WO2016066995A1 - Incorporation of unnatural amino acids into proteins - Google Patents
Incorporation of unnatural amino acids into proteins Download PDFInfo
- Publication number
- WO2016066995A1 WO2016066995A1 PCT/GB2015/053141 GB2015053141W WO2016066995A1 WO 2016066995 A1 WO2016066995 A1 WO 2016066995A1 GB 2015053141 W GB2015053141 W GB 2015053141W WO 2016066995 A1 WO2016066995 A1 WO 2016066995A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- amino acid
- erf1
- nucleic acid
- mutant
- interest
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/67—General methods for enhancing the expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/93—Ligases (6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y601/00—Ligases forming carbon-oxygen bonds (6.1)
- C12Y601/01—Ligases forming aminoacyl-tRNA and related compounds (6.1.1)
- C12Y601/01026—Pyrrolysine-tRNAPyl ligase (6.1.1.26)
Definitions
- the present invention is in the general field of protein expression, in particular the incorporation of an unnatural amino acid(s) into a protein of interest.
- Orthogonal tRNA synthetase/tRNA pairs direct the incorporation of unnatural amino acids, most commonly in response to the amber stop codon (UAG).
- the efficiency of unnatural amino acid incorporation is defined both by i) the intrinsic efficiency with which the orthogonal synthetase/tRNA pair enables translational elongation in response to a UAG codon in the A site of the ribosome, and ii) the efficiency with which release factors compete with the aminoacylated orthogonal tRNAcuA to terminate protein synthesis.
- the pyrrolysyl-tRNA synthetase (PylRS)/tRNAcuA pair is arguably the most useful pair to be developed for genetic code expansion because i) it is orthogonal in a range of hosts including E. coli, yeast, mammalian cells, C. elegans and D. melanogaster, ii) PylRS does not recognize the common 20 amino acids, iii) PylRS does not recognize the anticodon of its cognate tRNAcuA, iv) the active site of PylRS accommodates a range of unnatural amino acids bearing useful functional groups without the need for directed evolution, v) the active site of PylRS can be evolved to recognize structurally diverse unnatural amino acids bearing a range of useful functional groups in E.
- the synthetase variants discovered in E. coli may be used in diverse eukaryotic hosts, where directed evolution of synthetases is challenging to implement (5).
- Unnatural amino acid incorporation is currently less efficient in eukaryotic cells than in E. coli.
- the efficient, site-specific introduction of unnatural amino acids into proteins in eukaryotic cells is an outstanding challenge in realizing the potential of genetic code expansion approaches. Addressing this challenge will allow the synthesis of modified recombinant proteins in eukaryotic cells and augment emerging strategies that introduce new chemical functionalities into proteins to control and image their function with high spatial and temporal precision in eukaryotic cells.
- the present invention seeks to address this need.
- the present inventors have developed an expression system based on orthogonal synthetase/tRNA pairs for efficiently incorporating one or more unnatural amino acids into a protein of interest expressed in a eukaryotic cell - such as a mammalian cell or an insect cell.
- a eukaryotic cell - such as a mammalian cell or an insect cell.
- the expression system described herein increases the efficiency of unnatural amino acid incorporation in such cells.
- the present inventors have engineered eRF1 - that normally terminates translation on all three stop codons in mammalian cells - to provide a substantial increase in unnatural amino acid incorporation in response to the TAG codon without increasing read-through of other stop codons.
- the data presented herein provide the first demonstration that - despite native eRF1 recognizing all three stop codons - it is possible to engineer eRF1 to selectively enhance the efficiency of unnatural amino acid incorporation in eukaryotic cells in response to the amber stop codon, without increasing read through of opal or ochre stop codons.
- eRF1 mutants are known in the art. These mutants have been described purely in the course attempting to study eRF1 function. The disclosures focus on academic studies of eRF1 biology. In contrast, the present inventors teach for the first time the use of certain eRF1 mutants in incorporation of unnatural amino acids into proteins. Indeed, there are no known reports of engineering the eukaryotic translational machinery to enhance the efficiency with which unnatural amino acids are site-specifically incorporated into proteins in eukaryotic cells using orthogonal tRNA synthetase/tRNA pairs. The inventors are the first to realise the utility of the eRF1 mutants in the context of amber codon expression systems.
- the yield of protein bearing a single unnatural amino acid is increased 17- to 20- fold.
- Proteins can be produced containing unnatural amino acids with comparable yields to proteins produced from a gene that does not contain a stop codon.
- the improved system increases the yield of protein, incorporating an unnatural amino acid at multiple sites (for example, 3 or more sites) from unmeasurably low levels up to 43% of a no amber stop control.
- This approach may enable the efficient production of site-specifically modified therapeutic proteins, and the quantitative replacement of targeted cellular proteins with versions bearing unnatural amino acids that allow imaging or synthetic regulation of protein function.
- the present disclosure may enable the efficient production of site- specifically modified therapeutic proteins in eukaryotic cells, as well as the quantitative replacement of targeted cellular proteins with versions bearing unnatural amino acids that allow imaging or synthetic regulation of protein function.
- the invention provides a method for incorporating an unnatural amino acid into a protein of interest in a eukaryotic cell, said method comprising the steps of: i) providing a eukaryotic cell expressing an orthogonal tR A synthetase - tRNA pair, a nucleic acid sequence of interest encoding said protein of interest, and a mutant eRF1, said mutant eRF1 having amino acid sequence having at least 67% sequence identity to the human wild type eRF1 sequence of SEQ ID NO: 4,
- nucleic acid sequence of interest comprising a codon recognised by the tRNA at the position for incorporation of an unnatural amino acid
- the invention relates to use of a mutant eRF1, said mutant eRF1 having amino acid sequence having at least 60%, more suitably 67%, sequence identity to the human wild type eRF1 sequence of SEQ ID NO: 4, for incorporating an unnatural amino acid into a protein of interest in a eukaryotic cell.
- the invention relates to a mutant eRF1 polypeptide, said mutant eRF1 having amino acid sequence having at least 60%, more suitably 67%, sequence identity to the human wild type eRF1 sequence of SEQ ID NO: 4, or a nucleic acid encoding same, for use in aiding incorporation of an unnatural amino acid into a polypeptide of interest by translation of nucleic acid encoding said polypeptide of interest, said nucleic acid comprising an orthogonal codon directing incorporation of said unnatural amino acid into said polypeptide of interest.
- the invention relates to a eukaryotic host cell comprising the mutant eRF1 polypeptide or nucleic acid as described above.
- the invention relates to a eukaryotic host cell comprising
- mutant eRF1 having amino acid sequence having at least 60%, more suitably 67%, sequence identity to the human wild type eRF1 sequence of SEQ ID NO: 4, and optionally
- nucleic acid sequence of interest encoding a protein of interest, said nucleic acid sequence of interest comprising a codon recognised by the tRNA at a position for incorporation of an unnatural amino acid.
- the invention relates to a combination or kit comprising nucleic acid(s) encoding:
- mutant eRF1 having amino acid sequence having at least 60%, more suitably 67%, sequence identity to the human wild type eRF1 sequence of SEQ ID NO: 4, and optionally
- nucleic acid sequence of interest encoding a protein of interest, said nucleic acid sequence of interest comprising a codon recognised by the tRNA at a position for incorporation of an unnatural amino acid.
- the invention relates to a eukaryotic host cell as described above or a combination or kit as described above, further comprising an unnatural amino acid such as BocK or CypK or BCNK; more suitably BocK or CypK.
- mutant eRF1 provides increased efficiency of unnatural amino acid incorporation relative to a wild type eRF1 control.
- said mutant eRF1 comprises a mutation or combination of mutations relative to SEQ ID NO: 4 selected from the group consisting of
- mutant eRF1 comprises a mutation or combination of mutations relative to SEQ ID NO: 4 selected from the group consisting of
- said eukaryotic cell is a mammalian or insect cell.
- said codon is a stop codon. More suitably said stop codon is UAG.
- the orthogonal tRNA synthetase - tRNA pair comprises a pyrrolysyl-tRNA synthetase (PylRS)/PylTtRNAcuA pair.
- tRNA is:
- a nucleic acid construct for expressing a tRNA synthetase and tRNA pair in a eukaryotic cell - such as a mammalian cell or an insect cell comprising: (i) a nucleic acid sequence encoding the tRNA synthetase operably linked to a first promoter capable of expressing the tRNA synthetase; and (ii) a nucleic acid sequence encoding the tRNA operably linked to a second promoter capable of expressing the tRNA, wherein the first and second promoters are in opposite directions to each other, or wherein the tRNA is present in multiple copies on the nucleic acid construct.
- nucleic acid construct can further comprise a nucleic acid sequence encoding a nucleic acid sequence of interest operably linked to a further promoter capable of expressing the nucleic acid sequence of interest in a eukaryotic cell.
- the promoter that is capable of expressing the nucleic acid sequence of interest is oriented in the same direction as the first promoter according to the first aspect recited above.
- the promoter that is capable of expressing the nucleic acid sequence of interest is the same as the first promoter or different to the first promoter.
- this promoter is or is derived from an EF-i promoter as described herein or is or is derived from a CMV promoter.
- the nucleic acid construct further comprises a nucleic acid sequence encoding a mutant eRF1 as described herein.
- the eRF1 mutant is expressed from a CMV promoter downstream (3') of the first Pol II open reading frame expressing the tRNA synthetase.
- nucleic acid sequence encoding the mutant eRF1 and the nucleic acid sequence encoding the tRNA synthetase are linked via a self-cleaving peptide in the same open reading frame.
- nucleic acid sequence encoding the tRNA synthetase and the nucleic acid sequence encoding mutant eRF1 are linked via a self- cleaving peptide in the same open reading frame.
- An exemplary T2A self-cleaving peptide is described in PLoS ONE 6(4) (2011),
- a nucleic acid construct for expressing a tRNA and a nucleic acid sequence of interest in a eukaryotic cell - such as a mammalian cell or an insect cell said nucleic acid sequence of interest comprising a codon recognised by the tRNA at the position for incorporation of an unnatural amino acid
- a nucleic acid sequence comprising the nucleic acid sequence of interest operably linked to a first promoter capable of expressing the nucleic acid sequence of interest in a eukaryotic cell and
- An exemplary nucleotide sequence encoding this construct is set forth in SEQ ID NO:2.
- the construct comprises a nucleic acid sequence encoding a mutant eRF1, suitably a mutant mammalian eRF1, suitably a mutant homo sapiens eRF1, suitably, wherein the mutant eRF1 is selected from the group consisting of E55D, E55A, N129P/K130Q and Y125F or a combination of two or more thereof.
- the first and second promoters are in opposite directions to each other and the tRNA is present in multiple copies on the nucleic acid construct.
- the nucleic acid construct comprises the tRNA linked directly to the promoter.
- the tRNA is linked directly to the promoter without any intermediate sequences located between the tRNA and the promoter.
- the nucleic acid construct comprises the tRNA linked directly to the promoter.
- the tRNA is linked directly to the promoter with no intermediate sequence(s) located between the tRNA and the promoter.
- the 3' end of the tRNA can be linked indirectly to a terminator sequence.
- a terminator sequence for example, TTT ⁇
- TTT ⁇ can be connected to the tRNA via a linker, said linker optionally comprising the sequence GACAAGTGCGG.
- each copy of the nucleic acid sequence encoding the tRNA is under the control of a separate (its own) promoter.
- the promoter arrangement comprises an elongation factor promoter oriented in a first direction and a Pol III promoter oriented in a second direction.
- the first promoter is or is derived from an EF-i promoter.
- the second promoter is or is derived from a U6 promoter.
- the tRNA is present in 4, 5, 6, 7 or 8 or more copies on the nucleic acid construct(s).
- the tRNA is a wild-type or a variant tRNA, suitably a U25C variant of PylT.
- the nucleic acid sequence of interest comprises at least 1, 2, 3 or 4 or more stop codons, suitably, at least 1, 2 or 3 codons.
- the nucleic acid sequence of interest encodes an antibody or an antibody fragment.
- said tRNA synthetase is orthogonal to the endogenous tRNAs in the eukaryotic cell and/or said tRNA is orthogonal to the endogenous tRNA synthetases in the eukaryotic cell and/ or said tRNA synthetase is orthogonal to the endogenous tRNAs in the eukaryotic cell and said tRNA is orthogonal to the endogenous tRNA synthetases.
- nucleic acid constructs comprising the nucleic acid construct according to the first aspect and the nucleic acid construct according to the second aspect.
- nucleic acid constructs comprising the nucleic acid construct according to the first aspect of the invention and the nucleic acid construct according to the second aspect of the invention.
- nucleic acid sequence encoding the mutant eRF1 is on a further separate construct.
- a vector comprising the nucleic acid construct according to the first aspect of the present invention or the nucleic acid construct according to the second aspect of the present invention.
- a combination of vectors comprising a vector comprising the nucleic acid construct according to the first aspect of the present invention and the nucleic acid construct according to the second aspect of the present invention.
- the nucleic acid sequence encoding the mutant eRF1 is on a further separate vector.
- a cell comprising the nucleic acid construct according to the first aspect of the present invention or the nucleic acid construct according to the second aspect of the present invention, the combination of nucleic acid constructs, the vector or the combination of vectors.
- the cell further comprises a nucleic acid construct encoding a mutant eRF1, suitably a mutant homo sapiens eRF1.
- the nucleic acid sequence encoding the mutant eRF1 is on a separate construct or vector.
- the mutant eRF1 is selected from the group consisting of E55D, E55A, N129P/K130Q and Y125F or a combination of two or more thereof, suitably, where in the mutations are made in the hom o sapiens eRF1 gene sequence as described in GenBank Accession Number AF095901.1.
- the mutations are made in a codon optimised homo sapiens eRF1 gene sequence.
- An example of a codon optimised homo sapiens eRF1 gene sequence is set forth in SEQ ID NO:3
- the cell is a mammalian cell or an insect cell.
- the cell is transiently or stably transfected with the nucleic acid.
- kits for incorporating an unnatural amino acid into a protein in a eukaryotic cell - such as a mammalian cell or an insect cell comprising: (i) the nucleic acid construct according to the first or second aspect of the present invention; or (ii) the combination of nucleic acid constructs; or (iii) the vector; or (iv) the combination of vectors; or (v) the eukaryotic cell; and (vi) optionally, an unnatural amino acid.
- the kit further comprises a nucleic acid construct or a vector encoding a mutant eRF1, or a cell comprising same.
- a method for incorporating an unnatural amino acid into a protein of interest in a eukaryotic cell - such as a mammalian cell or an insect cell comprising the steps of: i) providing the cell, wherein said cell comprises the combination of nucleic acid constructs or the combination of vectors as described herein; ii) incubating the cell in the presence of the unnatural amino acid to be incorporated into a protein of interest encoded by the nucleic acid sequence of interest, wherein said unnatural amino acid is a substrate for the tRNA synthetase; and iii) incubating the cell to allow incorporation of said unnatural amino acid into the protein of interest via the orthogonal tRNA-tRNA synthetase pair.
- a method of preparing an antibody-drug conjugate comprising the steps of: i) providing a eukaryotic cell - such as a mammalian cell or an insect cell, wherein the nucleic acid sequence of interest encodes an antibody or an antibody fragment, and wherein said cell comprises the combination of nucleic acid constructs or the combination of vectors described herein, and ii) incubating the cell in the presence of the unnatural amino acid to be incorporated into the antibody or antibody fragment, wherein said unnatural amino acid is a substrate for the tRNA synthetase; iii) obtaining an antibody or antibody fragment in which an unnatural amino acid has been incorporated therein; and vi) conjugating the antibody or antibody fragment with a drug moiety via the unnatural amino acid.
- nucleic acid construct according to the first or second aspects of the present invention; and/or (ii) the combination of nucleic acid constructs; and/or (iii) the vector; and/or (iv) the combination of vectors; and/or (v) the eukaryotic cell - such as a mammalian cell or an insect cell, for incorporating an unnatural amino acid into a protein of interest in a eukaryotic cell.
- a method for incorporating an unnatural amino acid into a protein of interest in a eukaryotic cell - such as a mammalian cell or an insect cell comprising the steps of: i) providing a eukaryotic cell expressing a tRNA synthetase and tRNA pair, a nucleic acid sequence of interest and a mutant eRF1; ii) incubating the cell in the presence of an unnatural amino acid to be incorporated into a protein encoded by the nucleic acid sequence of interest, wherein said unnatural amino acid is a substrate for the tRNA synthetase; and iii) incubating the cell to allow incorporation of said unnatural amino acid into the protein of interest via the orthogonal tRNA-tRNA synthetase pair.
