WO2015054529A1 - Diagnosis and treatment of irritable bowel syndrome and inflammatory bowel disease - Google Patents
Diagnosis and treatment of irritable bowel syndrome and inflammatory bowel disease Download PDFInfo
- Publication number
- WO2015054529A1 WO2015054529A1 PCT/US2014/059957 US2014059957W WO2015054529A1 WO 2015054529 A1 WO2015054529 A1 WO 2015054529A1 US 2014059957 W US2014059957 W US 2014059957W WO 2015054529 A1 WO2015054529 A1 WO 2015054529A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antibodies
- ibs
- vinculin
- level
- cdt
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/483—Physical analysis of biological material
- G01N33/487—Physical analysis of biological material of liquid biological material
- G01N33/49—Blood
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6854—Immunoglobulins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/205—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Campylobacter (G)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/06—Gastro-intestinal diseases
- G01N2800/065—Bowel diseases, e.g. Crohn, ulcerative colitis, IBS
Definitions
- This invention relates to the diagnosis and treatment of irritable bowel syndrome.
- IBS irritable bowel syndrome
- Various embodiments provide for a method of diagnosing IBS, and optionally selecting a treatment for IBS or optionally administering an IBS therapy, comprising providing a biological sample from a subject desiring a diagnosis regarding IBS; assaying the biological sample for a level of anti-vinculin antibodies and a level of anti-CDT antibodies; determining the difference between the level of anti-vinculin antibodies and the level of anti- CDT antibodies; and determining the presence of IBS when the level of anti-vinculin antibodies is higher than the level of anti-CDT antibodies.
- IBD and optionally selecting a treatment for IBS or optionally administering an IBS therapy, comprising: providing a biological sample from a subject desiring a diagnosis to distinguish between IBS and IBD; assaying the biological sample for a level of anti-vinculin antibodies and a level of anti-CDT antibodies; and determining the presence of IBS when the level of anti-vinculin antibodies is higher than the level of anti-CDT antibodies, or determining the difference between the level of anti-vinculin antibodies and the level of anti-CDT antibodies.
- assaying the biological sample can comprise: contacting vinculin or a fragment thereof to the biological sample; contacting CdtB or a fragment thereof to the biological sample, wherein anti-vinculin and/or anti-CdtB antibodies specifically bind to the vinculin or the fragment thereof and/or the CdtB or the fragment thereof in the biological sample; and measuring the levels of the anti-vinculin antibodies and the anti-CdtB antibodies in the biological sample.
- the subject can be determined to have IBS if the level of anti-vinculin antibodies is 25% or more higher than the level of anti-CDT antibodies.
- optical density can be used to measure the level of anti-vinculin antibodies and anti-CDT antibodies, and when the difference between the OD of anti-vinculin antibodies (ODy) and OD of anti-CDT antibodies (ODCDT) is greater than 0, the subject can be determined to have IBS.
- the subject when OD V - ODCDT is greater than 0.2, the subject can be determined to have IBS.
- the anti-vinculin antibody can be an antibody that binds specifically to vinculin.
- the anti-vinculin antibody can be an antibody that binds specifically to a 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , or 22 residue peptide that has at least 95%, 96%, 97%, 98%, 99% or 100% homology with 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , or 22 contiguous residues of vinculin or SEQ ID NO. :7.
- the anti-vinculin antibody can be an antibody that binds specifically to a polypeptide comprising 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , or 22 residues that has at least 95%, 96%, 97%, 98%, 99% or 100% homology with 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous residues of vinculin or SEQ ID NO:7.
- the anti-CDT antibody can be an antibody that binds specifically to the CdtB subunit of CDT.
- the CdtB amino acid sequence can be Campylobacter jejuni cytolethal distending toxin B (SEQ ID NO: 5).
- the anti-CDT antibody can be an antibody that binds specifically to an amino acid sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5.
- the anti-CDT antibody can be an antibody that binds specifically to an amino acid sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1.
- the anti-CDT antibody can be an antibody that binds specifically to a polypeptide comprising 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 residues that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology with 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous residues of CdtB.
- the method can further comprise selecting an IBS treatment for the subject if the subject is determined to have IBS.
- the method can further comprise administering an
- IBS therapy to the subject if the subject is determined to have IBS.
- Various embodiments provide for a system to diagnose IBS comprising: an isolated biological sample from a subject desiring a diagnosis regarding IBS; and one or more assays for detecting a level of anti-vinculin antibodies and a level of anti-CDT antibodies to diagnose IBS.
- Various embodiments provide for a system to distinguish between IBS and
- IBD comprising: an isolated biological sample from a subject desiring a diagnosis to distinguish between IBS and IBD; and one or more assays to detect a level of anti-vinculin antibodies and a level of anti-CDT antibodies to distinguish between IBS and IBD.
- the system can further comprise a machine for determining a presence of IBS when the level of anti-vinculin antibodies is higher than the level of anti-CDT antibodies.
- the system can further comprise an output or display element for displaying whether the patient has IBS, and/or for displaying whether the anti- vinculin antibodies is higher than the level of anti-CDT antibodies.
- Figure 1 depicts the optical density of anti-vinculin antibodies (OD V ) and the optical density of anti-CDTB antibodies (ODC DTB ) in accordance with various embodiments of the present invention.
- Figure 2 depicts the difference between the optical density of anti-vinculin antibodies (ODy) and the optical density of anti-CDTB antibodies (ODC DTB ) in accordance with various embodiments of the present invention.
- Antibody or “antibodies” as used herein include polyclonal antibodies, monoclonal antibodies, antibody variants such as single chain (recombinant) Fv, human antibodies, humanized antibodies, chimeric antibodies, and immunologically active fragments of antibodies.
- Binds specifically refers to the act of an antibody binding to its antigen and is intended to exclude low-level, non-specific binding that may occur between random proteins. "Binds specifically” as used herein is not intended and does not imply that the antibody will not bind to any protein other than the proteins or polypeptides as disclosed herein since antibodies can cross-react with any protein that includes the relevant epitope.
- Severe irritable bowel syndrome refers to irritable bowel syndrome (IBS) in a subject who is referred to or would have been referred to a tertiary care center, an IBS specialist, or a motility specialist.
- IBS irritable bowel syndrome
- CdtB appeared not to simply be acting through direct toxicity but rather through the cross-reaction of antibodies to CdtB with the host protein, vinculin.
- Vinculin is a 117-kDa cytoplasmic actin-binding protein that is a key component of both focal adhesions and aherens junctions, mediating the link between integrins or cadherins respectively and the actin cytoskeleton.
- the study herein shows that when anti-vinculin antibodies are greater than anti-CdtB antibodies it is highly indicative IBS and distinguishes IBS from IBD. While not wishing to be bound to any particular theory, the inventors believe that when anti-vinculin antibodies are greater than anti-CdtB antibodies it is also indicative of the severity of the IBS experienced by the patients.
- the IBS patients in the study described herein were seen at tertiary care centers, which strongly imply the severity of the condition. Patients typically are not referred to or seek treatment at tertiary care centers unless their conditions are severe. They typically will self-treat or treat with their primary care physicians. Further, these patients are highly likely to have been refractory to some IBS therapies, which usually warrant a referral to a tertiary care center.
- Various embodiments of the present invention provide for methods, assays, and systems of diagnosing IBS and distinguishing between IBS and IBD.
- Various embodiments of the present invention provide for a method of diagnosing IBS comprising: providing a biological sample from a subject desiring a diagnosis regarding IBS; assaying the biological sample for a level of anti-vinculin antibodies and a level of anti-CDT antibodies; determining the difference between the level of anti-vinculin antibodies and the level of anti-CDT antibodies, and determining the presence of IBS when the level of anti-vinculin antibodies is higher than the level of anti-CDT antibodies.
- Various embodiments of the present invention provide for a method of distinguishing between IBS and IBD, comprising: providing a biological sample from a subject desiring a diagnosis to distinguish between IBS and IBD; assaying the biological sample for a level of anti-vinculin antibodies and a level of anti-CDT antibodies; determining the difference between the level of anti-vinculin antibodies and the level of anti-CDT antibodies; and determining the presence of IBS when the level of anti-vinculin antibodies is higher than the level of anti-CDT antibodies.
- the assay comprises adding vinculin or a fragment thereof as discussed herein and CdtB or a fragment thereof as described herein to a biological sample from a subject desiring a determination regarding IBS, wherein anti-vinculin and/or anti-CdtB antibodies (if present in the biological sample) specifically binds to the vinculin or the fragment thereof and/or the CdtB or the fragment thereof in the biological sample; measuring the levels the anti-vinculin antibodies and the anti-CdtB antibodies in the biological sample; and identifying that the subject has IBS if the level of the anti-vinculin antibodies is higher than the level of the anti-CdtB antibodies.
- the assay can be two separate assays, one to detect the level of anti-vinculin antibodies and one to detect the level of anti-CdtB antibodies. In various embodiments, the assay can be a single assay that detects both anti-vinculin and anti-CdtB antibodies.
- the subject is determined to have IBS if the level of anti-vinculin antibodies is 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000% or more higher than the level of anti-CDT antibodies.
- the extent of the level of anti-vinculin antibodies that is greater than anti-CDT antibodies provides a positive predictive value regarding the presence of IBS.
- the percentage in relation to the positive predictive value can be as described herein. In some embodiments, the percentage in relation to the positive predictive value can be calculated by examining additional IBS patients vs. controls or additional IBS patients vs. IBD patients for their levels of anti-vinculin antibodies and anti-CDT antibodies.
- optical density is used to measure the level of anti-vinculin antibodies and anti-CDT antibodies.
- OD optical density
- the subject is determined to have IBS.
- OD V - ODCDT is greater than 0.1 , 0.2, 0.3, 0.4, 0.5, or 0.6
- the subject is determined to have IBS.
- OD V - ODCDT is greater than 0.2
- the subject is determined to have IBS.
- the extent of OD V - ODCDT provides a positive predictive value regarding the presence of IBS.
