 외분비 및 내분비 세포가 공통 발달 경로를 공유함에 따라, 외분비세포를 이용하여 췌장 베타세포 유사 세포로 분화시킬 수 있는지 여부를 조사하였다.
먼저, 마우스 선방 세포주 266-6 세포에 대하여 miR-127+miR-709 조합-3을 사용하여 시험하였다. 먼저, 분리한 외분비 세포를 3단계 배지에서 6웰 플레이트 (BD Bioscience의 마트리겔의 1:10 희석으로 코팅됨)에 분주하였다. 3단계 배지에서 1일 후, 50 ㎍/ml 마이크로 RNA을 하나의 웰에 첨가하고 다른 웰은 마이크로 RNA을 첨가하지 않았다. 세포를 2일 동안 3단계 배지에서 마이크로 RNA와 배양한 뒤, 마이크로 RNA가 없는 신선한 배지를 각 웰에 첨가하였다. 7일 후, Qiagen RNeasy 키트를 사용하여 RNA 분리를 위한 세포를 수확하고, qRT-PCR을 이용하여 유전자 프로파일링을 수행하였다.
도 4a에 나타난 바와 같이, 266-6 세포는 5'FAM 표지 모방체 대조군으로 70-80% 형질감염 효율을 나타내었다.
또한, 형질감염된 266-6 세포를 3단계 배지에서 배양 및 성장시킴에 따라, 췌장 베타세포 마커의 발현을 확인하였다.
도 4b에 나타난 바와 같이, 외분비세포에 본 발명의 마이크로 RNA 조합을 처리한 경우에도 베타세포 마커 유전자가 증가되는 것을 확인하였다. Pdx1의 수준은 비처리 세포와 비교하여 1.5 배 이상 증가하였다. Ngn3 발현 또한, 마이크로 RNA 처리된 세포에서 1.6 배만큼 상향 조절되었다. 인슐린-1과 인슐린-2의 수치 또한 각각 1.8 배와 1.9 배 증가한 것으로 나타났다. 그러나, 엘라스타제 (선방 세포 마커)의 발현은 마이크로 RNA 처리시 오히려 감소된 것으로 나타났다.
즉, miR-127 및 miR-709를 병용함으로써 섬유아세포 및 외분비 세포와 같은 체세포를 췌장 베타세포로 직접분화시킬 수 있는 것이다.
실시예 6. 마이크로 RNA와 저분자 조합에 따른 사람의 췌관세포의 베타세포 유사 세포 분화 효과 확인
본 발명자들은 miR-127과 저분자물질의 조합을 통해 사람의 췌관세포인 Capan-1를 췌장 베타세포 유사 세포로 분화시킬 수 있음을 확인하였는 바, 이에 더하여 3단계에서 사용된 저분자 물질의 유무에 따른 췌장 베타세포 마커의 발현을 확인하였다.
도 5에 나타난 바와 같이, Nicotinamide가 결핍된 조합 C에서 Pax-6 및 MafA의 발현이 현저히 감소된 것을 확인하였다.
이는 본 발명의 3단계 배지 조성에 Nicotinamide가 필수적임을 나타내는 결과이다.
종합하면, 본 발명자들은 마이크로RNA 단독; 또는 마이크로RNA와 저분자 물질을 병용 사용한 경우, 췌장 베타세포로의 직접분화가 잘 이루어짐을 명확히 확인하였는 바, 본 발명의 마이크로RNA을 유효성분으로 포함하는, 체세포의 췌장 베타세포로의 직접분화 유도용 조성물을 제공하며, 생산된 췌장 베타세포를 당뇨병 또는 췌장암 등 췌장 관련 질환의 예방, 치료 및 개선을 위해 유용하게 이용할 수 있을 것으로 기대된다. 또한 이러한 직접분화 유도용 조성물을 신체에 직접 주입하여 신체 내에서 체세포의 베타세포유도를 통해 당뇨병 또는 췌장암 등 췌장 관련 질환의 예방, 치료 및 개선을 위해 유용하게 이용할 수 있을 것이다 기대된다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명자들은 다양한 분화 유도 물질 등 저분자성 물질과 마이크로 RNA를 병용처리하여 직접분화를 시도한 결과, 췌장 베타세포에서 PDX1의 발현량이 현저히 증가하였으며, 이러한 방법으로 유사 췌장 베타세포를 유도하였을 때 매우 높은 수율로 직접분화 됨을 확인하였다. 또한, 본 발명은 전환된 췌장베타세포를 당뇨병이나 췌장암 환자에게 이식하는 경우 자가 세포를 이용하므로 면역거부반응이 생기지 않으면서 암 발생 가능성도 낮다는 장점이 있어 더욱 안전한 세포치료제 개발에 유용하게 사용될 것으로 기대되므로, 산업상 이용가능성이 있다.