- a mutant eRF1 for incorporating an unnatural amino acid into a protein of interest in a eukaryotic cell -
- a method of identifying a mutant of eRF1 that increases the incorporation of an unnatural amino acid in a protein of interest comprising the steps of: (i) providing a cell that is capable in incorporating an unnatural amino into a protein of interest, suitably, wherein said cell comprises the combination of nucleic acid constructs or the combination of vectors described herein; (ii) incubating the cell in the presence of the unnatural amino acid to be incorporated into the protein of interest and in the presence and absence of the mutant of eRF1, wherein said unnatural amino acid is a substrate for the tRNA synthetase; and (iii) determining the level of unnatural amino acid incorporation into the protein of interest in the presence and absence of the mutant of eRF1, wherein an increase in the level of unnatural amino acid incorporation into the protein of interest in the presence the mutant of eRF1 is indicative that said mutant of eRF1 increases the incorporation of an unnatural amino acid in the protein of interest.
- Chart 1 shows the plasmid constructs and unnatural amino acids used
- PylT is the gene encoding Pyl tRNAcuA and PylT* encodes the U25C variant.
- U6 indicates the U6 promoter
- CMV is the CMV promoter
- CMV enh is the 5' enhancer fragment of CMV promoter
- EFi prom is the EF-ia promoter. Red bars indicate location of amber stop codons.
- Figure 1 illustrates optimizing PylRS/tRNAcuA expression vectors for the incorporation of unnatural amino acids in response to the TAG codon in mammalian cells, (a) Quantification of incorporation of 1 (2 mM) and 2 (0.5 mM) into sfGFP measured in a fluorescence assay. The indicated constructs were expressed transiently in HEK293T cells and sfGFP quantified in lysates by fluorescence at 520 nm, following excitation at 485 nm. A no amino acid control is included for each vector combination.
- Figure 2 illustrates the effect of mutations in eRF1 on stop codon read-through, and incorporation of 1 (2 mM) using the PylRS/tRNAcuA pair,
- (b) Human eRF1 variants are expressed following transient transfection of HEK 293T cells with peRF1 (X), where X designates the mutations introduced, and CMV-PylRS/CMV-DLR(TAG). The negative control (-) detects endogenous eRF1, shRNA is a knockdown of endogenous eRF1.
- Wt is human eRF1 recoded with D. melanogaster codon useage. Data for the ⁇ 100 mutant are off scale, the values are: 1.6% (TAA), 2% (TAG) and 15% (TGA).
- X designates the mutations introduced, plasmid c expressing PylT from a U6 promoter (Chart la) and CMV-PylRS/CMV-J? ⁇ niH -TAG-firefly, a version of plasmid a (Chart la) in which sfGFP is replaced by Reni Wa-TAG-firefly.
- the negative control detects endogenous eRF1, shRNA is a knockdown of endogenous eRF1.
- Equal amounts of cell lysate were immunoblotted with a-eRF1 and a-actin antibodies, (e) eRF1 (X) variants increase unnatural amino acid incorporation in response to an amber stop codon using the Pyrolysyl tRNA/synthetase pair.
- HEK293T cells were transfected as described for panel d, and grown in the presence of 1 mM amino acid 1, and measurements made after 20 h. % readthrough was measured relative to a i?eniKa-TCC-firefly reporter bearing a serine codon in place of the amber stop codon.
- Figure 3 illustrates combining eRF1 E55D with an optimized PylRS/tRNAcuA pair expression system enables efficient incorporation of multiple unnatural amino acids into recombinant proteins in mammalian cells
- Plasmids g, h (or i, Chart la) and eRF1 E55D were transiently transfected into HEK293T cells, and grown in the presence or absence of 2 mM amino acid 1 for 48 hours.
- Full-length sfGFP was quantified in cell lysate at 520 nm, following excitation at 485 nm. Data represents the mean ⁇ SE of four independent measurements
- FIG. 4 illustrates the expression, purification and characterization of recombinant sfGFP incorporating one or three unnatural amino acids
- Plasmids g, h (or i, Chart la) and eRF1 E55D were transiently transfected into HEK293T cells, and grown in the presence or absence of 2 mM amino acid 1 or 0.5 mM amino acid 2 for 48 hours.
- FIG. 5 illustrates stable expression of eRF1 E55D from genomic integration enhances amber suppression in T-Rex 293 Flp-In cells.
- Stable eRF1 lines were created by using the T-Rex 293 Flp-In system (Life Technologies), giving uniform expression of the inserted transgene due to insertion at a defined target locus.
- Plasmids g and h or i, were transiently transfected into T-Rex293 cells containing genomic integrated eRF1 E55D with D. melanogaster codon usage. Cells were grown in the presence or absence of 0.5 mM amino acid 2 for 48 hours. Expression of eRF1 E55D was induced by the addition of 1 ⁇ g/ml tetracycline sixteen hours prior to transfection. Certified tetracycline-free growth media was used throughout all experiments. Full-length sfGFP was quantified in cell lysate at 520 nm, following excitation at 485 nm. Data represents the mean ⁇ SE of 4 independent measurements.
- C sfGFP(TAG) was expressed following transient transfection of constructs g and h ( Figure 1) for 48 hours in the presence or absence of 2, and with the addition of 1 ug/ml tetracycline in the growth media, to induce expression of the release factor variant.
- Full-length sfGFP was quantified in cell lysate at 520 nm, following excitation at 485 nm. Data represents the mean ⁇ SE of four independent measurements
- Figure 6 illustrates the effect of mutations in eRF1 on stop codon read-through in Dmel cells, and incorporation of 1 (lmM) using the PylRS/tRNAcuA pair.
- A. Human eRF1 variants (recoded with D. melanogaster codon usage) are expressed following transient transfection of Dmel cells with peRF1 (X), where X designates the mutations introduced, and UAS-PylRS/UAS-GFP-CrAG)-mCherry/(U6-PylT)4.
- the no stop control serves as a size marker for full length protein
- the negative control (-) establishes baseline suppression efficiency in the presence of endogenous eRF1 and the negative control without 2 indicates the level of readthrough in the absence of 1.
- Figure 7 illustrates the incorporation of four distinct unnatural amino acids into sfGFPCTAG) in the presence of an eRF1 E55D mutant.
- Figure 8 (Supplementary Figure 1) illustrates Northern blot using a universal PylT/PylTU25C probe. Total RNA was extracted 24 hours after transient transfection with plasmids b+c, b+d, b+e, g+h (Chart 1) analogous to Figure ia,b.
- Figure 9 illustrates human eRF1 variants expressed following transient transfection of HEK 293T cells with peRF1(X) and CMV- PylPvS/CMV-DLR(TAG).
- the negative control (-) detects endogenous eRF1.
- the absolute expression levels of protein produced in the dual luciferase assay are shown by a-Renilla western blot. No tfx is untransfected cells.
- Figure 10 (Supplementary Figure 3) illustrates the calibration curve for the fluorometric quantification of sfGFP in lysis buffer. The fluorescence intensity of purified and serially diluted sfGFP is plotted against the concentration of sfGFP in the sample.
- the protein was purified after bacterial expression, quantified by absorbance measurements at 280 nm and diluted in RIPA-buffer with added protease inhibitor.
- Figure 11 illustrates electrospray ionization mass spectrometry which confirms the quantitative incorporation of unnatural amino acids 1 and 2, at three sites in sfGFP.
- the minor component represents the spontaneous cleavage at the carbamate groups of one 1 or 2 during detection, producing a native lysine.
- the corresponding mass loss is calculated to be 100 or 110 Da, respectively.
- Figure 12 Screening transgenic D. melanogaster fly lines for effects of eRF1 E55D or ⁇ 100 expression in ovaries on stop codon readthrough in a dual-luciferase reporter assay.
- FIG. 16 shows PylT U25C and PylT U25C Opt variants
- Figure 17 shows sequences of PylT U25C and PylT U25C Opt variants
- Figure 18 shows a photograph and a bar chart Figure 19 shows diagrams
- Figure 20 shows a diagram
- Figure 21 shows (A) a diagram, (B) a chemical structure and (C) two graphs.
- construct or “vector” refers generally to a nucleic acid capable of transporting a nucleic acid sequence of interest to which it has been linked.
- vector refers to a circular double stranded DNA loop into which additional DNA segments can be ligated.
- viral vector refers to a viral vector, wherein additional DNA segments can be ligated into the viral genome.
- Certain vectors are capable of autonomous replication in a host cell into which they are introduced (for example, bacterial vectors having a bacterial origin of replication and episomal mammalian vectors).
- Other vectors e.g., non-episomal mammalian vectors
- Nucleic acid sequences of interest can be incorporated into a construct or a vector - such as an expression vector.
- the vector may be used to replicate the nucleic acid in a compatible host cell.
- the vector may be recovered from the host cell.
- the vector may be an expression vector that is used to express the nucleic acid sequence of interest in a compatible host cell - such as a eukaryotic cell - such as a mammalian cell or an insect cell.
- the nucleic acid sequence of interest is operably linked to a control sequence - such as a promoter or an enhancer - that is capable of providing for the expression of the nucleic acid sequence of interest in the host cell.
- operably linked means that the components described are in a relationship permitting them to function in their intended manner.
- a regulatory sequence "operably linked" to a nucleic acid sequence of interest is ligated in such a way that expression of the nucleic acid sequence of interest is achieved under conditions compatible with the control sequences.
- Vectors may be transformed or transfected into a suitable host cell to provide for the expression of a protein. This process may comprise culturing a host cell transformed with an expression vector under conditions to provide for expression by the vector of a nucleic acid sequence of interest encoding the protein, and optionally recovering the expressed protein.
- the vectors may be for example, plasmid or virus vectors provided with an origin of replication, optionally a promoter for the expression of the nucleic acid sequence of interest and optionally a regulator of the promoter.
- the vectors may contain one or more selectable marker genes, for example an ampicillin resistance gene in the case of a bacterial plasmid.
- a nucleic acid construct for expressing a tRNA synthetase and tRNA pair in a eukaryotic cell comprising: (i) a nucleic acid sequence encoding the tRNA synthetase operably linked to a first promoter capable of expressing the tRNA synthetase; and (ii) a nucleic acid sequence encoding the tRNA operably linked to a second promoter capable of expressing the tRNA, wherein the first and second promoters are in opposite directions to each other, or wherein the tRNA is present in multiple copies on the nucleic acid construct.
- nucleic acid construct for expressing a tRNA and a nucleic acid sequence of interest in a eukaryotic cell, said nucleic acid sequence of interest comprising a codon recognised by the tRNA at the position for incorporation of an unnatural amino acid comprising: (i) a nucleic acid sequence comprising the nucleic acid sequence of interest operably linked to a first promoter capable of expressing the nucleic acid sequence of interest in the cell; and (ii) a nucleic acid sequence encoding the tRNA operably linked to a second promoter capable of expressing the tRNA, wherein the first and second promoters are in opposite directions to each other, or wherein the tRNA is present in multiple copies on the nucleic acid construct.
- nucleic acid constructs comprising each of the nucleic acid constructs described above.
- a vector comprising or separately comprising each the nucleic acid constructs described above.
- a combination of vectors comprising a vector separately comprising each of the nucleic acid constructs described above.
- the first and second promoters in the nucleic acid constructs are separate promoters that are placed in opposite directions.
- the first and second promoters can be said to be bidirectional promoters in which each of the promoters are coded on opposite strands with their 5' ends oriented toward one another.
- Each of the nucleic acids operably linked to the promoters will have a corresponding orientation.
- the promoter and the tRNA sequence to be expressed can be encoded on the reverse strand.
- the promoter and the tRNA synthetase gene to be expressed can be encoded on the forward strand.
- the U6 promoter and the tRNA sequence to be expressed can be encoded on the reverse strand.
- the EF-ia promoter and the tRNA synthetase gene to be expressed can be encoded on the forward strand.
- one or more further promoters may also be included, which may be the same promoter as the first and/or second promoters or may be different to the first and/or second promoters.
- the further promoter(s) can be oriented in the same direction as the first or second promoter.
- the further promoter(s) is oriented in the same direction as the first promoter.
- the construct described herein further comprise a nucleic acid sequence encoding a mutant eRF1 as described herein.
- the promoter expressing the mutant eRF1 can be oriented in the same direction as the first or second promoter.
- the promoter is oriented in the same direction as the first promoter.
- nucleic acid sequence encoding the mutant eRF1 and the nucleic acid sequence encoding the tRNA synthetase are linked via a self-cleaving peptide in the same open reading frame.
- nucleic acid sequence encoding the tRNA synthetase and the nucleic acid sequence encoding mutant eRF1 are linked via a self- cleaving peptide in the same open reading frame.
- An exemplary T2A self-cleaving peptide is described in PLoS ONE 6(4) (2011).
- the constructs provide a multi-copy tRNA arrangement.
- at least 2, 3, 4 > 5 > 6, 7, 8, 9, 10, 11 or 12 copies of the tRNA gene are provided in the constructs described herein.
- at least 4 copies of the tRNA gene are provided in a construct.
- at least 8 copies of the tRNA gene are provided in a construct.
- the multiple copies of the tRNA gene may be provided on the same or a different construct.
- at least 4 copies of the tRNA gene are provided on a first construct and at least 4 copies of the tRNA gene are provided on a second construct.
- multiple copies of the tRNA gene are under the control of a single promoter. In another embodiment, multiple copies of the tRNA gene are under the control of multiple different promoters. In another embodiment, each copy of the tRNA gene is under the control of a separate promoter, which may be the same promoter or two or more different promoters. In another embodiment, each copy of the tRNA gene is under the control of multiple promoters, which may be the same promoter or two or more different promoters. Suitably, each tRNA gene is under the control of a separate promoter, which is the same promoter for each tRNA gene. Suitably, the promoter or promoters controlling each of the tRNA gene(s) provided is the same. In this context by "same" is meant the same in terms of its sequence rather than implying a single promoter sequence controlling multiple tRNA sequences. Clearly, there may be multiple copies of the same promoter as described herein.
- a multi-copy tRNA arrangement in which at least 4 copies of the tRNA are provided, with each copy operably linked to a promoter.
- a multi-copy tRNA arrangement is provided in which at least 4 copies of the tRNA are provided, with each copy operably linked to a promoter, each promoter being the same promoter - such as a RNA pol III promoter, for example a U6 promoter.
- the 5' end of the tRNA is directly defined by the transcription start site of the promoter that is used to express the tRNA.
- nucleotide constructs provided herein have broad application and may be used in opal and/or ochre suppression as well as in amber suppression.
- the skilled operator will choose the appropriate tRNAs and/or tRNA synthetases accordingly together with the appropriate amber/opal/ochre codon.
- Combinations of constructs and vectors Combinations of the constructs and vectors described herein are contemplated for use in incorporating one or more unnatural amino acids into a cell.
- a combination of constructs comprising: (l) the nucleic acid construct comprising: (i) a nucleic acid sequence encoding the tRNA synthetase operably linked to a first promoter capable of expressing the tRNA synthetase; and (ii) a nucleic acid sequence encoding the tRNA operably linked to a second promoter capable of expressing the tRNA, wherein the first and second promoters are in opposite directions to each other, or wherein the tRNA is present in multiple copies on the nucleic acid construct; and (2) the nucleic acid construct comprising: (i) a nucleic acid sequence comprising the nucleic acid sequence of interest operably linked to a first promoter capable of expressing the nucleic acid sequence of interest in a eukaryotic cell; and (ii) a nucleic acid sequence encoding the tRNA operably linked to a second promoter capable of expressing the tRNA, wherein the first and second promoters
- the nucleic sequence of interest from construct (1) noted above further comprises a nucleic acid sequence encoding a nucleic acid sequence of interest operably linked to a further promoter capable of expressing the nucleic acid sequence of interest in a eukaryotic cell.
- construct (1) does not necessarily have to be used together with construct (2) because the nucleic acid sequence of interest and the tRNA from construct (2) is incorporated into construct (1).
- it may be desirable to include one or more further copies of tRNA on another vector. This other vector may exclusively comprise the tRNA(s) under the control of one or more promoters.
- other elements may be incorporated into this other vector as desired.
- nucleic acid sequence encoding the mutant eRF1 can be incorporated into the constructs (1) and/or (2).
- the nucleic acid sequence encoding the mutant eRF1 is incorporated into construct (1).
