WO2015122570A1 - 비브리오 패혈증균 알티엑스에이-1 단백질에 특이적으로 결합하는 단일클론 항체 및 이의 용도 - Google Patents

비브리오 패혈증균 알티엑스에이-1 단백질에 특이적으로 결합하는 단일클론 항체 및 이의 용도 Download PDF

Info

Publication number
WO2015122570A1
WO2015122570A1 PCT/KR2014/003659 KR2014003659W WO2015122570A1 WO 2015122570 A1 WO2015122570 A1 WO 2015122570A1 KR 2014003659 W KR2014003659 W KR 2014003659W WO 2015122570 A1 WO2015122570 A1 WO 2015122570A1
Authority
WO
WIPO (PCT)
Prior art keywords
rtxal
protein
recombinant
vibrio
monoclonal antibody
Prior art date
Application number
PCT/KR2014/003659
Other languages
English (en)
French (fr)
Inventor
정경민
이준행
우혜련
이태희
Original Assignee
전북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 전북대학교 산학협력단 filed Critical 전북대학교 산학협력단
Publication of WO2015122570A1 publication Critical patent/WO2015122570A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/12—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
    • C07K16/1203—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria
    • C07K16/1239—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria from Vibrionaceae (G)

Definitions

  • Monoclonal antibodies that specifically bind to Vibrio sepsis AltiAX-1 protein and uses thereof
  • the present invention relates to a monoclonal antibody specifically binding to Vibrio septic bacterium Alti X -l (RtxAl) and its use, and more particularly, to a high affinity specific binding ability to Vibrio septic bacterium.
  • Vibrio vulnificus is a basal pathogenic bacterium that lives primarily in the estuary adjacent to the sea and is associated with most of the death-related diseases associated with seafood.
  • vibrio sepsis infections have a relatively short history, they are one of the emerging hot spots in which clinical cases continue to increase globally due to global warming. In particular, global cases are less than cholera and salmonella food poisoning, but high mortality and The tragic clinical symptoms cause serious social problems.
  • Vibrio sepsis bacteremia has a short incubation period and has a mortality rate of over 50% despite various antibiotic treatments. Vibrio sepsis sepsis most commonly occurs in men in their 40s and above (about 90-95%) (more than 90%), rarely seen in normal people, It occurs mainly in patients with underlying diseases. In case of primary sepsis, most patients have chronic diseases such as hepatic disease and drinking wall, and hepatic cirrhosis, chronic hepatitis, liver cancer, etc. Underlying diseases such as chronic osteomyelitis and rheumatoid arthritis have been identified. However, below 5% may not find a specific underlying disease.
  • the present invention has been made to solve the above-mentioned problems, the first problem to be solved by the present invention is the prevention of diseases caused by vibrio sepsis and related infections with high affinity specific binding capacity to vibrio sepsis And it provides a monoclonal antibody excellent in the therapeutic effect and the hybridoma cell line producing the same.
  • a second object of the present invention is to provide a Vibrio sepsis treatment agent, a Vibrio sepsis prevention agent, and a Vibrio sepsis diagnostic kit comprising the monoclonal antibody of the present invention.
  • the present invention provides a hybridoma cell of Accession No. KCLRF-BP-00310 characterized by producing a monoclonal antibody against Vibrio sepsis RtxAl protein.
  • the present invention also provides a monoclonal antibody or antigen-binding fragment thereof against the Vibrio sepsis RtxAl protein produced by hybridoma cells with accession number KCLRF-BP-00310.
  • the monoclonal antibody may specifically bind to the 3491 to 3980 th amino acid sequence region of the RtxAl protein of SEQ ID NO: 4. Furthermore, the present invention provides a vibrio sepsis treatment comprising a monoclonal antibody or antigen-binding fragment thereof.
  • the present invention also provides a vibrio sepsis prevention agent comprising a monoclonal antibody or antigen-binding fragment thereof.
  • the present invention provides a vibrio sepsis diagnostic kit comprising a monoclonal antibody or antigen-binding fragment thereof.
  • the present invention provides a polyclonal antibody comprising the amino acid sequence of SEQ ID NO: 6 and specifically binding to Vibrio sepsis RtxAl protein.
  • the present invention provides a vibrio sepsis treatment agent comprising the amino acid sequence of SEQ ID NO: 6 and comprising a polyclonal antibody that specifically binds to the Vibrio sepsis RtxAl protein.
  • the present invention provides a vibrio sepsis prevention agent comprising the amino acid sequence of SEQ ID NO: 6 and comprising a polyclonal antibody that specifically binds to Vibrio sepsis RtxAl protein.
  • the present invention provides a vibrio sepsis diagnostic kit comprising an amino acid sequence of SEQ ID NO: 6 and comprising a polyclonal antibody that specifically binds to Vibrio sepsis RtxAl protein. ⁇
  • a vibrio sepsis diagnostic kit comprising an amino acid sequence of SEQ ID NO: 6 and comprising a polyclonal antibody that specifically binds to Vibrio sepsis RtxAl protein.
  • Recombinant refers to the cell replicating heterologous nucleic acid or expressing a peptide or protein encoded by the heterologous nucleic acid.
  • Recombinant cells can also express genes found in the cell's original form, but modified genes can be reintroduced into cells by artificial methods.
  • the term "primer" of the present invention means synthetic or natural ligonucleotides.
  • the primer acts as a starting point for the synthesis under conditions in which the synthesis of the primer extension product complementary to the template is induced, i.e. the presence of polymers such as nucleotides and DNA polymerases, and conditions of suitable temperature and pH.
  • the primer is preferably single chain.
  • the primer is deoxyribonucleotide.
  • Primers of the invention can include natural ly occurring dNMP (ie, dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides.
  • the primer may also include ribonucleotides.
  • the ligonucleotides of the present invention may be selected from the group consisting of backbone modified nucleotides such as peptide nucleic acids (PNAXM. Egholm et al. Nature, 365: 566-568 (1993)), phosphorothioate DNA, phosphorothioate DNA, Phosphoramidate DNA, amide-linked DNA, ⁇ I-linked DNA, 2'-0-methyl RNA, alpha -DNA and methylphosphonate DNA, sugar modified nucleotides such as 2'-0- Methyl RNA, 2'-fluoro RNA, 2'-amino RNA, 2'-ealkyl DNA, 2'-0-allyl DNA, 2'-0-alkynyl DNA, nuclear source DNA, pyranosyl RNA and anhydro Nucleotides are DNA, and nucleotides with base modifications such as C-5 substituted pyrimidines (substituents Polo-, bromo-, chloride
  • vector refers to a DNA molecule as a carrier capable of stably transporting a foreign gene into a host cell. To be a useful vector, it must be able to replicate, have a way to enter the host cell, and have a means to detect its presence.
  • the foreign gene herein refers to a sequence encoding the 3491-4701 amino acid region of the Vibrio septic bacterium RtxAl antigen or a sequence added with a poly His-tag sequence to facilitate purification at the end of the sequence.
  • plasmid of the present invention generally refers to a circular DNA molecule formed by operably linked to a vector so that a foreign gene can be expressed in a host cell, but a polyamide has a desired gene. It can be used as a vector to be degraded by specific restriction enzymes and introduce a new gene by gene recombination to produce a plasmid, so that the plasmid and vector are used interchangeably herein and are commonly used in the field of genetic engineering. Those who have the knowledge of God will understand the meaning of the words without their distinction.
  • the term "recombinant Vibrio pneumococcal RtxAl” is defined as "Vibrio septic bacterium RtxAl” or "Vibrio septic bacterium RtxAl with a chain added for convenience of purification" at the N-terminus or C-terminus.
  • Recombinant RtxAl (3491-4701) provides a recombinant RtxAl protein antigen which is very useful for polyclonal antibody production, monoclonal antibody production and vibrio sepsis vaccine production of Vibrio sepsis RtxAl. It also provides a recombinant RtxAl (3491-4701) protein antigen which is very useful for diagnosis using Vibrio sepsis RtxAl, and facilitates mass expression and purification of recombinant RtxAl (3491-4701) protein antigen.
  • the polyclonal antibody to the recombinant RtxAl (3491-4701) protein according to the present invention Due to the high affinity specific binding ability to vibrio sepsis, it can be very useful for rapid, accurate diagnosis, prevention and treatment of vibrio sepsis infection.
  • the recombinant protein RtxAl antigen expressed in E. coli is excellent in sensitivity and specificity, and can be very useful for a diagnostic agent or a diagnostic kit for infection of Vibrio sepsis.
  • the monoclonal antibody produced in the hybridoma cells according to the present invention has a high affinity specific binding ability to Vibrio sepsis, which is very useful for quickly, accurately diagnosing, preventing and treating Vibrio sepsis infection. Can be used.
  • the recombinant protein RtxAl antigen expressed in Escherichia coli is excellent in sensitivity and specificity, and thus may be very useful for a diagnostic agent or diagnostic kit for infection of Vibrio sepsis.
  • the monoclonal antibody of the present invention can be effectively used as a vibrio sepsis treatment agent because of its excellent anti-infective effect against Vibrio sepsis, prevention and treatment of Vibrio sepsis infection, and excellent survival and vaccine effect after vibrio sepsis infection. Can be.
  • 1 is a cleavage map of a recombinant RtxAl (3491-4701) expression vector into which recombinant RtxAl (3491-4701) is introduced.
  • FIG. 4 is a diagram schematically showing a recombinant RtxAl (3491-4701) fragment protein expressed in transformed Escherichia coli.
  • Figure 6 shows the results of electrophoresis analyzing the specificity of the expressed recombinant RtxAl (3491-4701) fragment protein by immunoblot.
  • Lane 1 control recombinant protein
  • lane 2 recombinant RtxAl (3491-4701) protein
  • lane 3 recombinant RtxAl (349l-4380) protein
  • lane 4 recombinant RtxAl (3491-3980) protein
  • FIG. 7 is a diagram schematically showing a site where three groups of monoclonal antibodies bind to RtxAl (3491-4701).
  • FIG. 8 shows the results of a competitive binding assay of monoclonal antibodies (13RA, 21RA, 24RA, 47RA) and 10RA and Biot in condensation 47RA used in Example 24 to investigate a therapeutic effect against Vibrio sepsis.
  • the result graph is shown.
  • FIG. 9 is a graph showing the vaccine effect against recombinant RtxAl (3491-4701) protein.
  • RtxAl-C and GST shown in solid and dashed lines were immunized with RtxAl (3491-4701) and GST protein, respectively. Means.
  • RtxAl-C and GST shown in squares and circles represent groups immunized with RtxAl (3491-4701) and GST proteins, respectively.
  • FIG. 11 is a graph showing the results of survival of experimental animals showing the prevention effect of polyclonal antibody against Vibrio sepsis infection of recombinant RtxAK3491-4701) protein.
  • the a -RtxAl-C and ⁇ -GST indicated by solid and dashed lines refer to the group administered with polyclonal antibodies of RtxAl (3491-4701) and GST protein, respectively.
  • FIG. 12 is a graph showing results of survival of experimental animals showing the therapeutic effect of multiclonal antibodies against Vibrio sepsis infection of recombinant RtxAl (3491-4701) protein.
  • the a-RtxAl-C and a -GST indicated by the straight line and the dotted line indicate the group to which the polyclonal antibody of RtxA 1 (3491-4701) and GST protein was administered, respectively.
  • FIG. 13 is a graph showing the preventive effect of monoclonal antibody against Vibrio sepsis infection on recombinant RtxAl (3491-4701) protein.
  • Figure 14 is a graph showing the long-term preventive effect of the monoclonal antibody against Vibrio sepsis infection of the recombinant RtxAU 3491-4701) protein as the survival of the experimental animal.
  • FIG. 15 is a graph showing the results of survival of experimental animals showing the inhibitory effect on vibrio sepsis infection according to the dose of monoclonal antibody to recombinant RtxAl (3491-4701) protein.
  • FIG. 16 is a graph showing results of survival of experimental animals showing the therapeutic effect of monoclonal antibody against Vibrio sepsis infection of recombinant RtxAl (3491-4701) protein.
  • the problem described above by providing a hybridoma cell with accession number KCLRF-BP-00310 characterized in that to produce a monoclonal antibody against Vibrio sepsis RtxAl protein Sought solution.
  • the present invention was determined to be a specific toxin antigen diverged early in Vibrio infection.
  • E. coli-expressing recombinant RtxAl (3491-4701) for the C-terminal region of RtxAl was immunized to the mouse, and the splenocytes of the immunized mouse and P3X63Ag8.653, a B-lymphoblast, were fused.
  • Hybridoma cells were prepared from which monoclonal antibodies against the Vibrio sepsis RtxAl antigen were produced.
  • the monoclonal antibody according to the present invention showed excellent reaction against Vibrio sepsis RtxAl antigen. This shows that the monoclonal antibody of the present invention is a diagnostic antibody that can be used for various diagnostic methods, such as indirect immunofluorescent antibody, immunoblot method, and enzyme immune antibody method.
  • polyclonal antibody and monoclonal antibody against the recombinant RtxAl (3491-4701) protein of the present invention have excellent mouse survival after infection with Vibrio sepsis as well as inhibitory effect against Vibrio sepsis infection, prevention and treatment against Vibrio sepsis infection. It can be used as a treatment for Vibrio sepsis.
  • sequenceol template represented by SEQ ID NO: 3 encoding the Vibrio septic bacterium RtxAl protein of SEQ ID NO: 4 and selectively amplifying the amino acid site at positions 3491 ⁇ 47 of the amino acid sequence of the Vibrio septic bacterium RtxAl
  • amino acid sequence of the amplified vibrio sepsis RtxAl (SEQ ID NO: 5) encoding the amino acid at position 3491 -4701 or the conventional poly His-tag (6x) to facilitate purification at the end of the sequence.
  • Hybridoma cells secreting monoclonal antibodies of the present invention can be cultured in large quantities in vitro or in vivo.
  • the monoclonal antibodies produced by the hybridoma cells may be used without purification, but in order to obtain the best results, they may be purified with high purity (eg, 95% or more) according to methods well known in the art. It is preferable to use.
  • Such purification techniques include separation from culture medium or ascites fizid using purification methods such as dialysis, salt precipitation, ion exchange chromatography, size exclusion chromatography, affinity chromatography, and the like. Can be.
  • ⁇ 63> A variety of methods commonly used to screen for monoclonal cells that selectively recognize Vibrio sepsis RtxAl protein, such as radioimmunoassay (RIA), enzyme immunosorbent assay (ELISA), and immunofluorescence (Immunoof luorescence). ), Western blotting and flow cytometry, but are not limited thereto.
  • the monoclonal may be selected by enzyme immunosorbent adsorption (ELISA).
  • Each monoclonal antibody produced in 37 hybridoma cells fused using a recombinant RtxAl protein as an immunogen binds to amino acids 3491 -3980 according to the amino acid binding site of RtxAl in Vibrio sepsis.
  • the recombinant RtxAl protein was used as an immunogen and the mass production potential according to isotype among each monoclonal antibody produced in 37 fused hybridoma cells, competitive binding between monoclonal antibodies, and vibrio sepsis infection of monoclonal antibody Recombinant RtxAl (3491-4701) protein monoclonal antibody 21RA with different antibody binding sites, isotype subclasses, and therapeutic effects, respectively. Showed excellent effects.
  • the 21RA was deposited with the Korean Cel l Line Bank under accession number KCLRF-BP-00310 (see Table 1).
  • ⁇ 66> According to another preferred embodiment of the present invention, the problem described above by providing a monoclonal antibody or antigen-binding fragment thereof against the Vibrio sepsis RtxAl protein produced by hybridoma cells having accession number KCLRF-BP-00310 Sought solution.
  • the monoclonal antibody of the present invention specifically binds to Vibrio sepsis RtxAl protein with high affinity.
  • the monoclonal antibody of the present invention may specifically bind to the 3491 to 3980th amino acid sequence region of the RtxAl protein of SEQ ID NO: 4.
  • antibody of the present invention is a specific antibody to Vibrio pneumococcal RtxAl protein, which means not only the complete antibody form but also the antigen-binding fragment of the antibody molecule.
  • a complete antibody is a structure having two full-length light chains and two full-length heavy chains, each of which is linked by a heavy chain and a disulfide bond.
  • the heavy chain constant region has gamma mu ( ⁇ ), alpha ( ⁇ ), delta ( ⁇ ) and epsilon ( ⁇ ) types and subclasses gamma 1 ( ⁇ 1), gamma 2 ( ⁇ 2), gamma 3 ( ⁇ 3), gamma 4 ( ⁇ 4), alpha 1 (alpha 1) and alpha 2 (alpha 2).
  • the constant region of the light chain has kappa ( ⁇ ) and lambda ( ⁇ ) types (Cellular and Molecular Immunology, Wonsiewicz, MJ, Ed., Chapter 45, pp. 41 ⁇ 50, WB Saunders Co. Philadelphia, PA (1991); Nisonoff, A., Introduction to Molecular Immunology, 2nd Ed., Chapter 4, pp. 45-65, sinauer Associates, Inc., Sunderland, MA (1984)).
  • An antigen binding fragment of an antibody molecule means a fragment having an antigen binding function and includes Fab, F (ab '), F (ab') 2 and Fv.
  • Fab in an antibody fragment has one antigen binding site in the structure which has the variable region of a light chain and a heavy chain, the constant region of a light chain, and the 1st constant region (CH1) of a heavy chain.
  • F (ab ') 2 antibodies are produced by disulfide bonds of cysteine residues in the hinge region of Fab'.
  • Double-chain Fv is a non-covalent bond that connects the heavy chain variable region and the light chain variable region, and the single-chain Fv is usually a variable region of the heavy chain and a short chain variable region through a peptide linker. These covalent bonds, or at the C-terminus, may lead to a dimer-like structure, such as double chain F.
  • Such antibody fragments can be obtained using proteolytic enzymes (eg, Restriction cleavage of the entire antibody to papain yields Fab and cleavage with pepsin yields F (ab ') 2 fragments), preferably through genetic recombination techniques.
  • proteolytic enzymes eg, Restriction cleavage of the entire antibody to papain yields Fab and cleavage with pepsin yields F (ab ') 2 fragments
  • the antibody is preferably in the form of one of a group consisting of Fab, F (ab '), F (ab') 2 and Fv or in the form of a complete antibody.
  • the “heavy chain” refers to a variable region domain VH comprising an amino acid sequence having a stratified variable region sequence for imparting specificity to an antigen and a full length heavy chain comprising three constant region domains CHI, CH2 and CH3; It means all fragments thereof.
  • the "light chain” refers to both a full-length light chain and a fragment thereof including a variable region domain VL and a constant region domain CL including an amino acid sequence having a fragmented variable region sequence for imparting specificity to an antigen. do.
  • monoclonal antibody refers to a highly specific antibody directed against a single antigenic site (epitope) as a term known in the art, and usually directed to different epitopes. Unlike polyclonal antibodies comprising different antibodies, monoclonal antibodies are directed against a single epitope on the antigen, which enhances the selectivity and specificity of diagnostic and analytical assays using antigen-antibody binding. has the advantage of, and has the further advantage that is not mass-produced because production by the cultured hybridoma. the easy and contamination by other immunoglobulins.
  • the monoclonal antibody of the present invention is a cell fusion method known in the art
  • hybridoma cells that secrete monoclonal antibodies are made by fusing cancer cells with immune cells from immunologically suitable host animals such as mice injected with antigenic proteins. Fusion of these two cells is known in the art polyethylene glycol
  • the cell line used in the specific examples of the present invention is myeloma cell P3x63Ag8.653.
  • the monoclonal antibody of the present invention binds to an antigen and inhibits or neutralizes its action.
  • Monoclonal antibodies can also bind to antigens, making them more easily eaten by phagocytes.
  • antigen cells to which a monoclonal antibody is bound are more easily killed by natural killer cells (NK cel l), thereby removing the monoclonal antibody through an immune response and the vibrio sepsis that produces the antigen. It is available. Therefore, the antibody alone can be expected to result in the removal and reduction of antigen and vibrio sepsis by the immune response, the antibody of the present invention can be used for the diagnosis or treatment of vibrio sepsis.
  • the functional fragment of an antibody molecule means at least the fragment which has an antigen binding function, and can include Fab, F (ab '), F (ab') 2 , Fv, etc.
  • the above-mentioned monoclonal antibody or antigen-binding fragment thereof is provided, thereby providing a therapeutic agent for Vibrio sepsis.
  • the monoclonal antibody of the present invention exhibits the neutralizing ability of Vibrio sepsis and can be used as a prophylactic and therapeutic composition against Vibrio sepsis infection alone or with a conventional pharmaceutically acceptable carrier.
  • the vibrio sepsis therapeutic agent may be a pharmaceutical composition for the prevention and treatment of Vibrio sepsis infection comprising the monoclonal antibody of the present invention, and the pharmaceutical composition comprising the monoclonal antibody of the present invention is already used. It may be formulated or used in combination with drugs such as antihistamines, anti-inflammatory control and antibiotics.
  • Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention As commonly used in poems, lactose, textose, sucrose, sorbbi, manny, starch, acacia rubber, calcium phosphate, alginate, gelatin, silicate microcrystalline cellulose, polyvinylpyridone, cells Ross, water, syrup, methyl cellulose, methyl hydroxybenzoate, propylhydroxybenzoate, talc, stearic acid magnesium and mineral oil, and the like.
  • the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like in addition to the above-mentioned people.
  • a lubricant e.g., a stannous tartrate, a stannous tartrate, a stannous tartrate, a stannous sulfate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium bicarbonate, sodium sulfate, sodium bicarbonate, sodium
  • the pharmaceutical composition of the present invention may be administered orally or parenterally, and in the case of parenteral administration, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, endothelial administration, topical administration, intranasal administration, pulmonary administration and rectal administration Or the like.
  • parenteral administration intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, endothelial administration, topical administration, intranasal administration, pulmonary administration and rectal administration Or the like.
  • oral compositions should be formulated to coat the active agent or to protect it from degradation in the stomach.
  • the pharmaceutical composition may also be administered by any device in which the active agent may migrate to the target cell.
  • Suitable dosages of the pharmaceutical compositions of the present invention vary depending on factors such as formulation method, mode of administration, patient's age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion and response. In general, the skilled practitioner can readily determine and prescribe a dosage effective for the desired treatment or prevention. According to a preferred embodiment of the present invention, the daily dose of the pharmaceutical composition of the present invention is 0.001 ⁇ 100 mg / kg.
  • pharmaceutically effective amount as used herein means an amount sufficient to prevent or treat an infection of Vibrio sepsis.
  • compositions of the present invention may be prepared in unit dosage form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or it may be prepared by incorporation into a multi-dose container.
