WO2015126129A2 - C형 간염 바이러스의 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤 다량체 및 이의 용도 - Google Patents

C형 간염 바이러스의 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤 다량체 및 이의 용도 Download PDF

Info

Publication number
WO2015126129A2
WO2015126129A2 PCT/KR2015/001577 KR2015001577W WO2015126129A2 WO 2015126129 A2 WO2015126129 A2 WO 2015126129A2 KR 2015001577 W KR2015001577 W KR 2015001577W WO 2015126129 A2 WO2015126129 A2 WO 2015126129A2
Authority
WO
WIPO (PCT)
Prior art keywords
formula
virus
hepatitis
carbon
resveratrol
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2015/001577
Other languages
English (en)
French (fr)
Other versions
WO2015126129A3 (ko
Inventor
이충호
윤기동
허태회
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Industry Academic Cooperation Foundation of Catholic University of Korea
Industry Academic Cooperation Foundation of Dongguk University
Original Assignee
Industry Academic Cooperation Foundation of Catholic University of Korea
Industry Academic Cooperation Foundation of Dongguk University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Industry Academic Cooperation Foundation of Catholic University of Korea, Industry Academic Cooperation Foundation of Dongguk University filed Critical Industry Academic Cooperation Foundation of Catholic University of Korea
Publication of WO2015126129A2 publication Critical patent/WO2015126129A2/ko
Anticipated expiration legal-status Critical
Publication of WO2015126129A3 publication Critical patent/WO2015126129A3/ko
Ceased legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/34—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide
    • A61K31/343—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide condensed with a carbocyclic ring, e.g. coumaran, bufuralol, befunolol, clobenfurol, amiodarone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/045—Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates
    • A61K31/05—Phenols
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D307/00—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom
    • C07D307/77—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom ortho- or peri-condensed with carbocyclic rings or ring systems
    • C07D307/78—Benzo [b] furans; Hydrogenated benzo [b] furans
    • C07D307/79—Benzo [b] furans; Hydrogenated benzo [b] furans with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to carbon atoms of the hetero ring
    • C07D307/80—Radicals substituted by oxygen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D407/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having oxygen atoms as the only ring hetero atoms, not provided for by group C07D405/00
    • C07D407/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having oxygen atoms as the only ring hetero atoms, not provided for by group C07D405/00 containing two hetero rings
    • C07D407/06—Heterocyclic compounds containing two or more hetero rings, at least one ring having oxygen atoms as the only ring hetero atoms, not provided for by group C07D405/00 containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D407/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having oxygen atoms as the only ring hetero atoms, not provided for by group C07D405/00
    • C07D407/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having oxygen atoms as the only ring hetero atoms, not provided for by group C07D405/00 containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D493/00—Heterocyclic compounds containing oxygen atoms as the only ring hetero atoms in the condensed system
    • C07D493/02—Heterocyclic compounds containing oxygen atoms as the only ring hetero atoms in the condensed system in which the condensed system contains two hetero rings
    • C07D493/04—Ortho-condensed systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2121/00—Preparations for use in therapy