- a nucleic acid construct comprising: (i) a nucleic acid sequence encoding the tRNA synthetase operably linked to a first promoter capable of expressing the tRNA synthetase; and (ii) a nucleic acid sequence encoding the tRNA operably linked to a second promoter capable of expressing the tRNA, wherein the first and second promoters are in opposite directions to each other, or wherein the tRNA is present in multiple copies on the nucleic acid construct; optionally (iii) a nucleic acid sequence encoding a nucleic acid sequence of interest operably linked to a further promoter capable of expressing the nucleic acid sequence of interest in a eukaryotic cell; and
- tRNA synthetase (suitably, aminoacyl-tRNA synthetase) used herein may be varied. Although specific tRNA synthetase sequences may have been used in the examples, the invention is not intended to be confined only to those examples. In principle any tRNA synthetase which provides a tRNA charging (aminoacylation) function can be employed.
- the tRNA synthetase may be from any suitable species such as from archea, for example from Methanosarcina - such as Methanosarcina barkeri MS; Methanosarcina barkeri str.
- the tRNA synthetase may be from bacteria, for example from Desulfitobacterium - such as Desulfitobacterium hafniense DCB-2; Desulfitobacterium hafniense Y51; Desulfitobacterium hafniense PCPl; or Desulfotomaculum acetoxidans DSM 771.
- Desulfitobacterium - such as Desulfitobacterium hafniense DCB-2; Desulfitobacterium hafniense Y51; Desulfitobacterium hafniense PCPl; or Desulfotomaculum acetoxidans DSM 771.
- the tRNA synthetase is pyrrolysyl tRNA synthetase (PylRS), which is a protein having pyrrolysl tRNA synthetase biological activity.
- the PylRS is capable of acylating a tRNA with an unnatural amino acid.
- the PylRS may be a wild-type or a genetically engineered PylRS. Genetically engineered PylRS has been described, for example, by Neumann et al. (Nat Chem Biol 4:232, 2008) and by Yanagisawa et al, (Chem Biol 2008, 15:1187), and in EP2192185A1.
- a genetically engineered tRNA synthetase gene is selected that increases the incorporation efficiency of unnatural amino acid(s).
- the PylRS is from Methanosarcina barkeri (MbPylRS), optionally comprising or consisting of the codon optimised sequence set forth below: ATGGACTACAAGGACGACGACGACAAGGACAAGAAACCCCTGGACGTGCTGATCAGCGCCACCGGCCTGT GGATGAGCCGGACCGGCACCCTGCACAAGATCAAGCACCACGAGGTGTCAAGAAGCAAAATCTACATCGA GATGGCCTGCGGCGACCACCTGGTGGTGAACAACAGCAGAAGCTGCCGGACCGCCAGAGCCTTCCGGCAC CACAAGTACAGAAAGACCTGCAAGCGGTGCCGGGTGTCCGACGAGGACATCAACAACTTTCTGACCAGAA GCACCGAGAGCAAGAACAGCGTGAAAGTGCGGGTGGTGTCCGCCCCCAAAGTGAAGAAAGCCATGCCCAA GAGCGTGTCCAGAGCCCCTGGAAAACAGCGTCCGCCAGCACCAACACCAGCCGC AGCGTGCCCAGC
- the PylRS is from Methanosarcina mazei (MmPylRS), optionally comprising or consisting of the codon optimised sequence set forth below:
- nucleotide sequence encoding the tRNA synthetase is codon optimised.
- tRNA used herein may be varied. Although specific tRNAs may have been used in the examples, the invention is not intended to be confined only to those examples. In principle, any tRNA can be used provided that it is compatible with the selected tRNA synthetase.
- the tRNA may be from any suitable species such as from archea, for example from Methanosarcina - such as Methanosarcina barkeri MS; Methanosarcina barkeri str. Fusaro; Methanosarcina mazei Goi; Methanosarcina acetivorans C2A; Methanosarcina thermophila; or Methanococcoides - such as Methanococcoides burtonii.
- Methanosarcina - such as Methanosarcina barkeri MS; Methanosarcina barkeri str. Fusaro; Methanosarcina mazei Goi; Methanosarcina acetivorans C2A; Methanosarcina thermophila; or Methanococcoides - such as Methanococcoides burtonii.
- the tRNA may be from bacteria, for example from Desulfitobacterium - such as Desulfitobacterium hafniense DCB-2; Desulfitobacterium hafniense Y51; Desulfitobacterium hafniense PCPl; or Desulfotomaculum acetoxidans DSM 771.
- Desulfitobacterium - such as Desulfitobacterium hafniense DCB-2; Desulfitobacterium hafniense Y51; Desulfitobacterium hafniense PCPl; or Desulfotomaculum acetoxidans DSM 771.
- the tRNA gene can be a wild-type tRNA gene or it may be a mutated tRNA gene.
- a mutated tRNA gene is selected that increases the incorporation efficiency of unnatural amino acid(s).
- the mutated tRNA gene for example, the mutated tRNAcuA gene, is a U25C variant of PylT as described in Biochemistry (2013) 52, 10.
- the mutated tRNA gene for example, the mutated tRNAcuA gene, is an Opt variant of PylT as described in Fan et al 2015 (Nucleic Acids Research doi:io.i093/nar/gkv8oo).
- the mutated tRNA gene for example, the mutated tRNAcuA gene, has both the U25C and the Opt variants of PylT, i.e. in this embodiment the tRNA, such as the PylT tRNAcuAgene, comprises both the U25C and the Opt mutations.
- the sequence encoding the tRNA is the pyrrolysine tRNA (PylT) gene from Methanosarcina mazei pyrrolysine which encodes tRNA 1 1 , more suitably tRNA Pyl CUA .
- PylT pyrrolysine tRNA
- the PylT from Methanosarcina mazei is expressed from a U6 promoter with a linker followed by a terminator at the 3' end of the Py IT.
- An exemplary sequence is (U6 promoter in lowercase and bold; PlyT underlined; linker in capitals and bold; terminator in uppercase and underlined): tgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctg tagagag ataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgtgacgtagaaagtaataat ttcttgggtagttttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaaa gtattcgattcttggctttatatatc
- the tRNA-tRNA synthetase pair is one that does not recognise any of the 20 naturally occurring amino acids.
- corresponding or cognate tRNA or tRNA synthetases may be combined from different species - such as different species of Methanococcus bacterium.
- the functionality of such pairings is easily tested using methods that are known in the art, for example, by combining together the different components in a host cell and analysing for an intact protein of interest being produced.
- the tRNA-tRNA synthetase pair is the pyrrolysyl-tRNA synthetase (PylRS)/tRNAcuA pair, suitably from Methanococcus.
- the tRNA synthetase is or is derived from the PylRS from Methanosarcina barkeri (MbPylRS) and the tRNA is or is derived from the pyrrolysine RNA (PylT) from Methanosarcina mazei pyrrolysine.
- the tRNA synthetase is or is derived from the PylRS from Methanosarcina mazei (MmPylRS) and the tRNA is or is derived from the pyrrolysine tRNA (Py/r) from Methanosarcina m azei pyrrolysine.
- said tRNA synthetase is orthogonal to the endogenous tRNAs in the eukaryotic cell and/or said tRNA is orthogonal to the endogenous tRNA synthetase in the eukaryotic cell and/or said tRNA synthetase is orthogonal to the endogenous tRNAs in the eukaryotic cell and said tRNA is orthogonal to the endogenous tRNA synthetases.
- Control sequences operably linked to nucleic acid sequences include promoters, enhancers and other expression regulation signals. These control sequences may be selected to be compatible with the host cell for which the construct or vector is designed to be used in.
- promoter is well-known in the art and encompasses nucleic acid regions ranging in size and complexity from minimal promoters to promoters including upstream elements and enhancers.
- one of the promoter sequences is a RNA Pol ⁇ promoter - such as a U6 promoter.
- the RNA Pol III promoter is operably linked to a tRNA gene.
- this arrangement is repeated at least 4, 5, 6, 7 or 8 times or more in the constructs of the present disclosure.
- one of the promoter sequences is a eukaryotic elongation factor promoter - such as an EF-i promoter (for example, EF-ia).
- this promoter is operably linked to a tRNA synthetase gene and/or a nucleic acid sequence of interest.
- this arrangement is repeated at least once in the constructs of the present disclosure.
- RNA Pol III promoters include intragenic and extragenic (internal and external) promoters.
- said promoter is, or is derived from, the eukaryotic U6 promoter, suitably, the homo sapien U6 promoter.
- U6 promoter for use in human and/or mouse systems is described in Journal of the American Chemical Society (2010) 132(12), 4086-4088.
- Another exemplary U6 promoter comprises or consists of the sequence set forth below:
- the promoter is, or is derived from, a U6 promoter capable of directing RNA Pol ⁇ transcription in mammalian cells - such as mouse or human cells - operably linked to one or more tRNA genes, as described herein.
- Elongation factor promoter Suitably any eukaryotic elongation factor promoter capable of directing expression in eukaryotic cells - such as mammalian or insect cells - may be used in the construct described herein.
- said promoter is, or is derived from, the eukaryotic elongation factor l (EF-i) promoter.
- said promoter is, or is derived from, the EF-ia promoter.
- Another exemplary EF-ia promoter comprises or consists of the sequence set forth below: CTAGTAAGGATCTGCGATCGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGA AGTTGGGGGGGGGTCGGCAATTGAACGGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGA TGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTG AACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGCTGAAGCTTCGAGGGGCTCGCATCTCTCTCCTT CACGCGCCCGCCGCCCTACCTGAGGCCGCCATCCACGCCGGTTGAGTCGCGTTCTGCCGCCTCCCGCCTG TGGTGCCTCCTGAACTGCGTCCGCCGTCTAGGTAAGTTTAAAGCTCAGGTCGAGACCGGGCCTTTGTCCG GCGCTCCCTTGGAGCCTACCTAAAGCTCAGGTCGAGACCGGGCCTTTG
- the promoter is, or is derived from, an EF-ia promoter capable of directing transcription in mammalian cells - such as mouse or human cells - operably linked to tRNA synthetase and/or a nucleic acid sequence of interest as described herein.
- Suitable host cells may include bacterial cells (e.g., E. coli), but most suitably host cells are eukaryotic cells, for example insect cells (e.g. Drosophila such as Drosophila melanogaster), yeast cells, nematodes (e.g. Celegans), mice (e.g. Mus musculus), or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells, human 293T cells, HeLa cells, NIH 3T3 cells, and mouse erythroleukemia (MEL) cells) or human cells or other eukaryotic cells.
- suitable host cells are known to those skilled in the art.
- the host cell is a mammalian cell - such as a human cell or an insect cell.
- Vector DNA can be introduced into host cells via conventional transformation or transfection techniques.
- stable cell lines are prepared.
- a gene that encodes a selectable marker for example, for resistance to antibiotics
- Preferred selectable markers include those that confer resistance to drugs, such as G418, hygromycin, or methotrexate.
- Nucleic acid molecules encoding a selectable marker can be introduced into a host cell on the same vector or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid molecule can be identified by drug selection (for example, cells that have incorporated the selectable marker gene will survive, while the other cells die).
- the constructs described herein are integrated into the genome of the host cell.
- An advantage of stable integration is that the uniformity between individual cells or clones is achieved. Another advantage is that selection of the best producers maybe carried out. Accordingly, it is desirable to create stable cell lines.
- the constructs described herein are transfected into a host cell. An advantage of transfecting the constructs into the host cell is that protein yields may be maximised.
- a cell comprising the nucleic acid construct or the vector described herein. eRFi Unless otherwise apparent from the context, references herein to 'eRF1' refer to eukaryotic eRF1.
- 'mutant' has its natural meaning of 'other than wild-type'.
- wild type residue may vary depending on the particular species of eRF1 being used. References to particular residues should be construed with reference to the H.sapiens wild type reference sequence for eRF1 of GenBank Accession Number AF095901.1. The database release at the date of filing is relied on. In case of any doubt, this means Genetic Sequence Data Bank NCBI- GenBank Flat File Release 209.0 dated August 152015.
- wild type human eRF1 polypeptide sequence is regarded as:
- amino acid addresses given in the application correspond to the numbering of the eRF1 reference sequence above.
- truncated or extended forms of eRF1 e.g. if a 6his tag is added or where a section of the polypeptide is deleted
- the amino acid numbering should be treated as corresponding to the equivalent section of the full length reference sequence and not as an 'absolute' or rigidly inflexible numeric address.
- substitution of E55 this means amino acid 55 of the eRF1 reference sequence above.
- the amino acid corresponding to E55 of the human wild type sequence is identified for example by aligning the sequence of the eRF1 of said other species with the reference sequence above and selecting the corresponding amino acid as is well known in the art.
- the address given will still be E55 (rather than e.g. E45) - this will be easily understood by the skilled reader to refer to the amino acid of the corresponding context with reference to the full length eRF1 sequence above, as is conventional in the art.
- the inventors teach that other truncations which remove the N-terminal domain of eRF1 would have a similar effect.
- the N-terminal domain (roughly amino acid 1-130) of eRF1 interacts with the messenger RNA and the stop codon. If the whole or part of this domain is deleted, in use it should form inactive eRF1-eRF3 complexes (exemplified by the delta 100 variant) and increase stop codon read-through (and toxicity).
- the eRF1 used in the invention comprises amino acid sequence corresponding to at least amino acids 131 onwards of SEQ ID NO: 4; suitably comprises amino acid sequence corresponding to at least amino acids 101 onwards of SEQ ID NO: 4.
- the eRF1 used in the invention comprises amino acid sequence corresponding to at least amino acids 101 to the end of SEQ ID NO: 4.
- the eRF1 used in the invention comprises amino acid sequence corresponding to at least amino acids 131 to the end of SEQ ID NO: 4.
- the C-terminal end of eRF1 is not truncated or is truncated only minimally relative to SEQ ID NO: 4. Most suitably the C-terminal end of eRF1 is not truncated relative to SEQ ID NO: 4.
- Any alignment required should be carried out by eye, or using any of the widely available sequence alignment programs known in the art, such as the GCG suite of programs (GCG Genetics Computer Group University Research Park 575 Science Drive Madison, WI 53711). Most suitably alignments are using ClustalW with the default settings.
- certain mutants of eRF1 can be employed in accordance with the present disclosure to provide a substantial increase in unnatural amino acid incorporation in response to one or more stop codons without substantially increasing read-through of other stop codons. Accordingly, it can be advantageous to express the nucleic acid constructs as described herein in a cell together with certain eRF1 mutants. eRF1 may be expressed using various promoters - such as an EFi promoter or a CMV promoter.
- the eRF1 mutants of the invention provide increased efficiency of unnatural amino acid incorporation.
- the eRF1 mutants of the invention increase efficiency of unnatural amino acid incorporation relative to a natural translation control.
- the eRF1 mutants of the invention provide increased efficiency of unnatural amino acid incorporation relative to a wild type eRF1 control.
- the mutant eRF1 is integrated into the host cell, suitably stably integrated into the host cell.
- the mutant eRF1 is expressed from one or more of the nucleic acid constructs described herein in a host cell. In certain embodiments, the nucleic acid sequence encoding the mutant eRF1 is on a separate construct or a separate vector.
- Eukaryotic translation termination factor l also known as TB3-1
- eRF1 Eukaryotic translation termination factor 1
- TB3-1 Eukaryotic translation termination factor 1
- eRF1 Eukaryotic translation termination factor 1
- TB3-1 Eukaryotic translation termination factor 1
- RFs protein release factors
- An exemplary eRF1 gene sequence is the wild type homo sapiens eRF1 gene sequence as described in GenBank Accession Number AF095901.1.
- the eRF1 gene can be codon optimized, for example, for Drosophila melanogaster.
- shRNA to knock down eRF1 expression in mammalian cells can also be deleterious after providing a transient increase in suppression. High levels of stop codon read through can also occur. Clearly these deleterious effects should be avoided and shRNA should suitably not be used in the present disclosure.
- eRF1 mutants useful in the invention are disclosed in the table below:
- the skilled person will take account of the interaction between cell viability and increased suppression.
- the ⁇ 100 eRF1 mutant can result in high levels of stop codon read through and sick cells.
- the ⁇ 100 eRF1 mutant is therefore suitably not used in the present disclosure.
- E55 in column I maybe mutated to 'other than E ⁇ More suitably E55 may be mutated to an amino acid conservative to the specific mutations in Column II - such as E55D or E55A or E55G or E55P. Most suitably E55 may be mutated to an amino acid specifically mentioned in Column II such as E55A or E55D, most suitably E55D. The same applies to the other residues listed in Column I.