Claims (27)

  1. miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 마이크로RNA를 포함하는 체세포의 췌장 베타세포로의 직접분화 유도용 조성물.
  2. 제1항에 있어서,
    상기 체세포는 섬유아세포 (fibroblast), 췌관세포 및 외분비 세포로 이루어진 군으로부터 선택된 하나 이상인 것을 특징으로 하는, 직접분화 유도용 조성물.
  3. 제1항에 있어서,
    상기 조성물은 miR-19b를 추가로 포함하는 것을 특징으로 하는, 직접분화 유도용 조성물.
  4. 제1항에 있어서,
    상기 조성물은 히스톤 메틸전달효소 저해제 (histone methyltransferase inhibitor), 레티노산 아고니스트(retinoic acid agonist); ALK-5 키나아제 억제제(ALK-5 kinase inhibitor); 헷지호그 억제제(hedgehog inhibitor); MAPK 억제제(MAPK inhibitor); 칼슘 채널 아고니스트; GLP 수용체 아고니스트; 및 보충제로 이루어진 군으로부터 선택된 하나 이상의 저분자 물질을 추가로 포함하는 것을 특징으로 하는, 직접분화 유도용 조성물.
  5. 제4항에 있어서,
    상기 히스톤 메틸전달효소 저해제는 BIX01294 (2-(Hexahydro-4-methyl-1H-1,4-diazepin-1-yl)-6,7-dimethoxy-N-[1-(phenylmethyl)-4-piperidinyl]-4-quinazolinamine), 데시타빈(Decitabine, 5-aza-2'-deoxycytidine, DAC), 제불라린 (Zebularine), 3'-데아자네플라노신 A 하이드로클로리드 (3'-Deazaneplanocin A hydrochloride), 로메구아트리브 (Lomeguatrib), 및 카에토신 (Chaetocin, 2,2',3S,3'S,5aR,5'aR,6,6'-octahydro-3,3'-bis(hydroxymethyl)-2,2'-dimethyl-[10bR,10'bR(11aS,11'aS)-bi-3,11a-epidithio-11aH-pyrazino[1',2':1,5]pyrrolo[2,3-b]indole]-1,1',4,4'-tetrone)으로 이루어진 군으로부터 선택된 하나 이상인 것을 특징으로 하는, 직접분화 유도용 조성물.
  6. 제4항에 있어서,
    상기 보충제는 2-포스포-L-아스코르브산, B27, 라미닌, 니코틴아마이드, 및 N2로 이루어진 군으로부터 선택된 하나 이상인 것을 특징으로 하는, 직접분화 유도용 조성물.
  7. 제4항에 있어서,
    상기 레티노산 아고니스트는 TTNPB, 피탄산, 및 레티노산으로 이루어진 군으로부터 선택된 하나 이상인 것을 특징으로 하는, 직접분화 유도용 조성물.
  8. 제4항에 있어서,
    상기 헷지호그 억제제는 사이클로파민(cyclopamine), 미페프리스톤(mifepristone), GDC-0449(Vismodegib), XL139(BMS-833923), IPI926, IPI609(IPI269609), LDE225, 제르빈, GANT61, 퍼모파민, SAG, SANT-2, 토마티딘, SANT74, SANT75, 제룸본 및 그의 유도체로 이루어진 군으로부터 선택된 하나 이상인 것을 특징으로 하는, 직접분화 유도용 조성물.
  9. 제4항에 있어서,
    상기 MAPK 억제제는 1-Pyridinyl-2-phenylazole, SB 203580, SKF 86002, SKF 86096, SKF 104351, 1-Aryl-2-pyridinyl/pyrimidinyl heterocycles, SB 242235, RO-32001195, SX-011, 및 BIRB-796로 이루어진 군으로부터 선택된 하나 이상인 것을 특징으로 하는, 직접분화 유도용 조성물.
  10. 제4항에 있어서,