- the OD V - ODCDT value in relation to the positive predictive value can be as described herein. In some embodiments, the OD V - ODCDT value in relation to the positive predictive value can be calculated by examining additional IBS patients vs. controls or additional IBS patients vs. IBD patients for their levels of anti-vinculin antibodies and anti-CDT antibodies.
- a 96-well plate is coated overnight or >16 hours at about 4°C in a humidified box with about ⁇ /well of antigen (vinculin or CdtB) @ about l ⁇ g/ml in BBS, approximate pH is 8.2.
- An additional well is coated, with each sample, with only BBS to determine non-specific background due to serum that will be subtracted from antigen coated well.
- Wells are washed about 3 times with approximately 250 ⁇ 1 ⁇ 11 of 0.05%PBS-T.
- Wells are blocked with about 200 ⁇ 1 ⁇ 11 of about 3% BSA in PBS for about 1 hour at room temperature in a humidified box.
- Sera are diluted to a 1 : 16 dilution using about 3% BSA in PBS.
- the IBS can be C-IBS, D-IBS, A-IBS (also known as
- the IBS is severe IBS. In various embodiments, the IBS is severe C-IBS, severe-D-IBS, or severe A-IBS.
- the anti-CDT antibodies are anti-CdtB antibodies.
- the assays comprise vinculin or a fragment thereof as discussed herein and CdtB or a fragment thereof as discussed herein as the antigen to detect anti-vinculin and anti-CdtB antibodies.
- Various embodiments of the present invention provide for a system to diagnose IBS comprising: an isolated biological sample from a subject desiring a diagnosis regarding IBS; and one or more assays for detecting a level of anti-vinculin antibodies and a level of anti-CDT antibodies to diagnose IBS.
- Various embodiments of the present invention provide for a system to distinguish between IBS and IBD, comprising: an isolated biological sample from a subject desiring a diagnosis to distinguish between IBS and IBD; one or more assays to detect a level of anti-vinculin antibodies and a level of anti-CDT antibodies to distinguish between IBS and IBD. [0050] In various embodiments, these systems further comprise a machine for determining a presence of IBS when the level of anti-vinculin antibodies is higher than the level of anti-CDT antibodies.
- the system comprises an output or display element for displaying whether the patient has IBS, and/or for displaying whether the anti-vinculin antibodies is higher than the level of anti-CDT antibodies.
- the system determines that the subject has IBS if the level of anti-vinculin antibodies is 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000% or more higher than the level of anti-CDT antibodies.
- the extent of the level of anti-vinculin antibodies that is greater than anti-CDT antibodies provides a positive predictive value regarding the presence of IBS.
- the percentage in relation to the positive predictive value can be as described herein.
- the percentage in relation to the positive predictive value can be calculated by examining additional IBS patients vs. controls or additional IBS patients vs. IBD patients for their levels of anti-vinculin antibodies and anti-CDT antibodies.
- optical density is used to measure the level of anti-vinculin antibodies and anti-CDT antibodies.
- OD optical density
- the system determines that the subject has IBS.
- OD V - ODCDT is greater than 0.1 , 0.2, 0.3, 0.4, 0.5, or 0.6
- the system determines that the subject has IBS.
- OD V - ODCDT is greater than 0.2, the subject is determined to have IBS.
- the extent of OD V - ODCDT provides a positive predictive value regarding the presence of IBS.
- the OD V - ODCDT value in relation to the positive predictive value can be as described herein.
- the OD V - OD C DT value in relation to the positive predictive value can be calculated by examining additional IBS patients vs. controls or additional IBS patients vs. IBD patients for their levels of anti- vinculin antibodies and anti-CDT antibodies.
- the IBS can be C-IBS, D-IBS, A-IBS (also known as
- the IBS is severe IBS. In various embodiments, the IBS is severe C-IBS, severe-D-IBS, or severe A-IBS.
- the anti-CDT antibodies are anti-CdtB antibodies.
- the assays comprise vinculin or a fragment thereof as discussed herein and CdtB or a fragment thereof as discussed herein as the antigen to detect anti-vinculin and anti-CdtB antibodies.
- Various embodiments of the present invention provides for a non-transitory computer readable medium comprising instructions to execute the methods of the present invention, as described herein.
- the methods of the invention implement a computer program for example, to compare the levels of anti-vinculin antibodies and the levels of anti- CDT antibodies.
- a non-transitory computer program can be used to perform the algorithms described herein.
- the software components can comprise both software components that are standard in the art and components that are special to the present invention.
- the methods of the invention can also be programmed or modeled in mathematical software packages that allow symbolic entry of equations and high-level specification of processing, including specific algorithms to be used, thereby freeing a user of the need to procedurally program individual equations and algorithms.
- Such packages include, e.g., Matlab from Mathworks (Natick, Mass.), Mathematica from Wolfram Research (Champaign, 111.) or S- Plus from MathSoft (Seattle, Wash.).
- the computer comprises a database for storage of levels of anti-vinculin antibodies and levels of anti-CDT antibodies. Such stored profiles can be accessed and used to compare levels of anti-vinculin antibodies and levels of anti-CDT antibodies in the sample to known control levels, if applicable.
- a laboratory technician or laboratory professional or group of laboratory technicians or laboratory professionals determines the level of anti-vinculin antibodies and the level of anti-CDT antibodies
- the same or a different laboratory technician or laboratory professional can analyze one or more assays to determine whether the level of anti-vinculin antibodies is higher than the level of anti-CDT antibodies or whether the ODy - ODC DT is greater than 0.0, 0.1 , 0.2, 0.3, 0.4, 0.5, or 0.6 and then determine that the subject has IBS or severe IBS.
- a non-transitory computer readable storage medium comprising: a storing data module containing data from a sample comprising a level of anti-vinculin antibodies and a level of anti-CDT antibodies; a detection module to detect the level of anti-vinculin antibodies and the level of anti-CDT antibodies; a comparison module that compares the data stored on the storing data module with a reference data and/or control data, or a comparison module to compare the level of anti-vinculin antibodies to the level of anti-CDT antibodies and to provide a comparison content, and an output module displaying the comparison content for the user, wherein an indication that the subject has IBS is displayed when the level of anti-vinculin antibodies is greater than the level of anti-CDT antibodies, or when the OD V - ODC DT is greater than 0.0, 0.1 , 0.2, 0.3, 0.4, 0.5, or 0.6.
- control data comprises data from patients who do not have IBS. In various embodiments, the control data comprises data from patients who do not have IBD. In various embodiments, the control data comprises data from patients who have IBS. In various embodiments, the control data comprises data from patients who have IBD.
- Embodiments of the invention can be described through functional modules, which are defined by computer executable instructions recorded on a non-transitory computer readable media and which cause a computer to perform method steps when executed.
- the modules are segregated by function, for the sake of clarity. However, it should be understood that the modules/systems need not correspond to discreet blocks of code and the described functions can be carried out by the execution of various code portions stored on various media and executed at various times. Furthermore, it should be appreciated that the modules may perform other functions, thus the modules are not limited to having any particular functions or set of functions.
- the non-transitory computer readable storage media can be any available tangible media that can be accessed by a computer.
- Computer readable storage media includes volatile and nonvolatile, removable and non-removable tangible media implemented in any method or technology for storage of information such as computer readable instructions, data structures, program modules or other data.
- Computer readable storage media includes, but is not limited to, RAM (random access memory), ROM (read only memory), EPROM (eraseable programmable read only memory), EEPROM (electrically eraseable programmable read only memory), flash memory or other memory technology, CD-ROM (compact disc read only memory), DVDs (digital versatile disks) or other optical storage media, magnetic cassettes, magnetic tape, magnetic disk storage or other magnetic storage media, other types of volatile and non-volatile memory, and any other tangible medium which can be used to store the desired information and which can be accessed by a computer including and any suitable combination of the foregoing.
- Computer-readable data embodied on one or more non-transitory computer- readable media may define instructions, for example, as part of one or more programs that, as a result of being executed by a computer, instruct the computer to perform one or more of the functions described herein, and/or various embodiments, variations and combinations thereof.
- Such instructions may be written in any of a plurality of programming languages, for example, Java, J#, Visual Basic, C, C#, C++, Fortran, Pascal, Eiffel, Basic, COBOL assembly language, and the like, or any of a variety of combinations thereof.
- the computer- readable media on which such instructions are embodied may reside on one or more of the components of either of a system, or a computer readable storage medium described herein, may be distributed across one or more of such components.
- the computer-readable media may be transportable such that the instructions stored thereon can be loaded onto any computer resource to implement the aspects of the present invention discussed herein.
- the instructions stored on the computer-readable medium, described above are not limited to instructions embodied as part of an application program running on a host computer. Rather, the instructions may be embodied as any type of computer code (e.g., software or microcode) that can be employed to program a computer to implement aspects of the present invention.
- the computer executable instructions may be written in a suitable computer language or combination of several languages.
- the functional modules of certain embodiments of the invention include for example, a measuring module, a storage module, a comparison module, and an output module.
- the functional modules can be executed on one, or multiple, computers, or by using one, or multiple, computer networks.
- the measuring module has computer executable instructions to provide, e.g., expression information in computer readable form.
- the measuring module can comprise any system for detecting the levels of anti-vinculin antibodies or anti-CDT antibodies.
- the information determined in the determination system can be read by the storage module.
- the "storage module” is intended to include any suitable computing or processing apparatus or other device configured or adapted for storing data or information. Examples of electronic apparatus suitable for use with the present invention include stand-alone computing apparatus, data telecommunications networks, including local area networks (LAN), wide area networks (WAN), Internet, Intranet, and Extranet, and local and distributed computer processing systems.
- Storage modules also include, but are not limited to: magnetic storage media, such as floppy discs, hard disc storage media, flash drives, magnetic tape, optical storage media such as CD-ROM, DVD, electronic storage media such as RAM, ROM, EPROM, EEPROM and the like, general hard disks and hybrids of these categories such as magnetic/optical storage media.
- the storage module is adapted or configured for having recorded thereon the level of anti-vinculin antibodies and level of anti- CDT antibodies information. Such information may be provided in digital form that can be transmitted and read electronically, e.g., via the Internet, on a flash drive, via USB (universal serial bus) or via any other suitable mode of communication.
- stored refers to a process for encoding information on the storage module.