Definitions

  • the present invention relates to a resveratrol multimer having a selective inhibitory activity of genome replication of hepatitis C virus, and more particularly, to a resveratrol having a selective inhibitory activity of genome replication of hepatitis C virus.
  • the present invention relates to a multimer and a pharmaceutical composition for preventing or treating hepatitis C.
  • Hepatitis B and C are caused by viral hepatitis B viruses. This accounts for 83% of the total. Among them, hepatitis C virus is a medically important pathogen with about 170 million infected people worldwide. Hepatitis C was classified as non-A non-B post-transfusion associated hepatitis (NANB) until the mid-1980s. It has been found that the disease is caused by, and since then, active research and development has been progressed.
  • NANB non-A non-B post-transfusion associated hepatitis
  • Hepatitis C infection by the hepatitis C virus is fatal in most cases because it progresses to chronic hepatitis and develops into chronic liver diseases such as cirrhosis and liver cancer over a long period of 15 to 20 years, and hepatitis C virus (HCV).
  • HCV hepatitis C virus
  • Hepatitis C virus has been reported to cause about 8,000 to 10,000 deaths each year in the United States alone.
  • most of the terminal hepatitis C patients die from waiting for liver transplantation and do not receive a liver transplant.
  • 1.5% of the population in Korea are infected with hepatitis C virus.
  • Hepatitis C Virus is the only virus classified among the hepaciviruses in the flaviviridae family.
  • Hepatitis C Virus has a single strand of RNA consisting of approximately 9600 nucleic acids as its viral genome. have.
  • the RNA is translated into a polyprotein consisting of about 3000 amino acids in hepatocytes, and the translated polyprotein is a non-structural protein of a signal peptidase and virus present in the endoplasmic reticulum of the hepatocytes. It is expressed by 10 different viral proteins by one NS3 protease.
  • viral proteins Among the expressed viral proteins, structural proteins such as envelope glycoproteins E1, E2 and capsid proteins core are used to make particles of the virus, NS2, Non-structural proteins such as NS3, NS4A, NS4B, NS5A, and NS5B are used to create the viral genome replication complex required to replicate the virus's genome.
  • HCV replicates the viral RNA genome by creating a viral genome replication complex in the membrane that occurs in the endoplasmic reticulum. Viral genomic replication complexes retain their invaginated accumulation in the membrane, creating independent structures isolated from the outside environment, expressing the nonstructural proteins of the virus, and expressing the nonstructural proteins expressed in the RNA RNA polymerase.
  • the NS5B protein acts as a genome replicator of the virus.
  • the virus genome replication complex is made and maintained.
  • the nonstructural proteins of the virus in particular the NS4B protein has been found to play the most critical role in making the membranous web, a multi-vesicular structure necessary for the genome replication of the virus in hepatocytes. It is believed that the structure of the membrane web made by NS4B provides the physical structure necessary to make the viral genome replication complex.
  • the NS5A protein assembles the viral genome replication complex using non-structural proteins of other viruses, transfers the resulting viral genome into a structure called lipid droplets, where it binds the viral core protein with the viral genome, It is known to play an important role in making viral particles.
  • protein-protein interactions between viral non-structural proteins are known to play a decisive role in the construction of viral genome replication complexes, but the exact role of them at the molecular level is still unknown.
  • Types of antiviral agents that can treat viral diseases include indirect-acting antivirals (IAAs) that attack viruses indirectly, depending on the mechanism of action of the antiviral agents, and direct-acting antivirals that attack viruses directly. , DAAs).
  • IAAs indirect-acting antivirals
  • DAAs direct-acting antivirals that attack viruses directly.
  • Interferon alpha which is secreted by the body when a pathogenic external microorganism such as a virus penetrates the body, is a representative antiviral intrinsic immunity enhancer that indirectly attacks the virus, rather than attacking the virus itself. Because it blocks the proliferation of virus cells by increasing the effect, it is effective for various kinds of viral diseases and shows antiviral activity by controlling the function of protein of host cell in which virus is parasitic. The probability of developing a mutant virus is relatively low.
  • antiviral specificity which can only show antiviral activity against a particular virus, is significantly reduced, so in order to overcome this, a much larger amount of interferon than the amount of interferon naturally secreted in vivo is used for therapeutic purposes. Administration, thus causing serious side effects and toxicity such as suicidal thoughts, depression, anemia and the like.
  • anti-viral agents that directly attack the virus unlike interferon, selectively inhibits only the specific functions of the viral proteins essential for life history of the virus, thereby exhibiting high anti-viral activity even at relatively low concentrations.
  • antiviral agents that indirectly attack the virus it is characterized by low toxicity and high safety.
  • Reverse transcriptase inhibitors and protease inhibitors of human immunodeficiency virus (HIV) are representative antiviral agents that directly attack the virus. It inhibits the proliferation of virus by inhibiting enzymes and proteolytic enzymes.
  • the virus may show resistance and resistance to existing antiviral agents by changing the amino acid sequence of the viral protein targeted by the antiviral agent, especially RNA polymerase of hepatitis C virus. Since there is no 5'-3 'endonuclease activity that corrects nucleic acids that are misplaced during replication of the RNA genome, the mutant virus is easily generated during the replication of the hepatitis C virus genome, RNA. Resistant and resistant to antiviral agents that directly attack
  • Interferon-alpha and ribavirin which are currently commonly used for the treatment of hepatitis C, are indirect-acting antivirals (IAAs) that indirectly attack viruses by enhancing innate immunity and inhibiting nucleic acid biosynthesis. Even when the two drugs are used together, the sustained virologic response (SVR) after 52 weeks of intravenous injection and oral administration is less than 50% depending on the genotype of the virus. In addition, many hepatitis C patients give up treatment due to serious side effects and toxicity such as suicidal thoughts, depression and anemia. Therefore, there is an urgent need for a more effective and safe drug development that can replace the antiviral drugs for the existing hepatitis C virus.
  • IAAs indirect-acting antivirals
  • SVR sustained virologic response
  • Another object of the present invention is to provide a resveratrol trimer having selective inhibitory activity of RNA genome replication of hepatitis C virus.
  • Another object of the present invention is to provide a resveratrol tetramer having selective inhibitory activity of RNA genome replication of hepatitis C virus.
  • Still another object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of hepatitis C, comprising as an active ingredient one or more compounds selected from the group consisting of resveratrol multimers.
  • the present invention provides a resveratrol dimer having a selective inhibitory activity of genome replication of hepatitis C virus represented by the following formula (1).
  • R 1 is , or ego
  • R 2 , R 3 are the same as or different from each other, H or OH,
  • Carbon of R 1 may be bonded to carbon in position a to form a ring
  • the present invention also provides a resveratrol trimer having selective inhibitory activity of genome replication of hepatitis C virus represented by the following formula (2).
  • R 1 is , or ego
  • R 2 , R 3 are the same as or different from each other, H or OH,
  • R 4 is H
  • Carbon of R 1 may be combined with carbon in a and / or b to form a ring
  • OR 4 may be bonded to carbon at position b to form a ring
  • the present invention provides a resveratrol tetramer having selective inhibitory activity of genome replication of hepatitis C virus represented by the following formula (3).
  • R 1 is , or ego
  • R 2 , R 3 , R 6 , R 8 are the same as or different from each other, H or OH,
  • R 5 is H
  • R 7 is Is
  • Carbon of R 1 may be bonded to carbon in position a to form a ring
  • Carbon in the d-position of R 7 may be bonded to OR 5 to form a 5-membered ring, or may be bonded to c-positioned carbon to form a 7-membered ring,
  • the resveratrol dimer is characterized in that it is selected from the group consisting of compounds represented by the following formula (4) to (10).
  • the resveratrol dimer is a compound represented by the following formula (4) or (5).
  • the resveratrol trimer is characterized in that it is selected from the group consisting of compounds represented by the following formula (11) to formula (17).
  • the resveratrol tetramer is characterized in that it is selected from the group consisting of compounds represented by the following formula (18) to formula (26).
  • the resveratrol tetramer is characterized in that it is selected from the group consisting of compounds represented by the following formula (18) to (20).
  • the present invention also provides a pharmaceutical composition for the prevention or treatment of hepatitis C, comprising as an active ingredient at least one compound selected from the group consisting of resveratrol multimers represented by the formula (1) to (3).
  • the resveratrol multimer is characterized in that it has a selective inhibitory activity of RNA genome replication of hepatitis C virus.
  • the present invention also provides a method for treating hepatitis C comprising administering the pharmaceutical composition to a subject.
  • the present invention also provides a method of using the pharmaceutical composition for the prevention or treatment of hepatitis C.
  • the present invention provides a health functional food composition for the prevention or improvement of hepatitis C comprising one or more compounds selected from the group consisting of resveratrol multimers represented by the formula (1) to (3) as an active ingredient. .
  • the resveratrol multimer according to the present invention has a very low toxicity against hepatocytes, but has an excellent effect of selectively inhibiting the genome replication of hepatitis C virus, thereby preventing, improving or treating hepatitis C. It is expected that the present invention may be usefully used as an active ingredient of a functional composition or functional food composition.
  • 1 is a diagram showing the 1 H-NMR results of Ampelopsin A.
  • Figure 2 is a diagram showing the 13 C-NMR results of Ampelopsin A.
  • Figure 3 is a diagram showing the 1 H-NMR results of (+)- ⁇ -viniferin.
  • Figure 5 shows the 1 H-NMR results of vitisin A.
  • Figure 6 shows the 13 C-NMR results of vitisin A.
  • Figure 7 is a diagram showing the 1 H-NMR results of wilsonol C.
  • FIG. 8 is a diagram showing 13 C-NMR results of wilsonol C.
  • FIG. 9 is a diagram showing a 1 H-NMR results of vitisin B.
  • 10 is a diagram showing 13 C-NMR results of vitisin B.
  • FIG. 11 is a diagram showing a structure of Compound 1 to Compound 5 identified and separated in Example 1.
  • FIG. 11 is a diagram showing a structure of Compound 1 to Compound 5 identified and separated in Example 1.
  • FIG. 12 is a diagram illustrating the genomic structure of the HCV replicon FL-J6 / JFH-5C19Rluc2AUbi reporter virus used to measure the genome replication of hepatitis C virus and the principle of viral genome replication inhibitor discovery.
  • FIG. 13 shows a screening of 350 herbal extract libraries using HCV replicon FL-J6 / JFH-5C19Rluc2AUbi reporter virus, showing that grape roots that are not toxic to hepatocytes with selective inhibition of genome replication of HCV virus.
  • Figure shows the results of finding the extract.
  • Figure 14 is a measure of the genome replication and hepatocyte viability of the virus of the extract fraction extracted with ethyl acetate, butanol, ethanol, hexane and water of grape root using HCV replicon FL-J6 / JFH-5C19Rluc2AUbi reporter virus.
  • Figure shows one result (circular: cell survival rate, square: HCV genome replication rate, EC 50 : half maximal effective concentration).
  • EA-A, EA-B, EA-C, EA-D obtained by fractionating ethyl acetate (EA) extract of grape root using HCV replicon FL-J6 / JFH-5C19Rluc2AUbi reporter virus.
  • Figure 2 shows the results of measuring the genome replication rate and the survival rate of hepatocytes of the virus of EA-E and EA-F at concentrations of 0.1, 1, and 10 ⁇ g / ml (blue: cell survival rate, red: HCV genome copy rate).
  • Figure 16 shows the genome replication rate of EA-B and EA-C virus and liver cells obtained by fractionating ethyl acetate (EA) extract of grape root using HCV replicon FL-J6 / JFH-5C19Rluc2AUbi reporter virus.
  • Figure showing the result of measuring the survival rate blue: cell survival rate, red: HCV genome replication rate, EC 50 : half maximal effective concentration.
  • FIG. 17 shows EA-Ba, EA-Bb, EA-Bc, EA-Bd, EA obtained by fractionating EA-B extract of grape root using HCV replicon FL-J6 / JFH-5C19Rluc2AUbi reporter virus.
  • Figure showing the results of measuring the genome replication rate and hepatocyte viability of the virus of Be, EA-Bf, EA-Bg, and EA-Bh at a concentration of 10 ⁇ g / ml (blue: cell survival rate, red: HCV genome replication rate) .
  • Figure 18 shows the virus of EA-Bd, EA-Be, EA-Bg, EA-Bh obtained by fractionating EA-B extract of grape root using HCV replicon FL-J6 / JFH-5C19Rluc2AUbi reporter virus Shows the results of measuring the genome replication rate and the survival rate of hepatocytes (blue: cell survival rate, red: HCV genome replication rate, EC 50 : half maximal effective concentration).
  • Figure 19 shows the structure of a single compound Ampelopsin A and Ampelopsin A virus isolated from high-performance countercurrent chromatography of EA-B extract of grape root using HCV replicon FL-J6 / JFH-5C19Rluc2AUbi reporter virus. Shows the results of measuring the genome replication rate and the survival rate of hepatocytes (prototype: cell survival rate, square: HCV genome replication rate, EC 50 : half maximal effective concentration, CC 50 : half maximal cytotoxic concentration 50).
  • FIG. 20 shows the structure and ⁇ -viniferin of a single compound ⁇ -viniferin from which EA-B extract of grape root was isolated by high-performance countercurrent chromatography using HCV replicon FL-J6 / JFH-5C19Rluc2AUbi reporter virus. Shows the results of measuring the genome replication rate and the survival rate of hepatocytes (circular: cell survival rate, square: HCV genome replication rate, EC 50 : half maximal effective concentration, CC 50 : half maximal cytotoxic concentration 50).
  • Figure 21 shows the structure of single compound Wilsonol C and Wilsonol C virus isolated from high-performance countercurrent chromatography of EA-B extract of grape root using HCV replicon FL-J6 / JFH-5C19Rluc2AUbi reporter virus. Shows the results of measuring the genome replication rate and the survival rate of hepatocytes (prototype: cell survival rate, square: HCV genome replication rate, EC 50 : half maximal effective concentration, CC 50 : half maximal cytotoxic concentration 50).
  • Figure 22 shows the structure of single compound Vitisin A and the virus of Vitisin A isolated from the high-performance countercurrent chromatography of EA-B extract of grape root using HCV replicon FL-J6 / JFH-5C19Rluc2AUbi reporter virus. Shows the results of measuring the genome replication rate and the survival rate of hepatocytes (prototype: cell survival rate, square: HCV genome replication rate, EC 50 : half maximal effective concentration, CC 50 : half maximal cytotoxic concentration 50).
  • Figure 23 shows the structure of single compound Vitisin B and the virus of Vitisin B isolated from high-performance countercurrent chromatography of EA-B extract of grape root using HCV replicon FL-J6 / JFH-5C19Rluc2AUbi reporter virus. Shows the results of measuring the genome replication rate and the survival rate of hepatocytes (prototype: cell survival rate, square: HCV genome replication rate, EC 50 : half maximal effective concentration, CC 50 : half maximal cytotoxic concentration 50).
  • FIG. 24 shows genome replication rate and hepatocytes of a single compound Vitisin B virus isolated from high-performance countercurrent chromatography of EA-B extract of grape root using HCV replicon FL-J6 / JFH-5C19Rluc2AUbi reporter virus. Is a result of measuring 72 hours at a concentration of 500 nM (circular: cell survival rate, square: HCV genome replication rate, EC 50 : half maximal effective concentration, CC 50 : half maximal cytotoxic concentration 50) (circle: Cell viability, square: HCV genome replication rate, T 1/2 : time taken for virus RNA to halve).
  • FIG. 25 shows the genomic structure of HCV subgenomic replicon Bart79I (genotype 1b) used to measure RNA genome expression of hepatitis C virus.
  • FIG. 26 is a diagram showing the genomic structure of HCV full genomic replicon J6 / JFH1 (genotype 2a) used to measure RNA genome expression of hepatitis C virus.
  • FIG. 27 shows the effect of HCV subgenomic replicas on the RNA genome replication of hepatitis C virus as the concentration of the single compound Vitisin B isolated from EA-B extract of grape root was increased by high-performance countercurrent chromatography. replicon) is shown using real time PCR quantitation of the genome of Bart79I (EC 50 : half maximal effective concentration).
  • FIG. 28 shows the effect of a single compound, Vitisin B, isolated from EA-B extract of grape root by high-performance countercurrent chromatography on RNA genome replication of hepatitis C virus over time. subgenomic replicon)
  • Figure shows the real time PCR quantitation of the genome of Bart79I (T 1/2 : time taken for virus RNA to halve).
  • FIG. 30 is a diagram showing the genomic structure of the subgenomic replicon Bart79I-NS5A-GFP HCV (genotype 1b) reporter virus used to measure protein expression of hepatitis C virus.
  • FIG. 31 is a diagram illustrating the effects of the single compound Vitisin B isolated from EA-B extract of grape roots on high-performance countercurrent chromatography on protein expression of hepatitis C virus as the concentration increases.
  • Subgenomic Replicon This figure shows the results of measuring the amount of green fluorescence expressed in hepatocytes containing Bart79I-NS5A-GFP using FACS (fluorsecence assorted cell sorter) (EC 50 : half maximal effective concentration). .
  • FIG. 32 illustrates the effect of the single compound Vitisin B isolated from EA-B extract of grape roots on high-performance countercurrent chromatography on the protein expression of hepatitis C virus over time treated at 500 nM.
  • Figure 1 shows the results of measuring the amount of green fluorescence expressed in hepatocytes containing GFP-tagged subgenomic replicon Bart79I-NS5A-GFP using FACS (fluorsecence assorted cell sorter) (T 1 / 2 : the time it takes for the virus RNA to drop in half).
  • FIG. 33 shows the effect of HCV subgenomic ripple described in FIG. 18 on the protein expression of hepatitis C virus as the concentration of the single compound Vitisin B isolated from EA-B extract of grape root was increased by high-performance countercurrent chromatography.
  • Figure 2 shows the results of measuring the amount of NS5A protein expressed in the genome of subgenomic replicon Bart79I and the beta actin protein, a control protein of hepatocytes, using western blot (EC 50 : half maximal effective concentration).
  • Figure 34 shows the effect on the protein expression of hepatitis C virus over time after treatment with a single compound Vitisin B isolated from EA-B extract of grape root by high-performance countercurrent chromatography at a concentration of 500 nM
  • Figure 1 shows the results of measuring the amount of NS5A protein expressed in the genome of HCV subgenomic replicon Bart79I and the beta actin protein, a control protein of hepatocytes, using western blot (T 1/2 : virus). Time for the RNA to drop in half).
  • FIG. 35 shows the effect of HCV full-genomic replicas described in FIG. 25 on the protein expression of hepatitis C virus as the concentration of the single compound Vitisin B isolated from EA-B extract of grape root was increased by high-performance countercurrent chromatography.
  • (full genomic replicon) J6 / JFH1 shows the results of measuring the amount of core protein expressed in the genome and beta actin protein, a control protein of hepatocytes, using western blot (EC 50 : half maximal effective concentration) .
  • the present invention provides a resveratrol dimer having selective inhibitory activity of RNA genome replication of hepatitis C virus represented by the following formula (1).
  • R 1 is , or ego
  • R 2 , R 3 are the same as or different from each other, H or OH,
  • Carbon of R 1 may be bonded to carbon in position a to form a ring
  • Preferred embodiments of the resveratrol dimer of the present invention is not limited thereto, but may be selected from the group consisting of compounds represented by the following Chemical Formulas 4 to 10, and more preferably, as the Chemical Formula 4 or Chemical Formula 5. It may be selected from the group consisting of the compound represented.
  • the present invention also provides a resveratrol trimer having selective inhibitory activity of RNA genome replication of hepatitis C virus represented by the following formula (2).
  • R 1 is , or ego
  • R 2 , R 3 are the same as or different from each other, H or OH,
  • R 4 is H
  • Carbon of R 1 may be combined with carbon in a and / or b to form a ring
  • OR 4 may be bonded to carbon at position b to form a ring
  • Preferred embodiments of the resveratrol trimer of the present invention is not limited thereto, but may be selected from the group consisting of compounds represented by the following Chemical Formulas 11 to 17.
  • the present invention provides a resveratrol tetramer having selective inhibitory activity of RNA genome replication of hepatitis C virus represented by the following formula (3).
  • R 1 is , or ego
  • R 2 , R 3 , R 6 , R 8 are the same as or different from each other, H or OH,
  • R 5 is H
  • R 7 is Is
  • Carbon of R 1 may be bonded to carbon in position a to form a ring
  • Carbon in the d-position of R 7 may be bonded to OR 5 to form a 5-membered ring, or may be bonded to c-positioned carbon to form a 7-membered ring,
  • Preferred embodiments of the resveratrol tetramer of the present invention are not limited thereto, but may be selected from the group consisting of compounds represented by the following Chemical Formulas 18 to 26, and more preferably as Chemical Formulas 18 to 20. It may be selected from the group consisting of the compound represented.
  • resveratrol multimers structurally similar to the resveratrol multimer represented by the formula (1), (2) and (3) is expected to have a selective inhibitory activity of RNA genome replication of hepatitis C virus, Specific examples are shown in Tables 1 to 3 below.
  • Resveratrol multimers of the present invention can be used as a natural product, for example, extracted from Vitidis Vinferae Radix , it will be apparent to those skilled in the art that chemically synthesized has the same effect as extracted.
  • the resveratrol multimer according to the present invention has a very low toxicity to hepatocytes, but has an excellent effect of selectively inhibiting genome replication of hepatitis C virus, and thus can be usefully used for the prevention or treatment of hepatitis C. Can be.
  • the present invention provides a pharmaceutical composition for the prevention or treatment of hepatitis C, comprising as an active ingredient at least one compound selected from the group consisting of resveratrol multimers represented by the formula (1) to (3).
  • prevention means any action that inhibits or delays the development of hepatitis C by administration of a pharmaceutical composition according to the present invention.
  • treatment means any action that improves or beneficially changes the symptoms caused by hepatitis C by administration of the pharmaceutical composition according to the present invention.
  • composition of the present invention may further contain at least one known active ingredient having a prophylactic or therapeutic effect of hepatitis C together with the resveratrol multimer.
  • composition of the present invention may further comprise suitable carriers, excipients and diluents commonly used in the manufacture of pharmaceutical compositions. It may also be used in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols and the like in the form of conventional formulations, external preparations, suppositories, and sterile injectable solutions. Suitable formulations known in the art are preferably those disclosed in Remington's Pharmaceutical Science, recently, Mack Publishing Company, Easton PA.
  • Carriers, excipients and diluents that may be included in the composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose , Microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate and mineral oil.
  • diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and the solid preparations include at least one excipient such as starch, calcium carbonate, sucrose, lactose, It is prepared by mixing gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.
  • Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups, and various excipients such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin, may be used. have.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories.
  • non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, and the like may be used.
  • base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
  • the term "administration" means providing a subject with any of the compositions of the present invention in any suitable manner.
  • the resveratrol polymer of the present invention oligostilbene compounds may be administered in an amount of 0.1 mg / kg to 1000 mg / kg per day, preferably 0.001 to 200 mg / kg, It may be administered once or in several divided doses.
  • composition of the present invention can be administered to a subject by various routes. All modes of administration can be expected, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or cerebrovascular injections.
  • composition of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy and biological response modifiers for the prevention or treatment of hepatitis C.
  • the present invention provides a method for treating hepatitis C comprising administering the pharmaceutical composition to a subject.
  • subject means a subject in need of treatment for a disease, and more specifically, human or non-human primates, mice, rats, dogs, cats, horses and cattle, etc. Mean mammal.
  • the present invention provides a hepatitis C preventive or improved health functional food composition
  • a hepatitis C preventive or improved health functional food composition comprising one or more compounds selected from the group consisting of resveratrol multimers represented by Chemical Formulas 1 to 3 as an active ingredient.
  • the term “improvement” refers to any action that at least reduces the parameters associated with the condition being treated, such as the extent of symptoms.
  • the functional food composition may be used simultaneously or separately with a medicament for treatment before or after the onset of the disease in order to prevent or improve hepatitis C.
  • the health functional food refers to a food having a bioregulatory function, such as prevention or improvement of disease, biological defense, immunity, recovery of the disease, inhibition of aging, and should be harmless to the human body when taken in the long term.
  • Grape root extract of the present invention may be added to dietary supplements for the purpose of preventing or improving hepatitis C.
  • the oligostilbene compounds of the resveratrol polymer of the present invention may be added as they are or may be used together with other food or food ingredients. Can be used accordingly.
  • the mixed amount of the active ingredient may be appropriately determined depending on the purpose of use (prevention, health or therapeutic treatment).
  • the grape root extract of the present invention in the preparation of food or beverage is added in an amount of up to 15% by weight, preferably up to 10% by weight relative to the raw material.
  • the active ingredient may be used in an amount above the above range because there is no problem in terms of safety.
  • foods to which the substance may be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, dairy products including gum, ice cream, various soups, beverages, teas, drinks, Alcoholic beverages and vitamin complexes, and the like and include all of the health foods in the conventional sense.
  • the health beverage composition of the present invention may include various flavors or natural carbohydrates, and the like as an additional ingredient, as in a general beverage.
  • the natural carbohydrates described above may be used as monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, and natural sweeteners such as dextrin and cyclodextrin, and synthetic sweeteners such as saccharin and aspartame.
  • the proportion of the natural carbohydrate is generally about 0.01 to 10 g, preferably about 0.01 to 0.1 g per 100 ml of the composition of the present invention.
  • the composition of the present invention includes various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, And carbonating agents used in the carbonated beverage.
  • the composition of the present invention may include a pulp for the production of natural fruit juice, fruit juice drinks and vegetable drinks. These components can be used independently or in combination. The proportion of such additives is not critical but is usually selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.
  • HPCCC's two-phase solvent system was prepared using hexane-ethyl acetate-methanol-distilled water (4: 8: 4: 10 v / v) and using the upper layer as the stationary phase and the lower layer as the mobile phase.
  • the flow rate of the pump was 4 ml / min at 0-75 minutes and 8 mL / min at 75-250 minutes using the gradient flow rate.
  • the HPCCC speed was set at 1600 rpm. Using this condition, 150 mg of oligostilbene-containing fractions were injected and collected by an automatic collector. Individual oligostilbenes were collected by UV chromatogram, and the oligostilbenes were separated by NMR and MS spectormeter.
  • the HPCCC method was used to isolate five compounds from the oligostilbene-containing fractions (150 mg) of grape roots, which were identified as ampelopsin A ('Compound 1', 12.1 mg) and (+)- ⁇ -viniferin ( 'Compound 2', 10.4 mg), vitisin A ('Compound 3', 2.8 mg), wilsonol C ('Compound 4', 3.2 mg) and vitisin B ('Compound 5', 37 mg). It was over%.
  • the separated compound was characterized by molecular weight information obtained through Q-TOF MS, 1 H-NMR, 13 C-NMR, and the results are shown in FIGS. 1 to 10, respectively.
  • the structure of the compound 1-the compound 5 obtained in Example 1 by the said result is shown in FIG.
  • 1.7 ⁇ 10 4 to 2.0 ⁇ 10 4 Huh 7.5 human liver cancer cells per well were added to a 96 well-plate and incubated for 24 hours in a 37 ° C. incubator.
  • the cells were treated with various concentrations of herbal extracts or compounds identified in the herbal extracts and then incubated for 72 hours. More specifically, the measured concentration is 0, 10 pg / ml, 100 pg / ml, 1 ng / ml, 10 ng / ml, 100 ng / ml, 1 ⁇ g / ml 10 ⁇ g / ml, 100 ⁇ g for herbal extracts.
  • FL-J6 / JFH-5C19Rluc2AUbi HCV replicon belonging to genotype 2a was used as a reporter virus to determine the effects of the herbal extracts and the compounds identified in the herbal extracts on genome replication of hepatitis C virus.
  • the genomic structure diagram of the reporter virus is shown in FIG. 12.
  • the reporter virus includes the entire genome of hepatitis C virus belonging to genotype 2a in a cDNA state, and has an internal ribosome entry site (IRES) and a core of the virus.
  • IRS internal ribosome entry site
  • a Ubi sequence of Lenilla luciferase and a self-cleaving foot and mouth disease virus 2A protein are attached between the protein.
  • a Ubi sequence of Lenilla luciferase and a self-cleaving foot and mouth disease virus 2A protein, thereby providing the FL-J6 / JFH-5C19Rluc2AUbi plasmid.
  • HCV RNA obtained by in vitro transcription using T7 RNA polymerase was transfected into Huh7.5 cells, a liver cancer cell line, the RNA of the injected virus enters an internal ribosome. Polyproteins are produced through translation using positions (IRES).
  • Renilla luciferase in the produced multiprotein is separated from viral non-structural proteins with the help of the Ubi sequence of the self-cutting foot disease virus 2A protein, and indirectly in the hepatocytes by measuring the activity of the isolated lenilla luciferase. Viral RNA genome replication can be measured.
  • Huh7.5 human liver cancer cells were trypsinized and resuspended with a PBS solution to a cell density of 1.5 ⁇ 10 7 / ml.
  • a total of 5 ⁇ g of in vitro transcribed FLJ6 / JFH-5 C19Rluc2AUbi RNA was mixed with 400 ⁇ l of PBS buffer containing Huh 7.5 human liver cancer cells and placed in 2-mm-gap cuvette (BTX).
  • the FL-J6 / JFH-5 C19Rluc2AUbi RNA was transfected into Huh7.5 human liver cancer cells by applying pulses five times for 99 ms at 0.82 kV using a BTX-830 electroporator.
  • the extracts of the herbal extracts or the compounds identified in the herbal extracts of various concentrations (1 pM-10 ⁇ M) were treated with the cells and incubated for 72 hours.
  • DMSO was used as a control. Discard the culture medium of the cells treated with the material, wash the wells to which the cells are attached with PBS, and then added 20 ⁇ l cell lysis buffer (cell lysis buffer) and left for 20 minutes in ice.
  • Renilla Luciferase substrate with Renilla Luciferase buffer was prepared, and 100 ⁇ l of the dilution was added to each well.
  • the luminescence of Renilla Luciferase was measured at an integration time of 10 seconds. Based on the luminescence upon DMSO treatment of 100, the relative luminescence upon treatment of the herbal extracts or the compounds identified in the herbal extracts was calculated.
  • the experiment of measuring the genome replication inhibitory activity of the hepatitis C virus of the herbal extract was carried out as follows.
  • HCV replicon HCV replicon FL-J6 / JFH-5C19Rluc2AUbi reporter virus prepared in 3-1
  • ethyl acetate, butanol, ethanol, hexane The genome replication rate and the survival rate of hepatocytes of the virus of the extract fractions extracted with water were measured, and the results are shown in FIG. 14.
  • the ethyl acetate fraction was found to effectively inhibit the genome replication of hepatitis C virus at the same time without affecting the survival rate of cells.
  • EA ethyl acetate
  • EA-B extract of grape root was subjected to normal column chromatography using the method of 3-2.
  • EA-Ba (0.9 g), EA-Bb (0.7 g), EA-Bc (1.5 g), EA-Bd, (0.8 g), EA-Be (0.8 g), EA-Bf (0.5 g), EA-Bg (0.4 g), EA-Bh (0.2 g) of the virus genome replication and hepatocyte viability was measured at a concentration of 10 ⁇ g / ml, the results are shown in Figure 17.
  • the EA-Bd, EA-Be, EA-Bf, EA-Bg, and EA-Bh fractions most efficiently effect genome replication of the hepatitis C virus without affecting cell survival. It was confirmed to inhibit.
  • Example 1 the structure of the single compound Ampelopsin A from which EA-B extract of grape root was separated by high-performance countercurrent chromatography was identified, and the HCV replicon FL-J6 / prepared by 3-1 was identified.
  • JFH-5C19Rluc2AUbi) reporter virus was used to measure the genome replication rate of the virus of Ampelopsin A and the survival rate of hepatocytes by the method of 3-2, and the results are shown in FIG. 19. As shown in FIG. 19, it was confirmed that Ampelopsin A effectively inhibited genome replication of hepatitis C virus without affecting cell survival.
  • Example 1 the structure of the single compound ⁇ -viniferin from which EA-B extract of grape root was separated by high-performance countercurrent chromatography was identified, and HCV replicon FL prepared in 3-1 above was identified.
  • -J6 / JFH-5C19Rluc2AUbi) reporter virus was used to measure the genome replication rate of the ⁇ -viniferin virus and the survival rate of hepatocytes through the method of 3-2, and the results are shown in FIG. 20. As shown in FIG. 20, it was confirmed that ⁇ -viniferin efficiently inhibited the genome replication of hepatitis C virus without affecting the survival rate of cells.
  • Example 1 the structure of the single compound Wilsonol C, in which EA-B extract of grape root was separated by high-performance countercurrent chromatography, was identified, and HCV replicon FL- prepared in 3-1 above was identified.
  • J6 / JFH-5C19Rluc2AUbi) reporter virus was used to measure the genome replication rate of the Wilsonol C virus and the survival rate of hepatocytes by the method of 3-2, and the results are shown in FIG. 21. As shown in FIG. 21, it was confirmed that Wilsonol C effectively inhibited the genome replication of hepatitis C virus without affecting the survival rate of cells.
  • Example 1 the structure of the single compound Vitisin A from which EA-B extract of grape root was separated by high-performance countercurrent chromatography was identified, and the HCV replicon FL- prepared in 3-1 above was identified.
  • the J6 / JFH-5C19Rluc2AUbi) reporter virus the genome replication rate and hepatocyte survival rate of the virus of Vitisin A were measured by the method of 3-2, and the results are shown in FIG. 22. As shown in Fig. 22, it was confirmed that Vitisin A effectively inhibited the genome replication of hepatitis C virus without affecting the survival rate of cells.
  • Example 1 the structure of the single compound Vitisin B from which EA-B extract of grape root was separated by high-performance countercurrent chromatography was identified, and HCV replicon FL- prepared in 3-1.
  • J6 / JFH-5C19Rluc2AUbi) reporter virus was used to measure the genome replication rate of the virus of Vitisin B and the survival rate of hepatocytes by the method of 3-2, and the results are shown in FIG. 23. As shown in FIG. 23, it was confirmed that Vitisin B effectively inhibited genome replication of hepatitis C virus while not affecting cell survival rate.
  • Subgenomic HCV replicon (bart79I) belonging to genotype (genotype 1b) and full genomic HCV replicon, belonging to genotype 2a to measure genome replication of hepatitis C virus J6 / JFH1) was used.
  • the genomic structure diagrams of the Riplicon virus are shown in FIGS. 25 and 26, respectively.
  • the replicon virus contains a part or whole genome of hepatitis C virus in the cDNA state.
  • HCV RNA obtained by in vitro transcription of the Ripleycon plasmid using T7 RNA polymerase was transfected into Huh7.5 cells, which are liver cancer cell lines, RNA produces polyproteins through translation using internal ribosomal entry sites (IRES). At this time, the produced multiprotein is separated into non-structural proteins and the expressed non-structural proteins replicate the genome of the virus, thereby making a replicable cell in which the virus replicates in hepatocytes.
  • IRS internal ribosomal entry sites
  • the amount of HCV remaining after 24, 48 and 72 hours after treatment with 10 mM of compound was measured by real time PCR.
  • Example 1 the effect of HCV subjino on the RNA genome replication of hepatitis C virus according to the concentration and treatment time of single compound Vitisin B isolated from EA-B extract of grape root by high-performance countercurrent chromatography Subgenomic replicon (subgenomic replicon) was confirmed using real time PCR quantitation of the genome of Bart79I, the results are shown in Figures 27 and 28. As shown in Fig. 27 and 28, it was confirmed that the genomic replication of hepatitis C virus effectively inhibits as the concentration of Vitisin B increases or the treatment time elapses.
  • Vitisin B RNA genome replication of hepatitis C virus with increasing drug concentration was quantified by real time PCR of HCV full genomic replicon J6 / JFH1 (genotype 2a). The results are shown in FIG. 29. As shown in FIG. 29, it was confirmed that Vitisin B effectively inhibited genomic replication of hepatitis C virus.
  • Vitisin B the effect of Vitisin B on protein expression of hepatitis C virus with increasing concentration is expressed in hepatocytes containing GFP-tagged subgenomic replicon Bart79I-NS5A-GFP as described in FIG.
  • the amount of green fluorescence was measured using a FACS (fluorsecence assorted cell sorter), the results are shown in FIG. As shown in FIG. 31, it was confirmed that Vitisin B effectively inhibited the genome replication of hepatitis C virus as the concentration increased.
  • Vitisin B protein expression of hepatitis C virus over time following 500 nM treatment were described with the addition of GFP-tagged subgenomic replicon Bart79I-NS5A-GFP as described in FIG.
  • the amount of green fluorescence expressed in hepatocytes was measured using FACS (fluorsecence assorted cell sorter), and the results are shown in 32. As shown in FIG. 32, it was confirmed that genome replication of hepatitis C virus was effectively inhibited according to the treatment time of Vitisin B.
  • Vitisin B the effect of Vitisin B on protein expression of hepatitis C virus as the concentration is increased is the amount of NS5A protein expressed in the genome of HCV subgenomic replicon Bart79I and control of hepatocytes as described in FIG. 19.
  • Protein beta actin protein was measured using a western blot, the results are shown in Figure 33. As shown in FIG. 33, it was confirmed that the virus NS5A protein was effectively reduced in a concentration-dependent manner of vitisin B.
  • NS5A protein expressed in the genome of HCV subgenomic replicon Bart79I described in FIG. 19 shows the effect on the protein expression of hepatitis C virus over time when Vitisin B was treated at a concentration of 500 nM.
  • the amount of and beta actin protein, a control protein of hepatocytes, were measured using western blot, and the results are shown in FIG. 34. As shown in Figure 34, it was confirmed that the virus NS5A protein is effectively reduced over time.
  • Vitisin B on protein expression of hepatitis C virus with increasing concentrations was determined by the amount of core protein expressed in the HCV full genomic replicon J6 / JFH1 (genotype 2a) genome described in FIG. Beta actin protein, a control protein of hepatocytes, was measured using western blot, and the results are shown in FIG. 35. As shown in FIG. 35, it was confirmed that the virus core protein was effectively reduced in a concentration-dependent manner.
  • the above ingredients are mixed and filled in an airtight cloth to prepare a powder.
  • tablets are prepared by tableting according to a conventional method for preparing tablets.
  • the above ingredients are mixed and filled into gelatin capsules to prepare capsules.
  • the amount of the above ingredient is prepared per ampoule (2 ml).
  • Vitamin B6 0.5 mg
  • composition ratio of the above-mentioned vitamin and mineral mixtures is mixed with a component suitable for a health food in a preferred embodiment, the compounding ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional health food manufacturing method.
  • the granules may be prepared and used for preparing a health food composition according to a conventional method.
  • the resulting solution is filtered and obtained in a sterilized 2 l container, sealed sterilization and refrigerated Used to prepare the healthy beverage composition of the invention.
  • composition ratio is mixed with a component suitable for a favorite beverage in a preferred embodiment, the composition ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, demand country, and usage.
  • the resveratrol multimer according to the present invention is expected to be usefully used as an active ingredient of a pharmaceutical composition or a functional food composition for preventing, improving or treating hepatitis C.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Molecular Biology (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