    상기 ALK-5 키나아제 억제제는 RepSox (1,5-Naphthyridine, 2-[3-(6-methyl-2-pyridinyl)-1H-pyrazol-4-yl]); SB525334 (6-(2-tert-butyl-4-(6-methylpyridin-2-yl)-1H-imidazol-5-yl)quinoxaline); GW788388 (4-(4-(3)-(pyridin-2-yl)-1H-pyrazol-4-yl)pyridin-2-yl)-N-(tetrahydro-2H-pyran-4-yl)benzamide); SD-208 (2-(5-chloro-2-fluorophenyl)-N-(pyridin-4-yl)pteridin-4-amine); Galunisertib (LY2157299, 4-(2-(6-methylpyridin-2-yl)-5,6-dihydro-4H-pyrrolo[1,2-b]pyrazol-3-yl)quinoline-6-carboxamide); EW-7197 (N-(2-fluorophenyl)-5-(6-methyl-2-pyridinyl)-4-[1,2,4]triazolo[1,5-a]pyridin-6-yl-1H-imidazole-2-methanamine); LY2109761 (7-(2-morpholinoethoxy)-4-(2-(pyridin-2-yl)-5,6-dihydro-4H-pyrrolo[1,2-b]pyrazol-3-yl)quinoline); SB505124 (2-(4-(benzo[d][1,3]dioxol-5-yl)-2-tert-butyl-1H-imidazol-5-yl)-6-methylpyridine); LY364947 (Quinoline, 4-[3-(2-pyridinyl)-1H-pyrazol-4-yl]); SB431542 (4-(4-(benzo[d][1,3]dioxol-5-yl)-5-(pyridin-2-yl)-1H-imidazol-2-yl)benzamide); K02288 (3)-[(6-Amino-5-(3),4,5-trimethoxyphenyl)-3-pyridinyl]phenol]; 및 LDN-212854 (Quinoline, 5-[6-[4-(1-piperazinyl)phenyl]pyrazolo[1,5-a]pyrimidin-3-yl])로 이루어지는 군으로부터 선택되는 하나 이상인 것을 특징으로 하는, 직접분화 유도용 조성물.
  11. 제4항에 있어서,
    상기 칼슘 채널 아고니스트는 Bay K-8644, FPL 64179, 및 CGP28392로 이루어진 군으로부터 선택된 하나 이상인 것을 특징으로 하는, 직접분화 유도용 조성물.
  12. 제4항에 있어서,
    상기 GLP 수용체 아고니스트는 엑센딘-4, 둘라글루티드(Dulaglutide), 엑세나티드(Exenatide), 세마글루티드(Semaglutide), 리라글루티드(Liraglutide), 릭시세나타이드(Lixisenatide), 및 알비글루티드(Albiglutide)로 이루어지는 군으로부터 선택된 하나 이상인 것을 특징으로 하는, 직접분화 유도용 조성물.
  13. MAPK 억제제(MAPK inhibitor), 칼슘 채널 아고니스트, GLP 수용체 아고니스트, 보충제; 및 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA;를 포함하는 조성물의 존재 하에 체세포를 배양하는 단계;를 포함하는 체세포로부터 췌장 베타세포로의 직접분화 방법.
  14. 제13항에 있어서,
    상기 체세포는 섬유아세포 (fibroblast), 췌관세포, 및 외분비 세포로 이루어진 군으로부터 선택된 하나 이상인 것을 특징으로 하는, 직접분화 방법.
  15. 제13항에 있어서,
    상기 직접분화 방법은 하기 단계를 포함하는 것을 특징으로 하는, 직접분화 방법:
    (1) 히스톤 메틸전달효소 저해제(Histone methyltransferase inhibitor); activin A, 보충제; 및 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA;를 포함하는 조성물의 존재 하에 체세포를 췌장 내배엽 세포(pancreatic endoderm cell)로 유도하는 단계;
    (2) 레티노산 아고니스트, ALK-5 키나아제 억제제 (ALK-5 kinase inhibitor), 헷지호그 억제제, 보충제; 및 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA;를 포함하는 조성물의 존재 하에 췌장 내배엽 세포를 췌장 전구 세포(pancreatic progenitor cell)로 유도하는 단계; 및