  • the formulation may be in the form of a solution, suspension or emulsion in an oil or an aqueous medium, or may be in the form of axes, powders, suppositories, powders, granules, tablets or capsules, and may further include a dispersant or stabilizer.
  • a diluent or excipient such as fillers, extenders, binders, wetting agents, disintegrating agents and surfactants which are commonly used.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and the solid preparations include at least one excipient such as starch, calcium carbonate, and sucrose in the extract. (sucrose) or lactose (lactose) is prepared by mixing gelatin dung. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.
  • Liquid preparations for oral use include various excipients, such as water and liquid paraffin, which are commonly used in the preparation of suspensions, solvents, emulsions, and syrups, such as wetting agents, sweeteners, fragrances, and preservatives. This may be included.
  • excipients such as water and liquid paraffin, which are commonly used in the preparation of suspensions, solvents, emulsions, and syrups, such as wetting agents, sweeteners, fragrances, and preservatives. This may be included.
  • Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations and suppositories.
  • Non-aqueous solvent, propylene glycol as suspending agent include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations and suppositories.
  • propylene glycol polyethylene glycol
  • vegetable oils such as olive oil
  • injectable esters such as ethylate
  • wi tepsol As the base of the suppository, wi tepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
  • the antibody composition of the present invention may be administered as a separate therapeutic agent or in combination with other therapeutic agents and may be administered sequentially or simultaneously with conventional therapeutic agents.
  • Antibodies can be introduced in vivo in the form of antibody-therapeutic conjugates to be used for the treatment of bacterial infections.
  • Therapeutic agents include chemotherapeutic agents, radionuclides, immunotherapeutics, cytokines, chemokines, toxins, biological agents and enzyme inhibitors. Methods for binding antibiotics to antibodies are described, for example, in G. Gregoriadies, ed. , Academic Press London, (1979); Arnon et al. , Recent Results in Cancer Res. , 75: 236 (1980); and Moolton et al. , Immunolog. Res. , 62:47 (1982).
  • Preferred agents for coupling with the antibodies or antibody fragments of the invention are antibacterial, antiparasitic, antifungal and related agents, for example sulfonamides, penicillins and cephalosporins, aminoglycosides, tetracyclines, chloramphenicols, Piperazine, Chloroquine, Diaminopyradine, Metronizide, Isoniazid, Rifampin, Straptomycin, Sulfon, Erythromycin, Polymyxin, Nystatin, Ampoterisin, 5-fluorocytosine, 5-iod-2 -Deoxyuridine, 1-adamantamine, adenine arabinoside, ammannitine, ribovarin and azitimidine (AZT), preferably ribovarin.
  • sulfonamides for example sulfonamides, penicillins and cephalosporins, aminoglycosides, tetracyclines, chloramphenicols, Piperazine,
  • Lymphoca may be used as a therapeutic agent in the antibody-therapeutic conjugate Phosphorus and cytokines, including but not limited to.
  • the present invention provides polyclonal and monoclonal antibodies against Vibrio septic RtxAl protein and hybridoma cell lines producing the antibodies, and polyclonal and monoclonal antibodies against Vibrio septic RtxAl protein of the present invention. Since the antibody has a high affinity specific binding ability to Vibrio sepsis RtxAl protein, it can be usefully used for the diagnosis and diagnosis kit for Vibrio sepsis.
  • polyclonal and monoclonal antibodies can be used as a therapeutic agent for vibrio sepsis because of their excellent antiviral sepsis infection inhibitory effect, prevention and treatment effect against Vibrio sepsis infection, and excellent survival rate of mice after Vibrio sepsis infection.
  • the present invention will be described in more detail with reference to Examples. These examples are only intended to illustrate the invention, so the scope of the invention is not to be construed as limited by these examples.
  • RA-4701R oligonucleotide contains 6 histidines (6x-His tag) to further include purification by chroma S-graph using histidine-binding resin during purification of recombinant RtxAl.
  • RA-4701R 5'-CTCCTCGAGCTMTGATGATGATGATGATGCACCGmTACCCTm ATG-3 '(SEQ ID NO: 2, rear primer)
  • Example 2 polymerase chain react ion (PCR) ⁇ 116> Vibrio sepsis RtxAl full-length DNA (SEQ ID NO: 3, 14106 bp)-() in a reaction solution in which the polymerase and the front primer (SEQ ID NO: 1) and the rear primer (SEQ ID NO: 2) synthesized in Example 1 were mixed NCBI accession No. CP002470.1) was mixed with a template to perform polymerase chain reaction to amplify the amino acid sequence 3491 to 47 of the Vibrio sepsis bacterium RtxAl (named RtxAl (3491-4701)).
  • SEQ ID NO: 4 is the amino acid sequence of the full-length vibrio sepsis RtxAl-(NCBI accession No. ⁇ _004191 ⁇ 72.1).
  • polymerase thermal cycler for the chain banung Thermalcycler (PTC-lOO), MJ Research. Inc, USA) for 3 minutes prior denaturation (predenaturat ion) at 94 ° C was used for 1 minute denaturation at 94 ° C ( denaturat ion), annealing at 55 ° C. for 1 minute and extension for 4 minutes at 72 ° C. were repeated 30 times, and finally additional reaction was carried out at 72 ° C. for 10 minutes.
  • the desired amplification product band was fragmented and purified using a gel extraction kit (Geneal l, Korea).
  • RtxAl fulllasmid vector having a cleavage map of FIG. 1 was constructed. Specifically, the amplification product of RtxAl (3491-4701) in which the poly his tag sequence CATCATCATCATCATCAT (6x-Hi s tag) was inserted into the C-terminus purified in Example 2 was digested with EcoRI (Ferment as, Canada). Subsequently, the cut sections were filled with E. coli polymerase Klenow (New England Biolab, USA) and cut with Xhol (Ferment as, Canada).
  • the pET-21 (a) (Novagen, USA) vector was digested with Nhel (Ferment as, Canada), and then filled with the cut surface using E. coli polymerase KIenow (New England Biolab, USA). Ferment as, Canada).
  • the cleaved fragment and the vector were purified using the gel extraction kit (Geneal l, Korea) used in Example 2, and then mixed with the purified RtxAl gene fragment 1 and 30 ng of the pET-21 (a) fragment, 10 times.
  • ⁇ And T4 DNA ligase (l igase, Takara) were added to adjust the total volume to 10 and reacted for 16 hours at phase silver, so that the recombinant RtxAl gene (SEQ ID NO: 5 + 6x) was added to the pET-21 (a) vector.
  • a cyclic plasmid (named pET-RtxAl (3491-4701)) having a cleavage map of FIG. 1 inserted with a -His tag) was prepared. The plasmid was then amplified and inserted into E.
  • coli DH5 a (Invitrogen, USA) to purely separate pET-RtxAl (3491-4701) into which the RtxAl (3491-4701) gene (SEQ ID NO: 5) was inserted.
  • Recombinant RtxAl (3491-4701) protein was first purified from the protein extract according to the manufacturer's instructions. Recombinant RtxAl (3491-4701) protein, first purified using Ni-NTA chromatography, was purified secondarily using gel filtration liquid chromatography (si ze exclus ion-FPLC) (GE Heal thcare, USA).
  • the recombinant RtxAl (3491-4701) protein (SEQ ID NO: 6 + 6x-Hi st ag) was produced. Purification modalities and purification efficiencies were confirmed by performing SDS-PAGE. The results are shown in FIG.
  • lane 1 is a purified control Glutathi one S-transferase (named GST) protein, and an asterisk indicates the position of the control protein GST.
  • lane 2 is RtxAl (3491-4701) protein purified from Ni -NTA chromatography and gel filtration liquid chromatography, the arrow indicates the location of the purified recombinant RtxAl (3491-4701) protein. Purified recombinant RtxAl (3491-4701) protein, as identified in lane 2, showed 98% purity.
  • Example 6 Specificity Analysis of Recombinant RtxAl (3491-4701) Protein SDS-PAGE of the recombinant RtxAl (3491-4701) protein and the control group GST protein of 130 kDa identified in Example 5 were performed, and the gel phase protein was obtained from Tobin (Towbin H, Staehel) after electrophoresis. Nitrocel was transferred to a Nitrocel lulose membrane (Bio-Rad) according to the method in T, Gordon J. Proc Nat Acad Sci USA 1979; 76: 4350-4354. The protein-transferred nitrocell membrane was blocked with non-specific reaction with a phosphate complete solution containing 5% skim milk.
  • Serum obtained from CD-I mice infected with the vibrio sepsis bacterium of Example 18 was then diluted in a volume ratio of 1: 1000 and reacted for 1 hour at, and labeled with peroxidase (Jackson labatory, USA) Secondary antibodies were used for dilution according to the manufacturer's instructions. After reacting with primary and secondary antibodies, the cells were washed three times with phosphate buffer (PBS). ECL Western blot substrate solution (Amersham, USA) was treated on the secondary antibody reaction and washed nitrocelose membrane, and a luminescence image analyzer (LAS-1000 luminescent image analyzer; Fuj ifi lm, Japan) The results were analyzed using, and the results are shown in FIG. 3.
  • PBS phosphate buffer
  • lane 1 is a control GST protein
  • lane 2 is a recombinant RtxAK3491-4701 protein.
  • the recombinant RtxAl (3491-4701) protein showed positive reaction against wild-type Vibrio sepsis infection serum, but the control GST did not respond.
  • the 130 kDa purified protein purified in Example 5 was not purified.
  • the recombinant RtxAl (3491-4701) expression vector provides a recombinant RtxAl protein antigen which is very useful for the production of monoclonal antibodies against Vibrio sepsis enriched RtxAl protein.
  • this provides a recombinant RtxAl (3491-4701) protein which is very useful for diagnosis using Vibrio sepsis RtxAl, and facilitates the mass expression and purification of the recombinant RtxAl (3491-4701) protein.
  • the recombinant RtxAl (3491-4701) protein expressed in transgenic Escherichia coli is used for the production of a diagnostic or diagnostic kit for Vibrio sepsis, the production of a vaccine for the prevention or treatment of Vibrio sepsis, and the production of antibodies to Vibrio sepsis.
  • a diagnostic or diagnostic kit for Vibrio sepsis the production of a vaccine for the prevention or treatment of Vibrio sepsis
  • the production of antibodies to Vibrio sepsis can be.
  • Example 7 Mouse Immunity for Production of Monoclonal Antibody Producing Cell Lines
  • RtxAl (3491-4701) recombinant antigen protein (SEQ ID NO: 6 + 6 ⁇ -his tag) prepared in Example 5 was matched with Sigma adjuvant (Sigma, USA) in the same amount (by volume ratio of 1: 1).
  • Sigma adjuvant Sigma, USA
  • four injections were made in the abdominal cavity of BALB / C (female, 8 week old) mice three times apart.
  • One month after the fourth immunization three days after administration of the purified recombinant RtxAl (3491-4701) protein into the tail vein, the spleen was extracted and used for cell fusion.
  • lymphocytes were separated using a cell strainer (Falcon, USA), and distilled at a concentration of 1 x 1 () 8 cells / m. 1 x 10 7 cells / 1 of myeloma cells
  • Antibody production of the fused cells was confirmed by performing ELISA using a cell culture fused with recombinant RtxAl (3491-4701) antigen expressed in E. coli.
  • Recombinant RtxAl (3491-4701) antigenic protein was distilled off in a concentration of 10 ugM in carbonate buffer (pH 9.4), then added 100 per each well of a Maxisorp ELISA plate (Nunc, micelle), 4 ° The reaction was coated for 16 hours at C to coat the antigen.
  • Each antigen-coated well was treated with blocking buffer solution containing 1% BSA (PBS, 0.05% Tween-20, 1% BSA, 3% heat inactive horse serum) to block nonspecific reaction at 37 ° C for 1 hour. It was.
  • hybridomas reacting with the recombinant RtxAl (3491-4701) antigen obtained in Example 5 contained about 10 cells in the first well of a 96 well plate. After the addition, two-fold dilution in a row, it was cloned twice by a method of dipping in a double-stage column. The selected hybridoma clones were suspended in IMDM medium containing 30% fetal calf serum and 7.5 DMSO (dimethyl sul foxide) and stored in liquid nitrogen.
  • Example 12 Production and Purification of Ascites of Monoclonal Antibodies
  • Example 13 Screening of Monoclonal Antibodies by Isotyping ⁇ i57> Determination of i sotype of monoclonal antibody was examined by ELISA.
  • isotypes For the determination of isotypes, purified antibodies to each isotypeche from rabbits, which were fished in rabbits, were distilled off in carbonate buf fer (pH 9.4) at a concentration of 10 ⁇ g / mi and then Maxi 100 ⁇ of each well of a sorp ELISA plate (Nunc, USA) was added and reaction was coated for 16 hours at 4 ° C to coat the antibody. Each well coated with each isotype antibody was treated with blocking complete solution containing 1% BSA (PBS, 0.05% Tween-20, 1% BSA, 3% thermally inactive horse serum) for 1 hour at 37 ° C. Nonspecific reaction was blocked.
  • BSA PBS, 0.05% Tween-20, 1% BSA, 3% thermally inactive horse serum
  • HRP Horseradi sh peroxidase
  • TMB (3 ⁇ 3 ', 5,5'-tetramethylbenzidine) (Sigma, USA) substrate solution was added to each well 100 ⁇ and reacted for 30 minutes in a cow to develop color and treated with 2N H 2 S0 4 . To stop the enzyme reaction. After reaction, absorbance was measured at 450 ran using an ELISA reader. The results are shown in Table 1.
  • the isotypes were analyzed and classified according to the subclass of the heavy chain, 16 IgGl subclasses, 18 IgG2a subclasses, and the other three. Was confirmed to have an isotype of subclass IgG2b.
  • RtxAl (3491-4701) protein was used as expressed in Example 4.
  • Gene regions of RtxAl (3491-4380) comprising amino acid sequences 3491 to 4380 of vibrio sepsis bacterium RtxAl were polymerized with the following two oligonucleotides (RA-3491F2 and RA-4380R) having EcoRI and X ol restriction enzyme recognition sites.
  • the enzyme chain reaction was used to amplify the same method as in Example 2.
  • RA-3491F2 5 '-ACATGAAnCATACCATGGCAGAGAAGTTTGGCGACTAC-3' ( SEQ ID NO: 7, the forward primer)
  • RtxA 1 (3491-3980) comprising amino acid sequences 3491 to 3980 of RtxAl include two oligonucleotides (RA-3491F2 and RA-3980R) having EcoRI and Xhol restriction enzyme recognition sites; And amplification by the same method as in Example 2 using a polymerase chain reaction.
  • RA-3491F2 5 ' -ACATGMTTCATACCATGGCAGAGMGmGGCGACTAC-3 '' (SEQ ID NO:
  • RA-3980R 5 ' -CCATTCTCGAGCTAATGATGATGA GATGATGCTCACCCGAGGTGGCAATGC-3' (SEQ ID NO: 9, rear primer)
  • the amplified RtxAl (3491-4380) and RtxAl (3491-3980) gene regions were inserted into the pET-21 (a) vector in the same manner as in Example 3 and transformed in the same manner as in Example 4.
  • Recombinant RtxAl (3491-4380) and RtxAl (3491-3980) proteins were expressed and extracted using Escherichia coli ( Figure 5). Specificity analysis of the extracted recombinant protein was confirmed using the same method as Example 6 (Fig. 6). The results are shown in FIGS. 5 to 6.
  • FIG. 4 schematically shows a recombinant RtxAl (3491-4701) fragment protein expressed in transformed Escherichia coli.
  • FIG. 5 shows the molecular weights of the molecular weights on the left side of the diagram, and the first lane, the lane 2, the lane 3, and the lane 4 are the control recombinant protein, the recombinant RtxAl (3491-4701), and the RtxAl (3491-4380), respectively. and it refers to a protein "derived from a transformed E. coli expressing RtxAl (3491-3980). Arrows indicate the positions of the expressed recombinant RtxAl (3491-4701), RtxAl (3491-4380) and RtxAl (3491-3980) proteins.
  • FIG. 6 shows the results of analyzing the specificity of the recombinant RtxAl (3491-4701), RtxAl (3491-4380) and RtxAl (3491-3980) proteins using antibodies against the Vibrio sepsis RtxAl protein.
  • the molecular weight size is shown on the left side of the figure, and lane 1, lane 2, lane 3 and lane 4 represent the control recombinant protein, recombinant RtxAl (3491-4701), RtxAl (3491-4380) and RtxA 1 (3491-3980), respectively.
  • the protein extracted from the transforming Escherichia coli is expressed.
  • the arrows indicate the positions of the RtxAl (3491-4701), RtxAl (3491-4380) and RtxAl (3491-3980) proteins, in which antibodies to the RtxAl protein are positive.
  • Transformed E. coli extracts expressing recombinant RtxAl (3491-4701), RtxAl (3491-4380) and RtxAl (3491-3980) proteins were diluted with carbonate buffer (pH 9.4), respectively. 100 ⁇ l per well of Maxisorp ELISA plate (Nunc, USA) was added and reacted at 4 ° C. for 16 hours to coat each recombinant protein. Each well coated with each recombinant protein was treated with blocking complete solution containing 1% BSA (PBS, 0.05% Tween-20, 1% BSA, 3% heat-inactive horse serum) for 1 hour at 37 ° C. Specific reaction was blocked.
  • BSA PBS, 0.05% Tween-20, 1% BSA, 3% heat-inactive horse serum
  • Cell culture medium containing monoclonal antibody was added to each well by 50 ⁇ , reacted at 4 ° C for 1 hour, and then washed three times with washed complete solution (PBS, 0.05% Tween-20, 0.05% BSA). After washing 1: 1000-fold diluted Biot in-condensed anti-mouse IgG + IgA + IgM antibody (1, 000; Sigma, USA) was added 100 ⁇ per well and reaction was repeated at 37 ° C for 1 hour. , Washed three times with a complete solution.
  • RtxAl (3491-4701) antigen Ten strongly recognized the recombinant protein RtxAl (3491-4701) antigen, and 13 simultaneously recognized the RtxAl (3491-4380) and RtxAl (3491-4701) antigens. In addition, 14 of them recognized all RtxAl (3491-3980) antigens, RtxAl (3491-4380) and RtxAl (3491-4701) antigens.
  • 32RA, 40RA, 46RA, 47RA, 50RA recognizes RtxA 1 (3491-3980), and 13 (IRA, 5RA, 7RA, 9RA, 12RA, 13RA, 14RA, 20RA, 26RA, 28RA, 29RA, 38RA, 44RA recognizes RtxAl (3981-4380), 10 (4RA, 10RA, 16RA, 27RA, 30RA, 41RA, 42RA, 45RA, 48RA, 52RA) was found to recognize RtxAl (4381-4701) (Fig. 7).
  • the present invention was able to secure three groups of monoclonal antibodies having different epitopes, and the monoclonal antibodies of each group were monoclonal antibodies and vibrio sepsis bacteria for the prevention and treatment of Vibrio sepsis. In addition to the development of diagnostics, it can be useful for basic research on vibrio sepsis using monoclonal antibodies.
  • Biotin labeling kit (FluoReporter Biotin-XX Protein labeling kit, Molecular Probes, USA) was carried out according to the manufacturer's instructions, Biotin-condensation 47RA was generated.
  • monoclonal antibody 47RA is shown to bind to different sites with the four (10RA, 13RA, 21RA, 24RA) monoclonal antibody.
  • Example 17 Culture of Wild Species Vibrio Sepsis
  • Wild type Vibrio sepsis M06-24 / 0 strain (Reddy GP, Hayat II, Abeygunawardana C, Fox C 'et al. J Bacterid. 174: 2620-2630, 1992) was inoculated in HKheart infusion medium containing 2.5% NaCl After that, it was incubated for 16 hours in a 37 ° C shaking incubator. After incubating 1/200 of this culture with HI medium (Di fco Co.) containing 2.5% NaCl again, the main culture was performed for 4 hours in a 37 ° C shaking incubator.
  • Example 18 Wild Species Vibrio Sepsis Infection Serum Generation
  • CD1 female, 8-week old mice were intraperitoneally administered 1 x lo nrf of the wild species Vibrio sepsis bacteria cultured in Example 17. Three weeks later, blood was obtained through an axi l lary vein incision and at 12000 rpm. Centrifugation for 3 minutes produced wild-type Vibrio sepsis bacteria infected sera.
  • Example 19 Vaccine Effect of Recombinant RtxAl (3491-4701) Protein Antigen
  • Example 5 20 ug of RtxAl (3491-4701) recombinant antigen protein (SEQ ID NO: 6 + 6 ⁇ -His tag tag) prepared in Example 5 was mixed with Sigma adjuvant (Sigma, USA) in the same manner as in Example 7, Two intervals were injected into the abdominal cavity of CD1 (female, 8 week old) mice. Wild Species Vibrio Septic Bacteria Cultivated in Example 17 14 Days After Second Immunization 8 X
  • mice vaccinated (or immunized) with "RtxAl-C” showed a survival rate of 93.3%, confirming the superior vaccine effect of the recombinant RtxAl (3491-4701) protein antigen.
  • the group immunized with the control recombinant GST protein had a very low survival rate of 6.7%.
  • Example 19 a mixture of recombinant RtxAl (3491-4701) protein antigen and Sigma adjuvant CSigma (USA) was injected into the abdominal cavity of CD1 (female, 8 week old) mice twice at three week intervals. After 14 days after the second immunization, the wild type Vibrio sepsis bacterium 8 X lo i cultured in Example 17 was administered intraperitoneally, and after 150 minutes, blood was obtained through axillary incision and diluted 10-fold in phosphate buffer solution. The diluted samples were plated on solid HI media to examine colony formation. The result is shown in FIG.
  • mice vaccinated (or immunized) with the recombinant RtxAl (3491-4701) protein antigen show a vaccine effect by reducing blood vibrio sepsis.
  • Recombinant RtxAl (3491-4701) protein (SEQ ID NO: 6 + 6x—His tag) 20 prepared in Example 5 was mixed with Sigma adjuvant (Sigma, USA), as in Example 7, and then every three weeks Three injections were given intraperitoneally of CD1 (female, 8 week old) mice. 14 days after third immunization Thereafter, blood was obtained through axillary vein incision, followed by centrifugation at 12,000 rpm for 3 minutes to generate serum including polyclonal antibody against RtxAl (3491-4701) protein.
  • CD1 female, 8 week old mice contained polyclonal antibody of 200 ⁇ RtxAl (3491-4701) protein.
  • mice that received serum containing polyclonal antibody against RtxAl (3491-4701) protein before vibrio sepsis infection showed 100% survival rate.
  • mice receiving serum containing polyclonal antibodies to the control recombinant GST protein showed very low survival rates of> 10.
  • mice that received serum containing polyclonal antibodies to RtxAl (3491-4701) protein after Vibrio sepsis infection showed 100% survival rate.
  • mice receiving sera containing polyclonal antibodies to the control recombinant GST protein had a very low survival rate of 10%.
  • each monoclonal antibody obtained in Example 12 was added to CD1 (female, 8-week old) mice.
  • Example 17 After 4 hours 30 minutes, the wild type Vibrio sepsis bacterium 1 X 10 6 / cultured in Example 17 was administered intraperitoneally, and mortality was observed for 96 hours. The results are shown in Table 1 and FIG.
  • 13RA, 21RA, 24RA, and 50RA showed a prophylactic effect of 10W against Vibrio sepsis infection, and 45RA, 46RA, 47RA showed a prophylactic effect of 90>.
  • mice treated with phosphate buffer as a control had a low 30% Survival rate was shown.
  • CD1 female, 8-week old mice were intraperitoneally administered with 500 ⁇ g per mouse of the monoclonal antibody obtained in Example 12. After one day, the wild type Vibrio sepsis bacterium 1 X lo n ⁇ cultured in Example 17 was administered intraperitoneally and mortality was observed for 96 hours. The results are shown in FIG.
  • CD1 cancer cut, 8 weeks old, average body weight 27g mice were treated with the monoclonal antibody obtained in Example 12 at 0. g, 4 g , 20 / ig, 100 / g, 4 hours and 30 minutes after intraperitoneal administration
  • the survival rates were different according to the amount of monoclonal antibody, and 100% for 500 iig, 90% for 100 fig, 80% for mice administered 20! Ig or 4 ⁇ . The survival rate seemed to come.
  • mice treated with more than 4 (148 / kg) 21RA monoclonal antibody per mouse had a survival rate of 80% or more. This suggests that even a small amount of monoclonal antibodies against RtxAl (3491-4701) protein may have sufficient inhibitory effect. However, mice treated with phosphate buffer solution showed a low survival rate of 3.
  • Example 12 ⁇ 245> administration of a wild type bacterium Vibrio sepsis 1 X 10 6 / m «culture in Example 17 for three CDK female, 8 week old) mice to determine the therapeutic effect of the monoclonal antibodies into the abdominal cavity, and After 1 hour, each monoclonal antibody obtained in Example 12 was dosed intraperitoneally with 200 ⁇ Anouse (multiple monoclonal antibodies) or 500 / mosue (purified monoclonal antibody) for 96 hours. It was. The results are shown in FIG.
  • monoclonal antibody 21RA showed 93% of the treatment effect against Vibrio sepsis infection, 24RA showed 87% of the treatment effect, and 47RA showed 67% of the treatment effect. However, mice treated with phosphate buffer solution showed a low survival rate of 32%.
  • the present invention is applicable to the Vibrio sepsis prophylactic and therapeutic industry.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명은 비브리오 패혈증균 알티엑스에이-1(RtxA1)에 특이적으로 결합하는 단일클론항체 및 이의 용도에 관한 것으로, 보다 상세하게는 비브리오 패혈증균에 대한 고친화도의 특이적 결합능력으로 높은 감수성, 특이성 및 민감도를 가지며, 비브리오 패혈증균과 그에 관련된 감염에 의해서 유발되는 질병의 예방 및 치료에 유용하게 이용될 수 있으며, 우수한 백신효과를 가짐으로써 비브리오 패혈증 예방제 및/또는 치료제로 사용될 수 있다.