본 발명은 C형 간염 바이러스의 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤(resveratrol) 다량체 및 이의 용도에 관한 것으로서, 보다 구체적으로는 C형 간염 바이러스의 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤(resveratrol) 다량체 및 이를 포함하는 C형 간염의 예방 또는 치료용 약학적 조성물에 관한 것이다. 본 발명에 따른 레스베라트롤(resveratrol) 다량체는 간세포에 대한 독성이 매우 낮으면서도, C형 간염 바이러스의 게놈 복제를 선택적으로 저해하는 우수한 효과를 가지고 있어, C형 간염을 예방, 개선 또는 치료하기 위한 약학적 조성물 또는 기능성 식품 조성물의 활성성분으로 유용하게 사용될 수 있을 것으로 기대된다.

Description

C형 간염 바이러스의 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤 다량체 및 이의 용도
본 발명은 C형 간염 바이러스의 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤(resveratrol) 다량체 및 이의 용도에 관한 것으로서, 보다 구체적으로는 C형 간염 바이러스의 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤(resveratrol) 다량체 및 이를 포함하는 C형 간염의 예방 또는 치료용 약학적 조성물에 관한 것이다.
간암과 간 질환은 뇌혈관 질환, 심장 질환 및 호흡기 질환과 더불어 한국인 인구 10만 명당 사망자 수가 가장 높은 4대 질환 중 하나로, 간암과 간 질환의 원인은 B형 및 C형 간염 바이러스에 의한 바이러스성 간염이 전체의 83%를 차지한다. 그 중에서도 C형 간염 바이러스는 전 세계적으로 약 1억 7천만 명의 감염자를 가지고 있는 의학적으로 매우 중요한 병원균이다. C형 간염은 1980년대 중반까지 비 A형 비 B형 수혈 후 연관간염 (non-A non-B post-transfusion associated hepatitis, NANB)으로 구분되다가, 1989년도에 비로소 전혀 새로운 종류의 바이러스에 의한 감염에 의해 생기는 질병임이 밝혀지게 되었고, 그 후 이에 대한 활발한연구와 개발이 진행되어 왔다.
C형 간염 바이러스에 의한 간세포의 감염은 대부분의 경우 만성간염으로 진행되고, 15년에서 20년 정도의 장기간에 걸쳐 간경화와 간암과 같은 만성간 질환으로 발전하기 때문에 치명적이며, C형 간염 바이러스 (HCV, Hepatitis C Virus)에 의한 만성 간염, 간경화 및 간암으로 매년 미국에서만 8,000명 내지 10,000명 정도가 사망하고 있는 것으로 보고되었다. 특히 대부분의 말기 C형 간염 환자들의 경우 간 이식 수술을 기다리다 간 이식을 받지 못해 사망하는 경우가 대부분이며, 통계적으로 한국의 경우 전 인구 중 1.5% 정도가 C형 간염 바이러스에 감염되어 있다고 알려져 있다.
C형 간염 바이러스 (Hepatitis C Virus, HCV)는 플라비비리데 (flaviviridae) 군 중 헤파시바이러스 (hepacivirus)속으로 분류되는 유일한 바이러스로, 약 9600개의 핵산으로 이루어진 단일 가닥의 RNA를 바이러스 게놈으로 가지고 있다. 상기 RNA는 간세포 내에서 약 3000개의 아미노산으로 이루어진 다단백질(polyprotein)로 번역되고, 번역된 다단백질 (polyprotein)은 간세포의 소포체에 존재하는 신호 펩티다제 (signal peptidase)와 바이러스의 비구조 단백질 중 하나인 NS3 단백질분해효소 (protease)에 의해 10가지의 다른 바이러스 단백질로 발현된다. 발현된 바이러스 단백질 중 외피 당단백질 (envelope glycoprotein)인 E1, E2, 그리고 캡시드 (capsid) 단백질인 코어 (core)와 같은 구조 단백질들 (structural proteins)은 바이러스의 입자 (particle)를 만드는데 쓰이고, NS2, NS3, NS4A, NS4B, NS5A, 그리고 NS5B와 같은 비구조 단백질들(non-structural proteins)은 바이러스의 게놈을 복제하는데 필요한 바이러스 게놈 복제 복합체 (virus genome replication complex)를 만드는데 쓰인다. HCV는 소포체(endoplasmic reticulum)에서 발생한 막피 (membrane)에서 바이러스 게놈 복제 복합체를 만들어서 바이러스의 RNA 게놈을 복제한다. 바이러스 게놈 복제 복합체는 막피에 쌓여 움푹 들어간 형태 (invaginated)를 유지함으로써 외부 환경에서 분리된 독립적인 구조를 만들고 이 구조 속에 바이러스의 비구조 단백질들을 발현시키고 발현된 비구조 단백질들이 바이러스의 RNA 중합효소인 NS5B 단백질과 함께 바이러스의 게놈복제공장의 역할을 한다. 하지만 이 바이러스게놈 복제 복합체가 어떻게 만들어지고 유지되는지에 대해서는 잘 알려져 있지 않다. 바이러스의 비구조 단백질들 중 특히 NS4B 단백질은 간세포 내에서 바이러스의 게놈복제에 꼭 필요한 다소포 구조 (multi-vesicular structure)인 세포막 거미줄 (membranous web)을 만드는데 가장 결정적인 역할을 하는 것으로 밝혀졌다. 이 NS4B에 의해서 만들어진 세포막 거미줄이라는 구조는 바이러스게놈 복제 복합체를 만드는데 필요한 물리적인 구조를 제공한다고 믿어진다. 또한, NS5A 단백질은 바이러스게놈 복제 복합체를 다른 바이러스의 비구조 단백질들을 이용하여 조립하고, 만들어진 바이러스게놈을 지방 물방울 (lipid droplet)이라는 구조로 옮기고, 여기서 바이러스의 코어 단백질을 바이러스 게놈과 결합시킴으로써 실제적인 바이러스입자를 만드는데 중요한 역할을 한다고 알려져 있다. 특히 바이러스의 비구조 단백질 간의 단백질 상호작용 (protein-protein interaction)은 바이러스 게놈 복제 복합체를 만드는데 결정적인 역할을 한다고 알려져 있지만 정확하게 분자 수준에서 어떤 역할을 하는지에 대해서는 아직 잘 알려져 있지 않은 상태이다.
바이러스성 질환을 치료할 수 있는 항바이러스제의 종류로는 항바이러스제의 작용 메커니즘에 따라 바이러스를 간접적으로 공격하는 항바이러스제(indirect-acting antivirals, IAAs)와 바이러스를 직접적으로 공격하는 항바이러스제 (direct-acting antivirals, DAAs)가 있다. 바이러스와 같은 병원성 외부 미생물이 체내 침투 시 체내에서 분비되는 인터페론 알파는 바이러스를 간접적으로 공격하는 대표적인 항바이러스성 내재면역 증강물질로서, 바이러스 자체를 공격하기보다는 바이러스가 기생하고 있는 숙주세포의 면역저항성을 높임으로써 바이러스 세포 내 증식을 차단하기 때문에, 여러 가지 다른 종류의 바이러스성 질환에 효과가 있고 바이러스가 기생하고 있는 숙주세포의 단백질의 기능을 조절하여 항바이러스 활성을 나타내므로, 내성과 저항성을 가지고 있는 돌연변이 바이러스가 생길 확률이 비교적 적다. 그러나 특정한 바이러스에 대해서만 항바이러스 활성을 나타낼 수 있는 항바이러스 특이성 (antiviral specificity)이 현저하게 떨어지기 때문에, 이를 극복하기 위해서 생체 내에서 자연스럽게 분비되는 인터페론의 양보다 훨씬 더 많은 양의 인터페론을 치료 목적으로 투여하게 되고, 따라서 자살충동, 우울증, 빈혈 등과 같은 심각한 부작용 및 독성이 나타나게 된다.
한편, 바이러스를 직접적으로 공격하는 항바이러스제의 경우, 인터페론과 달리 바이러스의 생활사에서 꼭 필요한 바이러스 단백질들의 특수한 기능만을 선택적으로 저해함으로써 상대적으로 낮은 농도에서도 높은 항바이러스 활성을 나타낸다. 또한 바이러스를 간접적으로 공격하는 항바이러스제에 비해, 독성이 적고 안전성이 높은 것이 특징이다. 인간 면역 결핍 바이러스 (human immunodeficiency virus, HIV)의 역전사 효소 저해제 (reverse transcriptase inhibitor)와 단백질 분해 효소 저해제 (protease inhibitor)는 바이러스를 직접적으로 공격하는 대표적인 항바이러스제로서, 각각 바이러스의 생활사에서 필수적인 효소인 역전사 효소, 단백질 분해 효소를 저해하여 바이러스의 세포 내 증식을 억제한다. 그러나 바이러스가 돌연변이를 통해 항바이러스제의 타겟이 된 바이러스 단백질의 아미노산 서열을 변화시킴으로써 기존 항바이러스제에 대한 저항성 및 내성을 나타낼 수 있는 가능성이 상대적으로 크며, 특히 C형 간염 바이러스의 RNA 중합효소 (polymerase)는 RNA 게놈의 복제 시 잘못 들어간 핵산을 교정하는 기능을 하는 5'-3' 엔도뉴클레아제 (endonuclease) 활성이 없으므로, C형 간염 바이러스 게놈인 RNA가 복제되는 과정에서 쉽게 돌연변이 바이러스가 생기게 되어 바이러스를 직접적으로 공격하는 항바이러스제에 대해 저항성과 내성을 갖기가 쉽다.
현재 C형 간염 치료제로 일반적으로 사용되고 있는 인터페론 알파 (interferon-alpha)와 리바비린 (ribavirin)은 각각 내재 면역 증진과 핵산 생합성 저해를 통해 바이러스를 간접적으로 공격하는 항바이러스제 (indirect-actingantivirals, IAAs)로서, 두 약물을 함께 병용하여도 52주 간의 정맥 주사 및 경구 투여를 통한 약물 투여 후 치료 성공률 (sustained virologic response, SVR)이 바이러스의 게놈형 (genotype)에 따라서는 50%에도 미치지 못하여 약효가 매우 낮을 뿐만 아니라, 자살 충동, 우울증, 빈혈과 같은 심각한 부작용 및 독성을 가지고 있어 많은 C형 간염 환자들이 중도에 치료를 포기하고 있는 실정이다. 따라서 상기와 같은 기존 C형 간염 바이러스에 대한 항바이러스 약물들을 대체할 수 있는 보다 효과적이면서도 안전한 약물 개발이 절실히 요구된다.
본 발명의 목적은 C형 간염 바이러스의 RNA 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤(resveratrol) 이량체를 제공하는 것이다.
본 발명의 다른 목적은 C형 간염 바이러스의 RNA 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤(resveratrol) 삼량체를 제공하는 것이다.
본 발명의 또 다른 목적은 C형 간염 바이러스의 RNA 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤(resveratrol) 사량체를 제공하는 것이다.
본 발명의 또 다른 목적은 레스베라트롤(resveratrol) 다량체로 구성된 군으로부터 선택되는 하나 이상의 화합물을 유효성분으로 포함하는 C형 간염의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
상기 목적을 달성하기 위하여, 본 발명은 하기 화학식 1로 표시되는 C형 간염 바이러스의 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤(resveratrol) 이량체를 제공한다.
[화학식 1]
Figure PCTKR2015001577-appb-I000001
상기 식에서, R1은
Figure PCTKR2015001577-appb-I000002
,
Figure PCTKR2015001577-appb-I000003
또는
Figure PCTKR2015001577-appb-I000004
이고,
R2, R3은 서로 같거나 다른 것으로, H 또는 OH이고,
R1의 탄소는 a 위치의 탄소와 결합하여 환을 형성할 수 있으며,
Figure PCTKR2015001577-appb-I000005
는 단일 또는 이중 결합을 나타낸다.
또한, 본 발명은 하기 화학식 2로 표시되는 C형 간염 바이러스의 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤(resveratrol) 삼량체를 제공한다.
[화학식 2]
Figure PCTKR2015001577-appb-I000006
상기 식에서, R1은
Figure PCTKR2015001577-appb-I000007
,
Figure PCTKR2015001577-appb-I000008
또는
Figure PCTKR2015001577-appb-I000009
이고,
R2, R3은 서로 같거나 다른 것으로, H 또는 OH이고,
R4는 H이며,
R1의 탄소는 a 위치 및/또는 b 위치의 탄소와 결합하여 환을 형성할 수 있고,
OR4는 b 위치의 탄소와 결합하여 환을 형성할 수 있으며,
Figure PCTKR2015001577-appb-I000010
는 단일 또는 이중 결합을 나타낸다.
더욱이, 본 발명은 하기 화학식 3으로 표시되는 C형 간염 바이러스의 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤(resveratrol) 사량체를 제공한다.
[화학식 3]
Figure PCTKR2015001577-appb-I000011
상기 식에서, R1은
Figure PCTKR2015001577-appb-I000012
,
Figure PCTKR2015001577-appb-I000013
또는
Figure PCTKR2015001577-appb-I000014
이고,
R2, R3, R6, R8은 서로 같거나 다른 것으로, H 또는 OH이며,
R5는 H이고,
R7은
Figure PCTKR2015001577-appb-I000015
이며,
R1의 탄소는 a 위치의 탄소와 결합하여 환을 형성할 수 있고,
R7의 d위치의 탄소는 OR5와 결합하여 5원환을 형성하거나, c위치의 탄소와 결합하여 7원환을 형성할 수 있으며,
Figure PCTKR2015001577-appb-I000016
는 단일 또는 이중 결합을 나타낸다.
본 발명의 일 구현예로, 상기 레스베라트롤(resveratrol) 이량체는 하기 화학식 4 내지 화학식 10으로 표시되는 화합물로 이루어진 군으로부터 선택되는 것을 특징으로 한다.
[화학식 4]
Figure PCTKR2015001577-appb-I000017
[화학식 5]
Figure PCTKR2015001577-appb-I000018
[화학식 6]
Figure PCTKR2015001577-appb-I000019
[화학식 7]
Figure PCTKR2015001577-appb-I000020
[화학식 8]
Figure PCTKR2015001577-appb-I000021
[화학식 9]
Figure PCTKR2015001577-appb-I000022
[화학식 10]
Figure PCTKR2015001577-appb-I000023
본 발명의 다른 구현예로, 상기 레스베라트롤(resveratrol) 이량체는 하기 화학식 4 또는 화학식 5로 표시되는 화합물인 것을 특징으로 한다.
[화학식 4]
Figure PCTKR2015001577-appb-I000024
[화학식 5]
Figure PCTKR2015001577-appb-I000025
본 발명의 일 구현예로, 상기 레스베라트롤(resveratrol) 삼량체는 하기 화학식 11 내지 화학식 17로 표시되는 화합물로 이루어진 군으로부터 선택되는 것을 특징으로 한다.
[화학식 11]
Figure PCTKR2015001577-appb-I000026
[화학식 12]
Figure PCTKR2015001577-appb-I000027
[화학식 13]
Figure PCTKR2015001577-appb-I000028
[화학식 14]
Figure PCTKR2015001577-appb-I000029
[화학식 15]
Figure PCTKR2015001577-appb-I000030
[화학식 16]
Figure PCTKR2015001577-appb-I000031
[화학식 17]
Figure PCTKR2015001577-appb-I000032
본 발명의 일 구현예로, 상기 레스베라트롤(resveratrol) 사량체는 하기 화학식 18 내지 화학식 26으로 표시되는 화합물로 이루어진 군으로부터 선택되는 것을 특징으로 한다.
[화학식 18]
Figure PCTKR2015001577-appb-I000033
[화학식 19]
Figure PCTKR2015001577-appb-I000034
[화학식 20]
Figure PCTKR2015001577-appb-I000035
[화학식 21]
Figure PCTKR2015001577-appb-I000036
[화학식 22]
Figure PCTKR2015001577-appb-I000037
[화학식 23]
Figure PCTKR2015001577-appb-I000038
[화학식 24]
Figure PCTKR2015001577-appb-I000039
[화학식 25]
Figure PCTKR2015001577-appb-I000040
[화학식 26]
Figure PCTKR2015001577-appb-I000041
본 발명의 다른 구현예로, 상기 레스베라트롤(resveratrol) 사량체는 하기 화학식 18 내지 화학식 20으로 표시되는 화합물로 이루어진 군으로부터 선택되는 것을 특징으로 한다.
[화학식 18]
Figure PCTKR2015001577-appb-I000042
[화학식 19]
Figure PCTKR2015001577-appb-I000043
[화학식 20]
Figure PCTKR2015001577-appb-I000044
또한, 본 발명은 상기 화학식 1 내지 화학식 3으로 표시되는 레스베라트롤(resveratrol) 다량체로 구성된 군으로부터 선택되는 하나 이상의 화합물을 유효성분으로 포함하는 C형 간염의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 일 구현예로, 상기 레스베라트롤(resveratrol) 다량체는 C형 간염 바이러스의 RNA 게놈 복제의 선택적 저해 활성을 갖는 것을 특징으로 한다.
또한, 본 발명은 상기 약학적 조성물을 개체에 투여하는 단계를 포함하는 C형 간염 치료방법을 제공한다.
또한, 본 발명은 상기 약학적 조성물을 C형 간염의 예방 또는 치료에 이용하는 방법을 제공한다.
뿐만 아니라, 본 발명은 상기 화학식 1 내지 화학식 3으로 표시되는 레스베라트롤(resveratrol) 다량체로 구성된 군으로부터 선택되는 하나 이상의 화합물을 유효성분으로 포함하는 C형 간염의 예방 또는 개선용 건강기능식품 조성물을 제공한다.
본 발명에 따른 레스베라트롤(resveratrol) 다량체는 간세포에 대한 독성이 매우 낮으면서도, C형 간염 바이러스의 게놈 복제를 선택적으로 저해하는 우수한 효과를 가지고 있어, C형 간염을 예방, 개선 또는 치료하기 위한 약학적 조성물 또는 기능성 식품 조성물의 활성성분으로 유용하게 사용될 수 있을 것으로 기대된다.
도 1은 Ampelopsin A의 1H-NMR 결과를 나타낸 도이다.
도 2는 Ampelopsin A의 13C-NMR 결과를 나타낸 도이다.
도 3은 (+)-ε-viniferin의 1H-NMR 결과를 나타낸 도이다.
도 4는 (+)-ε-viniferin의 13C-NMR 결과를 나타낸 도이다.
도 5는 vitisin A의 1H-NMR 결과를 나타낸 도이다.
도 6은 vitisin A의 13C-NMR 결과를 나타낸 도이다.
도 7은 wilsonol C의 1H-NMR 결과를 나타낸 도이다.
도 8은 wilsonol C의 13C-NMR 결과를 나타낸 도이다.
도 9는 vitisin B의 1H-NMR 결과를 나타낸 도이다.
도 10은 vitisin B의 13C-NMR 결과를 나타낸 도이다.