    (3) MAPK 억제제(MAPK inhibitor), 칼슘 채널 아고니스트, GLP 수용체 아고니스트, 보충제; 및 miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA;를 포함하는 조성물의 존재 하에 체세포를 배양하는 단계.
  16. miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA를 유효성분으로 포함하는 당뇨병 또는 췌장암 예방 또는 치료용 약학적 조성물.
  17. 제16항에 있어서,
    상기 당뇨병은 제1형 당뇨병, 제2형 당뇨병 및 임신성 당뇨병으로 이루어진 군에서 선택된 것을 특징으로 하는, 약학적 조성물.
  18. 제16항에 있어서,
    상기 조성물은 miR-19b를 추가로 포함하는 것을 특징으로 하는, 약학적 조성물.
  19. 제16항에 있어서,
    상기 조성물은 히스톤 메틸전달효소 저해제 (histone methyltransferase inhibitor), 레티노산 아고니스트(retinoic acid agonist); ALK-5 키나아제 억제제(ALK-5 kinase inhibitor); 헷지호그 억제제(hedgehog inhibitor); MAPK 억제제(MAPK inhibitor); 칼슘 채널 아고니스트; GLP 수용체 아고니스트; 및 보충제로 이루어진 군으로부터 선택된 하나 이상의 저분자 물질을 추가로 포함하는 것을 특징으로 하는, 약학적 조성물.
  20. 제13항의 방법에 의해 직접분화 유도된 췌장 베타세포를 약학적으로 허용되는 담체 및 부형제로 이루어진 군에서 선택된 하나 이상과 혼합하는 단계를 포함하는, 당뇨병 또는 췌장암 치료용 세포치료제를 제조하는 방법.
  21. 제13항의 방법에 의해 직접분화 유도된 췌장 베타세포를 유효성분으로 포함하는 당뇨병 또는 췌장암 치료용 세포 치료제.
  22. miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA를 포함하는 조성물을 생체 내에 전달하여 생체 내에서 체세포의 베타세포로의 직접분화를 유도하는 단계를 포함하는, 당뇨병 또는 췌장암 예방 또는 치료 방법.
  23. miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA; 또는 제13항의 방법에 의해 직접분화 유도된 췌장 베타세포를 유효성분으로 포함하는 약학적 조성물을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 당뇨병 또는 췌장암 예방 또는 치료 방법.
  24. miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA; 또는 제13항의 방법에 의해 직접분화 유도된 췌장 베타세포를 유효성분으로 포함하는 약학적 조성물의 당뇨병 또는 췌장암 예방 또는 치료 용도.
  25. miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA; 또는 제13항의 방법에 의해 직접분화 유도된 췌장 베타세포의 당뇨병 또는 췌장암 치료 약제를 제조하기 위한 용도.
  26. miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA를 포함하는 조성물의 체세포의 췌장 베타세포로의 직접분화 유도 용도.
  27. miR-127 및 miR-709로 이루어진 군으로부터 선택된 하나 이상의 miRNA를 포함하는 조성물을 포함하는 체세포의 췌장 베타세포로의 직접분화 유도용 키트.
PCT/KR2021/012922 2020-09-24 2021-09-23 마이크로 rna를 이용하여 체세포로부터 췌장 베타세포를 직접 분화시키는 방법 및 분화 조성물 WO2022065859A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US18/246,663 US20230364153A1 (en) 2020-09-24 2021-09-23 Method for direct reprogramming from somatic cells into pancreatic beta cells by using microrna, and differentiation composition