- Those skilled in the art can readily adopt any of the presently known methods for recording information on known media to generate manufactures comprising anti-vinculin antibody level and anti-CDT antibody level information.
- the reference data stored in the storage module to be read by the comparison module is, e.g., data from patients who do not have IBS, data from patients who do not have IBD, data from patients who have IBS, and/or data from patients who have IBD.
- the "comparison module” can use a variety of available software programs and formats for the comparison operative to compare binding data determined in the measuring module to reference samples and/or stored reference data.
- the comparison module is configured to use pattern recognition techniques to compare information from one or more entries to one or more reference data patterns.
- the comparison module may be configured using existing commercially-available or freely-available software for comparing patterns, and may be optimized for particular data comparisons that are conducted.
- the comparison module provides computer readable information related, for example, anti-vinculin antibody levels and/or anti-CDT antibody levels.
- the comparison module may include an operating system (e.g., UNIX) on which runs a relational database management system, a World Wide Web application, and a World Wide Web server.
- World Wide Web application includes the executable code necessary for generation of database language statements (e.g., Structured Query Language (SQL) statements).
- SQL Structured Query Language
- the executables will include embedded SQL statements.
- the World Wide Web application may include a configuration file which contains pointers and addresses to the various software entities that comprise the server as well as the various external and internal databases which must be accessed to service user requests.
- the Configuration file also directs requests for server resources to the appropriate hardware—as may be necessary should the server be distributed over two or more separate computers.
- the World Wide Web server supports a TCP/IP protocol.
- Local networks such as this are sometimes referred to as "Intranets.”
- An advantage of such Intranets is that they allow easy communication with public domain databases residing on the World Wide Web (e.g., the GenBank or Swiss Pro World Wide Web site).
- users can directly access data (via Hypertext links for example) residing on Internet databases using a HTML interface provided by Web browsers and Web servers.
- the comparison module provides a computer readable comparison result that can be processed in computer readable form by predefined criteria, or criteria defined by a user, to provide a content-based in part on the comparison result that may be stored and output as requested by a user using an output module.
- the content based on the comparison result may be anti-vinculin antibody levels compared to anti-CDT antibody levels.
- the content based on the comparison result is displayed on a computer monitor.
- the content based on the comparison result is displayed through printable media.
- the display module can be any suitable device configured to receive from a computer and display computer readable information to a user.
- Non-limiting examples include, for example, general-purpose computers such as those based on Intel PENTIUM-type processor, Motorola PowerPC, Sun UltraSPARC, Hewlett-Packard PA-RISC processors, any of a variety of processors available from Advanced Micro Devices (AMD) of Sunnyvale, California, or any other type of processor, visual display devices such as flat panel displays, cathode ray tubes and the like, as well as computer printers of various types.
- AMD Advanced Micro Devices
- a World Wide Web browser is used for providing a user interface for display of the content based on the comparison result.
- modules of the invention can be adapted to have a web browser interface.
- a user may construct requests for retrieving data from the comparison module.
- the user will typically point and click to user interface elements such as buttons, pull down menus, scroll bars and the like conventionally employed in graphical user interfaces.
- biological samples include but are not limited to body fluids, whole blood, plasma, stool, intestinal fluids or aspirate, and stomach fluids or aspirate, serum, cerebral spinal fluid (CSF), urine, sweat, saliva, tears, pulmonary secretions, breast aspirate, prostate fluid, seminal fluid, cervical scraping, amniotic fluid, intraocular fluid, mucous, and moisture in breath.
- the biological sample may be whole blood, blood plasma, blood serum, stool, intestinal fluid or aspirate or stomach fluid or aspirate.
- the biological sample is whole blood.
- the biological sample is serum.
- the biological sample is plasma.
- the anti-vinculin antibody detected in these methods, assays, or systems is an antibody that binds specifically to vinculin.
- the anti-vinculin antibody is an antibody that binds specifically to a 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 residue peptide that has at least 95%, 96%, 97%, 98%, 99% or 100% homology with 5, 6, 7, 8, 9, 10,
- the anti-vinculin antibody binds specifically to a polypeptide comprising 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 residues that has at least 95%, 96%, 97%, 98%, 99% or 100% homology with 5, 6, 7, 8, 9, 10,
- the anti-vinculin antibody binds specifically to a polypeptide comprising or consisting of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
- the anti-vinculin antibody is an antibody that binds specifically to SEQ ID NO:7.
- the anti-vinculin antibody is an antibody that binds specifically to a 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 residue peptide that has at least 95%, 96%, 97%, 98%, 99% or 100% homology with 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous residues of SEQ ID NO:7.
- the anti-vinculin antibody binds specifically to a polypeptide comprising 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 residues that has at least 95%, 96%, 97%, 98%, 99% or 100% homology with 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous residues of SEQ ID NO:7.
- the anti-vinculin antibody binds specifically to a polypeptide comprising or consisting of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous residues of SEQ ID NO:7.
- Contiguous residues of vinculin or SEQ ID NO: 7 include those beginning at any amino acid and ending at any amino acid of vinculin or SEQ ID NO:7.
- Protein sequence of Vinculin SEQ ID NO:7:
- the anti-CDT antibody an antibody that binds specifically to CDT.
- the amino acid sequences of CDT are known in the art.
- the anti-CDT antibody specifically binds to an epitope on the receptor-binding domain of CDT.
- the anti-CDT antibody binds specifically to the CdtA subunit of CDT. In another embodiment, the anti-CDT antibody binds specifically to the CdtB subunit of CDT. In another embodiment, the anti-CDT antibody binds specifically to the CdtC subunit of CDT.
- CdtB amino acid sequence is Campylobacter jejuni cytolethal distending toxin B, which has the amino acid sequence (SEQ ID NO: 5).
- SEQ ID NO:5 (CdtB of Campylobacter jejuni):
- CdtB amino acid sequence is Campylobacter coli cytolethal distending toxin B, which has the amino acid sequence (SEQ ID NO: 1) and nucleic acid sequence (SEQ ID NO:2).
- SEQ ID NO : 1 amino acid sequence of CdtB of Campylobacter Coli
- SEQ ID NO:2 nucleic acid sequence of CdtB of Campylobacter Coli
- the anti-CDT antibody binds specifically to
- the anti-CDT antibody binds specifically to an amino acid sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5. [0101] In another embodiment, the anti-CDT antibody binds specifically to SEQ ID NO:
- the anti-CDT antibody binds specifically to an amino acid sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1.
- the anti-CDT antibody binds specifically to a 17 residue peptide of CdtB (e.g., 17 residues of SEQ. ID NOs: 1 or 5).
- the 17 residue peptide has the following sequence: LDYAITGNSNRQQTYTP (SEQ ID NO:3).
- the anti-CDT antibody binds specifically to a 17 residue peptide that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology with 17 contiguous residues of CdtB (e.g., 17 contiguous residues of SEQ. ID NOs: 1 or 5).
- the 17 residues of CdtB have the following sequence: LDYAITGNSNRQQTYTP (SEQ ID NO:3).
- the anti-CDT antibody binds specifically to a polypeptide comprising 17 residues that have at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%) homology with 17 contiguous residues of CdtB (e.g., 17 residues of SEQ. ID NOs: 1 or 5).
- the 17 contiguous residues of CdtB have the following sequence: LDYAITGNSNRQQTYTP (SEQ ID NO:3).
- the anti-CDT antibody binds specifically to an 18 residue peptide having the following sequence: CLDYAITGNSNRQQTYTP (SEQ ID NO:4).
- the cysteine at the N-terminus was added to SEQ ID NO:3 for purposes of conjugation.
- the anti-CDT antibody binds specifically to a polypeptide comprising 18 residues that have at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology to CLDYAITGNSNRQQTYTP (SEQ ID NO:4).
- the anti-CDT antibody binds specifically to a 5, 6, 7,
- the anti-CDT antibody binds specifically to a polypeptide comprising 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , or 22 residues that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology with 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous residues of CdtB (e.g., 5, 6, 7, 8, 9, 10, 11, 12,
- Contiguous residues of SEQ ID NO: l include those beginning at any amino acid and ending at any amino acid of SEQ ID NO: l .
- Contiguous residues of SEQ ID NO:5 include those beginning at any amino acid and ending at any amino acid of SEQ ID NO:5.
- the anti-CDT antibody binds specifically to a 5, 6, 7,
- the anti-CDT antibody binds specifically to a polypeptide comprising 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 residue peptide that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology with 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 contiguous residues of LDYAITGNSNRQQTYTP (SEQ ID NO:3) (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 contiguous residues of SEQ ID NO:3).
- the anti-CDT antibody binds specifically to a polypeptide comprising 5, 6, 7, 8, 9, 10, 11, 12, 13,
- SEQ ID NO:3 e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 contiguous residues of SEQ ID NO:3.
- Contiguous residues of SEQ ID NO: 3 include those beginning at any amino acid and ending at any amino acid of SEQ ID NO: 3.
- the anti-CDT antibody binds specifically to a 17 residue peptide encoded by the CdtB gene sequence.
- the purified antibody binds specifically to a 17 residue peptide encoded by SEQ ID NO: 2.
- the anti-CDT antibody binds specifically to a 14, 15, 16, 17, 18, 19, 20, 21, or 22 residue peptide encoded by SEQ ID NO: 2.
- the anti-CDT antibody binds specifically to a 14, 15, 16, 17, 18, 19, 20, 21, or 22 residue peptide that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology to 14, 15, 16, 17, 18,
- the anti-CDT antibody binds specifically to a polypeptide comprising 14, 15, 16, 17, 18, 19,
- the anti-CDT antibody binds specifically to a peptide encoded by the nucleic acid sequence having the following sequence: CTTGATTATGCAATTACAGGAAATTCAAATAGACAACAAACCTATACTCCA (SEQ ID NO:6), which encodes the 17 amino acid peptide of SEQ ID NO. 3.
- the anti-CDT antibody binds specifically to a polypeptide comprising a peptide encoded by SEQ ID NO:6.