- mutant eRF1 comprises a mutation relative to SEQ ID NO: 4 selected from the group consisting of E55, N129, K130, T122, S123, Y125, T58, S60, S64, L125, S123, L124, M51, and K130.
- mutant eRF1 comprises a mutation relative to SEQ ID NO: 4 selected from the group consisting of E55D, N129P, K130Q, T122Q, S123F, E55A, Y125F, T58K, S60T, S64D, L125F, N129S, S123A, L124I, Y125L, S123R, L124W, Y125R, S123H, L124A, Y125G, M51A, K130M, Y125V, S123L, L124C, Y125S, S123L, L124S, Y125S, S123V, L124T, and Y125P.
- eRF1 may be provided in a host cell by transient expression or by genomic integration.
- the relevant nucleic acids are introduced by transient transfection. In one embodiment the relevant nucleic acids are introduced by stable cell line creation.
- the eRF1 mutant used in the present disclosure comprises a mutation at E55.
- the eRF1 mutant used in the present disclosure is selected from the group consisting of E55D, E55A, N129P/K130Q and Y125F or a combination of two or more thereof. These mutations are made with respect to the wild type homo sapiens eRF1 amino acid sequence which is derived from GenBank Accession Number AF095901.1 or a codon optimised variant thereof.
- the eRF1 protein shows very strong homology across most eukaryotic organisms.
- E55D in a human or insect eRF1 protein.
- these alternate species mutant eRF1 proteins should have similar technical effects as shown for the exemplary eRFs herein.
- eRF1 mutant engineered human (H. sapiens) eRF1 variant
- CHO cells C. griseus
- HEK cells H. sapiens
- Dmel cells D.
- the eRF1 proteins in these organisms are highly conserved (table 1).
- Table 1 Pair- wise similarity of eRFi in various species. The percentage given indicates conserved amino acid identities across the protein, as determined by ClustalW alignment. Given the level of conservation between the various unicellular (yeast) and
- eRF1 variants from various eukaryotic species will be functional in multiple other eukaryotic species host cells.
- the host cell maybe human, mouse, C. elegans, donkey, yeast or other eukaryotic host cell.
- the mutant eRF1 has amino acid sequence having at least 60% sequence identity to the human wild type eRF1 sequence of SEQ ID NO: 4; suitably the mutant eRF1 has amino acid sequence having at least 67% sequence identity to the human wild type eRF1 sequence of SEQ ID NO: 4; suitably the mutant eRF1 has amino acid sequence having at least 84% sequence identity to the human wild type eRF1 sequence of SEQ ID NO: 4; suitably the mutant eRF1 has amino acid sequence having at least 92% sequence identity to the human wild type eRF1 sequence of SEQ ID NO: 4, suitably the mutant eRF1 has amino acid sequence having at least 95% sequence identity to the human wild type eRF1 sequence of SEQ ID NO: 4, suitably the mutant eRF1 has amino acid sequence having at least 98% sequence identity to the human wild type eRF1 sequence of SEQ ID NO: 4, or even more.
- suitably percentage identity levels are calculated before specific mutations recited for the mutant eFRi's are introduced.
- the percentage identity levels are calculated including the specific mutations recited for the mutant eFRi's.
- the host cell is in vitro.
- the host cell is in an organism, suitably the host is non-human.
- the engineered human eRF1 enhances unnatural amino acid incorporation in species where the native eRF1 is only 84% conserved (Dmel insect cells).
- nucleic acid sequence for eRF1 (or a variant) is not important - one exemplary human eRF1 variant has been codon optimised to express well in insect cells, but also works in human cell lines. Thus the codon optimisation of the nucleic acid (if desired) is a matter for the skilled operator.
- amber suppression is increased.
- the eRF1 mutants described herein are used in amber suppression.
- a method for incorporating an unnatural amino acid into a protein of interest in a eukaryotic cell - such as a mammalian cell or an insect cell comprising the steps of: i) providing a eukaryotic cell expressing a tRNA synthetase and tRNA pair, a nucleic acid sequence of interest and a mutant eRF1; ii) incubating the cell in the presence of an unnatural amino acid to be incorporated into a protein encoded by the nucleic acid sequence of interest, wherein said unnatural amino acid is a substrate for the tRNA synthetase; and iii) incubating the cell to allow incorporation of said unnatural amino acid into the protein of interest via the orthogonal tRNA-tRNA synthetase pair.
- mutant eRF1 for incorporating an unnatural amino acid into a protein of interest in a eukaryotic cell is also disclosed.
- the method comprises the steps of: (i) providing a cell that is capable in incorporating an unnatural amino into a protein of interest, suitably wherein said cell is the eukaryotic cell as described herein; (ii) incubating the cell in the presence of the unnatural amino acid to be incorporated into the protein of interest and in the presence and absence of the mutant of eRF1, wherein said unnatural amino acid is a substrate for the tRNA synthetase; and (iii) determining the level of unnatural amino acid incorporation into the protein of interest in the presence and absence of the mutant of eRF1, wherein an increase in the level of unnatural amino acid incorporation into the protein of interest in the presence the mutant of eRF1 is indicative that said mutant of eRF1 increases the incorporation of an unnatural amino acid in the protein of interest.
- Methods for incorporating one or more mutations into a eRF1 include site-directed mutagenesis and the like which are well known in the art.
- the mutations that are selected may be based on mutations in amino acids in eRF1 that have an effect on termination at amber codons, as described in references 25-30.
- the mutations that are selected may be located in the N-terminal domain of eRF1 (see Figure 2a) that interacts with the stop codon on the mRNA within the ribosome.
- the eRF1 mutants result in efficient unnatural amino acid incorporation in response to a selected codon - such as TAG - without increasing read-through of other stop codons.
- release factor mutants - such as eRF1 - are not used in the present disclosure.
- expression of endogenous release factor - such as eRF1 - is decreased or deleted from the host cell. This can be achieved by, for example, a disruption one or more of the genomic loci encoding eRF1, or through RNA-mediated gene silencing of eRF1.
- An orthogonal or expanded genetic code can be used in the present disclosure, in which one or more specific codons present in the nucleic acid sequence of interest are allocated to encode the unnatural amino acid so that it can be genetically incorporated into the protein of interest by using an orthogonal tRNA synthetase/tRNA pair.
- the orthogonal tRNA synthetase/tRNA pair is capable of charging a tRNA with an unnatural amino acid and is capable of incorporating that unnatural amino acid into the polypeptide chain in response to the codon.
- the codon may be the codon amber, ochre, opal or a quadruplet codon.
- the codon simply has to correspond to the orthogonal tRNA which will be used to carry the unnatural amino acid.
- the codon is amber.
- the codon is an orthogonal codon.
- Unnatural amino acid incorporation is to a large extent performed on the amber UAG codon.
- the codon is UAG or UGA, most suitably UAG (amber).
- An exemplary mutation that minimises activity of the release factor on the amber (UAG) stop codon e.g. E55D.
- Other mutations described may not affect recognition of the amber stop codon, but reduce termination activity on UGA or UAA stop codons (opal/ochre). This is exemplified by S70A, G73S. The skilled operator will select the eRF1 mutants to suit their needs when using codons other than UAG (amber).
- the anticodon region of the tRNA may simply be swapped for the desired anticodon region for the codon of choice.
- the anticodon region is not involved in the charging or incorporation functions of the tRNA nor recognition by the tRNA synthetase so such swaps are entirely within the ambit of the skilled person.
- a host cell can be used to produce (for example, express) a protein that comprises one or more unnatural amino acids.
- the host cell into which the constructs or vectors disclosed herein are introduced is cultured or maintained in a suitable medium such that the tRNA, the tRNA synthetase and the protein of interest are produced.
- the medium also comprises the unnatural amino acid(s) such that the protein of interest incorporates the unnatural amino acid(s).
- proteins are encoded by a nucleic acid comprising one or more codons as described herein within the coding sequence.
- the orthogonal tRNA synthetase/tRNA pair charges a tRNA with an unnatural amino acid and incorporates the unnatural amino acid into the polypeptide chain in response to the codon.
- a method for incorporating an unnatural amino acid into a protein of interest in a eukaryotic cell comprising the steps of: i) providing a eukaryotic cell comprising the construct(s) or vector(s) described herein; ii) incubating the cell in the presence of one or more unnatural amino acids to be incorporated into a protein of interest encoded the nucleic acid sequence of interest, wherein said unnatural amino acid is a substrate for the tRNA synthetase; and iii) incubating the cell to allow incorporation of said unnatural amino acid into the protein of interest via the orthogonal tRNA-tRNA synthetase pair.
- Proteins comprising an unnatural amino acid(s) are prepared by introducing the nucleic acid constructs described herein comprising the tRNA and tRNA synthetase and comprising a nucleic acid sequence of interest with one or more in-frame orthogonal (stop) codons into a host cell.
- the host cell is exposed to a physiological solution comprising the unnatural amino acid(s), and the host cells are then maintained under conditions which permit expression of the protein of interest's encoding sequence.
- the unnatural amino acid(s) is incorporated into the polypeptide chain in response to the codon.
- more than one unnatural amino acid is incorporated into the protein of interest.
- two or more unnatural amino acids may be incorporated into the protein of interest at two or more sites in the protein.
- at least three unnatural amino acids may be incorporated into the protein of interest at three or more sites in the protein.
- at least four unnatural amino acids may be incorporated into the protein of interest at four or more sites in the protein.
- at least five unnatural amino acids may be incorporated into the protein of interest at five or more sites in the protein.
- Suitably at least six unnatural amino acids may be incorporated into the protein of interest at six or more sites in the protein.
- Suitably at least seven unnatural amino acids may be incorporated into the protein of interest at seven or more sites in the protein.
- at least eight unnatural amino acids may be incorporated into the protein of interest at eight or more sites in the protein.
- a second or further orthogonal tRNA-tRNA synthetase pair may be used to incorporate the second or further unnatural amino acid; suitably said second or further orthogonal tRNA-tRNA synthetase pair recognises a different codon in the nucleic acid encoding the protein of interest so that the two or more unnatural amino acids can be specifically incorporated into different defined sites in the protein in a single manufacturing step.
- two or more orthogonal tRNA-tRNA synthetase pairs may therefore be used.
- the protein of interest incorporating the unnatural amino acid(s) can be extracted therefrom by a variety of techniques known in the art, including enzymatic, chemical and/or osmotic lysis and physical disruption.
- the protein of interest can be purified by standard techniques known in the art such as preparative chromatography, affinity purification or any other suitable technique.
- unnatural amino acid refers to an amino acid other than the 20 amino acids that occur naturally in protein.
- Non-limiting examples of unnatural amino acids include: a p-acetyl-L-phenylalanine, a p-iodo-L-phenylalamne, an O-methyl-L-tyrosine, a p-propargyloxyphenylalanine, a p- propargyl-phenylalanine, an L-3-(2-naphthyl)alanine, a 3-methyl-phenylalanine, an O- 4-allyl-L-tyrosine, a 4-propyl-L-tyrosine, a tri-O-acetyl-GlcNAcp-serine, an L-Dopa, a fluorinated phenylalanine, an isopropyl-L-phenylalanine, a p-azido-L-phenylalanine, a p-acyl-L-phenylalanine, a p-benzoyl-L-phen
- Example 2 Specific examples of incorporation of different unnatural amino acids are provided herein.
- Example 2 the incorporation of (N ⁇ -[(tert-butoxy)carbonyl]-l-lysine ) and (N £ -[((2- methylcycloprop-2-en-i-yl)methoxy)carbonyl]-l-lysine is demonstrated.
- the structures of these compounds are shown in Chart lb. Both of these substrates are known efficient substrates for the PylRS/tRNAcuA pair (Nat Biotechnol 2014, 32, 465 and J Am Chem Soc 2009, 131, 8720).
- Example 9 the incorporation of Boc-K (N ⁇ -[(tert-butoxy)carbonyl]-L-lysine, Norbonene-K (N ⁇ --norbomene-2-yloxycarbonyl-L-lysine), Cyclopropene-K (N ⁇ -[((2- methylcycloprop-2-en-i-yl)methoxy)carbonyl]-L-lysine) and Bicyclonyne-K (N ⁇ - ([(iR,8S)-bicyclo[6.i.o]non-4-yn-9-ylmethoxy]carbonyl)-Lysine) is shown.
- WO2010/139948 describes the incorporation of aliphatic or straight chain carbon backbone amino acids capable of supporting alkyne-azide bonding into a protein of interest using an orthogonal tRNA-tRNA synthetase pair.
- WO2013/10844 describes the incorporation of a norbornene amino acid into a protein of interest using an orthogonal tRNA-tRNA synthetase pair.
- the nucleic acid sequence of interest encodes an antibody or an antibody fragment.
- One or more unnatural amino acids - suitably, 2, 3, 4, 5, 6, 7 or 8 or more unnatural amino acids - maybe incorporated into an antibody or an antibody fragment.
- antibody refers to a protein of the immunoglobulin family that is capable of binding a corresponding antigen non-covalently, reversibly, and in a specific manner.
- the term includes, but is not limited to, monoclonal antibodies, human antibodies, humanized antibodies, camelid antibodies, chimeric antibodies, and anti- idiotypic (anti-Id) antibodies.
- the antibodies can be of any isotype/class and can therefore include IgG, IgE, IgM, IgD, IgA and IgY, or subclass of antibodies - such as IgGi, IgG2, IgG3, IgG4, IgAi and IgA2.
- antibody fragment refers to one or more portions of an antibody that retains the ability to specifically interact with (for example, by binding, steric hindrance, stabilizing/destabilizing, spatial distribution) an epitope of an antigen.
- binding fragments include, but are not limited to, single-chain Fvs (scFv), disulfide-linked Fvs (sdFv), Fab fragments, F(ab') fragments, a monovalent fragment consisting of the VL, VH, CL and CHi domains; a F(ab) 2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulphide bridge at the hinge region; a Fd fragment consisting of the VH and CHi domains; a Fv fragment consisting of the VL and VH domains of a single arm of an antibody; a dAb fragment, which consists of a VH domain; and an isolated complementarity determining region (CDR), or other epitope-binding fragments of an antibody.
- scFv single-chain Fvs
- sdFv disulfide-linked Fvs
- Fab fragments F(ab') fragments, a monovalent fragment consisting of the VL, VH,
- the two domains of the Fv fragment, VL and VH are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv ("scFv").
- single chain Fv single chain Fv
- antigen binding fragments are obtained using conventional techniques known to those of skill in the art, and the fragments can be screened for activity in the same manner as intact antibodies.
- the antibody may be monospecific, bi-specific, or multispecific.
- a multispecific antibody may be specific for different epitopes of one target protein or may contain antigen-binding domains specific for more than one target protein.
- the antibody can be linked to or co-expressed with another functional molecule - such as another peptide or protein.
- another functional molecule - such as another peptide or protein.
- an antibody or fragment thereof can be functionally linked to one or more other molecular entities - such as another antibody or antibody fragment to produce a bi-specific or a multi-specific antibody with a second binding specificity.
- Functional linking may be achieved using chemical coupling, genetic fusion, or non-covalent association for example.
- bispecific formats include scFv-based or diabody bispecific formats, IgG-scFv fusions, dual variable domain (DVD)-Ig, Quadroma, knobs-into-holes, common light chain (e.g., common light chain with knobs-into-holes, etc.), CrossMab, CrossFab, (SEED)body, leucine zipper, Duobody, IgGi/IgG2 and dual acting Fab (DAF)-IgG bispecific formats (see, for example, m Abs (2012) 4:6, 1-11).
- the antibodies that are used are human antibodies.
- the term "human antibody” includes antibodies having variable regions in which both the framework and CDR regions are derived from sequences of human origin. Furthermore, if the antibody contains a constant region, the constant region also is derived from such human sequences, for example, human germline sequences, or mutated versions of human germline sequences or antibody containing consensus framework sequences derived from human framework sequences analysis.
- the human antibodies can include amino acid residues not encoded by human sequences (for example, mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo, or a conservative substitution to promote stability or manufacturing).
- the antibody or antibody fragment with one or more unnatural amino acids incorporated therein may be used to prepare an antibody drug conjugate (ADC).
- ADC antibody drug conjugate
- ADCs comprise an antibody(s) or antibody fragment(s) conjugated to a drug moiety.
- the drug moiety can be any drug moiety that has a desired impact on the cell in which the ADC is present.
- it can be an anti-cancer agent, anti- hematological disorder agent, an autoimmune treatment agent, an anti-inflammatory agent, an antifungal agent, an antibacterial agent, an anti-parasitic agent, an anti-viral agent, or an anesthetic agent, or a radioisotope and the like.