도 11은 실시예 1에서 분리 동정된 화합물 1 내지 화합물 5의 구조를 나타낸 도이다.
도 12는 C형 간염 바이러스의 게놈 복제를 측정하기 위해 사용된 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스의 게놈 구조와 바이러스 게놈 복제 저해제 발견의 원리를 설명한 도이다.
도 13은 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 사용하여 350개의 생약 추출물 라이브러리를 스크리닝한 결과 HCV 바이러스의 게놈 복제를 선택적으로 저해하면서 간세포에 독성을 나타내지 않는 포도근 추출물을 발견한 결과를 나타낸 도이다.
도 14는 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 이용해 포도근의 ethyl acetate, butanol, ethanol, hexane, 그리고 물로 추출한 추출 분획의 바이러스의 게놈 복제율과 간세포의 생존률을 측정한 결과를 나타낸 도이다(원형: 세포생존율, 사각형: HCV 게놈복제율, EC50: half maximal effective concentration).
도 15는 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 이용해 포도근의 ethyl acetate (EA) 추출물을 분획하여 얻은 EA-A, EA-B, EA-C, EA-D, EA-E, EA-F의 바이러스의 게놈 복제율과 간세포의 생존률을 0.1, 1, 그리고 10 μg/ml의 농도에서 측정한 결과를 나타낸 도이다(파란색: 세포생존율, 빨간색: HCV 게놈복제율).
도 16은 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 이용해 포도근의 ethyl acetate (EA) 추출물을 분획하여 얻은 EA-B 와 EA-C의 바이러스의 게놈 복제율과 간세포의 생존률을 측정한 결과를 나타낸 도이다(파란색: 세포생존율, 빨간색: HCV 게놈복제율, EC50: half maximal effective concentration).
도 17은 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 이용해 포도근의 EA-B 추출물을 분획하여 얻은 EA-Ba, EA-Bb, EA-Bc, EA-Bd, EA-Be, EA-Bf, EA-Bg, EA-Bh의 바이러스의 게놈 복제율과 간세포의 생존률을 10 μg/ml의 농도에서 측정한 결과를 나타낸 도이다(파란색: 세포생존율, 빨간색: HCV 게놈복제율).
도 18은 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 이용해 포도근의 EA-B 추출물을 분획하여 얻은 EA-Bd, EA-Be, EA-Bg, EA-Bh의 바이러스의 게놈 복제율과 간세포의 생존률을 측정한 결과를 나타낸 도이다(파란색: 세포생존율, 빨간색: HCV 게놈복제율, EC50: half maximal effective concentration).
도 19는 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 이용해 포도근의 EA-B 추출물을 high-performance countercurrent chromatography를 통해 분리한 단일 화합물 Ampelopsin A의 구조와 Ampelopsin A의 바이러스의 게놈 복제율과 간세포의 생존률을 측정한 결과를 나타낸 도이다(원형: 세포생존율, 사각형: HCV 게놈복제율, EC50: half maximal effective concentration, CC50: half maximal cytotoxic concentration 50).
도 20은 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 이용해 포도근의 EA-B 추출물을 high-performance countercurrent chromatography를 통해 분리한 단일 화합물 ε-viniferin의 구조와 ε-viniferin의 바이러스의 게놈 복제율과 간세포의 생존률을 측정한 결과를 나타낸 도이다(원형: 세포생존율, 사각형: HCV 게놈복제율, EC50: half maximal effective concentration, CC50: half maximal cytotoxic concentration 50).
도 21은 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 이용해 포도근의 EA-B 추출물을 high-performance countercurrent chromatography를 통해 분리한 단일 화합물 Wilsonol C의 구조와 Wilsonol C의 바이러스의 게놈 복제율과 간세포의 생존률을 측정한 결과를 나타낸 도이다(원형: 세포생존율, 사각형: HCV 게놈복제율, EC50: half maximal effective concentration, CC50: half maximal cytotoxic concentration 50).
도 22는 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 이용해 포도근의 EA-B 추출물을 high-performance countercurrent chromatography를 통해 분리한 단일 화합물 Vitisin A의 구조와 Vitisin A의 바이러스의 게놈 복제율과 간세포의 생존률을 측정한 결과를 나타낸 도이다(원형: 세포생존율, 사각형: HCV 게놈복제율, EC50: half maximal effective concentration, CC50: half maximal cytotoxic concentration 50).
도 23은 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 이용해 포도근의 EA-B 추출물을 high-performance countercurrent chromatography를 통해 분리한 단일 화합물 Vitisin B의 구조와 Vitisin B의 바이러스의 게놈 복제율과 간세포의 생존률을 측정한 결과를 나타낸 도이다(원형: 세포생존율, 사각형: HCV 게놈복제율, EC50: half maximal effective concentration, CC50: half maximal cytotoxic concentration 50).
도 24는 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 이용해 포도근의 EA-B 추출물을 high-performance countercurrent chromatography를 통해 분리한 단일 화합물 Vitisin B의 바이러스의 게놈 복제율과 간세포의 생존률을 500 nM의 농도에서 72시간 동안 측정한 결과를 나타낸 도이다(원형: 세포생존율, 사각형: HCV 게놈복제율, EC50: half maximal effective concentration, CC50: half maximal cytotoxic concentration 50)(동그라미: 세포생존율, 네모: HCV 게놈복제율, T1/2: 바이러스의 RNA양이 반으로 떨어지는데 걸리는 시간).
도 25는 C형 간염 바이러스의 RNA 게놈 발현을 측정하기 위해 사용된 HCV 서브지노믹 레플리콘 (subgenomic replicon) Bart79I (genotype 1b)의 게놈 구조를 나타낸 도이다.
도 26은 C형 간염 바이러스의 RNA 게놈 발현을 측정하기 위해 사용된 HCV 풀지놈믹 레플리콘 (full genomic replicon) J6/JFH1 (genotype 2a)의 게놈 구조를 나타낸 도이다.
도 27은 포도근의 EA-B 추출물을 high-performance countercurrent chromatography를 통해 분리한 단일 화합물 Vitisin B의 농도가 증가함에 따라 C형 간염 바이러스의 RNA 게놈 복제에 미치는 영향을 HCV 서브지노믹 리플리콘 (subgenomic replicon) Bart79I의 게놈의 real time PCR 정량법을 사용하여 나타낸 도이다(EC50: half maximal effective concentration).
도 28은 포도근의 EA-B 추출물을 high-performance countercurrent chromatography를 통해 분리한 단일 화합물 Vitisin B이 처리 시간이 경과함에 따라 C형 간염 바이러스의 RNA 게놈 복제에 미치는 영향을 HCV 서브지노믹 리플리콘 (subgenomic replicon) Bart79I의 게놈의 real time PCR 정량법을 사용하여 나타낸 도이다(T1/2: 바이러스의 RNA양이 반으로 떨어지는데 걸리는 시간).
도 29는 포도근의 EA-B 추출물을 high-performance countercurrent chromatography를 통해 분리한 단일 화합물 Vitisin B이 약물의 농도가 증가함에 따라 C형 간염 바이러스의 RNA 게놈 복제에 미치는 영향을 HCV 풀지놈믹 리플리콘 (full genomic replicon) J6/JFH1 (genotype 2a)의 real time PCR 정량법을 사용하여 나타낸 도이다(EC50: half maximal effective concentration).
도 30은 C형 간염 바이러스의 단백질 발현을 측정하기 위해 사용된 서브지노믹 리플리콘 (subgenomic replicon) Bart79I-NS5A-GFP HCV (genotype 1b) 리포터 바이러스의 게놈 구조를 나타낸 도이다.
도 31은 포도근의 EA-B 추출물을 high-performance countercurrent chromatography를 통해 분리한 단일 화합물 Vitisin B가 농도가 증가함에 따라 C형 간염 바이러스의 단백질 발현에 미치는 영향을 도 29에서 설명한 GFP가 tagging된 서브지노믹 리플리콘 (subgenomic replicon) Bart79I-NS5A-GFP이 들어간 간세포에서 발현하는 녹색 형광의 양을 FACS (fluorsecence assorted cell sorter)를 사용해서 측정한 결과를 나타낸 도이다(EC50: half maximal effective concentration).
도 32는 포도근의 EA-B 추출물을 high-performance countercurrent chromatography를 통해 분리한 단일 화합물 Vitisin B가 500 nM에서 처리한 시간이 경과함에 따라 C형 간염 바이러스의 단백질 발현에 미치는 영향을 도 29에서 설명한 GFP가 tagging된 서브지노믹 리플리콘 (subgenomic replicon) Bart79I-NS5A-GFP이 들어간 간세포에서 발현하는 녹색 형광의 양을 FACS (fluorsecence assorted cell sorter)를 사용해서 측정한 결과를 나타낸 도이다(T1/2: 바이러스의 RNA양이 반으로 떨어지는데 걸리는 시간).
도 33은 포도근의 EA-B 추출물을 high-performance countercurrent chromatography를 통해 분리한 단일 화합물 Vitisin B의 농도가 증가함에 따라 C형 간염 바이러스의 단백질 발현에 미치는 영향을 도 18에서 설명한 HCV 서브지노믹 리플리콘 (subgenomic replicon) Bart79I의 게놈에서 발현되는 NS5A 단백질의 양과 간세포의 control 단백질인 beta actin 단백질을 western blot을 사용해서 측정한 결과를 나타낸 도이다(EC50: half maximal effective concentration).
도 34는 포도근의 EA-B 추출물을 high-performance countercurrent chromatography를 통해 분리한 단일 화합물 Vitisin B를 500 nM의 농도에서 처리한 시간이 경과함에 따라 C형 간염 바이러스의 단백질 발현에 미치는 영향을 도 18에서 설명한 HCV 서브지노믹 리플리콘 (subgenomic replicon) Bart79I의 게놈에서 발현되는 NS5A 단백질의 양과 간세포의 control 단백질인 beta actin 단백질을 western blot을 사용해서 측정한 결과를 나타낸 도이다(T1/2: 바이러스의 RNA양이 반으로 떨어지는데 걸리는 시간).
도 35는 포도근의 EA-B 추출물을 high-performance countercurrent chromatography를 통해 분리한 단일 화합물 Vitisin B의 농도가 증가함에 따라 C형 간염 바이러스의 단백질 발현에 미치는 영향을 도 25에서 설명한 HCV 풀지놈믹 리플리콘 (full genomic replicon) J6/JFH1 (genotype 2a) 게놈에서 발현되는 core 단백질의 양과 간세포의 control 단백질인 beta actin 단백질을 western blot을 사용해서 측정한 결과를 나타낸 도이다(EC50: half maximal effective concentration).
본 발명자들은, 신규한 C형 간염 치료제를 개발하기 위한 노력을 계속한 결과, 천연물 추출물 라이브리에서 포도근 추출물이 C형 간염 바이러스의 게놈 복제를 선택적으로 저해하는 우수한 효과가 있음을 확인하고 이 포도근 추출물에서 동정한 일련의 레스베라트롤(resveratrol) 중합체인 올리고스틸벤 화합물들이 C형 간염 바이러스의 게놈복제를 매우 낮은 농도에서 선택적으로 저해하는 효과를 확인함으로써 본 발명을 완성하였다.
이하, 본 발명을 상세히 설명한다.
본 발명은 하기 화학식 1로 표시되는 C형 간염 바이러스의 RNA 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤(resveratrol) 이량체를 제공한다.
[화학식 1]
Figure PCTKR2015001577-appb-I000045
상기 식에서, R1은
Figure PCTKR2015001577-appb-I000046
,
Figure PCTKR2015001577-appb-I000047
또는
Figure PCTKR2015001577-appb-I000048
이고,
R2, R3은 서로 같거나 다른 것으로, H 또는 OH이고,
R1의 탄소는 a 위치의 탄소와 결합하여 환을 형성할 수 있으며,
Figure PCTKR2015001577-appb-I000049
는 단일 또는 이중 결합을 나타낸다.
본 발명의 레스베라트롤(resveratrol) 이량체의 바람직한 구현예로는 이에 제한되지는 않으나, 하기 화학식 4 내지 화학식 10으로 표시되는 화합물로 이루어진 군으로부터 선택될 수 있으며, 보다 바람직하게는 화학식 4 또는 화학식 5로 표시되는 화합물로 이루어지는 군으로부터 선택될 수 있다.
[화학식 4]
Figure PCTKR2015001577-appb-I000050
[화학식 5]
Figure PCTKR2015001577-appb-I000051
[화학식 6]
Figure PCTKR2015001577-appb-I000052
[화학식 7]
Figure PCTKR2015001577-appb-I000053
[화학식 8]
Figure PCTKR2015001577-appb-I000054
[화학식 9]
Figure PCTKR2015001577-appb-I000055
[화학식 10]
Figure PCTKR2015001577-appb-I000056
또한, 본 발명은 하기 화학식 2로 표시되는 C형 간염 바이러스의 RNA 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤(resveratrol) 삼량체를 제공한다.
[화학식 2]
Figure PCTKR2015001577-appb-I000057
상기 식에서, R1은
Figure PCTKR2015001577-appb-I000058
,
Figure PCTKR2015001577-appb-I000059
또는
Figure PCTKR2015001577-appb-I000060
이고,
R2, R3은 서로 같거나 다른 것으로, H 또는 OH이고,
R4는 H이며,
R1의 탄소는 a 위치 및/또는 b 위치의 탄소와 결합하여 환을 형성할 수 있고,
OR4는 b 위치의 탄소와 결합하여 환을 형성할 수 있으며,
Figure PCTKR2015001577-appb-I000061
는 단일 또는 이중 결합을 나타낸다.
본 발명의 레스베라트롤(resveratrol) 삼량체의 바람직한 구현예로는 이에 제한되지는 않으나, 하기 화학식 11 내지 화학식 17로 표시되는 화합물로 이루어진 군으로부터 선택될 수 있다.
[화학식 11]
Figure PCTKR2015001577-appb-I000062
[화학식 12]
Figure PCTKR2015001577-appb-I000063
[화학식 13]
Figure PCTKR2015001577-appb-I000064
[화학식 14]
Figure PCTKR2015001577-appb-I000065
[화학식 15]
Figure PCTKR2015001577-appb-I000066
[화학식 16]
Figure PCTKR2015001577-appb-I000067
[화학식 17]
Figure PCTKR2015001577-appb-I000068
더욱이, 본 발명은 하기 화학식 3으로 표시되는 C형 간염 바이러스의 RNA 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤(resveratrol) 사량체를 제공한다.
[화학식 3]
Figure PCTKR2015001577-appb-I000069
상기 식에서, R1은
Figure PCTKR2015001577-appb-I000070
,
Figure PCTKR2015001577-appb-I000071
또는
Figure PCTKR2015001577-appb-I000072
이고,
R2, R3, R6, R8은 서로 같거나 다른 것으로, H 또는 OH이며,
R5는 H이고,
R7은
Figure PCTKR2015001577-appb-I000073
이며,
R1의 탄소는 a 위치의 탄소와 결합하여 환을 형성할 수 있고,
R7의 d위치의 탄소는 OR5와 결합하여 5원환을 형성하거나, c위치의 탄소와 결합하여 7원환을 형성할 수 있으며,
Figure PCTKR2015001577-appb-I000074
는 단일 또는 이중 결합을 나타낸다.
본 발명의 레스베라트롤(resveratrol) 사량체의 바람직한 구현예로는 이에 제한되지는 않으나, 하기 화학식 18 내지 화학식 26으로 표시되는 화합물로 이루어진 군으로부터 선택될 수 있으며, 보다 바람직하게는 화학식 18 내지 화학식 20으로 표시되는 화합물로 이루어지는 군으로부터 선택될 수 있다.
[화학식 18]
Figure PCTKR2015001577-appb-I000075
[화학식 19]
Figure PCTKR2015001577-appb-I000076
[화학식 20]
Figure PCTKR2015001577-appb-I000077
[화학식 21]
Figure PCTKR2015001577-appb-I000078
[화학식 22]
Figure PCTKR2015001577-appb-I000079
[화학식 23]
Figure PCTKR2015001577-appb-I000080
[화학식 24]
Figure PCTKR2015001577-appb-I000081
[화학식 25]
Figure PCTKR2015001577-appb-I000082
[화학식 26]
Figure PCTKR2015001577-appb-I000083