- the anti-CDT antibody binds specifically to CdtB purified from E. coli overexpressing a near full-length CdtB ORF. (See Infection and Immunity, December 2000, p. 6535-6541, Vol. 68, No. 12 , herein incorporated by reference in its entirety as though fully set forth.)
- the assay is an enzyme-linked immunosorbent assay (ELISA), including but not limited to indirect ELISA, sandwich ELISA, competitive ELISA, multiple and portable ELISA.
- ELISA enzyme-linked immunosorbent assay
- the assay is an assay to detect the level of anti-vinculin antibodies.
- the assay can comprise: a first reagent (e.g., the antigen) to react with the biological sample if the biological sample comprises the anti-vinculin antibody (if anti-vinculin antibodies are not present, then the first reagent will not react the biological sample, but the first reagent is still present in the assay), a second reagent (e.g., secondary antibody) to react with the anti-vinculin antibody or a second reagent to react with the first reagent, and a substrate (e.g., to react with the second reagent and produce a signal).
- a first reagent e.g., the antigen
- a second reagent e.g., secondary antibody
- the first reagent is vinculin, SEQ ID NO: 7 or a fragment thereof as discussed herein.
- the second reagent comprises a label to produce a signal to indicate the presence of the anti-vinculin antibody.
- the label is a radiolabel, a chromophore, a fluorophore, a quantum dot, an enzyme, horseradish peroxidase (HRP), an alkaline phosphatase (AP), biotin, or a combination thereof.
- the label is an enzyme that will react with the substrate.
- the first reagent is on a solid phase (e.g., plate, multi-well plate).
- the substrate is a chromogenic substrate (e.g., 3,3',5,5'- Tetramethylbenzidine (TMB), 3,3'-Diaminobenzidine (DAB), 2,2'-azino-bis(3- ethylbenzothiazoline-6-sulphonic acid) (ABTS).
- the substrate is a chemiluminescence substrate (e.g., ECL).
- the assay comprises a first reagent to react with the anti-vinculin antibody.
- the first reagent comprises a label to produce a signal to indicate the presence of the anti-vinculin antibody.
- the label is a radiolabel, a chromophore, a fluorophore, a quantum dot, an enzyme, horseradish peroxidase (HRP), an alkaline phosphatase (AP), biotin, or a combination thereof.
- the first reagent is on a solid phase (e.g., plate, multi-well plate).
- the assay further comprises a substrate to react with the label in instances wherein the label requires a substrate to produce the signal; for example HRP can be reacted with the substrate TMB.
- the assay is an assay to determine the level of anti-
- the assay can comprise: a first reagent to react with the biological sample if the biological sample comprises the anti-CDT antibody (if anti-CDT antibodies are not present, then the first reagent will not react the biological sample, but the first reagent is still present in the assay), a second reagent (e.g., secondary antibody) to react with the anti-CDT antibody or a second reagent to react with the first reagent, and a substrate.
- the first reagent is CDT, CdtA, CdtB, CdtC, SEQ ID NOs: 1, 2, 4, 5 or a fragment thereof as discuss herein.
- the second reagent comprises a label to produce a signal to indicate the presence of the anti-CDT antibody.
- the label is a radiolabel, a chromophore, a fluorophore, a quantum dot, an enzyme, horseradish peroxidase (HRP), an alkaline phosphatase (AP), biotin, or a combination thereof.
- the label is an enzyme that will react with the substrate.
- the first reagent is on a solid phase (e.g., plate, multi-well plate).
- the substrate is a chromogenic substrate (e.g., 3,3',5,5'- Tetramethylbenzidine (TMB), 3,3'-Diaminobenzidine (DAB), 2,2'-azino-bis(3- ethylbenzothiazoline-6-sulphonic acid) (ABTS).
- the substrate is a chemiluminescence substrate (e.g., ECL).
- the assay comprises a first reagent to react with the anti-CDT antibody.
- the first reagent comprises a label to produce a signal to indicate the presence of the anti-CDT antibody.
- the label is a radiolabel, a chromophore, a fluorophore, a quantum dot, an enzyme, horseradish peroxidase (HRP), an alkaline phosphatase (AP), biotin, or a combination thereof.
- the reagent is on a solid phase (e.g., plate, multi-well plate).
- the assay further comprises a substrate to react with the label in instances wherein the label requires a substrate to produce the signal; for example HRP can be reacted with the substrate TMB.
- the assay is an assay to determine the level of the anti-vinculin antibodies and the level anti-CDT antibodies.
- the assay can comprise: a first reagent and second reagent to react with the biological sample if the biological sample comprises the anti-vinculin antibody and/or the anti-CDT antibody (if anti-vinculin antibodies are not present, then the first reagent will not react with the biological sample, but the first reagent is still present in the assay; or if anti-CDT antibodies are not present, then the second reagent will not react with the biological sample, but the second reagent is still present in the assay), a third reagent and a fourth (e.g., secondary antibodies) to react with the anti- vinculin antibody, the anti-CDT antibody, or a third reagent to react with the first reagent, and a fourth reagent to react with the second reagent, and a substrate.
- a third reagent and a fourth e.g., secondary antibodies
- the first reagent is vinculin or a fragment thereof.
- the second reagent is CDT or a fragment thereof.
- the third reagent and/or the fourth reagent comprises a label to produce a signal to indicate the presence of the anti-vinculin antibody and/or the anti-CDT antibody.
- the label is a radiolabel, a chromophore, a fluorophore, a quantum dot, an enzyme, horseradish peroxidase (HRP), an alkaline phosphatase (AP), biotin, or a combination thereof.
- the label is an enzyme that will react with the substrate.
- the first reagent is on a solid phase (e.g., plate, multi-well plate).
- the substrate is a chromogenic substrate (e.g., 3,3',5,5'-Tetramethylbenzidine (TMB), 3,3'-Diaminobenzidine (DAB), 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS).
- the substrate is a chemiluminescence substrate (e.g., ECL).
- the assay comprises a first reagent to react with the anti-vinculin antibody and a second reagent to react with the anti-CDT antibody.
- the first reagent and/or the second reagent comprises a label to produce a signal to indicate the presence of the anti-vinculin antibody and/or anti-CDT antibody.
- the label is a radiolabel, a chromophore, a fluorophore, a quantum dot, an enzyme, horseradish peroxidase (HRP), an alkaline phosphatase (AP), biotin, or a combination thereof.
- the reagent is on a solid phase (e.g., plate, multi-well plate).
- the assay further comprises a substrate to react with the label in instances wherein the label requires a substrate to produce the signal; for example HRP can be reacted with the substrate TMB.
- detecting the level of the anti-vinculin antibody or the level of anti-CDT antibody is performed on a biological sample obtained from the subject. In another embodiment, detecting the level of the anti-vinculin antibody or the level of anti-CDT antibody is performed on a blood, serum, or stool sample obtained from the subject.
- detecting the level of the anti-vinculin antibody or the level of anti-CDT antibody is performed on a blood, serum, or stool sample obtained from the subject.
- methods and systems include but are not limited to ELISA, immunohistochemistry, flow cytometry, fluorescence in situ hybridization (FISH), radioimmuno assays, and affinity purification.
- vinculin, SEQ ID NO: 7 or a fragment thereof is used as a reagent (e.g., collector, trap) to bind anti-vinculin antibodies (if present).
- a reagent e.g., collector, trap
- detecting the level an antibody that binds specifically to vinculin, SEQ ID NO: 7 or a fragment thereof may be performed by contacting vinculin, SEQ ID NO: 7 or a fragment thereof to a biological sample obtained from the subject to isolate the antibody that binds specifically to vinculin, SEQ ID NO: 7 or a fragment thereof.
- the fragment of vinculin or SEQ ID NO: 7 may be the fragments as described herein.
- an affinity matrix comprising vinculin, SEQ ID NO: 7 or a fragment thereof can be bound to a solid support; the biological sample can be contacted to the affinity matrix to produce an affinity matrix-antibody complex (if the antibody is present); the affinity matrix-antibody complex can be separated from the remainder of the biological sample; and the antibody can be released from the affinity matrix.
- a label e.g., fluorescent label
- the labeled vinculin, SEQ ID NO: 7 or a fragment thereof can be contacted with a biological sample to allow the antibody (if present) to bind specifically to the labeled vinculin, SEQ ID NO: 7 or a fragment thereof.
- the labeled vinculin, SEQ ID NO: 7 or a fragment thereof can be separated out and analyzed for its binding to the antibody.
- CDT, CdtA, CdtB, CdtC, SEQ ID NOS: 1, 2, 4, 5 or a fragment thereof as discuss herein is used as a reagent (e.g., collector, trap) to bind anti- CDT antibodies (if present).
- a reagent e.g., collector, trap
- detecting the level an antibody that binds specifically to CDT, CdtA, CdtB, CdtC, SEQ ID NOS: 1, 2, 4, 5 or a fragment thereof as discuss herein or a fragment thereof may be performed by contacting CDT, CdtA, CdtB, CdtC, SEQ ID NOS: 1, 2, 4, 5 or a fragment thereof as discuss herein to a biological sample obtained from the subject to isolate the antibody that binds specifically to CDT, CdtA, CdtB, CdtC, SEQ ID NOS: 1, 2, 4, 5 or a fragment thereof as discuss herein.
- an affinity matrix comprising CDT, CdtA, CdtB, CdtC, SEQ ID NOS: 1, 2, 4, 5 or a fragment thereof as discuss herein can be bound to a solid support; the biological sample can be contacted to the affinity matrix to produce an affinity matrix-antibody complex (if the antibody is present); the affinity matrix- antibody complex can be separated from the remainder of the biological sample; and the antibody can be released from the affinity matrix.
- a label e.g., fluorescent label
- the labeled CDT, CdtA, CdtB, CdtC, SEQ ID NOS: 1, 2, 4, 5 or a fragment thereof as discuss herein can be contacted with a biological sample to allow the antibody (if present) to bind specifically to the labeled CDT, CdtA, CdtB, CdtC, SEQ ID NOS: 1, 2, 4, 5 or a fragment thereof as discuss herein.
- the labeled CDT, CdtA, CdtB, CdtC, SEQ ID NOS: 1, 2, 4, 5 or a fragment thereof as discuss herein can be separated out and analyzed for its binding to the antibody.