- the antibodies or antibody fragments can be conjugated to one or more identical or different drug moieties as required.
- the antibodies or antibody fragments may be conjugated to a drug moiety that modifies a given biological response.
- the drug moiety may be a protein, peptide, or polypeptide possessing a desired biological activity.
- proteins may include, for example, a toxin, a cytotoxin, a protein - such as tumor necrosis factor, a cytokine, an apoptotic agent, an anti- angiogenic agent, or, a biological response modifier - such as a lymphokine.
- a drug moiety can be joined to an antibody or an antibody fragment via a linker.
- a 'linker refers to any chemical moiety that is capable of linking an antibody or antibody fragment to a drug moeity.
- Linkers can be susceptible to cleavage (cleavable linker), such as, acid-induced cleavage, photo-induced cleavage, peptidase- induced cleavage, esterase-induced cleavage, and disulfide bond cleavage.
- linkers can be substantially resistant to cleavage (for example, stable linker or noncleavable linker).
- the ADCs can be characterized and selected for their physical/chemical properties and/or biological activities by various assays known in the art.
- an antibody can be tested for its antigen binding activity by known methods - such as ELISA, FACS, Biacore or Western blot.
- Transgenic animals and cell lines are particularly useful in screening ADCs that have potential as prophylactic or therapeutic treatments. Screening for a useful ADC may involve administering a candidate ADC over a range of doses to the transgenic animal, and assaying at various time points for the effect(s) of the ADC on the disease or disorder being evaluated. Alternatively, or additionally, the drug can be administered prior to or simultaneously with exposure to an inducer of the disease, if applicable.
- the candidate ADC may be screened serially and individually, or in parallel under medium or high-throughput screening format.
- a method of preparing an antibody-drug conjugate comprising the steps of: i) providing the eukaryotic cell described herein, wherein the nucleic acid sequence of interest encodes an antibody or an antibody fragment; ii) incubating the cell in the presence of the unnatural amino acid to be incorporated into the antibody or antibody fragment, wherein said unnatural amino acid is a substrate for the tRNA synthetase; iii) obtaining an antibody or antibody fragment in which an unnatural amino acid has been incorporated therein; and vi) conjugating the antibody or antibody fragment with a drug moiety via the unnatural amino acid.
- a linker between the unnatural amino acid and the drug moiety may be used.
- the antibody or an antibody fragment comprising one or more (for example, 2, 3, 4, 5, 6, 7 or 8 or more) unnatural amino acids is conjugated to a drug moiety through a linkage between the unnatural amino acid and the drug moiety.
- a drug moiety is conjugated non-selectively to cysteine or lysine residues in the antibody or antibody fragment.
- this strategy often leads to heterogeneous products, which make optimisation of the biological, physical, and pharmacological properties of an ADC challenging.
- the use of unnatural amino acids as conjugation points to synthesize homogeneous ADCs with precise control of conjugation site and stoichiometry offers a number of advantages which can include improved pharmacokinetics and improved potency.
- a particular embodiment relates to an antibody or antibody fragment comprising about 4 unnatural amino acids that can be or are conjugated to a drug moiety through a linkage between the unnatural amino acid and the drug moiety.
- the antibody is an anti-HER2/neu IgGi humanized antibody or a variant or derivative thereof - such as Trastuzumab.
- Non-naturally occurring amino acids for example, N ⁇ -[((2-methylcycloprop- 2-en-i-yl)methoxy)carbonyl]-L-lysine
- the molecules can be conjugated with the unnatural amino acid(s) containing mAbs using tetrazine chemistry.
- the molecules can include cytotoxic molecules or chemical moieties that induce immune responses.
- N ⁇ -[((2-methylcycloprop-2-en-i-yl)methoxy)carbonyl]-L-lysine) exhibits very high incorporation rates at amber codons (and subsequently higher protein expression).
- cyclopropene has a longer side chain and a more solvent-exposed conjugation handle. This long side-chain, combined with the high rates of amber-codon incorporation, should allow for incorporation of the UAA at more sites within the mAb scaffold. This flexibility can be important for customising different antibody-drug conjugates.
- Kits for producing a protein of interest comprising one or more unnatural amino acids are also provided.
- a Mt for incorporating an unnatural amino acid into a protein in a eukaryotic cell comprising: (i) the nucleic acid constructs described herein; or (ii) the combination of nucleic acid constructs described herein; or (iii) the vector described herein; or (iv) the combination of vectors described herein; or (v) the cell described herein; and (vi) optionally, an unnatural amino acid.
- the kit further comprises a nucleic acid construct or a vector encoding a mutant eRF1, or a cell comprising same.
- kits may also comprise printed instructional materials describing a method for using the reagents to produce such proteins.
- the present invention employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology and recombinant DNA technology, which are within the capabilities of a person of ordinary skill in the art. Such techniques are explained in the literature. See, for example, M. Green & J. Sambrook, 2012, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press. This text is herein incorporated by reference.
- a nucleic acid construct for expressing a tRNA synthetase and tRNA pair in a eukaryotic cell suitably a mammalian or insect cell, comprising:
- nucleic acid construct (ii) a nucleic acid sequence encoding the tRNA operably linked to a second promoter capable of expressing the tRNA, wherein the first and second promoters are in opposite directions to each other, or wherein the tRNA is present in multiple copies on the nucleic acid construct. paragraph 2.
- nucleic acid construct according to paragraph 2 wherein the promoter is oriented in the same direction as the first promoter, optionally, wherein the promoter capable of expressing the nucleic acid sequence of interest in a eukaryotic cell is the same as the first promoter or different to the first promoter. paragraph 4.
- nucleic acid construct for expressing a tRNA and a nucleic acid sequence of interest in a eukaryotic cell, said nucleic acid sequence of interest comprising a codon recognised by the tRNA at the position for incorporation of an unnatural amino acid comprising:
- nucleic acid sequence comprising the nucleic acid sequence of interest operably linked to a first promoter capable of expressing the nucleic acid sequence of interest in a eukaryotic cell
- paragraph 7 The nucleic acid construct according to paragraph 6, further comprising a nucleic acid sequence encoding a mutant eRFi, suitably a mutant homo sapiens eRF1, suitably, wherein the mutant eRF1 is selected from the group consisting of E55D, E55A, N129P/K130Q and Y125F or a combination of two or more thereof. paragraph 8.
- nucleic acid construct according to any of the preceding paragraphs, wherein the first and second promoters are in opposite directions to each other and wherein the tRNA is present in multiple copies on the nucleic acid construct. paragraph 9.
- paragraph ic The nucleic acid construct according to any of the preceding paragraphs, wherein each copy of the nucleic acid sequence encoding the tRNA is under the control of a separate promoter. paragraph 11.
- nucleic acid construct according to any of the preceding paragraphs wherein the promoter arrangement comprises an elongation factor promoter oriented in a first direction and a Pol III promoter oriented in a second direction. paragraph 12.
- paragraph 19 The combination of nucleic acid constructs according to paragraph 19, wherein the nucleic acid sequence encoding the mutant eRF1 is on a separate construct. paragraph 21. A vector comprising the nucleic acid construct according to any of paragraphs 1 to 18. paragraph 22. A combination of vectors comprising a vector comprising the nucleic acid construct according to any of paragraphs 1 to 5 and 8 to 18 and a vector comprising the nucleic acid construct according to any of paragraphs 6 to 18. paragraph 23. The combination of vectors according to paragraph 22, wherein the nucleic acid sequence encoding the mutant eRF1 is on a separate vector. paragraph 24.
- a cell comprising the nucleic acid construct according to any of paragraphs 1 to 18, the combination of nucleic acid constructs according to paragraph 19 or paragraph 20, the vector according to paragraph 21 or the combination of vectors according to paragraph 22 or paragraph 23. paragraph 25.
- the cell according to paragraph 25, wherein the mutant eRF1 is selected from the group consisting of E55D, E55A, N129P/K130Q and Y125F or a combination of two or more thereof, suitably, where in the mutations are made in the homo sapiens eRF1 gene sequence as described in GenBank Accession Number AF095901.1. paragraph 27.
- nucleic acid constructs according to any of paragraphs 1 to 5 and 8 to 18 and the nucleic acid construct according to any of paragraphs 6 to 18; or (ii) the combination of nucleic acid constructs according to paragraph 19 or paragraph 20; or
- paragraph 30 The kit according to paragraph 29, further comprising a nucleic acid construct or a vector encoding a mutant eRF1, or a cell comprising same.
- paragraph 31 A method for incorporating an unnatural amino acid into a protein of interest in a eukaryotic cell, suitably a mammalian or insect cell, comprising the steps of: i) providing the cell according to paragraph 27 or paragraph 28, wherein said cell comprises the combination of nucleic acid constructs according to paragraph 19 or paragraph 20 or the combination of vectors according to paragraph 22 or paragraph 23; and ii) incubating the cell in the presence of the unnatural amino acid to be incorporated into a protein of interest encoded by the nucleic acid sequence of interest, wherein said unnatural amino acid is a substrate for the tRNA synthetase; and iii) incubating the cell to allow incorporation of said unnatural amino acid into the protein of interest via the orthogonal tRNA-tRNA synthetase
- paragraph 32 The method according to paragraph 31, wherein at least 3, 4, or 5 unnatural amino acids are incorporated into the protein of interest.
- paragraph 33. A method of preparing an antibody-drug conjugate comprising the steps of: i) providing the cell according to paragraph 27 or paragraph 28, wherein said cell comprises the combination of nucleic acid constructs according to paragraph 19 or paragraph 20 or the combination of vectors according to paragraph 22 or paragraph 23, and wherein the nucleic acid sequence of interest encodes an antibody or an antibody fragment; ii) incubating the cell in the presence of the unnatural amino acid to be incorporated into the antibody or antibody fragment, wherein said unnatural amino acid is a substrate for the tRNA synthetase; iii) obtaining an antibody or antibody fragment in which an unnatural amino acid has been incorporated therein; and iv) conjugating the antibody or antibody fragment with a drug moiety via the unnatural amino acid.
- paragraph 34 Use of: (i) the nucleic acid construct according to any of paragraphs 1 to 5 and 8 to 18 and the nucleic acid construct according to any of paragraphs 6 to 18; or (ii) the combination of nucleic acid constructs according to paragraph 19 or paragraph 20; or (iii) the vector according to paragraph 21; or (iv) the combination of vectors according to paragraph 22 or paragraph 23; or (v) the insect or mammalian cell according to paragraph 27 or paragraph 28, for incorporating an unnatural amino acid into a protein of interest in a eukaryotic cell, suitably a mammalian or insect cell. paragraph 35.
- a method for incorporating an unnatural amino acid into a protein of interest in a eukaryotic cell comprising the steps of: i) providing a eukaryotic cell expressing an orthogonal tRNA synthetase and tRNA pair, a nucleic acid sequence of interest and a mutant eRF1, said nucleic acid sequence of interest comprising a codon recognised by the tRNA at the position for incorporation of an unnatural amino acid; ii) incubating the eukaryotic cell in the presence of an unnatural amino acid to be incorporated into a protein encoded by the nucleic acid sequence of interest, wherein said unnatural amino acid is a substrate for the orthogonal tRNA synthetase; and iii) incubating the eukaryotic cell to allow incorporation of said unnatural amino acid into the protein of interest via the orthogonal tRNA-tRNA synthetase pair.
- paragraph 36 Use of a mutant eRF1 for incorporating an unnatural amino acid into a protein of interest in a eukaryotic cell, suitably a mammalian or insect cell .
- paragraph 37 A method of identifying a mutant of eRF1 that increases the incorporation of an unnatural amino acid in a protein of interest, comprising the steps of: (i) providing a cell that is capable in incorporating an unnatural amino into a protein of interest, suitably, wherein said cell expresses an orthogonal tRNA synthetase and tRNA pair, a nucleic acid sequence of interest and optionally a mutant eRF1, said nucleic acid sequence of interest comprising a codon recognised by the tRNA at the position for incorporation of an unnatural amino acid; incubating the cell in the presence of the unnatural amino acid to be incorporated into the protein of interest and in the presence and absence of the mutant of eRF1, wherein said unnatural amino acid is a substrate for the tRNA synthetase;
- Reporter constructs were derived from the previously described plasmid pMbPylRS- mCherry-TAG-EGFP-HAi restriction sites was replaced with sfGFP 150TAG, codon- optimized (Supplementary Information Table Si) for expression in human cell lines (Life Technologies), to create plasmid CMV-PylRS/CMV-sfGFP(TAG). The same region was replaced with a Renilla-TAG-firefly luciferase cassette to create plasmid CMV- PylRS/CMV-DLR(TAG).
- Stop or sense codons were introduced by site-directed mutagenesis into sfGFP 150TAG or the Renilla-TAG-firefly luciferase cassette in pJeti.2 (Thermo scientific), using KOD Hot Start polymerase (Novagen).
- PB220PA-1 backbone (System Biosciences) was used.
- the CMV cassette was replaced with an EF-ia cassette from CD532A-2 (System Biosciences), subcloning the Spel/Sall fragment into Spel/Sall of PB220PA-1.
- the optimized U6 promoter / Methanosarcina mazei pyrrolysine tRNA insert (Supplementary Information Table Si) was synthesized (Life technologies) with Spel/Avrll flanking sites.
- a 4xU6 PylT tandem cassette was constructed by repeated insertion of the Spel/Avrll fragment into a unique Spel site 5' of the EFi promoter.
- the (U6-PylT*)4/EF-ia-PylRS, (U6-PylT*)4/EF-ia-sfGFP(TAG) and (U6-PylT*)4/EF- i ⁇ x-sfGFP(TAG)3 plasmids were constructed by subcloning of the relevant genes from AG28, CMV-PylRS/CMV-sfGFP and CMV-PylRS/CMV-S2.
- the Homo sapiens eRFi gene (GenBank: AF095901.1) was codon optimized for Drosophila melanogaster (Supplementary Information Table Si), and extended by an N-terminal His6 tag, a C-terminal triple stop (UAAUGAUAG). The codon optimization was performed using the Helixweb toolkit2. Additional mutations were introduced by site-directed mutagenesis (Supplementary Information Table 2), and the resulting constructs cloned into the mammalian expression vectors pcDNATMs/FRT/TO using restriction sites Hindin/Notl to create the peRFi(X) vectors in which X represents the mutation, and eRFi is expressed from a CMV promoter. Cell culture, antibodies and assays
- Adherent HEK293T cells were maintained on Diilbecco's modified Eagle's medium (DMEM)-Glutamax (Gibco), supplemented with 10% FBS in a 5% CO2 atmosphere at 37°C.
- Transient transfections were performed using TransIT®-293 (Minis) transfection reagent or polyethylenimin (Max PEI, Polysciences) in a 3:1 PEIrDNA ratio following the manufacturers protocol.
- Amino acid 1 was commercially available (E1610.0025, Bachern), amino acid 2 was synthesized as previously described.
- amino acid solutions were prepared as neutralized stock solutions in culture media, and added to cultured cells either with the premcubated transfection mixture (Trans IT-293, 96 well plates) or while changing the culture media four hours post transfection (PEI, 24 well plates, 10cm culture dishes, T75 flasks).
- Northern blotting was performed with the NorthernMax-Gly kit (Ambion); the RNA was denatured in glyoxal load dye, separated on a 2% agarose gel, transferred onto BrightStar-Plus positively charged nylon membrane (Ambion) and cross-linked by UV via a Stratalinker 2400 UV crosslinker (Strategene).
- the membrane was hybridized overnight at 37°C with a 5'-biofinylated DNA probe (5'-GGAAACCCCGGGAATCTAACCCGGCTGAACGGATTTAGAG-3'). The hybridized probe was detected using chemilumineseent nucleic acid detection module (Thermo Scientific).
- Dual Luciferase Assay HEK293T cells were transfected in a 96 well plate (Costar #3595, Corning) using twice the suggested amount of DNA (total 0.2 ⁇ g) and TransIT®-293 reagent (0.6 ul) per well. Dual Luciferase assays were performed according to a simplified manufacturer's protocol (Promega). After 16 hours of growth the culture media was removed, and cells lysed in 20 ⁇ l of passive lysis buffer for 15 minutes at room temperature, 10 ul of lysate were then added to 50 ul of Luciferase Assay Buffer II, in white 96 well plates (Nunc 236105, Thermo Scientific).