한편, 상기 화학식 1, 화학식 2 및 화학식 3으로 표시되는 레스베라트롤(resveratrol) 다량체와 구조적으로 유사한 레스베라트롤(resveratrol) 다량체도 C형 간염 바이러스의 RNA 게놈 복제의 선택적 저해 활성을 가질 수 있을 것으로 기대되며, 구체적인 예는 하기 표1 내지 표 3에 나타내었다.
표 1
Figure PCTKR2015001577-appb-T000001
표 2
Figure PCTKR2015001577-appb-T000002
표 3
Figure PCTKR2015001577-appb-T000003
본 발명의 레스베라트롤(resveratrol) 다량체는 천연물, 예를 들어 포도근(Vitidis Vinferae Radix)으로부터 추출된 것을 사용할 수 있으나, 화학적으로 합성된 것도 추출된 것과 동일한 효과를 나타낸다는 것은 당업자에게 자명하다.
본 발명에 따른 레스베라트롤(resveratrol) 다량체는 간세포에 대한 독성이 매우 낮으면서도, C형 간염 바이러스의 게놈 복제를 선택적으로 저해하는 우수한 효과를 가지는바, C형 간염의 예방 또는 치료에 유용하게 이용될 수 있다.
본 발명의 일 실시예에서는 350개의 생약 추출물 라이브러리를 스크리닝하여 포도근 추출물이 HCV 바이러스의 게놈 복제를 선택적으로 저해하면서 간세포에 독성을 나타내지 않음을 확인하고, 이로부터 레스베라트롤(resveratrol) 다량체인 ampelopsin A, (+)-ε-viniferin, vitisin A, wilsonol C 및 vitisin B를 분리하여 그 구조를 동정하였다(실시예 1 참조).
본 발명의 다른 실시예에서는 레스베라트롤(resveratrol) 다량체인 ampelopsin A, (+)-ε-viniferin, vitisin A, wilsonol C 및 vitisin B의 C형 간염 바이러스의 게놈 복제 저해 활성을 측정한 결과, 본 발명의 레스베라트롤(resveratrol) 다량체가 효율적으로 세포의 생존률에는 영향을 주지 않는 동시에 C형 간염 바이러스의 게놈 복제를 효과적으로 저해하는 것을 확인하였다(실시예 3 참조)
이에, 본 발명은 상기 화학식 1 내지 화학식 3으로 표시되는 레스베라트롤(resveratrol) 다량체로 구성된 군으로부터 선택되는 하나 이상의 화합물을 유효성분으로 포함하는 C형 간염의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명에서 사용되는 용어, "예방"이란 본 발명에 따른 약학적 조성물의 투여에 의해 C형 간염을 억제시키거나 발병을 지연시키는 모든 행위를 의미한다.
본 발명에서 사용되는 용어, "치료"란 본 발명에 따른 약학적 조성물의 투여에 의해 C형 간염에 의한 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미한다.
본 발명의 조성물은 상기 레스베라트롤(resveratrol) 다량체와 함께 C형 간염의 예방 또는 치료 효과를 갖는 공지의 유효성분을 1종 이상 더 함유할 수 있다.
본 발명의 조성물은 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다. 또한 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 당해 기술 분야에 알려진 적합한 제제는 문헌 (Remington's Pharmaceutical Science, 최근, Mack Publishing Company, Easton PA)에 개시되어 있는 것을 사용하는 것이 바람직하다.
상기 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토오스, 덱스트로오스, 수크로오스, 소르비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로오스, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐 피롤리돈, 물, 메틸히드록시 벤조에이트, 프로필히드록시 벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유 등이 있다. 상기 조성물을 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다.
경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 조성물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트 (calcium carbonate), 수크로오스, 락토오스, 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구투여를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 또한, 비수성용제, 현탁제로는 프로필렌글리콜 (propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈 (tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명에서 사용되는 용어 "투여"는 임의의 적절한 방법으로 개체에게 소정의 본 발명의 조성물을 제공하는 것을 의미한다.
본 발명의 약학적 조성물의 바람직한 투여량은 개체의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르며, 당업자에 의해 적절하게 선택될 수 있다. 바람직한 효과를 위해서, 본 발명의 레스베라트롤(resveratrol) 중합체인 올리고스틸벤 화합물들은 1일 0.1 mg/kg 내지 1000 mg/kg으로, 바람직하게는 0.001 내지 200 mg/kg의 양으로 투여할 수 있으며, 하루에 한번 또는 수 회 나누어 투여할 수도 있다.
본 발명의 약학적 조성물은 개체에게 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구, 직장 또는 정맥, 근육, 피하, 자궁 내 경막 또는 뇌혈관 내 주사에 의해 투여될 수 있다.
본 발명의 조성물은 C형 간염의 예방 또는 치료를 위하여 단독으로, 또는 수술, 방사선 치료, 호르몬 치료, 화학 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다.
이에, 본 발명은 상기 약학적 조성물을 개체에 투여하는 단계를 포함하는 C형 간염 치료방법을 제공한다. 본 발명에서 "개체"란 질병의 치료를 필요로 하는 대상을 의미하고, 보다 구체적으로는 인간 또는 비-인간인 영장류, 생쥐 (mouse), 쥐 (rat), 개, 고양이, 말 및 소 등의 포유류를 의미한다.
더욱이, 본 발명은 상기 화학식 1 내지 화학식 3으로 표시되는 레스베라트롤(resveratrol) 다량체로 구성된 군으로부터 선택되는 하나 이상의 화합물을 유효성분으로 포함하는 C형 간염 예방 또는 개선용 건강기능 식품 조성물을 제공한다.
본 발명에서 사용되는 용어 "개선"이란 치료되는 상태와 관련된 파라미터, 예를 들면 증상의 정도를 적어도 감소시키는 모든 행위를 의미한다. 이때 상기 기능성 식품 조성물은 C형 간염 예방 또는 개선을 위하여 해당 질환의 발병 단계 이전 또는 발병 후, 치료를 위한 약제와 동시에 또는 별개로서 사용될 수 있다.
본 발명에서, 건강기능식품이란 질병의 예방 또는 개선, 생체방어, 면역, 병후의 회복, 노화 억제 등 생체조절기능을 가지는 식품을 말하는 것으로, 장기적으로 복용하였을 때 인체에 무해하여야 한다. 본 발명의 포도근 추출물은 C형 간염의 예방 또는 개선을 목적으로 건강기능식품에 첨가될 수 있다. 본 발명의 레스베라트롤(resveratrol) 중합체인 올리고스틸벤 화합물들을 식품 첨가물로 사용할 경우, 상기 레스베라트롤(resveratrol) 중합체인 올리고스틸벤 화합물들을 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효성분의 혼합양은 사용 목적 (예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품 또는 음료의 제조 시에 본 발명의 포도근 추출물은 원료에 대하여 15 중량 % 이하, 바람직하게는 10 중량 % 이하의 양으로 첨가된다. 그러나, 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 범위 이하일 수 있으며, 안전성 면에서 아무런 문제가 없기 때문에 유효성분은 상기 범위 이상의 양으로도 사용될 수 있다.
상기 식품의 종류에는 특별한 제한은 없다. 상기 물질을 첨가할 수 있는 식품의 예로는 육류, 소시지, 빵, 초콜릿, 캔디류, 스낵류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 수프, 음료수, 차, 드링크제, 알코올 음료 및 비타민 복합제 등이 있으며, 통상적인 의미에서의 건강 식품을 모두 포함한다.
본 발명의 건강음료 조성물은 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 포함할 수 있다. 상술한 천연 탄수화물은 포도당, 과당과 같은 모노사카라이드, 말토오스, 수크로오스와 같은 디사카라이드, 및 덱스트린, 사이클로덱스트린과 같은 천연 감미제나, 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 ml 당 일반적으로 약 0.01 내지 10 g, 바람직하게는 약 0.01 내지 0.1g 이다.
상기 외에 본 발명의 조성물은 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산 음료에 사용되는 탄산화제 등을 포함할 수 있다. 그 밖에 본 발명의 조성물은 천연 과일주스, 과일주스 음료 및 야채 음료의 제조를 위한 과육을 포함할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 크게 중요하진 않지만 본 발명의 조성물 100 중량부 당 0.01 내지 0.1 중량부의 범위에서 선택되는 것이 일반적이다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예, 실험예 및 제조예를 제시한다. 그러나 하기의 실시예, 실험예 및 제조예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예, 실험예 및 제조예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실시예 1. 레스베라트롤(resveratrol) 다량체 분리 동정
건조한 포도근 600g을 분쇄기로 세절하여 메탄올 (4.5 L)로 3시간 초음파 추출하여 총메탄올 추출물 45g을 얻었다. 총메탄올 추출물을 헥산, 에틸아세테이트(EA), 부탄올로 유기용매분획한 후 에틸아세테이트 가용 분획 15.3g을 얻었다. 에틸아세테이트 가용 분획을 순상컬럼크로마토그래피를 이용하여 분획을 나누었으며 항 HCV 활성 검색을 통해 활성이 가장 우수한 EA-B (6.3g)를 얻었다. EA-B 분획을 high-performance countercurrent chromatography를 통해 단일물질 분리를 시도하였다. HPCCC의 two-phase solvent system은 헥산-에틸아세테이트-메탄올-증류수 (4:8:4:10 v/v)를 제조하여 상층을 고정상, 하층을 이동상으로 하여 사용하였다. 펌프의 유속은 gradient flow rate를 이용하여 0분-75분에는 4 ml/min으로 75분-250분에는 8 mL/min의 조건을 사용하였으며 HPCCC의 속도는 1600 rpm 로 지정하였다. 이의 조건을 이용하여 oligostilbene 함유 분획물 150 mg을 주입하고 자동수집기로 분취하였으며 UV chromatogram을 통하여 개별 올리고스틸벤을 모았으며 분리된 올리고스틸벤은 NMR 및 MS spectormeter를 이용하여 구조를 결정하였다.
즉, 상기 HPCCC 방법을 이용하여 포도근의 올리고스틸벤 함유 분획물 (150 mg)에서 5 종의 화합물을 분리하였으며 이는 각각 ampelopsin A ('화합물 1', 12.1 mg), (+)-ε-viniferin ('화합물 2', 10.4 mg), vitisin A ('화합물 3', 2.8 mg), wilsonol C ('화합물 4', 3.2 mg) 및 vitisin B ('화합물 5', 37 mg)이었고, 순도는 모두 95% 이상이었다. 분리된 화합물은 Q-TOF MS를 통해 얻은 분자량 정보와 1H-NMR, 13C-NMR을 이용하여 구조를 규명하였고, 그 결과를 각각 도 1 내지 도 10에 나타내었다. 또한, 상기 결과에 의해, 실시예 1에서 얻은 화합물 1 내지 화합물 5의 구조를 도 11에 나타내었다.
실시예 2. 생약 추출물들과 생약 추출물에서 동정한 화합물들의 세포 생존률 측정
생약 추출물들과 생약 추출물에서 동정한 화합물들이 세포의 생존에 미치는 영향을 확인하기 위하여, 종래 공지된 방법인 EZ-Cytox 세포 생존 어쎄이 (EZ-Cytox cell viability assay, Daeil Lab Service)를 이용하여 하기와 같은 실험을 수행하였다.
먼저, 96 웰-플레이트에 웰 당 1.7 X 104 내지 2.0 X 104 개의 Huh 7.5 인간 간암 세포를 첨가하고 37℃ 배양기에서 24시간 동안 배양하였다. 상기 세포에 다양한 농도의 생약 추출물들 또는 생약 추출물에서 동정한 화합물들을 처리한 후 72시간 동안 배양하였다. 보다 구체적으로, 측정한 농도는 생약 추출물의 경우 0, 10 pg/ml, 100 pg/ml, 1 ng/ml, 10 ng/ml, 100 ng/ml, 1 μg/ml 10 μg/ml, 100 μg/ml이고 동정한 화합물의 경우 0, 10 pM, 100 pM, 1 nM, 10 nM, 100 nM, 1 μM, 10 μM, 100 μM이었다. 대조군으로는 DMSO (dimethyl sulfoxide)를 처리하였다. 이후 배양액을 버리고, PBS로 세척한 후, 수용성 테트라졸리움염 (tetrazolium salt)이 포함된 EZ-Cytox 시약에 세포 배양액을 첨가하여 제조한 1/10 (v/v) 희석액을 100 μl씩 첨가하고 3시간 동안 반응시켰다. 반응이 종료된 후 분광광도계를 이용하여 450 nm의 파장으로 세포의 흡광도를 계측하였다. DMSO 처리 시의 흡광도를 100으로 기준하여, 포도근 메탄올 추출물 처리 시의 상대적인 흡광도를 계산하였고, 그 결과를 도 14 내지 도 24에 나타내었다.
실시예 3. C형 간염 바이러스 게놈 복제 저해 활성 측정
3-1. C형 간염 바이러스의 게놈 복제를 측정하기 위한 리포터 바이러스의 준비
생약 추출물들과 생약 추출물에서 동정한 화합물들이 C형 간염 바이러스의 게놈 복제에 미치는 영향을 측정하기 위해 유전형(genotype) 2a에 속하는 FL-J6/JFH-5C19Rluc2AUbi HCV replicon을 리포터 바이러스로 사용하였다. 상기 리포터 바이러스의 게놈 구조도를 도 12에 나타내었다.
도 12에 나타낸 바와 같이, 상기 리포터 바이러스는 유전형 2a에 속하는 C 형 간염 바이러스의 전체 게놈이 cDNA 상태로 포함되어 있고, 바이러스의 내부 리보솜 진입 위치 (IRES, internal ribosome entry site)와 바이러스의 코어 (core) 단백질 사이에 레닐라 루시퍼라제와 스스로 절단하는 (self-cleaving) 구족병 바이러스 (foot and mouth disease virus) 2A 단백질의 Ubi 시퀀스 (sequence)가 부착되어 있어, 상기 FL-J6/JFH-5C19Rluc2AUbi 플라스미드를 T7 RNA 중합효소(polymerase)를 사용하여 시험관 상 (in-vitro)에서 전사 (transcription)하여 얻은 HCV RNA를 간암 세포주인 Huh7.5 세포에 주입 (transfection)하면, 주입된 바이러스의 RNA가 내부 리보솜 진입 위치(IRES)를 사용한 번역을 통해서 다중단백질(polyprotein)을 생산한다. 이때 생산된 다중단백질 중 레닐라 루시퍼라제는 스스로 잘려나가는 구족병 바이러스 2A 단백질의 Ubi 시퀀스의 도움을 받아 바이러스 비구조 단백질들과 분리되고, 분리된 레닐라 루시퍼라제의 활성을 측정함으로써 간접적으로 간세포 내의 바이러스 RNA 게놈 복제를 측정할 수 있게 된다.
3-2. C형 간염 바이러스의 게놈 복제 저해 활성 측정 방법
Huh7.5 인간 간암 세포를 트립신화하여 PBS 용액으로 1.5X107 개/ml의 세포 밀도를 갖도록 재현탁시켰다. 총 5 μg의 시험관 내 (in vitro) 전사된 FLJ6/JFH-5 C19Rluc2AUbi RNA를 Huh 7.5 인간 간암 세포가 포함된 400μl의 PBS 완충액과 혼합한 후 2-mm-gap cuvette (BTX)에 넣었다. 여기에 BTX-830 전기천공기를 이용하여 0.82kV로 99 ms 동안 5회 펄스를 가하여 상기 FL-J6/JFH-5 C19Rluc2AUbi RNA를 Huh7.5 인간 간암 세포 내로 트랜스펙션하였다. 상기 전기천공을 실시한 지 6시간 경과 후, 다양한 농도 (1 pM - 10 μM)의 생약 추출물들 또는 생약 추출물에서 동정한 화합물들을 상기 세포에 처리하고 72시간 동안 배양하였다. 대조군으로는 DMSO를 이용하였다. 상기 물질을 처리한 세포의 배양액을 버리고 PBS로 세포가 부착되어 있는 웰을 세척한 다음, 20μl의 세포용해 완충액 (cell lysis buffer)을 넣고 얼음 내에서 20분간 방치하였다.
이후, 레닐라 루시퍼라제 기질을 레닐라 루시퍼라제 완충액으로 100배 희석한 희석액을 준비하고, 상기 희석액 100 μl를 각 웰에 넣어주었다. 인테그레이션 타임을 10초로 하여 레닐라 루시퍼라제의 발광도를 측정하였다. DMSO 처리 시의 발광도를 100으로 기준하여, 생약 추출물들 또는 생약 추출물에서 동정한 화합물들을 처리 시의 상대적인 발광도를 계산하였다.
3-3. 생약 추출물의 C형 간염 바이러스의 게놈 복제 저해 활성 측정
생약 추출물의 C형 간염 바이러스의 게놈 복제 저해 활성 측정 실험을 하기와 같이 진행하였다.
먼저, 상기 3-1에 의해 준비된 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 사용하여 350개의 생약 추출물 라이브러리를 스크리닝하였고, 그 결과를 도 13에 나타내었다. 도 13에 나타낸 바와 같이, 생약 추출물 중 포도근 추출물이 HCV 바이러스의 게놈 복제를 선택적을 저해하면서 간세포에 독성을 나타내지 않음을 확인할 수 있었다.
다음으로, 상기 3-1에 의해 준비된 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 사용하여 상기 3-2의 방법을 통해 포도근의 ethyl acetate, butanol, ethanol, hexane, 그리고 물로 추출한 추출 분획의 바이러스의 게놈 복제율과 간세포의 생존률을 측정하였고, 그 결과를 도 14에 나타내었다. 도 14에 나타낸 바와 같이, ethyl acetate 분획에서 가장 효율적으로 세포의 생존률에는 영향을 주지 않는 동시에 C형 간염 바이러스의 게놈 복제를 효과적으로 저해하는 것을 확인할 수 있었다.
다음으로, 상기 3-1에 의해 준비된 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 사용하여 상기 3-2의 방법을 통해 포도근의 ethyl acetate (EA) 추출물을 순상컬럼크로마토그래피를 이용하여 분획을 진행하여 얻은 EA-A (1.2 g), EA-B (6.3 g), EA-C (2.6 g), EA-D (1.7 g), EA-E (1.1 g), EA-F (0.9 g)의 바이러스의 게놈 복제율과 간세포의 생존률을 0.1, 1, 그리고 10 μg/ml의 농도에서 측정하였고, 그 결과를 도 15에 나타내었다. 도 15에 나타낸 바와 같이, EA-B와 EA-C 분획에서 가장 효율적으로 세포의 생존률에는 영향을 주지 않는 동시에 C형 간염 바이러스의 게놈 복제를 효과적으로 저해하는 것을 확인할 수 있었다.