- the assay comprises adding vinculin or a fragment thereof as discussed herein and CdtB or a fragment thereof as discussed herein to a biological sample from a subject desiring a determination regarding IBS, wherein anti-vinculin and/or anti-CdtB antibodies (if present in the biological sample) specifically binds to the vinculin or the fragment thereof and the CdtB or the fragment thereof in the biological sample; measuring the levels the anti-vinculin antibodies and the anti-CdtB antibodies in the biological sample; and identifying that the subject has IBS if the levels of the binding of the anti-vinculin antibodies is higher than the levels of the binding of the anti-CdtB antibodies.
- Various embodiments of the present invention provide for a method of selecting a therapy for IBS, comprising: providing a biological sample from a subject desiring a diagnosis regarding IBS; assaying the biological sample for a level of anti-vinculin antibodies and a level of anti-CDT antibodies; determining the difference between the level of anti-vinculin antibodies and the level of anti-CDT antibodies; determining the presence of IBS when the level of anti-vinculin antibodies is higher than the level of anti-CDT antibodies; and selecting a therapy for IBS when the presence of IBS is determined.
- Various embodiments of the present invention provide for a method of selecting a therapy for IBS: providing a biological sample from a subject desiring a diagnosis to distinguish between IBS and IBD; assaying the biological sample for a level of anti- vinculin antibodies and a level of anti-CDT antibodies; determining the difference between the level of anti-vinculin antibodies and the level of anti-CDT antibodies; determining the presence of IBS when the level of anti-vinculin antibodies is higher than the level of anti- CDT antibodies; and selecting a therapy for IBS when the presence of IBS is determined.
- Assaying the biological samples can be performed as described herein.
- the subject is determined to have IBS if the level of anti-vinculin antibodies is 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000% or more higher than the level of anti-CDT antibodies.
- the extent of the level of anti-vinculin antibodies that is greater than anti-CDT antibodies provides a positive predictive value regarding the presence of IBS.
- the percentage in relation to the positive predictive value can be as described herein.
- the percentage in relation to the positive predictive value can be calculated by examining additional IBS patients vs. controls or additional IBS patients vs. IBD patients for their levels of anti-vinculin antibodies and anti-CDT antibodies.
- optical density is used to measure the level of anti-vinculin antibodies and anti-CDT antibodies.
- OD optical density
- the subject is determined to have IBS.
- OD V - ODCDT is greater than 0. 1 , 0.2, 0.3, 0.4, 0.5, or 0.6
- the subject is determined to have IBS.
- OD V - ODCDT is greater than 0. 1 , 0.2, 0.3, 0.4, 0.5, or 0.6
- the subject is determined to have IBS.
- OD V - ODCDT is greater than 0.2
- the subject is determined to have IBS.
- the extent of OD V - ODCDT provides a positive predictive value regarding the presence of IBS.
- the OD V - OD C DT value in relation to the positive predictive value can be as described herein.
- the ODy - ODCDT value in relation to the positive predictive value can be calculated by examining additional IBS patients vs. controls or additional IBS patients vs. IBD patients for their levels of anti-vinculin antibodies and anti-CDT antibodies.
- Selecting a therapy as used herein includes but is not limited to selecting, choosing, prescribing, advising, recommending, instructing, or counseling the subject with respect to the treatment.
- the method further comprises administering the therapy to treat the IBS.
- the therapy selected or administered is a therapy as described herein.
- the therapy selected or administered is an available therapy at the time of the present invention.
- the available therapy comprises administering a course of antibiotic therapy to treat the IBS.
- the therapy is an available IBS therapy in the prior art.
- the available therapy is an experimental therapy for IBS, for example, a therapy that is undergoing FDA approval for the treatment of IBS.
- assaying the biological sample for a level of anti- vinculin antibodies and a level of anti-CDT antibodies can be performed as described herein.
- the subject can be a subject presenting one or more symptoms IBS; for example, constipation, diarrhea, bloating, abdominal pain.
- the IBS can be C-IBS, D-IBS, A-IBS (also known as
- the IBS is severe IBS. In various embodiments, the IBS is severe C-IBS, severe-D-IBS, or severe A-IBS.
- the anti-CDT antibodies are anti-CdtB antibodies.
- antibiotics include but are not limited to aminoglycosides (e.g., amikacin, gentamicin, kanamycin, neomycin, netilmicin, streptomycin, tobramycin, paromomycin), ansamycins (e.g., geldanamycin, herbimycin), carbacephems (e.g., loracarbef), carbapenems (e.g., ertapenem, doripenem, imipenem, cilastatin, meropenem), cephalosporins (e.g., first generation: cefadroxil, cefazolin, cefalotin or cefalothin, cefalexin; second generation: cefaclor, cefamandole, cefoxitin, cefprozil, cefuroxime; third generation: cefixime, cefdinir, cefditoren, cefoperazone, cefotaxime, ce
- the antibiotics are a combination of rifaximin and neomycin. In various embodiments, the antibiotics are a combination of rifaximin and doxycycline. In various embodiments, the antibiotics are a combination of rifaximin and metronidazole.
- the antibiotics are non-absorbable antibiotics.
- non-absorbable antibiotics include but are not limited to rifaximin, neomycin, Bacitracin, vancomycin, teicoplanin, ramoplanin, and paramomycin.
- IBS therapies include fiber supplements (e.g.,
- RESULTRAIL RESULTRAIL
- CITRUCEL osmotic laxatives
- anti-diarrheal medications e.g., loperamide (IMODIUM), bile acid binders (e.g., cholestyramine (PREVALITE), colestipol (COLESTID) or colesevelam (WELCHOL), anticholinergic and antispasmodic medications (e.g., hyoscyamine (LEVSIN) and dicyclomine (BENTYL), antidepressant medications (e.g., tricyclic antidepressant (e.g., imipramine (TOFRANIL) or nortriptyline (PAMELOR)) or a selective serotonin reuptake inhibitor (SSRI) (e.g., fluoxetine (PROZAC, SARAFEM) or paroxetine (PAXIL)), Alosetron (LOTRONEX) and Lubipro
- SSRI selective serotonin
- Recent therapies for the treatment of constipation IBS include secretagogues such as lubiprostone (a choride channel activator (AMITIZA)) and linaclotide (a guanylate cyclase C agonist (LINZESS)).
- secretagogues such as lubiprostone (a choride channel activator (AMITIZA)) and linaclotide (a guanylate cyclase C agonist (LINZESS)).
- the vinculin protein or a fragment thereof as described herein is used as the antigen at about 1.2 ⁇ g/ml concentration.
- the concentration can be about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1., 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2.0 ⁇ g/ml concentration.
- an about 1:16 dilution of the biological sample is used in the determination of the presence or level of anti-vinculin antibodies.
- an about 1:8, 1:9, 1:10; 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17; 1:18, 1:19, 1:20, 1:22, 1:24, 1:26, 1:28, 1:30, 1:32, 1:34, 1:36, 1:38, 1:40, 1:42, 1:44, 1:46, or 1:48 dilution of the biological sample (e.g., plasma, serum) is used in the determination of the presence or level of anti-vinculin antibodies.
- an about 1:8 to 1:48 dilution of the biological sample e.g., plasma, serum
- an about 1:32 dilution of the biological sample e.g., plasma, serum
- an about 1:8, 1:10, 1:12; 1:16, 1:20, 1:24, 1:30, 1:36, 1:48, or 1:64 dilution of the biological sample is used in the determination of the presence or level of anti-vinculin antibodies.
- an about 1:8 to 1:64 dilution of the biological sample is used in the determination of the presence or level of anti-vinculin antibodies.
- the biological sample e.g., plasma, serum
- CdtB protein or a fragment thereof as described herein is used as the antigen at about 1.2 ⁇ g/ml concentration.
- the concentration can be about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1., 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2.0 ⁇ / ⁇ 1 concentration.
- an about 1:16 dilution of the biological sample is used in the determination of the presence or level of anti-CdtB antibodies.
- an about 1:8, 1:9, 1:10; 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17; 1:18, 1:19, 1:20, 1:22, 1:24, 1:26, 1:28, 1:30, 1:32, 1:34, 1:36, 1:38, 1:40, 1:42, 1:44, 1:46, or 1:48 dilution of the biological sample (e.g., plasma, serum) is used in the determination of the presence or level of anti-CdtB antibodies.
- an about 1 :8 to 1 :48 dilution of the biological sample is used in the determination of the presence or level of anti-CdtB antibodies.
- a 1:512 dilution of the biological sample is used in the determination of the presence or level of anti-CdtB antibodies.
- an about 1:128, 1:256, 1:768, or 1:1024 dilution of the biological sample is used in the determination of the presence or level of anti- CdtB antibodies.
- an about 1:100, 1:150, 1:200, 1:250, 1:300, 1:350, 1:400, 1:500, 1:550; 1:600, 1:650, 1:700, 1:750, 1:800, 1:850, 1:900, 1:950, or 1:1000 dilution of the biological sample (e.g., plasma, serum) is used in the determination of the presence or level of anti-CdtB antibodies.
- an about 1:100 - 1:1000 dilution of the biological sample e.g., plasma, serum
- an about 1:5 to 1:10, 1:10- 1:25, 1:25-1:50, 1:50-1:100, 1:100-1:200, 1:200-1-3:00, 1:300-1:400, 1:400-1:500, 1:500-1- 600, or 1-600-1:100 dilution of the biological sample (e.g., plasma, serum) is used in the determination of the presence or level of anti-CdtB antibodies.
- the biological sample e.g., plasma, serum
- Various embodiments provide for methods for treating IBS.
- the method can comprise measuring for the presence of anti-vinculin antibodies that is greater than the presence of anti-CDT antibodies in a biological sample obtained from a subject; and administering an IBS therapy to the subject.
- the method can comprise providing a biological sample from a subject desiring a diagnosis regarding IBS; assaying the biological sample for a level of anti-vinculin antibodies and a level of anti-CDT antibodies; determining the difference between the level of anti-vinculin antibodies and the level of anti-CDT antibodies; determining the presence of IBS when the level of anti-vinculin antibodies is higher than the level of anti-CDT antibodies; and administering a therapy for IBS when the presence of IBS is determined.