- sfGFP(TAG) and sfGFP(TAG)3 for fluorescent assays were performed in 24 well plates. Routinely, iooooo ceils were seeded per well, grown over night and transiently transfected using 160 ng DNA per plasmid, 1.5 ⁇ l of PEI (1 mg/ml) and 50 ⁇ l reduced serum media (Opti-MEM, Gibco). Four hours post transfection, the media was exchanged and amino acid 1 or 2 added to the fresh growth media. Following 48 hours of growth, the supernatant was carefully removed and cells lysed in 100 ⁇ l RIPA buffer (Sigma) with added Complete protease inhibitor (Roche) while shaking.
- sfGFP was expressed in E. coli DHiob cells from a PI5A- based plasmid under pBAD promoter control, and purified by Ni-affinity chromatography as described previously 4 . Protein purity was verified by coomassie staining after SDS-PAGE.
- the absolute protein concentration in the reference sample was determined by measuring the absorbance at 280 nm (extinction coefficient 0.6845) serially diluted (1:10 per step) in RIPA buffer (Sigma) supplemented with Complete protease In hibitor (Roche).
- the fluorescense intensity (excitation 485 nm, emission 520 nm) for a given concentration of sfGFP was measured in a volume of 50 ⁇ l in 96-we.ll plates (Costar, Corning) in triplicate. Measurements outside of the linear range of the microplate reader for a given gain setting (Pherastar FS, BMG Labtech) were discarded and the remaining data points fitted to a linear curve.
- Electrospray mass spectrometry was carried out using an Agilent 1200 LC-MS system equipped with a 6130 Quadrupole spectrometer.
- the solvent system consisted of 0.1% formic acid in H2O as buffer A, and 0.1% formic acid in acetonitrile (MeCN) as buffer B, Protein UV absorbance was monitored at 214 and 280 nm.
- Protein MS acquisition was carried out in positive ion mode and total protein masses were calculated by deconvolution within the MS Chemstation software (Agilent Technologies) 6 .
- This system directed the incorporation of 1 (N ⁇ -[(tert- butoxy)carbonyl]-L-lysine, or 2 (N ⁇ -[((2-methylcycloprop-2-en-i- yl)methoxy)carbonyl]-L-lysine (Chart lb), both known and efficient substrates for the PylRS/tRNAcuA pair 21 - 22 ) in response to an amber codon at position 150 in sfGFP 23 (CMV-sfGFP(TAG)) with efficiencies of 5% and 7% ( Figure la,b); all incorporation efficiencies are reported as a percentage of sfGFP levels produced from an otherwise identical control construct bearing a leucine codon in place of the amber codon at position 150 (plasmid a, Ch rt 1).
- Western blots demonstrate that changing the promoter of the protein coding genes to EF-ia does not change the levels of PylRS (anti-FLAG b+e vs g+h, Figure lb) or wt sfGFP (a vs / Figure lb) , demonstrating that neither PylRS levels nor maximal levels of sfGFP expression are substantially altered by changing to the EFi a promoter.
- northern blots demonstrate that tRNA levels are much higher in this system than in all other systems tested, strongly suggesting that the large increases in unnatural amino acid incorporation efficiency we observe are caused by an increase in tRNA level.
- eRF1 forms a complex with eRF3, primarily mediated through the C- terminal domain on eRF1 37 , that mediates translational termination.
- eRF 3 is present in cells at levels comparable to endogenous eRF1, and therefore eRF 3 limits the number of termination complexes that may form 35 .
- Overexpression of eRF1 N -terminal domain mutants may bias (by mass action) these complexes towards containing the eRF1 mutants, thereby revealing the phenotype of the eRF1 mutations.
- each eRF1 variant into cells ( Figure 2b), and measured basal read- through of stop codons, using three dual luciferase reporters (Figu re 2c).
- Each reporter contained an N-terminal Renilla luciferase followed by a stop codon (amber, opal or ochre) and a C-terminal firefly luciferase 31-34 .
- the read through of the stop codons was between 0.08 and 0.12% (TAG 0.09%, TGA 0.12%, TAA 0.08%), providing a benchmark for further experiments.
- Ectopic overexpression of eRF1 led to a decrease in read-through of all three stop codons (TAG 0.03%, TGA 0.07%, TAA 0.04%), consistent with the increased level of eRF1 in cells 35 .
- This decrease in read-through is small, consistent with the levels of eRF3 being comparable to the levels of endogenous eRF1, and eRF3 levels limiting the number of functional termination complexes that can be formed 35 .
- eRF1 variants increased stop codon read-through with respect to the introduction of wild-type eRF1. However, for all eRF1 mutants tested, except two, read through of all three stop codons was not increased above the levels found in the absence of ectopically expressed eRF1. We conclude that ectopic expression of most of the eRF1 variants tested does not increase read through of stop codons above basal levels.
- the two eRF1 mutants which increase read through of stop codons above levels normally found in cells are eRF1 ⁇ 100, a mutant that increases read-through to 1.6% (TAA), 2% (TAG) and 15% (TGA) and the T122Q, S123F mutant 29 that selectively increases read-through at TGA codons 2-fold. Reduction of endogenous eRF1 levels by shRNA increased basal read-through for all three stop codons 2- to 3-fold.
- the effect of the eRF1 ⁇ 100 mutant on read through of all stop codons is expected, as the N-terminal domain, from which the residues are deleted, mediates recognition of all three stop codons in mRNA, but does not mediate interactions with eRF33 6 -39.
- the mutant is therefore predicted to form inactive complexes with eRFs, decreasing the number of functional eRF1/eRF 3 complexes that can mediate termination,
- shRNA against eRF1 on all stop codons are expected 40 since a decrease in eRF1 should lead to a decrease in termination on all stop codons.
- the dual Iuciferase assay was used to determine the effects of eRF1 on unnatural amino acid incorporation efficiency (Figure 2e).
- the efficiency of unnatural amino acid incorporation was approximately 5.3% in this assay.
- the incorporation efficiency was decreased slightly upon ectopic expression of wild-type release factor, and increased to 13% upon shRNA knockdown of endogenous eRF1.
- the efficiency of incorporation for 1 increased in the presence of all mutant release factors except the S70A, G73S mutant. This mutant was described previously as a bipotent UAR specific eRF1.
- the eRF1 ⁇ 100 mutant significantly reduced the total amount of Iuciferase produced in both situations, consistent with a drastic disruption of termination at all three stop codons having global effects on translation efficiency (Supporting Inform ation Figure 2)
- the ⁇ mutant leads to readthrough of all three stop codons in the absence of suppressor tRNAs; therefore, we did not investigate this release factor mutant further.
- This release factor mutant has been identified to removes formyl-methionine from the initiator tRNA in response to the ochre and opal codon more efficiently than in response to the amber codon, in an in vitro assay using rabbit reticulocyte ribosomes. 25
- Example 5 An optim ized system for incorporating m ultiple unnatural amino acids.
- the yield of sfGFP-1 from sfGFP(TAG) was 0.65 ⁇ g from 10 5 cells, while the yield of sfGFP-(1)3 from sfGFP-(TAG)3 was 0.1 per 10 5 cells (Supporting Inform ation Figure 3 ; all yields are quoted per number of cells seeded, and were measured 48 h after transfection).
- the eRFi-enhanced expression system described so far relies on the parallel transfection of three plasmids in order to introduce all necessary components for unnatural amino acid incorporation into cells.
- genomic integration of the eRFi E55D mutant only two plasmids ( Figure 1, construct g combined with h or i) have to be transfected, increasing the amount of these plasmids delivered into cells.
- a cell line was created that can be switched from a standard cell culture maintenance mode into a high efficiency amber suppression mode when required, by addition of tetracycline to the growth media.
- the eRFi variants were introduced into a Flp-InTM T-RExTM 293 cell line (Life Technologies).
- the cell line contains a single, transcriptionally active genomic FRT target site, and thereby removes variation in expression levels due to the genomic insertion site. It is therefore an ideal tool for comparing the effect of multiple genetic constructs in distinct stable cell lines.
- Amber suppression efficiency was determined by transient transfection of the constructs containing the PylRS/tRNAcuA and sfGFP reporter (constructs g + h/i, Figure 1), in a 1:1 ratio. In the presence of 0.5 mM amino acid 2, amber suppression increased from 75% to 99% in sfGFP(TAG), and from 8% to 20% in sfGFP TAG) 3 upon induction of eRFi expression by addition of 1 ⁇ g/mL tetracycline (Figure 5 A) compared to sfGFP(wt).
- Amber suppression efficiency was determined after transient transfection of the PylRS/ tRNAcuA pair and the sfGFP(TAG) or sfGFP(TAG) 3 reporter constructs (plasmid g + h/I, Figure 1). Amber suppression efficiency is shown as total sfGFP fluorescence over background, and normalization to sfGFP(wt) in the same cell line.
- the cell lines with constitutive expression of eRF1-specific shRNAs increased relative fluorescence to 114% in the eRF1 E55D background, but maintained suppression at 79% in the eRF1 wt background ( Figure 5C) .
- Amber suppression efficiency with a sfGFP(TAG) 3 reporter was 7.6% in the Trex 293 Flp-In parent cell line.
- the stable line expressing eRF1 E55D shows an increase in amber suppression to 19%, further increasing to 31% in the cell line expressing both eRF1 E55D and shRNA(eRF1).
- the cell line expressing eRF1 wt shows no change in amber suppression compared to the parent cell line at 7.6%.
- the derived cell line expressing both eRF1 wt and shRNA(eRF1) displays a minor reduction in suppression efficiency to 5% (Figure 5D) .
- the relative amber suppression efficiency can be enhanced by stable integration of a single copy of eRF1 E55D, and further enhancements require either a reduction in endogenous eRF1 levels, or an increased expression of eRF1 E55D.
- quantitative expression of sfGFP-2 can be achieved, and sfGFP-2 3 can be produced with an efficiency of 30-40% of sfGFP.
- a PylRS/tRNAcuA expression construct a reporter construct containing GFP-mCherry or GFP-TAG-mCherry a UAS driver and an expression construct for each eRF1 variant.
- the transfection efficiency in Dmel cells is lower than in the mammalian system, and the resulting cell lysate and blots represent a mixture of transfected and untransfected cells, reducing the apparent effect ( Figure 6.4).
- a visual indicator is the ⁇ 100 mutant, showing a weak band corresponding to ectopic, truncated eRF1 below the endogenous eRF1 band ( Figure 6B).
- the quantification of amber suppression shown in Figure 6 A is based on three independent transfection experiments, with the corresponding blots being quantified individually.
- the E55D mutant shows the second largest increase in read-through levels of the variants tested, a four-fold increase to 15%.
- the mutations E55A and NK129PQ increase read-through roughly three-fold, to 12%.
- Mutant S70A G73S reported to enhance IJGA read-through, shows no effect on amber suppression. Despite the differences both in the cellular context and the reporter system used, these results closely mirror the relative effect sizes previously observed in mammalian cells. The only exception is mutation Y125F, which appears to have a negligible effect in Dmel cells, but improved UAG read-through in the mammalian system.
- Example 9 - eRFl E55D mutant increases incorporation efficiency of a wide range of unnatural amino acids and tRNA synthetase variants.
- Amber suppression efficiency was determined by transient transfection of the constructs containing the PylRS/tRNAcuA and sfGFP 150 TAG reporter (constructs g + h/i, Figure 1), in a 1:1 ratio. Amber suppression efficiency was determined base on the expression of sfGFP by western blotting. In all cases, the presence of eRF1 E55D mutant increased expression of sfGFP.
- Example 10 Discussion We have defined the efficiency of unnatural amino acid incorporation relative to a natural translation control, allowing us to quantitatively benchmark improvements in unnatural amino acid incorporation efficiency.
- the optimized system we have created provides a 17- to 20- fold improvement in unnatural amino acid incorporation efficiency with amino acids 1 and 2. For amino acid 1 the incorporation efficiency is increased from 5% to 85%, while for amino acid 2 the incorporation efficiency is increased from 7% to 157% of a no stop codon control. Moreover, the optimized system increases the yield of proteins incorporating 1 and 2 at three positions from un- measurably low levels to 12% and 43% of a no stop control respectively.
- Various factors contribute to the dramatic improvement in unnatural amino acid incorporation, which include: the optimization of tRNA CUA levels to optimize PylRS/ tRNAcuA expression; and the development and use of engineered eRF1 variants. While
- the incorporation of unnatural amino acids is quite efficient in response to a single amber codon using the optimized PylRS/tRNAcuA system alone, the efficiency is further improved by the addition of eRF1 (for example, E55D).
- eRF1 for example, E55D
- the effect of the eRF1 mutant on unnatural amino acid incorporation is more dramatic when incorporating unnatural amino acids at multiple sites, increasing the yield of protein containing amino acid 1 at three sites, 2- to 3-foid and the yield of protein containing 2 at three sites, 4-fold.
- the invention finds application in diverse eukaryotic species.
- the invention can be applied in insect ceils such as fly cells (e.g. Drosophiia), fungal cells such as yeast ceils and other eukaryotes.
- Drosophiia S2 cells (D.Mel; invitrogen) were maintained on complete Express 5 SFM medium (Life technologies Ltd.), enriched with 2 mM L-glutamine and pen/strep (50 I.U./mL penicillin, 50 Mg/mL streptomycin) in T75 flasks following standard cell culture practices. Twenty-four hours prior to transfecfions, cells were detached from the surface by scraping or shaking, and 5 ml suspended were cells diluted with 8 ml of pre-warmed medium. For 24-wei! plates 0.5 ml suspended cells were seeded per well and grown over night. Cells were transiently transfected using Fugene HD (Promega).
- Unnatural amino acid incorporation was determined by the expression of a GFP-TAG-mCherry construct. The ratio of full length protein over truncated protein was determined by quantification on blots immunostained for GFP, as described for HEK293T cells.
- Drosophiia melanogaster genetic constructs A human eRF1 gene, optimized for D. meianogaster codon usage containing a terminal His 6 tag and a triple-stop termination signal, was cloned into piasmid SG105(Bianco et al, 2012) using BamHI/Noti restriction sites (primer eRF1__SG105).
- SG105 is derived from UASp, and contains a second multiple cloning site downstream of the white locus (R0rth, 1998).
- AB51 contains six copies of a U6-PylT cassette and UAS-PyIRS (Ambra Bianco, unpublished data).
- Transgenic fly lines containing the eRF1 variants were created by P element injection using a Drosophiia embryo injection service (Bestgene Inc.). eRF1 ⁇ 100 and E55D constructs cloned into piasmid SG105 were successfully microinjected, and returned nine and seven unique lines, respectively.
- Fly line stocks were maintained on apple plates at 16°C. For genetic crosses and unnatural amino incorporation experiments, flies were maintained at 25°C.Fiy lines containing the eRF1 ⁇ 100 or E55D variants were crossed with virgin females from FT74-S2-nos fly lines. The resulting offspring was screened for the correct combination of genetic markers depending on each eRF1 line, maintained for further experiments.
- the FT74-S2-nos line supports unnatural amino acid incorporation using the PyiRS/PylT C uA pair and expresses a dual iuciferase reporter.
- the constructs integrates on the genome are a UAS-dual-luciferase(TAG) reporter, UAS-Py!RS, four copies of a U6-PylT cassette (Triple-Rep-L) and a nos-Gai4-VP16 cassette (B!oomington 4937)
- TAG UAS-dual-luciferase
- Compound 2 was fed to flies mixed into yeast paste. 2 was dissolved in water/NaOH to a final concentration of 10mM, and dried yeast added until a pasty consistency was reached. 1 M HCI was added to neutralize the paste.
- 15 female flies of each line expressing the necessary components for unnatural amino incorporation as well as an eRF1 variant were set-up in tubes with 5 males, and supplied with a small amount of 10mM 2-yeast paste. The flies were transferred into new tubes with fresh 2-yeast paste after 24 and 48 hours. On the third day, the transfer into a fresh tube with 2-yeast paste was performed in the morning, and female flies were dissected in the afternoon.
- flies were collected on a C0 2 pad.
- Female flies were transferred to dissection glasses under a microscope, and the ovaries isolated from the thorax by careful removal of the posterior tip.
- the ovaries from 10-12 flies were collected in PBS buffer, and transferred into a 1 .5 ml microcentrifuge tube. The tube was centrifuged in a table top centrifuge at the lowest setting for 30 seconds, and the supernatant removed. After adding 100 ⁇ 1x passive lysis buffer (Promega), the ovaries were ground up using a plastic pestle, until the solution approached a milky appearance. Debris was removed by centrifugation at full speed for 3 minutes.