다음으로, 상기 3-1에 의해 준비된 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 사용하여 상기 3-2의 방법을 통해 포도근의 ethyl acetate (EA) 추출물을 분획하여 얻은 EA-B 와 EA-C의 바이러스의 게놈 복제율과 간세포의 생존률을 측정하였고, 그 결과를 도 16에 나타내었다. 도 16에 나타낸 바와 같이, EA-B 분획에서 가장 효율적으로 세포의 생존률에는 영향을 주지 않는 동시에 C형 간염 바이러스의 게놈 복제를 효과적으로 저해하는 것을 확인할 수 있었다.
다음으로, 상기 3-1에 의해 준비된 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 사용하여 상기 3-2의 방법을 통해 포도근의 EA-B 추출물을 순상컬럼크로마토그래피를 이용하여 분획하여 얻은 EA-Ba (0.9 g), EA-Bb (0.7 g), EA-Bc (1.5 g), EA-Bd,(0.8 g), EA-Be (0.8 g), EA-Bf (0.5 g), EA-Bg (0.4 g), EA-Bh (0.2 g)의 바이러스의 게놈 복제율과 간세포의 생존률을 10 μg/ml의 농도에서 측정하였고, 그 결과를 도 17에 나타내었다. 도 17에 나타낸 바와 같이, EA-Bd, EA-Be, EA-Bf, EA-Bg, 그리고 EA-Bh 분획에서 가장 효율적으로 세포의 생존률에는 영향을 주지 않는 동시에 C형 간염 바이러스의 게놈 복제를 효과적으로 저해하는 것을 확인할 수 있었다.
다음으로, 상기 3-1에 의해 준비된 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 사용하여 상기 3-2의 방법을 통해 포도근의 EA-B 추출물을 분획하여 얻은 EA-Bd, EA-Be, EA-Bf, EA-Bg, EA-Bh의 바이러스의 게놈 복제율과 간세포의 생존률을 측정하였고, 그 결과를 도 18에 나타내었다. 도 18에 나타낸 바와 같이, 모든 분획에서 가장 효율적으로 세포의 생존률에는 영향을 주지 않는 동시에 C형 간염 바이러스의 게놈 복제를 효과적으로 저해하는 것을 확인할 수 있었다.
3-4. 레스베라트롤(resveratrol) 다량체의 C형 간염 바이러스의 게놈 복제 저해 활성 측정
상기 실시예 1에서 포도근의 EA-B 추출물을 high-performance countercurrent chromatography를 통해 분리한 단일 화합물 Ampelopsin A의 구조를 동정하였고, 상기 3-1에 의해 준비된 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 사용하여 상기 3-2의 방법을 통해 Ampelopsin A의 바이러스의 게놈 복제율과 간세포의 생존률을 측정하였고, 그 결과를 도 19에 나타내었다. 도 19에 나타낸 바와 같이, Ampelopsin A가 효율적으로 세포의 생존률에는 영향을 주지 않는 동시에 C형 간염 바이러스의 게놈 복제를 효과적으로 저해하는 것을 확인할 수 있었다.
다음으로, 실시예 1에서 포도근의 EA-B 추출물을 high-performance countercurrent chromatography를 통해 분리한 단일 화합물 ε-viniferin의 구조를 동정하였고, 상기 3-1에 의해 준비된 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 사용하여 상기 3-2의 방법을 통해 ε-viniferin의 바이러스의 게놈 복제율과 간세포의 생존률을 측정하였고, 그 결과를 도 20에 나타내었다. 도 20에 나타낸 바와 같이, ε-viniferin가 효율적으로 세포의 생존률에는 영향을 주지 않는 동시에 C형 간염 바이러스의 게놈 복제를 효과적으로 저해하는 것을 확인할 수 있었다.
다음으로, 실시예 1에서 포도근의 EA-B 추출물을 high-performance countercurrent chromatography를 통해 분리한 단일 화합물 Wilsonol C의 구조를 동정하였고, 상기 3-1에 의해 준비된 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 사용하여 상기 3-2의 방법을 통해 Wilsonol C의 바이러스의 게놈 복제율과 간세포의 생존률을 측정하였고, 그 결과를 도 21에 나타내었다. 도 21에 나타낸 바와 같이, Wilsonol C가 효율적으로 세포의 생존률에는 영향을 주지 않는 동시에 C형 간염 바이러스의 게놈 복제를 효과적으로 저해하는 것을 확인할 수 있었다.
다음으로, 실시예 1에서 포도근의 EA-B 추출물을 high-performance countercurrent chromatography를 통해 분리한 단일 화합물 Vitisin A의 구조를 동정하였고, 상기 3-1에 의해 준비된 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 사용하여 상기 3-2의 방법을 통해 Vitisin A의 바이러스의 게놈 복제율과 간세포의 생존률을 측정하였고, 그 결과를 도 22에 나타내었다. 도 22에 나타낸 바와 같이, Vitisin A가 효율적으로 세포의 생존률에는 영향을 주지 않는 동시에 C형 간염 바이러스의 게놈 복제를 효과적으로 저해하는 것을 확인할 수 있었다.
다음으로, 실시예 1에서 포도근의 EA-B 추출물을 high-performance countercurrent chromatography를 통해 분리한 단일 화합물 Vitisin B의 구조를 동정하였고, 상기 3-1에 의해 준비된 HCV 레플리콘 (HCV replicon FL-J6/JFH-5C19Rluc2AUbi) 리포터 바이러스를 사용하여 상기 3-2의 방법을 통해 Vitisin B의 바이러스의 게놈 복제율과 간세포의 생존률을 측정하였고, 그 결과를 도 23에 나타내었다. 도 23에 나타낸 바와 같이, Vitisin B가 효율적으로 세포의 생존률에는 영향을 주지 않는 동시에 C형 간염 바이러스의 게놈 복제를 효과적으로 저해하는 것을 확인할 수 있었다.
추가적으로, Vitisin B의 바이러스의 게놈 복제율과 간세포의 생존률을 500 nM의 농도에서 72시간 동안 측정하였고, 그 결과를 도 24에 나타내었다. 도 24에 나타낸 바와 같이, Vitisin B가 효율적으로 세포의 생존률에는 영향을 주지 않는 동시에 C형 간염 바이러스의 게놈 복제를 효과적으로 저해하는 것을 확인할 수 있었다.
3-5. C형 간염 바이러스의 게놈 복제를 측정하기 위한 리플리콘 바이러스의 준비
C형 간염 바이러스의 게놈 복제를 측정하기 위해 유전형 (genotype 1b)에 속하는 서브지노믹 레플리콘 (subgenomic HCV replicon, Bart79I)와 유전형(genotype) 2a에 속하는 풀지놈믹 레플리콘 (full genomic HCV replicon, J6/JFH1)을 사용하였다. 상기 리플리콘 바이러스의 게놈 구조도는 각각 도 25 및 도 26에 나타내었다.
도 25 및 도 26에 나타낸 바와 같이, 상기 리플리콘 바이러스는 C형 간염 바이러스의 부분 혹은 전체 게놈이 cDNA 상태로 포함되어 있다. 상기 리플리콘 플라스미드를 T7 RNA 중합효소(polymerase)를 사용하여 시험관 상 (in-vitro)에서 전사 (transcription)하여 얻은 HCV RNA를 간암 세포주인 Huh7.5 세포에 주입 (transfection)하면, 주입된 바이러스의 RNA가 내부 리보솜 진입 위치(IRES)를 사용한 번역을 통해서 다중단백질(polyprotein)을 생산한다. 이때 생산된 다중단백질이 비구조 단백질로 분리되고 발현된 비구조 단백질들이 바이러스의 게놈을 복제함으로써 간세포내에서 바이러스가 복제되는 리플리콘 세포를 만들 수 있다.
3-6. Real time PCR을 통한 C형 간염 바이러스 게놈 복제 저해 활성 측정
3 X 105 세포(Huh7.5-J6/JFH1 or Bart79I)를 6-well plate에 분획한 후 다양한 농도 (1 pM - 10 μM)의 Vitisin B를 상기 HCV 리플리콘 세포에 처리하고 72시간 동안 배양하였다.
상기 Vitisin B를 처리한 세포의 배양액을 버리고 PBS로 세포가 부착되어 있는 웰을 세척한 다음 total RNA isolation kit를 사용하여 세포 내 total RNA를 분리한 후 reverse transcriptase를 사용해서 cDNA를 합성한 후 합성된 cDNA를 HCV 바이러스에 특이적인 프라이머를 사용해서 real time으로 PCR했을 때 얻어지는 Ct 값을 계산하여 바이러스 RNA를 정량할 수 있었다. 이때 사용한 프라이머는 하기 표 4에 나타내었다.
표 4
primer sequence(5' - 3')
FW RV
J6/JFH1 CTCCGCCATGAATCACTC(서열번호 1) ACGACACTCATACTAACGC(서열번호 2)
Bart79I AGAGCCATAGTGGTCT(서열번호 3) CCAAATCTCCAGGCATTGAGC(서열번호 4)
GAPDH TGGTCTCCTCTGACTTCA(서열번호 5) CGTTGTCATACCAGGAAATG(서열번호 6)
시간 반응 곡선의 경우 10 mM의 화합물을 처리한 후 24, 48, 72 시간 후 남아 있는 HCV의 양을 real time PCR로 측정하였다.
즉, 실시예 1에서 포도근의 EA-B 추출물을 high-performance countercurrent chromatography를 통해 분리한 단일 화합물 Vitisin B의 농도별 및 처리시간에 따른 C형 간염 바이러스의 RNA 게놈 복제에 미치는 영향을 HCV 서브지노믹 리플리콘 (subgenomic replicon) Bart79I의 게놈의 real time PCR 정량법을 사용하여 확인하였고, 그 결과를 도 27 및 도 28에 나타내었다. 도 27 및 도 28에 나타낸 바와 같이, Vitisin B의 농도가 증가하거나 처리시간이 경과함에 따라 C형 간염 바이러스의 게놈 복제를 효과적으로 저해하는 것을 확인할 수 있었다.
추가적으로, Vitisin B이 약물의 농도가 증가함에 따라 C형 간염 바이러스의 RNA 게놈 복제에 미치는 영향을 HCV 풀지놈믹 리플리콘 (full genomic replicon) J6/JFH1 (genotype 2a)의 real time PCR을 통해 정량하였고, 그 결과를 도 29에 나타내었다. 도 29에 나타내 바와 같이, Vitisin B가 C형 간염 바이러스의 게놈 복제를 효과적으로 저해하는 것을 확인할 수 있었다.
3-7. FACS를 통한 C형 간염 바이러스 게놈 복제 저해 활성 측정
상기 실험에서 확인한 생약 추출물들과 생약 추출물에서 동정한 화합물들의 C형 간염 바이러스 게놈 복제 저해 활성이 C형 간염 바이러스의 단백질 발현 저해로 나타나는지의 여부를 확인하기 위하여, 하기와 같은 실험을 수행하였다.
먼저, 도 30에 나타낸 유전형 1b C형 간염 바이러스의 서브지노믹 레플리콘 (subgenomic replicon)인 Bart79I에 GFP가 삽입되어 있는 HCV 서브지노믹 리플리콘을 사용하여, 생약 추출물들 또는 생약 추출물에서 동정한 화합물들을 투여 시 C형 간염 바이러스의 단백질 발현 정도를 확인하기 위하여, 바이러스의 게놈에서 발현되는 GFP(녹색형광단백질)의 형광의 양을 FACS(형광세포분석기)를 통해 측정하였다.
보다 구체적으로, Vitisin B가 농도가 증가함에 따라 C형 간염 바이러스의 단백질 발현에 미치는 영향을 도 30에서 설명한 GFP가 tagging된 서브지노믹 리플리콘 (subgenomic replicon) Bart79I-NS5A-GFP이 들어간 간세포에서 발현하는 녹색 형광의 양을 FACS (fluorsecence assorted cell sorter)를 사용해서 측정하였고, 그 결과를 도 31에 나타내었다. 도 31에 나타낸 바와 같이, Vitisin B가 농도가 증가함에 따라 C형 간염 바이러스의 게놈 복제를 효과적으로 저해되는 것을 확인할 수 있었다.
추가적으로, Vitisin B가 500 nM에서 처리한 시간이 경과함에 따라 C형 간염 바이러스의 단백질 발현에 미치는 영향을 도 30에서 설명한 GFP가 tagging된 서브지노믹 리플리콘 (subgenomic replicon) Bart79I-NS5A-GFP이 들어간 간세포에서 발현하는 녹색 형광의 양을 FACS (fluorsecence assorted cell sorter)를 사용해서 측정하였고, 그 결과를 32에 나타내었다. 도 32에 나타낸 바와 같이, Vitisin B 처리시간에 따라 C형 간염 바이러스의 게놈 복제가 효과적으로 저해되는 것을 확인할 수 있었다.
3-8. Western blot을 통한 C형 간염 바이러스 게놈 복제 저해 활성 측정
1.5 X 105 세포(Huh7.5-J6/JFH1 or Bart79I)를 6-well plate (Costar 3610) 에 배양한 후 DMSO 또는 추출물에서 분리된 화합물들과 함께 배양했다. 배양 5일 후 whole-cell extracts을 RIPA buffer (150 mM NaCl, 1 % Triton X-100, 1 % deoxicholic acid sodium salt, 0.1 % sodium dodecyl sulfate, 50 mM Tris-HCl, pH 7.5, 2 mM EDTA; genDEPOT, protease inhibitors)을 이용해 추출하고 Bradford assay로 정량했다. 같은 양의 단백질을 SDS-polyacrylamide gel에 전기영동 후 polyvinylidene difluoride membrane에 transfer했다. NS5A와 core에 대한 일차 항체를 붙인 후 Horseradish peroxidase가 붙어 있는 이차 항체를 이용해 단백질의 양을 상대적으로 정량했다.
보다 구체적으로, Vitisin B가 농도가 증가함에 따라 C형 간염 바이러스의 단백질 발현에 미치는 영향을 도 19에서 설명한 HCV 서브지노믹 리플리콘 (subgenomic replicon) Bart79I의 게놈에서 발현되는 NS5A 단백질의 양과 간세포의 control 단백질인 beta actin 단백질을 western blot을 사용해서 측정하였고, 그 결과를 도 33에 나타내었다. 도 33에 나타낸 바와 같이, vitisin B의 농도 의존적으로 바이러스 NS5A 단백질이 효과적으로 감소함을 확인할 수 있었다.
또한, Vitisin B를 500 nM의 농도에서 처리한 시간이 경과함에 따라 C형 간염 바이러스의 단백질 발현에 미치는 영향을 도 19에서 설명한 HCV 서브지노믹 리플리콘 (subgenomic replicon) Bart79I의 게놈에서 발현되는 NS5A 단백질의 양과 간세포의 control 단백질인 beta actin 단백질을 western blot을 사용해서 측정하였고, 그 결과를 도 34에 나타내었다. 도 34에 나타낸 바와 같이, 시간이 지남에 따라서 바이러스 NS5A 단백질이 효과적으로 감소함을 확인할 수 있었다.
추가적으로, Vitisin B가 농도가 증가함에 따라 C형 간염 바이러스의 단백질 발현에 미치는 영향을 도 26에서 설명한 HCV 풀지놈믹 리플리콘 (full genomic replicon) J6/JFH1 (genotype 2a) 게놈에서 발현되는 core 단백질의 양과 간세포의 control 단백질인 beta actin 단백질을 western blot을 사용해서 측정하였고, 그 결과를 도 35에 나타내었다. 도 35에 나타낸 바와 같이, 농도의존적으로 바이러스 core 단백질이 효과적으로 감소함을 확인할 수 있었다.
하기에 본 발명의 추출물을 포함하는 약학적 조성물의 제조예를 설명하나, 본 발명은 이를 한정하고자 함이 아닌 단지 구체적으로 설명하고자 함이다.
제제예 1. 약학적 조성물의 제조
1-1. 산제의 제조
올리고스틸벤 화합물 20 mg
유당 100 mg
탈크 10 mg
상기의 성분들을 혼합하고 기밀포에 충진하여 산제를 제조한다.
1-2. 정제의 제조
올리고스틸벤 화합물 10 mg
옥수수전분 100 mg
유당 100 mg
스테아린산 마그네슘 2 mg
상기의 성분들을 혼합한 후 통상의 정제의 제조방법에 따라서 타정하여 정제를 제조한다.
1-3. 캡슐제의 제조
올리고스틸벤 화합물 10 mg
결정성 셀룰로오스 3 mg
락토오스 14.8 mg
마그네슘 스테아레이트 0.2 mg
통상의 캡슐제 제조방법에 따라 상기의 성분을 혼합하고 젤라틴 캡슐에 충전하여 캡슐제를 제조한다.
1-4. 주사제의 제조
올리고스틸벤 화합물 10 mg
만니톨 180 mg
주사용 멸균 증류수 2974 mg
Na2HPO42H2O 26 mg
통상의 주사제의 제조방법에 따라 1 앰플당 (2 ml) 상기의 성분 함량으로 제조한다.
1-5. 액제의 제조
올리고스틸벤 화합물 20 mg
이성화당 10 g
만니톨 5 g
정제수 적량
통상의 액제의 제조방법에 따라 정제수에 각각의 성분을 가하여 용해시키고 레몬향을 적량 가한 다음 상기의 성분을 혼합한 다음 정제수를 가하여 전체를 정제수를 가하여 전체 100 ml로 조절한 후 갈색병에 충진하여 멸균시켜 액제를 제조한다.
제제예 2. 식품 조성물의 제조
2-1. 건강식품의 제조
올리고스틸벤 화합물 100 mg
비타민 혼합물 적량
비타민 A 아세테이트 70 μg
비타민 E 1.0 mg
비타민 B1 0.13 mg
비타민 B2 0.15 mg
비타민 B6 0.5 mg
비타민 B12 0.2 μg
비타민 C 10 mg
비오틴 10 μg
니코틴산아미드 1.7 mg
엽산 50 μg
판토텐산 칼슘 0.5 mg
무기질 혼합물 적량
황산제1철 1.75 mg
산화아연 0.82 mg
탄산마그네슘 25.3 mg
제1인산칼륨 15 mg
제2인산칼슘 55 mg
구연산칼륨 90 mg
탄산칼슘 100 mg
염화마그네슘 24.8 mg
상기의 비타민 및 미네랄 혼합물의 조성비는 비교적 건강식품에 적합한 성분을 바람직한 실시예로 혼합 조성하였지만, 그 배합비를 임의로 변형 실시하여도 무방하며, 통상의 건강식품 제조방법에 따라 상기의 성분을 혼합한 다음, 과립을 제조하고, 통상의 방법에 따라 건강식품 조성물 제조에 사용할 수 있다.
2-2. 건강음료의 제조
올리고스틸벤 화합물 100 mg
비타민 C 15 g
비타민 E(분말) 100 g
젖산철 19.75 g
산화아연 3.5 g
니코틴산아미드 3.5 g
비타민 A 0.2 g
비타민 B1 0.25 g
비타민 B2 0.3 g
물 정량
통상의 건강음료 제조방법에 따라 상기의 성분을 혼합한 다음, 약 1시간 동안 85℃에서 교반 가열한 후, 만들어진 용액을 여과하여 멸균된 2 l 용기에 취득하여 밀봉 멸균한 뒤 냉장 보관한 다음 본 발명의 건강음료 조성물 제조에 사용한다.
상기 조성비는 비교적 기호음료에 적합한 성분을 바람직한 실시예로 혼합 조성하였지만 수요계층이나, 수요국가, 사용용도 등 지역적, 민족적 기호도에 따라서 그 배합비를 임의로 변형 실시하여도 무방하다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명에 따른 레스베라트롤(resveratrol) 다량체는 C형 간염을 예방, 개선 또는 치료하기 위한 약학적 조성물 또는 기능성 식품 조성물의 활성성분으로 유용하게 사용될 수 있을 것으로 기대된다.