- the method can comprise providing a biological sample from a subject desiring a diagnosis to distinguish between IBS and IBD; assaying the biological sample for a level of anti-vinculin antibodies and a level of anti-CDT antibodies; determining the difference between the level of anti-vinculin antibodies and the level of anti- CDT antibodies; determining the presence of IBS when the level of anti-vinculin antibodies is higher than the level of anti-CDT antibodies; and administering a therapy for IBS when the presence of IBS is determined.
- Assaying the biological samples can be performed as described herein.
- the subject is determined to have IBS if the level of anti-vinculin antibodies is 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000% or more higher than the level of anti-CDT antibodies.
- the extent of the level of anti-vinculin antibodies that is greater than anti-CDT antibodies provides a positive predictive value regarding the presence of IBS.
- the percentage in relation to the positive predictive value can be as described herein.
- the percentage in relation to the positive predictive value can be calculated by examining additional IBS patients vs. controls or additional IBS patients vs. IBD patients for their levels of anti-vinculin antibodies and anti-CDT antibodies.
- optical density is used to measure the level of anti-vinculin antibodies and anti-CDT antibodies.
- OD optical density
- the subject is determined to have IBS.
- OD V - OD C DT is greater than 0.1 , 0.2, 0.3, 0.4, 0.5, or 0.6
- the subject is determined to have IBS.
- OD V - ODCDT is greater than 0.2
- the subject is determined to have IBS.
- the extent of OD V - ODCDT provides a positive predictive value regarding the presence of IBS.
- the OD v - ODC DT value in relation to the positive predictive value can be as described herein.
- the ODy - ODC DT value in relation to the positive predictive value can be calculated by examining additional IBS patients vs. controls or additional IBS patients vs. IBD patients for their levels of anti-vinculin antibodies and anti-CDT antibodies.
- the therapy administered is a therapy as described herein.
- the therapy administered is an available therapy at the time of the present invention.
- the available therapy comprises administering a course of antibiotic therapy to treat the IBS.
- the therapy is an available therapy in the prior art.
- assaying the biological sample for a level of anti- vinculin antibodies and a level of anti-CDT antibodies can be performed as described by the methods or systems of the present invention.
- the subject can be a subject presenting one or more symptoms IBS; for example, constipation, diarrhea, bloating, abdominal pain.
- the IBS can be C-IBS, D-IBS, A-IBS (also known as
- the IBS is severe IBS. In various embodiments, the IBS is severe C-IBS, severe-D-IBS, or severe A-IBS.
- the anti-CDT antibodies are anti-CdtB antibodies.
- the method can comprise providing an anti-vinculin antibody neutralizing or inhibiting agent and administering the anti-vinculin antibody neutralizing or inhibiting agent to a subject in need thereof to neutralize or inhibit the anti- vinculin antibody.
- the anti-vinculin antibody neutralizing or inhibiting agent is a polypeptide capable of binding to the anti-vinculin antibody and neutralizing or inhibiting its function.
- the anti-vinculin antibody neutralizing or inhibiting agent is a polypeptide capable of binding to an antigen binding site of the anti-vinculin antibody. While not wishing to be bound by any particular theory, the inventors believe that these polypeptides can serves as a decoy to the anti-vinculin antibody.
- the polypeptides are CDT pentapeptides as disclosed by Lucchese and Delfmo ⁇ Developing an anti-Campylobacter jejuni vaccine. Immunopharmacology and Immunotoxicology, 2012; Early Online: 1 -6), which is hereby incorporated by reference in its entirety as though fully set forth.
- the anti-vinculin antibody neutralizing or inhibiting agent is a small molecule capable of binding to the anti-vinculin antibody and neutralizing or inhibiting its function.
- the anti-vinculin antibody neutralizing or inhibiting agent is a small molecule capable of binding to an antigen binding site of the anti-vinculin antibody.
- the method can comprise providing an agent to change vinculin from an inactive state to an active state; and administering the agent to a subject in need thereof to treat the IBS.
- the agent to change vinculin from an inactive state to an active state is a small molecule capable of activating vinculin.
- the method can comprise providing a vinculin agonist; and administering the vinculin agonist to a subject in need thereof to treat the IBS.
- the vinculin agonist can be vinculin activating peptide (VAP) as disclosed by Nelson et al., Vinculin Activators Target Integrins from Within the Cell to Increase Melanoma Sensitivity to Chemotherapy, MOL CANCER RES JUNE 201 1 9; 111 (published online April 1 , 201 1), which is hereby incorporated by reference in its entirety as though fully set forth.
- the VAP can be residues 500-633 of invasin protein IpaA of Shigella.
- the present invention provides pharmaceutical compositions including a pharmaceutically acceptable excipient along with a therapeutically effective amount of the agents described herein.
- “Pharmaceutically acceptable excipient” means an excipient that is useful in preparing a pharmaceutical composition that is generally safe, non-toxic, and desirable, and includes excipients that are acceptable for veterinary use as well as for human pharmaceutical use. Such excipients may be solid, liquid, semisolid, or, in the case of an aerosol composition, gaseous.
- the pharmaceutical compositions according to the invention may be formulated for delivery via any route of administration.
- Route of administration may refer to any administration pathway known in the art, including but not limited to aerosol, nasal, oral, transmucosal, transdermal or parenteral.
- Transdermal administration may be accomplished using a topical cream or ointment or by means of a transdermal patch.
- the pharmaceutical compositions based on compounds according to the invention may be formulated for treating the skin and mucous membranes and are in the form of ointments, creams, milks, salves, powders, impregnated pads, solutions, gels, sprays, lotions or suspensions.
- Topical-route compositions can be either in anhydrous form or in aqueous form depending on the clinical indication.
- "Parenteral” refers to a route of administration that is generally associated with injection, including intraorbital, infusion, intraarterial, intracapsular, intracardiac, intradermal, intramuscular, intraperitoneal, intrapulmonary, intraspinal, intrasternal, intrathecal, intrauterine, intravenous, subarachnoid, subcapsular, subcutaneous, transmucosal, or transtracheal.
- the compositions may be in the form of solutions or suspensions for infusion or for injection, or as lyophilized powders.
- the pharmaceutical compositions can be in the form of tablets, gel capsules, sugar-coated tablets, syrups, suspensions, solutions, powders, granules, emulsions, microspheres or nanospheres or lipid vesicles or polymer vesicles allowing controlled release.
- the compositions may be in the form of solutions or suspensions for infusion or for injection.
- compositions according to the invention can also contain any pharmaceutically acceptable carrier.
- “Pharmaceutically acceptable carrier” as used herein refers to a pharmaceutically acceptable material, composition, or vehicle that is involved in carrying or transporting a compound of interest from one tissue, organ, or portion of the body to another tissue, organ, or portion of the body.
- the carrier may be a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, or a combination thereof.
- Each component of the carrier must be “pharmaceutically acceptable” in that it must be compatible with the other ingredients of the formulation. It must also be suitable for use in contact with any tissues or organs with which it may come in contact, meaning that it must not carry a risk of toxicity, irritation, allergic response, immunogenicity, or any other complication that excessively outweighs its therapeutic benefits.
- compositions according to the invention can also be encapsulated, tableted or prepared in an emulsion or syrup for oral administration.
- Pharmaceutically acceptable solid or liquid carriers may be added to enhance or stabilize the composition, or to facilitate preparation of the composition.
- Liquid carriers include syrup, peanut oil, olive oil, glycerin, saline, alcohols and water.
- Solid carriers include starch, lactose, calcium sulfate, dihydrate, terra alba, magnesium stearate or stearic acid, talc, pectin, acacia, agar or gelatin.
- the carrier may also include a sustained release material such as glyceryl monostearate or glyceryl distearate, alone or with a wax.
- the pharmaceutical preparations are made following the conventional techniques of pharmacy involving milling, mixing, granulation, and compressing, when necessary, for tablet forms; or milling, mixing and filling for hard gelatin capsule forms.
- a liquid carrier When a liquid carrier is used, the preparation will be in the form of a syrup, elixir, emulsion or an aqueous or non-aqueous suspension.
- Such a liquid formulation may be administered directly p.o. or filled into a soft gelatin capsule.
- the pharmaceutical compositions according to the invention may be delivered in a therapeutically effective amount.
- the precise therapeutically effective amount is that amount of the composition that will yield the most effective results in terms of efficacy of treatment in a given subject.
- This amount will vary depending upon a variety of factors, including but not limited to the characteristics of the therapeutic compound (including activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological condition of the subject (including age, sex, disease type and stage, general physical condition, responsiveness to a given dosage, and type of medication), the nature of the pharmaceutically acceptable carrier or carriers in the formulation, and the route of administration.
- One skilled in the clinical and pharmacological arts will be able to determine a therapeutically effective amount through routine experimentation, for instance, by monitoring a subject's response to administration of a compound and adjusting the dosage accordingly. For additional guidance, see Remington: The Science and Practice of Pharmacy (Gennaro ed. 20th edition, Williams & Wilkins PA, USA) (2000).
- STEP 6 Create Secondary Solution & Dispense - ⁇ /well of a 1 : 10,000 secondary antibody conjugated to HRP diluted in 3% BSA in PBS as added. Incubated for lhr at room temperature in humidified box.
- TMB - ELISA Substrate Pierce, 34028
- plate reader BioTek Synergy HT
- absorbance protocol at 370nm
- results were further analyzed to control for IBD when using an assumption thatl0% of IBD patients has IBS.