Description

【명세서】
【발명의 명칭】
비브리오 패혈증균 알티엑스에이 -1 단백질에 특이적으로 결합하는 단일클론 항체 및 이의 용도
【기술분야】
<ι> 본 발명은 비브리오 패혈증균 알티엑스에이 -l(RtxAl)에 특이적으로 결합하는 단일클론항체 및 이의 용도에 관한 것으로， 보다 상세하게는 비브리오 패혈증균에 대한 고친화도의 특이적 결합능력으로 높은 감수성， 특이 및 민감도를 가지며， 비브리오 패혈증균과 그에 관련된 감염에 의해서 유발되는 질병의 예방 및 치료에 유용하게 이용될 수 있는 비브리오 패혈증균 알티엑스에이 -l(RtxAl)에 특이적으로 결합하는 단일클론항체 및 이의 용도에 관한 것이다.
【배경기술】
<2> 비브리오 패혈증균 (Vibrio vulnificus)은 주로 바다와 인접한 강하구에 서식 하는 호염성 병원성박테리아이며 대부분의 해산물과 관련된 사망성 질환과 관련되 어있다. 비록 비브리오 패혈증균 감염증은 비교적 역사가 짧으나， 지구 온난화에 의해서 세계적으로 임상증례가 계속 증가하고 있는 새로이 주목받고 있는 질환중의 하나이다ᅳ 특히 전세계적으로 절대적인 발병 예는 콜레라나 살모넬라 식중독보다 적지만 높은 치사율과 비극적인 임상증상 때문에 심각한 사회적 문제를 야기하고 있다.
<3> 비브리오 패혈증균은 1976년 미국 질병통제센터 (Centers for Disease
Control; 이하 CDC로 약함)의 홀리스 (Hollis) 등이 11년 동안 사람에서 분리된 호 염성, 병원성 비브리오 균의 세균학적 성상을 처음 보고한 이후， 유당 (lactose)을 분해하는 특징 때문에 유당 분해 비브리오 (lactoseᅳ ferment ingVi brio 또는 Lac(+)) 라 명명되었다. 1979년 CDC의 블레이크 (Blake)등은 CDC에 보고된 39명의 환자들의 자료를 역학적으로 분석하여 임상증상에 따라 원발성 패혈증 (primary septicemia) 군과 창상감염 (wound infect ion)군으로 분류하였다 (Blake,P.A., Merson, M.H., Weaver , R.E. , Hollis, D.G., Heublein, P.C., N. Engl. J. Med. 300:1-6， 1979) . 같은 해 파머 (Farmer)는 새로운 종으로서 Vibrio vulnificus (vulnus=wound, ficus=forming)라 명명하였으며， 오늘에 이르고 있다 (Farmer, J.J. Ill, Lancet 2:903, 1979).
<4> 비브리오 패혈증균 패혈증은 잠복기가 짧고， 다양한 항생제 치료에도 불구하 고 50%이상의 치사율을 나타내고 있다. 비브리오 패혈증균 패혈증은 대부분 40대 이상 (약 90-95%)의 남자 (90% 이상)에서 발생하며， 정상인에서는 거의 볼 수 없고, 기저질환을 가지는 환자들에서 주로 발병한다. 전 세계의 발생 증례를 분석해 보면 원발성 패혈증의 경우， 대부분의 환자들은 간장 질환과 음주벽 등 만성질환을 가지 고 있으며， 간장 질환으로서는 간경변， 만성간염， 간암 등이 주종을 이루고, 그 외 당뇨병， 폐결핵， 만성골수염， 류마티스성 관절염 등의 기저질환이 확인되었다. 그 러나 5%이하에서는 특별한 기저질환을 찾을 수 없는 경우도 있다. 미국의 경우 당 뇨병, 악성종양， 혈색소증 (hemochromatosis), 지중해빈혈 (thalassemia) 등의 환자 에서 빈도가 비교적 높게 나타난다. 최근에는 AIDS 환자들에서 비브리오 패혈증균 패혈증의 발생보고가 나오고 있어, 미국 CDC에서는 AIDS 환자들에게 여름철에는 굴 등의 해산물을 생식하지 말 것을 권고하고 있다. 또한 허리케인 발생 지역의 만성 질환자의 경우는 상처를 통한 비브리오 패혈증균 감염에 주의할 것을 권고하고 있 다. 따라서 , 비브리오 패혈증균와 관련 박테리아의 감염에 의한 패혈증의 예방과 치료를 위해서 새로운 항 박테리아 물질의 개발이 절실히 요구된다.
<5> 한편， 1980년 중반 이후 시작된 비브리오 패혈증균의 발변 기전 연구를 통하 여 여러 가지 독력인자가 보고되었다. 즉， capsular polysacchar ide(VvCPS) , iron assimilation system, flagella, pili , VvhA, VvpE, RtxAl등이 알려져 있다 (Jones M.K., Oliver J.D. Infect. Immun. 77:1723-1733. 2009) . 이 중 RtxAl은 비브리오 패혈증균 감염초기에 분비되는 주요한 독력인자로써， 장을 통한 혈액으로 비브리오 패혈증균의 전파와 세포의 사멸에 중요한 역할을 하고 있다. 이는 RtxAl이 초기 감 염의 새로운 진단법과 치료제 개발에 유용한 표적임을 시사하고 있다.
<6> 상기 비브리오 패혈증균 검출방법 증 등록특허 1으1192130(공개일자:
2012.01.09)에는 비브리오패혈증세균의 외막단백질을 특이적으로 인식하는 단쇄항 체 및 상기 항체를 이용한 비브리오균 검출 키트 및 방법을 기재하고 있다.
<7>
<8> 그러나， 종래의 다양한 항생제를 이용한 치료법에도 불구하고， 50% 이상의 치사율을 가지는 비브리오 패혈증균의 감염에 대한 높은 치사율을 낮추기 위한 몇 가지 시도가 있었다. 그 예로 불활성 비브리오 패혈증균， VvCPS, VvpE을 이용한 예 방차원의 백신 개발이 진행 되었다 (Kreger A.S., Gray L.D., Testa J. Infect Immun. 45:537-543. 1984, Devi S.J., Hayat U., Frasch C.E., et al . Infect Immun. 63:2906—2911. 1995， Chen Y.C., Chang C.C., Chang S.Y. , et al . Letters in applied microbiology 50:168-172. 2010). 하지만， 불활성 비브리오 패혈증균와 VvpE는 잠재적 부작용을 가지고 있으며 (Chang A. . , Kim H.Y., Park J.E., et al . J. Bacteriol. 187 :6909-6916. 2005)， VvCPS는 다양한 비브리오 패혈증균에 사용 할 수 없는 한계를 가지고 있다 (Devi S.J., Hayat U., Frasch CE, et al. Infect I画 un. 63 :2906-2911 , 1995) . 나아가， 비브리오 패혈증균에 감염이 될 경우， 매우 높은 치사율에도 불구하 고, 현재 비브리오 패혈증에 대한 효을적인 예방 및 치료가 이투어 지지 못하고 있 는 문제점이 있다.
【발명의 상세한 설명】
【기술적 과제】
본 발명은 상술한 문제를 해결하기 위해 안출된 것으로， 본 발명의 첫 번째 해결하려는 과제는 비브리오 패혈증균에 대하여 고친화도의 특이적 결합능력으로 비브리오 패혈증균과 그에 관련된 감염에 의해서 유발되는 질병의 예방 및 치료 효 과가 우수한 단일클론항체 및 이를 생산하는 하이브리도마 세포주를 제공하는 것이 다.
본 발명의 두번째 해결하려는 과제는 본 발명의 단일클론항체를 포함하는 비브리오 패혈증 치료제， 비브리오 패혈증 예방제 및 비브리오 패혈증 진단 키트를 제공하는 것이다.
【기술적 해결방법】
본 발명은 비브리오 패혈증균 RtxAl 단백질에 대한 단일클론항체를 생산하는 것을 특징으로 하는 수탁번호 KCLRF-BP-00310인 하이브리도마 세포를 제공한다. 또한， 본 발명은 수탁번호 KCLRF-BP-00310인 하이브리도마 세포에 의해 생산 되는 비브리오 패혈증균 RtxAl 단백질에 대한 단일클론항체 또는 이의 항원결합단 편을 제공한다.
본 발명의 바람직한 일실시예에 따르면， 상기 단일클론항체는 서열목톡 4의 RtxAl 단백질의 3491 내지 3980번째 아미노산 서열 부위에 특이적으로 결합할 수 있다. 나아가， 본 발명은 단일클론항체 또는 이의 항원결합단편을 포함하는 비브리 오 패혈증 치료제를 제공한다.
또한， 본 발명은 단일클론항체 또는 이의 항원결합단편을 포함하는 비브리오 패혈증 예방제를 제공한다.
나아가, 본 발명은 단일클론항체 또는 이의 항원결합단편을 포함하는 비브리 오 패혈증 진단 키트를 제공한다. 또한， 서열번호 6의 아미노산 서열을 포함하고, 비브리오 패혈증균 RtxAl 단 백질에 특이적으로 결합하는 다클론 항체를 제공한다.
더불어， 본 발명은 서열번호 6의 아미노산 서열을 포함하고， 비브리오 패혈 증균 RtxAl 단백질에 특이적으로 결합하는 다클론 항체를 포함하는 비브리오 패혈 증 치료제를 제공한다.
게다가， 본 발명은 서열번호 6의 아미노산 서열을 포함하고， 비브리오 패혈 증균 RtxAl 단백질에 특이적으로 결합하는 다클론 항체를 포함하는 비브리오 패혈 증 예방제를 제공한다.
나아가， 본 발명은 서열번호 6의 아미노산 서열을 포함하고， 비브리오 패혈 증균 RtxAl 단백질에 특이적으로 결합하는 다클론 항체를 포함하는 비브리오 패혈 증 진단 키트를 제공한다. ᅳ 이하, 본 명세서에서 사용된 용어에 대해 간략히 설명한다.
세포와 관련하여 사용되는 용어 "재조합 (recombinant ) "은 세포가 이형의 핵 산을 복제하거나 이형의 핵산에 의해 코드화되는 펩타이드 또는 단백질을 발현하는 것을 가리킨다. 또한 재조합 세포는 세포의 본래 형태에서 발견되는 유전자를 발현 시킬 수 있으나， 변형된 유전자가 인공적인 방법에 의해 세포로 재도입되기도 한 다.
본 발명의 용어 "프라이머"는 합성 또는 자연의 을리고뉴클레오타이드를 의 미한다. 프라이머는 주형에 상보적인 프라이머 연장 산물의 합성이 유도되는 조건， 즉， 뉴클레오타이드와 DNA 중합효소와 같은 중합체의 존재, 그리고 적합한 온도와 pH의 조건에서 합성의 개시점으로 작용한다. 증폭의 최대 효을을 위하여， 바람직하 게는 프라이머는 단일쇄이다. 바람직하게는， 프라이머는 디옥시리보뉴클레오타이드 이다. 본 발명의 프라이머는 자연 (natural ly occurring) dNMP (즉， dAMP, dGMP, dCMP 및 dTMP) , 변형 뉴클레오타이드 또는 비 -자연 뉴클레오타이드를 포함할 수 있 다. 또한， 프라이머는 리보뉴클레오타이드도 포함할 수 있다. 예컨대， 본 발명의 을리고뉴클레오타이드는 골격 변형된 뉴클레오타이드 예컨대， 펩타이드 핵산 (PNAXM. Egholm et al . .Nature, 365： 566-568 ( 1993) ) , 포스포로티오에이트 DNA, 포 스포로디티오에이트 DNA, 포스포로아미데이트 DNA, 아마이드-연결된 DNA, 顧 I-연결 된 DNA, 2 ' -0-메틸 RNA, 알파 -DNA 및 메틸포스포네이트 DNA, 당 변형된 뉴클레오타 이드 예컨대， 2 ' -0-메틸 RNA, 2' -플루오로 RNA, 2 ' -아미노 RNA, 2' -으알킬 DNA, 2' -0-알릴 DNA, 2' -0-알카이닐 DNA, 핵소스 DNA, 피라노실 RNA 및 안히드로핵시를 DNA, 및 염기 변형을 갖는 뉴클레오타이드 예컨대, C-5 치환된 피리미딘 (치환기는 폴루오로- , 브로모-， 클로로- , 아이오도- , 메틸-， 에틸-, 비닐-, 포르밀- , 에티틸-
,프로피닐-， 알카이닐-， 티아조릴- , 이미다조릴-， 피리딜- 포함)， C-7 치환기를 갖 는 7-데아자퓨린 (치환기는 플투오로-， 브로모-, 클로로-， 아이오도ᅳ， 메틸-ᅳ 에틸 -， 비닐- , 포르밀-, 알카이닐-, 알켄일-， 티아조릴-ᅳ 이미다조릴- , 피리딜 -)， 이노 신 및 디아미노퓨린을 포함할 수 있다.
<30> 본 발명의 용어 "백터"는 외래 유전자를 숙주 세포 내로 안정적으로 운반할 수 있는 운반체로서의 DNA 분자를 말한다. 유용한 백터가 되기 위해서는 복제될 수 있어야 하며， 숙주 세포 내로 유입할 수 있는 방안을 갖추어야 하고, 자신의 존재 를 검출할 수 있는 수단을 구비하여 한다. 여기서 외래 유전자는 비브리오 패혈증 균 RtxAl 항원의 3491-4701 아미노산 부위를 코딩하는 서열 또는 상기 서열의 말단 에 정제를 용이하게 하기 위하여 poly His-tag서열을 부가한서열을 의미한다.
<31> 본 발명의 용어 "플라스미드' '는 일반적으로 외래 유전자가 숙주 세포에서 발 현될 수 있도록 백터에 작동적으로 연결되어 형성된 환상의 DNA 분자를 말한다. 그 러나， 폴라스미드는 목적하는 유전자를 포함하는 플라스미드를 제작하기 위해 유전 자 재조합에 의해 특정한 제한 효소에 의해 분해되고 새로운 유전자를 도입하는 백 터로 사용될 수 있다. 따라서， 본원에서는 플라스미드와 백터는 상호교환적으로 사 용되며, 유전공학 분야에 통상의 지식으로 가진 자라면 그들의 명칭을 구분하지 않 더라도 그 의미를 층분히 이해할 것이다.
<32> 본 발명의 용어' ' '융합단백질 "은 추후 단백질 정제의 편의를 위하여 C-말단에
His-tag를 부착하고 있는 비브리오 폐증균 RtxAl을 의미한다. 따라서 본 발명에서 "융합단백질' '이라 표현하였지만， 그것이 반드시 poly Hisᅳ tag가 부착된 것을 의미 하는 것이 아니며， 단백질 정제의 불편함을 감수한다면 융합단백질을 사용하지 않 을 수도 있다. 그러므로 본 발명에서 "재조합 비브리오 폐증균 RtxAl"란 용어는 " 비브리오 패혈증균 RtxAl" 또는 "정제의 편의를 위한 사슬이 N-말단 또는 C-말단에 부가된 비브리오 패혈증균 RtxAl"의 약칭으로 정의된다.
<33>
【유리한 효과】
<34> 본 발명에 따론 재조합 RtxAl(3491-4701)은 비브리오 패혈증균 RtxAl의 다클 론항체 생성， 단일클론항체 생성 및 비브리오 패혈증 백신 생산에 매우 유용한 재 조합 RtxAl 단백질 항원을 제공한다. 또한 이는 비브리오 패혈증균 RtxAl을 이용한 진단에 매우 유용한 재조합 RtxAl(3491-4701)단백질 항원을 제공하고， 재조합 RtxAl(3491-4701) 단백질 항원의 대량발현 및 정제가 용이하게 한다.
<35> 또한， 본 발명에 따른 재조합 RtxAl(3491-4701) 단백질에 대한 다클론항체는 비브리오 패혈증균에 대한 고친화도의 특이적 결합능력으로 비브리오 패혈증균 감 염 여부를 신속， 정확하게 진단， 예방 및 치료 등에 매우 유용하게 사용 될 수 있 다. 또한 대장균에서 발현된 재조합 단백질 RtxAl 항원은 감수성 및 특이성이 우수 하여， 비브리오 패혈증균의 감염에 대한 진단제 또는 진단키트 등에 매우 유용하게 사용될 수 있다.
나아가, 본 발명에 따른 하이브리도마 세포에서 생산되는 단일클론항체는 비 브리오 패혈증균에 대한 고친화도의 특이적 결합능력으로 비브리오 패혈증균 감염 여부를 신속, 장확하게 진단, 예방 및 치료 등에 매우 유용하게 사용 될 수 있다. 또한 대장균에서 발현된 재조합 단백질 RtxAl 항원은 감수성 및 특이성이 우수하 여, 비브리오 패혈증균의 감염에 대한 진단제 또는 진단키트 등에 매우 유용하게 사용될 수 있다.
더불어， 본 발명의 단일클론항체는 비브리오 패혈증균의 감염억제 효과， 비 브리오 패혈증 감염에 대한 예방 및 치료효과뿐만 아니라 비브리오 패혈증의 감염 후 마우스 생존율 및 백신효과가 우수하여 비브리오 패혈증 치료제로 유용하게 사 용될 수 있다.
【도면의 간단한 설명】
도 1는 재조합 RtxAl (3491-4701)을 도입된 재조합 RtxAl(3491-4701)발현 백 터의 개열지도이다.
도 2는 비브리오 패혈증균의 정제된 재조합 RtxAl(3491-4701) 단백질을 10% SDS-PAEG로 확인한 전기영동의 결과이다. (레인 1 :정제된 대조군 Glutathione S- transferase(GST)단백질， 레인 2 :정제된 RtxAl(3491-4701)단백질)
도 3는 정제된 재조합 RtxAl (3491-4701) 단백질의 특이성을 면역블롯으로 분석한 전기영동의 결과이다. (1레인:대조군 GST단백질， 레인 2:재조합 RtxAl(3491- 4701)단백질)
도 4는 형질전환 대장균에서 발현된 재조합 RtxAl(3491-4701) 단편 단백질을 모식적으로 나타낸 그림이다.
도 5는 재조합 RtxAl(3491— 4701) 단편 단백질의 발현을 SDS-PAEG로 확인한 전기영동의 결과이다. (제 1레인:대조군 재조합 단백질， 2레인:재조합 RtxAl(3491- 4701)단백질， 3레인:재조합 RtxAl(3491-4380)단백질 및 4레인: 재조합 RtxAl(3491- 3980)단백질)
도 6는 발현된 재조합 RtxAl(3491-4701) 단편 단백질의 특이성을 면역블롯으 로 분석한 전기영동의 결과이다. (제 1레인:대조군 재조합 단백질， 2레인:재조합 RtxAl(3491-4701)단백질， 3레인:재조합 RtxAl(349l-4380)단백질 및 4레인: 재조합 RtxAl(3491-3980)단백질)