Claims (13)

  1. 하기 화학식 1로 표시되는 C형 간염 바이러스의 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤(resveratrol) 이량체.
    [화학식 1]
    Figure PCTKR2015001577-appb-I000084
    상기 식에서, R1은
    Figure PCTKR2015001577-appb-I000085
    ,
    Figure PCTKR2015001577-appb-I000086
    또는
    Figure PCTKR2015001577-appb-I000087
    이고,
    R2, R3은 서로 같거나 다른 것으로, H 또는 OH이고,
    R1의 탄소는 a 위치의 탄소와 결합하여 환을 형성할 수 있으며,
    Figure PCTKR2015001577-appb-I000088
    는 단일 또는 이중 결합을 나타낸다.
  2. 하기 화학식 2로 표시되는 C형 간염 바이러스의 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤(resveratrol) 삼량체.
    [화학식 2]
    Figure PCTKR2015001577-appb-I000089
    상기 식에서, R1은
    Figure PCTKR2015001577-appb-I000090
    ,
    Figure PCTKR2015001577-appb-I000091
    또는
    Figure PCTKR2015001577-appb-I000092
    이고,
    R2, R3은 서로 같거나 다른 것으로, H 또는 OH이고,
    R4는 H이며,
    R1의 탄소는 a 위치 및/또는 b 위치의 탄소와 결합하여 환을 형성할 수 있고,
    OR4는 b 위치의 탄소와 결합하여 환을 형성할 수 있으며,
    Figure PCTKR2015001577-appb-I000093
    는 단일 또는 이중 결합을 나타낸다.
  3. 하기 화학식 3으로 표시되는 C형 간염 바이러스의 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤(resveratrol) 사량체.
    [화학식 3]
    Figure PCTKR2015001577-appb-I000094
    상기 식에서, R1은
    Figure PCTKR2015001577-appb-I000095
    ,
    Figure PCTKR2015001577-appb-I000096
    또는
    Figure PCTKR2015001577-appb-I000097
    이고,
    R2, R3, R6, R8은 서로 같거나 다른 것으로, H 또는 OH이며,
    R5는 H이고,
    R7은
    Figure PCTKR2015001577-appb-I000098
    이며,
    R1의 탄소는 a 위치의 탄소와 결합하여 환을 형성할 수 있고,
    R7의 d위치의 탄소는 OR5와 결합하여 5원환을 형성하거나, c위치의 탄소와 결합하여 7원환을 형성할 수 있으며,
    Figure PCTKR2015001577-appb-I000099
    는 단일 또는 이중 결합을 나타낸다.
  4. 제1항에 있어서,
    상기 레스베라트롤(resveratrol) 이량체는 하기 화학식 4 내지 화학식 10으로 표시되는 화합물로 이루어진 군으로부터 선택되는 것을 특징으로 하는, 레스베라트롤(resveratrol) 이량체.
    [화학식 4]
    Figure PCTKR2015001577-appb-I000100
    [화학식 5]
    Figure PCTKR2015001577-appb-I000101
    [화학식 6]
    Figure PCTKR2015001577-appb-I000102
    [화학식 7]
    Figure PCTKR2015001577-appb-I000103
    [화학식 8]
    Figure PCTKR2015001577-appb-I000104
    [화학식 9]
    Figure PCTKR2015001577-appb-I000105
    [화학식 10]
    Figure PCTKR2015001577-appb-I000106
  5. 제4항에 있어서,
    상기 레스베라트롤(resveratrol) 이량체는 하기 화학식 4 또는 화학식 5로 표시되는 화합물인 것을 특징으로 하는, 레스베라트롤(resveratrol) 이량체.
    [화학식 4]
    Figure PCTKR2015001577-appb-I000107
    [화학식 5]
    Figure PCTKR2015001577-appb-I000108
  6. 제2항에 있어서,
    상기 레스베라트롤(resveratrol) 삼량체는 하기 화학식 11 내지 화학식 17로 표시되는 화합물로 이루어진 군으로부터 선택되는 것을 특징으로 하는, 레스베라트롤(resveratrol) 삼량체.
    [화학식 11]
    Figure PCTKR2015001577-appb-I000109
    [화학식 12]
    Figure PCTKR2015001577-appb-I000110
    [화학식 13]
    Figure PCTKR2015001577-appb-I000111
    [화학식 14]
    Figure PCTKR2015001577-appb-I000112
    [화학식 15]
    Figure PCTKR2015001577-appb-I000113
    [화학식 16]
    Figure PCTKR2015001577-appb-I000114
    [화학식 17]
    Figure PCTKR2015001577-appb-I000115
  7. 제3항에 있어서,
    상기 레스베라트롤(resveratrol) 사량체는 하기 화학식 18 내지 화학식 26으로 표시되는 화합물로 이루어진 군으로부터 선택되는 것을 특징으로 하는, 레스베라트롤(resveratrol) 사량체.
    [화학식 18]
    Figure PCTKR2015001577-appb-I000116
    [화학식 19]
    Figure PCTKR2015001577-appb-I000117
    [화학식 20]
    Figure PCTKR2015001577-appb-I000118
    [화학식 21]
    Figure PCTKR2015001577-appb-I000119
    [화학식 22]
    Figure PCTKR2015001577-appb-I000120
    [화학식 23]
    Figure PCTKR2015001577-appb-I000121
    [화학식 24]
    Figure PCTKR2015001577-appb-I000122
    [화학식 25]
    Figure PCTKR2015001577-appb-I000123
    [화학식 26]
    Figure PCTKR2015001577-appb-I000124
  8. 제7항에 있어서,
    상기 레스베라트롤(resveratrol) 사량체는 하기 화학식 18 내지 화학식 20으로 표시되는 화합물로 이루어진 군으로부터 선택되는 것을 특징으로 하는, 레스베라트롤(resveratrol) 사량체.
    [화학식 18]
    Figure PCTKR2015001577-appb-I000125
    [화학식 19]
    Figure PCTKR2015001577-appb-I000126
    [화학식 20]
    Figure PCTKR2015001577-appb-I000127
  9. 하기 화학식 1 내지 화학식 3으로 표시되는 레스베라트롤(resveratrol) 다량체로 구성된 군으로부터 선택되는 하나 이상의 화합물을 유효성분으로 포함하는 C형 간염의 예방 또는 치료용 약학적 조성물.
    [화학식 1]
    Figure PCTKR2015001577-appb-I000128
    상기 화학식 1에서, R1은
    Figure PCTKR2015001577-appb-I000129
    ,
    Figure PCTKR2015001577-appb-I000130
    또는
    Figure PCTKR2015001577-appb-I000131
    이고,
    R2, R3은 서로 같거나 다른 것으로, H 또는 OH이고,
    R1의 탄소는 a 위치의 탄소와 결합하여 환을 형성할 수 있으며,
    Figure PCTKR2015001577-appb-I000132
    는 단일 또는 이중 결합을 나타낸다.
    [화학식 2]
    Figure PCTKR2015001577-appb-I000133
    상기 화학식 2에서, R1은
    Figure PCTKR2015001577-appb-I000134
    ,
    Figure PCTKR2015001577-appb-I000135
    또는
    Figure PCTKR2015001577-appb-I000136
    이고,
    R2, R3은 서로 같거나 다른 것으로, H 또는 OH이고,
    R4는 H이며,
    R1의 탄소는 a 위치 및/또는 b 위치의 탄소와 결합하여 환을 형성할 수 있고,
    OR4는 b 위치의 탄소와 결합하여 환을 형성할 수 있으며,
    Figure PCTKR2015001577-appb-I000137
    는 단일 또는 이중 결합을 나타낸다.
    [화학식 3]
    Figure PCTKR2015001577-appb-I000138
    상기 화학식 3에서, R1은
    Figure PCTKR2015001577-appb-I000139
    ,
    Figure PCTKR2015001577-appb-I000140
    또는
    Figure PCTKR2015001577-appb-I000141
    이고,
    R2, R3, R6, R8은 서로 같거나 다른 것으로, H 또는 OH이며,
    R5는 H이고,
    R7은
    Figure PCTKR2015001577-appb-I000142
    이며,
    R1의 탄소는 a 위치의 탄소와 결합하여 환을 형성할 수 있고,
    R7의 d위치의 탄소는 OR5와 결합하여 5원환을 형성하거나, c위치의 탄소와 결합하여 7원환을 형성할 수 있으며,
    Figure PCTKR2015001577-appb-I000143
    는 단일 또는 이중 결합을 나타낸다.
  10. 제9항에 있어서, 상기 레스베라트롤(resveratrol) 다량체는 C형 간염 바이러스의 RNA 게놈 복제의 선택적 저해 활성을 갖는 것을 특징으로 하는, 약학적 조성물.
  11. 하기 화학식 1 내지 화학식 3으로 표시되는 레스베라트롤(resveratrol) 다량체로 구성된 군으로부터 선택되는 하나 이상의 화합물을 유효성분으로 포함하는 C형 간염의 예방 또는 개선용 건강기능 식품 조성물.
    [화학식 1]
    Figure PCTKR2015001577-appb-I000144
    상기 화학식 1에서, R1은
    Figure PCTKR2015001577-appb-I000145
    ,
    Figure PCTKR2015001577-appb-I000146
    또는
    Figure PCTKR2015001577-appb-I000147
    이고,
    R2, R3은 서로 같거나 다른 것으로, H 또는 OH이고,
    R1의 탄소는 a 위치의 탄소와 결합하여 환을 형성할 수 있으며,
    Figure PCTKR2015001577-appb-I000148
    는 단일 또는 이중 결합을 나타낸다.
    [화학식 2]
    Figure PCTKR2015001577-appb-I000149
    상기 화학식 2에서, R1은
    Figure PCTKR2015001577-appb-I000150
    ,
    Figure PCTKR2015001577-appb-I000151
    또는
    Figure PCTKR2015001577-appb-I000152
    이고,
    R2, R3은 서로 같거나 다른 것으로, H 또는 OH이고,
    R4는 H이며,
    R1의 탄소는 a 위치 및/또는 b 위치의 탄소와 결합하여 환을 형성할 수 있고,
    OR4는 b 위치의 탄소와 결합하여 환을 형성할 수 있으며,
    Figure PCTKR2015001577-appb-I000153
    는 단일 또는 이중 결합을 나타낸다.
    [화학식 3]
    Figure PCTKR2015001577-appb-I000154
    상기 화학식 3에서, R1은
    Figure PCTKR2015001577-appb-I000155
    ,
    Figure PCTKR2015001577-appb-I000156
    또는
    Figure PCTKR2015001577-appb-I000157
    이고,
    R2, R3, R6, R8은 서로 같거나 다른 것으로, H 또는 OH이며,
    R5는 H이고,
    R7은
    Figure PCTKR2015001577-appb-I000158
    이며,
    R1의 탄소는 a 위치의 탄소와 결합하여 환을 형성할 수 있고,
    R7의 d위치의 탄소는 OR5와 결합하여 5원환을 형성하거나, c위치의 탄소와 결합하여 7원환을 형성할 수 있으며,
    Figure PCTKR2015001577-appb-I000159
    는 단일 또는 이중 결합을 나타낸다.
  12. 제9항에 따른 약학적 조성물을 개체에 투여하는 단계를 포함하는 C형 간염의 예방 또는 치료 방법.
  13. 제9항에 따른 약학적 조성물의 C형 간염의 예방 또는 치료 용도.
PCT/KR2015/001577 2014-02-18 2015-02-16 C형 간염 바이러스의 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤 다량체 및 이의 용도 Ceased WO2015126129A2 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2014-0018552 2014-02-18
KR1020140018552A KR101584885B1 (ko) 2014-02-18 2014-02-18 C형 간염 바이러스의 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤 다량체 및 이의 용도