- the rate of positive antibody in IBS was taken and applied to the 10% of IBD patient (i.e., removed them from the analysis).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Food Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Organic Chemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Public Health (AREA)
- Ecology (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines Containing Plant Substances (AREA)
Priority Applications (18)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201480055994.5A CN105744956B (zh) | 2013-10-09 | 2014-10-09 | 肠易激综合征和炎性肠病的诊断和治疗 |
| ES14851688T ES2892905T3 (es) | 2013-10-09 | 2014-10-09 | Diagnóstico y tratamiento del síndrome del intestino irritable y la enfermedad inflamatoria intestinal |
| PL14851688T PL3054977T3 (pl) | 2013-10-09 | 2014-10-09 | Diagnoza i leczenie zespołu jelita drażliwego i choroby zapalnej jelit |
| AU2014331841A AU2014331841B2 (en) | 2013-10-09 | 2014-10-09 | Diagnosis and treatment of irritable bowel syndrome and inflammatory bowel disease |
| EP14851688.3A EP3054977B1 (en) | 2013-10-09 | 2014-10-09 | Diagnosis and treatment of irritable bowel syndrome and inflammatory bowel disease |
| JP2016521777A JP6567509B2 (ja) | 2013-10-09 | 2014-10-09 | 過敏性腸症候および炎症性腸疾患の診断および治療 |
| CA2923651A CA2923651C (en) | 2013-10-09 | 2014-10-09 | Diagnosis and treatment of irritable bowel syndrome and inflammatory bowel disease |
| IL244971A IL244971B2 (en) | 2013-10-09 | 2014-10-09 | Diagnostic methods and systems for irritable bowel syndrome and inflammatory bowel disease |
| HK16109934.2A HK1221898B (en) | 2013-10-09 | 2014-10-09 | Diagnosis and treatment of irritable bowel syndrome and inflammatory bowel disease |
| US15/021,850 US9851361B2 (en) | 2013-10-09 | 2014-10-09 | Methods of comparing anti-vinculin and anti-cytolethal distending toxin antibodies as they relate to irritable bowel syndrome |
| NZ717633A NZ717633A (en) | 2013-10-09 | 2014-10-09 | Diagnosis and treatment of irritable bowel syndrome and inflammatory bowel disease |
| KR1020167011774A KR102259588B1 (ko) | 2013-10-09 | 2014-10-09 | 과민성 장 증후군 및 염증성 장 질환의 진단 및 치료 |
| SG11201601733VA SG11201601733VA (en) | 2013-10-09 | 2014-10-09 | Diagnosis and treatment of irritable bowel syndrome and inflammatory bowel disease |
| MX2016004167A MX383423B (es) | 2013-10-09 | 2014-10-09 | Método in vitro para el diagnóstico del síndrqme del intestino irritable y la enfermedad inflamatoria intestinal. |
| BR112016007474A BR112016007474A2 (pt) | 2013-10-09 | 2014-10-09 | diagnóstico e tratamento de síndrome do intestino irritável e doença inflamatória intestinal |
| RU2016116766A RU2683781C2 (ru) | 2013-10-09 | 2014-10-09 | Диагностика и лечение синдрома раздраженного кишечника и воспалительного заболевания кишечника |
| US15/839,366 US10352944B2 (en) | 2013-10-09 | 2017-12-12 | Method of determinig levels of anti-vinculin and anti-cytolethal distending toxin antibodies in subjects desiring to distinguish irritable bowel syndrome from inflammatory bowel disease |
| AU2020203468A AU2020203468A1 (en) | 2013-10-09 | 2020-05-27 | Diagnosis and treatment of irritable bowel syndrome and inflammatory bowel disease |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361888658P | 2013-10-09 | 2013-10-09 | |
| US61/888,658 | 2013-10-09 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/021,850 A-371-Of-International US9851361B2 (en) | 2013-10-09 | 2014-10-09 | Methods of comparing anti-vinculin and anti-cytolethal distending toxin antibodies as they relate to irritable bowel syndrome |
| US15/839,366 Continuation US10352944B2 (en) | 2013-10-09 | 2017-12-12 | Method of determinig levels of anti-vinculin and anti-cytolethal distending toxin antibodies in subjects desiring to distinguish irritable bowel syndrome from inflammatory bowel disease |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2015054529A1 true WO2015054529A1 (en) | 2015-04-16 |
Family
ID=52813648
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/059957 Ceased WO2015054529A1 (en) | 2013-10-09 | 2014-10-09 | Diagnosis and treatment of irritable bowel syndrome and inflammatory bowel disease |
Country Status (19)
| Country | Link |
|---|---|
| US (2) | US9851361B2 (enExample) |
| EP (1) | EP3054977B1 (enExample) |
| JP (1) | JP6567509B2 (enExample) |
| KR (1) | KR102259588B1 (enExample) |
| CN (1) | CN105744956B (enExample) |
| AU (2) | AU2014331841B2 (enExample) |
| BR (1) | BR112016007474A2 (enExample) |
| CA (1) | CA2923651C (enExample) |
| CL (1) | CL2016000820A1 (enExample) |
| ES (1) | ES2892905T3 (enExample) |
| IL (1) | IL244971B2 (enExample) |
| MX (1) | MX383423B (enExample) |
| NZ (1) | NZ717633A (enExample) |
| PE (1) | PE20160882A1 (enExample) |
| PL (1) | PL3054977T3 (enExample) |
| PT (1) | PT3054977T (enExample) |
| RU (1) | RU2683781C2 (enExample) |
| SG (1) | SG11201601733VA (enExample) |
| WO (1) | WO2015054529A1 (enExample) |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105784989A (zh) * | 2016-05-17 | 2016-07-20 | 上海凯璟生物科技有限公司 | 一种肠易激综合症标志物CdtB抗体检测试剂盒及其制备方法 |
| CN106053827A (zh) * | 2016-05-17 | 2016-10-26 | 上海凯璟生物科技有限公司 | 一种肠易激综合症标志物Vinculin抗体检测试剂盒及其制备方法 |
| US9702884B2 (en) | 2012-09-17 | 2017-07-11 | Cedars-Sinai Medical Center | Methods for detecting the presence of irritable bowel syndrome and system for diagnosing same |
| US9851361B2 (en) | 2013-10-09 | 2017-12-26 | Cedars-Sinai Medical Center | Methods of comparing anti-vinculin and anti-cytolethal distending toxin antibodies as they relate to irritable bowel syndrome |
| US9869676B2 (en) | 2009-02-11 | 2018-01-16 | Cedars-Sinai Medical Center | Antibody to cytolethal distending toxin of Campylobacter jejuni |
| US10132814B2 (en) | 2014-10-09 | 2018-11-20 | Cedars-Sinai Medical Center | Methods for distinguishing irritable bowel syndrome from inflammatory bowel disease and celiac disease |
| CN109476698A (zh) * | 2016-05-20 | 2019-03-15 | 西达-赛奈医疗中心 | 基于基因的炎性肠病诊断 |
| RU2763258C1 (ru) * | 2020-07-13 | 2021-12-28 | Евгения Николаевна Воронина | Способ дифференциальной диагностики воспалительных заболеваний кишечника у детей по комплексу клинико-анамнестических, лабораторных и инструментальных критериев |
| US11693009B2 (en) | 2009-02-11 | 2023-07-04 | Cedars-Sinai Medical Center | Methods for detecting post-infectious irritable bowel syndrome |
| US12222352B2 (en) | 2017-01-30 | 2025-02-11 | Cedars-Sinai Medical Center | Diagnosis of scleroderma |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040018528A1 (en) * | 2002-05-17 | 2004-01-29 | Sugen, Inc. | Novel biomarkers of tyrosine kinase inhibitor exposure and activity in mammals |
| US20110305704A1 (en) * | 2009-02-11 | 2011-12-15 | Cedars-Sinai Medical Center | Antibody to cytolethal distending toxin of campylobacter jejuni |
Family Cites Families (23)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5691151A (en) * | 1994-10-07 | 1997-11-25 | Regents Of University Of California | Methods of screening for ulcerative colitis and crohn's disease by detecting VH3-15 autoantibody and panca |
| US6861053B1 (en) | 1999-08-11 | 2005-03-01 | Cedars-Sinai Medical Center | Methods of diagnosing or treating irritable bowel syndrome and other disorders caused by small intestinal bacterial overgrowth |
| US6562629B1 (en) | 1999-08-11 | 2003-05-13 | Cedars-Sinai Medical Center | Method of diagnosing irritable bowel syndrome and other disorders caused by small intestinal bacterial overgrowth by detecting the presence of anti-saccharomyces cerivisiae antibodies (asca) in human serum |
| US7048906B2 (en) | 1995-05-17 | 2006-05-23 | Cedars-Sinai Medical Center | Methods of diagnosing and treating small intestinal bacterial overgrowth (SIBO) and SIBO-related conditions |
| FR2806805A1 (fr) | 2000-03-22 | 2001-09-28 | Centre Nat Rech Scient | SEQUENCE PEPTIDIQUES COMPRENANT UN OU PLUSIEURS MOTIFS DE LIAISON AUX PROTEINES DE LA FAMILLE Ena/VASP, ET LEURS UTILISATIONS |
| JP2006515165A (ja) | 2002-09-16 | 2006-05-25 | ジェネンテック・インコーポレーテッド | 免疫関連疾患の治療のための新規組成物と方法 |
| US7595386B2 (en) | 2003-01-24 | 2009-09-29 | William Beaumont Hospital | Methods and compositions for heat activated gene therapy using cytolethal distending toxin |
| BRPI0409128A (pt) * | 2003-04-08 | 2006-03-28 | Progenics Pharm Inc | uso de antagonistas de opióides periféricos, especialmente metilnaltrexona para tratar sìndrome de intestino irritável |
| EP1664796B1 (en) * | 2003-09-15 | 2010-12-15 | Oklahoma Medical Research Foundation | Method of using cytokine assays to diagnose, treat, and evaluate ankylosing spondylitis |
| KR101152078B1 (ko) | 2003-12-05 | 2012-06-21 | 후소 야쿠힝 고교 가부시끼가이샤 | 세포팽창화 치사독 및 그것을 표적으로 한 캄필로박터속에속하는 세균의 검출 |
| EP2102367A2 (en) | 2006-11-09 | 2009-09-23 | XDX, Inc. | Methods for diagnosing and monitoring the status of systemic lupus erythematosus |
| DK2223121T3 (da) | 2007-12-20 | 2012-10-22 | Index Diagnostics Ab Publ | Fremgangsmåde og kit til anvendelse ved differentiering mellem ibd og ibs og yderligere skelnen mellem ibd-sygdomstyper |