- A Illustration of the genetic background. Virgin females from fly line FT74-S2-Nos/TM6, expressing a pyrrolysyl aaRS/tRNAcu A pair, a dual-luciferase reporter and an ovary-specific promoter were crossed to males from balanced fly lines generated by random genomic insertion of eRF1 E55D or ⁇ 100 after microinjection (Bestgene).
- B C. Measuring stop codon readthrough in a dual luciferase assay. Twelve female flies with the correct genetic markers from each genetic cross were collected, and fed on 10mM CyP-yeast paste for 72 hours. The ovaries were collected by dissection, pooled and tested for UAG read-through. Panel B lists the results for all fly lines generated from eRF1 E55D integration events; panel C lists the results for eRF1 ⁇ 100.
- Example 13 Both PyiT U25C and PyiT U25C Opt variants efficiently amber suppression in HEK cells HEK cells transfected with GFP150UAG and 4 PylT U25C or 4x PylT U25C Opt, analysed for GFP fluorescence via FACS, GFP-positive population circled in pink with percentage labelled, MFI of replicates for graph. Standard transfection and flow cytometry protocols, expressed in 2 mM BocK. See Fig 13.
- This 4x cassette may replace the 4x PylT U25C cassette in various vectors described above, such as pKYMi with OFPC150 uag), Trastuzumab LC and HC (114 uag).
- Antibody expression was done in a LC-ires-HC format from a single vector containing both the antibody genes as well as the Pyrollysine unnatural amino acid tRNA and synthetase. This 4xPylT(u25c)/PylS construct is as described above.
- eRFl was expressed from pcDNAs, a standard expression vector. eRFl was transfected at 1:5 ratio to the antibody plasmid. Experiment was done in Expi293 cells, a suspension HEK system, and transfected with PEI using standard protocols. Cultures were 30 mL each, 60 ug of DNA with 180 ug of PEI, expression for 7 days.
- Plasmid diagram is in Figure 20. Sequences below. pKYMi LC-ires-HC sequence
- Example 15 eRF1 E55D enhances BCN incorporation in HEK cells
- PylRS pyrrolysyl-tRNA synthetase
- PylT pyrrolysyl-tRNA synthetase
- eRFl eukaiyotic release factor 1
- eRF3, eukaiyotic release factor 3 sfGFP, super-folder green fluorescent protein.
- Nucleotide sequences of synthetic genes used in this study A. Sequence of the modified U6-PylT* expression cassette. PylT is underlined, and the anticodon marked in red.
- C shows the human eRF1 sequence after codon optimisation for D. melanogaster, with an N- terminal poiyhistidine tag.
- Oligonucleotides used for site-directed mutagenesis Oligonucleotides used for site-directed mutagenesis
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201580058784.6A CN107002088B (zh) | 2014-10-27 | 2015-10-21 | 将非天然氨基酸掺入蛋白质中 |
| EP15794622.9A EP3212799B1 (en) | 2014-10-27 | 2015-10-21 | Incorporation of unnatural amino acids into proteins |
| KR1020177014048A KR102516695B1 (ko) | 2014-10-27 | 2015-10-21 | 단백질 내로의 비-천연 아미노산의 혼입 |
| BR112017008108A BR112017008108A2 (pt) | 2014-10-27 | 2015-10-21 | incorporação de aminoácidos não naturais em proteínas |
| CA2965085A CA2965085A1 (en) | 2014-10-27 | 2015-10-21 | Incorporation of unnatural amino acids into proteins |
| US15/521,103 US10738339B2 (en) | 2014-10-27 | 2015-10-21 | Use of eRF1 mutants in unnatural amino acid incorporation |
| JP2017519813A JP6843044B2 (ja) | 2014-10-27 | 2015-10-21 | 非天然アミノ酸のタンパク質への組み込み |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GBGB1419109.2A GB201419109D0 (en) | 2014-10-27 | 2014-10-27 | Incorporation of unnatural amino acids into proteins |
| GB1419109.2 | 2014-10-27 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016066995A1 true WO2016066995A1 (en) | 2016-05-06 |
Family
ID=52103474
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2015/053141 Ceased WO2016066995A1 (en) | 2014-10-27 | 2015-10-21 | Incorporation of unnatural amino acids into proteins |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US10738339B2 (https=) |
| EP (1) | EP3212799B1 (https=) |
| JP (2) | JP6843044B2 (https=) |
| KR (1) | KR102516695B1 (https=) |
| CN (1) | CN107002088B (https=) |
| BR (1) | BR112017008108A2 (https=) |
| CA (1) | CA2965085A1 (https=) |
| GB (1) | GB201419109D0 (https=) |
| WO (1) | WO2016066995A1 (https=) |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834349A (zh) * | 2017-02-28 | 2017-06-13 | 中国人民解放军军事医学科学院 | 一种安全性提高的病毒基因递送系统 |
| WO2018044143A1 (ko) * | 2016-09-05 | 2018-03-08 | 한국과학기술원 | 목적 단백질의 위치 특이적 변형이 시공간적으로 조절되는 마우스, 이의 제조방법 및 그 용도 |
| WO2018223108A1 (en) * | 2017-06-02 | 2018-12-06 | Ambrx, Inc. | Methods and compositions for promoting non-natural amino acid-containing protein production |
| US10774039B2 (en) | 2014-03-14 | 2020-09-15 | United Kingdom Research And Innovation | Cyclopropene amino acids and methods |
| GB202110137D0 (en) | 2021-07-14 | 2021-08-25 | Res & Innovation Uk | Methods for optimising protein production |
| CN113727993A (zh) * | 2019-02-14 | 2021-11-30 | 欧洲分子生物学实验室 | 通过遗传密码子扩展以靶蛋白选择性方式制备工程化靶蛋白的手段和方法 |
| WO2022248061A1 (en) | 2021-05-28 | 2022-12-01 | United Kingdom Research And Innovation | Microorganisms and uses thereof |
| US11732001B2 (en) | 2012-05-18 | 2023-08-22 | United Kingdom Research And Innovation | Methods of incorporating an amino acid comprising a BCN group into a polypeptide using an orthogonal codon encoding it and an orthogonal pylrs synthase |
| US12286657B2 (en) | 2018-10-26 | 2025-04-29 | United Kingdom Research And Innovation | Methods and compositions |
| WO2025140227A1 (zh) * | 2023-12-25 | 2025-07-03 | 康码(上海)生物科技有限公司 | 一种改造的氨酰-tRNA合成酶、核酸构建物以及基因工程菌株 |
| US12378547B2 (en) | 2019-05-14 | 2025-08-05 | United Kingdom Research And Innovation | Synthetic genome |
Families Citing this family (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20210005172A (ko) * | 2018-05-01 | 2021-01-13 | 암브룩스, 인코포레이티드 | 항체 발현을 최적화하는 방법 |
| CN112673109A (zh) * | 2018-09-07 | 2021-04-16 | 免疫医疗有限责任公司 | 细胞选择方法 |
| CN111718949B (zh) * | 2019-03-19 | 2021-10-01 | 宁波鲲鹏生物科技有限公司 | 利用双质粒系统在蛋白中引入非天然氨基酸 |
| CN111850020B (zh) * | 2019-04-25 | 2021-05-07 | 苏州鲲鹏生物技术有限公司 | 利用质粒系统在蛋白中引入非天然氨基酸 |
| CN111849929B (zh) * | 2019-04-30 | 2021-05-11 | 苏州鲲鹏生物技术有限公司 | 高效引入赖氨酸衍生物的氨酰基—tRNA合成酶 |
| TW202128996A (zh) * | 2019-10-10 | 2021-08-01 | 美商史基普研究協會 | 用於活體內合成非天然多肽的組合物及方法 |
| CN113481239A (zh) * | 2021-07-01 | 2021-10-08 | 四川大学华西医院 | 一种通过Rosa26位点向细胞系中引入非天然氨基酸编码体系的方法及其细胞系 |
| WO2023282315A1 (ja) * | 2021-07-07 | 2023-01-12 | 味の素株式会社 | 非天然アミノ酸含有タンパク質の分泌生産法 |
| CN113699124B (zh) * | 2021-09-08 | 2022-04-12 | 北京大学 | 一种含非天然氨基酸蛋白的制备方法 |
| WO2023196596A2 (en) * | 2022-04-08 | 2023-10-12 | Absci Corporation | Trna synthetases and methods of use thereof |
| EP4689125A1 (en) * | 2023-03-30 | 2026-02-11 | The Chinese University of Hong Kong | Unnatural amino acid in cellulo synthesis for site-specific protein modification |
| CN120752342A (zh) * | 2023-07-13 | 2025-10-03 | 深圳华大生命科学研究院 | 工程生物遏制系统及方法 |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006110182A2 (en) * | 2004-10-27 | 2006-10-19 | The Scripps Research Institute | Orthogonal translation components for the in vivo incorporation of unnatural amino acids |
| EP2192185A1 (en) | 2007-09-20 | 2010-06-02 | Riken | Mutant pyrrolysyl-trna synthetase, and method for production of protein having non-natural amino acid integrated therein by using the same |
| WO2010139948A2 (en) | 2009-06-04 | 2010-12-09 | Medical Research Council | Methods |
| US20120077186A1 (en) * | 2010-05-07 | 2012-03-29 | Oregon Health & Science University | Use of cysteine-derived suppressor trnas for non-native amino acid incorporation |
| WO2013108044A2 (en) | 2012-01-20 | 2013-07-25 | Medical Research Council | Polypeptides and methods |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2004321117B2 (en) * | 2003-12-18 | 2010-09-02 | The Scripps Research Institute | Selective incorporation of 5-hydroxytryptophan into proteins in mammalian cells |
-
2014
- 2014-10-27 GB GBGB1419109.2A patent/GB201419109D0/en not_active Ceased
-
2015
- 2015-10-21 KR KR1020177014048A patent/KR102516695B1/ko active Active
- 2015-10-21 WO PCT/GB2015/053141 patent/WO2016066995A1/en not_active Ceased
- 2015-10-21 CA CA2965085A patent/CA2965085A1/en not_active Abandoned
- 2015-10-21 BR BR112017008108A patent/BR112017008108A2/pt not_active Application Discontinuation
- 2015-10-21 JP JP2017519813A patent/JP6843044B2/ja active Active
- 2015-10-21 CN CN201580058784.6A patent/CN107002088B/zh active Active
- 2015-10-21 US US15/521,103 patent/US10738339B2/en active Active
- 2015-10-21 EP EP15794622.9A patent/EP3212799B1/en active Active
-
2020
- 2020-10-22 JP JP2020177605A patent/JP2021035374A/ja not_active Withdrawn
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006110182A2 (en) * | 2004-10-27 | 2006-10-19 | The Scripps Research Institute | Orthogonal translation components for the in vivo incorporation of unnatural amino acids |
| EP2192185A1 (en) | 2007-09-20 | 2010-06-02 | Riken | Mutant pyrrolysyl-trna synthetase, and method for production of protein having non-natural amino acid integrated therein by using the same |
| WO2010139948A2 (en) | 2009-06-04 | 2010-12-09 | Medical Research Council | Methods |
| US20120077186A1 (en) * | 2010-05-07 | 2012-03-29 | Oregon Health & Science University | Use of cysteine-derived suppressor trnas for non-native amino acid incorporation |
| WO2013108044A2 (en) | 2012-01-20 | 2013-07-25 | Medical Research Council | Polypeptides and methods |
Non-Patent Citations (73)
| Title |
|---|
| ANTICANCER RES., vol. 22, no. 6A, 2002, pages 3325 - 30 |
| ARBELY, E.; TORRES-KOLBUS, J.; DEITERS, A.; CHIN, J. W., J AM CHEM SOC, vol. 134, 2012, pages 11912 |
| BAKER, A. S.; DEITERS, A, ACS CHEM BIOL, vol. 9, 2014, pages 7 |
| BERTRAM, G.; INNES, S.; MINELLA, O.; RICHARDSON, J.; STANSFIELD, I, MICROBIOLOGY, vol. 147, 2001, pages 255 |
| BIOCHEMISTRY, vol. 52, 2013, pages 10 |
| BULYGIN KONSTANTIN N ET AL: "Three distinct peptides from the N domain of translation termination factor eRF1 surround stop codon in the ribosome", RNA (COLD SPRING HARBOR), vol. 16, no. 10, October 2010 (2010-10-01), pages 1902 - 1914, XP002753739, ISSN: 1355-8382 * |
| BULYGIN, K. N.; KHAIRULINA, Y. S.; KOLOSOV, P. M.; VEN'YAMINOVA, A. G.; GRAIFER, D. M.; VOROBJEV, Y. N.; FROLOVA, L. Y.; KISSELEV,, RNA, vol. L6, 2010, pages 1902 |
| CHATTERJEE, A.; SUN, S. B.; FURMAN, J. L.; XIAO, H.; SCHULTZ, P. G., BIOCHEMISTRY, vol. 52, 2013, pages 10 |
| CHEM BIOL., vol. 17, 2010, pages 213 - 27 |
| CHEN, P. R.; GROFF, D.; GUO, J; OU, W.; CELLITTI, S.; GEIERSTANGER, B. H; SCHULTZ, P. G., ANGEWANDTE CHEMIE INTERNATIONAL EDITION, vol. 48, 2009, pages 4052 |
| CHENG, Z.; SAITO, K.; PISAREV, A. V.; WADA, M.; PISAREVA, V. P.; PESTOVA, T. V.; GAJDA, M.; ROUND, A.; KONG, C.; LIM, M., GENES DEV, vol. 23, 2009, pages 1106 |
| CHIN JASON W: "Expanding and reprogramming the genetic code of cells and animals.", ANNUAL REVIEW OF BIOCHEMISTRY 2014, vol. 83, 10 February 2014 (2014-02-10), pages 379 - 408, XP002753743, ISSN: 1545-4509 * |
| CHIN, J. W., ANNU REV BIOCHEM, vol. 83, 2014, pages 379 |
| CONARD, S. E.; BUCKLEY, J.; DANG, M.; BEDWELL, G. J.; CARTER, R. L.; KHASS, M.; BEDWELL, D. M, RNA, vol. 18, 2012, pages 1210 |
| DAVIS, L; CHIN, J. W, NAT REV MOL CELL BIOL, vol. 13, 2012, pages 168 |
| DES GEORGES, A.; HASHEM, Y.; UNBEHAUN, A.; GRASSUCCI, R. A.; ; TAYLOR, D.; HELLEN, C. U.; PESTOVA, T. V.; FRANK, J., NUCLEIC ACIDS RES, vol. 42, 2014, pages 3409 |
| DEVER, T. E.; GREEN, R, COLD SPRING HARB PERSPECT BIOL, vol. 4, 2012, pages AOI37O6 |
| ELISEEV, B.; KRYUCHKOVA, P.; ALKALAEVA, E.; FROLOVA, L., NUCLEIC ACIDS RES, vol. 39, 2011, pages 599 |
| ELLIOTT, T. S.; TOWNSLEY, F. M.; BIANCO, A.; ERNST, R. J.; SACHDEVA, A.; ELSASSER, S. J.; DAVIS, L.; LANG, K.; PISA, R.; GREISS, S, NAT BIOTECHNOL, vol. 32, 2014, pages 465 |
| FAN ET AL., NUCLEIC ACIDS RESEARCH, 2015 |
| GAUTIER, A.; NGUYEN, D. P.; LUSIC, H.; AN, W.; DEITERS, A.; CHIN, J. W., J AM CHEM SOC, vol. 132, 2010, pages 4086 |
| GAUTIER, A; NGUYEN, D. P.; LUSIC, H.; AN, W.; DEITERS, A.; CHIN, J. W., JAM CHEM SAC, vol. 132, 2010, pages 4086 |
| GREG T. HERMANSON: "Bioconjugate Techniques, 2nd ed.", 2008, ELSEVIER |
| GRENTZMANN, G.; INGRAM, J. A.; KELLY, P. J.; GESTELAND, R. F.; ATKINS, J. F., RNA, vol. 4, 1998, pages 479 |