<44> 도 7는 3그룹의 단일클론항체가 RtxAl(3491-4701)에 결합하는 부위를 모식적 으로 나타낸 그림이다.
<45> 도 8는 실시예 24에서 비브리오 패혈증균에 대한 치료효과 조사를 위해서 사 용한 단일클론항체 (13RA, 21RA, 24RA, 47RA)및 10RA와 Biot inᅳ축합 47RA의 경쟁적 결합 분석에 대한 결과를 나타낸 결과 그래프이다.
<46> 도 9는 재조합 RtxAl(3491-4701) 단백질에 대한 백신효과를 나타낸 결과 그 래프이다ᅳ 실선과 점선으로 표시된 RtxAl-C와 GST는 각각 RtxAl(3491-4701)과 GST 단백질로 면역한 그룹을 의미한다.
<47> 도 10는 재조합 RtxAl(3491-4701) 단백질의 백신네이션이 혈중 비브리오 패 혈증균 개수에 미치는 영향을 나타낸 결과 그래프이다. 사각형과 동그라미로 표시 된 RtxAl-C와 GST는 각각 RtxAl(3491-4701)과 GST 단백질로 면역한 그룹을 의미한 다.
<48> 도 11는 재조합 RtxAK3491-4701) 단백질에 대한 다중클론항체의 비브리오 패혈증 감염에 대한 예방효과를 실험동물의 생존을로 나타낸 결과 그래프이다. 실 선과 점선으로 표시된 a -RtxAl-C와 α -GST는 각각 RtxAl(3491— 4701)과 GST 단백질 의 다중클론항체를 투여한 그룹을 의미한다.
<49> 도 12는 재조합 RtxAl(3491-4701) 단백질에 대한 다중클론항체의 비브리오 패혈증 감염에 대한 치료 효과를 실험동물의 생존율로 나타낸 결과 그래프이다. 직 선과 점선으로 표시된 a -RtxAl-C와 a -GST는 각각 RtxA 1(3491-4701)과 GST 단백질 의 다중클론항체를 투여한 그룹을 의미한다.
<50> 도 13는 재조합 RtxAl(3491-4701) 단백질에 대한 단일클론항체의 비브리오 패혈증 감염에 대한 예방효과를 나타낸 결과 그래프이다.
<5i> 도 14는 재조합 RtxAU 3491-4701) 단백질에 대한 단일클론항체의 비브리오 패혈증 감염에 대한 장기간 예방효과를 실험동물의 생존을로 나타낸 결과 그래프이 다.
<52> 도 15는 재조합 RtxAl(3491-4701) 단백질에 대한 단일클론항체의 투여양에 따른 비브리오 패혈증 감염에 대한 감염 억제효과를 실험동물의 생존율로 나타낸 결과 그래프이다.
<53> 도 16는 재조합 RtxAl(3491-4701) 단백질에 대한 단일클론항체의 비브리오 패혈증 감염에 대한 치료효과를 실험동물의 생존율로 나타낸 결과 그래프이다.
<54>
<55> 【발명의 실시를 위한 형태】
<56> 이하， 본 발명을 보다 상세히 설명한다.
<57> 상술한 바와 같이， 비브리오 패혈증균에 감염이 될 경우， 매우 높은 치사율 에도 불구하고, 현재 비브리오 패혈증에 대한 효율적인 예방 및 치료가 이루어 지 지 못하고 있는 문제점이 있다.
<58>
<59> 이에 본 발명의 바람직한 일구현예에 따르면, 비브리오 패혈증균 RtxAl 단백 질에 대한 단일클론항체를 생산하는 것을 특징으로 하는 수탁번호 KCLRF-BP-00310 인 하이브리도마 세포를 제공하여 상술한 문제의 해결을 모색하였다.
<60> 본 발명은 비브리오 감염 초기에 분버되는 특이적인 독소 항원으로 판정된，
RtxAl의 C-말단 부위에 대한 대장균 발현 재조합 RtxAl (3491-4701)을 면역원으로 이용하여 마우스에 면역시키고, 면역된 마우스의 비장세포와 Bᅳ임프아세포 (B- lymphoblast )인 P3X63Ag8.653가 융합된 하이브리도마 세포를 제조하고, 이로부터 비브리오 패혈증균 RtxAl 항원에 대한 단일클론항체를 생산하였다. 본 발명에 따른 단일클론항체는 비브리오 패혈증균 RtxAl 항원에 대해 우수한 반웅성을 보였다. 이는 본 발명의 단일클론항체가 간접면역 형광항체, 면역블롯법 및 효소면역 항체 법 등의 다양한 진단법에 이용 가능한 진단용 항체임을 보여 주고 있다. 또한 본 발명의 재조합 RtxAl(3491-4701) 단백질에 대한 다클론항체와 단일클론항체는 비브 리오 패혈증 감염 억제 효과， 비브리오 패혈증 감염에 대한 예방 및 치료효과뿐만 아니라 비브리오 패혈증의 감염 후 마우스 생존율이 우수하여 비브리오 패혈증 치 료제로 사용될 수 있다.
6i> 구체적으로, 서열번호 4의 비브리오 패혈증균 RtxAl 단백질올 코딩하는 서열 번호 3로 표시되는 서열올 주형으로 하고 비브리오 패혈증균 RtxAl의 아미노산 서 열 중 3491번ᅳ47이번 위치의 아미노산 부위를 선택적으로 증폭하기 위하여 신규한 프라이머 서열인 서열번호 1 및 2의 전방 및 후방 프라이머로 하여 PCR을 수행한 다. 그 뒤 상기 증폭된 비브리오 패혈증균 RtxAl의 아미노산 서열 중 3491번 -4701 번 위치의 아미노산을 코딩하는 서열 (서열번호 5) 또는 상기 서열의 말단에 정제를 용이하게 하기 위하여 통상의 poly His-tag(6x-His)서열을 첨가한 서열을 플라스미 드 백터에 삽입하고 이를 숙주세포에 형질전환 하였다. 이후 발현된 단백질을 정제 하고 이를 마우스의 복강에 주사한 후 비장세포를 적출하여 이를 골수종세포 (myeloma)와 융합하고 이를 배양하여 다수개의 하이브리도마 세포를 수득한다. 이 후 상기 하이브리도마 세포에서 생산된 단일클론항체들에 대하여 이소타입에 따른 대량생산가능성, 단일클론항체들간의 경쟁적 결합, 단일클론항체의 비브리오 패혈 증 감염에 대한 예방 및 치료효과, 백신효과， 비브리오패혈증 감염 후 마우스 생존 율 등을 종합적으로 평가하고， 가장 우수한 21RA를 한국세포주은행 (Korean Cel l Line Bank)에 기탁번호 KCLRF-BP-00310로 기탁하였다. 이렇게 생산된 21RA 단일클 론항체는 비브리오 패혈증균 RtxAl의 아미노산 서열 중 3491번 -3980번째 아미노산 부위에 특이적으로 결합할 수 있다.
<62> 본 발명의 단일클론항체를 분비하는 하이브리도마 세포는 이를 시험관 내에 서 또는 생체 내에서 대량으로 배양할 수 있다. 상기한 하이브리도마 세포가 생산 하는 단일클론항체는 정제하지 않고 사용할 수도 있으나, 최선의 결과를 얻기 위해 서는 본 발명이 속하는 기술분야에 잘 알려져 있는 방법에 따라 고순도 (예컨대, 95% 이상)로 정제하여 사용하는 것이 바람직하다. 이러한 정제 기술로는， 예를 들 어 투석， 염 침전, 이온교환크로마토그래피， 크기배제크로마토그래피, 친화성크로 마토그래피 등의 정제방법을 이용하여 배양 배지 또는 복수액 (ascites f luid)으로 부터 분리될 수 있다.
<63> 비브리오 패혈증균 RtxAl 단백질을 선택적으로 인식하는 단일클론을 선별하 기 위하여 통상 사용되는 다양한 방법 , 예를 들면， 방사능면역분석법 (RIA) , 효소면 역흡착법 (ELISA) , 면역형광법 ( Immunof luorescence) , 웨스턴 블랏팅 (Western blott ing) 및 유세포 분석법 등을 사용할 수 있으나， 이에 한정되는 것은 아니다. 본 발명의 구체적인 일 실시예에 의하면， 효소면역흡착법 (ELISA)에 의해 단일클론 을 선별할 수 있다.
<64>
<65> 재조합 RtxAl 단백질을 면역원으로 이용하여 융합된 하이브리도마 세포 37 개에서 생산된 각각의 단일클론항체들은 비브리오 패혈증균의 RtxAl의 아미노산 결 합부위에 따라 3491번 -3980번째 아미노산에 결합하는 단일클론항체들， 3981-4380번 째 아미노산에 결합하는 단일클론항체들 및 4381-4701번째 아미노산에 결합하는 단 일클론항체들로 분류할 수 있다. 이 중 재조합 RtxAl 단백질을 면역원으로 이용하 여 융합된 하이브리도마 세포 37개에서 생산된 각각의 단일클론항체 중 이소타입에 따른 대량생산가능성, 단일클론항체들 간의 경쟁적 결합, 단일클론항체의 비브리오 패혈증 감염에 대한 예방 및 치료효과， 비브리오패혈증 감염 후 마우스 생존율 등 을 종합해 볼 때, 항원에 대한 항체의 결합부위， 이소타입 서브클래스및 치료효과 가 각각 다른 재조합 RtxAl(3491-4701) 단백질 단일클론항체 21RA가 우수한 효과를 나타내었다. 따라서, 상기 21RA는 한국세포주은행 (Korean Cel l Line Bank)에 기탁 번호 KCLRF-BP-00310로 기탁하였다 (표 1 참조) .
<66> <67> 본 발명의 바람직한 다른 구현예에 따르면 , 기탁번호 KCLRF-BP-00310인 하이 브리도마 세포에 의해 생산되는 비브리오 패혈증균 RtxAl 단백질에 대한 단일클론 항체 또는 이의 항원결합단편을 제공하여 상술한 문제의 해결을 모색하였다.
<68> 본 발명의 단일클론 항체는 비브리오 패혈증균 RtxAl 단백질에 고친화도를 가지면서 특이적으로 결합한다.
<69> 본 발명의 단일클론항체는 서열목록 4의 RtxAl 단백질의 3491 내지 3980번째 아미노산서열 부위에 특이적으로 결합할 수 있다.
<70> 본 발명의 용어 "항체''는 비브리오 폐증균 RtxAl 단백질에 대한 특이 항체로 서， 완전한 항체 형태뿐만 아니라 상기 항체 분자의 항원 결합 단편도 포함하는 의 미이다.
<7i> 완전한 항체는 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 구조이며 각각의 경쇄는 증쇄와 다이설파이드 결합으로 연결되어 있다. 중쇄 불변 영역은 감마 뮤 (μ), 알파 (α), 델타 (δ) 및 엡실론 (ε ) 타입을 가지고 서브 클래스로 감마 1(γ1), 감마 2(γ2), 감마 3(γ3), 감마 4(γ4), 알파 1( α 1) 및 알파 2( α2)를 가진다. 경쇄의 불변영역은 카파 ( Κ ) 및 람다 (λ) 타입을 가진다 (Cellular and Molecular Immunology, Wonsiewicz, M. J., Ed. , Chapter 45, pp. 41ᅳ 50， W. B. Saunders Co. Philadelphia, PA(1991); Nisonoff , A. , Introduction to Molecular Immunology, 2nd Ed. , Chapter 4, pp. 45-65 , sinauer Associates, Inc. , Sunderland, MA (1984)).
<72> 항체 분자의 항원 결합 단편이란 항원 결합 기능을 보유하고 있는 단편을 의 미하며， Fab, F(ab'), F(ab')2 및 Fv등을 포함한다. 항체 단편 중 Fab는 경쇄 및 중쇄의 가변영역과 경쇄의 불변 영역 및 중쇄의 첫 번째 불변 영역 (CH1)을 가지는 구조로 1개의 항원 결합 부위를 가진다. Fab'는 중쇄 CH1 도메인꾀 C-말단에 하나 이상의 시스테인 잔기를 포함하는 힌지 영역 (hinge region)을 가진다는 점에서 Fab 와 차이가 있다. F(ab')2 항체는 Fab'의 힌지 영역의 시스테인 잔기가 디설파이드 결합을 이루면서 생성된다. F 는 중쇄 가변부위 및 경쇄 가변부위만을 가지고 있 는 최소의 항체조각으로 FV 단편을 생성하는 재조합 기술은 PCT국제 공개특허출원 W088/ 10649, W0 88/106630, W0 88/07085, W0 88/07086 및 W0 88/09344에 개시되어 있다. 이중쇄 Fv (two-chain Fv)는 비공유 결합으로 중쇄 가변부위와 경쇄 가변부 위가 연결되어 있고 단쇄 Fv(single-chain Fv)는 일반적으로 펩타이드 링커를 통하 여 중쇄의 가변 영역과 단쇄의 가변 영역이 공유 결합으로 연결되거나또는 C-말단 에서 바로 연결되어 있어서 이중쇄 F 와 같이 다이머와 같은 구조를 이롤 수 있다. 이러한 항체 단편은 단백질 가수 분해 효소를 이용해서 얻을 수 있고 (예를 들어， 전체 항체를 파파인으로 제한 절단하면 Fab를 얻을 수 있고 펩신으로 절단하면 F(ab' )2 단편을 얻을 수 있다)， 바람직하게는 유전자 재조합 기술을 통하여 제작할 수 있다.
<73> 본 발명에서 항체는 바람직하게는 Fab, F(ab ' ) , F(ab' )2 및 Fv로 이투어진 군 중 하나의 형태이거나 완전한 항체 형태이다.
<74>
<75> 상기 "중쇄 "는 항원에 특이성을 부여하기 위한 층분한 가변 영역 서열을 갖 는 아미노산 서열을 포함하는 가변 영역 도메인 VH 및 3개의 불변 영역 도메인 CHI, CH2 및 CH3를 포함하는 전체길이 중쇄 및 이의 단편을모두 의미한다. <76> 또한， 상기 "경쇄 "는 항원에 특이성을 부여하기 위한 층분한 가변영역 서열 을 갖는 아미노산서열을 포함하는 가변 영역 도메인 VL 및 불변 영역 도메인 CL을 포함하는 전체길이 경쇄 및 이의 단편을모두 의미한다.
<77>
<78> 본 발명의 용어 "단일클론항체' '는 당해 분야에 공지된 용어로서 단일 항원성 부위 (에피토프)에 대해서 지시되는 고도의 특이적인 항체를 의미한다. 통상적으로， 상이한 에피토프들에 대해 지시되는 상이한 항체들을 포함하는 다클론항체와는 다 르게， 단일클론항체는 항원상의 단일 에피토프에 대해서 지시된다. 단일클론항체는 항원 -항체 결합을 이용하는 진단 및 분석학적 분석법의 선택성과 특이성을 개선시 키는 장점이 있으며， 또한 하이브리도마의 배양에 의해 생산되기 때문에 대량 생산... 이 용이하고 다른 면역글로블린에 의해 오염되지 않는 또 다른 장점을 갖는다.
<79>
<80> 본 발명의 단일클론항체는 당해 기술분야에서 공지된 세포융합방법에 의해
?1 생성된 하이브리도마 세포로부터 얻을 수 있다. 일반적으로 단일클론항체를 분비 하는 하이브리도마 세포는 항원 단백질을 주사한 마우스와 같은 면역학적으로 적합 한 숙주 동물로부터의 면역세포와 암 세포주를 융합함으로써 만들어진다. 이러한 두 가지 세포의 융합은 당업계에서 공지되어 있는 폴리에틸렌클리콜
(polyethyleneglycol )을 이용하는 방법을 통해 융합시키고 항체 생산 세포를 표준 적인 배양 방법에 의해 증식시킨다. 한계 회석법 ( l imited di lut ion)에 의한 서브 클로닝을 실시하여 균일한 세포 집단을 수득하고 난 후， 항원에 특이적인 항체를 생산할 수 있는 하이보리도마 세포를 시험관 또는 생체 내에서 대량으로 배양한다. 세포 융합에 사용되는 골수종 세포로는 마우스 유래의 p3/x63— Ag8, p3-Ul, NS-1 , MPC-11 , SP=2/0, F0, P3x63Ag8.653 , V653, S194, ¾트 유래의 R210 등 다양한 세 포주를 사용할 수 있다. 본 발명의 구체적 실시예에서 사용된 세포주는 골수종 세 포 P3x63Ag8.653이다.
<81>
<82> 본 발명의 단일클론항체는 항원과 결합하여 그 작용을 억제하거나 중화
(neutral izat ion)시키며， 나아가 병원체와 병원체에 감염된 세포를 죽일 수 있다. 예를 들에 비브리오 패혈중균의 독소부분인 RtxAl를 특이적으로 인식하는 단일클 론항체는 이에 결합하여 그 작용을 억제하거나 중화할 수 있고， 항원과 결합된 항 체는 보체를 활성화시킬 수 있으며， 활성화된 보체에 의하여 항원이 제거되도록 할 수 있다. 또한， 단일클론항체는 항원에 결합하여 그 항원이 식균세포에 의하여 더 욱 잘 잡아먹히게 만들 수도 있다. 또한， 단일클론항체가 결합되어 있는 항원 세포 는 자연살해세포 (NK cel l )에 의해 보다 쉽게 살해당함으로써， 상기 단일클론항체를 면역반응을 통한 항원과 이 항원을 생성하는 비브리오 패혈증균의 제거에 이용할 수 있다. 따라서， 항체 자체만으로 면역반응을 통한 항원 및 비브리오 패혈증균의 제거와 감소의 결과를 기대할 수 있어 본 발명의 항체는 비브리오 패혈증균의 진 단 또는 치료에 사용할 수 있다.
<83>
<84> 또한 본 발명의 단일클론항체는, 상기한 바와 같은 결합의 특성을 갖는 한，
2개의 중쇄와 2개의 경쇄의 전체 길이를 가지는 완전한 형태뿐만 아니라， 항체 분 자의 기능적인 단편으로서 비브리오 패혈증 치료 및 진단에 사용될 수 있다. 항체 분자의 기능적인 단편이란， 적어도 항원 결합 기능을 보유하고 있는 단편을 뜻하 며 , Fab, F(ab' ) , F(ab' )2 및 Fv등을 포함할 수 있다.
<85>