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20200123558 2020-09-24
KR10-2020-0123558 2020-09-24
KR1020210102649A KR20220040982A (ko) 2020-09-24 2021-08-04 마이크로 rna를 이용하여 체세포로부터 췌장 베타세포를 직접 분화시키는 방법 및 분화 조성물
KR10-2021-0102649 2021-08-04

Publications (1)

Publication Number Publication Date
WO2022065859A1 true WO2022065859A1 (ko) 2022-03-31

Family

ID=80845751

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/012922 WO2022065859A1 (ko) 2020-09-24 2021-09-23 마이크로 rna를 이용하여 체세포로부터 췌장 베타세포를 직접 분화시키는 방법 및 분화 조성물

Country Status (2)

Country Link
US (1) US20230364153A1 (ko)
WO (1) WO2022065859A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114196614A (zh) * 2021-12-14 2022-03-18 福建省医学科学研究院 pAdM3C感染大鼠胰腺导管细胞促进转分化方法

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120095257A (ko) * 2011-02-18 2012-08-28 주식회사 강스템홀딩스 성체 줄기세포로부터 췌장 베타 유사세포를 제조하는 방법
KR101524079B1 (ko) * 2014-12-03 2015-06-04 서울대학교산학협력단 엑소솜을 이용한 성체 유래 세포로부터 인슐린 생산세포로의 분화 유도 방법
WO2018125019A2 (en) * 2016-12-30 2018-07-05 Istanbul Üni̇versi̇tesi̇ Use of some mirnas for the diagnosis and treatment of diseases associated with insulin

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120095257A (ko) * 2011-02-18 2012-08-28 주식회사 강스템홀딩스 성체 줄기세포로부터 췌장 베타 유사세포를 제조하는 방법
KR101524079B1 (ko) * 2014-12-03 2015-06-04 서울대학교산학협력단 엑소솜을 이용한 성체 유래 세포로부터 인슐린 생산세포로의 분화 유도 방법
WO2018125019A2 (en) * 2016-12-30 2018-07-05 Istanbul Üni̇versi̇tesi̇ Use of some mirnas for the diagnosis and treatment of diseases associated with insulin

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CHEN HU, MO DELIN, LI MING, ZHANG YUN, CHEN LUXI, ZHANG XUMENG, LI MINGSEN, ZHOU XINGYU, CHEN YAOSHENG: "miR-709 inhibits 3T3-L1 cell differentiation by targeting GSK3β of Wnt/β-catenin signaling", CELLULAR SIGNALLING, vol. 26, no. 11, 1 November 2014 (2014-11-01), GB , pages 2583 - 2589, XP055914963, ISSN: 0898-6568, DOI: 10.1016/j.cellsig.2014.07.017 *
LENG SANHUA, ZHANG WENSHUO, ZHENG YANBIN, LIBERMAN ZIVA, RHODES CHRISTOPHER J, ELDAR-FINKELMAN HAGIT, SUN XIAO JIAN: "Glycogen synthase kinase 3β mediates high glucose-induced ubiquitination and proteasome degradation of insulin receptor substrate 1", JOURNAL OF ENDOCRINOLOGY, vol. 206, no. 2, 12 May 2010 (2010-05-12), pages 171 - 181, XP055914965, ISSN: 0022-0795, DOI: 10.1677/JOE-09-0456 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114196614A (zh) * 2021-12-14 2022-03-18 福建省医学科学研究院 pAdM3C感染大鼠胰腺导管细胞促进转分化方法