| HOOVER, D. M.; LUBKOWSKI, J., NUCLEIC ACIDS RES, vol. 30, 2002 |
| ILEGEMS E ET AL: "Downregulation of eRF1 by RNA interference increases mis-acylated tRNA suppression efficiency in human cells", PROTEIN ENGINEERING, DESIGN AND SELECTION, OXFORD JOURNAL, LONDON, GB, vol. 17, no. 12, 1 January 2004 (2004-01-01), pages 821 - 827, XP003016883, ISSN: 1741-0126, DOI: 10.1093/PROTEIN/GZH096 * |
| JACKSON, R. J.; HELLEN, C. U.; PESTOVA, T. V., ADV PROTEIN CHEM STRUCT BIOL, vol. 86, 2012, pages 45 |
| JAM CHEM SAC, vol. 131, 2009, pages 8720 |
| JANZEN, D. M.; GEBALLE, A. P., NUCLEIC ACIDS RES, vol. 32, 2004, pages 4491 |
| JOHNSON, D. B.; XU, J.; SHEN, Z.; TAKIMOTO, J. K.; SCHULTZ, M. D.; SCHMITZ, R. J.; XIANG, Z.; ECKER, J. R.; BRIGGS, S. P.; WANG, L, NAT CHEM BIOL, vol. 7, 2011, pages 779 |
| JOURNAL OF THE AMERICAN CHEMICAL SOCIETY, vol. 132, no. 12, 2010, pages 4086 - 4088 |
| K. LANG; L. DAVIS; S. WALLACE; M. MAHESH; D. J. COX; M. L. BLACKMAN; J. M. FOX; J.W. CHIN, J. AM. CHEM. SOC, vol. 134, 2012, pages 10317 - 10320 |
| KEELING, K. M.; LANIER, J.; DU, M.; SALAS-MARCO, J.; GAO, L.; KAENJAK-ANGELETTI, A.; BEDWELL, D. M., RNA, vol. 10, 2004, pages 691 |
| KIM, C. H.; AXUP, J. Y.; SCHULTZ, P. G., CURR OPIN CHEM BIOL, vol. 17, 2013, pages 412 |
| KOLOSOV PETR ET AL: "Invariant amino acids essential for decoding function of polypeptide release factor eRF1", 2005, NUCLEIC ACIDS RESEARCH, VOL. 33, NR. 19, PAGE(S) 6418-6425, ISSN: 0305-1048, XP002753738 * |
| KOLOSOV, P.; FROLOVA, L.; SEIT-NEBI, A.; DUBOVAYA, V.; KONONENKO, A.; OPARINA, N.; JUSTESEN, J.; EFIMOV, A.; KISSELEV, L., NUCLEIC ACIDS RES, vol. 33, 2005, pages 6418 |
| KONECKI, D. S.; AUNE, K. C.; TATE, W.; CASKEY, C. T., J BIOL CHEM, vol. 252, 1977, pages 4514 |
| KONONENKO, A. V.; MITKEVICH, V. A.; DUBOVAYA, V. I.; KOLOSOV, P. M.; MAKAROV, A. A.; KISSELEV, L. L., PROTEINS, vol. 70, 2008, pages 388 |
| KRYUCHKOVA POLINA ET AL: "Two-step model of stop codon recognition by eukaryotic release factor eRF1", NUCLEIC ACIDS RESEARCH, vol. 41, no. 8, April 2013 (2013-04-01), pages 4573 - 4586, XP002753741 * |
| KRYUCHKOVA, P.; GRISHIN, A.; ELISEEV, B.; KARYAGINA, A.; FROLOVA, L.; ALKALAEVA, E, NUCLEIC ACIDS RES, vol. 41, 2013, pages 4573 |
| LAJOIE, M. J.; ROVNER, A. J.; GOODMAN, D. B.; AERNI, H. R.; HAIMOVICH, A. D.; KUZNETSOV, G.; MERCER, J. A.; WANG, H. H.; CARR, P., SCIENCE, vol. 342, 2013, pages 357 |
| LANG, K.; CHIN, J. W, CHEM REV, vol. 114, 2014, pages 4764 |
| LE GOFF, X.; PHILIPPE, M.; JEAN-JEAN, O, MOL CELL BIOL, vol. 17, 1997, pages 3164 |
| LEKOMTSEV SERGEY ET AL: "Different modes of stop codon restriction by the stylonychia and paramecium eRF1 translation termination factors", June 2007, PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, VOL. 104, NR. 26, PAGE(S) 10824-10829, ISSN: 0027-8424, XP002753742 * |
| LEKOMTSEV, S.; KOLOSOV, P.; BIDOU, L.; FROLOVA, L.; ROUSSET, J. P.; KISSELEV, L, PROC NATL ACAD SCI USA, vol. IO4, 2007, pages 10824 |
| LIANG, H.; WONG, J. Y.; BAO, Q.; CAVALCANTI, A. R.; LANDWEBER, L. F., J MOL EVOL, vol. 60, 2005, pages 337 |
| M. GREEN; J. SAMBROOK: "Molecular Cloning: A Laboratory Manual", 2012, COLD SPRING HARBOR LABORATORY PRESS |
| MABS, vol. 4, no. 6, 2012, pages 1 - 11 |
| MABS, vol. 6, no. 1, 2014, pages 46 - 53 |
| MERKULOVA, T. I.; FROLOVA, L. Y.; LAZAR, M.; CAMONIS, J.; KISSELEV, L. L., FEBS LETT, vol. 443, 1999, pages 41 |
| MIYAKE-STONER, S. J.; REFAKIS, C. A.; HAMMILL, J. T.; LUSIC, H.; HAZEN, J. L.; DEITERS, A.; MEHL, R. A., BIOCHEMISTRY, vol. 49, 2010, pages 1667 |
| MUKAI, T.; HAYASHI, A.; IRAHA, F.; SATO, A.; OHTAKE, K.; YOKOYAMA, S.; SAKAMOTO, K, NUCLEIC ACIDS RES, vol. 38, 2010, pages 8188 |
| MUKAI, T.; KOBAYASHI, T.; HINO, N.; YANAGISAWA, T.; SAKAMOTO, K.; YOKOYAMA, S., BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, 2008 |
| NAT BIOTECHNOL, vol. 32, 2014, pages 465 |
| NAT CHEM BIOL., vol. 7, 2011, pages 876 - 84 |
| NEUMANN ET AL., NAT CHEM BIOL, vol. 4, 2008, pages 232 |
| NGUYEN, D. P.; GARCIA M. M.; KAPADNIS P. B.; NEUMANN, N.; CHIN, J. W., J AM CHEM SOC, vol. 131, 2009, pages 40 |
| NGUYEN, D. P.; LUSIC, H.; NEUMANN, H.; KAPADNIS, P. B.; DEITERS, A.; CHIN, J. W., J AM CHEM SAC, vol. 131, 2009, pages 8720 |
| NGUYEN, D. P.; MAHESH, M.; ELSASSER, S. J.; HANCOCK, S. M.; UTTAMAPINANT, C.; CHIN, J. W, J AM CHEM SOC, vol. 136, 2014, pages 2240 |
| NUCLEIC ACIDS RES., vol. 38, no. I6, September 2010 (2010-09-01), pages 5479 - 92 |
| PETRY, S.; BRODERSEN, D. E.; MURPHY, F. V. T.; DUNHAM, C. M.; SELMER, M.; TARRY, M. J.; KELLEY, A. C.; RAMAKRISHNAN, V, CELL, vol. 123, 2005, pages 1255 |
| SALAS-MARCO, J.; FAN-MINOGUE, H.; KALLMEYER, A. K.; KLOBUTCHER, L. A.; FARABAUGH, P. J.; BEDWELL, D. M., MOL CELL BIOL, vol. 26, 2006, pages 438 |
| SCOLNICK, E.; TOMPKINS, R.; CASKEY, T.; NIRENBERG, M, PROC NATL ACAD SCI U S A, vol. 61, 1968, pages 768 |
| SEIT-NEBI ALIM ET AL: "Conversion of omnipotent translation termination factor eRF1 into ciliate-like UGA-only unipotent eRF1.", September 2002, EMBO REPORTS, VOL. 3, NR. 9, PAGE(S) 881-886, ISSN: 1469-221X, XP002753740 * |
| SEIT-NEBI, A.; FROLOVA, L.; KISSELEV, L, EMBO REP, vol. 3, 2002, pages 881 |
| THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 262, no. 3, 1987, pages 1187 - 1193 |
| THOMAS S ELLIOTT ET AL: "Proteome labeling and protein identification in specific tissues and at specific developmental stages in an animal", NATURE BIOTECHNOLOGY, vol. 32, no. 5, 13 April 2014 (2014-04-13), pages 465 - 472, XP055188555, ISSN: 1087-0156, DOI: 10.1038/nbt.2860 * |
| WANG, K.; NEUMANN, H.; PEAK-CHEW, S. Y.; CHIN, J. W., NAT BIOTECHNOL, vol. 25, 2007, pages 770 |
| WILKINS, M. R.; GASTEIGER, E.; BAIROCH, A.; SANCHEZ, J. C.; WILLIAMS, K. L.; APPEL, R. D.; HOCHSTRASSER, D. F, METHODS MOL BIOL, vol. 112, 1999, pages 531 |
| WOLFGANG H. SCHMIED ET AL: "Efficient Multisite Unnatural Amino Acid Incorporation in Mammalian Cells via Optimized Pyrrolysyl tRNA Synthetase/tRNA Expression and Engineered eRF1", JOURNAL OF THE AMERICAN CHEMICAL SOCIETY, vol. 136, no. 44, 28 October 2014 (2014-10-28), US, pages 15577 - 15583, XP055188529, ISSN: 0002-7863, DOI: 10.1021/ja5069728 * |
| WU, I. L.; PATTERSON, M. A.; CARPENTER DESAI, H. E.; MEHL, R. A.; GIORGI, G.; CONTICELLO, V. P., CHEMBIOCHEM, vol. 14, 2013, pages 968 |
| XIAO, H.; CHATTERJEE, A.; CHOI, S. H.; BAJJURI, K. M.; SINHA, S. C.; SCHULTZ, P. G., ANGEW CHEM INT ED ENGL, vol. 52, 2013, pages 14080 |
| YANAGISAWA ET AL., CHEM BIOL, vol. 15, 2008, pages 1187 |
Cited By (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11732001B2 (en) | 2012-05-18 | 2023-08-22 | United Kingdom Research And Innovation | Methods of incorporating an amino acid comprising a BCN group into a polypeptide using an orthogonal codon encoding it and an orthogonal pylrs synthase |
| US10774039B2 (en) | 2014-03-14 | 2020-09-15 | United Kingdom Research And Innovation | Cyclopropene amino acids and methods |
| WO2018044143A1 (ko) * | 2016-09-05 | 2018-03-08 | 한국과학기술원 | 목적 단백질의 위치 특이적 변형이 시공간적으로 조절되는 마우스, 이의 제조방법 및 그 용도 |
| CN106834349A (zh) * | 2017-02-28 | 2017-06-13 | 中国人民解放军军事医学科学院 | 一种安全性提高的病毒基因递送系统 |
| CN106834349B (zh) * | 2017-02-28 | 2019-12-13 | 中国人民解放军军事医学科学院 | 一种安全性提高的病毒基因递送系统 |
| KR102705871B1 (ko) | 2017-06-02 | 2024-09-11 | 암브룩스, 인코포레이티드 | 비천연 아미노산 함유 단백질 생성을 촉진하는 방법 및 조성물 |
| EP4382124A3 (en) * | 2017-06-02 | 2024-10-16 | Ambrx, Inc. | Methods and compositions for promoting non-natural amino acid-containing protein production |
| US20210017527A1 (en) * | 2017-06-02 | 2021-01-21 | Ambrx, Inc. | Methods and compositions for promoting non-natural amino acid-containing protein production |
| CN110959041B (zh) * | 2017-06-02 | 2023-09-29 | Ambrx公司 | 促进含非天然氨基酸的蛋白质产生的方法和组合物 |
| KR20200011979A (ko) * | 2017-06-02 | 2020-02-04 | 암브룩스, 인코포레이티드 | 비천연 아미노산 함유 단백질 생성을 촉진하는 방법 및 조성물 |
| US12577575B2 (en) | 2017-06-02 | 2026-03-17 | Ambrx, Inc. | Methods and compositions for promoting non-natural amino acid-containing protein production |
| WO2018223108A1 (en) * | 2017-06-02 | 2018-12-06 | Ambrx, Inc. | Methods and compositions for promoting non-natural amino acid-containing protein production |
| CN110959041A (zh) * | 2017-06-02 | 2020-04-03 | Ambrx公司 | 促进含非天然氨基酸的蛋白质产生的方法和组合物 |
| KR20240063184A (ko) * | 2017-06-02 | 2024-05-09 | 암브룩스, 인코포레이티드 | 비천연 아미노산 함유 단백질 생성을 촉진하는 방법 및 조성물 |
| US11851662B2 (en) | 2017-06-02 | 2023-12-26 | Ambrx, Inc. | Methods and compositions for promoting non-natural amino acid-containing protein production |
| KR102662379B1 (ko) | 2017-06-02 | 2024-04-29 | 암브룩스, 인코포레이티드 | 비천연 아미노산 함유 단백질 생성을 촉진하는 방법 및 조성물 |
| US12286657B2 (en) | 2018-10-26 | 2025-04-29 | United Kingdom Research And Innovation | Methods and compositions |
| CN113727993A (zh) * | 2019-02-14 | 2021-11-30 | 欧洲分子生物学实验室 | 通过遗传密码子扩展以靶蛋白选择性方式制备工程化靶蛋白的手段和方法 |
| US12378547B2 (en) | 2019-05-14 | 2025-08-05 | United Kingdom Research And Innovation | Synthetic genome |
| US12385035B2 (en) | 2019-05-14 | 2025-08-12 | United Kingdom Research And Innovation | Synthetic genome |
| WO2022248061A1 (en) | 2021-05-28 | 2022-12-01 | United Kingdom Research And Innovation | Microorganisms and uses thereof |
| GB202110137D0 (en) | 2021-07-14 | 2021-08-25 | Res & Innovation Uk | Methods for optimising protein production |
| WO2023285596A2 (en) | 2021-07-14 | 2023-01-19 | United Kingdom Research And Innovation | Methods for optimising protein production |
| WO2025140227A1 (zh) * | 2023-12-25 | 2025-07-03 | 康码(上海)生物科技有限公司 | 一种改造的氨酰-tRNA合成酶、核酸构建物以及基因工程菌株 |
Also Published As
| Publication number | Publication date |
|---|---|
| EP3212799B1 (en) | 2019-04-17 |
| EP3212799A1 (en) | 2017-09-06 |
| BR112017008108A2 (pt) | 2017-12-19 |
| CN107002088B (zh) | 2022-01-11 |
| JP2021035374A (ja) | 2021-03-04 |
| CN107002088A (zh) | 2017-08-01 |
| JP6843044B2 (ja) | 2021-03-17 |
| KR20170070238A (ko) | 2017-06-21 |
| JP2017532043A (ja) | 2017-11-02 |
| GB201419109D0 (en) | 2014-12-10 |
| US20170356023A1 (en) | 2017-12-14 |
| US10738339B2 (en) | 2020-08-11 |
| KR102516695B1 (ko) | 2023-03-30 |
| CA2965085A1 (en) | 2016-05-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3212799B1 (en) | Incorporation of unnatural amino acids into proteins | |
| JP7617162B2 (ja) | 非天然アミノ酸含有タンパク質の産生を促進する方法および組成物 | |
| US10618952B2 (en) | Prevention of N-terminal truncation in IgG light chains | |
| US20240384267A1 (en) | Compositions and methods for multiplex decoding of quadruplet codons | |
| HK1235831B (en) | Incorporation of unnatural amino acids into proteins | |
| HK1235831A1 (en) | Incorporation of unnatural amino acids into proteins | |
| WO2006055898A2 (en) | Orthogonal suppressor trnas and aminoacyl-trna synthetases and uses thereof | |
| HK40112802A (en) | Methods and compositions for promoting non-natural amino acid-containing protein production | |
| HK40105193A (zh) | 促进含非天然氨基酸的蛋白质产生的方法和组合物 | |
| HK40025639A (en) | Methods and compositions for promoting non-natural amino acid-containing protein production | |
| HK40025639B (en) | Methods and compositions for promoting non-natural amino acid-containing protein production | |
| CA3154273A1 (en) | Chimeric thermostable aminoacyl-trna synthetase for enhanced unnatural amino acid incorporation | |
| BR122024018546A2 (pt) | Métodos de geração de uma célula ou linhagem celular para incorporar um aminoácido não natural em uma proteína e de diminuição ou redução de apoptose em uma célula, proteína isolada, célula isolada ou linhagem celular e vacina produzida pelos ditos métodos |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15794622 Country of ref document: EP Kind code of ref document: A1 |
|
| DPE1 | Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101) | ||
| ENP | Entry into the national phase |
Ref document number: 2017519813 Country of ref document: JP Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2965085 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15521103 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2015794622 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112017008108 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 20177014048 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 112017008108 Country of ref document: BR Kind code of ref document: A2 Effective date: 20170419 |