<86> 본 발명의 바람직한 또 다른 구현예에 따르면， 상술한 단일클론항체 또는 이 의 항원결합단편을 포함하는 비브리오 패혈증 치료제를 제공하여 상술한 문제의 해 결을 모색하였다. 이를 통해 본 발명의 단일클론 항체는 비브리오 패혈증균의 중 화능력을 나타내므로 항체 단독 또는 통상의 약제학적으로 허용되는 담체와 함께 비브리오 패혈증 감염에 대한 예방 및 치료 조성물로 사용가능하다.
<87> 상기 비브리오 패혈증 치료제는 본 발명의 단일클론항체를 포함하는 비브리 오 패혈증 감염에 대한 예방 및 치료용 약제학적 조성물일 수 있으며, 본 발명의 단일클론항체를 포함하는 약학 조성물은 이미 사용되고 있는 항히스타민제， 소염진 통제 및 항생제 등의 약제와 함께 제제화하거나 병용하여 사용될 수 있다.
<88> 본 발명의 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제 시에 통상적으로 이용되는 것으로서， 락토스， 텍스트로스， 수크로스， 솔비를, 만니 를， 전분, 아카시아 고무， 인산 칼슘, 알기네이트， 젤라틴, 규산칼슴 미세결정성 셀를로스， 폴리비닐피를리돈， 셀를로스, 물， 시럽, 메틸 셀를로스， 메.틸히드록시벤 조에이트， 프로필히드록시벤조에이트， 활석， 스테아르산 마그네슴 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성 분들 이외에 윤활제， 습윤제, 감미제, 향미제, 유화제， 현탁제， 보존제 등을 추가 로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington ' s Pharmaceut ical Sciences (19th ed. , 1995)에 상세히 기재되어 있다.
본 발명의 약제학적 조성물은 경구 또는 비경구로 투여할 수 있고， 비경구 투여인 경우에는 정맥내 주입， 피하 주입， 근육 주입， 복강 주입, 내피 투여ᅳ 국소 투여， 비내 투여， 폐내 투여 및 직장내 투여 등으로 투여할 수 있다. 경구 투여시， 단백질 또는 펩타이드는 소화가 되기 때문에 경구용 조성물은 활성 약제를 코팅하 거나 위에서의 분해로부터 보호되도록 제형화 되어야 한다. 또한 약제학적 조성물 은 활성 물질이 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수 있다. 본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법， 투여 방식, 환 자의 연령, 체중， 성， 병적 상태， 음식， 투여 시간， 투여 경로, 배설 속도 및 반웅 감웅성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 소망하는 치료 또 는 예방에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다. 본 발명의 바람직 한 구현예에 따르면， 본 발명의 약제학적 조성물의 1일 투여량은 0.001 ~ 100 mg/ kg이다. 본 명세서에서 용어 "약제학적 유효량"은 비브리오 패혈증의 감염을 예방 또는 치료하는 데 층분한 양을 의미한다.
본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식 을 가진 자가 용이하게 실시할 수 있는 방법에 따라， 약제학적으로 허용되는 담체 및 /또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다 용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액， 현탁액 또는 유화액 형태이거나 액스제, 산제， 좌제， 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며， 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
제제화할 경우에는 보통 사용하는 충진제， 증량제， 결합제， 습윤제， 붕해제， 계면활성제 등의 회석제 또는 부형제를 사용하여 조제된다.
경구투여를 위한 고형제제에는 정제, 환제, 산제， 과립제, 캡슐제 등이 포함 되며, 이러한 고형제제는 상기 추출물에 적어도 하나 이상의 부형제 예를 들면， 전 분, 탄산칼슘카보네이트 (calcium carbonate) , 수크로스 (sucrose) 또는 락토오스 ( lactose) , 젤라틴 둥을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테 아레이트, 탈크 같은 윤활제들도 사용된다.
<94> 경구를 위한 액상 제제로는 현탁제， 내용액제, 유제， 시럽제 등이 해당되는 데 흔히 사용되는 단순회석제인 물， 리퀴드 파라핀 이외에 여러 가지 부형제， 예를 들면 습윤제， 감미제， 방향제， 보존제 등이 포함될 수 있다.
<95> 비경구 투여를 위한 제제에는 멸균된 수용액， 비수성 용제， 현탁제， 유제, 동결건조 제제， 좌제가 포함된다. 비수성용제， 현탁제로는 프로필렌글리콜
(propylene glycol ) , 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름， 에틸을 레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다.
<96> 좌제의 기제로는 위텝솔 (wi tepsol ) , 마크로골, 트원 ( tween) 61 , 카카오지， 라우린지， 글리세로제라틴 등이 사용될 수 있다.
<97> 본 발명의 항체 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있다.
<98> 항체는 항체-치료제 결합체 형태로 생체내로 투입하여 박테리아 감염 치료에 이용할 수 있다. 치료제는 화학 치료제， 방사성핵종， 면역치료제, 사이토킨, 케모 킨, 독소， 생물작용제 및 효소 저해물질 등을 포함한다. 항생제를 항체에 결합시키 는 방법은, 예를 들면 문헌 G. Gregoriadies , ed. , Academic Press London , (1979)； Arnon et al . , Recent Results in Cancer Res . ,75： 236( 1980)； 및 Moolton et al . , Immunolog. Res . ,62 :47(1982) )에 기재되어 있다.
<99> 본 발명의 항체 또는 항체 단편과 커플링 시키기기에 바람직한 약품은 항세 균， 구충, 항진균 및 관련 약제들이고， 예를 들면 설폰아미드, 페니실린 및 세팔로 스포린， 아미노글리코시드, 테트라사이클린， 클로람페니콜, 피페라진， 클로로퀸， 디아미노피라딘, 메트로니아지드， 이소니아지드， 리팜핀, 스트랩토마이신， 설폰， 에리트로마이신， 폴리믹신, 나이스타틴， 암포테리신， 5-플루오로사이토신, 5-요오 드 -2' -데옥시우리딘， 1-아다만타아민， 아데닌 아라비노사이드, 암만니틴， 리바바린 및 아지도티미딘 (AZT)이며， 바람직하게는 리바바린이다. 약제를 특이적 표적 부위 로 표적화하는데 적당하고 바람직한 여러 가지 조건은 예를 들어 문헌 Trouet et al . , Plenum Press , New York and London, 19-30( 1982)에 보고되었다. 유효한 치료 제를 미생물 항원에 대해 제조된 매우 특이성이 있는 항체를 사용하여 감염 병소에 직접 타겟팅하여 감염균을 선택적으로 죽임으로써 약품에 내성이 있는 감염을 치료 할 때에 발생하는 많은 문제점을 해결할 수 있다. 또한 병소로 타겟팅된 약품은 감 염 부위에서는 높은 농도로 약효를 상승시킬 수 있다.
ιοο> 상기 항체-치료제 결합체에서 치료제로 이용될 수 있는 면역조절제는 림포카 인 및 사이토카인를 포함하지만， 이에 한정되지 않는다. 결국, 본 발명은 비브리오 패혈증균 RtxAl 단백질에 대한 다클론항체 및 단 일클론항체 및 상기 항체를 생산하는 하이브리도마 세포주를 제공하며, 본 발명의 비브리오 패혈증균 RtxAl 단백질에 대한 다클론항체 및 단일클론항체는 비브리오 패혈증균 RtxAl 단백질에 대한 고친화도의 특이적 결합능력을 가지므로， 비브리오 패혈증의 진단 및 진단용 키트 제조에 유용하게 사용될 수 있다. 또한, 다클론항체 및 단일클론항체의 비브리오 패혈증 감염 억제 효과， 비브리오 패혈증 감염에 대한 예방 및 치료 효과뿐만 아니라， 비브리오 패혈증 감염 후 마우스 생존율이 우수하 여 비브리오 패혈증에 대한 치료제로 사용될 수 있다. 이하， 실시예를 통하여 본 발명을 더욱 상세히 설명하기로 한다. 이들 실시 예는 단지 본 발명을 예시하기 위한 것이므로， 본 발명의 범위가 이들 실시예에 의 해 제한되는 것으로 해석되지는 않는다.
[실시예]
실시예 1: 비브리오 패혈증균의 재조합 RtxAl합성을위한을리고뉴클레오 타이드 합성
Nhel 및 Xhol 제한효소 인식부위를 갖는 하기 2개의 올리고 뉴클레오타이드 를 합성하였다. 또한 RA-4701R 올리고 뉴클레오타이드는 재조합 RtxAl의 정제 과정 중 히스티딘 -결합 레진을 이용한 크로마 S그래프에 의한 정제과정을 추가 포함하기 위하여 6개의 히스티딘 (6x-His tag)을 포함하고 있다.
^-349^ :5' - 0 ^ 八6 6 6^ { ^ ^-3 ' (서열번호： 1 , 전방프라 이머)
RA-4701R： 5 ' -CTCCTCGAGCTMTGATGATGATGATGATGCACCGmTACCCTm ATG-3 ' (서 열번호: 2， 후방 프라이머) 상기 뉴클레오티드를 후속하는 비브리오 패혈증균 RtxAl 유전자의 증폭 (하 기 실시예 2) 및 재조합 RtxAl 단백질 생산을 위한 재조합백터의 제조에 이용하였 다. 실시예 2: 중합효소연쇄반웅 (polymerase chain react ion (PCR)) <116> 중합효소 및 상기 실시예 1에서 합성한 전방 프라이머 (서열번호 1) 및 후방 프라이머 (서열번호 2)를 흔합한 반응용액에 비브리오 패혈증균 RtxAl 전장 DNA (서 열번호 3， 14106bp)-(NCBI accession No. CP002470.1)를 주형 (template)으로 흔합 하여 중합효소연쇄반웅을 수행하여 비브리오 패혈증균 RtxAl의 아미노산 서열 3491 부터 47이부분을 증폭 (RtxAl(3491-4701)로 명명함)하였다. 서열번호 4는 전장 비브 리오 패혈증균 RtxAl의 아미노산 서열 -(NCBI accession No . ΥΡ_004191Γ72.1)이다. 중합효소연쇄반웅을 위하여 써멀 싸이클러 (Thermalcycler(PTC-lOO) , MJ Research. Inc, 미국)를 사용하였으며 94°C에서 3분간 사전변성 (predenaturat ion) 시킨 후， 94°C에서 1분간 변성 (denaturat ion) , 55°C에서 1분간 결합 (anneal ing) 및 72°C에서 4분간 연장 (extension)을 30회 반복 실시하고， 마지막으로 72°C에서 10분간 추가 반웅시켰다. 다음 증합효소와 비특이적 증폭산물을 제거하기 위해 아가로즈 겔에서 전기영동 후 원하는 증폭산물 밴드 부위를 조각내어 겔 추출 키트 (Geneal l , 한국) 를 이용하여 정제하였다.
<117>
<1 18> 실시예 3: 재조합 RtxAl(3491-4701) 발현 백터의 제작
<Π9> 도 1의 개열 지도를 갖는 재조합 RtxAl 풀라스미드 백터를 제작하였다. 구체 적으로, 상기 실시예 2에서 정제된 C-말단에 poly his tag 서열인 CATCATCATCATCATCAT(6x-Hi s tag)을 삽입한 RtxAl (3491-4701)의 증폭산물을 EcoRI (Ferment as , 캐나다)으로 절단 후 대장균 중합효소인 Klenow(New England Biolab, 미국)을 이용하여 절단면을 채우고 ( f i l l in) , Xhol (Ferment as , 캐나다)으로 절단 하였다. 또한， pET-21(a) (Novagen, 미국) 백터는 Nhel (Ferment as , 캐나다)으로 절단 후 대장균 중합효소인 KIenow(New England Biolab, 미국)을 이용하여 절단면 을 채우고 ( f i l l in) , Xhol (Ferment as , 캐나다)으로 절단하였다. 절단된 단편과 백 터는 상기 실시예 2에서 이용된 겔 추출 키트 (Geneal l , 한국)를 이용하여 정제한 후 정제된 RtxAl 유전자 단편 1 과 pET— 21(a) 단편 30 ng을 흔합하고, 10배 농 도의 접합 농축액 (10 mM DTT, 100 mM MgCl2, 10 mM ATP, 600 mM Tri s-HCl , pH7.5) 1
^ 및 T4 DNA 연결효소 ( l igase, Takara) 10 단위 (unit )를 가하여 전체 부피를 10 로 조정하고 상은에서 16시간 반웅시켜, pET-21(a) 백터에 재조합 RtxAl 유전자 ( 서열번호 5 + 6x-His tag)가 삽입된 9,027bp의 도 1의 개열지도를 갖는 환형 플라 스미드 (pET-RtxAl(3491-4701)로 명명)를 제조하였다. 다음 플라스미드를 증폭하고, RtxAl(3491-4701) 유전자 (서열번호 5)가 삽입된 pET-RtxAl( 3491-4701)만을 순수분 리하기 위해 대장균 DH5 a (Invitrogen, 미국)에 삽입하였다. 형질전환된 대장균으 로부터 재조합 pET-RtxAl(3491-4701)을 재추출한 후 DNA 염기서열 분석과 제한효소 를 처리하고 아가로스 겔 전기영동을 실시하여 pET-RtxAl(3491-4701)에 비브리오 패혈증균 RtxAl(3491-4701) 유전자의 존재 유무를 확인하였다.
<120>
<i2i> 실시예 4: 재조합 RtxAl(3491-4701) 단백질의 발현
<122> 상기 실시예 3에서 제조한 재조합 RtxAl 백터 pET-RtxAl (3491-4701)의 발현 을 위해 대장균 BL21(DE3) /pLyS( Invi t rogen , 미국)에 삽입하였다. 형질전환된 대장 균을 371： 진탕 배양기에서 4시간 배양한 후 1 mM IPTG을 첨가하여 다시 3시간을 더 배양하였다. 이렇게 배양한 형질전환된 대장균을 8 , 000 rpm에서 30분간 원심분 리한 후， 대장균침전물은 용출완축액 (300 mM NaCl , 25 mM Tr i s-HCKpH 7.5)， 10% glycerol , 0. 1% Tween-20)으로 현탁하였다. 단백질 추출을 위해 현탁한 대장균침전 물을 초음파분쇄기 (soni cator )를 이용하여 파쇄한 후 원심분리에 의해 상등의 단백 질 추출액을 수집하였다.
<123>
<124> 실시예 5: 재조합 RtxAl(3491-4701) 단백질의 정제
<125> 재조합 RtxAl(3491-4701) 제조용 백터 pET-RtxAl( 3491-4701)으로 형질전환된 대장균에서 상기 실시예 4의 방법으로 단백질을 추출한 후, Ni -NTA크로마토그래피 (Qi agen , 미국)를 제조자의 지시에 따라 단백질 추출액으로부터 재조합 RtxAl(3491-4701) 단백질을 1차적으로 정제하였다. Ni-NTA 크로마토그래피를 이용 하여 1차 정제한 재조합 RtxAl(3491-4701)단백질을 겔 여과 액체크로마토그래피 (s i ze exclus ion-FPLC) (GE Heal thcare , 미국)을 이용하여 2차적으로 순수 정제하 여 재조합 RtxAl(3491-4701)단백질 (서열번호 6 + 6x-Hi s t ag)을 생산하였다. 정제 양상과 정제 효율은 SDS-PAGE를 수행하여 확인하였다. 그 결과를 도 2에 나타내었 다.
<126>
<127> 도 2에 나타난 바와 같이, 레인 1은 정제된 대조군 Glutathi one S- transferase(GST로 명명) 단백질이고, 별표는 대조군 단백질 GST의 위치를 나타낸 다. 또한, 레인 2는 Ni -NTA 크로마토그래피와 겔 여과 액체크로마토그래피에서 정 제된 RtxAl(3491-4701)단백질이고, 화살표는 정제된 재조합 RtxAl (3491-4701) 단 백질의 위치를 나타낸다. 레인 2에서 확인되는 바와 같이 정제된 재조합 RtxAl(3491-4701) 단백질은 98%의 순도를 보였다.
<128>