Also Published As

Publication number Publication date
US20230364153A1 (en) 2023-11-16

Similar Documents

Publication Publication Date Title
EP1879591B1 (en) Use of azapaullones for preventing and treating pancreatic autoimmune disorders
WO2018030879A1 (ko) 아모디아퀸 및 항당뇨 약물을 유효성분으로 함유하는 당뇨병의 예방 또는 치료용 약학적 조성물
WO2018097628A2 (ko) 신경줄기세포의 분화 촉진 및 보호용 조성물 및 이를 이용하여 신경재생을 유도하는 방법
WO2022065859A1 (ko) 마이크로 rna를 이용하여 체세포로부터 췌장 베타세포를 직접 분화시키는 방법 및 분화 조성물
WO2019198995A1 (ko) 엑소좀 기반의 면역세포의 교차분화 방법
WO2018160028A1 (ko) 신경세포 분화용 배지 조성물 및 상기 배지 조성물을 이용한 체세포로부터 신경세포로의 분화 방법
WO2010056907A2 (en) Compounds that induce pancreatic beta-cell expansion
WO2022025559A1 (ko) 줄기세포 유래 엑소좀을 포함하는 조성물 및 이의 제조방법
KR102596837B1 (ko) 체세포로부터 췌장 베타 세포를 직접 분화시키는 방법 및 분화 조성물
WO2018155913A1 (ko) 저분자 화합물을 이용한 골격근육세포 분화 방법
US8394629B2 (en) Use of vinca alkaloids and salts thereof
WO2019124803A1 (ko) 셀라지넬라 로씨 추출물, 이의 분획물을 포함하는 대사증후군의 예방 또는 치료용 조성물
WO2021141452A1 (ko) 인슐린 생산세포로의 분화 유도용 조성물 및 이의 이용
KR101705390B1 (ko) 이중환 구조를 갖는 신규한 ｇｐｃｒ 효능제
KR20220040982A (ko) 마이크로 rna를 이용하여 체세포로부터 췌장 베타세포를 직접 분화시키는 방법 및 분화 조성물
WO2018034523A1 (ko) Jak 억제제를 포함하는 면역반응 억제용 조성물
WO2021125839A1 (ko) 인간 만능 줄기세포로부터 3d 오가노이드를 이용하여 미세교세포를 다량 확보하는 미세교세포의 분화방법
WO2015111971A1 (ko) Gpr119 리간드를 유효성분으로 포함하는 비알콜성 지방간 질환의 예방 또는 치료용 약학적 조성물
WO2021034168A1 (ko) 줄기세포의 증식 및 전능성 증진용 조성물
WO2016122166A1 (ko) Sirt1 발현 조절을 통한 배아줄기세포로부터 지방세포 또는 신장전구세포로의 분화 조절 방법
WO2022055238A1 (ko) 경막외 지방 중간엽 줄기세포 유래 엑소좀을 포함하는 골 질환 치료용 조성물
WO2024014792A1 (ko) 망막 오가노이드 유래 엑소좀을 포함하는 안구 질환 치료용 약학적 조성물
WO2021182896A1 (ko) 이소리퀴리티제닌 유도체를 포함하는 갈색 지방 유도화 분화 조성물
WO2022124795A1 (ko) 트라메티닙 및 선택적으로 파르네소이드 x 수용체 작용제를 포함하는 대사성 또는 담즙정체성 간질환의 예방 또는 치료용 약학적 조성물
WO2021158008A1 (ko) 3,4-디아미노-3-시클로부텐-1,2-디온 유도체를 포함하는 탈모의 예방 또는 치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21872887

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21872887

Country of ref document: EP

Kind code of ref document: A1