| ES2529060T3 (es) | 2008-11-24 | 2015-02-16 | Cedars-Sinai Medical Center | Derivados antioxidantes de la camptotecina y nanoesferas antineoplásicas antioxidantes de los mismos |
| MX2011008354A (es) | 2009-02-11 | 2011-09-06 | Cedars Sinai Medical Center | Terapia antibiotica para reducir la probabilidad de desarrollar el sindrome del intestino irritable post-infeccioso. |
| FR2942541A1 (fr) | 2009-02-25 | 2010-08-27 | Assist Publ Hopitaux De Paris | Procede de diagnostic d'une vascularite |
| RU2397178C1 (ru) * | 2009-02-27 | 2010-08-20 | Федеральное государственное учреждение науки "Центральный научно-исследовательский институт эпидемиологии" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека | Диагностическая тест-система в формате иммуночипа и способ серологической дифференциальной диагностики сифилиса |
| IT1400989B1 (it) | 2010-07-13 | 2013-07-05 | Segix Italia S R L Ora Istituto Biochimico Naz Savio S R L | Forme di somministrazione orale a rilascio controllato di rifampicina per il trattamento di infezioni batteriche dell' apparato intestinale. |
| GB201017520D0 (en) | 2010-10-15 | 2010-12-01 | Sense Proteomic Ltd | Biomarkers |
| ES2646598T3 (es) | 2012-09-17 | 2017-12-14 | Cedars-Sinai Medical Center | Diagnóstico y tratamiento de los trastornos de la motilidad del intestino y la vejiga, y de la fibromialgia |
| AU2014331841B2 (en) | 2013-10-09 | 2020-03-12 | Cedars-Sinai Medical Center | Diagnosis and treatment of irritable bowel syndrome and inflammatory bowel disease |
| MX384921B (es) | 2014-10-09 | 2025-03-14 | Cedars Sinai Medical Center | Métodos y sistemas para distinguir el síndrome del intestino irritable de la enfermedad inflamatoria intestinal y la enfermedad celíaca. |
| CN106091069A (zh) | 2016-06-15 | 2016-11-09 | 安徽省绿巨人环境技术有限公司 | 一种废水再利用装置 |
| JP2020507755A (ja) | 2017-01-30 | 2020-03-12 | シーダーズ−サイナイ メディカル センター | 強皮症の診断法 |
-
2014
- 2014-10-09 AU AU2014331841A patent/AU2014331841B2/en active Active
- 2014-10-09 CN CN201480055994.5A patent/CN105744956B/zh active Active
- 2014-10-09 PL PL14851688T patent/PL3054977T3/pl unknown
- 2014-10-09 BR BR112016007474A patent/BR112016007474A2/pt not_active Application Discontinuation
- 2014-10-09 US US15/021,850 patent/US9851361B2/en active Active
- 2014-10-09 KR KR1020167011774A patent/KR102259588B1/ko not_active Expired - Fee Related
- 2014-10-09 EP EP14851688.3A patent/EP3054977B1/en active Active
- 2014-10-09 PT PT14851688T patent/PT3054977T/pt unknown
- 2014-10-09 RU RU2016116766A patent/RU2683781C2/ru active
- 2014-10-09 CA CA2923651A patent/CA2923651C/en active Active
- 2014-10-09 NZ NZ717633A patent/NZ717633A/en unknown
- 2014-10-09 JP JP2016521777A patent/JP6567509B2/ja active Active
- 2014-10-09 ES ES14851688T patent/ES2892905T3/es active Active
- 2014-10-09 PE PE2016000430A patent/PE20160882A1/es unknown
- 2014-10-09 IL IL244971A patent/IL244971B2/en unknown
- 2014-10-09 SG SG11201601733VA patent/SG11201601733VA/en unknown
- 2014-10-09 WO PCT/US2014/059957 patent/WO2015054529A1/en not_active Ceased
- 2014-10-09 MX MX2016004167A patent/MX383423B/es unknown
-
2016
- 2016-04-08 CL CL2016000820A patent/CL2016000820A1/es unknown
-
2017
- 2017-12-12 US US15/839,366 patent/US10352944B2/en active Active
-
2020
- 2020-05-27 AU AU2020203468A patent/AU2020203468A1/en not_active Abandoned
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040018528A1 (en) * | 2002-05-17 | 2004-01-29 | Sugen, Inc. | Novel biomarkers of tyrosine kinase inhibitor exposure and activity in mammals |
| US20110305704A1 (en) * | 2009-02-11 | 2011-12-15 | Cedars-Sinai Medical Center | Antibody to cytolethal distending toxin of campylobacter jejuni |
Non-Patent Citations (2)
| Title |
|---|
| MORALES ET AL.: "Antibodies to Cytolethal Distending Toxin B and Auto-Antibodies to Human Vinculin Are Elevated in IBS Subjects.", GASTROENTEROLOGY, vol. 144, no. ISSUE, May 2013 (2013-05-01), pages S- 914, XP055331766 * |
| See also references of EP3054977A4 * |
Cited By (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11693009B2 (en) | 2009-02-11 | 2023-07-04 | Cedars-Sinai Medical Center | Methods for detecting post-infectious irritable bowel syndrome |
| US9869676B2 (en) | 2009-02-11 | 2018-01-16 | Cedars-Sinai Medical Center | Antibody to cytolethal distending toxin of Campylobacter jejuni |
| US10527621B2 (en) | 2009-02-11 | 2020-01-07 | Cedars-Sinai Medical Center | Antibody to cytolethal distending toxin of Campylobacter jejuni |
| US10151752B2 (en) | 2009-02-11 | 2018-12-11 | Cedars-Sinai Medical Center | Antibody to cytolethal distending toxin of Campylobacter jejuni |
| US9702884B2 (en) | 2012-09-17 | 2017-07-11 | Cedars-Sinai Medical Center | Methods for detecting the presence of irritable bowel syndrome and system for diagnosing same |
| US9952223B2 (en) | 2012-09-17 | 2018-04-24 | Cedars-Sinai Medical Center | Method for detecting anti-vinculin antibodies in a subject with an IBS symptom |
| US10466254B2 (en) | 2012-09-17 | 2019-11-05 | Cedars-Sinai Medical Center | Method of measuring a level of anti-vinculin antibodies in a biological sample |
| US10352944B2 (en) | 2013-10-09 | 2019-07-16 | Cedars-Sinai Medical Center | Method of determinig levels of anti-vinculin and anti-cytolethal distending toxin antibodies in subjects desiring to distinguish irritable bowel syndrome from inflammatory bowel disease |
| US9851361B2 (en) | 2013-10-09 | 2017-12-26 | Cedars-Sinai Medical Center | Methods of comparing anti-vinculin and anti-cytolethal distending toxin antibodies as they relate to irritable bowel syndrome |
| US10690679B2 (en) | 2014-10-09 | 2020-06-23 | Cedars-Sinai Medical Center | Methods and systems for distinguishing irritable bowel syndrome from inflammatory bowel disease and celiac disease |
| US10132814B2 (en) | 2014-10-09 | 2018-11-20 | Cedars-Sinai Medical Center | Methods for distinguishing irritable bowel syndrome from inflammatory bowel disease and celiac disease |
| CN105784989A (zh) * | 2016-05-17 | 2016-07-20 | 上海凯璟生物科技有限公司 | 一种肠易激综合症标志物CdtB抗体检测试剂盒及其制备方法 |
| CN106053827A (zh) * | 2016-05-17 | 2016-10-26 | 上海凯璟生物科技有限公司 | 一种肠易激综合症标志物Vinculin抗体检测试剂盒及其制备方法 |
| CN109476698A (zh) * | 2016-05-20 | 2019-03-15 | 西达-赛奈医疗中心 | 基于基因的炎性肠病诊断 |
| US11549146B2 (en) | 2016-05-20 | 2023-01-10 | Cedars-Sinai Medical Center | Diagnosis of inflammatory bowel disease based on genes |
| CN109476698B (zh) * | 2016-05-20 | 2023-10-17 | 西达-赛奈医疗中心 | 基于基因的炎性肠病诊断 |
| US12545959B2 (en) | 2016-05-20 | 2026-02-10 | Cedars-Sinai Medical Center | Diagnosis of inflammatory bowel disease based on genes |
| US12222352B2 (en) | 2017-01-30 | 2025-02-11 | Cedars-Sinai Medical Center | Diagnosis of scleroderma |
| RU2763258C1 (ru) * | 2020-07-13 | 2021-12-28 | Евгения Николаевна Воронина | Способ дифференциальной диагностики воспалительных заболеваний кишечника у детей по комплексу клинико-анамнестических, лабораторных и инструментальных критериев |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10352944B2 (en) | Method of determinig levels of anti-vinculin and anti-cytolethal distending toxin antibodies in subjects desiring to distinguish irritable bowel syndrome from inflammatory bowel disease | |
| US10690679B2 (en) | Methods and systems for distinguishing irritable bowel syndrome from inflammatory bowel disease and celiac disease | |
| US10466254B2 (en) | Method of measuring a level of anti-vinculin antibodies in a biological sample | |
| US20240159772A1 (en) | Methods for Detecting and Treating Irritable Bowel Syndrome | |
| HK1221898B (en) | Diagnosis and treatment of irritable bowel syndrome and inflammatory bowel disease | |
| HK1234824B (en) | Methods and systems for distinguishing irritable bowel syndrome from inflammatory bowel disease and celiac disease | |
| HK1234824A1 (en) | Methods and systems for distinguishing irritable bowel syndrome from inflammatory bowel disease and celiac disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14851688 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2923651 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15021850 Country of ref document: US |
|
| REEP | Request for entry into the european phase |
Ref document number: 2014851688 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2014851688 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2014331841 Country of ref document: AU Date of ref document: 20141009 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 000430-2016 Country of ref document: PE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2016/004167 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 244971 Country of ref document: IL |
|
| ENP | Entry into the national phase |
Ref document number: 2016521777 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 16091069 Country of ref document: CO |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112016007474 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 20167011774 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2016116766 Country of ref document: RU Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 112016007474 Country of ref document: BR Kind code of ref document: A2 Effective date: 20160404 |