<129> 실시예 6: 재조합 RtxAl(3491-4701) 단백질의 특이성 분석 상기 실시예 5에서 확인된 130 kDa의 재조합 RtxAl(3491-4701)단백질과 대조 군 GST 단백질을 SDS— PAGE를 실시하고, 전기영동 종료 후 겔 상 단백질을 토우빈 (Towbin)의 (Towbin H, Staehel in T, Gordon J . Proc Nat l Acad Sci USA 1979； 76 :4350-4354)방법에 따라 니트로셀를로오스 막 (Nitrocel lulose membrane) (Bio- Rad)으로 옮겼다. 단백질이 이적된 니트로셀를로오스 막을 5% 탈지유 (skim mi lk)가 함유된 인산완층용액으로 비특이적 반응을 차단하였다. 여기에 실시예 18의 비브리 오 패혈증균에 감염된 CD-I 쥐에서 얻은 혈청을 1 : 1000의 부피비로 회석하여 실은 에서 1시간 동안 반웅시키고， 퍼옥시다제로 표지된 IgG (Jackson labatory, 미국) 2차 항체를 제조사의 지시에 따라 회석하여 사용하였다. 1차와 2차 항체로 반웅시 킨 후에는 인산완충용액 (PBS)으로 3회에 걸쳐 세척하였다. 2차 항체반웅 및 세척이 끝난 니트로셀를로오스 막에 ECL 웨스턴 블럿 (western blot ) 기질액 (Amersham, 미 국)을 처리하고， 발광영상분석기 (LAS-1000 luminescent image analyzer ; Fuj i f i lm, 일본)를 이용하여 결과를 분석하였으며， 그 결과를 도 3에 나타내었다. 도 3에 나 타난 바와 같이， 레인 1은 대조군 GST 단백질이고， 레인 2는 재조합 RtxAK3491- 4701)단백질이다. 도 3에서 확인되는 바와 같이 재조합 RtxAl(3491-4701) 단백질은 야생종 비 브리오 패혈증균 감염 혈청에 대해서 양성반웅을 보이나， 대조군 GST은 반응하지 않았다ᅳ 따라서， 실시예 5에서 순수 정제된 130kDa의 재조합 단백질은 비브리오 패 혈증균 RtxAl(3491-4701) 단백질임이 확인되었다. 결국， 본 발명에 따른 재조합 RtxAl(3491-4701) 발현 백터는 비브리오 패혈 증균 RtxAl단백질에 대한 단일클론항체 생성에 매우 유용한 재조합 RtxAl 단백질 항원을 제공한다. 또한， 이는 비브리오 패혈증균 RtxAl을 이용한 진단에 매우 유용 한 재조합 RtxAl(3491-4701)단백질을 제공하고， 재조합 RtxAl (3491-4701) 단백질의 대량 발현 및 정제가 용이하게 한다. 따라서 이와 같은 형질전환 대장균에서 발현 된 재조합 RtxAl(3491-4701)단백질은 비브리오 패혈증균에 대한 진단제 또는 진단 키트， 비브리오 패혈증 예방 또는 치료용 백신의 제조, 및 비브리오 패혈증균에 대 한 항체 생산 등에 이용될 수 있다. 실시예 7: 단일클론항체 생산세포주 제작을 위한마우스 면역
실시예 5에서 제조된 RtxAl (3491-4701) 재조합 항원 단백질 (서열 번호 6+6χ- Hi s tag)을 Sigma adjuvant (Sigma, 미국)와 동량 ( 1 : 1의 부피비로)으로 흔합한 다 음， 3주 간격으로 4차례 BALB/C (암컷， 8 주령) 마우스의 복강에 씩 주사하였 다. 4번째 면역 한 달 후 꼬리 정맥으로 정제된 재조합 RtxAl(3491-4701) 단백질을 투여한 3일 후에 비장을 적출하여 세포융합에 사용하였다. 실시예 8: B-임프아세포 (B-lymphob st)인 P3X63Ag8.653의 배양
세포융합하기 5일 전에 질소통에서 보관된 골수종세포 (myeloma)인 P3X63Ag8.653 (ATCC accession number CRL-1580)를 꺼내어 10% 우태아혈청 (FBS)이 첨가된 IMDMdnvitrogen, 미국) 배지에 현탁시키고, 1,000 rmp에서 5분간 원심분리 하였다. 상층액을 버리고 침전세포를 조심스럽게 10% 우태아혈청이 첨가된 IMDM에 다시 현탁 시켜 5% 탄산가스가 공급되는 37°C 배양기에서 배양하였다. 실시예 9： 세포융합 (cell fusion)
세포융합은 폴리에틸렌글리콜을 사용하는 일반적인 방법 (Ed Harlow, David Lane ： Antibodis, A laboratory manual . Cold Springs Harbor press, 1988 P139- 244)에 따라 다음과 같이 실시하였다. 실시예 7에서 적출한 비장에서 비장세포들
(splenocytes)을 cell strainer(Falcon, 미국)를 이용하여 분리하고, 1 x 1()8세포 / m의 농도로 회석하였다. 1 X 107세포 /1 의 골수종 (myeloma) 세포와 의
PEG1500(Sigma, 미국)을 흔합하여 융합시켰다. 융합이 완료된 세포를 200 ^의 HAKSigma, 미국) 배지에 회석시킨 후 96 웰 마이크로플레이트에 100 ^씩 분주하 고， 5¾ 탄산가스가 공급되는 37°C 배양기에서 배양하였다. 실시예 10: 세포융합된 하이브리도마 세포에서 RtxAl(3491-4701)항체 생성 확인
융합된 세포의 항체 생성 여부는 대장균에서 발현된 재조합 RtxAl(3491- 4701) 항원과 융합된 세포 배양액을 이용하여 ELISA를 수행하여 확인하였다. 재조 합 RtxAl(3491-4701) 항원 단백질을 탄산염 완층액 (carbonate buffer)(pH 9.4)으로 10 ugM 농도로 회석한 다음, Maxisorp ELISA 플레이트 (Nunc, 미슥)의 각 웰 당 100 씩 첨가하고, 4°C에서 16시간 반응시켜 항원을 코팅하였다. 항원이 코팅된 각 웰에 1% BSA 가 포함된 블러킹완충용액 (PBS, 0.05% Tween-20, 1% BSA, 3% 열 비활성 말 혈청)을 처리하여 37°C에서 1시간 동안 비특이적 반웅을 차단하였다. 각 웰에 융합된 세포배양액을 50 ^씩 첨가하고， 4°C에서 1 시간 반웅한 다음 세척완 충용액 (PBS, 0.05% Tween-20, 0.05% BSA)으로 3회 세척하였다. 세척 후 1:1000배 회석한 Biot in-축합 항-마우스 IgG+IgA+IgM 항체 (1 :2，000； Sigma, 미국)를 각 웰 당 100 ^씩 첨가하고 37°C에서 1 시간 반웅시킨 다음 세척완충용액으로 3회 세척 하였다. 세척 후， HRP(Horseradish peroxidase)一축합 streptavidindnvi trogen, 미 국)를 각 웰 당 100 ^씩 첨가하고 37°C에서 1 시간 반응시킨 후 다시 세척완층용 액으로 3회 세척한 후, 연이어 TMB (3,3 ' ,5,5' - tetramethylbenzidine)(Sigma, 미 국) 기질용액을 각 웰 (wel l )에 100 ^씩 첨가하고 암소에서 30분간 반응시켜 발색 한 후 2N H2S04를 처리하여 효소반웅을 정지시켰다. 반웅 후, ELISA 리더기를 이용 하여 450 nm에서 흡광도를 측정하였다.
그 결과， 표 1에 나타난 바와 같이, 비브리오 패혈증균 RtxAK 3491-4701) 항 원과 반웅하는 37개의 하이브리도마 세포를 얻었다. 실시예 11: 하이브리도마 세포의 클로닝
융합된 37개의 하이브리도마 세포의 클로닝을 위하여 실시예 5에서 얻은 재 조합 RtxAl(3491-4701) 항원과 반웅하는 하이브리도마를 96 웰 플레이트의 첫 번째 웰에 약 10개의 세포가 들어가도톡 세포 부유액을 넣은 후， 행으로 2배 단계 회석 하고， 이를 다시 열로 2배 단계 회석하는 방법으로 2회 클로닝 하였다. 선별 된 하 이브리도마 클론은 30% 우태아 혈청과 7.5 DMSO(dimethyl sul foxide)가 함유된 IMDM배지에 현탁 시켜 액체질소에 보관하였다. 실시예 12: 단일클론항체의 복수 (ascites) 생산 및 정제
단일클론항체의 복수 생산을 위하여， 실시예 11에서 선발된 단일클론항체를 생산하는 하이브리도마를 배양하여 프리스텐 (Sigma, 미국)으로 프라이밍 (priming) 한 BALB/C (암컷, 8 주령) 마우스의 복강내에 1 X 106 세포 / 의 농도로 0.5 주 입하고, 마우스의 복강내에 복수가 생성되면 채취하였다. 수확한 복수를 1500 rpm 으로 10분간 원심분리하고, 상층액을 수확하여 -8( C 초저온 넁동고에서 보관하였 다.
또한， 단일클론항체의 정제를 위해서는 실시예 11에서 선발된 단일클론항체 를 생산하는 하이브리도마 세포를 37°C , 5% 탄산가스 항은기에서 배양 후, 상등액 에서 항체를 정제하였다. 항체의 정제는 단백질 A 또는 G 크로마토그래피 (Peptron, 한국)를 이용하였으며， 실험과정은 제조사의 방법에 따라 수행하였다. 실시예 13: 이소타이핑 ( isotyping)에 의한 단일클론항체의 선별 <i57> 단일클론항체의 이소타입 ( i sotype)의 결정은 ELISA를 실시하여 조사하였다.
<158> 이소타입 결정을 위하여, 토끼에서 생선 된 각각의 쥐 (mice)의 이소타입쉐 대한 정제된 항체가 탄산염 완충액 (carbonate buf fer , pH 9.4)로 10 ^g/mi 농도로 회석한 다음 Maxi sorp ELISA 플레이트 (Nunc , 미국)의 각 웰 당 100 ^씩 첨가하고, 4°C에서 16시간 반웅시켜 항체를 코팅하였다. 각각의 이소타입 항체가 코팅된 각 웰에 1% BSA가 포함된 블러킹 완층용액 (PBS, 0.05% Tween-20, 1% BSA, 3% 열 비활 성 말 혈청)을 처리하여 37°C에서 1시간 동안 비특이적 반웅을 차단하였다. 각 웰 에 단일클론항체 생성 하이브리도마 세포배양액을 50 ^씩 첨가하고, 4°C에서 1 시 간 반웅한 다음, 세척완층용액 (PBS, 0.05% Tween— 20， 0.05% BSA)으로 3회 세척하였 다. 세척 후 1 : 1000배 회석한 HRP (Horseradi sh peroxidase)—축합 항-마우스 IgG+IgA+IgM 항체 ( 1 : 2000 ; Sigma, 미국)를 각 웰 당 100 ^씩 첨가하고 37°C에서 1 시간 반웅시킨 다음 세척완층용액으로 3희 세척하였다. 세척 후 TMB (3ᅳ 3 ' , 5，5 ' - tetramethylbenzidine) (Sigma, 미국) 기질용액을 각 웰에 100 ^씩 첨가하고 암 소에서 30분간 반웅시켜 발색한 후， 2N H2S04를 처리 하여 효소반웅을 정지시켰다. 반웅 후 ELISA 리더를 이용하여 450 ran에서 흡광도를 측정하였다. 그 결과를 표 1 에 나타내었다.
<159> 표 1에 나타난 바와 같이 , 이소타입을 분석한 결과， 중쇄 (heavy chain)의 서 브클래스에 따라 분류할 수 있었으며， 16개는 IgGl 서브클래스， 18개는 IgG2a 서브 클래스 및 나머지 3개는 IgG2b서브클래스의 이소타입을 가짐을 확인할 수 있었다.
<160>
<i6i> 실시예 14: 단일클론항체의 친화도 분석 및 항원결정기 분석을 위한
RtxAl(3491-4701) 단편의 발현
<162> 비브리오 패혈증균 RtxAl의 아미노산 서열 3491부터 4701을 포함하는 재조합
RtxAl(3491-4701) 단백질은 실시예 4에서 발현된 것을 사용했다. 비브리오 패혈증 균 RtxAl의 아미노산 서열 3491부터 4380을 포함하는 RtxAl(3491-4380)의 유전자 부위는 EcoRI 및 X ol 제한효소 인식부위를 갖는 하기 2개 (RA-3491F2와 RA-4380R) 의 올리고 뉴클레오타이드와 중합효소연쇄반웅를 이용하여 실시예 2와 같은 방법으 로 증폭하였다.
<163>
<i64> RA-3491F2： 5 ' -ACATGAAnCATACCATGGCAGAGAAGTTTGGCGACTAC-3 ' (서열번호 7， 전방 프라이머)
d65> RA-4380R: 5 ' -CCA CTCGAGCTAATGATGATGATGATGATGCGTGCC GTTGCGTAGAACAC-3 ' (서열번호 8, 후방 프라이머)
<166>
<167> 또한， RtxAl의 아미노산 서열 3491부터 3980을 포함하는 RtxA 1(3491-3980)의 유전자 부위는 EcoRI 및 Xhol 제한효소 인식부위를 갖는 하기 2개 (RA-3491F2와 RA- 3980R)의 올리고 뉴클레오타이드와 중합효소연쇄반웅을 이용하여 실시예 2와 같은 방법으로 증폭하였다.
<168>
<169> RA-3491F2: 5 ' -ACATGMTTCATACCATGGCAGAGMGmGGCGACTAC-3 ' ' (서열번호
7, 전방 프라이머)
<i70> RA-3980R:5 ' -CCATTCTCGAGCTAATGATGATGA GATGATGCTCACCCGAGGTGGCAATGC-3 ' ( 서열번호 9， 후방프라이머)
<171>
<172> 증폭된 RtxAl (3491-4380) 및 RtxAl(3491-3980) 유전자 부위는 실시예 3과 같 은 방법으로 pET-21(a) 백터에 삽입되고， 실시예 4와 같은 방법으로 형질 전환된 대장균올 이용하여 재조합 RtxAl(3491— 4380)과 RtxAl (3491-3980) 단백질을 발현하 고 추출하였다 (도 5) . 추출된 재조합 단백질의 특이성 분석은 실시예 6과 같은 방 법을 이용하여 확인 하였다 (도 6) . 그 결과를 도 5 내지 도 6에 나타내었다.
<173>
<174> 도 4는 형질전환 대장균에서 발현된 재조합 RtxAl (3491-4701) 단편 단백질을 모식적으로 보여 주고 있다.
<Π5> 또한， 도 5는 분자량 크기는 도의 왼쪽에 표시되어 있고， 제 1레인， 2레인， 3 레인 및 4레인은 각각 대조군 재조합 단백질과 재조합 RtxAl(3491-4701)， RtxAl(3491-4380) 및 RtxAl(3491-3980)을 발현하는 형질 전환 대장균에서 추출된 단백질 '을 나타낸다. 화살표는 발현된 재조합 RtxAl(3491-4701) , RtxAl (3491-4380) 및 RtxAl (3491-3980) 단백질의 위치를 나타낸다.
<176> 나아가, 도 6은 비브리오 패혈증균 RtxAl 단백질에 대한 항체를 이용하여 재 조합 RtxAl(3491-4701) , RtxAl (3491-4380) 및 RtxAl (3491-3980) 단백질의 특이성 을 분석한 결과이다. 분자량 크기는 도의 왼쪽에 표시되어 있고, 레인 1 , 레인 2， 레인 3 과 레인 4는 각각 대조군 재조합 단백질， 재조합 RtxAl(3491-4701) , RtxAl (3491-4380) 및 RtxA 1(3491-3980)을 발현하는 형질 전환 대장균에서 추출된 단백질 을 나타낸다. 화살표는 RtxAl 단백질에 대한 항체가 양성 반웅 보이는 RtxAl(3491- 4701) , RtxAl(3491-4380) 및 RtxAl (3491-3980) 단백질의 위치를 나타낸다.
Ί77> <i 78> 따라서， 도 5 및 도 6을 통해 재조합 RtxAl(3491ᅳ 4701) , RtxAK 3491-4380) 및 RtxAl(3491-3980)단백질이 확인되었다.
<179>
<180> 실시예 15: 단일클론항체의 친화도 분석 및 항원결정기 분석
<181> 진단 및 치료용 단일클론항체의 선별에 유용한 정보로 사용되는 단일클론항 체의 친화도 분석 및 항원결정기 분석은 실시예 14에서 확인한 재조합 RtxAl(3491- 4701)의 단편과 ELISA법에 의해 수행되었다.
<182> 재조합 RtxAl(3491-4701)， RtxAl (3491-4380) 및 RtxAl(3491-3980) 단백질을 발현하는 형질전환 대장균 추출물을 각각 탄산염 완층액 (carbonate buffer) (pH 9.4)으로 희석한 다음， Maxisorp ELISA 플레이트 (Nunc, 미국)의 각 웰 당 100 μϊ 씩 첨가하고, 4°C에서 16시간 반웅시켜 각각의 재조합 단백질을 코팅하였다. 각각 의 재조합 단백질이 코팅된 각 웰에 1% BSA가 포함된 블로킹완층용액 (PBS, 0.05% Tween-20, 1% BSA, 3% 열비활성 말 혈청)을 처리하여 37°C에서 1시간 동안 비특이 적 반응을 차단하였다. 각 웰에 단일클론항체를 포함한 세포배양액을 50 ^씩 첨가 하고, 4°C에서 1 시간 반웅한 다음 세척완층용액 (PBS, 0.05% Tween-20, 0.05% BSA) 으로 3회 세척하였다. 세척 후 1 : 1000배 희석한 Biot in-축합 항-마우스 IgG+IgA+IgM 항체 (1: 2, 000； Sigma, 미국)를 각 웰 당 100 ^씩 첨가하고 37°C에서 1 시간 반웅시킨 다음, 세척완층용액으로 3회 세척하였다. 세척 후 HRP (Horseradish peroxidase)-축합 ^^^크 ！를 각 웰 당 100 ^씩 첨가하고 37 °C 에서 1 시간 반응시킨 후, 다시 세척완층용액으로 3회 세척하고， 연이어 TMB (3,3'，5，5' - tetramethyl-benzidine) (Sigma, 미국) 기질용액을 각 웰에 100 ^씩 첨가하여 암소에서 30분간 반웅시켜 발색한 다음, 2N S04를 처리하여 효소반웅을 정지시켰다. 반응 후 ELISA 리더를 이용하여 450 nm에서 흡광도를 측정하였다. 그 결과를 표 1에 나타내었다.
<183>