Publications (2)

Publication Number Publication Date
WO2015126129A2 true WO2015126129A2 (ko) 2015-08-27
WO2015126129A3 WO2015126129A3 (ko) 2017-05-18

Family

ID=53879194

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/001577 Ceased WO2015126129A2 (ko) 2014-02-18 2015-02-16 C형 간염 바이러스의 게놈 복제의 선택적 저해 활성을 갖는 레스베라트롤 다량체 및 이의 용도

Country Status (2)

Country Link
KR (1) KR101584885B1 (ko)
WO (1) WO2015126129A2 (ko)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109897021A (zh) * 2017-12-07 2019-06-18 中国医学科学院药物研究所 葡萄藤戊素衍生物、其制法以及药物组合物与用途
CN110433152A (zh) * 2018-05-03 2019-11-12 中国医学科学院药物研究所 一类葡萄藤戊素衍生物在制备治疗肝脏相关疾病药物中的应用
CN110433153A (zh) * 2018-05-03 2019-11-12 中国医学科学院药物研究所 一类Amurensin H衍生物在治疗和预防肝脏相关疾病中的应用
WO2024018018A1 (fr) 2022-07-21 2024-01-25 Etablissement Francais Du Sang Utilisation d'un composé vitisine pour la production de cellules hématopoïétiques

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20210169113A1 (en) * 2018-10-04 2021-06-10 Hosoda Shc Co., Ltd. Composition for improving intestinal flora

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100447608B1 (ko) * 2001-06-12 2004-09-07 김종성 작약씨로부터 항암 및 항돌연변이성 트란스-레즈베라트롤및 그 유도체의 추출방법
CN100584837C (zh) * 2003-10-21 2010-01-27 复旦大学 羟基茋类化合物及其制备方法和应用

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109897021A (zh) * 2017-12-07 2019-06-18 中国医学科学院药物研究所 葡萄藤戊素衍生物、其制法以及药物组合物与用途
CN109897021B (zh) * 2017-12-07 2021-09-14 中国医学科学院药物研究所 葡萄藤戊素衍生物、其制法以及药物组合物与用途
CN110433152A (zh) * 2018-05-03 2019-11-12 中国医学科学院药物研究所 一类葡萄藤戊素衍生物在制备治疗肝脏相关疾病药物中的应用
CN110433153A (zh) * 2018-05-03 2019-11-12 中国医学科学院药物研究所 一类Amurensin H衍生物在治疗和预防肝脏相关疾病中的应用
WO2024018018A1 (fr) 2022-07-21 2024-01-25 Etablissement Francais Du Sang Utilisation d'un composé vitisine pour la production de cellules hématopoïétiques

Also Published As

Publication number Publication date
WO2015126129A3 (ko) 2017-05-18
KR20150097256A (ko) 2015-08-26
KR101584885B1 (ko) 2016-01-15

Similar Documents

Publication Publication Date Title
WO2011052950A2 (en) Pharmaceutical composition comprising indole compound
WO2018124508A1 (ko) 3,5-디카페오일퀴닉에시드 또는 국화 추출물을 함유하는 근육 질환 예방 및 치료용 또는 근 기능 개선용 조성물
WO2022035115A1 (ko) 오리나무 추출물 또는 이로부터 분리된 화합물을 함유하는 골격근 근육관련 질환의 예방 및 치료용 조성물 및 이의 용도
WO2013180462A1 (en) A composition comprising the extract of pine tree leaf or the compounds isolated therefrom for the prevention and treatment of cancer disease by inhibiting hpv virus and the uses thereby
WO2022196858A1 (ko) 아미노산 유도체, 이의 제조방법 및 이를 포함하는 간염 치료용 약학적 조성물
WO2019168237A1 (ko) 신규 화합물 및 이를 유효성분으로 함유하는 섬유증 또는 비알코올성 지방간염의 예방, 개선 또는 치료용 조성물
WO2017003267A1 (ko) 항바이러스 활성 효능을 가지는 펩티드 및 이를 포함하는 조성물
WO2014175543A1 (ko) 복합 추출물을 포함하는 대장염 예방, 개선 또는 치료용 조성물
WO2017188694A1 (ko) 질소를 포함하는 헤테로아릴 화합물 및 이의 용도
WO2019147089A1 (ko) 칼슘 채널 억제제 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물
WO2012033353A2 (ko) 세스터터핀 화합물 및 이들 물질의 용도
WO2015026172A1 (ko) 세포괴사 저해제로서의 인돌아미드 화합물
WO2023224371A1 (ko) 신규 옥사다이아졸 유도체 화합물 및 이를 포함하는 신경염증성 질환 예방 또는 치료용 약학적 조성물
WO2020085826A1 (ko) 육두구 추출물 또는 메이스리그난을 유효성분으로 함유하는 환경오염인자로부터 유도되는 피부자극 완화 및 피부보호용 조성물
WO2010090498A2 (ko) 이고들빼기 추출물, 이의 분획물 또는 이로부터 분리한 화합물을 유효성분으로 함유하는 간 기능 개선용 약학적 조성물 및 간 기능 개선용 건강기능 식품조성물
WO2012060482A1 (ko) Ｃｄｋ를 저해하는 피롤로피리미디논 카복사미드 유도체 또는 이의 약학적으로 허용가능한 염, 이를 유효성분으로 함유하는 간세포암의 예방 또는 치료용 약학적 조성물
WO2021225363A1 (ko) 해양 유래 진균 페니실리움 글라브룸 sf-7123의 대사체를 포함하는 항염증 또는 항당뇨용 조성물
WO2010041908A2 (ko) 판두라틴 유도체 또는 보에센베르기아 판두라타 추출물의 신규한 용도
WO2020145619A1 (ko) 운데칸 또는 운데칸알을 유효성분으로 포함하는 항알러지, 아토피 피부염 개선, 또는 피부 재생용 조성물
WO2020096416A1 (ko) Yap-tead 결합을 저해하는 화합물 및 이를 유효 성분으로 함유하는 암의 예방 또는 치료용 약제학적 조성물
WO2019194583A1 (ko) 3-페닐-2,8-디히드로피라노[2,3-f]크로멘 유도체 및 이를 포함하는 약학적 조성물
WO2013187696A1 (ko) Ｃ형 간염 바이러스의 게놈 복제의 선택적 저해 활성을 갖는 인돌계 화합물, 이의 제조방법 및 이를 유효성분으로 함유하는 ｃ형 간염의 예방 또는 치료용 약학적 조성물
WO2023038413A1 (ko) 담팔수 추출물, 분획물 또는 이들 유래 페놀화합물을 유효성분으로 포함하는, 인플루엔자 바이러스 감염증 예방, 치료 또는 개선용 조성물
WO2019059687A1 (ko) 플루오렌 유도체 또는 이의 약학적으로 허용가능한 염, 이의 제조방법 및 이를 유효성분으로 포함하는 hcv 관련 질환의 예방 또는 치료용 약학적 조성물
WO2021141439A1 (ko) 커피 실버스킨 추출물, 이의 분획물 또는 이로부터 분리된 화합물을 포함하는 근육질환의 예방 또는 치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15751782

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15751782

Country of ref document: EP

Kind code of ref document: A2