<184> 하기 표 1에서 확인되는 바와 같이， 단일클론항체의 항원결정기 분석 결과，
10개는 재조합 단백질 RtxAl(3491-4701) 항원을 강하게 인식하였고, 13개는 RtxAl(3491-4380) 및 RtxAl(3491-4701)항원을 동시에 인식하였다. 또한, 14개는 RtxAl(3491ᅳ 3980)항원， RtxAl(3491-4380)항원 및 RtxAl(3491-4701)항원을 모두 인 식하였다.
<185> 이를 통하여 14개 (2RA, 3RA, 8RA, 11RA, 19RA, 21RA, 22RA, 23RA, 24RA,
32RA, 40RA, 46RA, 47RA, 50RA)는 RtxA 1(3491-3980)을 인식하고, 13개 ( IRA, 5RA, 7RA, 9RA, 12RA, 13RA, 14RA, 20RA, 26RA, 28RA, 29RA, 38RA, 44RA)는 RtxAl(3981- 4380)을 인식하고， 10개 (4RA, 10RA, 16RA, 27RA, 30RA, 41RA, 42RA, 45RA, 48RA, 52RA)는 RtxAl(4381-4701)을 인식함을 알 수 있었다 (도 7).
<186>
<187> 따라서， 본 발명을 통해 항원결정기가 다른 3그룹의 단일클론항체를 확보할 수 있었으며， 각 그룹의 단일클론항체들은 비브리오 패혈증균의 예방 및 치료용 단 일클론항체 및 비브리오 패혈증균의 항원진단제 개발뿐만 아니라， 단일클론항체를 이용한 비브리오 패혈증균에 대한 기초연구에 유용하게 이용될 수 있다.
<188>
<189> 실시예 16: 단일클론항체들간의 경쟁적 결합분석
<190>
<i9i> *RtxAl(3491-3980)을 인식하는 47RA 단일클론항체와 실시예 24에서 치료효과 조사를 위해 사용한 3개 (13RA, 21RA, 24RA) 및 10RA의 단일클론항체와 결합부위가 상이한지를 알아보기 위해서， Biotin로 표지 (labeling)된 47RA(Biot in-축합 47RA로 명명)을 이용하여, 단일클론항체들간의 경쟁적 결합 분석을 수행하였다.
<192>
<193> Biotin-축합 47RA을 생성하기 위해서, 실시예 12에서 정제한 47RA와 항체
Biotin labeling kit(FluoReporter Biotin-XX Protein labelling kit , Molecular Probes, 미국)를 이용하여 제조자의 지시에 따라 수행하였으며， Biotin-축합 47RA 을 생성 하였다.
<194> 단일클론항체 47RA와 4개 (lORA, 13RA, 2 IRA, 24RA)의 단일클론항체들간의 경 쟁적 결합분석을 위하여， 실시예 5에서 정제된 재조합 RtxAl(3491-4701)와 Biotin- 축합 47RA을 이용한 경쟁적 ELISA을 수행하였다.
<195> 실시예 5에서 정제된 재조합 RtxAl(3491-4701) 단백질을 탄산염 완층액
(carbonate buffer, pH 9.4)으로 2. /ig/i 로 회석한 다음 Maxisorp ELISA 플레이트 (Nunc, 미국)의 각 웰 당 55 ^씩 첨가하고， 4°C에서 16시간 반웅시켜 재조합 RtxAl(3491-4701) 단백질을 코팅하였다. 재조합 단백질을 코팅한 각 웰에 1% BSA가 포함된 블로킹완층용액 (PBS, 0.05% Tween-20, 1% BSA, 3% 열비활성 말 혈청)을 처 리하여 37°C에서 1시간 동안 비특이적 반응을 차단하였다. 각 웰에 단일클론항체를 포함한 세포배양액올 50 ^씩 첨가하고， 4°C에서 1 시간 반응한 다음, 4 ； «g/m£의 Biotinᅳ축합 47RA을 15 ^씩 추가로 첨가하고 4°C에서 1 시간 반응시켰다. 그 후， 세척완충용액 (PBS, 0.05% Tween-20, 0.05% BSA)으로 3회 세척하고, HRPCHorseradish peroxidase)-축합 streptavidin를 각 웰 당 100 ^씩 첨가하고 37 °C에서 1 시간 반웅시킨 후, 다시 세척완충용액으로 3회 세척하고 연이어 TMB (3，3'，5,5' - tetramethyl -benzidine) (Sigma, 미국) 기질용액을 각 웰에 100 ^씩 첨가하여 암소에서 30분간 반웅시켜 발색한 후 2N H2S04를 처리하여 효소반웅을 정 지시켰다. 반웅 후 ELISA 리더를 이용하여 450 nm에서 흡광도를 측정하고， 각각의 단일클론항체가 존재할 때의 Biot in-축합 47RA 결합 강도를 ¾로 나타내었다. 그 결 과를 도 8에 나타내었다. 도 8에 나타난 바와 같이， 결과적으로 Biot in-축합 47RA는 4개 (10RA, 13RA, 21RA, 24RA)의 단일클론항체와 재조합 RtxAl(3491-4701)단백질에 경쟁적 결합을 하 지 않았다.
따라서， 단일클론항체 47RA는 상기 4개 (10RA, 13RA, 21RA, 24RA) 단일클론항 체와 서로 다른 부위에 결합함을 나타낸다. 실시예 17: 야생종 비브리오 패혈증균의 배양
야생종 비브리오 패혈증균 M06-24/0 균주 (Reddy GP, Hayat II， Abeygunawardana C, Fox C' et al . J Bacterid . 174:2620-2630, 1992)를 2.5% NaCl 을 포함한 HKheart infusion) 배지에 접종한 후， 37°C 진탕 배양기에서 16시간 배 양하였다. 이 배양액의 1/200을 다시 2.5% NaCl이 포함한 HI 배지 (Di fco Co . )에 접 종한 후， 37°C 진탕 배양기에서 4시간 동안 본 배양을 수행하였다. 실시예 18: 야생종 비브리오 패혈증균 감염 혈청 생성
CD1(암컷, 8 주령) 마우스에 실시예 17에서 배양한 야생종 비브리오 패혈증 균 1 X lo nrf를 복강 내에 투여하고， 3주 후에 액와정맥 (axi l lary vein) 절개를 통하여 혈액을 얻고， 12000 rpm에서 3분간 원심분리 하여 야생종 비브리오 패혈증 균 감염 혈청을 생성하였다. 실시예 19: 재조합 RtxAl(3491-4701) 단백질 항원의 백신 효과
실시예 5에서 제조된 RtxAl(3491-4701) 재조합 항원단백질 (서열 번호 6+6χ- His tag tag) 20 ug을 실시예 7과 같은 방법으로 Sigma adjuvant (Sigma, 미국)와 흔합한 다음， 3주 간격으로 2차례 CD1(암컷， 8 주령) 마우스의 복강에 주사하였다. 2번째 면역 후 14일 후에 실시예 17에서 배양한 야생종 비브리오 패혈증균 8 X
106/ιη£을 복강으로 투여하고 치사 여부를 96시간 동안 관찰하였다. 그 결과를 도 9 에 나타내었다.
<208>
<209> 도 9에 나타난 바와 같이， 재조합 RtxAl(3491— 4701) 단백질 (도 9에는
"RtxAl-C"로 표시함)로 백신네이션 (또는 면역)된 마우스는 93.3%의 생존율을 보였 으며， 재조합 RtxAl(3491-4701) 단백질 항원의 우수한 백신 효과를 확인할 수 있었 다. 하지만, 대조군 재조합 GST 단백질로 면역된 그룹은 6.7%의 매우 낮은 생존율 을 보였다.
<210>
<2ΐ ι > 실시예 20: 재조합 RtxAl(3491-4701) 단백질 항원의 백신네이션 (또는 면역 된)이 혈중 비브리오 패혈증균 개수에 미치는 효과
<212> 실시예 19와 같이 재조합 RtxAl(3491-4701) 단백질 항원과 Sigma adjuvant CSigma, 미국)의 흔합물을 3주 간격으로 2차례 CD1(암컷， 8 주령) 마우스 의 복강에 주사하였다. 2번째 면역 후 14일 후에 실시예 17에서 배양한 야생종 비 브리오 패혈증균 8 X lo i 을 복강으로 투여하고 150분 후에 액와정맥 절개를 통 하여 혈액을 얻은 후에 10배씩 인산완충용액에 희석하였다. 이렇게 희석한 샘플을 고체 HI 배지에 도말하여 콜로니 (colony)형성을 조사하였다. 그 결과를 도 10에 나 타내었다.
<213>
<214> 도 10에 나타난 바와 같이， 재조합 RtxAl (3491-4701) 단백질 항원으로 백신 네이션 (또는 면역)된 마우스 9마리 중 1마리만이 1 혈액 중 40개의 비브리오 패 혈증균을 가지고 있었다. 하지만， 대조군 재조합 GST 단백질로 백신네이션 (또는 면 역)된 모든 마우스의 혈액에서는 평균 1 X 105/ 의 많은 수의 비리오 패혈증균이 관찰되었다.
<215> 이를 통해 재조합 RtxAl(3491-4701) 단백질 항원으로 백신네이션 (또는 면역) 된 마우스는 혈중 비브리오 패혈증균을 감소시킴으로써 백신효과를 보임을 의미하 는 것이다.
<216>
<217> 실시예 21: RtxAl(3491-4701)단백질에 대한다중클론항체의 예방및치료효 과
<218> 실시예 5에서 제조된 재조합 RtxAl(3491-4701) 단백질 (서열 번호 6+6x— His tag) 20 을 실시예 7와 같이 Sigma adjuvant (Sigma, 미국)와 흔합한 다음 3주 간 격으로 3차례 CD1(암컷, 8 주령) 마우스의 복강에 주사하였다. 3번째 면역 후 14일 후에 액와정맥 절개을 통하여 혈액을 얻은 후 12,000 rpm에서 3분간 원심분리 하여 RtxAl(3491-4701) 단백질에 대한 다중클론항체를 포함한 혈청을 생성하였다.
<219>
<220> 재조합 RtxAl(3491-4701) 단백질에 대한 다중클론항체의 예방효과를 확인하 기 위해서， CD1 (암컷， 8 주령) 마우스에 200 ^의 RtxAl(3491-4701) 단백질의 다중 클론항체를 포함한 혈청을 복강으로 투여하고， 4시간 30분 후에 실시예 17에서 배 양한 야생종 비브리오 패혈증균 2 X 106/1 을 복강으로 투여하고, 치사 여부를 96 시간 동안 관찰하였다. 그 결과를 도 11에 나타내었다.
<221>
<222> 도 11에 나타난 바와 같이, 비브리오 패혈증균 감염 전 RtxAl(3491-4701) 단 백질에 대한 다중클론항체를 포함한 혈청을 투여한 마우스는 100%의 생존율을 보였 다. 하지만， 대조군 재조합 GST 단백질에 대한 다중클론항체를 포함한 혈청을 투여 ..받은 마우스는 10 >의 매우 낮은 생존율을 보였다.
<223>
<224> 재조합 RtxAl( 3491-4701) 단백질에 대한 다중클론항체의 치료효과를 확인하 기 위해서, CD1(암컷, 8 주령) 마우스에 실시예 17에서 배양한 야생종 비브리오 패 혈증균 2 X 106/ι 을 복강으로 투여하고 1시간 후에 200 ^의 RtxAl(3491-4701) 단백질에 대한 다중클론항체를 포함한 혈청을 복강으로 투여하고, 치사여부를 96시 간 동안 관찰하였다. 그 결과를 도 12에 나타내었다.
<225>
<226> 도 12에 나타난 바와 같이， 비브리오 패혈증균 감염 후 RtxAl(3491-4701) 단 백질에 대한 다증클론항체를 포함한 혈청을 투여한 마우스는 100%의 생존율을 보였 다. 하지만， 대조군 재조합 GST 단백질에 대한 다중클론항체를 포함한 혈청을 투여 받은 마우스는 10%의 매우 낮은 생존율을 보였다.
<227>
<228> 이를 통해， 재조합 RtxAK 3491-4701) 단백질에 대한 다중클론항체가 비브리 오 패혈증균 감염에 대한 예방 및 치료 효과가 우수함을 확인할 수 있었다.
<229>
<230> 실시예 22: 재조합 RtxAl(3491-4701)단백질에 대한단일클론항체의 비브리 오 패혈증 감염에 대한 예방효과
<23 i > 재조합 RtxAl(3491-4701)단백질에 대한 단일클른항체의 예방효과를 확인하기 위해서， CD1(암컷， 8 주령) 마우스에 실시예 12에서 얻은 각각의 단일클론항체를 200^/mouse (복수로 얻은 단일클론항체; 하기 표 1에서 "ASC"로 기재)나 1 mg /mosue (정제된 단일클론항체; 하기 표 1에서 "PUR"로 기재)을 복강으로 투여하고，
4시간 30분 후에 실시예 17에서 배양한 야생종 비브리오 패혈증균 1 X 106/ 을 복 강으로 투여하고， 치사 여부를 96시간 동안 관찰하였다. 그 결과를 표 1 및 도 13 에 나타내었다.
【표 1】
Figure imgf000030_0001
상기 표 1 및 도 13에 나타난 바와 같이 13RA, 21RA, 24RA, 50RA는 비브리오 패혈증 감염에 대해서 10W의 예방효과를 보였고， 45RA, 46RA, 47RA는 90 >의 예방 효과를 보였다. 그러나， 대조군으로 인산완충용액을 투여한 마우스는 30%의 낮은 생존율을 보였다.
<234>
<235> 재조합 RtxAK3491-4701) 단백질에 대한 단일클론항체의 장기간 예방효과를 확인하기 위해서， CD1(암컷， 8 주령) 마우스에 실시예 12에서 얻은 단일클론항체를 마우스당 500ug을 복강으로 투여하고 14일 후에 실시예 17에서 배양한 야생종 비브 리오 패혈증균 1 X lo n^을 복강으로 투여하고 치사 여부를 96시간 동안 관찰하였 다. 그 결과를 도 14에 나타내었다.
<236> 도 14에 나타난 바와 같이, 14일 동안 단일클론항체 21RA는 비브오 패혈증균 감염에 대해서 90%의 예방효과를 보였다. 그러나， 대조군으로 인산완충용액을 투여 받은 마우스는 18%의 낮은 생존율을 보였다.
<237>
<238> 실시예 23: 재조합 RtxAl(3491-4701)단백질에 대한단일클론항체의 투여 양 에 따른 비브리오 패혈증 감염 억제효과
<239> 단일클론항체의 투여 양에 따른 감염억제 효과를 확인하기 위해서， CD1 (암 컷， 8 주령, 평균 체중 27g) 마우스에 실시예 12에서 얻은 단일클론항체를 마우스 당 0. g, 4 g , 20/ig, 100/ g, 을 복강으로 투여하고 4시간 30분 후에 실시예
17에서 배양한 야생종 비브리오 패혈증균 1 X 106/m을 복강으로 투여하고 치사 여 부를 96시간 동안 관찰하였다. 그 결과를 도 15에 나타내었다.
<240>
<241> 도 15에 나타난 바와 같이 , 단일클론항체의 투여 양에 따라 각각 다른 생존 율을 보였으며 , 500 iig는 100%， 100 fig는 90%, 20 !ig 또는 4 ^을 투여 마우스는 80%의 생존율올 보였다.
<242> 결론적으로 마우스당 4 이상 (148 /kg)의 21RA 단일클론항체를 투여한 마 우스는 80%이상의 생존율을 보였다. 이는 RtxAl(3491-4701) 단백질에 대해 미량의 단일클론항체도 충분한 감염억제 효과를 나타낼 수 있음을 보여주고 있다. 그러나, 대조군으로 인산완층용액을 투여한 마우스는 3 의 낮은 생존율을 보였다.
<243>
<244> 실시예 24: 재조합 RtxAl(3491-4701) 단백질에 대한단일클론항체의 비브리 오 패혈증 감염에 대한 치료효과
<245> 단일클론항체의 치료효과를 확인하기 위해세 CDK암컷， 8 주령) 마우스에 실시예 17에서 배양한 야생종 비브리오 패혈증균 1 X 106/m«을 복강으로 투여하고， 1시간이 후에 실시예 12에서 얻은 각각의 단일클론항체를 200 ^Anouse (복수로 얻 은 단일클론항체)나 500 /mosue (정제된 단일클론항체)을 복강으로 투여하여 치사 여부를 96시간 동안 관찰하였다. 그 결과를 도 16에 나타내었다.
<246>
<247> 도 16에 나타난 바와 같이 , 단일클론항체 21RA는 비브리오 패혈증 감염에 대 해서 93%의 치료효과를 보였고， 24RA는 87% 치료효과, 47RA는 67%의 치료효과를 보 였다. 하지만, 대조군으로 인산완충용액을 투여한 마우스는 32%의 낮은 생존율을 보였다.
<248>
<249> 상기 표 1을 통해 알 수 있듯이 재조합 RtxAl 단백질을 면역원으로 이용하 여 융합된 하이브리도마 세포 37개에서 생산된 각각의 단일클론항체 중 이소타입에 따른 대량생산가능성， 단일클론항체들간의 경쟁적 결합, 단일클론항체의 비브리오 패혈증 감염에 대한 예방 및 치료효과， 비브리 오패혈증 감염 후 마우스 생존율 둥 을 종합해 볼 때， 항원에 대한 항체의 결합부위, 이소타입 서브클래스는 및 치료효 과가 각각 다른 재조합 RtxAl (3491-4701) 단백질에 대한 단일클론항체 중 21RA가 우수한 호과를 나타내었다. 특히, 단일클론항체 21RA는 비브리오 패혈증 감염에 대 해서 가장 높은 치료효과를 보였다.
<250>
<251> 이를 통해 비브리오 패혈증균과 그에 관련된 감염에 의해서 유발되는 질병의 예방 및 치료에 유용하게 이용될 수 있으며， 우수한 백신효과를 가짐으로써 비브리 오 패혈증 예방제 및 /또는 치료제로 사용될 수 있다.
【산업상 이용가능성】
<252> 본 발명은 비브리오 패혈증균 예방제 및 치료제 산업에 이용가능하다 .
<253>
<254>

Claims

【청구의 범위】
【청구항 1】
비브리오 패혈증균 RtxAl 단백질에 대한 단일클론항체를 생산하는 것을 특징 으로 하는 수탁번호 KCLRF-BP-00310인 하이브리도마 세포.
【청구항 2】
수탁번호 KCLRF-BP-00310인 하이브리도마 세포에 의해 생산되는 비브리오 패혈증균 RtxAl 단백질에 대한 단일클론항체 또는 이의 항원결합단편.
【청구항 3]
제 2항에 있어서， 상기 단일클론항체는 서열목록 4의 RtxAl 단백질의 3491 내지 3980번째 아미노산 서열 부위에 특이적으로 결합하는 것올 특징으로 하는 항체 또 는 이의 항원결합단편.
【청구항 4】
제 2항 또는 제 3항의 단일클론항체 또는 이의 항원결합단편을 포함하는 비브리오 패 혈증 치료제.
【청구항 5】
제 2항 또는 제 3항의 단일클론항체 또는 이의 항원결합단편을 포함하는 비브리오 패 혈증 예방제.
【청구항 6】
제 2항 또는 제 3항의 단일클론항체 또는 이의 항원결합단편을 포함하는 비브리오 패 혈증 진단 키트.
【청구항 7]
서열번호 6의 아미노산 서열을 포함하고， 비브리오 패혈증균 RtxAl 단백질에 특이 적으로 결합하는 다클론 항체 .
【청구항 8】
제 7항의 다클론 항체를 포함하는 비브리오 패혈증 치료제.
【청구항 9】
제 7항의 다클론 항체를 포함하는 비브리오 패혈증 예방제.
【청구항 10]
제 7항의 다클론 항체를 포함하는 비브리오 패혈증 진단 키트.
PCT/KR2014/003659 2014-02-13 2014-04-25 비브리오 패혈증균 알티엑스에이-1 단백질에 특이적으로 결합하는 단일클론 항체 및 이의 용도 WO2015122570A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020140016693A KR101613347B1 (ko) 2014-02-13 2014-02-13 비브리오 패혈증균 알티엑스에이-1 단백질에 특이적으로 결합하는 단일클론항체 및 이의 용도
KR10-2014-0016693 2014-02-13

Publications (1)

Publication Number Publication Date
WO2015122570A1 true WO2015122570A1 (ko) 2015-08-20

Family

ID=53800294

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2014/003659 WO2015122570A1 (ko) 2014-02-13 2014-04-25 비브리오 패혈증균 알티엑스에이-1 단백질에 특이적으로 결합하는 단일클론 항체 및 이의 용도

Country Status (2)

Country Link
KR (1) KR101613347B1 (ko)
WO (1) WO2015122570A1 (ko)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102171321B1 (ko) 2018-01-31 2020-10-28 서울대학교산학협력단 Rtx 독소 생성 저해제 및 이를 이용한 비브리오균 감염증 치료용 조성물
KR102453605B1 (ko) * 2020-01-22 2022-10-12 전북대학교산학협력단 신규 펩타이드 태그, 이에 결합하는 항체 및 이들의 용도

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040098202A (ko) * 2003-05-14 2004-11-20 대한민국(전남대학교총장) 비브리오 패혈증균의 접촉 세포독성과 동물 치사작용에관여하는 독력인자 ｒｔｘ와 연관 유전자들
KR20130101496A (ko) * 2013-09-04 2013-09-13 전북대학교산학협력단 비브리오 패혈증균 알티엑스에이원 항원에 결합하는 단일클론항체 제조와 진단 항원을 제공하기 위한 재조합 단백질 발현벡터
KR101309386B1 (ko) * 2011-04-05 2013-09-17 전북대학교산학협력단 비브리오 패혈증균 알티엑스에이원에 특이적인 단일클론항체, 이를 분비하는 하이브리도마 및 이를 포함하는 진단키트
KR101309485B1 (ko) * 2011-04-05 2013-09-23 전북대학교산학협력단 비브리오 패혈증균 알티엑스에이원에 특이적인 단일클론항체, 이를 분비하는 하이브리도마 및 이를 포함하는 진단키트

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101349413B1 (ko) 2011-04-05 2014-01-10 전북대학교산학협력단 비브리오 패혈증균 알티엑스에이원 항원에 결합하는 단일클론항체 제조와 진단 항원을 제공하기 위한 재조합 단백질 발현벡터

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040098202A (ko) * 2003-05-14 2004-11-20 대한민국(전남대학교총장) 비브리오 패혈증균의 접촉 세포독성과 동물 치사작용에관여하는 독력인자 ｒｔｘ와 연관 유전자들
KR101309386B1 (ko) * 2011-04-05 2013-09-17 전북대학교산학협력단 비브리오 패혈증균 알티엑스에이원에 특이적인 단일클론항체, 이를 분비하는 하이브리도마 및 이를 포함하는 진단키트
KR101309485B1 (ko) * 2011-04-05 2013-09-23 전북대학교산학협력단 비브리오 패혈증균 알티엑스에이원에 특이적인 단일클론항체, 이를 분비하는 하이브리도마 및 이를 포함하는 진단키트
KR20130101496A (ko) * 2013-09-04 2013-09-13 전북대학교산학협력단 비브리오 패혈증균 알티엑스에이원 항원에 결합하는 단일클론항체 제조와 진단 항원을 제공하기 위한 재조합 단백질 발현벡터

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
KIM, Y. R. ET AL.: "Vibrio vulnificus RTX toxin kills host cells only after contact of the bacteria with host cells", CELL MICROBIOLOGY, vol. 10, no. 4, 2008, pages 848 - 862 *
LEE, TAE HEE ET AL.: "Protection against Vibrio vulnificus infection by active and passive immunization with the c-terminal region of the RtxA1/MARTXvv protein", VACCINE, vol. 32, no. 2, 17 November 2013 (2013-11-17), pages 271 - 276 *

Also Published As

Publication number Publication date
KR20150095419A (ko) 2015-08-21
KR101613347B1 (ko) 2016-04-19

Similar Documents

Publication Publication Date Title
JP7158403B2 (ja) Ｂ７－ｈ３抗体、その抗原結合フラグメント、及びそれらの医学的使用
RU2757813C2 (ru) Антитело против lag-3, его антигенсвязывающий фрагмент и их фармацевтическое применение
EP3689909A1 (en) Tigit antibody, antigen-binding fragment thereof, and medical use thereof
US9458234B2 (en) TLR2 antagonistic antibody and use thereof
EP3712170A1 (en) Cd96 antibody, antigen-binding fragment and pharmaceutical use thereof
KR20120128687A (ko) 녹농균의 혈청형 ｇ 지질다당류에 대한 항체
JP4766716B2 (ja) ＰｃｒＶに対する抗体
TWI489995B (zh) 具有抗綠膿桿菌作用之人化ＰｃｒＶ抗體
CN115461364A (zh) 一种抗新型冠状病毒的单克隆抗体及其应用
US20170260259A1 (en) Monoclonal antibody against muramyl peptides
WO2015122570A1 (ko) 비브리오 패혈증균 알티엑스에이-1 단백질에 특이적으로 결합하는 단일클론 항체 및 이의 용도
KR101309485B1 (ko) 비브리오 패혈증균 알티엑스에이원에 특이적인 단일클론항체, 이를 분비하는 하이브리도마 및 이를 포함하는 진단키트
KR101349413B1 (ko) 비브리오 패혈증균 알티엑스에이원 항원에 결합하는 단일클론항체 제조와 진단 항원을 제공하기 위한 재조합 단백질 발현벡터
KR101309386B1 (ko) 비브리오 패혈증균 알티엑스에이원에 특이적인 단일클론항체, 이를 분비하는 하이브리도마 및 이를 포함하는 진단키트
KR101372766B1 (ko) 비브리오 패혈증균 알티엑스에이원 항원에 결합하는 단일클론항체 제조와 진단 항원을 제공하기 위한 재조합 단백질 발현벡터
WO2015122598A1 (ko) 비브리오 패혈증균 알티엑스에이-1 단백질에 특이적으로 결합하는 단일클론항체 및 이의 용도
JP4892548B2 (ja) Ｈｉｖに対して中和活性を有する抗体又はその断片
WO2012029792A1 (ja) ＴＧＦ－β受容体の活性化を抑制する活性を有する化合物、そのスクリーニング方法、並びにＣ型肝炎ウィルスに起因する疾患の予防又は治療のための組成物
CN107459575B (zh) 具有抑制病原体的免疫抑制功能的单克隆抗体，其抗原结合片段，以及产生该抗体的杂交瘤
CN117820466B (zh) 抗志贺毒素抗体及其应用
CN109160943B (zh) 抗空肠弯曲菌感染的短肽及其应用
KR101905095B1 (ko) 비브리오 콜레라균 엠에이알티엑스 브이씨(martxvc) 단백질에 교차 결합하는 단일클론항체 및 이의 용도
KR101905083B1 (ko) 비브리오 콜레라균 엠에이알티엑스 브이씨(martxvc) 단백질에 교차 결합하는 단일클론항체 및 이의 용도
AU2022283733A1 (en) Helicobacter pylori detection kit and detection method thereof
KR20220143255A (ko) 코로나-19 바이러스 표적 인간 항체

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14882717

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14882717

Country of ref document: EP

Kind code of ref document: A1